WorldWideScience

Sample records for governing charge transport

  1. Dimer and cluster approach for the evaluation of electronic couplings governing charge transport: Application to two pentacene polymorphs

    Energy Technology Data Exchange (ETDEWEB)

    Canola, Sofia; Pecoraro, Claudia; Negri, Fabrizia

    2016-10-20

    Hole transport properties are modeled for two polymorphs of pentacene: the single crystal polymorph and the thin film polymorph relevant for organic thin-film transistor applications. Electronic couplings are evaluated in the standard dimer approach but also considering a cluster approach in which the central molecule is surrounded by a large number of molecules quantum-chemically described. The effective electronic couplings suitable for the parametrization of a tight-binding model are derived either from the orthogonalization scheme limited to HOMO orbitals and from the orthogonalization of the full basis of molecular orbitals. The angular dependent mobilities estimated for the two polymorphs using the predicted pattern of couplings display different anisotropy characteristics as suggested from experimental investigations.

  2. Charge transport in organic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Ortmann, Frank

    2009-07-01

    The understanding of charge transport is one of the central goals in the research on semiconducting crystals. For organic crystals this is particularly complicated due to the strength of the electron-phonon interaction which requires the description of a seamless transition between the limiting cases of a coherent band-transport mechanism and incoherent hopping. In this thesis, charge transport phenomena in organic crystals are studied by theoretical means. A theory for charge transport in organic crystals is developed which covers the whole temperature range from low T, where it reproduces an expression from the Boltzmann equation for band transport, via elevated T, where it generalizes Holstein's small-polaron theory to finite bandwidths, up to high T, for which a temperature dependence equal to Marcus' electron-transfer theory is obtained. Thereby, coherent band transport and thermally induced hopping are treated on equal footing while simultaneously treating the electron-phonon interaction non-perturbatively. By avoiding the approximation of narrow polaron bands the theory allows for the description of large and small polarons and serves as a starting point for computational studies. The theoretical description is completed by using ab initio material parameters for the selected crystals under study. These material parameters are taken from density functional theory calculations for durene, naphthalene, and guanine crystals. Besides the analysis of the transport mechanism, special focus is put on the study of the relationship between mobility anisotropy and structure of the crystals. This study is supported by a 3D-visualization method for the transport channels in such crystals which has been derived in this thesis. (orig.)

  3. 76 FR 10811 - Annual Charges for Use of Government Lands

    Science.gov (United States)

    2011-02-28

    ... Energy Regulatory Commission 18 CFR Chapter I Annual Charges for Use of Government Lands AGENCY: Federal... annual charges for the use of government lands. This Notice of Inquiry will assist the Commission in... comments on its procedures with respect to the assessment of annual charges for the use of government lands...

  4. Charge transport in amorphous organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Lukyanov, Alexander

    2011-03-15

    Organic semiconductors with the unique combination of electronic and mechanical properties may offer cost-effective ways of realizing many electronic applications, e. g. large-area flexible displays, printed integrated circuits and plastic solar cells. In order to facilitate the rational compound design of organic semiconductors, it is essential to understand relevant physical properties e. g. charge transport. This, however, is not straightforward, since physical models operating on different time and length scales need to be combined. First, the material morphology has to be known at an atomistic scale. For this atomistic molecular dynamics simulations can be employed, provided that an atomistic force field is available. Otherwise it has to be developed based on the existing force fields and first principle calculations. However, atomistic simulations are typically limited to the nanometer length- and nanosecond time-scales. To overcome these limitations, systematic coarse-graining techniques can be used. In the first part of this thesis, it is demonstrated how a force field can be parameterized for a typical organic molecule. Then different coarse-graining approaches are introduced together with the analysis of their advantages and problems. When atomistic morphology is available, charge transport can be studied by combining the high-temperature Marcus theory with kinetic Monte Carlo simulations. The approach is applied to the hole transport in amorphous films of tris(8- hydroxyquinoline)aluminium (Alq{sub 3}). First the influence of the force field parameters and the corresponding morphological changes on charge transport is studied. It is shown that the energetic disorder plays an important role for amorphous Alq{sub 3}, defining charge carrier dynamics. Its spatial correlations govern the Poole-Frenkel behavior of the charge carrier mobility. It is found that hole transport is dispersive for system sizes accessible to simulations, meaning that calculated

  5. Charge Injection and Transport in Conjugated Polymers.

    Science.gov (United States)

    Malliaras, George

    2007-03-01

    We will overview the state-of-the-art in our understanding of charge injection and transport in conjugated polymers. We start by discussing the identifying characteristics of this class of materials, especially in relation with their structure and morphology. We follow by reviewing the advantages and limitations of experimental techniques that are used to probe charge transport. We then embark on a discussion of the fundamentals of charge transport in organics. We follow a didactic approach, where we start from transport in crystalline semiconductors and gradually introduce corrections for space charge effects, for the influence of disorder on mobility, for high charge densities, and for electric field-dependent charge densities. We compare with experimental data from polyfluorenes. We then shift our attention to charge injection. We review some of the recent theories and compared their predictions to experimental data, again from polyfluorenes. We close by proposing directions for future work.

  6. Surface transport processes in charged porous media.

    Science.gov (United States)

    Gabitto, Jorge; Tsouris, Costas

    2017-07-15

    Surface transport processes are very important in chemistry, colloidal sciences, engineering, biology, and geophysics. Natural or externally produced charges on surfaces create electrical double layers (EDLs) at the solid-liquid interface. The existence of the EDLs produces several complex processes including bulk and surface transport of ions. In this work, a model is presented to simulate bulk and transport processes in homogeneous porous media comprising big pores. It is based on a theory for capacitive charging by ideally polarizable porous electrodes without Faradaic reactions or specific adsorption of ions. A volume averaging technique is used to derive the averaged transport equations in the limit of thin electrical double layers. Description of the EDL between the electrolyte solution and the charged wall is accomplished using the Gouy-Chapman-Stern (GCS) model. The surface transport terms enter into the average equations due to the use of boundary conditions for diffuse interfaces. Two extra surface transports terms appear in the closed average equations. One is a surface diffusion term equivalent to the transport process in non-charged porous media. The second surface transport term is a migration term unique to charged porous media. The effective bulk and transport parameters for isotropic porous media are calculated solving the corresponding closure problems. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Charge Transport in Electrostatic Radiography.

    Science.gov (United States)

    Fallone, B. Gino

    A new analytical hyperbolic expression is presented to describe the full saturation curve of parallel-plate ionization chambers filled with air or with high atomic number gases at elevated pressures. It is shown that all parameters of the saturation curve expression can be calculated from one single measurement of ionization current at a given electric field and air gap thickness. Isothermal charge deposition on polymers to form stable foil electrets by using an apparatus resembling parallel-plate ionization chambers is reported. Charge carriers produced by irradiation of the sensitive air volume drift in the externally applied electric field and get trapped on the polymer surface to form electrets. The time dependence of the polarization and depolarization current densities, the effective electric field in the electret chamber, and the electret surface charge densities are presented for the radiation-induced foil electret and an excellent agreement is obtained with the measured electret data. The theory of linear systems is used to derive the electric field and potential in distance space in the electret chamber. The charging characteristics of ionographi latent images are discussed in terms of saturation characteristics of ionographic chambers. The minimum applied electric field needed for an optimized charge collection in the ionographic chamber is presented in terms of both the electret characteristic polarization time and the electret relaxation time. The feasibility of radiographic image subtraction based on electrostatic imaging techniques is demonstrated. Latent image charging at one polarity corresponding to the production of the primary image, and latent image discharging with the opposite chamber polarity, are used to create the final image representing the region of interest.

  8. Charge and spin transport in mesoscopic superconductors

    Directory of Open Access Journals (Sweden)

    M. J. Wolf

    2014-02-01

    Full Text Available Background: Non-equilibrium charge transport in superconductors has been investigated intensely in the 1970s and 1980s, mostly in the vicinity of the critical temperature. Much less attention has been paid to low temperatures and the role of the quasiparticle spin.Results: We report here on nonlocal transport in superconductor hybrid structures at very low temperatures. By comparing the nonlocal conductance obtained by using ferromagnetic and normal-metal detectors, we discriminate charge and spin degrees of freedom. We observe spin injection and long-range transport of pure, chargeless spin currents in the regime of large Zeeman splitting. We elucidate charge and spin transport by comparison to theoretical models.Conclusion: The observed long-range chargeless spin transport opens a new path to manipulate and utilize the quasiparticle spin in superconductor nanostructures.

  9. Charge Transport Processes in Molecular Junctions

    Science.gov (United States)

    Smith, Christopher Eugene

    Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (films, and open opportunities to engineer improved electronic functionality into molecular devices.

  10. Charge-transport simulations in organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    May, Falk

    2012-07-06

    In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that

  11. Detecting monopole charge via quantum interference transport

    Science.gov (United States)

    Dai, Xin; Lu, Haizhou; Yao, Hong

    Topological Weyl and double-Weyl semimetals host different monopole charges in momentum space. How to detect the signature of the monopole charges in quantum transport remains a challenging topic. Here, we reveal the connection between the parity of monopole charge in topological semimetals and the quantum-interference correction to the conductivity. We demonstrate that the parity of monopole charge determines the sign of quantum-interfere correction, with odd and even parity yielding the weak anti-localization and weak localization effect, respectively. This is attributed to the Berry phase difference between time-reversed trajectories circulating the great circle of the Fermi sphere that encloses the monopole charges. From standard Feynman diagram calculations, we further show that the weak-field magnetoconductivity is proportional to +/-√{ B} for double-Weyl semimetals and Weyl semimetals, respectively, which could be verified experimentally.

  12. Simulations of charge transport in organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Vehoff, Thorsten

    2010-05-05

    We study the charge transport properties of organic liquid crystals, i.e. hexabenzocoronene and carbazole macrocycle, and single crystals, i.e. rubrene, indolocarbazole and benzothiophene derivatives (BTBT, BBBT). The aim is to find structure-property relationships linking the chemical structure as well as the morphology with the bulk charge carrier mobility of the compounds. To this end, molecular dynamics (MD) simulations are performed yielding realistic equilibrated morphologies. Partial charges and molecular orbitals are calculated based on single molecules in vacuum using quantum chemical methods. The molecular orbitals are then mapped onto the molecular positions and orientations, which allows calculation of the transfer integrals between nearest neighbors using the molecular orbital overlap method. Thus we obtain realistic transfer integral distributions and their autocorrelations. In case of organic crystals the differences between two descriptions of charge transport, namely semi-classical dynamics (SCD) in the small polaron limit and kinetic Monte Carlo (KMC) based on Marcus rates, are studied. The liquid crystals are investigated solely in the hopping limit. To simulate the charge dynamics using KMC, the centers of mass of the molecules are mapped onto lattice sites and the transfer integrals are used to compute the hopping rates. In the small polaron limit, where the electronic wave function is spread over a limited number of neighboring molecules, the Schroedinger equation is solved numerically using a semi-classical approach. The carbazole macrocycles form columnar structures arranged on a hexagonal lattice with side chains facing inwards, so columns can closely approach each other allowing inter-columnar and thus three-dimensional transport. We are able to show that, on the time-scales of charge transport, static disorder due to slow side chain motions is the main factor determining the mobility. The high mobility of rubrene is explained by two main

  13. Flexoelectric rectification of charge transport in strain-graded dielectrics.

    Science.gov (United States)

    Lee, Daesu; Yang, Sang Mo; Yoon, Jong-Gul; Noh, Tae Won

    2012-12-12

    Flexoelectricity is emerging as a fascinating means for exploring the physical properties of nanoscale materials. Here, we demonstrated the unusual coupling between electronic transport and the mechanical strain gradient in a dielectric epitaxial thin film. Utilizing the nanoscale strain gradient, we showed the unique functionality of flexoelectricity to generate a rectifying diode effect. Furthermore, using conductive atomic force microscopy, we found that the flexoelectric effect can govern the local transport characteristics, including spatial conduction inhomogeneities, in thin-film epitaxy systems. Consideration of the flexoelectric effect will improve understanding of the charge conduction mechanism at the nanoscale and may facilitate the advancement of novel nanoelectronic device design.

  14. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei

    2018-02-22

    Charge transport governs the operation and performance of organic diodes. Illuminating the charge-transfer/transport processes across the interfaces and the bulk organic semiconductors is at the focus of intensive investigations. Traditionally, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I–V characteristics, still represents a major challenge. Here, the electrical potential distribution in planar organic diodes is investigated by using the scanning Kelvin probe force microscopy technique, a method that can clearly separate the contact and bulk regimes of charge transport. Interestingly, by applying to devices based on novel, high mobility organic materials, the space-charge-limited-current-like I–V curves, which are previously believed to be a result of the bulk transport, are surprisingly but unambiguously demonstrated to be caused by contact-limited conduction. A model accounting is developed for the transport properties of both the two metal/organic interfaces and the bulk. The results indicate that pure interface-dominated transport can indeed give rise to I–V curves similar to those caused by bulk transport. These findings provide a new insight into the charge injection and transport processes in organic diodes.

  15. Charge transport by holographic Fermi surfaces

    CERN Document Server

    Faulkner, Thomas; Liu, Hong; McGreevy, John; Vegh, David

    2013-01-01

    We compute the contribution to the conductivity from holographic Fermi surfaces obtained from probe fermions in an AdS charged black hole. This requires calculating a certain part of the one-loop correction to a vector propagator on the charged black hole geometry. We find that the current dissipation is as efficient as possible and the transport lifetime coincides with the single-particle lifetime. In particular, in the case where the spectral density is that of a marginal Fermi liquid, the resistivity is linear in temperature.

  16. Cavity-Enhanced Transport of Charge

    Science.gov (United States)

    Hagenmüller, David; Schachenmayer, Johannes; Schütz, Stefan; Genes, Claudiu; Pupillo, Guido

    2017-12-01

    We theoretically investigate charge transport through electronic bands of a mesoscopic one-dimensional system, where interband transitions are coupled to a confined cavity mode, initially prepared close to its vacuum. This coupling leads to light-matter hybridization where the dressed fermionic bands interact via absorption and emission of dressed cavity photons. Using a self-consistent nonequilibrium Green's function method, we compute electronic transmissions and cavity photon spectra and demonstrate how light-matter coupling can lead to an enhancement of charge conductivity in the steady state. We find that depending on cavity loss rate, electronic bandwidth, and coupling strength, the dynamics involves either an individual or a collective response of Bloch states, and we explain how this affects the current enhancement. We show that the charge conductivity enhancement can reach orders of magnitudes under experimentally relevant conditions.

  17. Anomalous Charge Transport in Disordered Organic Semiconductors

    International Nuclear Information System (INIS)

    Muniandy, S. V.; Woon, K. L.; Choo, K. Y.

    2011-01-01

    Anomalous charge carrier transport in disordered organic semiconductors is studied using fractional differential equations. The connection between index of fractional derivative and dispersion exponent is examined from the perspective of fractional Fokker-Planck equation and its link to the continuous time random walk formalism. The fractional model is used to describe the bi-scaling power-laws observed in the time-of flight photo-current transient data for two different types of organic semiconductors.

  18. Metrology and Transport of Multiply Charged Ions

    Science.gov (United States)

    Kulkarni, Dhruva

    The transport and interaction of singly- and multiply-charged ions with matter has been studied. The experiments were performed in an ultra-high vacuum environment. The low- and hyperthermal-energy ion beamline was used as a source of singly charged ions, while the CUEBIT facility was used as a source of multiply charged ions. The kinetic energy of the ion beam obtained from the CUEBIT is offset from the nominal value expected from the applied electrostatic potentials. These offsets were studied by measuring the kinetic energy of the beam using a retarding field analyzer (RFA). The offset was attributed to the space charge of the electron beam that is used to create the multiply charged ions. The charge density of the electron beam was varied by changing operational parameters of the electron beam, namely the electron beam current and the energy of the electron beam. Ion beams of Ar4+ and Ar8+ were extracted from the source and the offsets observed in the kinetic energy were related to the variation in the space charge potential of the electron beam. Measurements of these offsets, ranging from 100 eV/Q to 300 eV/Q, are significant and important for experiments that aim to utilize the potential energy of slow multiply charged ions. The transport of ions using capillaries has been studied to investigate the viability of ion-guiding as a means for a novel ion delivery mechanism. Results on transport through large bore capillaries (macrocapillaries) that probe both the geometric and ionguided mechanisms are presented. The angle- and position-dependent transport properties were found to depend on the material of the capillary (specifically, whether metal or insulator) and the geometry of the capillary. Rb+ ions at a kinetic energy of 1 keV were transmitted through metal and glass capillaries that were a few centimeters in length and a few millimeters in diameter. Oscillations were observed in the capillaries made of glass which were absent in the metal capillaries

  19. Charge Transport in Conjugated Block Copolymers

    Science.gov (United States)

    Smith, Brandon; Le, Thinh; Lee, Youngmin; Gomez, Enrique

    Interest in conjugated block copolymers for high performance organic photovoltaic applications has increased considerably in recent years. Polymer/fullerene mixtures for conventional bulk heterojunction devices, such as P3HT:PCBM, are severely limited in control over interfaces and domain length scales. In contrast, microphase separated block copolymers self-assemble to form lamellar morphologies with alternating electron donor and acceptor domains, thereby maximizing electronic coupling and local order at interfaces. Efficiencies as high as 3% have been reported in solar cells for one block copolymer, P3HT-PFTBT, but the details concerning charge transport within copolymers have not been explored. To fill this gap, we probed the transport characteristics with thin-film transistors. Excellent charge mobility values for electron transport have been observed on aluminum source and drain contacts in a bottom gate, bottom contact transistor configuration. Evidence of high mobility in ordered PFTBT phases has also been obtained following thermal annealing. The insights gleaned from our investigation serve as useful guideposts, revealing the significance of the interplay between charge mobility, interfacial order, and optimal domain size in organic block copolymer semiconductors.

  20. Charge transport in mesoscopic conducting polymer wires

    Energy Technology Data Exchange (ETDEWEB)

    He Jin; Lindsay, Stuart [Biodesign Institute, Arizona State University, Tempe, AZ 85287 (United States); Forzani, Erica S; Tao Nongjian [Department of Electrical Engineering and the Center for Solid State Electronics Research, Arizona State University, Tempe, AZ 85287 (United States); Nagahara, Larry A [Embedded Systems Research Center, Motorola Labs, Tempe, AZ 85284 (United States)], E-mail: JinHe@asu.edu

    2008-09-17

    In an attempt to reconcile transport in aniline oligomers with that observed in bulk polyaniline, we constructed meso-scale (60 nm) molecular junctions bridged by polyanion-stabilized polyaniline (PANI) strands. Junctions were characterized by their conductance versus electrochemical potential (G-E) and current versus voltage (I-V) characteristics, In contrast to bulk polyaniline, sharp peaks were seen in the G-E data, and these gave rise to negative differential resistance in the I-V curves, behavior much like that observed in aniline oligomers. The width of the conductance peaks increased with the amount of polymer deposited in the junction. In contrast to oligomers, the peaks in the meso-scale devices displayed a large hysteresis. The absolute conductance of the junctions is far too high to be consistent with transport along isolated chains, suggesting that a fundamental charge carrying unit is something morphologically more complex than a single polymer molecule.

  1. Charge transport in mesoscopic conducting polymer wires

    International Nuclear Information System (INIS)

    He Jin; Lindsay, Stuart; Forzani, Erica S; Tao Nongjian; Nagahara, Larry A

    2008-01-01

    In an attempt to reconcile transport in aniline oligomers with that observed in bulk polyaniline, we constructed meso-scale (60 nm) molecular junctions bridged by polyanion-stabilized polyaniline (PANI) strands. Junctions were characterized by their conductance versus electrochemical potential (G-E) and current versus voltage (I-V) characteristics, In contrast to bulk polyaniline, sharp peaks were seen in the G-E data, and these gave rise to negative differential resistance in the I-V curves, behavior much like that observed in aniline oligomers. The width of the conductance peaks increased with the amount of polymer deposited in the junction. In contrast to oligomers, the peaks in the meso-scale devices displayed a large hysteresis. The absolute conductance of the junctions is far too high to be consistent with transport along isolated chains, suggesting that a fundamental charge carrying unit is something morphologically more complex than a single polymer molecule

  2. Manipulation of charge transport in thermoelectrics

    Science.gov (United States)

    Zhang, Xinyue; Pei, Yanzhong

    2017-12-01

    While numerous improvements have been achieved in thermoelectric materials by reducing the lattice thermal conductivity (κL), electronic approaches for enhancement can be as effective, or even more. A key challenge is decoupling Seebeck coefficient (S) from electrical conductivity (σ). The first order approximation - a single parabolic band assumption with acoustic scattering - leads the thermoelectric power factor (S2σ) to be maximized at a constant reduced Fermi level (η 0.67) and therefore at a given S of 167 μV/K. This simplifies the challenge of maximization of σ at a constant η, leading to a large number of degenerate transport channels (band degeneracy, Nv) and a fast transportation of charges (carrier mobility, μ). In this paper, existing efforts on this issue are summarized and future prospectives are given.

  3. Preface: Charge transport in nanoscale junctions

    Science.gov (United States)

    Albrecht, Tim; Kornyshev, Alexei; Bjørnholm, Thomas

    2008-09-01

    Understanding the fundamentals of nanoscale charge transfer is pivotal for designing future nano-electronic devices. Such devices could be based on individual or groups of molecular bridges, nanotubes, nanoparticles, biomolecules and other 'active' components, mimicking wire, diode and transistor functions. These have operated in various environments including vacuum, air and condensed matter, in two- or three-electrode configurations, at ultra-low and room temperatures. Interest in charge transport in ultra-small device components has a long history and can be dated back to Aviram and Ratner's letter in 1974 (Chem. Phys. Lett. 29 277-83). So why is there a necessity for a special issue on this subject? The area has reached some degree of maturity, and even subtle geometric effects in the nanojunction and noise features can now be resolved and rationalized based on existing theoretical concepts. One purpose of this special issue is thus to showcase various aspects of nanoscale and single-molecule charge transport from experimental and theoretical perspectives. The main principles have 'crystallized' in our minds, but there is still a long way to go before true single-molecule electronics can be implemented. Major obstacles include the stability of electronic nanojunctions, reliable operation at room temperature, speed of operation and, last but not least, integration into large networks. A gradual transition from traditional silicon-based electronics to devices involving a single (or a few) molecule(s) therefore appears to be more viable from technologic and economic perspectives than a 'quantum leap'. As research in this area progresses, new applications emerge, e.g. with a view to characterizing interfacial charge transfer at the single-molecule level in general. For example, electrochemical experiments with individual enzyme molecules demonstrate that catalytic processes can be studied with nanometre resolution, offering a route towards optimizing biosensors at

  4. Charge transport in single crystal organic semiconductors

    Science.gov (United States)

    Xie, Wei

    Organic electronics have engendered substantial interest in printable, flexible and large-area applications thanks to their low fabrication cost per unit area, chemical versatility and solution processability. Nevertheless, fundamental understanding of device physics and charge transport in organic semiconductors lag somewhat behind, partially due to ubiquitous defects and impurities in technologically useful organic thin films, formed either by vacuum deposition or solution process. In this context, single-crystalline organic semiconductors, or organic single crystals, have therefore provided the ideal system for transport studies. Organic single crystals are characterized by their high chemical purity and outstanding structural perfection, leading to significantly improved electrical properties compared with their thin-film counterparts. Importantly, the surfaces of the crystals are molecularly flat, an ideal condition for building field-effect transistors (FETs). Progress in organic single crystal FETs (SC-FETs) is tremendous during the past decade. Large mobilities ~ 1 - 10 cm2V-1s-1 have been achieved in several crystals, allowing a wide range of electrical, optical, mechanical, structural, and theoretical studies. Several challenges still remain, however, which are the motivation of this thesis. The first challenge is to delineate the crystal structure/electrical property relationship for development of high-performance organic semiconductors. This thesis demonstrates a full spectrum of studies spanning from chemical synthesis, single crystal structure determination, quantum-chemical calculation, SC-OFET fabrication, electrical measurement, photoelectron spectroscopy characterization and extensive device optimization in a series of new rubrene derivatives, motivated by the fact that rubrene is a benchmark semiconductor with record hole mobility ~ 20 cm2V-1s-1. With successful preservation of beneficial pi-stacking structures, these rubrene derivatives form

  5. Charge Transport in LDPE Nanocomposites Part II—Computational Approach

    Directory of Open Access Journals (Sweden)

    Anh T. Hoang

    2016-03-01

    Full Text Available A bipolar charge transport model is employed to investigate the remarkable reduction in dc conductivity of low-density polyethylene (LDPE based material filled with uncoated nanofillers (reported in the first part of this work. The effect of temperature on charge transport is considered and the model outcomes are compared with measured conduction currents. The simulations reveal that the contribution of charge carrier recombination to the total transport process becomes more significant at elevated temperatures. Among the effects caused by the presence of nanoparticles, a reduced charge injection at electrodes has been found as the most essential one. Possible mechanisms for charge injection at different temperatures are therefore discussed.

  6. Methods for producing thin film charge selective transport layers

    Science.gov (United States)

    Hammond, Scott Ryan; Olson, Dana C.; van Hest, Marinus Franciscus Antonius Maria

    2018-01-02

    Methods for producing thin film charge selective transport layers are provided. In one embodiment, a method for forming a thin film charge selective transport layer comprises: providing a precursor solution comprising a metal containing reactive precursor material dissolved into a complexing solvent; depositing the precursor solution onto a surface of a substrate to form a film; and forming a charge selective transport layer on the substrate by annealing the film.

  7. 41 CFR 102-118.200 - Can a TSP demand advance payment for the transportation charges submitted on a bill of lading...

    Science.gov (United States)

    2010-07-01

    ... payment for the transportation charges submitted on a bill of lading (including GBL)? 102-118.200 Section... (Continued) FEDERAL MANAGEMENT REGULATION TRANSPORTATION 118-TRANSPORTATION PAYMENT AND AUDIT Use of Government Billing Documents Terms and Conditions Governing Acceptance and Use of A Government Bill of Lading...

  8. Role of mesoscopic morphology in charge transport of doped ...

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics; Volume 58; Issue 2. Role of mesoscopic morphology in charge transport of doped polyaniline ... In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among ...

  9. Percolative transport in the vicinity of charge-order ferromagnetic ...

    Indian Academy of Sciences (India)

    The electric field driven charge transport in the system is modelled on the basis of an inhomogeneous medium consisting of ferromagnetic metallic clusters dispersed in a CO background. Keywords. Hole-doped manganite; percolative transport; charge-order; ferromagnetic transition. PACS Nos 75.30.Vn; 75.50.Dd. 1.

  10. Molecular Level Manipulation of Interfacial Charge Transport

    Science.gov (United States)

    Song, Charles Kiseok

    The bulk-heterojunction organic (BHJ) photovoltaics (OPVs) and lithium ion battery (LiB) have been extensively studied. Power conversion efficiency (PCE) of an OPV greater than 10% and utilizing group 4 elements as the anode to accommodate high capacity for LiBs are the goals of many studies. However, the currently ubiquitous hole-collecting layer of OPVs limit device performance and durability, and group 4 elements are unstable and brittle to be commercially produced. Thus, my thesis has focused on developing functional and durable interfacial layers (IFLs) for OPVs and characterizing flexible artificial solid-electrolyte interphase (SEI) for LiBs. In Chapter 2, a series of robust organosilane-based dipolar self-assembled monolayer (SAM) IFLs on the tin-doped indium oxide (ITO) anodes of OPVs are developed. These hydrophobic and amorphous IFLs modify anode work functions from 4.66 to 5.27 eV. Two series of Glass/ITO/SAM IFL/Active Layer/LiF/Al BHJ OPVs are fabricated, and a strong positive correlation between the electrochemically-derived heterogeneous electron transport rate constants (ks) and OPV PCEs are observed due to enhanced anode carrier extraction. In Chapter 3, a series of unusually denser organosilane-based SAM IFLs on ITO anodes of OPVs are developed. Precursor mixtures having short and long tail groups were simultaneously deposited to minimize sterical encumbrance and denser SAM IFLs are achieved. These heterogeneous supersaturated SAMs (SHSAMs), with PCE (7.62%) exceeding that of PEDOT:PSS IFL, are found to be 17% denser and enhances PCE by 54% versus comparable devices with homogeneous SAM IFLs due to enhanced charge selectivity and collection. In Chapter 4, libraries of electron affinities (EAs) of widely used conductive polymers are constructed by cyclic voltammetry (CV) in conventional and LiB media. The EAs of the conductive polymer films measured via CV in conventional (EAC) and Li+ battery (EAB) media could be linearly correlated by EAB = (1

  11. Spatial configuration and composition of charge modulates transport into a mucin hydrogel barrier.

    Science.gov (United States)

    Li, Leon D; Crouzier, Thomas; Sarkar, Aniruddh; Dunphy, Laura; Han, Jongyoon; Ribbeck, Katharina

    2013-09-17

    The mucus barrier is selectively permeable to a wide variety of molecules, proteins, and cells, and establishes gradients of these particulates to influence the uptake of nutrients, the defense against pathogens, and the delivery of drugs. Despite its importance for health and disease, the criteria that govern transport through the mucus barrier are largely unknown. Studies with uniformly functionalized nanoparticles have provided critical information about the relevance of particle size and net charge for mucus transport. However, these particles lack the detailed spatial arrangements of charge found in natural mucus-interacting substrates, such as certain viruses, which may have important consequences for transport through the mucus barrier. Using a novel, to our knowledge, microfluidic design that enables us to measure real-time transport gradients inside a hydrogel of mucins, the gel-forming glycoprotein component of mucus, we show that two peptides with the same net charge, but different charge arrangements, exhibit fundamentally different transport behaviors. Specifically, we show that certain configurations of positive and negative charges result in enhanced uptake into a mucin barrier, a remarkable effect that is not observed with either charge alone. Moreover, we show that the ionic strength within the mucin barrier strongly influences transport specificity, and that this effect depends on the detailed spatial arrangement of charge. These findings suggest that spatial charge distribution is a critical parameter to modulate transport through mucin-based barriers, and have concrete implications for the prediction of mucosal passage, and the design of drug delivery vehicles with tunable transport properties. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Urban transport, the environment and deliberative governance

    DEFF Research Database (Denmark)

    Hansen, Carsten Jahn

    2006-01-01

    , a range of deliberative and more interactive governance approaches have emerged. This article discusses the central role of interdependence and trust in such approaches, based on three cases, Aalborg (DK), Lund (S) and Groningen (NL), in which environmental objectives and strategies have materialized...... in searching for new formats for collaboration and deliberative governance and, in particular, for generating trust among interdependent actors. The concluding remark holds that deliberative governance can illuminate conflicting relations and provoke or massage those early in policy and planning processes...

  13. Symmetrization of mathematical model of charge transport in semiconductors

    Directory of Open Access Journals (Sweden)

    Alexander M. Blokhin

    2002-11-01

    Full Text Available A mathematical model of charge transport in semiconductors is considered. The model is a quasilinear system of differential equations. A problem of finding an additional entropy conservation law and system symmetrization are solved.

  14. Role of mesoscopic morphology in charge transport of doped ...

    Indian Academy of Sciences (India)

    In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent. Molecular recognition plays a significant role in chain conformation and charge delocalization.

  15. The charge transport in an electrostatic belt generator

    NARCIS (Netherlands)

    Vermeer, A.; Strasters, B.A.

    1975-01-01

    The fluctuations in the charge transport system of an EN Tandem Van de Graaff accelerator have been investigated by means of a frequency spectrum analyser. Frequency spectra of the terminal ripple, the short-circuit current and the voltage at the belt charge screen have been measured. Also the

  16. Role of mesoscopic morphology in charge transport of doped ...

    Indian Academy of Sciences (India)

    Abstract. In doped polyaniline (PANI), the charge transport properties are determined by meso- scopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent. Molecular recognition plays a significant role in chain confor- mation and charge delocalization.

  17. Charge Injection and Transport in Organic Nanofibers

    DEFF Research Database (Denmark)

    Kjelstrup-Hansen, Jakob; Bøggild, Peter; Rubahn, H. G.

    2007-01-01

    We investigate the carrier injection and transport in individual para-hexaphenylene nanofibers by electrical transport measurements at different temperatures. The injected current shows much weaker temperature dependence than what would be anticipated from a simplistic model that considers the in...

  18. Effect of Coulomb correlation on charge transport in disordered organic semiconductors

    Science.gov (United States)

    Liu, Feilong; van Eersel, Harm; Xu, Bojian; Wilbers, Janine G. E.; de Jong, Michel P.; van der Wiel, Wilfred G.; Bobbert, Peter A.; Coehoorn, Reinder

    2017-11-01

    Charge transport in disordered organic semiconductors, which is governed by incoherent hopping between localized molecular states, is frequently studied using a mean-field approach. However, such an approach only considers the time-averaged occupation of sites and neglects the correlation effect resulting from the Coulomb interaction between charge carriers. Here, we study the charge transport in unipolar organic devices using kinetic Monte Carlo simulations and show that the effect of Coulomb correlation is already important when the charge-carrier concentration is above 10-3 per molecular site and the electric field is smaller than 108 V/m. The mean-field approach is then no longer valid, and neglecting the effect can result in significant errors in device modeling. This finding is supported by experimental current density-voltage characteristics of ultrathin sandwich-type unipolar poly(3-hexylthiophene) (P3HT) devices, where high carrier concentrations are reached.

  19. Temperature dependent charge transport in poly(3-hexylthiophene) diodes

    Science.gov (United States)

    Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya

    2018-04-01

    In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.

  20. Too difficult to govern? An assessment of the governability of transport biofuels in the EU

    International Nuclear Information System (INIS)

    Di Lucia, Lorenzo

    2013-01-01

    Transport biofuels are currently the subject of heated debate in the EU. In the past decade the deployment of these technologies has been justified by claims of attractive environmental, geopolitical and rural development benefits. However, expectations have rapidly turned into deep criticism regarding the sustainability of these technologies and the desirability of pursuing the biofuel path. This situation has generated an on-going controversy and policy deadlock at EU level. This study explores these issues from a governance perspective. Employing the concept of system governability, derived from interactive governance theory, it attempts to shed some light on the problems facing the governance of biofuels and on how the quality of the governance system could be improved. The analysis showed that the governability of the system decreased substantially in the period 2003–2012 due to increasing governing needs and decreasing governing capacity. The quality of the governance system can be improved by (i) improving governing capacity by reducing conflicts among governing actors, advancing consistency among institutions and creating capacity at international and global level; and (ii) promoting advanced technologies and adjusting societal ambitions and expectations regarding biofuels. - highlights: • Biofuels in the EU are significantly more difficult to govern today than in 2003. • This is due to the qualities of the system to be governed and the governing system. • Sustainable biofuel systems are inherently difficult to govern

  1. New governance principles for sustainable urban transport

    OpenAIRE

    Camagni, R.; Capello, R.; Nijkamp, P.

    1996-01-01

    The paper positions the communications and transport in the centre of a rejuvenation policy for a sustainable urban habitat, taking for granted the success of urban govemance will depend on the professionality of local/regional policy-making govemed by sound principles from business practice in corporate organizations.

  2. Terahertz transport dynamics of graphene charge carriers

    DEFF Research Database (Denmark)

    Buron, Jonas Christian Due

    resolved approaches to electronic characterization of large-area graphene. In a comparative study, we observe significant suppression of DC micrometer-scale transport, probed using micro four-point probe conductance mapping, relative to AC nanoscopic transport, probed by THz-TDS conductance mapping....... A detailed analysis of micro four-point probe, THz-TDS and Raman spectroscopy data reveals that the suppression of micrometer-scale conductance is a signature of electrical defects on the scale of 10 μm, giving rise to 1D-like micrometer-scale transport....... to rapid and non-contact electrical characterization of large-area graphene, relevant for industrial integration. We show that THz-TDS is an accurate and reliable probe of graphene sheet conductance, and that the technique provides insight into fundamental aspects of the nanoscopic nature of conduction...

  3. Production, transport and charge capture measurements of highly charged recoil ions

    International Nuclear Information System (INIS)

    Trebus, U.E.

    1989-01-01

    An experiment is described to study highly charged recoil ions on-line to the heavy accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy-ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q = 15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q = 4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q = 6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix

  4. Colorado Rules and Regulations Governing Operation of School Transportation Vehicles.

    Science.gov (United States)

    Colorado State Dept. of Education, Denver. Office of Field Services.

    This document contains the text of the rules and regulations, adopted in 1972 and later amended, governing the operation of student transportation vehicles in the state of Colorado. They define the kinds of vehicles that qualify as school transportation vehicles, outline the requirements for vehicle operator's examination, describe the types of…

  5. Nuclear materials transportation workshops: USDOE outreach to local governments

    International Nuclear Information System (INIS)

    1987-01-01

    To provide direct outreach to local governments, the Transportation Management Division of the United States Department of Energy asked the Urban Consortium and its Energy Task Force to assemble representatives for two workshops focusing on the transport of nuclear materials. The first session, for jurisdictions east of the Mississippi River, was held in New Orleans on May 5--6, 1988; the second was conducted on June 6--7, 1988 in Denver for jurisdictions to the west. Twenty local government professionals with management or operational responsibility for hazardous materials transportation within their jurisdictions were selected to attend each workshop. The discussions identified five major areas of concern to local government professionals; coordination; training; information resources; marking and placarding; and responder resources. Integrated federal, state, and local levels of government emerged as a priority coordination issue along with the need for expanded availability of training and training resources for first-reponders

  6. Contribution of transport governance to socio-economic development in South Africa

    CSIR Research Space (South Africa)

    Chakwizira, J

    2009-07-01

    Full Text Available This paper discusses the contribution of transport governance to socio-economic development in South Africa. It is premised on the argument that transport governance is a higher, more complex and inclusive phenomenon than transport government...

  7. Charge Transport Phenomena in Peptide Molecular Junctions

    Directory of Open Access Journals (Sweden)

    Alessandra Luchini

    2008-01-01

    Full Text Available Inelastic electron tunneling spectroscopy (IETS is a valuable in situ spectroscopic analysis technique that provides a direct portrait of the electron transport properties of a molecular species. In the past, IETS has been applied to small molecules. Using self-assembled nanoelectronic junctions, IETS was performed for the first time on a large polypeptide protein peptide in the phosphorylated and native form, yielding interpretable spectra. A reproducible 10-fold shift of the I/V characteristics of the peptide was observed upon phosphorylation. Phosphorylation can be utilized as a site-specific modification to alter peptide structure and thereby influence electron transport in peptide molecular junctions. It is envisioned that kinases and phosphatases may be used to create tunable systems for molecular electronics applications, such as biosensors and memory devices.

  8. Charge redistribution and transport in molecular contacts

    Czech Academy of Sciences Publication Activity Database

    Corso, A.; Ondráček, Martin; Lotze, C.; Hapala, Prokop; Franke, K.J.; Jelínek, Pavel; Pascual, I.

    2015-01-01

    Roč. 115, č. 13 (2015), "136101-1"-"136101-5" ISSN 0031-9007 R&D Projects: GA ČR(CZ) GA14-02079S Grant - others:AV ČR(CZ) M100101207 Institutional support: RVO:68378271 Keywords : AFM * molecular transport * STM * DFT * molecular junction * tunneling Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.645, year: 2015

  9. Trans-European transport network and cross-border governance

    DEFF Research Database (Denmark)

    Guasco, Clement Nicolas

    2014-01-01

    This article looks at the implementation of trans-European transport corridors in the EU and the influence it has on governance within EU member-states. It considers the implementation of such a scheme in the context of cross-border cooperation and discusses the system of governance necessary...... for coordinating knowledge, efforts and solutions across several national systems. In order to understand this governance setting, one needs to understand the specific quality of transnational governance in the EU, which is neither purely international nor federally integrated. The transport corridor between Malmö...... and Hamburg is taken as a case for discussion. Cross-border governance is analyzed within a multi-level policy network approach including actors from supranational, national and subnational levels, in order to determine the existence of a policy network across the borders. The main finding is a depiction...

  10. Interactive design environment transportation channel of relativistic charged particle beams

    Science.gov (United States)

    Osadchuk, I. O.; Averyanov, G. P.; Budkin, V. A.

    2017-01-01

    Considered a modern implementation of a computer environment for the design of channels of transportation of high-energy charged particle beams. The environment includes a software package for the simulation of the dynamics of charged particles in the channel, operating means for changing parameters of the channel, the elements channel optimization and processing of the output characteristics of the beam with the graphical output the main output parameters.

  11. Detecting monopole charge in Weyl semimetals via quantum interference transport

    Science.gov (United States)

    Dai, Xin; Lu, Hai-Zhou; Shen, Shun-Qing; Yao, Hong

    2016-04-01

    Topological Weyl semimetals can host Weyl nodes with monopole charges in momentum space. How to detect the signature of the monopole charges in quantum transport remains a challenging topic. Here, we reveal the connection between the parity of monopole charge in topological semimetals and the quantum interference corrections to the conductivity. We show that the parity of monopole charge determines the sign of the quantum interference correction, with odd and even parity yielding the weak antilocalization and weak localization effects, respectively. This is attributed to the Berry phase difference between time-reversed trajectories circulating the Fermi sphere that encloses the monopole charges. From standard Feynman diagram calculations, we further show that the weak-field magnetoconductivity at low temperatures is proportional to +√{B } in double-Weyl semimetals and -√{B } in single-Weyl semimetals, respectively, which could be verified experimentally.

  12. Origin of traps and charge transport mechanism in hafnia

    Energy Technology Data Exchange (ETDEWEB)

    Islamov, D. R., E-mail: damir@isp.nsc.ru; Gritsenko, V. A., E-mail: grits@isp.nsc.ru [Rzhanov Institute of Semiconductor Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk 630090 (Russian Federation); Novosibirsk State University, Novosibirsk 630090 (Russian Federation); Cheng, C. H. [Department of Mechatronic Technology, National Taiwan Normal University, Taipei 106, Taiwan (China); Chin, A., E-mail: albert-achin@hotmail.com [National Chiao Tung University, Hsinchu 300, Taiwan (China)

    2014-12-01

    In this study, we demonstrated experimentally and theoretically that oxygen vacancies are responsible for the charge transport in HfO{sub 2}. Basing on the model of phonon-assisted tunneling between traps, and assuming that the electron traps are oxygen vacancies, good quantitative agreement between the experimental and theoretical data of current-voltage characteristics was achieved. The thermal trap energy of 1.25 eV in HfO{sub 2} was determined based on the charge transport experiments.

  13. The need for performance governance to reach sustainable transport

    DEFF Research Database (Denmark)

    Gudmundsson, Henrik

    The objective to set transport on a course towards sustainability is a complex and long term aspiration that is likely to meet, and have already met, several market and governance failures. While many market failures can be countered through careful design of appropriate policy instruments, the g...... is even more pronounced. The next Transport Bill to be adopted in the USA is expected to take new steps towards a performance governance approach. A European approach could be to include sustainability in a performance governance approach for transport policy.......The objective to set transport on a course towards sustainability is a complex and long term aspiration that is likely to meet, and have already met, several market and governance failures. While many market failures can be countered through careful design of appropriate policy instruments......, ‘Performance governance’ is what they call the most advanced form of public performance management. In simple models a government collects only sporadic information on performance to satisfy internal reporting. In the performance governance model, performance management is systematic, continuous...

  14. The Regulation and Improvement of Suburban Landless Peasants’ Community in the Charge of the Government

    Directory of Open Access Journals (Sweden)

    Jinsong Zhang

    2014-04-01

    Full Text Available Suburban landless peasants’ communities are both the transfiguration in the passive urbanization and transformation in the leading of governments. The specificity of suburban landless peasants community-generated determines the specificity in governing. The deficiency of well governance mechanisms, the scarcity of citizen spirit, the low level of self-organization and the deficiency of social capital in suburban landless peasants’ community in the charge of the government bring about a serious of developing dilemma. The regulation and improvement of government should embark on reconstructive governance mechanisms, straighten out organizational system; Cultivating citizen spirit, promoting public participation; Remodeling social capital, tamping autonomy foundation.

  15. Charge transport and structure in semimetallic polymers

    DEFF Research Database (Denmark)

    Rudd, Sam; Franco-Gonzalez, Juan F.; Kumar Singh, Sandeep

    2017-01-01

    Owing to changes in their chemistry and structure, polymers can be fabricated to demonstrate vastly different electrical conductivities over many orders of magnitude. At the high end of conductivity is the class of conducting polymers, which are ideal candidates for many applications in low......-cost electronics. Here, we report the influence of the nature of the doping anion at high doping levels within the semi-metallic conducting polymer poly(3,4-ethylenedioxythiophene) (PEDOT) on its electronic transport properties. Hall effect measurements on a variety of PEDOT samples show that the choice of doping...... that the chosen doping anion modifies the way PEDOT chains stack together. This link between structure and specific anion doping at high doping levels has ramifications for the fabrication of conducting polymer-based devices....

  16. Investigating anomalous transport of electrolytes in charged porous media

    Science.gov (United States)

    Skjøde Bolet, Asger Johannes; Mathiesen, Joachim

    2017-04-01

    Surface charge is know to play an important role in microfluidics devices when dealing with electrolytes and their transport properties. Similarly, surface charge could play a role for transport in porous rock with submicron pore sizes. Estimates of the streaming potentials and electro osmotic are mostly considered in simple geometries both using analytic and numerical tools, however it is unclear at present how realistic complex geometries will modify the dynamics. Our work have focused on doing numerical studies of the full three-dimensional Stokes-Poisson-Nernst-Planck problem for electrolyte transport in porous rock. As the numerical implementation, we have used a finite element solver made using the FEniCS project code base, which can both solve for a steady state configuration and the full transient. In the presentation, we will show our results on anomalous transport due to electro kinetic effects such as the streaming potential or the electro osmotic effect.

  17. Charge transport by inverse micelles in non-polar media

    Science.gov (United States)

    Strubbe, Filip; Neyts, Kristiaan

    2017-11-01

    Charged inverse micelles play an important role in the electrical charging and the electrodynamics of nonpolar colloidal dispersions relevant for applications such as electronic ink displays and liquid toner printing. This review examines the properties and the behavior of charged inverse micelles in microscale devices in the absence of colloidal particles. It is discussed how charge in nonpolar liquids is stabilized in inverse micelles and how conductivity depends on the inverse micelle size, water content and ionic impurities. Frequently used nonpolar surfactant systems are investigated with emphasis on aerosol-OT (AOT) and poly-isobutylene succinimide (PIBS) in dodecane. Charge generation in the bulk by disproportionation is studied from measurements of conductivity as a function of surfactant concentration and from generation currents in quasi steady-state. When a potential difference is applied, the steady-state situation can show electric field screening or complete charge separation. Different regimes of charge transport are identified when a voltage step is applied. It is shown how the transient and steady-state currents depend on the rate of bulk generation, on insulating layers and on the sticking or non-sticking behavior of charged inverse micelles at interfaces. For the cases of AOT and PIBS in dodecane, the magnitude of the generation rate and the type of interaction at the interface are very different.

  18. Electron-hole collision limited transport in charge-neutral bilayer graphene

    Science.gov (United States)

    Nam, Youngwoo; Ki, Dong-Keun; Soler-Delgado, David; Morpurgo, Alberto F.

    2017-12-01

    Ballistic transport occurs whenever electrons propagate without collisions deflecting their trajectory. It is normally observed in conductors with a negligible concentration of impurities, at low temperature, to avoid electron-phonon scattering. Here, we use suspended bilayer graphene devices to reveal a new regime, in which ballistic transport is not limited by scattering with phonons or impurities, but by electron-hole collisions. The phenomenon manifests itself in a negative four-terminal resistance that becomes visible when the density of holes (electrons) is suppressed by gate-shifting the Fermi level in the conduction (valence) band, above the thermal energy. For smaller densities, transport is diffusive, and the measured conductivity is reproduced quantitatively, with no fitting parameters, by including electron-hole scattering as the only process causing velocity relaxation. Experiments on a trilayer device show that the phenomenon is robust and that transport at charge neutrality is governed by the same physics. Our results provide a textbook illustration of a transport regime that had not been observed previously and clarify the nature of conduction through charge-neutral graphene under conditions in which carrier density inhomogeneity is immaterial. They also demonstrate that transport can be limited by a fully electronic mechanism, originating from the same microscopic processes that govern the physics of Dirac-like plasmas.

  19. Charge transport in nanoscale lateral and vertical organic semiconductor devices

    NARCIS (Netherlands)

    Xu, Bojian

    2017-01-01

    Organic semiconductors have been drawing more and more attention due to their huge potential for low-cost, flexible, printable electronics and spintronics. In this thesis research, we have investigated charge transport in two organic semiconductors, DXP and P3HT, in different device configurations.

  20. On the Structure of the Fixed Charge Transportation Problem

    Science.gov (United States)

    Kowalski, K.

    2005-01-01

    This work extends the theory of the fixed charge transportation problem (FCTP), currently based mostly on a forty-year-old publication by Hirsch and Danzig. This paper presents novel properties that need to be considered by those using existing, or those developing new methods for optimizing FCTP. It also defines the problem in an easier way,…

  1. Percolative transport in the vicinity of charge-order ferromagnetic ...

    Indian Academy of Sciences (India)

    However, on substitution of Pr with La, a crossover from the highly resistive CO state to a state of metallic character is observed at relatively low electric fields. The current–voltage characteristics of the samples at low temperatures show hysteretic and history dependent effects. The electric field driven charge transport in the ...

  2. Density functional theory calculations of charge transport properties ...

    Indian Academy of Sciences (India)

    ZIRAN CHEN

    2017-08-04

    Aug 4, 2017 ... Density functional theory calculations of charge transport properties of 'plate-like' coronene topological structures. ZIRAN CHENa, ZHANRONG HEa, YOUHUI XUa and WENHAO YUb,∗. aDepartment of Architecture and Environment Engineering, Sichuan Vocational and Technical College, Suining,.

  3. Charge transport in silicon nanocrystal superlattices in the terahertz regime

    Czech Academy of Sciences Publication Activity Database

    Němec, Hynek; Zajac, Vít; Kužel, Petr; Malý, P.; Gutsch, S.; Hiller, D.; Zacharias, M.

    2015-01-01

    Roč. 91, č. 19 (2015), "195443-1"-"195443-10" ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : silicon nanocrystals * charge transport * terahertz spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

  4. Disorder-tuned charge transport in organic semiconductors

    Science.gov (United States)

    Xu, Feng; Qiu, Dong; Yan, Dadong

    2013-02-01

    We propose that the polaron transport in organic semiconductors is remarkably tuned by the fluctuation of polarization energy. The tuning effect of energetic fluctuation not only causes a continuous transition from non-Arrhenius to Arrhenius temperature activated charge transport with increasing moderate disorder strengths but also results in a band-like conduction in the low disorder regime which benefits from the enhanced mobilities in shallow trap states. As a result, a unified description of polaron transport is obtained for a set of typical organic semiconductors.

  5. 19 CFR 351.515 - Internal transport and freight charges for export shipments.

    Science.gov (United States)

    2010-04-01

    ... Internal transport and freight charges for export shipments. (a) Benefit—(1) In general. In the case of internal transport and freight charges on export shipments, a benefit exists to the extent that the charges... receipt of benefit. In the case of internal transport and freight charges for export shipments, the...

  6. Ion Transport through Diffusion Layer Controlled by Charge Mosaic Membrane

    Directory of Open Access Journals (Sweden)

    Akira Yamauchi

    2012-01-01

    Full Text Available The kinetic transport behaviors in near interface of the membranes were studied using commercial anion and cation exchange membrane and charge mosaic membrane. Current-voltage curve gave the limiting current density that indicates the ceiling of conventional flux. From chronopotentiometry above the limiting current density, the transition time was estimated. The thickness of boundary layer was derived with conjunction with the conventional limiting current density and the transition time from steady state flux. On the other hand, the charge mosaic membrane was introduced in order to examine the ion transport on the membrane surface in detail. The concentration profile was discussed by the kinetic transport number with regard to the water dissociation (splitting on the membrane surface.

  7. Spin and charge transport study in single crystal organic semiconductors

    Science.gov (United States)

    Raman, Karthik V.; Mulder, Carlijn L.; Baldo, Marc A.; Moodera, Jagadeesh S.

    2009-03-01

    Spin transport studies in amorphous rubrene films have shown exciting and promising results [1]. A large spin diffusion length in these amorphous films has increased the motivation to perform spin transport study in high purity single crystal rubrene. This will provide the fundamental understanding on the spin transport behavior in OS; not influenced by defects or traps. We will present work on small channel single crystal rubrene FET device with magnetic electrodes. For example, our preliminary studies have show mobility for FET with Co electrode to be 0.014cm^2/V-s. A study on the spin and charge transport properties in single crystals of OS with magnetic electrodes is being done and the results will be reported. The influence of gate voltage and applied magnetic field on the transport properties will be discussed. [1] J.H. Shim et al., PRL 100, 226603 (2008)

  8. Indicators in the governance of sustainable transport policies in Japan

    DEFF Research Database (Denmark)

    Gudmundsson, Henrik; Fukuda, Daisuke

    The paper addresses the role of indicators to promote transitions towards a more sustainable transportation future in Japan. Existing international literature suggests a potential key role for performance measurement and indicator systems to strengthen such policies. The research explores to what...... is represented, as well as how the framework is integrated with decision making processes. Japan is used as a case, because Japanese transport seems to perform well in certain aspects of ‘sustainability’, while Japanese transportation policy also faces significant management challenges. A range of governance...... measures have been adopted to assist in managing transport policy challenges, including the application of experimentation, monitoring and evaluation of plans, policies and institutions. The paper looks at two cases of policy management within Japanese transportation: The first is the performance...

  9. Charge transport in metal oxide nanocrystal-based materials

    Science.gov (United States)

    Runnerstrom, Evan Lars

    There is probably no class of materials more varied, more widely used, or more ubiquitous than metal oxides. Depending on their composition, metal oxides can exhibit almost any number of properties. Of particular interest are the ways in which charge is transported in metal oxides: devices such as displays, touch screens, and smart windows rely on the ability of certain metal oxides to conduct electricity while maintaining visible transparency. Smart windows, fuel cells, and other electrochemical devices additionally rely on efficient transport of ionic charge in and around metal oxides. Colloidal synthesis has enabled metal oxide nanocrystals to emerge as a relatively new but highly tunable class of materials. Certain metal oxide nanocrystals, particularly highly doped metal oxides, have been enjoying rapid development in the last decade. As in myriad other materials systems, structure dictates the properties of metal oxide nanocrystals, but a full understanding of how nanocrystal synthesis, the processing of nanocrystal-based materials, and the structure of nanocrystals relate to the resulting properties of nanocrystal-based materials is still nascent. Gaining a fundamental understanding of and control over these structure-property relationships is crucial to developing a holistic understanding of metal oxide nanocrystals. The unique ability to tune metal oxide nanocrystals by changing composition through the introduction of dopants or by changing size and shape affords a way to study the interplay between structure, processing, and properties. This overall goal of this work is to chemically synthesize colloidal metal oxide nanocrystals, process them into useful materials, characterize charge transport in materials based on colloidal metal oxide nanocrystals, and develop ways to manipulate charge transport. In particular, this dissertation characterizes how the charge transport properties of metal oxide nanocrystal-based materials depend on their processing and

  10. Role of mesoscopic morphology in charge transport of doped polyaniline

    Science.gov (United States)

    Mukherjee, A. K.; Menon, Reghu

    2002-02-01

    In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent Molecular recognition plays a significant role in chain conformation and charge delocalization. The resistivity of PANI doped by camphor sulfonic acid (CSA)/2-acrylo-amido-1-propane sulfonic acid (AMPSA)/dodecyl benzene sulfonic acid (DBSA) is around 0.02 W cm. PANI-CSA and PANI-AMPSA show a metallic positive temperature coefficient of resistivity above 150 K, with a finite value of conductivity at 1.4 K; whereas, PANI-DBSA shows hopping transport at low temperatures. The magnetoresistance is positive (negative) for PANI-CSA (PANI-AMPSA); and PANI-DBSA has a large positive MR. The behavior of MR suggests subtle variations in mesoscopic morphology between PANI-CSA and PANI-AMPSA.

  11. Adiabatic and Nonadiabatic Charge Transport in Li-S Batteries

    DEFF Research Database (Denmark)

    Park, Haesun; Kumar, Nitin; Melander, Marko

    2017-01-01

    The insulating nature of the redox end members in Li-S batteries, -S and Li2S, has the potential to limit the capacity and efficiency of this emerging energy storage system. Nevertheless, the mechanisms responsible for ionic and electronic transport in these materials remain a matter of debate...... studies, we conclude that low equilibrium carrier concentrations are responsible for sluggish charge transport in -S and Li2S. Thus, a potential strategy for improving the performance of Li-S batteries is to increase the concentrations of holes in these redox end members....

  12. Charge-carrier transport in large-area epitaxial graphene

    Energy Technology Data Exchange (ETDEWEB)

    Kisslinger, Ferdinand; Popp, Matthias; Weber, Heiko B. [Lehrstuhl fuer Angewandte Physik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany); Jobst, Johannes [Huygens-Kamerlingh Onnes Laboratorium, Leiden Institute of Physics, Leiden University (Netherlands); Shallcross, Sam [Lehrstuhl fuer theoretische Festkoerperphysik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany)

    2017-11-15

    We present an overview of recent charge carrier transport experiments in both monolayer and bilayer graphene, with emphasis on the phenomena that appear in large-area samples. While many aspects of transport are based on quantum mechanical concepts, in the large-area limit classical corrections dominate and shape the magnetoresistance and the tunneling conductance. The discussed phenomena are very general and can, with little modification, be expected in any atomically thin 2D conductor. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  13. Charged particles transport in one-dimensional finite systems

    International Nuclear Information System (INIS)

    Muthukrishnan, G.; Santhanam, K.; Gopinath, D.V.

    1977-01-01

    A semi-analytical technique for the charged particle transport in one-dimensional finite media is developed which can be applied to multi-energy multi-region systems with arbitrary degree of anisotropy in scattering. For this purpose the transport equation is cast in the form of coupled integral equations separating spatial and energy-angle transmission. The spatial transmission is evaluated using discrete ordinate representation in space, energy and direction cosine for the particle source and flux. The collision integral is evaluated using discrete ordinate representation in energy and legendre polynomial approximation in the direction cosine. A computer code based on the above formulation is described

  14. Intrinsic Charge Transport in Organic Field-Effect Transistors

    Science.gov (United States)

    Podzorov, Vitaly

    2005-03-01

    Organic field-effect transistors (OFETs) are essential components of modern electronics. Despite the rapid progress of organic electronics, understanding of fundamental aspects of the charge transport in organic devices is still lacking. Recently, the OFETs based on highly ordered organic crystals have been fabricated with innovative techniques that preserve the high quality of single-crystal organic surfaces. This technological progress facilitated the study of transport mechanisms in organic semiconductors [1-4]. It has been demonstrated that the intrinsic polaronic transport, not dominated by disorder, with a remarkably high mobility of ``holes'' μ = 20 cm^2/Vs can be achieved in these devices at room temperature [4]. The signatures of the intrinsic polaronic transport are the anisotropy of the carrier mobility and an increase of μ with cooling. These and other aspects of the charge transport in organic single-crystal FETs will be discussed. Co-authors are Etienne Menard, University of Illinois at Urbana Champaign; Valery Kiryukhin, Rutgers University; John Rogers, University of Illinois at Urbana Champaign; Michael Gershenson, Rutgers University. [1] V. Podzorov et al., Appl. Phys. Lett. 82, 1739 (2003); ibid. 83, 3504 (2003). [2] V. C. Sundar et al., Science 303, 1644 (2004). [3] R. W. I. de Boer et al., Phys. Stat. Sol. (a) 201, 1302 (2004). [4] V. Podzorov et al., Phys. Rev. Lett. 93, 086602 (2004).

  15. Effects of Confinement on Microstructure and Charge Transport in High Performance Semicrystalline Polymer Semiconductors

    KAUST Repository

    Himmelberger, Scott

    2012-11-23

    The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Charge Transport in LDPE Nanocomposites Part I—Experimental Approach

    Directory of Open Access Journals (Sweden)

    Anh T. Hoang

    2016-03-01

    Full Text Available This work presents results of bulk conductivity and surface potential decay measurements on low-density polyethylene and its nanocomposites filled with uncoated MgO and Al2O3, with the aim to highlight the effect of the nanofillers on charge transport processes. Material samples at various filler contents, up to 9 wt %, were prepared in the form of thin films. The performed measurements show a significant impact of the nanofillers on reduction of material’s direct current (dc conductivity. The investigations thus focused on the nanocomposites having the lowest dc conductivity. Various mechanisms of charge generation and transport in solids, including space charge limited current, Poole-Frenkel effect and Schottky injection, were utilized for examining the experimental results. The mobilities of charge carriers were deduced from the measured surface potential decay characteristics and were found to be at least two times lower for the nanocomposites. The temperature dependencies of the mobilities were compared for different materials.

  17. Charge transport in conducting polymers: insights from impedance spectroscopy.

    Science.gov (United States)

    Rubinson, Judith F; Kayinamura, Yohani P

    2009-12-01

    This tutorial review gives a brief introduction to impedance spectroscopy and discusses how it has been used to provide insight into charge transport through conducting polymers, particularly when the polymers are used as electrodes for solution studies or the design of electrodes for biomedical applications. As such it provides both an introduction to the topic and references to both classic and contemporary work for the more advanced reader.

  18. Charge transport in metal oxide nanocrystal-based materials

    OpenAIRE

    Runnerstrom, Evan Lars

    2016-01-01

    There is probably no class of materials more varied, more widely used, or more ubiquitous than metal oxides. Depending on their composition, metal oxides can exhibit almost any number of properties. Of particular interest are the ways in which charge is transported in metal oxides: devices such as displays, touch screens, and smart windows rely on the ability of certain metal oxides to conduct electricity while maintaining visible transparency. Smart windows, fuel cells, and other electrochem...

  19. Density functional theory calculations of charge transport properties ...

    Indian Academy of Sciences (India)

    In this paper, we used density functional theory (DFT) at the M06-2X/6−31+G(d) level to compute the charge transport rates of nine coronene topological structures. The results show that the energy gap of these nine coronene derivatives is in the range 2.90–3.30 eV, falling into the organic semiconductor category. The size ...

  20. Charge carrier transport mechanisms in nanocrystalline indium oxide

    International Nuclear Information System (INIS)

    Forsh, E.A.; Marikutsa, A.V.; Martyshov, M.N.; Forsh, P.A.; Rumyantseva, M.N.; Gaskov, A.M.; Kashkarov, P.K.

    2014-01-01

    The charge transport properties of nanocrystalline indium oxide (In 2 O 3 ) are studied. A number of nanostructured In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method and characterized using various techniques. The mean nanocrystals size varies from 7–8 nm to 18–20 nm depending on the conditions of their preparation. Structural characterizations of the In 2 O 3 samples are performed by means of transmission electron microscopy and X-ray diffraction. The analysis of dc and ac conductivity in a wide temperature range (T = 50–300 K) shows that at high temperatures charge carrier transport takes place over conduction band and at low temperatures a variable range hopping transport mechanism can be observed. We find out that the temperature of transition from one mechanism to another depends on nanocrystal size: the transition temperature rises when nanocrystals are bigger in size. The average hopping distance between two sites and the activation energy are calculated basing on the analysis of dc conductivity at low temperature. Using random barrier model we show a uniform hopping mechanism taking place in our samples and conclude that nanocrystalline In 2 O 3 can be regarded as a disordered system. - Highlights: • In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method. • The mean nanocrystal size varies from 7–8 nm to 18–20 nm. • At high temperatures charge carrier transport takes place over conduction band. • At low temperatures a variable range hopping transport mechanism can be observed. • We show a uniform hopping mechanism taking place in our samples

  1. Electronic properties of mesoscopic graphene structures: Charge confinement and control of spin and charge transport

    Energy Technology Data Exchange (ETDEWEB)

    Rozhkov, A.V., E-mail: arozhkov@gmail.co [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412, Moscow (Russian Federation); Giavaras, G. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Bliokh, Yury P. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Technion-Israel Institute of Technology, Haifa 32000 (Israel); Freilikher, Valentin [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Bar-Ilan University, Ramat-Gan 52900 (Israel); Nori, Franco [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, University of Michigan, Ann Arbor, MI 48109-1040 (United States)

    2011-06-15

    This brief review discusses electronic properties of mesoscopic graphene-based structures. These allow controlling the confinement and transport of charge and spin; thus, they are of interest not only for fundamental research, but also for applications. The graphene-related topics covered here are: edges, nanoribbons, quantum dots, pn-junctions, pnp-structures, and quantum barriers and waveguides. This review is partly intended as a short introduction to graphene mesoscopics.

  2. Electric generation and ratcheted transport of contact-charged drops

    Science.gov (United States)

    Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.

    2017-10-01

    We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

  3. Normal and impaired charge transport in biological systems

    Energy Technology Data Exchange (ETDEWEB)

    Miller, John H., E-mail: jhmiller@uh.edu [Department of Physics & Texas Center for Superconductivity, University of Houston, Houston, TX 77204-5005 (United States); Villagrán, Martha Y. Suárez; Maric, Sladjana [Department of Physics & Texas Center for Superconductivity, University of Houston, Houston, TX 77204-5005 (United States); Briggs, James M. [Department of Biology & Biochemistry, University of Houston, Houston, TX 77204-5001 (United States)

    2015-03-01

    We examine the physics behind some of the causes (e.g., hole migration and localization that cause incorrect base pairing in DNA) and effects (due to amino acid replacements affecting mitochondrial charge transport) of disease-implicated point mutations, with emphasis on mutations affecting mitochondrial DNA (mtDNA). First we discuss hole transport and localization in DNA, including some of our quantum mechanical modeling results, as they relate to certain mutations in cancer. Next, we give an overview of electron and proton transport in the mitochondrial electron transport chain, and how such transport can become impaired by mutations implicated in neurodegenerative diseases, cancer, and other major illnesses. In particular, we report on our molecular dynamics (MD) studies of a leucine→arginine amino acid replacement in ATP synthase, encoded by the T→G point mutation at locus 8993 of mtDNA. This mutation causes Leigh syndrome, a devastating maternally inherited neuromuscular disorder, and has been found to trigger rapid tumor growth in prostate cancer cell lines. Our MD results suggest, for the first time, that this mutation adversely affects water channels that transport protons to and from the c-ring of the rotary motor ATP synthase, thus impairing the ability of the motor to produce ATP. Finally, we discuss possible future research topics for biological physics, such as mitochondrial complex I, a large proton-pumping machine whose physics remains poorly understood.

  4. Diffusion-Driven Charge Transport in Light Emitting Devices.

    Science.gov (United States)

    Kim, Iurii; Kivisaari, Pyry; Oksanen, Jani; Suihkonen, Sami

    2017-12-12

    Almost all modern inorganic light-emitting diode (LED) designs are based on double heterojunctions (DHJs) whose structure and current injection principle have remained essentially unchanged for decades. Although highly efficient devices based on the DHJ design have been developed and commercialized for energy-efficient general lighting, the conventional DHJ design requires burying the active region (AR) inside a pn-junction. This has hindered the development of emitters utilizing nanostructured ARs located close to device surfaces such as nanowires or surface quantum wells. Modern DHJ III-N LEDs also exhibit resistive losses that arise from the DHJ device geometry. The recently introduced diffusion-driven charge transport (DDCT) emitter design offers a novel way to transport charge carriers to unconventionally placed ARs. In a DDCT device, the AR is located apart from the pn-junction and the charge carriers are injected into the AR by bipolar diffusion. This device design allows the integration of surface ARs to semiconductor LEDs and offers a promising method to reduce resistive losses in high power devices. In this work, we present a review of the recent progress in gallium nitride (GaN) based DDCT devices, and an outlook of potential DDCT has for opto- and microelectronics.

  5. Maintenance Policy in Public-Transport Involving Government Subsidy

    Science.gov (United States)

    Pasaribu, U. S.; Bayuzetra, Y.; Gunawan, L. E.; Husniah, H.

    2018-02-01

    A public transport with government subsidy is considered to encourage the sustainability of the transportation. The transportations revenue is determined by the maximum of the uptimes of the vehicle. In this paper, we study a one-dimensional maintenance policy for new vehicle which is characterized by age parameter. We consider that the degradation of the vehicle is affected by the age of the vehicle, and modelled by using a one-dimensional approach. The owner performs both preventive and corrective maintenance actions, and the preventive maintenance action will reduce the vehicle failure rate and hence it will decrease the corrective maintenance cost during the life time of the vehicle. The decision problem for the owner is to find the optimal preventive maintenance time of the vehicle of each subsidy option offered by maximizing the expected profit for each subsidy.

  6. Symposium GC: Nanoscale Charge Transport in Excitonic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Bommisetty, Venkat [Univ. of South Dakota, Vermillion, SD (United States)

    2011-06-23

    This paper provides a summary only and table of contents of the sessions. Excitonic solar cells, including all-organic, hybrid organic-inorganic and dye-sensitized solar cells (DSSCs), offer strong potential for inexpensive and large-area solar energy conversion. Unlike traditional inorganic semiconductor solar cells, where all the charge generation and collection processes are well understood, these excitonic solar cells contain extremely disordered structures with complex interfaces which results in large variations in nanoscale electronic properties and has a strong influence on carrier generation, transport, dissociation and collection. Detailed understanding of these processes is important for fabrication of highly efficient solar cells. Efforts to improve efficiency are underway at a large number of research groups throughout the world focused on inorganic and organic semiconductors, photonics, photophysics, charge transport, nanoscience, ultrafast spectroscopy, photonics, semiconductor processing, device physics, device structures, interface structure etc. Rapid progress in this multidisciplinary area requires strong synergetic efforts among researchers from diverse backgrounds. Such effort can lead to novel methods for development of new materials with improved photon harvesting and interfacial treatments for improved carrier transport, process optimization to yield ordered nanoscale morphologies with well defined electronic structures.

  7. Charged-particle transport in one-dimensional systems

    International Nuclear Information System (INIS)

    Muthukrishnan, G.; Gopinath, D.V.

    1983-01-01

    A semianalytical technique to study the charged-particle transport in one-dimensional finite media is developed. For this purpose, the transport equation is written in the form of coupled integral equations, separating the spatial and energy-angle transmissions. Legendre polynomial representations for the source, flux, and scattering kernel are used to solve the equations. For evaluation of the spatial transmission, discrete ordinate representation in space, energy, and direction cosine is used for the particle and source flux. The integral equations are then solved by the fast iteration technique. The computer code CHASFIT, written on the basis of the above formulation, is described. The fast convergence of the iteration process which is characteristic of charged-particle transport is demonstrated. Convergence studies are carried out with a number of mesh points and polynomial approximations. The method is applied to study the depth-dose distributions due to 140-, 200-, 300-, 400-, 600-, and 740-MeV protons incident normally on a 30-cm-thick tissue slab. The values of the quality factor at the surface and at 5 cm depth, as well as the total average quality factor, are calculated. The results thus obtained are compared with those predicted by the Monte Carlo method. This method can also be applied to multienergy, multiregion systems with arbitrary degree of anisotropy

  8. Transport of Charged Particles in Turbulent Magnetic Fields

    Science.gov (United States)

    Parashar, T.; Subedi, P.; Sonsrettee, W.; Blasi, P.; Ruffolo, D. J.; Matthaeus, W. H.; Montgomery, D.; Chuychai, P.; Dmitruk, P.; Wan, M.; Chhiber, R.

    2017-12-01

    Magnetic fields permeate the Universe. They are found in planets, stars, galaxies, and the intergalactic medium. The magnetic field found in these astrophysical systems are usually chaotic, disordered, and turbulent. The investigation of the transport of cosmic rays in magnetic turbulence is a subject of considerable interest. One of the important aspects of cosmic ray transport is to understand their diffusive behavior and to calculate the diffusion coefficient in the presence of these turbulent fields. Research has most frequently concentrated on determining the diffusion coefficient in the presence of a mean magnetic field. Here, we will particularly focus on calculating diffusion coefficients of charged particles and magnetic field lines in a fully three-dimensional isotropic turbulent magnetic field with no mean field, which may be pertinent to many astrophysical situations. For charged particles in isotropic turbulence we identify different ranges of particle energy depending upon the ratio of the Larmor radius of the charged particle to the characteristic outer length scale of the turbulence. Different theoretical models are proposed to calculate the diffusion coefficient, each applicable to a distinct range of particle energies. The theoretical ideas are tested against results of detailed numerical experiments using Monte-Carlo simulations of particle propagation in stochastic magnetic fields. We also discuss two different methods of generating random magnetic field to study charged particle propagation using numerical simulation. One method is the usual way of generating random fields with a specified power law in wavenumber space, using Gaussian random variables. Turbulence, however, is non-Gaussian, with variability that comes in bursts called intermittency. We therefore devise a way to generate synthetic intermittent fields which have many properties of realistic turbulence. Possible applications of such synthetically generated intermittent fields are

  9. Sustainable Governance for the Opened Electric Vehicle Charging and Upgraded Facilities Market

    Directory of Open Access Journals (Sweden)

    Tian Wu

    2017-11-01

    Full Text Available Since the China State Grid opened the market for infrastructure construction of electric charging stations and allowed Tesla, Potevio, BAIC BJEV and other enterprises to provide their own charging stations and other infrastructure construction, the development of electric vehicles has been greatly affected. How to maintain a sustainable governance in the opened electric vehicle charging and upgraded facilities market is an important policy issues. This paper presents a monopolistic competition model for the differentiated products market and addresses several issues related to Cournot equilibrium to illustrate why the expected free market actually operates in a monopolistic competition market structure. The analytic solution of the model shows that whether the extent of firm entry is insufficient, excessive or optimum is determined by consumers’ time preference, level of production differentiation and features of cost structure, including fixed cost and marginal cost. The sensitivity analysis has been performed among the above factors and tracked some other factors which would determine the effect of the new policy issues. The main policy suggestion is that the government should optimize entry regulations and lay down the criterion of charging interface standards for charging stations to avoid the electric vehicle charging and upgraded facilities marketization process of a one-size-fits-all solution and form a monopolistic competition market.

  10. Chemical disorder and charge transport in ferromagnetic manganites

    International Nuclear Information System (INIS)

    Pickett, W.E.; Singh, D.J.

    1997-01-01

    Disorder broadening due to randomly distributed La 3+ and A 2+ (A=Ca,Sr,Ba) cations is combined with a virtual-crystal treatment of the average system to evaluate the effects on both majority and minority transport in the ferromagnetic La 2/3 A 1/3 MnO 3 system. The low-density minority carriers which lie in the band tail are localized by disorder, while the majority carriers retain long mean free paths reflected in the observed strongly metallic conductivity. In addition to obtaining transport parameters, we provide evidence that local distortions are due to nearby ionic charges rather than to ion size considerations. copyright 1997 The American Physical Society

  11. Thermal detection of trapped charge carriers in organic transport materials

    Science.gov (United States)

    von Malm, Norwin; Steiger, Juergen; Finnberg, Torsten; Schmechel, Roland; von Seggern, Heinz

    2003-03-01

    The effect of trap states on the transport and luminescence properties of organic light emitting diodes (OLEDs) is studied. For trap level detection energy resolved thermally stimulated current (TSC) measurements known as fractional glow are utilized to determine the density of occupied states (DOOS) in various organic semiconductors such as the small molecule systems Alq3 [aluminum tris(8-hydroxyquinoline)], 1-NaphDATA {4,4',4"-tris-[N-(1-naphtyl)-N-phenylamino]-triphenylamine} and α-NPD [N,N'-di-(1-naphthyl)-N,N'-diphenylbenzidine] and the polymeric semiconductor MDMO-PPV {poly[2-methoxy-5-(3',7'-dimethyloctyloxy)-1,4-phenylenevinylene]}. Characteristic differences in the trap spectra are obtained and interpreted in terms of possible structural and compositional origins of the investigated materials. In order to judge the formation process of traps and their practical consequences on the charge carrier transport I-V and L-V characteristics of 1-NaphDATA doped α-NPD devices and α-NPD doped 1-NaphDATA devices were compared to respective non-doped samples. A clearly reduced current and luminescence was found only in the former case. It was possible to conclude that the detected electronic trap states either act as hole traps or as scattering centers. Furthermore, pulsed transport studies on ITO/α-NPD/Alq3/Al devices show thte critical influence of traps on the dynamical performance of the charge transport. In a two-pulse experiment the carrier injection and trap depletion can be separated.

  12. Simulating charge transport to understand the spectral response of Swept Charge Devices

    Science.gov (United States)

    Athiray, P. S.; Sreekumar, P.; Narendranath, S.; Gow, J. P. D.

    2015-11-01

    Context. Swept Charge Devices (SCD) are novel X-ray detectors optimized for improved spectral performance without any demand for active cooling. The Chandrayaan-1 X-ray Spectrometer (C1XS) experiment onboard the Chandrayaan-1 spacecraft used an array of SCDs to map the global surface elemental abundances on the Moon using the X-ray fluorescence (XRF) technique. The successful demonstration of SCDs in C1XS spurred an enhanced version of the spectrometer on Chandrayaan-2 using the next-generation SCD sensors. Aims: The objective of this paper is to demonstrate validation of a physical model developed to simulate X-ray photon interaction and charge transportation in a SCD. The model helps to understand and identify the origin of individual components that collectively contribute to the energy-dependent spectral response of the SCD. Furthermore, the model provides completeness to various calibration tasks, such as generating spectral matrices (RMFs - redistribution matrix files), estimating efficiency, optimizing event selection logic, and maximizing event recovery to improve photon-collection efficiency in SCDs. Methods: Charge generation and transportation in the SCD at different layers related to channel stops, field zones, and field-free zones due to photon interaction were computed using standard drift and diffusion equations. Charge collected in the buried channel due to photon interaction in different volumes of the detector was computed by assuming a Gaussian radial profile of the charge cloud. The collected charge was processed further to simulate both diagonal clocking read-out, which is a novel design exclusive for SCDs, and event selection logic to construct the energy spectrum. Results: We compare simulation results of the SCD CCD54 with measurements obtained during the ground calibration of C1XS and clearly demonstrate that our model reproduces all the major spectral features seen in calibration data. We also describe our understanding of interactions at

  13. Effects of cytosine methylation on DNA charge transport

    International Nuclear Information System (INIS)

    Hihath, Joshua; Guo Shaoyin; Tao Nongjian; Zhang Peiming

    2012-01-01

    The methylation of cytosine bases in DNA commonly takes place in the human genome and its abnormality can be used as a biomarker in the diagnosis of genetic diseases. In this paper we explore the effects of cytosine methylation on the conductance of DNA. Although the methyl group is a small chemical modification, and has a van der Waals radius of only 2 Å, its presence significantly changes the duplex stability, and as such may also affect the conductance properties of DNA. To determine if charge transport through the DNA stack is sensitive to this important biological modification we perform multiple conductance measurements on a methylated DNA molecule with an alternating G:C sequence and its non-methylated counterpart. From these studies we find a measurable difference in the conductance between the two types of molecules, and demonstrate that this difference is statistically significant. The conductance values of these molecules are also compared with a similar sequence that has been previously studied to help elucidate the charge transport mechanisms involved in direct DNA conductance measurements. (paper)

  14. Light-Induced Charge Transport within a Single Asymmetric Nanowire

    Energy Technology Data Exchange (ETDEWEB)

    LIU, CHONG; HWANG, YUN YEONG; JEONG, HOON EIU; YANG, PEIDONG

    2011-01-21

    Artificial photosynthetic systems using semiconductor materials have been explored for more than three decades in order to store solar energy in chemical fuels such as hydrogen. By mimicking biological photosynthesis with two light-absorbing centers that relay excited electrons in a nanoscopic space, a dual-band gap photoelectrochemical (PEC) system is expected to have higher theoretical energy conversion efficiency than a single band gap system. This work demonstrates the vectorial charge transport of photo-generated electrons and holes within a single asymmetric Si/TiO2 nanowire using Kelvin probe force microscopy (KPFM). Under UV illumination, higher surface potential was observed on the n-TiO₂ side, relative to the potential of the p-Si side, as a result of majority carriers’ recombination at the Si/TiO₂ interface. These results demonstrate a new approach to investigate charge separation and transport in a PEC system. This asymmetric nanowire heterostructure, with a dual band gap configuration and simultaneously exposed anode and cathode surfaces represents an ideal platform for the development of technologies for the generation of solar fuels, although better photoanode materials remain to be discovered.

  15. Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties

    Directory of Open Access Journals (Sweden)

    Guang Zhang

    2016-10-01

    Full Text Available Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer (D1 manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one (D2 displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1, in a three-layer organic light emitting diode (OLED by solution processing gave a pure blue emission with Commission Internationale de l’Éclairage 1931 CIE xy = (0.16, 0.12, a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m2. This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

  16. Bipolar resistive switching and charge transport in silicon oxide memristor

    Energy Technology Data Exchange (ETDEWEB)

    Mikhaylov, Alexey N., E-mail: mian@nifti.unn.ru [Lobachevsky State University of Nizhni Novgorod, 23/3 Gagarin Prospect, Nizhni Novgorod 603950 (Russian Federation); Belov, Alexey I.; Guseinov, Davud V.; Korolev, Dmitry S.; Antonov, Ivan N.; Efimovykh, Denis V.; Tikhov, Stanislav V.; Kasatkin, Alexander P.; Gorshkov, Oleg N.; Tetelbaum, David I.; Bobrov, Alexander I.; Malekhonova, Natalia V.; Pavlov, Dmitry A. [Lobachevsky State University of Nizhni Novgorod, 23/3 Gagarin Prospect, Nizhni Novgorod 603950 (Russian Federation); Gryaznov, Evgeny G. [Lobachevsky State University of Nizhni Novgorod, 23/3 Gagarin Prospect, Nizhni Novgorod 603950 (Russian Federation); Sedakov Scientific-Research Institute, GSP-486, Nizhny Novgorod 603950 (Russian Federation); Yatmanov, Alexander P. [Sedakov Scientific-Research Institute, GSP-486, Nizhny Novgorod 603950 (Russian Federation)

    2015-04-15

    Graphical abstract: - Highlights: • Si-based thin-film memristor structure was fabricated by magnetron sputtering. • We study bipolar resistive switching and charge transport mechanisms. • Resistive switching parameters are determined by a balance between redox reactions. - Abstract: Reproducible bipolar resistive switching has been studied in SiO{sub x}-based thin-film memristor structures deposited by magnetron sputtering technique on the TiN/Ti metalized SiO{sub 2}/Si substrates. It is established that, after electroforming, the structure can be switched between the quasi-ohmic low-resistance state related to silicon chains (conducting filaments) and the high-resistance state with semiconductor-like hopping mechanism of charge transport through the defects in silicon oxide. The switching parameters are determined by a balance between the reduction and oxidation processes that, in turn, are driven by the value and polarity of voltage bias, current, temperature and device environment. The results can be used for the development of silicon-based nonvolatile memory and memristive systems as a key component of future electronics.

  17. The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals

    KAUST Repository

    Kaushik, Ananth P.

    2014-03-25

    We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current computational reach, i.e., nanocrystals from 1.53 to 2.1 nm in diameter. These nanocrystals, which resemble PbSe systems, are either bare or covered in short ligands. They also differ in shape, octahedral vs cube-octahedral, and in superlattice symmetry (fcc vs bcc). We have provided insights on electron and hole coupling along different facets and overall charge mobility in bcc and fcc superlattices. We have determined that the relative areas of (100) to (111) facets, and facet atom types are important factors governing the optimization of charge transport. The calculated electronic density of states shows no role of -SCH3 - ligands on states near the band gap. Electron coupling between nanocrystals is significantly higher than that of hole coupling; thiol ligands lower the ratio between electron and hole couplings. Stronger coupling exists between smaller nanocrystals. © 2014 American Chemical Society.

  18. Correlation of Disorder and Charge Transport in a Range of Indacenodithiophene-Based Semiconducting Polymers

    KAUST Repository

    Nikolka, Mark

    2017-12-13

    Over the past 25 years, various design motifs have emerged for the development of organic semiconductors for demanding applications in flexible organic light emitting diode display backplanes or even printed organic logic. Due to their large area uniformity paired with high charge carrier mobilities, conjugated polymers have attracted increasing attention in this respect. However, the performances delivered by current generation conjugated polymers still fall short of many industrial requirements demanding devices with ideal transistor characteristics and higher mobilities. The discovery of conjugated polymers with low energetic disorder, such as the indacenodithiophene-based polymer indacenodithiophene-co-benzothiadiazole, represent an exciting opportunity to breach this chasm if these materials can be further optimized while maintaining their low disorder. Here, it is shown how both the charge transport properties as well as the energetic disorder are affected by tuning the molecular structure of a large range of indacenodithiophene-based semiconducting polymer derivatives. This study allows to understand better the interplay between molecular design and structure of the polymer backbone and the degree of energetic disorder that governs the charge transport properties in thin polymer films.

  19. Setting up charging electric stations within residential communities in current China: Gaming of government agencies and property management companies

    International Nuclear Information System (INIS)

    Wu, Tian; Ma, Lin; Mao, Zhonggen; Ou, Xunmin

    2015-01-01

    The difficulty of charging electric vehicles (EVs) is now hindering their further development. Governments generally choose to build stations for home charging (including piles) within residential communities. Given the conflict of interest between various government agencies and property management companies, constructing a charging station within residential communities would result in welfare loss for the property management companies and therefore lead to the principal–agent problem. This paper constructs a two-period imperfect information game theory model to study the moral hazard involved in this issue and government agencies' optimal choice. In the analytic solution of the model, we find that the optimal choice for a farsighted government agency is to constantly improve the incentive mechanism and introduce charging stations only when the conflict of interest is eliminated. Any benefits derived from government regulations by force would prove short-lived. The government should focus on long-term returns in the development of EVs, and its optimal mechanism should be designed to mitigate the principal–agent problem of property management companies, thereby accelerate the progress of EV charging infrastructure and improve overall social welfare. - Highlights: • The charging of electric vehicles (EVs) is hindering their use. • A game theory model is used for analysis of EV charging station construction. • Charging stations are in residential communities in China. • Government agencies are constantly improving incentive mechanisms

  20. Development and governance of renewable methane use in transport

    Energy Technology Data Exchange (ETDEWEB)

    Lampinen, Ari

    2013-10-15

    Renewable methane is promoted in many countries as a sustainable alternative to fossil fuels in all types of transport applications. This article examines development, governance and motives for the use of biogas, synthetic biogas, wind methane and other types of renewable methane in transport. Fossil methane fuels, such as natural gas, shale gas and synthetic natural gas, are included as a comparison. Compressed town gas played an important role in the adoption of methane for traffic use, so its history is also examined. Three waves of development in the use of traffic biogas are identified: the Second World War, the 1970s oil crises, and the present day quest for sustainability. While biogas has been used in transport since the 1930s, the other renewable methane fuels are now emerging in the commercial market with only a few years of history. The article looks at the use of renewable methane in a global perspective, although most of the examples are from Europe, as the majority of the technological and political advances have been European.

  1. URBAN TRANSPORT AND LOCAL GOVERNANCE IN ASIAN DEVELOPING COUNTRIES

    Directory of Open Access Journals (Sweden)

    Akira MORITA

    2004-01-01

    This paper comprises a GIS-based land use analysis on the relationship between urbanization and transport infrastructure development, b GPS-based travel behavior survey, and c interview survey on residents' satisfaction with transport infrastructures and services. It was shown that the current land use patterns largely differ depending on the existence of agricultural infrastructure development in the pre-urbanized stage. It was also confirmed by a GPS-based travel survey that travel behavior patterns in scattered development areas are significantly different from those in orderly development areas. The former areas lack not only road space but also a structured hierarchy of networks, resulting in inefficient travel behaviors with low speed and detours. The GPS survey gave clearer pictures to grasp the relationship between travel patterns of residents and their demand for the improvement of local transport services. It was indicated that local governments who are responsible for these demands often fail to meet them due to financial and institutional limitations of the current system.

  2. Quantized charge transport in chiral Majorana edge modes

    Science.gov (United States)

    Rachel, Stephan; Mascot, Eric; Cocklin, Sagen; Vojta, Matthias; Morr, Dirk K.

    2017-11-01

    Majorana fermions can be realized as quasiparticles in topological superconductors, with potential applications in topological quantum computing. Recently, lattices of magnetic adatoms deposited on the surface of s -wave superconductors—Shiba lattices—have been proposed as a new platform for topological superconductivity. These systems possess the great advantage that they are accessible via scanning-probe techniques and thus enable the local manipulation and detection of Majorana modes. Using a nonequilibrium Green's function technique we demonstrate that the topological Majorana edge modes of nanoscopic Shiba islands display universal electronic and transport properties. Most remarkably, these Majorana modes possess a quantized charge conductance that is proportional to the topological Chern number, C , and carry a supercurrent whose chirality reflects the sign of C . These results establish nanoscopic Shiba islands as promising components in future topology-based devices.

  3. Fundamentals of charged particle transport in gases and condensed matter

    CERN Document Server

    Robson, Robert E; Hildebrandt, Malte

    2018-01-01

    This book offers a comprehensive and cohesive overview of transport processes associated with all kinds of charged particles, including electrons, ions, positrons, and muons, in both gases and condensed matter. The emphasis is on fundamental physics, linking experiment, theory and applications. In particular, the authors discuss: The kinetic theory of gases, from the traditional Boltzmann equation to modern generalizations A complementary approach: Maxwell’s equations of change and fluid modeling Calculation of ion-atom scattering cross sections Extension to soft condensed matter, amorphous materials Applications: drift tube experiments, including the Franck-Hertz experiment, modeling plasma processing devices, muon catalysed fusion, positron emission tomography, gaseous radiation detectors Straightforward, physically-based arguments are used wherever possible to complement mathematical rigor.

  4. DNA Charge Transport: From Chemical Principles to the Cell

    Science.gov (United States)

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

    2016-01-01

    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  5. Charge and energy transport at the nanoscale: A DFT perspective

    Science.gov (United States)

    Eich, Florian; Covito, Fabio; Rubio, Angel

    Understanding the interplay between charge and energy transport at the nanoscale paves the way for novel thermoelectric devices, which may prove useful for the development for sustainable energy sources. However, concepts, such as heat flow, temperature and entropy are only well-established at the macroscopic level for slow dynamics. This raises the question about whether these concepts can be employed for small length and short time scales. We will present our recent efforts to use a time-dependent density-functional theory framework, dubbed thermal DFT, in order to generalize temperature and heat or energy flow to the microscopic regime. To this end we will highlight the analogy of the formally exact microscopic equations of motion for charge density and energy density in thermal DFT to the macroscopic equations of motion of hydrodynamics. Furthermore, we will present first result using our approach to compute transient energy energy currents induced by a temperature gradient and show that in the steady-state limit persistent temperature oscillations develop. This project has received funding from the European Union's Framework Programme for Research and Innovation Horizon 2020 (2014-2020) under the Marie Skłodowska-Curie Grant Agreement No. 701796.

  6. Charge injection and transport properties of an organic light-emitting diode

    Directory of Open Access Journals (Sweden)

    Peter Juhasz

    2016-01-01

    Full Text Available The charge behavior of organic light emitting diode (OLED is investigated by steady-state current–voltage technique and impedance spectroscopy at various temperatures to obtain activation energies of charge injection and transport processes. Good agreement of activation energies obtained by steady-state and frequency-domain was used to analyze their contributions to the charge injection and transport. We concluded that charge is injected into the OLED device mostly through the interfacial states at low voltage region, whereas the thermionic injection dominates in the high voltage region. This comparison of experimental techniques demonstrates their capabilities of identification of major bottleneck of charge injection and transport.

  7. Metal Oxides as Efficient Charge Transporters in Perovskite Solar Cells

    KAUST Repository

    Haque, Mohammed

    2017-07-10

    Over the past few years, hybrid halide perovskites have emerged as a highly promising class of materials for photovoltaic technology, and the power conversion efficiency of perovskite solar cells (PSCs) has accelerated at an unprecedented pace, reaching a record value of over 22%. In the context of PSC research, wide-bandgap semiconducting metal oxides have been extensively studied because of their exceptional performance for injection and extraction of photo-generated carriers. In this comprehensive review, we focus on the synthesis and applications of metal oxides as electron and hole transporters in efficient PSCs with both mesoporous and planar architectures. Metal oxides and their doped variants with proper energy band alignment with halide perovskites, in the form of nanostructured layers and compact thin films, can not only assist with charge transport but also improve the stability of PSCs under ambient conditions. Strategies for the implementation of metal oxides with tailored compositions and structures, and for the engineering of their interfaces with perovskites will be critical for the future development and commercialization of PSCs.

  8. Spatial charge configuration regulates nanoparticle transport and binding behavior in vivo

    Science.gov (United States)

    Han, Hee-Sun; Martin, John D.; Lee, Jungmin; Harris, Daniel K.; Fukumura, Dai; Jain, Rakesh K.; Bawendi, Moungi

    2013-01-01

    Detailed Charge arrangements: A new set of zwitterionic quantum dots were synthesized and used to study the influence of microscopic charge arrangements on the in vivo behavior of nanoparticles. Experiments using cultured cells and live mice demonstrate that the microscopic arrangement of surface charges strongly influence nonspecific binding, clearance behavior, and in vivo transport of nanoparticles. PMID:23255143

  9. Charge and spin transport in nanoscale junction from first principles

    Science.gov (United States)

    Mandal, Subhasish

    Recently nanoscale junctions consisting of 0-D nanostructures (single molecule) or 1-D nanostructures (semiconducting nanowire) sandwiched between two metal electrodes are successfully fabricated and characterized. What lacks in the recent developments is the understanding of the mechanism behind the observed phenomena at the level of atoms and electrons. For example, the origin of observed switching effect in a semiconducting nanowire due to the influence of an external gate bias is not yet understood at the electronic structure level. On the same context, different experimental groups have reported different signs in tunneling magneto-resistance for the same organic spin valve structure, which has baffled researchers working in this field. In this thesis, we present the answers to some of these subtle questions by investigating the charge and spin transport in different nanoscale junctions. A parameter-free, single particle Green's function approach in conjunction with a posteriori density functional theory (DFT) involving a hybrid orbital dependent functional is used to calculate the tunneling current in the coherent transport limit. The effect of spin polarization is explicitly incorporated to investigate spin transport in a nanoscale junction. Through the electron transport studies in PbS nanowire junction, a new orbital controlled mechanism behind the switching of the current is proposed. It can explain the switching behavior, not only in PbS nanowire, but in other lead-chalcogenide nanowires as well. Beside this, the electronic structure properties of this nanowire are studied using periodic DFT. The quantum confinement effect was investigated by calculating the bandgap of PbS nanowires with different diameters. Subsequently, we explain an observed semiconducting to metallic phase transition of this nanowire by calculating the bandgap of the nanowire under uniform radial strain. The compressive radial strain on the nanowire was found to be responsible for

  10. Single molecule charge transport : From a quantum mechanical to a classical description

    NARCIS (Netherlands)

    Kocherzhenko, A.A.; Grozema, F.C.; Siebbeles, L.D.A.

    2010-01-01

    This paper explores charge transport at the single molecule level. The conductive properties of both small organic molecules and conjugated polymers (molecular wires) are considered. In particular, the reasons for the transition from fully coherent to incoherent charge transport and the approaches

  11. Charge transport and photocurrent generation in poly (3-hexylthiophene) : Methanofullerene bulk-heterojunction solar cells

    NARCIS (Netherlands)

    Mihailetchi, VD; Xie, HX; de Boer, B; Koster, LJA; Blom, PWM; Mihailetchi, Valentin D.; Xie, Hangxing

    2006-01-01

    The effect of controlled thermal annealing on charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (P3HT) and methanofullerene (PCBM) has been studied. With respect to the charge transport, it is demonstrated that the

  12. Spin and charge transport in the presence of spin-orbit interaction

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics; Volume 58; Issue 2. Spin and ... We present the study of spin and charge transport in nanostructures in the presence of spin-orbit (SO) interaction. ... Using these tight binding Hamiltonians and spin resolved Landauer–Büttiker formula, spin and charge transport is studied.

  13. Charge transport and recombination in polyspirobifluorene blue light-emitting diodes

    NARCIS (Netherlands)

    Nicolai, H.T.; Hof, A.; Oosthoek, J.L.M.; Blom, P.W.M.

    2011-01-01

    The charge transport in blue light-emitting polyspirobifluorene is investigated by both steady-state current-voltage measurements and transient electroluminescence. Both measurement techniques yield consistent results and show that the hole transport is space-charge limited. The electron current is

  14. STM and transport measurements of highly charged ion modified materials

    International Nuclear Information System (INIS)

    Pomeroy, J.M.; Grube, H.; Perrella, A.C.; Gillaspy, J.D.

    2007-01-01

    Careful measurements of highly charged ions (HCIs) colliding with gases and surfaces have provided glimpses of intense electronic interactions, but a comprehensive model for the interaction mechanisms, time scales, and resultant nano-features that bridges materials systems is yet to be realized. At the National Institute of Standards and Technology (NIST) electron beam ion trap (EBIT) facility, new apparatus is now connected to the HCI beamline to allow preparation of clean, atomically flat surfaces of single crystals, e.g. gold, tungsten and silicon, and deposition and patterning of thin films, e.g. high resistivity oxides, ferromagnetic metals, normal metals and superconductors. Experiments reported here focus on the electronic and morphological structure of HCI induced nano-features. Current activities are focused on using in situ scanning tunneling microscope (STM) on Au(1 1 1) and (separately) ex situ transport measurements to study electronic properties within HCI modified magnetic multilayer systems. Specifically, we are fabricating magnetic multilayers similar to magnetic tunnel junctions (MTJs) (important in advanced magnetic field sensors and superconducting Josephson junction devices) and using HCIs to adjust critical electronic properties. The electrical response of the tunnel junction to HCIs provides a novel approach to performing HCI-induced nanostructure ensemble measurements

  15. Charge Transport in Non-Irradiated and Irradiated Silicon Diodes

    CERN Document Server

    Leroy, C; Casse, G L; Glaser, M; Grigoriev, E; Lemeilleur, F

    1999-01-01

    A model describing the transport of charge carriers generated in silicon detectors (standard planar float zone and MESA diodes) by ionizing particles is presented. The current pulse response induced by $\\alpha$ and $\\beta$ particles in non-irradiated detectors and detectors irradiated up to fluences $\\Phi \\approx 3 \\cdot 10^{14}$ particles/cm$^2$ is reproduced through this model: i) by adding a small n-type region 15 $\\mu$m deep on the $p^+$ side for the standard planar float zone detectors at fluences beyond the n to p-type inversion and ii) for the MESA detectors, by considering one dead layer 14 $\\mu$m deep (observed experimentally) on each side, and introducing a second (delayed) component. For both types of detectors, the model gives mobilities decreasing linearily up to fluences of about $5 \\cdot 10^{13}$ particles/cm$^2$ and converging, beyond, to saturation values of about 1000 cm$^2$/Vs and 455 cm$^2$/Vs for electrons and holes, respectively. At a fluence $\\Phi \\approx 10^{14}$ particles/cm$^2$, char...

  16. New perspective on charge transport in molecularly doped systems

    Science.gov (United States)

    Yuh, Huoy-Jen; Pai, David M.

    1990-07-01

    Hole transport has been investigated in films of solid solutions of N,N'-diphenyl-N,N'- bis(3-methylphenyl)-[1, 1 '-biphenylj-4,4'-diamine (TPD), ETPD, a structural variant of TPD and a hydrazone molecule in two different polymer binders. Rather than being 'inert' as generally assumed, the binder plays a major role in influencing the rate of charge exchange between molecules. It is found that the absolute values of the drift mobilities, their electric field dependence and the activation energies are strong functions of the binder polymer employed to cast the film. At equivalent molecular concentrations but with two different binder polymers, the mobilities can vary by as much as two orders of magnitude. In some instances mobility decreases as the electric field is increased. The increased mobility of dispersions in polystyrene is directly related to the reduction in the activation energies. The role that binder plays may be related to the dispersibility of the diamine molecules in the polymeric binders.

  17. Charge transport in DNA nanowires connected to carbon nanotubes

    Science.gov (United States)

    Tan, Bikan; Hodak, Miroslav; Lu, Wenchang; Bernholc, J.

    2015-08-01

    DNA is perhaps the worlds most controllable nanowire, with potential applications in nanoelectronics and sensing. However, understanding of its charge transport (CT) properties remains elusive, with experiments reporting a wide range of behaviors from insulating to superconductive. We report extensive first-principle simulations that account for DNA's high flexibility and its native solvent environment. The results show that the CT along the DNA's long axis is strongly dependent on DNA's instantaneous conformation varying over many orders of magnitude. In high CT conformations, delocalized conductive states extending over up to 10 base pairs are found. Their low exponential decay constants further indicate that coherent CT, which is assumed to be active only over 2-3 base pairs in the commonly accepted DNA CT models, can act over much longer length scales. We also identify a simple geometrical rule that predicts CT properties of a given conformation with high accuracy. The effect of mismatched base pairs is also considered: while they decrease conductivities of specific DNA conformations, thermally induced conformational fluctuations wash out this effect. Overall, our results indicate that an immobilized partially dried poly(G)-poly(C) B-DNA is preferable for nanowire applications.

  18. 48 CFR 47.403-2 - Air transport agreements between the United States and foreign governments.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Air transport agreements between the United States and foreign governments. 47.403-2 Section 47.403-2 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACT MANAGEMENT TRANSPORTATION Air Transportation by U.S.-Flag Carriers 47.403-2 Air transport...

  19. An LP-based heuristic for the fixed charge transportation problem

    DEFF Research Database (Denmark)

    Klose, Andreas

    2007-01-01

    The fixed charge transportation problem consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported, transportation costs also include a fixed charge. The paper describes a linear programming based heuristic...... inequalities and flow cover inequalities, the approach also employs Fenchel cuts that are based on embedded 0-1 single node flow sets. Computational results obtained for a set of standard test problem instances are reported....

  20. Molecule-induced interface states dominate charge transport in Si-alkyl-metal junctions

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Lam H; Gergel-Hackett, Nadine; Zangmeister, Christopher D; Hacker, Christina A; Richter, Curt A; Kushmerick, James G [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)], E-mail: james.kushmerick@nist.gov

    2008-09-17

    Semiconductor-molecule-metal junctions consisting of alkanethiol monolayers self-assembled on both p{sup +} and n{sup -} type highly doped Si(111) wires contacted with a 10 {mu}m Au wire in a crossed-wire geometry are examined. Low temperature transport measurements reveal that molecule-induced semiconductor interface states control charge transport across these systems. Inelastic electron tunneling spectroscopy also highlights the strong contribution of the induced interface states to the observed charge transport.

  1. Molecule-induced interface states dominate charge transport in Si-alkyl-metal junctions.

    Science.gov (United States)

    Yu, Lam H; Gergel-Hackett, Nadine; Zangmeister, Christopher D; Hacker, Christina A; Richter, Curt A; Kushmerick, James G

    2008-09-17

    Semiconductor-molecule-metal junctions consisting of alkanethiol monolayers self-assembled on both p(+) and n(-) type highly doped Si(111) wires contacted with a 10 µm Au wire in a crossed-wire geometry are examined. Low temperature transport measurements reveal that molecule-induced semiconductor interface states control charge transport across these systems. Inelastic electron tunneling spectroscopy also highlights the strong contribution of the induced interface states to the observed charge transport.

  2. High throughput ab initio modeling of charge transport for bio-molecular-electronics

    Science.gov (United States)

    Bruque, Nicolas Alexander

    2009-12-01

    Self-assembled nanostructures, composed of inorganic and organic materials, have multiple applications in the fields of engineering and nanotechnology. Experimental research using nanoscaled materials, such as semiconductor/metallic nanocrystals, nanowires (NW), and carbon nanotube (CNT)-molecular systems have potential applications in next generation nano electronic devices. Many of these molecular systems exhibit electronic device functionality. However, experimental analytical techniques to determine how the chemistry and geometry affects electron transport through these devices does not yet exist. Using theory and modeling, one can approximate the chemistry and geometry at the atomic level and also determine how the chemistry and geometry governs electron current. Nanoelectronic devices however, contain several thousand atoms which makes quantum modeling difficult. Popular atomistic modeling approaches are capable of handling small molecular systems, which are of scientific interest, but have little engineering value. The lack of large scale modeling tools has left the scientific and engineering community with a limited ability to understand, explore, and design complex systems of engineering interest. To address these issues, I have developed a high performance general quantum charge transport model based on the non-equilibrium Green function (NEGF) formalism using density functional theory (DFT) as implemented in the FIREBALL software. FIREBALL is a quantum molecular dynamics code which has demonstrated the ability to model large molecular systems. This dissertation project of integrating NEGF into FIREBALL provides researchers with a modeling tool capable of simulating charge current in large inorganic/organic systems. To provide theoretical support for experimental efforts, this project focused on CNT-molecular systems, which includes the discovery of a CNT-molecular resonant tunneling diode (RTD) for electronic circuit applications. This research also

  3. Beamline for low-energy transport of highly charged ions at HITRAP

    Energy Technology Data Exchange (ETDEWEB)

    Andelkovic, Z., E-mail: z.andelkovic@gsi.de [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt (Germany); Herfurth, F.; Kotovskiy, N. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt (Germany); König, K.; Maaß, B.; Murböck, T. [Technische Universität Darmstadt (Germany); Neidherr, D. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt (Germany); Schmidt, S. [Technische Universität Darmstadt (Germany); Johannes Gutenberg-Universität Mainz (Germany); Steinmann, J. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt (Germany); Hochschule Darmstadt (Germany); Vogel, M.; Vorobjev, G. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt (Germany)

    2015-09-21

    A beamline for transport of highly charged ions with energies as low as a few keV/charge has been constructed and commissioned at GSI. Complementary to the existing infrastructure of the HITRAP facility for deceleration of highly charged ions from the GSI accelerator, the new beamline connects the HITRAP ion decelerator and an EBIT with the associated experimental setups. Therefore, the facility can now transport the decelerated heavy highly charged ions to the experiments or supply them offline with medium-heavy highly charged ions from the EBIT, both at energies as low as a few keV/charge. Here we present the design of the 20 m long beamline with the corresponding beam instrumentation, as well as its performance in terms of energy and transport efficiency.

  4. Modeling Transport in Ultrathin Si Nanowires: Charged versus Neutral Impurities

    DEFF Research Database (Denmark)

    Rurali, Riccardo; Markussen, Troels; Suné, Jordi

    2008-01-01

    of this effect are obtained by computing the electronic transmission through wires with either charged or neutral P and B dopants. The dopant potential is obtained from density functional theory (DFT) calculations. Contrary to the neutral case, the transmission through charged dopants cannot be converged within...

  5. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    NARCIS (Netherlands)

    Bhattacharjee, S.; Opstal, van E.J.; Alink, G.M.; Marcelis, A.T.M.; Zuilhof, H.; Rietjens, I.M.C.M.

    2013-01-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles

  6. Numerical computation of discrete differential scattering cross sections for Monte Carlo charged particle transport

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Jonathan A., E-mail: walshjon@mit.edu [Department of Nuclear Science and Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, 24-107, Cambridge, MA 02139 (United States); Palmer, Todd S. [Department of Nuclear Engineering and Radiation Health Physics, Oregon State University, 116 Radiation Center, Corvallis, OR 97331 (United States); Urbatsch, Todd J. [XTD-IDA: Theoretical Design, Integrated Design and Assessment, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

    2015-12-15

    Highlights: • Generation of discrete differential scattering angle and energy loss cross sections. • Gauss–Radau quadrature utilizing numerically computed cross section moments. • Development of a charged particle transport capability in the Milagro IMC code. • Integration of cross section generation and charged particle transport capabilities. - Abstract: We investigate a method for numerically generating discrete scattering cross sections for use in charged particle transport simulations. We describe the cross section generation procedure and compare it to existing methods used to obtain discrete cross sections. The numerical approach presented here is generalized to allow greater flexibility in choosing a cross section model from which to derive discrete values. Cross section data computed with this method compare favorably with discrete data generated with an existing method. Additionally, a charged particle transport capability is demonstrated in the time-dependent Implicit Monte Carlo radiative transfer code, Milagro. We verify the implementation of charged particle transport in Milagro with analytic test problems and we compare calculated electron depth–dose profiles with another particle transport code that has a validated electron transport capability. Finally, we investigate the integration of the new discrete cross section generation method with the charged particle transport capability in Milagro.

  7. The single-sink fixed-charge transportation problem: Applications and solution methods

    DEFF Research Database (Denmark)

    Goertz, Simon; Klose, Andreas

    2007-01-01

    The single-sink fixed-charge transportation problem (SSFCTP) consists in finding a minimum cost flow from a number of supplier nodes to a single demand node. Shipping costs comprise costs proportional to the amount shipped as well as a fixed-charge. Although the SSFCTP is an important special case...... of the well-known fixed-charge transportation problem, just a few methods for solving this problem have been proposed in the literature. After summarising some applications of this problem arising in manufacturing and transportation, we give an overview on approximation algorithms and worst-case results....... Finally, we briefly compare some exact solution algorithms for this problem....

  8. Transport of Cryptosporidium parvum Oocysts in Charge Heterogeneous Porous Media: Microfluidics Experiment and Numerical Simulation

    Science.gov (United States)

    Liu, Y.; Meng, X.; Guo, Z.; Zhang, C.; Nguyen, T. H.; Hu, D.; Ji, J.; Yang, X.

    2017-12-01

    Colloidal attachment on charge heterogeneous grains has significant environmental implications for transport of hazardous colloids, such as pathogens, in the aquifer, where iron, manganese, and aluminium oxide minerals are the major source of surface charge heterogeneity of the aquifer grains. A patchwise surface charge model is often used to describe the surface charge heterogeneity of the grains. In the patchwise model, the colloidal attachment efficiency is linearly correlated with the fraction of the favorable patches (θ=λ(θf - θu)+θu). However, our previous microfluidic study showed that the attachment efficiency of oocysts of Cryptosporidium parvum, a waterborne protozoan parasite, was not linear correlated with the fraction of the favorable patches (λ). In this study, we developed a pore scale model to simulate colloidal transport and attachment on charge heterogeneous grains. The flow field was simulated using the LBM method and colloidal transport and attachment were simulated using the Lagrange particle tracking method. The pore scale model was calibrated with experimental results of colloidal and oocyst transport in microfluidic devices and was then used to simulate oocyst transport in charge heterogeneous porous media under a variety of environmental relative conditions, i.e. the fraction of favorable patchwise, ionic strength, and pH. The results of the pore scale simulations were used to evaluate the effect of surface charge heterogeneity on upscaling of oocyst transport from pore to continuum scale and to develop an applicable correlation between colloidal attachment efficiency and the fraction of the favorable patches.

  9. The role of space charge compensation for ion beam extraction and ion beam transport (invited)

    International Nuclear Information System (INIS)

    Spädtke, Peter

    2014-01-01

    Depending on the specific type of ion source, the ion beam is extracted either from an electrode surface or from a plasma. There is always an interface between the (almost) space charge compensated ion source plasma, and the extraction region in which the full space charge is influencing the ion beam itself. After extraction, the ion beam is to be transported towards an accelerating structure in most cases. For lower intensities, this transport can be done without space charge compensation. However, if space charge is not negligible, the positive charge of the ion beam will attract electrons, which will compensate the space charge, at least partially. The final degree of Space Charge Compensation (SCC) will depend on different properties, like the ratio of generation rate of secondary particles and their loss rate, or the fact whether the ion beam is pulsed or continuous. In sections of the beam line, where the ion beam is drifting, a pure electrostatic plasma will develop, whereas in magnetic elements, these space charge compensating electrons become magnetized. The transport section will provide a series of different plasma conditions with different properties. Different measurement tools to investigate the degree of space charge compensation will be described, as well as computational methods for the simulation of ion beams with partial space charge compensation

  10. Bistetracene Thin Film Polymorphic Control to Unravel the Effect of Molecular Packing on Charge Transport

    KAUST Repository

    Burnett, Edmund K.

    2018-02-26

    Polymorphism, the ability for a given material to adopt multiple crystalline packing states, is a powerful approach for investigating how changes in molecular packing influence charge transport within organic semiconductors. In this study, a new

  11. Numerical design of electron guns and space charge limited transport systems

    International Nuclear Information System (INIS)

    Herrmannsfeldt, W.B.

    1980-10-01

    This paper describes the capabilities and limitations of computer programs used to design electron guns and similarly space-charge limited transport systems. Examples of computer generated plots from several different types of gun problems are included

  12. Electrification Opportunities in the Transportation Sector and Impact of Residential Charging

    Energy Technology Data Exchange (ETDEWEB)

    Muratori, Matteo [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2018-04-04

    This presentation provides an overview of electrification opportunities in the transportation sector and present results of a study assessing the impact of residential charging on residential power demand and electric power distribution infrastructure.

  13. Multiple nucleon transfer in damped nuclear collisions. [Lectures, mass charge, and linear and angular momentum transport

    Energy Technology Data Exchange (ETDEWEB)

    Randrup, J.

    1979-07-01

    This lecture discusses a theory for the transport of mass, charge, linear, and angular momentum and energy in damped nuclear collisions, as induced by multiple transfer of individual nucleons. 11 references.

  14. Charge transport in organic crystals: Critical role of correlated fluctuations unveiled by analysis of Feynman diagrams

    International Nuclear Information System (INIS)

    Packwood, Daniel M.; Oniwa, Kazuaki; Jin, Tienan; Asao, Naoki

    2015-01-01

    Organic crystals have unique charge transport properties that lie somewhere between delocalised band-type transport and localised hopping transport. In this paper, we use a stochastic tight-binding model to explore how dynamical disorder in organic crystals affects charge transport. By analysing the model in terms of Feynman diagrams (virtual processes), we expose the crucial role of correlated dynamical disorder to the charge transport dynamics in the model at short times in the order of a few hundred femtoseconds. Under correlated dynamical disorder, the random motions of molecules in the crystal allow for low-energy “bonding”-type interactions between neighboring molecular orbitals can persist over long periods of time. On the other hand, the dependence of charge transport on correlated dynamical disorder also tends to localize the charge, as correlated disorder cannot persist far in space. This concept of correlation may be the “missing link” for describing the intermediate regime between band transport and hopping transport that occurs in organic crystals

  15. Charge carrier transport in polycrystalline organic thin film based field effect transistors

    Science.gov (United States)

    Rani, Varsha; Sharma, Akanksha; Ghosh, Subhasis

    2016-05-01

    The charge carrier transport mechanism in polycrystalline thin film based organic field effect transistors (OFETs) has been explained using two competing models, multiple trapping and releases (MTR) model and percolation model. It has been shown that MTR model is most suitable for explaining charge carrier transport in grainy polycrystalline organic thin films. The energetic distribution of traps determined independently using Mayer-Neldel rule (MNR) is in excellent agreement with the values obtained by MTR model for copper phthalocyanine and pentacene based OFETs.

  16. Structural contributions to charge transport across Ni-octanedithiol multilayer junctions.

    Science.gov (United States)

    Yu, Lam H; Zangmeister, Christopher D; Kushmerick, James G

    2006-11-01

    We report the fabrication and characterization of multilayer thin films incorporating 1,8-octanedithiols and Ni atoms. Low-temperature charge transport measurements exhibit inelastic co-tunneling and resonant tunneling features that correspond energetically to vibrational excitations of the molecular multilayer. Several junctions exhibit changes in conductance features characteristic of charge defect-gating. Transport through our junctions is shown to be dominated by the intrinsic properties of the multilayer.

  17. Note on the Noether charge and holographic transports

    Science.gov (United States)

    Fan, Zhong-Ying

    2018-03-01

    We clarify the relation between the Noether charge associated to an arbitrary vector field and the equations of motion by revisiting Wald formalism. For a timelike Killing vector, aspects of the Noether charge suggest that it is dual to the heat current in the boundary for general holographic theories. For a spacelike Killing vector, we interpret the Noether charge (at the transverse direction) as shear stress of the dual fluid so we can compute the ratio of shear viscosity to entropy density by simply using the infrared data on the black hole event horizon. We test the new method for Einstein gravity and Gauss-Bonnet gravity and find that it produces correct results for both cases even in the presence of additional matter fields.

  18. Transport barrier fluctuations governed by SOL turbulence spreading

    International Nuclear Information System (INIS)

    Ghendrih, Ph.; Sarazin, Y.; Ciraolo, G.; Darmet, G.; Garbet, X.; Grangirard, V.; Tamain, P.; Benkadda, S.; Beyer, P.

    2007-01-01

    Turbulence spreading, namely turbulent transport extending into a stable region is reported both for the flat density profiles in the far SOL and into a modeled H-mode barrier. It is shown that due to turbulence penetration, the pedestal width fluctuates and that its effective width is a factor 2 smaller than the linear predicted width. Turbulence overshooting throughout the pedestal leads to a non-vanishing turbulent transport within the barrier and provides a coupling of core and SOL turbulence despite the transport barrier

  19. Low-energy beam transport using space-charge lenses

    International Nuclear Information System (INIS)

    Meusel, O.; Bechtold, A.; Pozimski, J.; Ratzinger, U.; Schempp, A.; Klein, H.

    2005-01-01

    Space-charge lenses (SCL) of the Gabor type provide strong cylinder symmetric focusing for low-energy ion beams using a confined nonneutral plasma. They need modest magnetic and electrostatic field strength and provide a short installation length when compared to conventional LEBT-lenses like quadrupoles and magnetic solenoids. The density distribution of the enclosed space charge within the Gabor lens is given by the confinement in transverse and longitudinal directions. In the case of a positive ion beam, the space charge of the confined electron cloud may cause an overcompensation of the ion beam space-charge force and consequently focuses the beam. To investigate the capabilities of an SCL double-lens system for ion beam into an RFQ, a test injector was installed at IAP and put into operation successfully. Furthermore, to study the focusing capabilities of this lens at beam energies up to 500 keV, a high-field Gabor lens was built and installed downstream of the RFQ. Experimental results of the beam injection into the RFQ are presented as well as those of these first bunched beam-focusing tests with the 110 A keV He + beam

  20. Information services in social networked transportation : governance and ITS.

    Science.gov (United States)

    2014-06-01

    The purpose of this research seeks to understand the functions and the benefits of social : networked transportation (SNT), the processes that make SNT possible, and the institutional : innovations needed to facilitate those processes. First, this re...

  1. Role of Molecular Weight Distribution on Charge Transport in Semiconducting Polymers

    KAUST Repository

    Himmelberger, Scott

    2014-10-28

    © 2014 American Chemical Society. Model semiconducting polymer blends of well-controlled molecular weight distributions are fabricated and demonstrated to be a simple method to control intermolecular disorder without affecting intramolecular order or degree of aggregation. Mobility measurements exhibit that even small amounts of low molecular weight material are detrimental to charge transport. Trends in charge carrier mobility can be reproduced by a simple analytical model which indicates that carriers have no preference for high or low molecular weight chains and that charge transport is limited by interchain hopping. These results quantify the role of long polymer tie-chains and demonstrate the need for controlled polydispersity for achieving high carrier mobilities.

  2. Investigation of charge transport and electromagnetic effects in advanced microelectronics and optoelectronics

    Energy Technology Data Exchange (ETDEWEB)

    Kwan, T.; Booth, T.; Gray, M. [and others

    1996-07-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The next generation of electronic microchips will utilize components with sub-micron feature size and optoelectronic devices with picosecond response time. Fundamental understanding of the device performance can only be obtained through first principles physics modeling of charge transport and electromagnetic effects in realistic geometries with material interfaces and dispersive properties. We have developed a general model incorporating important physics such as charge transport processes in materials with multilevel band structures and electromagnetic effects to simulate device characteristics. Accurate treatment of material interfaces and boundaries is included. The Monte Carlo charge transport is coupled self-consistently to Maxwell`s equations to accurately model scattering processes in the presence of an externally biased potential. This detailed multidimensional simulation capability is compared with and verified by experimental data, and could become an industrial standard for benchmarking and improving the {open_quotes}reduced model{close_quotes} codes used for semiconductor design. Specific tasks are the extension of existing capabilities in particle-in-cell plasma simulation technique and Monte Carlo charge transport to study the physics of charged particle dynamics in realistic microelectronic devices, such as bipolar semiconductors, heterojunction transistors, and optoelectronic switches. Our approach has been based on the coupled particle-in-cell/Monte Carlo technique, which can simultaneously treat both electromagnetic wave propagation and charged-particle transport.

  3. A general relationship between disorder, aggregation and charge transport in conjugated polymers

    KAUST Repository

    Noriega, Rodrigo

    2013-08-04

    Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.

  4. A reduced-cost iterated local search heuristic for the fixed-charge transportation problem

    NARCIS (Netherlands)

    Buson, Erika; Roberti, Roberto; Toth, Paolo

    2014-01-01

    The fixed-charge transportation problem (FCTP) is a generalization of the transportation problem where an additional fixed cost is paid for sending a flow from an origin to a destination. We propose an iterated local search heuristic based on the utilization of reduced costs for guiding the restart

  5. Towards a wave theory of charged beam transport: A collection of thoughts

    International Nuclear Information System (INIS)

    Dattoli, G.; Mari, C.; Torre, A.

    1992-01-01

    We formulate in a rigorous way a wave theory of charged beam linear transport. The Wigner distribution function is introduced and provides the link with classical mechanics. Finally, the von Neumann equation is shown to coincide with the Liouville equation for the nonlinear transport

  6. The impact of governance modes on sustainable transport - the case of bus transport in Greater Manchester, UK

    DEFF Research Database (Denmark)

    Sørensen, Claus Hedegaard; Gudmundsson, Henrik

    2010-01-01

    pursued in a deregulated context. We focus on bus transport in Greater Manchester as the case in point. First, we study the effects of the NPM reforms on modal shift. We find that the reforms generally have contributed to a decline in bus passengers, while some reform elements have made positive......'Sustainable transport' has become a priority for transport planning and policy making around the world. Sustainable transport plans often promote efforts to shift passengers from private cars to other modes such as public transport. However, the actual success of such efforts is likely to depend...... on how the transport sector is organised and governed. In this paper, we study the impacts of new public management (NPM) reforms in the British local transport sector on the attraction of passengers to buses. Britain is an interesting example since high level sustainable transport policies have been...

  7. Continuity of operations/continuity of government for state-level transportation organizations : brief.

    Science.gov (United States)

    2011-09-01

    As a result of a federal requirement, all non-federal entities that own or operate critical : infrastructure are required to develop Continuity of Operations/Continuity of Government : (COOP/COG) Plans. Transportation is a critical infrastructure com...

  8. Optoelectronic properties and depth profile of charge transport in nanocrystal films

    Science.gov (United States)

    Aigner, Willi; Bienek, Oliver; Desta, Derese; Wiggers, Hartmut; Stutzmann, Martin; Pereira, Rui N.

    2017-07-01

    We investigate the charge transport in nanocrystal (NC) films using field effect transistors (FETs) of silicon NCs. By studying films with various thicknesses in the dark and under illumination with photons with different penetration depths (UV and red light), we are able to predictably change the spatial distribution of charge carriers across the films' profile. The experimental data are compared with photoinduced charge carrier generation rates computed using finite-difference time-domain (FDTD) simulations complemented with optical measurements. This enables us to understand the optoelectronic properties of NC films and the depth profile dependence of the charge transport properties. From electrical measurements, we extract the total (bulk) photoinduced charge carrier densities (nphoto) and the photoinduced charge carrier densities in the FETs channel (nphoto*). We observe that the values of nphoto and their dependence on film thickness are similar for UV and red light illumination, whereas a significant difference is observed for the values of nphoto*. The dependencies of nphoto and nphoto* on film thickness and illumination wavelength are compared with data from FDTD simulations. Combining experimental data and simulation results, we find that charge carriers in the top rough surface of the films cannot contribute to the macroscopic charge transport. Moreover, we conclude that below the top rough surface of NC films, the efficiency of charge transport, including the charge carrier mobility, is homogeneous across the film thickness. Our work shows that the use of NC films as photoactive layers in applications requiring harvesting of strongly absorbed photons such as photodetectors and photovoltaics demands a very rigorous control over the films' roughness.

  9. Nonlinear charge transport in bipolar semiconductors due to electron heating

    Energy Technology Data Exchange (ETDEWEB)

    Molina-Valdovinos, S., E-mail: sergiom@fisica.uaz.edu.mx [Universidad Autónoma de Zacatecas, Unidad Académica de Física, Calzada Solidaridad esq. Paseo, La Bufa s/n, CP 98060, Zacatecas, Zac, México (Mexico); Gurevich, Yu.G. [Centro de Investigación y de Estudios Avanzados del IPN, Departamento de Física, Av. IPN 2508, México D.F., CP 07360, México (Mexico)

    2016-05-27

    It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

  10. Study of Charge Carrier Transport in GaN Sensors

    Science.gov (United States)

    Gaubas, Eugenijus; Ceponis, Tomas; Kuokstis, Edmundas; Meskauskaite, Dovile; Pavlov, Jevgenij; Reklaitis, Ignas

    2016-01-01

    Capacitor and Schottky diode sensors were fabricated on GaN material grown by hydride vapor phase epitaxy and metal-organic chemical vapor deposition techniques using plasma etching and metal deposition. The operational characteristics of these devices have been investigated by profiling current transients and by comparing the experimental regimes of the perpendicular and parallel injection of excess carrier domains. Profiling of the carrier injection location allows for the separation of the bipolar and the monopolar charge drift components. Carrier mobility values attributed to the hydride vapor phase epitaxy (HVPE) GaN material have been estimated as μe = 1000 ± 200 cm2/Vs for electrons, and μh = 400 ± 80 cm2/Vs for holes, respectively. Current transients under injection of the localized and bulk packets of excess carriers have been examined in order to determine the surface charge formation and polarization effects. PMID:28773418

  11. Charge Carrier Transport Properties of Vacuum Evaporated Anthrylvinylbenzene Thin Films

    Directory of Open Access Journals (Sweden)

    Haikel HRICHI

    2014-05-01

    Full Text Available The charge carrier conduction processes and dielectric properties of two new materials based on anthracene core structure, 1-(9 anthrylvinyl-4-benzyloxybenzene (AVB and 1,4- bis(9-anthrylvinylbenzene (AV2B diodes have been investigated using dc current density–voltage (J–V and AC impedance spectroscopy (100 Hz–10 MHz. The DC electrical properties of ITO/anthracene derivative /Al device showing an ohmic behavior at low voltages and switches to space charge limited current (SCLC conduction with exponential trap distribution at higher voltages. The best performance device was achieved from ITO/AVB/Al structure showing the high charge carrier mobility which has also been evaluated from SCLC as 6.55´10-6 cm/Vs. According to the impedance spectroscopy results the structures were modeled by equivalent circuit designed as a parallel resistor Rp and capacitor Cp network in series with resistor Rs. The evolution of the electrical parameters with frequency and bias voltage of these anthracene-based systems has been discussed. The conductivity s(w evolution with frequency and bias voltage was studied for ITO/anthracene derivatives/Al devices. The dc conductivity sdc for these devices has been determined. The ac conductivity sac showed a variation in angular frequency as A.ws with a critical exponent s< 1 suggesting a hopping conduction mechanism at high frequency.

  12. Temperature-Dependent Charge Transport through Individually Contacted DNA Origami-Based Au Nanowires.

    Science.gov (United States)

    Teschome, Bezu; Facsko, Stefan; Schönherr, Tommy; Kerbusch, Jochen; Keller, Adrian; Erbe, Artur

    2016-10-11

    DNA origami nanostructures have been used extensively as scaffolds for numerous applications such as for organizing both organic and inorganic nanomaterials, studying single molecule reactions, and fabricating photonic devices. Yet, little has been done toward the integration of DNA origami nanostructures into nanoelectronic devices. Among other challenges, the technical difficulties in producing well-defined electrical contacts between macroscopic electrodes and individual DNA origami-based nanodevices represent a serious bottleneck that hinders the thorough characterization of such devices. Therefore, in this work, we have developed a method to electrically contact individual DNA origami-based metallic nanowires using electron beam lithography. We then characterize the charge transport of such nanowires in the temperature range from room temperature down to 4.2 K. The room temperature charge transport measurements exhibit ohmic behavior, whereas at lower temperatures, multiple charge transport mechanisms such as tunneling and thermally assisted transport start to dominate. Our results confirm that charge transport along metallized DNA origami nanostructures may deviate from pure metallic behavior due to several factors including partial metallization, seed inhomogeneities, impurities, and weak electronic coupling among AuNPs. Besides, this study further elucidates the importance of variable temperature measurements for determining the dominant charge transport mechanisms for conductive nanostructures made by self-assembly approaches.

  13. Theoretical tools for the description of charge transport in disordered organic semiconductors.

    Science.gov (United States)

    Nenashev, A V; Oelerich, J O; Baranovskii, S D

    2015-03-11

    Hopping conduction is widely considered the dominant charge transport mechanism in disordered organic semiconductors. Although theories of hopping transport have been developed in detail for applications to inorganic amorphous materials, these theories are often out of scope for the community working with organic amorphous systems. Theoretical research on charge transport in organic systems is overwhelmed by phenomenological fittings of numerical results by equations, which often make little physical sense. The aim of the current review is to bring analytical theoretical methods to the attention of the community working with disordered organic semiconductors.

  14. Link between hopping models and percolation scaling laws for charge transport in mixtures of small molecules

    Directory of Open Access Journals (Sweden)

    Dong-Gwang Ha

    2016-04-01

    Full Text Available Mixed host compositions that combine charge transport materials with luminescent dyes offer superior control over exciton formation and charge transport in organic light emitting devices (OLEDs. Two approaches are typically used to optimize the fraction of charge transport materials in a mixed host composition: either an empirical percolative model, or a hopping transport model. We show that these two commonly-employed models are linked by an analytic expression which relates the localization length to the percolation threshold and critical exponent. The relation is confirmed both numerically and experimentally through measurements of the relative conductivity of Tris(4-carbazoyl-9-ylphenylamine (TCTA :1,3-bis(3,5-dipyrid-3-yl-phenylbenzene (BmPyPb mixtures with different concentrations, where the TCTA plays a role as hole conductor and the BmPyPb as hole insulator. The analytic relation may allow the rational design of mixed layers of small molecules for high-performance OLEDs.

  15. Extracellular Polymeric Substances Govern the Surface Charge of Biogenic Elemental Selenium Nanoparticles

    KAUST Repository

    Jain, Rohan

    2015-02-03

    © 2014 American Chemical Society. The origin of the organic layer covering colloidal biogenic elemental selenium nanoparticles (BioSeNPs) is not known, particularly in the case when they are synthesized by complex microbial communities. This study investigated the presence of extracellular polymeric substances (EPS) on BioSeNPs. The role of EPS in capping the extracellularly available BioSeNPs was also examined. Fourier transform infrared (FT-IR) spectroscopy and colorimetric measurements confirmed the presence of functional groups characteristic of proteins and carbohydrates on the BioSeNPs, suggesting the presence of EPS. Chemical synthesis of elemental selenium nanoparticles in the presence of EPS, extracted from selenite fed anaerobic granular sludge, yielded stable colloidal spherical selenium nanoparticles. Furthermore, extracted EPS, BioSeNPs, and chemically synthesized EPS-capped selenium nanoparticles had similar surface properties, as shown by ζ-potential versus pH profiles and isoelectric point measurements. This study shows that the EPS of anaerobic granular sludge form the organic layer present on the BioSeNPs synthesized by these granules. The EPS also govern the surface charge of these BioSeNPs, thereby contributing to their colloidal properties, hence affecting their fate in the environment and the efficiency of bioremediation technologies.

  16. Gauge field governing parallel transport along mixed states

    International Nuclear Information System (INIS)

    Uhlmann, A.

    1990-01-01

    At first a short account is given of some basic notations and results on parallel transport along mixed states. A new connection form (gauge field) is introduced to give a geometric meaning to the concept of parallelity in the theory of density operators. (Author) 11 refs

  17. Effect of Molecular Rotation on Charge Transport Phenomena

    Science.gov (United States)

    Garg, O. P.; Lamba, Vijay Kr; Kaushik, D. K.

    2015-12-01

    The study of electron transport properties of molecular systems could be explained on the basis of the Landauer formalism. Unfortunately, due to the complexity of the experimental setup, most of these measurements have no control over the details of the electrode geometry, rotation of molecules, variation in angle of contacts, effect of fano resonances associated with side groups attached to rigid backbones, which results in a spectrum of IV-characteristics. Theoretical models can therefore help to understand and helps to develop new applications such as molecular sensors, etc. Thus we used simulation methods that generate the required structural ensemble, which is then analyzed with Green’s function methods to characterize the electronic transport properties. In present work we had discussed applications of this approach to understand the conductance in molecular system in the direction of controlling electron transport through molecules and studied the effect of rotation of sandwiched molecule.

  18. Assessing the potential of different charging strategies for electric vehicle fleets in closed transport systems

    International Nuclear Information System (INIS)

    Schmidt, Johannes; Eisel, Matthias; Kolbe, Lutz M.

    2014-01-01

    A key reason for the low sales volumes of electric vehicles is their significantly higher purchasing price in comparison to conventional vehicles. However, various charging strategies can be applied to make these vehicles more profitable. In this paper, controlled charging concepts are transferred to commercial fleets operating in closed transport systems, as we found this field of application particularly well suited for the implementation of charging strategies. We analyzed data gathered in a field experiment conducted in a European port using electric vehicles in combination with a battery-swapping station to calculate the economic potentials of three charging scenarios: (1) optimizing energy procurement (2) trading load-shifting potential on control markets, and (3) a combination of the two. The findings indicate that all approaches are appropriate for reducing economic disadvantages of electric transport vehicles. Furthermore, we find that adjusting charging processes to avoid price peaks is more profitable than offering control reserve. Finally, focusing on the combination of both strategies seems to be most promising from an economic perspective. In this context, operational cost savings of more than 65% can be achieved compared to a similar dieselpowered vehicle when applying this strategy. - Highlights: • We model various charging strategies for electric transport vehicles. • The economic assessment is based on a field experiment with a port operator. • We consider the special market design of spot and ancillary service markets. • All charging strategies presented provide substantial cost-saving potentials. • Optimizing energy procurement is more profitable than offering control reserve

  19. Optical conductivity and optical effective mass in a high-mobility organic semiconductor: Implications for the nature of charge transport

    KAUST Repository

    Li, Yuan

    2014-12-03

    We present a multiscale modeling of the infrared optical properties of the rubrene crystal. The results are in very good agreement with the experimental data that point to nonmonotonic features in the optical conductivity spectrum and small optical effective masses. We find that, in the static-disorder approximation, the nonlocal electron-phonon interactions stemming from low-frequency lattice vibrations can decrease the optical effective masses and lead to lighter quasiparticles. On the other hand, the charge-transport and infrared optical properties of the rubrene crystal at room temperature are demonstrated to be governed by localized carriers driven by inherent thermal disorders. Our findings underline that the presence of apparently light carriers in high-mobility organic semiconductors does not necessarily imply bandlike transport.

  20. Adaptive tree multigrids and simplified spherical harmonics approximation in deterministic neutral and charged particle transport

    International Nuclear Information System (INIS)

    Kotiluoto, P.

    2007-05-01

    A new deterministic three-dimensional neutral and charged particle transport code, MultiTrans, has been developed. In the novel approach, the adaptive tree multigrid technique is used in conjunction with simplified spherical harmonics approximation of the Boltzmann transport equation. The development of the new radiation transport code started in the framework of the Finnish boron neutron capture therapy (BNCT) project. Since the application of the MultiTrans code to BNCT dose planning problems, the testing and development of the MultiTrans code has continued in conventional radiotherapy and reactor physics applications. In this thesis, an overview of different numerical radiation transport methods is first given. Special features of the simplified spherical harmonics method and the adaptive tree multigrid technique are then reviewed. The usefulness of the new MultiTrans code has been indicated by verifying and validating the code performance for different types of neutral and charged particle transport problems, reported in separate publications. (orig.)

  1. Charge carrier transport mechanisms in perovskite CdTiO3 fibers

    Directory of Open Access Journals (Sweden)

    Z. Imran

    2014-06-01

    Full Text Available Electrical transport properties of electrospun cadmium titanate (CdTiO3 fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behavior followed by space charge limited current (SCLC with traps at higher voltages at all temperatures (200 K – 420 K. Trap density in our fibers system is Nt = 6.27 × 1017 /cm3. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH from 200 K – 300 K. The localized density of states were found to be N(EF = 5.51 × 1021 eV−1 cm−3 at 2 V. Other VRH parameters such as hopping distance (Rhop and hopping energy (Whop were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO3 fibers efficient material for capacitive energy storage devices.

  2. Influence of functional groups on charge transport in molecular junctions

    DEFF Research Database (Denmark)

    Mowbray, Duncan; Jones, Glenn; Thygesen, Kristian Sommer

    2008-01-01

    Using density functional theory (DFT), we analyze the influence of five classes of functional groups, as exemplified by NO2, OCH3, CH3, CCl3, and I, on the transport properties of a 1,4-benzenedithiolate (BDT) and 1,4-benzenediamine (BDA) molecular junction with gold electrodes. Our analysis...... demonstrates how ideas from functional group chemistry may be used to engineer a molecule's transport properties, as was shown experimentally and using a semiempirical model for BDA [Nano Lett. 7, 502 (2007)]. In particular, we show that the qualitative change in conductance due to a given functional group can...... be predicted from its known electronic effect (whether it is sigma/pi donating/withdrawing). However, the influence of functional groups on a molecule's conductance is very weak, as was also found in the BDA experiments. The calculated DFT conductances for the BDA species are five times larger than...

  3. Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy

    International Nuclear Information System (INIS)

    Lee, Min Hyung; Song, Hyunwook

    2013-01-01

    We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects

  4. Absence of ballistic charge transport in the half-filled 1D Hubbard model

    Science.gov (United States)

    Carmelo, J. M. P.; Nemati, S.; Prosen, T.

    2018-05-01

    Whether in the thermodynamic limit of lattice length L → ∞, hole concentration mηz = - 2Sηz / L = 1 -ne → 0, nonzero temperature T > 0, and U / t > 0 the charge stiffness of the 1D Hubbard model with first neighbor transfer integral t and on-site repulsion U is finite or vanishes and thus whether there is or there is no ballistic charge transport, respectively, remains an unsolved and controversial issue, as different approaches yield contradictory results. (Here Sηz = - (L -Ne) / 2 is the η-spin projection and ne =Ne / L the electronic density.) In this paper we provide an upper bound on the charge stiffness and show that (similarly as at zero temperature), for T > 0 and U / t > 0 it vanishes for mηz → 0 within the canonical ensemble in the thermodynamic limit L → ∞. Moreover, we show that at high temperature T → ∞ the charge stiffness vanishes as well within the grand-canonical ensemble for L → ∞ and chemical potential μ →μu where (μ -μu) ≥ 0 and 2μu is the Mott-Hubbard gap. The lack of charge ballistic transport indicates that charge transport at finite temperatures is dominated by a diffusive contribution. Our scheme uses a suitable exact representation of the electrons in terms of rotated electrons for which the numbers of singly occupied and doubly occupied lattice sites are good quantum numbers for U / t > 0. In contrast to often less controllable numerical studies, the use of such a representation reveals the carriers that couple to the charge probes and provides useful physical information on the microscopic processes behind the exotic charge transport properties of the 1D electronic correlated system under study.

  5. Charge transport in organic semiconductors: assessment of the mean field theory in the hopping regime.

    Science.gov (United States)

    Wang, Linjun; Beljonne, David

    2013-08-14

    The performance of the mean field theory to account for charge transfer rate in molecular dimers and charge transport mobility in molecular stacks with small intermolecular electronic coupling and large local electron-phonon coupling (i.e., in the hopping regime) is carefully investigated against various other approaches. Using Marcus formula as a reference, it is found that mean field theory with system-bath interaction and surface hopping approaches yield fully consistent charge transfer rates in dimers. However, in contrast to the dimer case, incorporating system-bath interaction in the mean field approach results in a completely wrong temperature dependence of charge carrier mobility in larger aggregates. Although the mean field simulation starting from the relaxed geometry of a charged molecule and neglecting system-bath interaction can reproduce thermally activated transport, it is not able to characterize properly the role of additional nonlocal electron-phonon couplings. Our study reveals that the mean field theory must be used with caution when studying charge transport in the hopping regime of organic semiconductors, where the surface hopping approach is generally superior.

  6. Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

    KAUST Repository

    Sutton, Christopher

    2017-06-13

    Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

  7. Flywheel-Based Fast Charging Station - FFCS for Electric Vehicles and Public Transportation

    Science.gov (United States)

    Gabbar, Hossam A.; Othman, Ahmed M.

    2017-08-01

    This paper demonstrates novel Flywheel-based Fast Charging Station (FFCS) for high performance and profitable charging infrastructures for public electric buses. The design criteria will be provided for fast charging stations. The station would support the private and open charging framework. Flywheel Energy storage system is utilized to offer advanced energy storage for charging stations to achieve clean public transportation, including electric buses with reducing GHG, including CO2 emission reduction. The integrated modelling and management system in the station is performed by a decision-based control platform that coordinates the power streams between the quick chargers, the flywheel storage framework, photovoltaic cells and the network association. There is a tidy exchange up between the capacity rate of flywheel framework and the power rating of the network association.”

  8. Analysis of ABCD-like law for charged-particle beam transport with transversal divergence

    International Nuclear Information System (INIS)

    Chen Baoxin; Zhang Aiju; Sun Biehe

    2004-01-01

    It is shown that the propagation of charged-particle beam can be made in complete analogy with the transmission of ellipse-Gaussian light beam in paraxial approximation. Based on this similarity, the ABCD-like law for charged-particle beam transport with transversal divergence is developed by means of the complex curvature radius of charged-particle beam in which its real part shows the beam characteristics of convergent and divergent and its imaginary part shows the beam radius. From this, charged-particle beam as a whole is thought of as a single ellipse Gaussian light-like beam whose emittance plays the role of wave-length. In particular, this analogy gives an insight that it is hopeful to attain possible coherent charged-particle beam in favorable accelerator environment. (authors)

  9. Anomalous doping effects on charge transport in graphene nanoribbons.

    Science.gov (United States)

    Biel, Blanca; Blase, X; Triozon, François; Roche, Stephan

    2009-03-06

    We present first-principles calculations of quantum transport in chemically doped graphene nanoribbons with a width of up to 4 nm. The presence of boron and nitrogen impurities is shown to yield resonant backscattering, whose features are strongly dependent on the symmetry and the width of the ribbon, as well as the position of the dopants. Full suppression of backscattering is obtained on the pi-pi* plateau when the impurity preserves the mirror symmetry of armchair ribbons. Further, an unusual acceptor-donor transition is observed in zigzag ribbons. These unconventional doping effects could be used to design novel types of switching devices.

  10. Influence of electromagnetic field on soliton-mediated charge transport in biological systems.

    Science.gov (United States)

    Brizhik, Larissa

    2015-01-01

    It is shown that electromagnetic fields affect dynamics of Davydov's solitons which provide charge transport processes in macromolecules during metabolism of the system. There is a resonant frequency of the field at which it can cause the transition of electrons from bound soliton states into delocalised states. Such decay of solitons reduces the effectiveness of charge transport, and, therefore, inhibits redox processes. Solitons radiate their own electromagnetic field of characteristic frequency determined by their average velocity. This self-radiated field leads to synchronization of soliton dynamics and charge transport processes, and is the source of the coherence in the system. Exposition of the system to the oscillating electromagnetic field of the frequency, which coincides with the eigen-frequency of solitons can enhance eigen-radiation of solitons, and, therefore, will enhance synchronization of charge transpor, stimulate the redox processes and increase coherence in the system. Electromagnetic oscillating field causes also ratchet phenomenon of solitons, i.e., drift of solitons in macromolecules in the presence of unbiased periodic field. Such additional drift enhances the charge transport processes. It is shown that temperature facilitates the ratchet drift. In particular, temperature fluctuations lead to the lowering of the critical value of the intensity and period of the field, above which the drift of solitons takes place. Moreover, there is a stochastic resonance in the soliton dynamics in external electromagnetic fields. This means, that there is some optimal temperature at which the drift of solitons is maximal.

  11. Space Charge Compensation in the Linac4 Low Energy Beam Transport Line with Negative Hydrogen Ions

    CERN Document Server

    Valerio-Lizarraga, C; Leon-Monzon, I; Lettry, J; Midttun, O; Scrivens, R

    2014-01-01

    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Tranport (LEBT) using the package IBSimu1, which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H- beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

  12. Review of heavy charged particle transport in MCNP6.2

    Science.gov (United States)

    Zieb, K.; Hughes, H. G.; James, M. R.; Xu, X. G.

    2018-04-01

    The release of version 6.2 of the MCNP6 radiation transport code is imminent. To complement the newest release, a summary of the heavy charged particle physics models used in the 1 MeV to 1 GeV energy regime is presented. Several changes have been introduced into the charged particle physics models since the merger of the MCNP5 and MCNPX codes into MCNP6. This paper discusses the default models used in MCNP6 for continuous energy loss, energy straggling, and angular scattering of heavy charged particles. Explanations of the physics models' theories are included as well.

  13. Algorithms for solving the single-sink fixed-charge transportation problem

    DEFF Research Database (Denmark)

    Klose, Andreas

    2006-01-01

    The single-sink fixed-charge transportation problem is an important subproblem of the fixed-charge transportation problem. Just a few methods have been proposed in the literature to solve this problem. In this paper, solution approaches based on dynamic programming and implicit enumeration...... are revisited. It is shown how the problem size as well as the search space of a recently published dynamic programming method can be reduced by exploiting reduced cost information. Additionally, a further implicit enumeration approach relying on solution concepts for the binary knapsack problem is introduced...

  14. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  15. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    Science.gov (United States)

    Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

    2013-06-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  16. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharjee, Sourav, E-mail: sourav.bhattacharjee@wur.nl [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Opstal, Edward J. van; Alink, Gerrit M. [Wageningen University, Division of Toxicology (Netherlands); Marcelis, Antonius T. M.; Zuilhof, Han [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Rietjens, Ivonne M. C. M. [Wageningen University, Division of Toxicology (Netherlands)

    2013-06-15

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size {approx}45 nm) and polystyrene nanoparticles (PSNPs/size {approx}50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  17. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    International Nuclear Information System (INIS)

    Bhattacharjee, Sourav; Opstal, Edward J. van; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

    2013-01-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size ∼45 nm) and polystyrene nanoparticles (PSNPs/size ∼50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  18. Charge Transport Properties of Durene Crystals from First-Principles.

    Science.gov (United States)

    Motta, Carlo; Sanvito, Stefano

    2014-10-14

    We establish a rigorous computational scheme for constructing an effective Hamiltonian to be used for the determination of the charge carrier mobility of pure organic crystals at finite temperature, which accounts for van der Waals interactions, and it includes vibrational contributions from the entire phonon spectrum of the crystal. Such an approach is based on the ab initio framework provided by density functional theory and the construction of a tight-binding effective model via Wannier transformation. The final Hamiltonian includes coupling of the electrons to the crystals phonons, which are also calculated from density functional theory. We apply this methodology to the case of durene, a small π-conjugated molecule, which forms a high-mobility herringbone-stacked crystal. We show that accounting correctly for dispersive forces is fundamental for obtaining a high-quality phonon spectrum, in agreement with experiments. Then, the mobility as a function of temperature is calculated along different crystallographic directions and the phonons most responsible for the scattering are identified.

  19. Third-order TRANSPORT: A computer program for designing charged particle beam transport systems

    International Nuclear Information System (INIS)

    Carey, D.C.; Brown, K.L.; Rothacker, F.

    1995-05-01

    TRANSPORT has been in existence in various evolutionary versions since 1963. The present version of TRANSPORT is a first-, second-, and third-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems. This report discusses the following topics on TRANSPORT: Mathematical formulation of TRANSPORT; input format for TRANSPORT; summaries of TRANSPORT elements; preliminary specifications; description of the beam; physical elements; other transformations; assembling beam lines; operations; variation of parameters for fitting; and available constraints -- the FIT command

  20. Third-order TRANSPORT: A computer program for designing charged particle beam transport systems

    Energy Technology Data Exchange (ETDEWEB)

    Carey, D.C. [Fermi National Accelerator Lab., Batavia, IL (United States); Brown, K.L.; Rothacker, F. [Stanford Linear Accelerator Center, Menlo Park, CA (United States)

    1995-05-01

    TRANSPORT has been in existence in various evolutionary versions since 1963. The present version of TRANSPORT is a first-, second-, and third-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems. This report discusses the following topics on TRANSPORT: Mathematical formulation of TRANSPORT; input format for TRANSPORT; summaries of TRANSPORT elements; preliminary specifications; description of the beam; physical elements; other transformations; assembling beam lines; operations; variation of parameters for fitting; and available constraints -- the FIT command.

  1. Modeling of charge transport in ion bipolar junction transistors.

    Science.gov (United States)

    Volkov, Anton V; Tybrandt, Klas; Berggren, Magnus; Zozoulenko, Igor V

    2014-06-17

    Spatiotemporal control of the complex chemical microenvironment is of great importance to many fields within life science. One way to facilitate such control is to construct delivery circuits, comprising arrays of dispensing outlets, for ions and charged biomolecules based on ionic transistors. This allows for addressability of ionic signals, which opens up for spatiotemporally controlled delivery in a highly complex manner. One class of ionic transistors, the ion bipolar junction transistors (IBJTs), is especially attractive for these applications because these transistors are functional at physiological conditions and have been employed to modulate the delivery of neurotransmitters to regulate signaling in neuronal cells. Further, the first integrated complementary ionic circuits were recently developed on the basis of these ionic transistors. However, a detailed understanding of the device physics of these transistors is still lacking and hampers further development of components and circuits. Here, we report on the modeling of IBJTs using Poisson's and Nernst-Planck equations and the finite element method. A two-dimensional model of the device is employed that successfully reproduces the main characteristics of the measurement data. On the basis of the detailed concentration and potential profiles provided by the model, the different modes of operation of the transistor are analyzed as well as the transitions between the different modes. The model correctly predicts the measured threshold voltage, which is explained in terms of membrane potentials. All in all, the results provide the basis for a detailed understanding of IBJT operation. This new knowledge is employed to discuss potential improvements of ion bipolar junction transistors in terms of miniaturization and device parameters.

  2. Unconventional Current Scaling and Edge Effects for Charge Transport through Molecular Clusters

    DEFF Research Database (Denmark)

    Obersteiner, Veronika; Huhs, Georg; Papior, Nick Rübner

    2017-01-01

    -size islands. On the basis of first-principles charge-transport simulations, we explain why the scaling of the conductivity of a junction has to be highly non-linear in the number of molecules it contains. Moreover, transport through molecular clusters is found to be highly inhomogeneous with pronounced edge...... effects determined by molecules in locally different electrostatic environments. These effects are most pronounced for comparably small clusters, but electrostatic considerations show that they prevail also for more extended systems....

  3. The 'principles governing charging' for re-use of public sector information

    NARCIS (Netherlands)

    Ricolfi, M.; Drexl, J.; van Eechoud, M.; Janssen, K.; Maggiolino, M.T.; Morando, F.; Sappa, C.; Torremans, P.; Uhlir, P.; Iemma, R.; de Vries, M.

    2011-01-01

    According to the EU Directive 2003/98 public sector bodies can currently charge the cost of collection, production, reproduction and dissemination, together with a reasonable return on investment. If the upper limit for charging was lowered to the marginal costs of reproduction and dissemination of

  4. Government to Government Communication Concerning the Transportation of Radioactive Material: Routine and Crisis

    International Nuclear Information System (INIS)

    Ludbrook, Julian

    2016-01-01

    Good communication between Governments about international shipments of nuclear material, including full information sharing, is key to the effective management of the radiological, economic, environmental and political risks associated with such shipments and particularly any accident or incident involving them. In many, if not most, countries public sensitivity about the potential consequences of any accident involving radioactive material generally is high. Recognising this sensitivity, which has been further heightened by the Fukushima accident, rules are already in place regarding advance communication about the shipment of particular nuclear material from one state to or through the land territory of another state. No particular rules exist in relation to shipments of such material passing through or near the waters under the jurisdiction of another state but not being landed in that state. But the same sensitivity exists and there is the same need for the political leadership in the relevant Coastal State to have full information in advance about such shipments in order to ensure effective practical and political management of any accident involving the shipment. In part taking account of such sensitivity, some Shipping States have in practice been willing to communicate information in advance to Coastal States in this situation. There would be value in recognising more systematically the mutual benefit served by Shipping States routinely communicating information relating to these types of shipments in advance to affected Coastal States, while taking into account the shared concern about ensuring that all sensitive information is protected appropriately. This paper identifies the information needed in advance for effective risk management, recognising that this could be supplemented by bilateral arrangements between the relevant Shipping and Coastal State. It also identifies information that should be communicated and exchanged in an emergency situation

  5. Computational investigation of the effects of perfluorination on the charge-transport properties of polyaromatic hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Cardia, R. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy); Malloci, G., E-mail: giuliano.malloci@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Bosin, A.; Serra, G. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Cappellini, G., E-mail: giancarlo.cappellini@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy)

    2016-10-20

    We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.

  6. Surface and charge transport characterization of polyaniline-cellulose acetate composite membranes.

    Science.gov (United States)

    Qaiser, Asif A; Hyland, Margaret M; Patterson, Darrell A

    2011-02-24

    This study elucidates the charge transport processes of polyaniline (PANI) composite membranes and correlates them to the PANI deposition site and the extent of PANI surface layering on the base microporous membranes. PANI was deposited either as a surface layer or inside the pores of cellulose acetate microporous membranes using various in situ chemical polymerization techniques. The extent of PANI layering at the surface of the base membrane and its oxidation and doping states were characterized using Fourier transform infrared (FTIR) spectroscopy and X-ray photoelectron spectroscopy (XPS). PANI deposition on the membranes showed a strong dependence on the polymerization technique and polymerization time within a single technique. In XPS, the deconvolution of C 1s and N 1s core-level spectra of the composite membranes was used to quantify the extent of PANI layering at the surface along with its oxidation and doping states. PANI incompletely covered the surface of the base microporous membranes for all the employed techniques. However, the extent of the layering increased with the polymerization time in a particular technique. The charge transport through the bulk membrane and charge transfer at the membrane/electrode interface were studied by electrochemical impedance spectroscopy (EIS). The data were analyzed using the equivalent circuit modeling technique. The modeling parameters revealed that PANI deposition at the surface enhanced the interfacial charge transfer but the process depended on the extent of the surface coverage of the membrane. In addition, the charge transport in the bulk membrane depended on the PANI intercalation level, which varied depending on the polymerization technique employed. In addition, the EIS of electrolyte-soaked membranes was also conducted to evaluate the effects of PANI deposition site on charge transport in the presence of an electrolyte. PANI layering at the pore walls of the base membrane from diaphragmatic polymerization

  7. Charge transport in anodic TiO.sub.2./sub. nanotubes studied by terahertz spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Krbal, M.; Kuchařík, Jiří; Sopha, H.; Němec, Hynek; Macák, J. M.

    2016-01-01

    Roč. 10, č. 9 (2016), s. 691-695 ISSN 1862-6254 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO2 nanotubes Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.032, year: 2016

  8. Charge transport in MDMO-PPV : PCNEPV all-polymer solar cells

    NARCIS (Netherlands)

    Mandoc, M. Magdalena; Veurman, Welmoed; Koster, L. Jan Anton; Koetse, Marc M.; Sweelssen, Jorgen; de Boer, Bert; Blom, Paul W. M.

    2007-01-01

    Charge transport properties are investigated of blends of poly [2-methoxy-5-(3('), 7(')-dimethyloctyloxy)-1,4-phenylene vinylene] (MDMO-PPV) and poly-[oxa-1,4-phenylene-(1-cyano-1,2-vinylene)-(2-methoxy-5-(3('), 7(')-dimethyloctyloxy)-1,4-phenylene)-1,2-(2-cyanovinylene)-1,4-phenylene] (PCNEPV). The

  9. Electrical transport through constrictions in the charge-density wave conductor NbSe3

    NARCIS (Netherlands)

    O´Neill, K.; Slot, E.; Thorne, R.; Van der Zant, H.

    2005-01-01

    We have investigated the electrical transport properties of insulating and metallic constrictions of dimensions 100nm-10_m in the charge-density wave (CDW) conductor NbSe3. The constrictions are made in a variety of ways: focused ion beam, reactive ion etching through a resist mask, and in a

  10. Picosecond charge transport in rutile at high carrier densities studiedby transient terahertz spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Zajac, Vít; Němec, Hynek; Kužel, Petr

    2016-01-01

    Roč. 94, č. 11 (2016), 1-9, č. článku 115206. ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO 2 * rutile * ultrafast spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

  11. Influence of magnetic impurities on charge transport in diffusive-normal-metal/superconductor junctions

    NARCIS (Netherlands)

    Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Inoue, J.; Asano, Y.

    2005-01-01

    Charge transport in the diffusive normal metal (DN)/insulator/s- and d-wave superconductor junctions is studied in the presence of magnetic impurities in DN in the framework of the quasiclassical Usadel equations with the generalized boundary conditions. The cases of s- and d-wave superconducting

  12. Enhancement of charge-transport characteristics in polymeric films using polymer brushes

    DEFF Research Database (Denmark)

    Whiting, G.L.; Snaith, H.J.; Khodabakhsh, S.

    2006-01-01

    We show that charge-transporting polymer chains in the brush conformation can be synthesized from a variety of substrates of interest, displaying a high degree of stretching and showing up to a 3 orders of magnitude increase in current density normal to the substrate as compared with a spin...

  13. Quasiclassical theory of coherent charge transport into multi-band superconductors

    NARCIS (Netherlands)

    Burmistrova, A.V.; Devyatov, I.A.; Golubov, Alexandre Avraamovitch; Yada, Keiji; Tanaka, Y.

    2014-01-01

    We formulate a quasiclassical theory of coherent charge transport in junctions involving multi-band iron-based superconductors (FeBSs), explicitly taking into account the complex excitation spectrum and unconventional nature of superconducting pairing in FeBSs. We perform calculations assuming

  14. Charge transport and contact resistance in coplanar devices based on colloidal polyaniline dispersion

    Czech Academy of Sciences Publication Activity Database

    Masillamani, A. M.; Peřinka, N.; Hajná, Milena; Stejskal, Jaroslav; Tondelier, D.; Bonnassieux, Y.; Vanel, J.-C.; Geffroy, B.; Mencaraglia, D.

    2016-01-01

    Roč. 54, č. 17 (2016), s. 1710-1716 ISSN 0887-6266 R&D Projects: GA ČR(CZ) GA13-00270S Institutional support: RVO:61389013 Keywords : charge transport * colloidal dispersion * colloids Subject RIV: JI - Composite Materials Impact factor: 2.838, year: 2016

  15. Charge transport through DNA/DNA duplexes and DNA/RNA hybrids: complex mechanism study

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Vala, M.; Weiter, M.; Špérová, M.; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2013-01-01

    Roč. 20, č. 1 (2013), s. 9-9 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 ; RVO:86652036 Keywords : charge transport * fluorescence spectroscopy * DFT Subject RIV: CF - Physical ; Theoretical Chemistry

  16. Iterated local search and record-to-record travel applied to the fixed charge transportation problem

    DEFF Research Database (Denmark)

    Andersen, Jeanne; Klose, Andreas

    , transportation costs do, however, include a fixed charge. Iterated local search and record-to-record travel are both simple local search based meta-heuristics that, to our knowledge, not yet have been applied to the FCTP. In this paper, we apply both types of search strategies and combine them into a single...

  17. Universal scaling of the charge transport in large-area molecular junctions

    NARCIS (Netherlands)

    Kronemeijer, A.J.; Katsouras, I.; Huisman, E.H.; Hal, P.A. van; Geuns, T.C.T.; Blom, P.W.M.; Leeuw, D.M. de

    2011-01-01

    Charge transport through alkanes and para-phenylene oligomers is investigated in large-area molecular junctions. The molecules are self-assembled in a monolayer and contacted with a top electrode consisting of poly(3,4-ethylenedioxythiophene)-poly(4-styrenesulfonic acid) (PEDOT:PSS). The complete

  18. Charge transport study and spectral response of GaSb/GaAs heterojunctions prepared by MOVPE

    Czech Academy of Sciences Publication Activity Database

    Toušková, J.; Kindl, Dobroslav; Samokhin, Jevgen; Toušek, J.; Hulicius, Eduard; Pangrác, Jiří; Šimeček, Tomislav; Výborný, Zdeněk

    2003-01-01

    Roč. 76, - (2003), s. 135-145 ISSN 0927-0248 R&D Projects: GA ČR GA102/99/0414 Institutional research plan: CEZ:AV0Z1010914 Keywords : thermophotovoltaics * GaSb/GaAs heterojunction * charge transport * band diagram Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.188, year: 2003

  19. Electrochemical gate-controlled charge transport in graphene in ionic liquid and aqueous solution.

    Science.gov (United States)

    Chen, Fang; Qing, Quan; Xia, Jilin; Li, Jinghong; Tao, Nongjian

    2009-07-29

    We have studied the electron transport behavior of electrochemically gated graphene transistors in different solutions. In an ionic liquid, we have determined the electron and hole carrier densities and estimated the concentration of charged impurities to be (1-10) x 10(12) cm(-2). The minimum conductivity displays an exponential decrease with the density of charged impurities, which is attributed to the impurity scattering of the carriers. In aqueous solutions, the position of minimum conductivity shifts negatively as the ionic concentration increases. The dependence of the transport properties on ionic concentration is important for biosensor applications, and the observation is modeled in terms of screening for impurity charges by the ions in solutions.

  20. Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

    DEFF Research Database (Denmark)

    Rauff Lind Christensen, Tue; Klose, Andreas; Andersen, Kim Allan

    The Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem (SSFCMCTP) is a problem with versatile applications. This problem is a generalization of the Single-Sink, Fixed-Charge Transportation Problem (SSFCTP), which has a fixed-charge, linear cost structure. However, in at least two...... are neglected in the SSFCTP. The SSFCMCTP overcome this problem by incorporating a staircase cost structure in the cost function instead of the usual one used in SSFCTP. We present a dynamic programming algorithm for the resulting problem. To enhance the performance of the generic algorithm a number...... of enhancements is employed. The problem instance is reduced by variable pegging using a Lagrangean relaxation from which also a flow augmentation scheme is derived. Additionally a reduction in the search space is employed along with a variable transformation which generalizes a transformation known from...

  1. An improved charge transport system for the pelletron accelerator in Lund

    International Nuclear Information System (INIS)

    Hellborg, R.; Hakansson, K.

    1988-01-01

    Several improvements have been implemented in the chain charge transport system of a pelletron. The main new components are a modified support at ground for the chain accessories, a new power supply for the chain motor, including the possibility of variable chain speed, and pickup rings to monitor the relative amount of charge on individual cylinders of the chain. These modifications, together with the installation of a second chain, have resulted in improved operational reliability, a much smoother startup of the chain, and a doubled maximum chain current. The latter will simplify running the accelerator with heavy ions at maximum terminal voltage. The pickup rings have been found to be useful in diagnosing malfunctions in the charge transport system. (orig.)

  2. Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions

    Energy Technology Data Exchange (ETDEWEB)

    Valerio-Lizarraga, Cristhian A., E-mail: cristhian.alfonso.valerio.lizarraga@cern.ch [CERN, Geneva (Switzerland); Departamento de Investigación en Física, Universidad de Sonora, Hermosillo (Mexico); Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard [CERN, Geneva (Switzerland); Leon-Monzon, Ildefonso [Facultad de Ciencias Fisico-Matematicas, Universidad Autónoma de Sinaloa, Culiacan (Mexico); Midttun, Øystein [CERN, Geneva (Switzerland); University of Oslo, Oslo (Norway)

    2014-02-15

    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H{sup −} beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

  3. Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions

    International Nuclear Information System (INIS)

    Valerio-Lizarraga, Cristhian A.; Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard; Leon-Monzon, Ildefonso; Midttun, Øystein

    2014-01-01

    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H − beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree

  4. Two-Dimensional Spatial Imaging of Charge Transport in Germanium Crystals at Cryogenic Temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Moffatt, Robert [Stanford Univ., CA (United States)

    2016-03-01

    In this dissertation, I describe a novel apparatus for studying the transport of charge in semiconductors at cryogenic temperatures. The motivation to conduct this experiment originated from an asymmetry observed between the behavior of electrons and holes in the germanium detector crystals used by the Cryogenic Dark Matter Search (CDMS). This asymmetry is a consequence of the anisotropic propagation of electrons in germanium at cryogenic temperatures. To better model our detectors, we incorporated this effect into our Monte Carlo simulations of charge transport. The purpose of the experiment described in this dissertation is to test those models in detail. Our measurements have allowed us to discover a shortcoming in our most recent Monte Carlo simulations of electrons in germanium. This discovery would not have been possible without the measurement of the full, two-dimensional charge distribution, which our experimental apparatus has allowed for the first time at cryogenic temperatures.

  5. Transport and Deposition of Variably Charged Soil Colloids in Saturated Porous Media

    DEFF Research Database (Denmark)

    Sharma, Anu; Kawmoto, Ken; Møldrup, Per

    2012-01-01

    A series of column experiments was conducted to investigate the transport and deposition of variably charged colloids in saturated porous media. Soil colloids with diameters ... Okinawa (RYS colloids) in Japan. The VAS colloids exhibited a negative surface charge with a high pH dependency, whereas the RYS colloids exhibited a negative surface charge with less pH dependency. The soil colloids were applied as colloidal suspensions to 10-cm-long saturated sand columns packed...... with either Narita sand (mean diameter = 0.64 mm) or Toyoura sand (mean diameter = 0.21 mm) at different flow rates, suspension concentrations, and pH conditions. Both sands exhibited a negative surface charge in the measured pH range, but the pH dependency was more pronounced for the Toyoura sand...

  6. The Danish Rejsekortet (Smart Card for Public Transportation); Project Governance for Failure or Success?

    DEFF Research Database (Denmark)

    Harboe, Peter Georg; Riis, Eva

    The authors examine a project regarded as a major failure in Danish public investments: The Smart Card for Public Transportation whose introduction was delayed for 9 years with an estimated cost overrun of 125 million EURO. After 3 years of operation, the Smart Card system only covers seven...... of the nine Danish regions and the discussion about giving up the system is continuing. The authors explore the overall conditions set up for these types of projects in the project governance - how project governance conditions a major public IT project and forms the success evaluation. The focus...... infrastructural projects, not IT projects. The authors will close this gap by exploring how project governance affects the life-cycle of a major public IT project and forms the basis of its success evaluation. The analysis of governance in the case study projects – i.e. governance structure, decision processes...

  7. Governance reforming of road transport in Ukraine in the years of 1990-2000

    OpenAIRE

    V. A. Balin

    2015-01-01

    This article explores the main features of Governance reforming of road transport in Ukraine in the years of 1990-2000. Peculiarities of legal regulation of state control authorities in Ukraine are analyzed. The basis of the analysis at different stages of development of Ukrainian society assigned studying: system monitoring bodies, their forms and methods of operation; mechanisms for coordination and cooperation in such control in road transport. Reveals the order of system of...

  8. Behavioral Logistics - Analysis of behavioral routines and governance structures in the interorganizational maritime transport chain

    Directory of Open Access Journals (Sweden)

    2010-09-01

    Full Text Available The strong improvements in information and communication systems as well as better transshipment technologies provide the platform for more efficient transport within interorganizational transport chains. Nevertheless these technologies do not automatically optimize systems based on routines and behavioral patterns, established over the last decades. Logisticians - in theory and practice - have to consider the field of behavioral science to describe and analyse transport problems regarding to involved actors' strategic behavior and social embeddedness, too. The objective of this paper is to illustrate behavioral aspects of supposed technical problems in interorganizational transport chains. Therefore, this paper analyses behavioral routines and governance structures in the interorganizational maritime transport chain using a case study, dealing with the generation and circulation of transport information at the earliest point available, so called "estimated time of arrival" (ETA.

  9. Carbon materials for enhancing charge transport in the advancements of perovskite solar cells

    Science.gov (United States)

    Hu, Ruiyuan; Chu, Liang; Zhang, Jian; Li, Xing'ao; Huang, Wei

    2017-09-01

    Organic-inorganic halide perovskite solar cells (PSCs) have become a new favorite in the photovoltaic field, due to the boosted efficiency up to 22.1%. Despite a flow of achievements, there are certain challenges to simultaneously meet high efficiency, large scale, low cost and high stability. Due to the low cost, extensive sources, high electrical conductivity and chemical stability, carbon materials have made undeniable contributions to play positive roles in developing PSCs. Carbon materials not only have the favorable conductivity but also bipolar advantage, which can transfer both electrons and holes. In this review, we will discuss how the carbon materials transfer charge or accelerate charge transport by incorporation in PSCs. Carbon materials can replace transparent conductive oxide layers, and enhance electron transport in electron transport layers. Moreover, carbon materials with continuous structure, especially carbon nanotubes and graphene, can provide direct charge transport channel that make them suitable additives or even substitutes in hole transport layers. Especially, the successful application of carbon materials as counter electrodes makes the devices full-printable, low temperature and high stability. Finally, a brief outlook is provided on the future development of carbon materials for PSCs, which are expected to devote more contributions in the future photovoltaic market.

  10. The 'principles governing charging' for re-use of public sector information

    OpenAIRE

    Ricolfi, M.; Drexl, J.; van Eechoud, M.; Janssen, K.; Maggiolino, M.T.; Morando, F.; Sappa, C.; Torremans, P.; Uhlir, P.; Iemma, R.; de Vries, M.

    2011-01-01

    According to the EU Directive 2003/98 public sector bodies can currently charge the cost of collection, production, reproduction and dissemination, together with a reasonable return on investment. If the upper limit for charging was lowered to the marginal costs of reproduction and dissemination of documents, with a possibility for a limited number of exhaustively spelled out exceptions, what could these exceptions be? Who would decide in practice on the exceptions: Member States or local pub...

  11. Chain conformations dictate multiscale charge transport phenomena in disordered semiconducting polymers.

    Science.gov (United States)

    Noriega, Rodrigo; Salleo, Alberto; Spakowitz, Andrew J

    2013-10-08

    Existing models for the electronic properties of conjugated polymers do not capture the spatial arrangement of the disordered macromolecular chains over which charge transport occurs. Here, we present an analytical and computational description in which the morphology of individual polymer chains is dictated by well-known statistical models and the electronic coupling between units is determined using Marcus theory. The multiscale transport of charges in these materials (high mobility at short length scales, low mobility at long length scales) is naturally described with our framework. Additionally, the dependence of mobility with electric field and temperature is explained in terms of conformational variability and spatial correlation. Our model offers a predictive approach to connecting processing conditions with transport behavior.

  12. Charge transport and recombination dynamics in organic bulk heterojunction solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Andreas

    2011-08-02

    The charge transport in disordered organic bulk heterojunction (BHJ) solar cells is a crucial process affecting the power conversion efficiency (PCE) of the solar cell. With the need of synthesizing new materials for improving the power conversion efficiency of those cells it is important to study not only the photophysical but also the electrical properties of the new material classes. Thereby, the experimental techniques need to be applicable to operating solar cells. In this work, the conventional methods of transient photoconductivity (also known as ''Time-of-Flight'' (TOF)), as well as the transient charge extraction technique of ''Charge Carrier Extraction by Linearly Increasing Voltage'' (CELIV) are performed on different organic blend compositions. Especially with the latter it is feasible to study the dynamics - i.e. charge transport and charge carrier recombination - in bulk heterojunction (BHJ) solar cells with active layer thicknesses of 100-200 nm. For a well performing organic BHJ solar cells the morphology is the most crucial parameter finding a trade-off between an efficient photogeneration of charge carriers and the transport of the latter to the electrodes. Besides the morphology, the nature of energetic disorder of the active material blend and its influence on the dynamics are discussed extensively in this work. Thereby, the material system of poly(3-hexylthiophene-2,5-diyl) (P3HT) and [6,6]-phenyl-C{sub 61}butyric acid methyl ester (PC{sub 61}BM) serves mainly as a reference material system. New promising donor or acceptor materials and their potential for application in organic photovoltaics are studied in view of charge dynamics and compared with the reference system. With the need for commercialization of organic solar cells the question of the impact of environmental conditions on the PCE of the solar cells raises. In this work, organic BHJ solar cells exposed to synthetic air for finite duration are

  13. MHC-IIB filament assembly and cellular localization are governed by the rod net charge.

    Directory of Open Access Journals (Sweden)

    Michael Rosenberg

    Full Text Available BACKGROUND: Actin-dependent myosin II molecular motors form an integral part of the cell cytoskeleton. Myosin II molecules contain a long coiled-coil rod that mediates filament assembly required for myosin II to exert its full activity. The exact mechanisms orchestrating filament assembly are not fully understood. METHODOLOGY/PRINCIPAL FINDINGS: Here we examine mechanisms controlling filament assembly of non-muscle myosin IIB heavy chain (MHC-IIB. We show that in vitro the entire C-terminus region of net positive charge, found in myosin II rods, is important for self-assembly of MHC-IIB fragments. In contrast, no particular sequences in the rod region with net negative charge were identified as important for self-assembly, yet a minimal area from this region is necessary. Proper paracrystal formation by MHC-IIB fragments requires the 196aa charge periodicity along the entire coiled-coil region. In vivo, in contrast to self-assembly in vitro, negatively-charged regions of the coiled-coil were found to play an important role by controlling the intracellular localization of native MHC-IIB. The entire positively-charged region is also important for intracellular localization of native MHC-IIB. CONCLUSIONS/SIGNIFICANCE: A correct distribution of positive and negative charges along myosin II rod is a necessary component in proper filament assembly and intracellular localization of MHC-IIB.

  14. Charge carrier transport and photogeneration in P3HT:PCBM photovoltaic blends.

    Science.gov (United States)

    Laquai, Frédéric; Andrienko, Denis; Mauer, Ralf; Blom, Paul W M

    2015-06-01

    This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano-fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10(-4) cm(2) V(-1) s(-1) after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea-sured in P3HT:PCBM photovoltaic devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Charge Carrier Transport and Photogeneration in P3HT:PCBM Photovoltaic Blends

    KAUST Repository

    Laquai, Frederic

    2015-05-03

    This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano­fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10−4 cm2 V−1 s−1 after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea­sured in P3HT:PCBM photovoltaic devices.

  16. Charge trapping and carrier transport mechanism in silicon-rich silicon oxynitride

    Energy Technology Data Exchange (ETDEWEB)

    Yu Zhenrui [Department of Electronics, INAOE, Apdo. 51, Puebla, Pue. 72000 (Mexico)]. E-mail: yinaoep@yahoo.mx; Aceves, Mariano [Department of Electronics, INAOE, Apdo. 51, Puebla, Pue. 72000 (Mexico); Carrillo, Jesus [CIDS, BUAP, Puebla, Pue. (Mexico); Lopez-Estopier, Rosa [Department of Electronics, INAOE, Apdo. 51, Puebla, Pue. 72000 (Mexico)

    2006-12-05

    The charge-trapping and carrier transport properties of silicon-rich silicon oxynitride (SRO:N) were studied. The SRO:N films were deposited by low pressure chemical vapor deposition. Infrared (IR) and transmission electron microscopic (TEM) measurements were performed to characterize their structural properties. Capacitance versus voltage and current versus voltage measurements (I-V) were used to study the charge-trapping and carrier transport mechanism. IR and TEM measurements revealed the existence of Si nanodots in SRO:N films. I-V measurements revealed that there are two conduction regimes divided by a threshold voltage V {sub T}. When the applied voltage is smaller than V {sub T}, the current is dominated by the charge transfer between the SRO:N and substrate; and in this regime only dynamic charging/discharging of the SRO:N layer is observed. When the voltage is larger than V {sub T}, the current increases rapidly and is dominated by the Poole-Frenkel mechanism; and in this regime, large permanent trapped charge density is obtained. Nitrogen incorporation significantly reduced the silicon nanodots or defects near the SRO:N/Si interface. However, a significant increase of the density of silicon nanodot in the bulk of the SRO:N layer is obtained.

  17. Charge trapping and carrier transport mechanism in silicon-rich silicon oxynitride

    International Nuclear Information System (INIS)

    Yu Zhenrui; Aceves, Mariano; Carrillo, Jesus; Lopez-Estopier, Rosa

    2006-01-01

    The charge-trapping and carrier transport properties of silicon-rich silicon oxynitride (SRO:N) were studied. The SRO:N films were deposited by low pressure chemical vapor deposition. Infrared (IR) and transmission electron microscopic (TEM) measurements were performed to characterize their structural properties. Capacitance versus voltage and current versus voltage measurements (I-V) were used to study the charge-trapping and carrier transport mechanism. IR and TEM measurements revealed the existence of Si nanodots in SRO:N films. I-V measurements revealed that there are two conduction regimes divided by a threshold voltage V T . When the applied voltage is smaller than V T , the current is dominated by the charge transfer between the SRO:N and substrate; and in this regime only dynamic charging/discharging of the SRO:N layer is observed. When the voltage is larger than V T , the current increases rapidly and is dominated by the Poole-Frenkel mechanism; and in this regime, large permanent trapped charge density is obtained. Nitrogen incorporation significantly reduced the silicon nanodots or defects near the SRO:N/Si interface. However, a significant increase of the density of silicon nanodot in the bulk of the SRO:N layer is obtained

  18. City Governments and Aging in Place: Community Design, Transportation and Housing Innovation Adoption

    Science.gov (United States)

    Lehning, Amanda J.

    2012-01-01

    Purpose of the study: To examine the characteristics associated with city government adoption of community design, housing, and transportation innovations that could benefit older adults. Design and methods: A mixed-methods study with quantitative data collected via online surveys from 62 city planners combined with qualitative data collected via…

  19. Varying the charge of small cations in liquid water: Structural, transport, and thermodynamical properties

    Science.gov (United States)

    Martelli, Fausto; Vuilleumier, Rodolphe; Simonin, Jean-Pierre; Spezia, Riccardo

    2012-10-01

    In this work, we show how increasing the charge of small cations affects the structural, thermodynamical, and dynamical properties of these ions in liquid water. We have studied the case of lanthanoid and actinoid ions, for which we have recently developed accurate polarizable force fields, and the ionic radius is in the 0.995-1.250 Å range, and explored the valency range from 0 to 4+. We found that the ion charge strongly structures the neighboring water molecules and that, in this range of charges, the hydration enthalpies exhibit a quadratic dependence with respect to the charge, in line with the Born model. The diffusion process follows two main regimes: a hydrodynamical regime for neutral or low charges, and a dielectric friction regime for high charges in which the contraction of the ionic radius along the series of elements causes a decrease of the diffusion coefficient. This latter behavior can be qualitatively described by theoretical models, such as the Zwanzig and the solvated ion models. However, these models need be modified in order to obtain agreement with the observed behavior in the full charge range. We have thus modified the solvated ion model by introducing a dependence of the bare ion radius as a function of the ionic charge. Besides agreement between theory and simulation this modification allows one to obtain an empirical unified model. Thus, by analyzing the contributions to the drag coefficient from the viscous and the dielectric terms, we are able to explain the transition from a regime in which the effect of viscosity dominates to one in which dielectric friction governs the motion of ions with radii of ca. 1 Å.

  20. Transport of Heat and Charge in Electromagnetic Metrology Based on Nonequilibrium Statistical Mechanics

    Directory of Open Access Journals (Sweden)

    James Baker-Jarvis

    2009-11-01

    Full Text Available Current research is probing transport on ever smaller scales. Modeling of the electromagnetic interaction with nanoparticles or small collections of dipoles and its associated energy transport and nonequilibrium characteristics requires a detailed understanding of transport properties. The goal of this paper is to use a nonequilibrium statistical-mechanical method to obtain exact time-correlation functions, fluctuation-dissipation theorems (FD, heat and charge transport, and associated transport expressions under electromagnetic driving. We extend the time-symmetric Robertson statistical-mechanical theory to study the exact time evolution of relevant variables and entropy rate in the electromagnetic interaction with materials. In this exact statistical-mechanical theory, a generalized canonical density is used to define an entropy in terms of a set of relevant variables and associated Lagrange multipliers. Then the entropy production rate are defined through the relevant variables. The influence of the nonrelevant variables enter the equations through the projection-like operator and thereby influences the entropy. We present applications to the response functions for the electrical and thermal conductivity, specific heat, generalized temperature, Boltzmann’s constant, and noise. The analysis can be performed either classically or quantum-mechanically, and there are only a few modifications in transferring between the approaches. As an application we study the energy, generalized temperature, and charge transport equations that are valid in nonequilibrium and relate it to heat flow and temperature relations in equilibrium states.

  1. Formulation and Evaluation of CTRW Governing Equations for Irreversible, Bimolecular Reactions During Transport

    Science.gov (United States)

    Hansen, S. K.; Berkowitz, B.

    2014-12-01

    The continuous time random walk (CTRW) formalism is a valuable tool for modeling both conservative and reversibly sorbing solute transport in heterogeneous porous media, underpinning both Eulerian (integrodifferential equation-based) and Lagrangian (particle tracking) approaches to transport modeling. More recently, there has been interest in modeling transport with irreversible reactions, and Lagrangian CTRW-based numerical models have been successfully applied to these problems. However, a corresponding Eulerian theory has been lacking. We recently developed Eulerian governing equations in the presence of irreversible bimolecular reactions, via the device of upscaling transport and treating reactions at a finer scale. The technique is generally valid, even in porous media that do not have an obvious division of length scales, subject to certain smoothness assumptions on the solution. We show that the governing equations we develop simplify, under appropriate circumstances, to both the generalized master equation for the unreactive CTRW and to the advection-dispersion-reaction equation. We also present a numerical corroboration of our development and its underlying smoothness assumptions obtained using a novel, indirect particle-tracking / partial differential equation hybrid technique. We discuss the implications of the new governing equations for practical reactive transport modeling and for conceptualization of subsurface processes, and highlight connections to other approaches. As applicable, we will also discuss aspects of numerical implementation.

  2. Polarization of electron-beam irradiated LDPE films: contribution to charge generation and transport

    Science.gov (United States)

    Banda, M. E.; Griseri, V.; Teyssèdre, G.; Le Roy, S.

    2018-04-01

    Electron-beam irradiation is an alternative way to generate charges in insulating materials, at controlled position and quantity, in order to monitor their behaviour in regard to transport phenomena under the space charge induced electric field or external field applied. In this study, low density polyethylene (LDPE) films were irradiated by a 80 keV electron-beam with a flux of 1 nA cm‑2 during 10 min in an irradiation chamber under vacuum conditions, and were then characterized outside the chamber using three experimental methods. The electrical behaviour of the irradiated material was assessed by space charge measurements using the pulsed electro-acoustic (PEA) method under dc stress. The influence of the applied electric field polarity and amplitude has been tested in order to better understand the charge behaviour after electron-beam irradiation. Fourier transform infra-red spectroscopy (FTIR) and photoluminescence (PL) measurements were performed to evaluate the impact of the electron beam irradiation, i.e. deposited charges and energy, on the chemical structure of the irradiated samples. The present results show that the electrical behaviour in LDPE after irradiation is mostly driven by charges, i.e. by physical process functions of the electric field, and that changes in the chemical structure seems to be mild.

  3. EBQ code: transport of space-charge beams in axially symmetric devices

    International Nuclear Information System (INIS)

    Paul, A.C.

    1982-11-01

    Such general-purpose space charge codes as EGUN, BATES, WOLF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present

  4. Modulation and Control of Charge Transport Through Single-Molecule Junctions.

    Science.gov (United States)

    Wang, Kun; Xu, Bingqian

    2017-02-01

    The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge

  5. Thermal generation and mobility of charge carriers in collective proton transport in hydrogen-bonded chains

    Energy Technology Data Exchange (ETDEWEB)

    Peyrard, M.; Boesch, R.; Kourakis, I. (Dijon Univ., 21 (France). Faculte des Sciences)

    1991-01-01

    The transport of protons in hydrogen-bonded systems is a long standing problem which has not yet obtained a satisfactorily theoretical description. Although this problem was examined first for ice, it is relevant in many systems and in particular in biology for the transport along proteins or for proton conductance across membranes, an essential process in cell life. The broad relevance makes the study of proton conduction very appealing. Since the original work of Bernal and Fowler on ice, the idea that the transport occurs through chains of hydrogen bonds has been well accepted. Such proton wires'' were invoked by Nagle and Morowitz for proton transport across membranes proteins and more recently across lipid bilayers. In this report, we assume the existence of such an hydrogen-bonded chain and discuss its consequences on the dynamics of the charge carriers. We show that this assumption leads naturally to the idea of soliton transport and we put a special emphasis on the role of the coupling between the protons and heavy ions motions. The model is presented. We show how the coupling affects strongly the dynamics of the charge carriers and we discuss the role it plays in the thermal generation of carriers. The work presented has been performed in 1986 and 87 with St. Pnevmatikos and N. Flyzanis and was then completed in collaboration with D. Hochstrasser and H. Buettner. Therefore the results presented in this part are not new but we think that they are appropriate in the context of this multidisciplinary workshop because they provide a rather complete example of the soliton picture for proton conduction. This paper discusses the thermal generation of the charge carriers when the coupling between the protons and heavy ions dynamics is taken into account. The results presented in this part are very recent and will deserve further analysis but they already show that the coupling can assist for the formation of the charge carriers.

  6. Coulombic interactions and multicomponent ionic dispersion during transport of charged species in heterogeneous porous media

    DEFF Research Database (Denmark)

    Muniruzzaman, Muhammad; Rolle, Massimo

    the ionic interactions by mapping the Coulombic cross-coupling between the dispersive fluxes of the charged species in the heterogeneous domains. The outcomes of this study are important in many subsurface applications including migration of contaminants and propagation of reaction fronts.......Electrochemical cross-coupling plays a significant role for transport of charged species in porous media [1, 2]. In this study we performed flow-through experiments in a quasi two-dimensional setup using dilute solutions of strong electrolytes to study the influence of charge interactions on mass...... transfer of ionic species in saturated porous media. The experiments were carried out under advection-dominated conditions (seepage velocity: 1 and 1.5 m/day) in two well-defined heterogeneous domains where flow diverging around a low-permeability inclusion and flow focusing in high-permeability zones...

  7. Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

    DEFF Research Database (Denmark)

    Christensen, Tue; Andersen, Kim Allan; Klose, Andreas

    2013-01-01

    This paper considers a minimum-cost network flow problem in a bipartite graph with a single sink. The transportation costs exhibit a staircase cost structure because such types of transportation cost functions are often found in practice. We present a dynamic programming algorithm for solving...... this so-called single-sink, fixed-charge, multiple-choice transportation problem exactly. The method exploits heuristics and lower bounds to peg binary variables, improve bounds on flow variables, and reduce the state-space variable. In this way, the dynamic programming method is able to solve large...... instances with up to 10,000 nodes and 10 different transportation modes in a few seconds, much less time than required by a widely used mixed-integer programming solver and other methods proposed in the literature for this problem....

  8. Charge transport mechanisms of graphene/semiconductor Schottky barriers: A theoretical and experimental study

    International Nuclear Information System (INIS)

    Zhong, Haijian; Liu, Zhenghui; Xu, Gengzhao; Shi, Lin; Fan, Yingmin; Yang, Hui; Xu, Ke; Wang, Jianfeng; Ren, Guoqiang

    2014-01-01

    Graphene has been proposed as a material for semiconductor electronic and optoelectronic devices. Understanding the charge transport mechanisms of graphene/semiconductor Schottky barriers will be crucial for future applications. Here, we report a theoretical model to describe the transport mechanisms at the interface of graphene and semiconductors based on conventional semiconductor Schottky theory and a floating Fermi level of graphene. The contact barrier heights can be estimated through this model and be close to the values obtained from the experiments, which are lower than those of the metal/semiconductor contacts. A detailed analysis reveals that the barrier heights are as the function of the interface separations and dielectric constants, and are influenced by the interfacial states of semiconductors. Our calculations show how this behavior of lowering barrier heights arises from the Fermi level shift of graphene induced by the charge transfer owing to the unique linear electronic structure

  9. Charge transport mechanisms of graphene/semiconductor Schottky barriers: A theoretical and experimental study

    Energy Technology Data Exchange (ETDEWEB)

    Zhong, Haijian; Liu, Zhenghui; Xu, Gengzhao; Shi, Lin; Fan, Yingmin; Yang, Hui [Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Xu, Ke, E-mail: kxu2006@sinano.ac.cn; Wang, Jianfeng; Ren, Guoqiang [Suzhou Institute of Nano-Tech and Nano-Bionics, CAS, Suzhou 215123 (China); Suzhou Nanowin Science and Technology Co., Ltd., Suzhou 215123 (China)

    2014-01-07

    Graphene has been proposed as a material for semiconductor electronic and optoelectronic devices. Understanding the charge transport mechanisms of graphene/semiconductor Schottky barriers will be crucial for future applications. Here, we report a theoretical model to describe the transport mechanisms at the interface of graphene and semiconductors based on conventional semiconductor Schottky theory and a floating Fermi level of graphene. The contact barrier heights can be estimated through this model and be close to the values obtained from the experiments, which are lower than those of the metal/semiconductor contacts. A detailed analysis reveals that the barrier heights are as the function of the interface separations and dielectric constants, and are influenced by the interfacial states of semiconductors. Our calculations show how this behavior of lowering barrier heights arises from the Fermi level shift of graphene induced by the charge transfer owing to the unique linear electronic structure.

  10. Structure and Morphology Control in Thin Films of Conjugated Polymers for an Improved Charge Transport

    Directory of Open Access Journals (Sweden)

    Haiyang Wang

    2013-11-01

    Full Text Available The morphological and structural features of the conjugated polymer films play an important role in the charge transport and the final performance of organic optoelectronics devices [such as organic thin-film transistor (OTFT and organic photovoltaic cell (OPV, etc.] in terms of crystallinity, packing of polymer chains and connection between crystal domains. This review will discuss how the conjugated polymer solidify into, for instance, thin-film structures, and how to control the molecular arrangement of such functional polymer architectures by controlling the polymer chain rigidity, polymer solution aggregation, suitable processing procedures, etc. These basic elements in intrinsic properties and processing strategy described here would be helpful to understand the correlation between morphology and charge transport properties and guide the preparation of efficient functional conjugated polymer films correspondingly.

  11. Grain boundary-induced variability of charge transport in hydrogenated polycrystalline graphene

    DEFF Research Database (Denmark)

    Barrios-Vargas, Jose E.; Falkenberg, Jesper Toft; Soriano, David

    2017-01-01

    Chemical functionalization has proven to be a promising means of tailoring the unique properties of graphene. For example, hydrogenation can yield a variety of interesting effects, including a metal-insulator transition or the formation of localized magnetic moments. Meanwhile, graphene grown...... by chemical vapor deposition is the most suitable for large-scale production, but the resulting material tends to be polycrystalline. Up to now there has been relatively little focus on how chemical functionalization, and hydrogenation in particular, impacts the properties of polycrystalline graphene....... In this work, we use numerical simulations to study the electrical properties of hydrogenated polycrystalline graphene. We find a strong correlation between the spatial distribution of the hydrogen adsorbates and the charge transport properties. Charge transport is weakly sensitive to hydrogenation when...

  12. PATH: a lumped-element beam-transport simulation program with space charge

    International Nuclear Information System (INIS)

    Farrell, J.A.

    1983-01-01

    PATH is a group of computer programs for simulating charged-particle beam-transport systems. It was developed for evaluating the effects of some aberrations without a time-consuming integration of trajectories through the system. The beam-transport portion of PATH is derived from the well-known program, DECAY TURTLE. PATH contains all features available in DECAY TURTLE (including the input format) plus additional features such as a more flexible random-ray generator, longitudinal phase space, some additional beamline elements, and space-charge routines. One of the programs also provides a simulation of an Alvarez linear accelerator. The programs, originally written for a CDC 7600 computer system, also are available on a VAX-VMS system. All of the programs are interactive with input prompting for ease of use

  13. Charge carrier transport in defective reduced graphene oxide as quantum dots and nanoplatelets in multilayer films

    Science.gov (United States)

    Jimenez, Mawin J. M.; Oliveira, Rafael F.; Almeida, Tiago P.; Hensel Ferreira, Rafael C.; Bufon, Carlos Cesar B.; Rodrigues, Varlei; Pereira-da-Silva, Marcelo A.; Gobbi, Ângelo L.; Piazzetta, Maria H. O.; Riul, Antonio, Jr.

    2017-12-01

    Graphene is a breakthrough 2D material due to its unique mechanical, electrical, and thermal properties, with considerable responsiveness in real applications. However, the coverage of large areas with pristine graphene is a challenge and graphene derivatives have been alternatively exploited to produce hybrid and composite materials that allow for new developments, considering also the handling of large areas using distinct methodologies. For electronic applications there is significant interest in the investigation of the electrical properties of graphene derivatives and related composites to determine whether the characteristic 2D charge transport of pristine graphene is preserved. Here, we report a systematic study of the charge transport mechanisms of reduced graphene oxide chemically functionalized with sodium polystyrene sulfonate (PSS), named as GPSS. GPSS was produced either as quantum dots (QDs) or nanoplatelets (NPLs), being further nanostructured with poly(diallyldimethylammonium chloride) through the layer-by-layer (LbL) assembly to produce graphene nanocomposites with molecular level control. Current-voltage (I-V) measurements indicated a meticulous growth of the LbL nanostructures onto gold interdigitated electrodes (IDEs), with a space-charge-limited current dominated by a Mott-variable range hopping mechanism. A 2D intra-planar conduction within the GPSS nanostructure was observed, which resulted in effective charge carrier mobility (μ) of 4.7 cm2 V-1 s-1 for the QDs and 34.7 cm2 V-1 s-1 for the NPLs. The LbL assemblies together with the dimension of the materials (QDs or NPLs) were favorably used for the fine tuning and control of the charge carrier mobility inside the LbL nanostructures. Such 2D charge conduction mechanism and high μ values inside an interlocked multilayered assembly containing graphene-based nanocomposites are of great interest for organic devices and functionalization of interfaces.

  14. Charge transport across a single-Cooper-pair transistor coupled to a resonant transmission line

    Energy Technology Data Exchange (ETDEWEB)

    Leppaekangas, Juha [Institut fuer Theoretische Festkoerperphysik, Karlsruhe Institute of Technology, D-76128 Karlsruhe (Germany); Department of Physical Sciences, University of Oulu, FI-90014 Oulu (Finland); Pashkin, Yuri [NEC Nano Electronics Research Laboratories, RIKEN Advanced Science Institute, Tsukuba, Ibaraki 305-8501 (Japan); Thuneberg, Erkki [Department of Physical Sciences, University of Oulu, FI-90014 Oulu (Finland)

    2010-07-01

    We have investigated charge transport in ultrasmall superconducting single and double Josephson junctions coupled to a transmission-line resonator. The microstrip resonator is naturally formed by the on-chip leads and the sample holder. We observe equidistant peaks in the transport characteristics of both types of devices and attribute them to the process involving simultaneous tunneling of Cooper pairs and photon emission into the resonator. The experimental data is well reproduced with the orthodox model of Cooper pair tunneling that accounts for the microwave photon emission into the resonator.

  15. Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite

    Science.gov (United States)

    Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya

    2017-12-01

    Charge transport in the temperature range 80 K polyaniline (PANi). PANi was synthesized via the oxidative polymerization of aniline with ammonium peroxydisulfate (APS) in acidic media. The CS/PANi composite was prepared by coating the spheres with a thin polyaniline (PANi) film doped with hydrochloric acid (HCl) in situ during the polymerization process. Temperature dependent conductivity measurements show that three dimensional variable range hopping of electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.

  16. Spiro-OMeTAD single crystals: Remarkably enhanced charge-carrier transport via mesoscale ordering

    KAUST Repository

    Shi, Dong

    2016-04-15

    We report the crystal structure and hole-transport mechanism in spiro-OMeTAD [2,2′,7,7′-tetrakis(N,N-di-p-methoxyphenyl-amine)9,9′-spirobifluorene], the dominant hole-transporting material in perovskite and solid-state dye-sensitized solar cells. Despite spiro-OMeTAD’s paramount role in such devices, its crystal structure was unknown because of highly disordered solution-processed films; the hole-transport pathways remained ill-defined and the charge carrier mobilities were low, posing a major bottleneck for advancing cell efficiencies. We devised an antisolvent crystallization strategy to grow single crystals of spiro-OMeTAD, which allowed us to experimentally elucidate its molecular packing and transport properties. Electronic structure calculations enabled us to map spiro-OMeTAD’s intermolecular charge-hopping pathways. Promisingly, single-crystal mobilities were found to exceed their thin-film counterparts by three orders of magnitude. Our findings underscore mesoscale ordering as a key strategy to achieving breakthroughs in hole-transport material engineering of solar cells.

  17. Charge transport in non-polar and semi-polar III-V nitride heterostructures

    International Nuclear Information System (INIS)

    Konar, Aniruddha; Verma, Amit; Fang, Tian; Zhao, Pei; Jana, Raj; Jena, Debdeep

    2012-01-01

    Compared to the intense research focus on the optical properties, the transport properties in non-polar and semi-polar III-nitride semiconductors remain relatively unexplored to date. The purpose of this paper is to discuss charge-transport properties in non-polar and semi-polar orientations of GaN in a comparative fashion to what is known for transport in polar orientations. A comprehensive approach is adopted, starting from an investigation of the differences in the electronic bandstructure along different polar orientations of GaN. The polarization fields along various orientations are then discussed, followed by the low-field electron and hole mobilities. A number of scattering mechanisms that are specific to non-polar and semi-polar GaN heterostructures are identified, and their effects are evaluated. Many of these scattering mechanisms originate due to the coupling of polarization with disorder and defects in various incarnations depending on the crystal orientation. The effect of polarization orientation on carrier injection into quantum-well light-emitting diodes is discussed. This paper ends with a discussion of orientation-dependent high-field charge-transport properties including velocity saturation, instabilities and tunneling transport. Possible open problems and opportunities are also discussed. (paper)

  18. Analysis of some greedy algorithms for the single-sink fixed-charge transportation problem

    DEFF Research Database (Denmark)

    Görtz, Simon; Klose, Andreas

    2009-01-01

    -charge transportation problem. Nevertheless, just a few methods for solving this problem have been proposed in the literature. In this paper, some greedy heuristic solutions methods for the SSFCTP are investigated. It is shown that two greedy approaches for the SSFCTP known from the literature can be arbitrarily bad......, whereas an approximation algorithm proposed in the literature for the binary min-knapsack problem has a guaranteed worst case bound if adapted accordingly to the case of the SSFCTP....

  19. Finite Element in Angle Unit Sphere Meshing for Charged Particle Transport.

    Energy Technology Data Exchange (ETDEWEB)

    Ortega, Mario Ivan [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Drumm, Clifton R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    Finite element in angle formulations of the charged particle transport equation require the discretization of the unit sphere. In Sceptre, a three-dimensional surface mesh of a sphere is transformed into a two-dimensional mesh. Projection of a sphere onto a two-dimensional surface is well studied with map makers spending the last few centuries attempting to create maps that preserve proportion and area. Using these techniques, various meshing schemes for the unit sphere were investigated.

  20. Charge transport in organic materials: From molecular wire to 3D systems

    Czech Academy of Sciences Publication Activity Database

    Nešpůrek, Stanislav; Toman, Petr; Menšík, Miroslav; Kratochvílová, Irena; Sworakowski, J.; Mallouk, T. E.

    2007-01-01

    Roč. 9, č.1 (2007), s. 134-140 ISSN 1454-4164 R&D Projects: GA AV ČR KAN401770651; GA AV ČR IAA401770601 Grant - others:Polish Ministry of Science(PL) 3T08E 08430 Institutional research plan: CEZ:AV0Z40500505; CEZ:AV0Z10100520 Keywords : charge transport * molecular wire * polaron Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.827, year: 2007

  1. Charge transport mechanism in p-type copper ion containing triazine thiolate metallopolymer thin film devices

    Science.gov (United States)

    K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.

    2017-10-01

    The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.

  2. Swelling kinetics and electrical charge transport in PEDOT:PSS thin films exposed to water vapor.

    Science.gov (United States)

    Sarkar, Biporjoy; Jaiswal, Manu; Satapathy, Dillip K Kumar

    2018-04-16

    We report the swelling kinetics and evolution of the electrical charge transport in poly(3,4-ethylene dioxythiophene) polystyrene sulfonate (PEDOT:PSS) thin films subjected to water vapor. Polymer films swell by the diffusion of water vapor and are found to undergo structural relaxations. Upon exposure to water vapor, primarily the hygroscopic PSS shell, which surrounds the conducting PEDOT-rich cores, takes up water vapor and subsequently swells. We found that the degree of swelling largely depends on the PEDOT to PSS ratio. Swelling driven microscopic rearrangement of the conducting PEDOT-rich cores in the PSS matrix strongly influences the electrical charge transport of the polymer film. Swelling induced increase as well as decrease of electrical resistance are observed in polymer films having different PEDOT to PSS ratio. This anomalous charge transport behavior in PEDOT:PSS films is reconciled by taking into account the contrasting swelling behavior of the PSS and the conducting PEDOT-rich cores leading to spatial segregation of PSS in films with PSS as a minority phase and by a net increase in mean separation between conducting PEDOT-rich cores for films having abundance of PSS. © 2018 IOP Publishing Ltd.

  3. Charge transport and mobility engineering in two-dimensional transition metal chalcogenide semiconductors.

    Science.gov (United States)

    Li, Song-Lin; Tsukagoshi, Kazuhito; Orgiu, Emanuele; Samorì, Paolo

    2016-01-07

    Two-dimensional (2D) van der Waals semiconductors represent the thinnest, air stable semiconducting materials known. Their unique optical, electronic and mechanical properties hold great potential for harnessing them as key components in novel applications for electronics and optoelectronics. However, the charge transport behavior in 2D semiconductors is more susceptible to external surroundings (e.g. gaseous adsorbates from air and trapped charges in substrates) and their electronic performance is generally lower than corresponding bulk materials due to the fact that the surface and bulk coincide. In this article, we review recent progress on the charge transport properties and carrier mobility engineering of 2D transition metal chalcogenides, with a particular focus on the markedly high dependence of carrier mobility on thickness. We unveil the origin of this unique thickness dependence and elaborate the devised strategies to master it for carrier mobility optimization. Specifically, physical and chemical methods towards the optimization of the major factors influencing the extrinsic transport such as electrode/semiconductor contacts, interfacial Coulomb impurities and atomic defects are discussed. In particular, the use of ad hoc molecules makes it possible to engineer the interface with the dielectric and heal the vacancies in such materials. By casting fresh light on the theoretical and experimental studies, we provide a guide for improving the electronic performance of 2D semiconductors, with the ultimate goal of achieving technologically viable atomically thin (opto)electronics.

  4. Design study of low-energy beam transport for multi-charge beams at RAON

    Science.gov (United States)

    Bahng, Jungbae; Qiang, Ji; Kim, Eun-San

    2015-12-01

    The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.

  5. TRANSPORT: a computer program for designing charged particle beam transport systems

    International Nuclear Information System (INIS)

    Brown, K.L.; Rothacker, F.; Carey, D.C.; Iselin, C.

    1977-05-01

    TRANSPORT is a first- and second-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems. It has been in existence in various evolutionary versions since 1963. The present version, described in the manual given, includes both first- and second-order fitting capabilities. TRANSPORT will step through the beam line, element by element, calculating the properties of the beam or other quantities, described below, where requested. Therefore one of the first elements is a specification of the phase space region occupied by the beam entering the system. Magnets and intervening spaces and other elements then follow in the sequence in which they occur in the beam line. Specifications of calculations to be done or of configurations other than normal are placed in the same sequence, at the point where their effect is to be made

  6. Opto-electro-modulated transient photovoltage and photocurrent system for investigation of charge transport and recombination in solar cells.

    Science.gov (United States)

    Shi, Jiangjian; Li, Dongmei; Luo, Yanhong; Wu, Huijue; Meng, Qingbo

    2016-12-01

    An opto-electro-modulated transient photovoltage/photocurrent system has been developed to probe microscopic charge processes of a solar cell in its adjustable operating conditions. The reliability of this system is carefully determined by electric circuit simulations and experimental measurements. Using this system, the charge transport, recombination and storage properties of a conventional multicrystalline silicon solar cell under different steady-state bias voltages, and light illumination intensities are investigated. This system has also been applied to study the influence of the hole transport material layer on charge extraction and the microscopic charge processes behind the widely considered photoelectric hysteresis in perovskite solar cells.

  7. Design of the low energy beam transport line between CARIBU and the EBIS charge breeder

    Energy Technology Data Exchange (ETDEWEB)

    Perry, A., E-mail: aperry4@hawk.iit.edu [Argonne National Laboratory, Argonne, IL 60439, USA and Illinois Institute of Technology, Chicago, IL 60616 (United States); Ostroumov, P. N.; Barcikowski, A.; Dickerson, C.; Kondrashev, S. A.; Mustapha, B.; Savard, G. [Argonne National Laboratory, Argonne, IL 60439 (United States)

    2015-01-09

    An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed to breed radioactive beams from the CAlifornium Rare Isotope Breeder Upgrade (CARIBU) facility at ATLAS. The EBIS-CB will replace the existing ECR charge breeder to increase the intensity and improve the purity of reaccelerated radioactive ion beams. The EBIS-CB is in the final stage of off-line commissioning. Currently, we are developing a low energy beam transport (LEBT) system to transfer CARIBU beams to the EBIS-CB. As was originally planned, an RFQ cooler-buncher will precede the EBIS-CB. Recently, it was decided to include a multi-reflection time-of-flight (MR-TOF) mass-spectrometer following the RFQ. MR-TOF is a relatively new technology used to purify beams with a mass-resolving power up to 3×10{sup 5} as was demonstrated in experiments at CERN/ISOLDE. Very high purity singly-charged radioactive ion beams will be injected into the EBIS for charge breeding and due to its inherent properties, the EBIS-CB will maintain the purity of the charge bred beams. Possible contamination of residual gas ions will be greatly suppressed by achieving ultra-high vacuum in the EBIS trap. This paper will present and discuss the design of the LEBT and the overall integration of the EBIS-CB into ATLAS.

  8. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  9. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    Energy Technology Data Exchange (ETDEWEB)

    Palmero, F [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Archilla, J F R [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Hennig, D [Freie Universitaet Berlin, Fachbereich Physik, Arnimallee 14, 14195-Berlin (Germany); Romero, F R [Facultad de FIsica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain)

    2004-02-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder.

  10. Role of collector alternating charged patches on transport of Cryptosporidium parvum oocyst in a patchwise charged heterogeneous micromodel

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yuanyuan; Zhang, Changyong; Hu, Dehong; Kuhlenschmidt, Mark S.; Kuhlenschmidt, Theresa B.; Mylon, Steven E.; Kong, Rong; Bhargava, Rohit; Nguyen, Thanh H.

    2013-02-04

    The role of collector surface charge heterogeneity on transport of Cryptosporidium parvum oocyst and carboxylate microsphere in 2-dimensional micromodels was studied. The cylindrical silica collectors within the micromodels were coated with 0, 10, 20, 50 and 100% Fe2O3 patches. The experimental values of average single collector removal efficiencies (η) of the Fe2O3 patches and on the entire collectors were determined. In the presence of significant (>3500 kT) Derjaguin–Landau–Verwey–Overbeek (DLVO) energy barrier between the microspheres and the silica collectors at pH 5.8 and 8.1, the values of η determined for Fe2O3 patches were significantly less (p < 0.05, t-test) than that obtained for collectors coated entirely with Fe2O3. However, η on Fe2O3 patches for microspheres at pH 4.4 and for oocysts at pH 5.8 and 8.1, where the DLVO energy barrier was relatively small (ca. 200-360 kT), were significantly greater (p < 0.05, t-test) than that on the collectors coated entirely with Fe2O3. The dependence of η determined for Fe2O3 patches on the DLVO energy barrier indicated the importance of periodic favorable and unfavorable electrostatic interactions between colloids and collectors with alternating Fe2O3 and silica patches. Differences between experimentally determined η and that predicted by a patchwise geochemical heterogeneous model was observed, but can be explained by the model’s lack of consideration for the spatial distribution of charge heterogeneity on the collector surface and colloid migration on patchwise heterogeneous collectors.

  11. Initial Energy Logistics Cost Analysis for Stationary, Quasi-Dynamic, and Dynamic Wireless Charging Public Transportation Systems

    Directory of Open Access Journals (Sweden)

    Young Jae Jang

    2016-06-01

    Full Text Available This paper presents an initial investment cost analysis of public transportation systems operating with wireless charging electric vehicles (EVs. There are three different types of wireless charging systems, namely, stationary wireless charging (SWC, in which charging happens only when the vehicle is parked or idle, quasi-dynamic wireless charging (QWC, in which power is transferred when a vehicle is moving slowly or in stop-and-go mode, and dynamic wireless charging (DWC, in which power can be supplied even when the vehicle is in motion. This analysis compares the initial investment costs for these three types of charging systems for a wireless charging-based public transportation system. In particular, this analysis is focused on the energy logistics cost in transportation, which is defined as the cost of transferring and storing the energy needed to operate the transportation system. Performing this initial investment analysis is complicated, because it involves considerable tradeoffs between the costs of batteries in the EV fleet and different kinds of battery-charging infrastructure. Mathematical optimization models for each type of EV and infrastructure system are used to analyze the initial costs. The optimization methods evaluate the minimum initial investment needed to deploy the public transportation system for each type of EV charging solution. To deal with the variable cost estimates for batteries and infrastructure equipment in the current market, a cost-sensitivity analysis is performed. The goal of this analysis is to identify the market cost conditions that are most favorable for each type of wireless charging solution. Furthermore, the cost analysis quantitatively verifies the qualitative comparison of the three different wireless charging types conducted in the previous research.

  12. A smoothed particle hydrodynamics model for electrostatic transport of charged lunar dust on the moon surface

    Science.gov (United States)

    Mao, Zirui; Liu, G. R.

    2018-02-01

    The behavior of lunar dust on the Moon surface is quite complicated compared to that on the Earth surface due to the small lunar gravity and the significant influence of the complicated electrostatic filed in the Universe. Understanding such behavior is critical for the exploration of the Moon. This work develops a smoothed particle hydrodynamics (SPH) model with the elastic-perfectly plastic constitutive equation and Drucker-Prager yield criterion to simulate the electrostatic transporting of multiple charged lunar dust particles. The initial electric field is generated based on the particle-in-cell method and then is superposed with the additional electric field from the charged dust particles to obtain the resultant electric field in the following process. Simulations of cohesive soil's natural failure and electrostatic transport of charged soil under the given electric force and gravity were carried out using the SPH model. Results obtained in this paper show that the negatively charged dust particles levitate and transport to the shadow area with a higher potential from the light area with a lower potential. The motion of soil particles finally comes to a stable state. The numerical result for final distribution of soil particles and potential profile above planar surface by the SPH method matches well with the experimental result, and the SPH solution looks sound in the maximum levitation height prediction of lunar dust under an uniform electric field compared to theoretical solution, which prove that SPH is a reliable method in describing the behavior of soil particles under a complicated electric field and small gravity field with the consideration of interactions among soil particles.

  13. The Role of Local Self-government Units in the System of the Organization and Financing Local Public Transport

    Directory of Open Access Journals (Sweden)

    Krzysztof Czarnecki

    2013-10-01

    Full Text Available The article describes the system of organization and financing of the local public transport in Poland. Providing local public transport is one of the tasks of local self-government units (called gmina. According to The Act on Public Transport of 2010 that task may be performed using different legal forms, e.g. budgetary entities or commercial companies established by local self-governments.

  14. BEAMR: An interactive graphic computer program for design of charged particle beam transport systems

    Science.gov (United States)

    Leonard, R. F.; Giamati, C. C.

    1973-01-01

    A computer program for a PDP-15 is presented which calculates, to first order, the characteristics of charged-particle beam as it is transported through a sequence of focusing and bending magnets. The maximum dimensions of the beam envelope normal to the transport system axis are continuously plotted on an oscilloscope as a function of distance along the axis. Provision is made to iterate the calculation by changing the types of magnets, their positions, and their field strengths. The program is especially useful for transport system design studies because of the ease and rapidity of altering parameters from panel switches. A typical calculation for a system with eight elements is completed in less than 10 seconds. An IBM 7094 version containing more-detailed printed output but no oscilloscope display is also presented.

  15. Charge-transport anisotropy in black phosphorus: critical dependence on the number of layers.

    Science.gov (United States)

    Banerjee, Swastika; Pati, Swapan K

    2016-06-28

    Phosphorene is a promising candidate for modern electronics because of the anisotropy associated with high electron-hole mobility. Additionally, superior mechanical flexibility allows the strain-engineering of various properties including the transport of charge carriers in phosphorene. In this work, we have shown the criticality of the number of layers to dictate the transport properties of black phosphorus. Trilayer black phosphorus (TBP) has been proposed as an excellent anisotropic material, based on the transport parameters using Boltzmann transport formalisms coupled with density functional theory. The mobilities of both the electron and the hole are found to be higher along the zigzag direction (∼10(4) cm(2) V(-1) s(-1) at 300 K) compared to the armchair direction (∼10(2) cm(2) V(-1) s(-1)), resulting in the intrinsic directional anisotropy. Application of strain leads to additional electron-hole anisotropy with 10(3) fold higher mobility for the electron compared to the hole. Critical strain for maximum anisotropic response has also been determined. Whether the transport anisotropy is due to the spatial or charge-carrier has been determined through analyses of the scattering process of electrons and holes, and their recombination as well as relaxation dynamics. In this context, we have derived two descriptors (S and F(k)), which are general enough for any 2D or quasi-2D systems. Information on the scattering involving purely the carrier states also helps to understand the layer-dependent photoluminescence and electron (hole) relaxation in black phosphorus. Finally, we justify trilayer black phosphorus (TBP) as the material of interest with excellent transport properties.

  16. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  17. Charge and Spin Transport in Spin-orbit Coupled and Topological Systems

    KAUST Repository

    Ndiaye, Papa Birame

    2017-10-31

    In the search for low power operation of microelectronic devices, spin-based solutions have attracted undeniable increasing interest due to their intrinsic magnetic nonvolatility. The ability to electrically manipulate the magnetic order using spin-orbit interaction, associated with the recent emergence of topological spintronics with its promise of highly efficient charge-to-spin conversion in solid state, offer alluring opportunities in terms of system design. Although the related technology is still at its infancy, this thesis intends to contribute to this engaging field by investigating the nature of the charge and spin transport in spin-orbit coupled and topological systems using quantum transport methods. We identified three promising building blocks for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic state). Chapter 2 reviews the basics and essential concepts used throughout the thesis: the spin-orbit coupling, the mathematical notion of topology and its importance in condensed matter physics, then topological magnetism and a zest of magnonics. In Chapter 3, we study the spin-orbit torques at the magnetized interfaces of 3D topological insulators. We demonstrated that their peculiar form, compared to other spin-orbit torques, have important repercussions in terms of magnetization reversal, charge pumping and anisotropic damping. In Chapter 4, we showed that the interplay between magnon current jm and magnetization m in homogeneous ferromagnets with Dzyaloshinskii-Moriya (DM) interaction, produces a field-like torque as well as a damping-like torque. These DM torques mediated by spin wave can tilt the imeaveraged magnetization direction and are similar to Rashba torques for electronic systems. Moreover, the DM torque is more efficient when magnons are

  18. Models of charge transport and transfer in molecular switch tunnel junctions of bistable catenanes and rotaxanes

    International Nuclear Information System (INIS)

    Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser

    2006-01-01

    The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules

  19. Charge transport kinetics in a robust radical-substituted polymer/nanocarbon composite electrode

    Science.gov (United States)

    Sato, Kan; Oyaizu, Kenichi; Nishide, Hiroyuki

    We have reported a series of organic radical-substituted polymers as new-type charge storage and transport materials which could be used for energy related devices such as batteries and solar cells. Redox-active radical moieties introduced to the non-conjugated polymer backbones enable the rapid electron transfer among the adjacent radical sites, and thus large diffusive flux of electrical charge at a bulk scale. Here we present the elucidated charge transport kinetics in a radical polymer/single-walled carbon nanotube (SWNT) composite electrode. The synergetic effect of electrical conduction by a three-dimensional SWNT network and electron self-exchange reaction by radical polymers contributed to the 105-fold (per 1 g of added SWNT) boosting of electrochemical reactions and exceptionally large current density (greater than 1 A/cm2) as a rechargeable electrode. A totally organic-based secondary battery with a submicron thickness was fabricated to demonstrate the splendid electrochemical performances. Grants-in-Aid for Scientific Research (No. 24225003, 15J00888) and the Leading Graduate Program in Science and Engineering, from the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT).

  20. Charge transport properties of metal/metal-phthalocyanine/n-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Afzal

    2010-12-16

    In present work the charge transport properties of metal/metal-phthalocyanine/n-Si structures with low (N{sub D} = 4 x 10{sup 14} cm{sup -3}), medium (N{sub D}=1 x 10{sup 16} cm{sup -3}) and high (N{sub D}=2 x 10{sup 19} cm{sup -3}) doped n-Si as injecting electrode and the effect of air exposure of the vacuum evaporated metal-phthalocyanine film in these structures is investigated. The results obtained through temperature dependent electrical characterizations of the structures suggest that in terms of dominant conduction mechanism in the corresponding devices Schottky-type conduction mechanism dominates the charge transport in low-bias region of these devices up to 0.8 V, 0.302 V and 0.15 V in case of low, medium and high doped n-Silicon devices. For higher voltages, in each case of devices, the space-charge-limited conduction, controlled by exponential trap distribution, is found to dominate the charge transport properties of the devices. The interface density of states at the CuPc/n-Si interface of the devices are found to be lower in case of lower work function difference at the CuPc/n-Si interface of the devices. The results also suggest that the work function difference at the CuPc/n-Si interface of these devices causes charge transfer at the interface and these phenomena results in formation of interface dipole. The width of the Schottky depletion region at the CuPc/n-Si interface of these devices is found to be higher with higher work function difference at the interface. The investigation of charge transport properties of Al/ZnPc/medium n-Si and Au/ZnPc/ medium n-Si devices suggest that the Schottky depletion region formed at the ZnPc/n-Si interface of these devices determines the charge transport in the low-bias region of both the devices. Therefore, the Schottky-type (injection limited) and the space-charge-limited (bulk limited) conduction are observed in the low and the high bias regions of these devices, respectively. The determined width of the

  1. Simulation of charge transport in organic semiconductors: A time-dependent multiscale method based on nonequilibrium Green's functions

    Science.gov (United States)

    Leitherer, S.; Jäger, C. M.; Krause, A.; Halik, M.; Clark, T.; Thoss, M.

    2017-11-01

    In weakly interacting organic semiconductors, static disorder and dynamic disorder often have an important impact on transport properties. Describing charge transport in these systems requires an approach that correctly takes structural and electronic fluctuations into account. Here, we present a multiscale method based on a combination of molecular-dynamics simulations, electronic-structure calculations, and a transport theory that uses time-dependent nonequilibrium Green's functions. We apply the methodology to investigate charge transport in C60-containing self-assembled monolayers, which are used in organic field-effect transistors.

  2. Simulation of charge transport in organic semiconductors: A time-dependent multiscale method based on nonequilibrium Green's functions

    DEFF Research Database (Denmark)

    Leitherer, Susanne; Jager, C. M.; Krause, A.

    2017-01-01

    In weakly interacting organic semiconductors, static disorder and dynamic disorder often have an important impact on transport properties. Describing charge transport in these systems requires an approach that correctly takes structural and electronic fluctuations into account. Here, we present...... a multiscale method based on a combination of molecular-dynamics simulations, electronic-structure calculations, and a transport theory that uses time-dependent nonequilibrium Green's functions. We apply the methodology to investigate charge transport in C-60-containing self-assembled monolayers, which...

  3. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.

    2016-07-15

    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  4. Large-scale charge transport and collective streamer dynamics within a developing sprite

    Science.gov (United States)

    Luque, A.; Ebert, U.; Gordillo-Vázquez, F.

    2013-12-01

    Sprite discharges, ocurring above active electrical thunderstorms, often appear as huge trees containing hundreds of propagating streamer filaments. Some features in these "carrot sprites", such as the reconnection of neighbouring streamers and the emergence of upward-propagating tendrils, reveal the complex collective dynamics of the propagating branches and the large-scale charge transport within the developing sprite. We here present a model of growing streamer trees that takes into account the finite channel conductivity and treats the electric field self-consistently [1]. Our simulations show the structure of an overall ``streamer of streamers'' that we name collective streamer front. We discuss the charge distribution inside the discharge tree, which provides a natural explanation for the observed reconnections of streamers in sprites and for the emergence from existing channels of upward-propagating, negative streamers. [1] arXiv:1307.2378 [physics.plasm-ph

  5. Quadrupole beam-transport experiment for heavy ions under extreme space charge conditions

    International Nuclear Information System (INIS)

    Chupp, W.; Faltens, A.; Hartwig, E.C.

    1983-03-01

    A Cs ion-beam-transport experiment is in progress to study beam behavior under extreme space-charge conditions. A five-lens section matches the beam into a periodic electrostatic quadrupole FODO channel and its behavior is found to agree with predictions. With the available parameters (less than or equal to 200 keV, less than or equal to 20 mA, πepsilon/sub n/ greater than or equal to 10 - 7 π rad-m, up to 41 periods) the transverse (betatron) occillation frequency (nu) can be depressed down to one-tenth of its zero current value (nu/sub 0/), where nu/sup 2/ = nu/sub 0//sup 2/ -#betta#/sub p/ 2 /2, and #betta#/sub p/ is the beam plasma frequency. The current can be controlled by adjustment of the gun and the emittance can be controlled independently by means of a set of charged grids

  6. Microscopic Charge Transport and Recombination Processes behind the Photoelectric Hysteresis in Perovskite Solar Cells.

    Science.gov (United States)

    Shi, Jiangjian; Zhang, Huiyin; Xu, Xin; Li, Dongmei; Luo, Yanhong; Meng, Qingbo

    2016-10-01

    The microscopic charge transport and recombination processes behind the widely concerned photoelectric hysteresis in the perovskite solar cell have been investigated with both in situ transient photovoltage/photocurrent measurements and the semiconductor device simulation. Time-dependent behaviors of intensity and direction of the photocurrent and photovoltage are observed under the steady-state bias voltages and open-circuit conditions. These charge processes reveal the electric properties of the cell, demonstrating evolutions of both strength and direction of the internal electric field during the hysteresis. Further calculation indicates that this behavior is mainly attributed to both the interfacial doping and defect effects induced by the ion accumulation, which may be the origins for the general hysteresis in this cell. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Momentum and charge transport in non-relativistic holographic fluids from Hořava gravity

    Energy Technology Data Exchange (ETDEWEB)

    Davison, Richard A. [Department of Physics, Harvard University, Cambridge, MA 02138 (United States); Grozdanov, Sašo [Instituut-Lorentz for Theoretical Physics, Leiden University, Niels Bohrweg 2, Leiden 2333 CA (Netherlands); Janiszewski, Stefan [Department of Physics and Astronomy, University of Victoria, Victoria, BC, V8W 3P6 (Canada); Kaminski, Matthias [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL 35487 (United States)

    2016-11-28

    We study the linearized transport of transverse momentum and charge in a conjectured field theory dual to a black brane solution of Hořava gravity with Lifshitz exponent z=1. As expected from general hydrodynamic reasoning, we find that both of these quantities are diffusive over distance and time scales larger than the inverse temperature. We compute the diffusion constants and conductivities of transverse momentum and charge, as well the ratio of shear viscosity to entropy density, and find that they differ from their relativistic counterparts. To derive these results, we propose how the holographic dictionary should be modified to deal with the multiple horizons and differing propagation speeds of bulk excitations in Hořava gravity. When possible, as a check on our methods and results, we use the covariant Einstein-Aether formulation of Hořava gravity, along with field redefinitions, to re-derive our results from a relativistic bulk theory.

  8. Intragrain charge transport in kesterite thin films—Limits arising from carrier localization

    Science.gov (United States)

    Hempel, Hannes; Redinger, Alex; Repins, Ingrid; Moisan, Camille; Larramona, Gerardo; Dennler, Gilles; Handwerg, Martin; Fischer, Saskia F.; Eichberger, Rainer; Unold, Thomas

    2016-11-01

    Intragrain charge carrier mobilities measured by time-resolved terahertz spectroscopy in state of the art Cu2ZnSn(S,Se)4 kesterite thin films are found to increase from 32 to 140 cm2 V-1 s-1 with increasing Se content. The mobilities are limited by carrier localization on the nanometer-scale, which takes place within the first 2 ps after carrier excitation. The localization strength obtained from the Drude-Smith model is found to be independent of the excited photocarrier density. This is in accordance with bandgap fluctuations as a cause of the localized transport. Charge carrier localization is a general issue in the probed kesterite thin films, which were deposited by coevaporation, colloidal inks, and sputtering followed by annealing with varying Se/S contents and yield 4.9%-10.0% efficiency in the completed device.

  9. Charge transport in films of Geobacter sulfurreducens on graphite electrodes as a function of film thickness

    KAUST Repository

    Jana, Partha Sarathi

    2014-01-01

    Harnessing, and understanding the mechanisms of growth and activity of, biofilms of electroactive bacteria (EAB) on solid electrodes is of increasing interest, for application to microbial fuel and electrolysis cells. Microbial electrochemical cell technology can be used to generate electricity, or higher value chemicals, from organic waste. The capability of biofilms of electroactive bacteria to transfer electrons to solid anodes is a key feature of this emerging technology, yet the electron transfer mechanism is not fully characterized as yet. Acetate oxidation current generated from biofilms of an EAB, Geobacter sulfurreducens, on graphite electrodes as a function of time does not correlate with film thickness. Values of film thickness, and the number and local concentration of electrically connected redox sites within Geobacter sulfurreducens biofilms as well as a charge transport diffusion co-efficient for the biofilm can be estimated from non-turnover voltammetry. The thicker biofilms, of 50 ± 9 μm, display higher charge transport diffusion co-efficient than that in thinner films, as increased film porosity of these films improves ion transport, required to maintain electro-neutrality upon electrolysis. This journal is © the Partner Organisations 2014.

  10. Investigation of the dimensionality of charge transport in organic field effect transistors

    Science.gov (United States)

    Abdalla, Hassan; Fabiano, Simone; Kemerink, Martijn

    2017-02-01

    Ever since the first experimental investigations of organic field effect transistors (OFETs) the dimensionality of charge transport has alternately been described as two dimensional (2D) and three dimensional (3D). More recently, researchers have turned to an analytical analysis of the temperature-dependent transfer characteristics to classify the dimensionality as either 2D or 3D as well as to determine the disorder of the system, thereby greatly simplifying dimensionality investigations. We applied said analytical analysis to the experimental results of our OFETs comprising molecularly well-defined polymeric layers as the active material as well as to results obtained from kinetic Monte Carlo simulations and found that it was not able to correctly distinguish between 2D and 3D transports or give meaningful values for the disorder and should only be used for quasiquantitative and comparative analysis. We conclude to show that the dimensionality of charge transport in OFETs is a function of the interplay between transistor physics and morphology of the organic material.

  11. Shot noise of charge and spin transport in a junction with a precessing molecular spin

    Science.gov (United States)

    Filipović, Milena; Belzig, Wolfgang

    2018-03-01

    Magnetic molecules and nanomagnets can be used to influence the electronic transport in mesoscopic junction. In a magnetic field, the precessional motion leads to resonances in the dc- and ac-transport properties of a nanocontact, in which the electrons are coupled to the precession. Quantities such as the dc conductance or the ac response provide valuable information, such as the level structure and the coupling parameters. Here, we address the current-noise properties of such contacts. This encompasses the charge current and spin-torque shot noise, which both show a steplike behavior as functions of bias voltage and magnetic field. The charge-current noise shows pronounced dips around the steps, which we trace back to interference effects of electrons in quasienergy levels coupled by the molecular spin precession. We show that some components of the noise of the spin-torque currents are directly related to the Gilbert damping, and hence are experimentally accessible. Our results show that the noise characteristics allow us to investigate in more detail the coherence of spin transport in contacts containing magnetic molecules.

  12. Space-charge limits on the transport of ion beams in a long alternating gradient system

    Energy Technology Data Exchange (ETDEWEB)

    Tiefenback, M.G.

    1986-11-01

    We have experimentally studied the space-charge-dominated transport of ion beams in an alternating-gradient channel, without acceleration. We parameterize the focusing strength in terms of the zero-current ''betatron'' oscillation phase advance rate, sigma/sub 0/ (degrees per focusing period). We have investigated the conditions for ''stability'', defined as the constancy of the total current and phase space area of the beam during transport. We find that the beam may be transported with neither loss of current nor growth in phase area if sigma/sub 0/ < 90/sup 0/. In this regime, the space-charge repulsive force can counter 98-99% of the externally applied focusing field, and the oscillation frequency of the beam particles can be depressed by self-forces to almost a factor of 10 below the zero-current value, limited only by the optical quality of our ion source. For sigma/sub 0/ > 90/sup 0/, we find that collective interactions bound the maintainable density of the beam, and we present a simple, semi-empirical characterization for stability, within our ability to distinguish the growth rate from zero in our apparatus. Our channel comprises 87 quadrupole lenses, 5 of which are used to prepare the beam for injection into the non-azimuthally-symmetric focusing channel.

  13. Charge-carrier transport in epitactical strontium titanate layers for the application in superconducting components

    International Nuclear Information System (INIS)

    Grosse, Veit

    2011-01-01

    In this thesis thin STO layers were epitactically deposited on YBCO for a subsequent electrical characterization. YBCO layers with a roughness of less than 2 nm (RMS), good out-of-plane orientation with a half-width in the rocking curve in the range (0.2..0.3) at only slightly diminished critical temperature could be reached. The STO layers exhibited also very good crystallographic properties. The charge-carrier transport in STO is mainly dominated by interface-limited processes. By means of an in thesis newly developed barrier model thereby the measured dependencies j(U,T) respectively σ(U,T) could be described very far-reachingly. At larger layer thicknesses and low temperatures the charge-carrier transport succeeds by hopping processes. So in the YBCO/STO/YBCO system the variable-range hopping could be identified as dominating transport process. Just above U>10 V a new behaviour is observed, which concerning its temperature dependence however is also tunnel-like. The STO layers exhibit here very large resistances, so that fields up to 10 7 ..10 8 V/m can be reached without flowing of significant leakage currents through the barrier. In the system YBCO/STO/Au the current transport can be principally in the same way as in the YBCO/STO/YBCO system. The special shape and above all the asymmetry of the barrier however work out very distinctly. It could be shown that at high temperatures according to the current direction a second barrier on the opposite electrode must be passed. So often observed breakdown effects can be well described. For STO layer-thicknesses in the range around 25 nm in the whole temperature range studied inelastic tunneling over chains of localized states was identified as dominating transport process. It could however for the first time be shown that at very low temperatures in the STO layers Coulomb blockades can be formed.

  14. Charge transport and light emission in bilayer organic field-effect transistors

    Energy Technology Data Exchange (ETDEWEB)

    Li Weicong; Kwok, H.L., E-mail: hlkwok@ece.uvic.ca

    2012-02-29

    Recently there has been some major interest in the charge transport and light emission properties of organic field-effect transistors (OFETs). Different device structures have been proposed and they can be divided into two broad categories consisting of either a single layer or a bilayer. In the case of the single-layer OFETs, efficient light emission has not been observed while the performance of the bilayer OFETs appear to be more promising (for instance: recent work on a bilayer OFET has shown distinct ambipolar characteristics as well as limited light emission). In this work, we examined the electroluminescence intensities of bilayer OFETs reported in the open literature and attempted to identify the transport and recombination mechanisms. As observed, light emission in these devices appeared to be linked to a narrow region at the interface acting as a light-emitting source. To understand the recombination mechanisms, we computed the spatial charge distributions under various biasing conditions and correlated the results to the reported electroluminescence intensity data. Our overall results re-affirmed the significance of the light-emitting interface layer and the fact that device operation critically depended on the alignment of the energy levels at the respective interface. - Highlights: Black-Right-Pointing-Pointer Data taken from a reported bilayer OFET had been analyzed. Black-Right-Pointing-Pointer Transport and light emission mechanisms were used explain the device operation. Black-Right-Pointing-Pointer Light emission was found to depend on the charge distribution under bias. Black-Right-Pointing-Pointer We highlighted the opportunities to improve the device performance.

  15. Determination of charge transport activation energy and injection barrier in organic semiconductor devices

    Science.gov (United States)

    Züfle, S.; Altazin, S.; Hofmann, A.; Jäger, L.; Neukom, M. T.; Brütting, W.; Ruhstaller, B.

    2017-09-01

    Charge carrier transport in organic semiconductor devices is thermally activated with characteristic activation energies in the range of 0.2-0.6 eV, leading to strongly temperature-dependent behaviour. For designing efficient organic semiconductor materials and devices, it is therefore indispensable to understand the origin of these activation energies. We propose that in bilayer organic light-emitting diodes (OLEDs) employing a polar electron transport layer, as well as in metal-insulator-semiconductor (MIS) devices, the hole injection barrier Einj and the hole mobility activation energy Eμ can be decoupled from each other if temperature-dependent capacitance-frequency (C-f-T) and MIS-CELIV (charge extraction by linearly increasing voltage) experiments are combined. While the C-f-T signal contains information of both injection and transport, the CELIV current is expected to be insensitive to the electrode injection properties. We employ numerical drift-diffusion simulations to investigate the accuracy of this analytical parameter extraction approach and to develop criteria for its validity. We show that the implicit assumption of constant charge density and field profiles leads to systematic errors in determining the activation energies. Thus, one should be aware of the intrinsic limitations of the analytical Arrhenius fit, and for more accurate parameter determination a full drift-diffusion modelling is advised. Applying the analytical method to a standard bilayer OLED, we find that the total activation energy of 0.5 eV for the hole current can be split into contributions of ≈0.25 eV each for injection barrier and mobility. Finally, we also discuss the broader applicability of this method for other device stacks and material combinations.

  16. TTF/TCNQ-based thin films and microcrystals. Growth and charge transport phenomena

    Energy Technology Data Exchange (ETDEWEB)

    Solovyeva, Vita

    2011-05-26

    The thesis adresses several problems related to growth and charge transport phenomena in thin films of TTF-TCNQ and (BEDT-TTF)TCNQ. The following main new problems are addressed: - The influence of thin-film specific factors, such as the substrate material and growth-induced defects, on the Peierls transition temperature in TTF-TCNQ thin films was studied; - finite-size effects in TTF-TCNQ were investigated by considering transport properties in TTF-TCNQ microcrystals. The influence of the size of the crystal on the Peierls transition temperature was studied. In this context a new method of microcontact fabrication was employed to favor the measurements; - an analysis of radiation-induced defects in TTF-TCNQ thin films and microcrystals was performed. It was demonstrated than an electron beam can induce appreciable damage to the sample such that its electronic properties are strongly modified; - a bilayer growth method was established to fabricate (BEDT-TTF)TCNQ from the gas phase. This newly developed bilayer growth method was showed to be suitable for testing (BEDT-TTF)TCNQ charge-transfer phase formation; - the structure of the formed (BEDT-TTF)TCNQ charge-transfer compounds was analyzed by using a wide range of experimental techniques. An overview and the description of the basic physical principles underlying charge-transfer compounds is given in chapter 2. Experimental techniques used for the growth and characterization of thin films and microcrystals are presented in chapter 3. Chapter 4 gives an overview of the physical properties of the studied organic materials. Chapter 5 discussed the experimental study of TTF-TCNQ thin films. he Peierls transition in TTF-TCNQ is a consequence of the quasi-one-dimensional structure of the material and depends on different factors, studied in chapters 5 and 6. In contradistinction to TTF-TTCNQ, the (BEDT-TTF)TCNQ charge-transfer compound crystallizes in several different modifications with different physical properties

  17. Simulation of neutron transport process, photons and charged particles within the Monte Carlo method

    International Nuclear Information System (INIS)

    Androsenko, A.A.; Androsenko, P.A.; Artamonov, S.N.; Bolonkina, G.V.; Lomtev, V.L.; Pupko, S.V.

    1991-01-01

    Description is given to the program system BRAND designed for the accurate solution of non-stationary transport equation of neutrons, photons and charged particles in the conditions of real three-dimensional geometry. An extensive set of local and non-local estimates provides an opportunity of calculating a great set of linear functionals normally being of interest in the calculation of reactors, radiation protection and experiment simulation. The process of particle interaction with substance is simulated on the basis of individual non-group data on each isotope of the composition. 24 refs

  18. A Boltzmann-weighted hopping model of charge transport in organic semicrystalline films

    KAUST Repository

    Kwiatkowski, Joe J.

    2011-01-01

    We present a model of charge transport in polycrystalline electronic films, which considers details of the microscopic scale while simultaneously allowing realistically sized films to be simulated. We discuss the approximations and assumptions made by the model, and rationalize its application to thin films of directionally crystallized poly(3-hexylthiophene). In conjunction with experimental data, we use the model to characterize the effects of defects in these films. Our findings support the hypothesis that it is the directional crystallization of these films, rather than their defects, which causes anisotropic mobilities. © 2011 American Institute of Physics.

  19. The effect of interfacial layers on charge transport in organic solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Mbuyise, Xolani G.; Tonui, Patrick; Mola, Genene Tessema, E-mail: mola@ukzn.ac.za

    2016-09-01

    The effect of interfacial buffer layers in organic photovoltaic cell (OPV) whose active layer is composed of poly(3 hexylthiophene) (P3HT) and [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) blend was studied. The electrical properties of OPV devices produced with and without interfacial layers are compared and discussed in terms of measured parameters of the cells. The charge transport properties showed significant difference on the mobility and activation factor between the two types of device structures. The life time measurements in the unprotected conditions are also presented and discussed.

  20. Vivitron - A 35 MV Van de Graaff tandem. Design, performance, charge transport system

    International Nuclear Information System (INIS)

    Letournel, M.; Helleboid, J.M.; Bertein, H.

    1985-01-01

    This paper describes a new configuration for an electrostatic tandem accelerator. The project of the Strasbourg Nuclear Center is a 35 MV Van de Graaff tandem, in fact a new design in that field. The general features of the machine and its associated electrostatic field are described. The machine is designed to minimise energy dissipation within the accelerator column in the event of electrical breakdown. This is discussed as also insulator and conductor designs. Charge transport system is a particular field. The choice of a belt system and its design result from specific studies carried out at the C.R.N. with reference to the electrostatics of solid and gaseous insulations [fr

  1. The influence of dipolar species on charge carrier transport in a linear polysilicon

    Czech Academy of Sciences Publication Activity Database

    Nešpůrek, Stanislav; Sworakowski, J.; Kadashchuk, A.

    2001-01-01

    Roč. 8, č. 3 (2001), s. 432-441 ISSN 1070-9878. [International Conference on Dielectrics and Related Phenomena /6./. Spala, 06.09.2000-10.09.2000] R&D Projects: GA AV ČR IAA1050901; GA AV ČR KSK4050111; GA ČR GA106/98/0700 Institutional research plan: CEZ:AV0Z4050913 Keywords : transport of charge carriers * poly[methyl(phenyl)silanediyl] * polaron Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.778, year: 2001

  2. Competition between deformability and charge transport in semiconducting polymers for flexible and stretchable electronics

    Energy Technology Data Exchange (ETDEWEB)

    Printz, Adam D.; Lipomi, Darren J., E-mail: dlipomi@ucsd.edu [Department of NanoEngineering, University of California, San Diego, 9500 Gilman Drive, Mail Code 0448, La Jolla, California 92093-0448 (United States)

    2016-06-15

    The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competition can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not

  3. System Dynamic Analysis of Impacts of Government Charges on Disposal of Construction and Demolition Waste: A Hong Kong Case Study

    Directory of Open Access Journals (Sweden)

    Lai Sheung Au

    2018-04-01

    Full Text Available With the purpose of reducing the amount of construction and demolition (C&D waste disposed to landfills, many countries and municipalities have introduced increasingly stringent C&D waste disposal charges (CDWDC but the level of CDWDC is often determined without a clear understanding of its broad and complex impacts. Against this background, this paper aims to propose a system dynamics (SD model that can help predict CDWDC’s environmental implications as well as its financial implications. Specifically, the proposed model explains complex causal relationships between variables such as the level of CDWDC, the amount of C&D waste disposed to landfills, the government’s revenues from CDWDC as well as the costs of supplying and operating landfills over time. For a case study, the developed model is customized and calibrated with actual data from Hong Kong, where the remaining capacities of existing landfills are limited and the need for supplying more landfills is imminent. The simulation analysis with the model predicts that the current charging levels may not be high enough to effectively control the amount of C&D waste disposed to landfills or to compensate for the costs to the government of supplying additional landfills. The analysis also predicts how much illegal dumping may increase as the level of CDWDC increases. This case study illustrates that the proposed SD model can help policy makers to see the potential impacts of increased CDWDC on the amount of C&D waste disposed to landfills, government costs and the amount of illegal dumping of C&D waste; and can therefore help them to determine the most appropriate level of CDWDC.

  4. Challenges in Governing the Digital Transportation Ecosystem in Jakarta: A Research Direction in Smart City Frameworks

    Directory of Open Access Journals (Sweden)

    Iqbal Yulizar Mukti

    2018-03-01

    Full Text Available Mobility is one of the most difficult domains of the smart city to face. In fact, most large cities in the world are still facing urban mobility problems, especially traffic congestion. Particularly, in Jakarta, Indonesia, traffic congestion is a major issue that negatively affects productivity and the overall living quality of the citizens. Along with the development of the information communication and technology (ICT, the transportation domain in Jakarta has formed a digital transportation ecosystem, shown by the emergence of innovative digital-based transportation services. In line with this current condition, this paper hopes to contribute to the improvement of urban traffic in Jakarta by proposing research directions to govern the digital transportation ecosystem within a smart city framework. The significance of the research directions is reviewed using Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA methodology in a systematic review of previous studies. Ultimately, the research directions proposed in this paper lead to the necessity for an architectural perspective and relevant big data analytical tools to improve the digital transportation ecosystem in Jakarta.

  5. 41 CFR 102-118.150 - What are the major mandatory terms and conditions governing the use of passenger transportation...

    Science.gov (United States)

    2010-07-01

    ...) Interest shall accrue from the voucher payment date on overcharges made hereunder and shall be paid at the... (Continued) FEDERAL MANAGEMENT REGULATION TRANSPORTATION 118-TRANSPORTATION PAYMENT AND AUDIT Ordering and... responsible for charges exceeding those applicable to the type, class, or character authorized in...

  6. A renormalization approach to describe charge transport in quasiperiodic dangling backbone ladder (DBL)-DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Fisica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofisica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofisica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Caetano, E.W.S. [Instituto Federal de Educacao, Ciencia e Tecnologia do Ceara, 60040-531 Fortaleza, CE (Brazil); Freire, V.N. [Departamento de Fisica, Universidade Federal do Ceara, 60455-760 Fortaleza, CE (Brazil)

    2011-10-31

    Highlights: → One-step renormalization approach to describe the DBL-DNA molecule. → Electronic tight-binding Hamiltonian model. → A quasiperiodic sequence to mimic the DNA nucleotides arrangement. → Electronic transmission spectra. → I-V characteristics. -- Abstract: We study the charge transport properties of a dangling backbone ladder (DBL)-DNA molecule focusing on a quasiperiodic arrangement of its constituent nucleotides forming a Rudin-Shapiro (RS) and Fibonacci (FB) Poly (CG) sequences, as well as a natural DNA sequence (Ch22) for the sake of comparison. Making use of a one-step renormalization process, the DBL-DNA molecule is modeled in terms of a one-dimensional tight-binding Hamiltonian to investigate its transmissivity and current-voltage (I-V) profiles. Beyond the semiconductor I-V characteristics, a striking similarity between the electronic transport properties of the RS quasiperiodic structure and the natural DNA sequence was found.

  7. The effects of two counterpropagating surface acoustic wave beams on single electron acoustic charge transport

    International Nuclear Information System (INIS)

    He Jianhong; Guo Huazhong; Song Li; Zhang Wei; Gao Jie; Lu Chuan

    2010-01-01

    We present a comprehensive study of the effects of two counterpropagating surface acoustic waves on the acoustoelectric current of single electron transport devices. A significant improvement in the accuracy of current quantization is achieved as a result of an additional surface acoustic wave beam. The experiments reveal the sinusoidally periodical modulation in the acoustoelectric current characteristic as a function of the relative phase of the two surface acoustic wave beams. Besides, by using standing surface acoustic waves, the acoustoelectric current is detected which we consider as the so-called anomalous acoustoelectric current produced by acoustic wave mechanical deformations. This kind current is contributed to one component of the acoustoelectric current in surface acoustic wave device, which could enable us to establish a more adequate description of acoustoelectric effects on single-electron acoustic charge transport.

  8. Self-consistent study of space-charge-dominated beams in a misaligned transport system

    International Nuclear Information System (INIS)

    Sing Babu, P.; Goswami, A.; Pandit, V.S.

    2013-01-01

    A self-consistent particle-in-cell (PIC) simulation method is developed to investigate the dynamics of space-charge-dominated beams through a misaligned solenoid based transport system. Evolution of beam centroid, beam envelope and emittance is studied as a function of misalignment parameters for various types of beam distributions. Simulation results performed up to 40 mA of proton beam indicate that centroid oscillations induced by the displacement and rotational misalignments of solenoids do not depend of the beam distribution. It is shown that the beam envelope around the centroid is independent of the centroid motion for small centroid oscillation. In addition, we have estimated the loss of beam during the transport caused by the misalignment for various beam distributions

  9. Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

    International Nuclear Information System (INIS)

    Le Roy, S; Segur, P; Teyssedre, G; Laurent, C

    2004-01-01

    We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene

  10. Corporate governance and internationalization of capital of brazilian companies of the sectors construction and transports

    Directory of Open Access Journals (Sweden)

    Anna Beatriz Grangeiro Ribeiro Maia

    2013-08-01

    Full Text Available The study aims at analyzing comparatively the representativeness of foreign capital in the capital of Brazilian companies of the sectors construction and transports, considering their segments on the BM&FBovespa. The internationalization of the 66 companies in the sample was measured by the percentage of the company's share capital held by foreign investors, and governance by the company's participation on the “Differentiated Level of Corporate Governance” (DLCG segments of BM&FBovespa. Using a descriptive and a quantitative study, the results of applying the Mann-Whitney test for the percentage of foreign capital in the capital of DLCG firms and of companies listed on the traditional market indicate that there is a difference statistically significant between the two groups of firms, confirming the hypothesis of this research. The conclusion is that governance is a sign of the internationalization of capital companies, confirming the efficiency of the administration based on the theory of transaction costs.

  11. Response to Comments on "The [4Fe4S] cluster of human DNA primase functions as a redox switch using DNA charge transport".

    Science.gov (United States)

    O'Brien, Elizabeth; Holt, Marilyn E; Thompson, Matthew K; Salay, Lauren E; Ehlinger, Aaron C; Chazin, Walter J; Barton, Jacqueline K

    2017-07-21

    Baranovskiy et al and Pellegrini argue that, based on structural data, the path for charge transfer through the [4Fe4S] domain of primase is not feasible. Our manuscript presents electrochemical data directly showing charge transport through DNA to the [4Fe4S] cluster of a primase p58C construct and a reversible switch in the DNA-bound signal with oxidation/reduction, which is inhibited by mutation of three tyrosine residues. Although the dispositions of tyrosines differ in different constructs, all are within range for microsecond electron transfer. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  12. Scientific Computation Application Partnerships in Materials and Chemical Sciences, Charge Transfer and Charge Transport in Photoactivated Systems, Developing Electron-Correlated Methods for Excited State Structure and Dynamics in the NWChem Software Suite

    Energy Technology Data Exchange (ETDEWEB)

    Cramer, Christopher J. [Univ. of Minnesota, Minneapolis, MN (United States)

    2017-11-12

    Charge transfer and charge transport in photoactivated systems are fundamental processes that underlie solar energy capture, solar energy conversion, and photoactivated catalysis, both organometallic and enzymatic. We developed methods, algorithms, and software tools needed for reliable treatment of the underlying physics for charge transfer and charge transport, an undertaking with broad applicability to the goals of the fundamental-interaction component of the Department of Energy Office of Basic Energy Sciences and the exascale initiative of the Office of Advanced Scientific Computing Research.

  13. The programme library for numerical simulation of charged particle dynamics in transportation lines

    International Nuclear Information System (INIS)

    Aleksandrov, V.S.; Shevtsov, V.F.; Shirkov, G.D.; Batygin, Yu.K.

    1998-01-01

    The description of a PC codes library to simulate the beam transportation of charged particles is presented. The codes are realized on IBM PC in Visual Basic common interface. It is destined for the simulation and optimization of beam dynamics and based on the successive and consistent use of two methods: the momentum method of distribution functions (RMS technique) and the particle-particle method (PP-Method). The library allows to calculate the RMS parameters of electron and ion beams, passing through a set of quadrupoles, solenoids, bends, accelerating sections. The RMS code is a fast code very suitable for the first test, design and optimization of the beam line parameters. The PP code requires more time for execution but provides a high accuracy of simulation taking into account the space charge effects, aberrations and beam losses. One of the main advantages of PP code presented here is an ability to simulate a real multicomponent beam of different masses and charged states of ions from ion sources

  14. Charge Transport in Two-Photon Semiconducting Structures for Solar Fuels.

    Science.gov (United States)

    Liu, Guohua; Du, Kang; Haussener, Sophia; Wang, Kaiying

    2016-10-20

    Semiconducting heterostructures are emerging as promising light absorbers and offer effective electron-hole separation to drive solar chemistry. This technology relies on semiconductor composites or photoelectrodes that work in the presence of a redox mediator and that create cascade junctions to promote surface catalytic reactions. Rational tuning of their structures and compositions is crucial to fully exploit their functionality. In this review, we describe the possibilities of applying the two-photon concept to the field of solar fuels. A wide range of strategies including the indirect combination of two semiconductors by a redox couple, direct coupling of two semiconductors, multicomponent structures with a conductive mediator, related photoelectrodes, as well as two-photon cells are discussed for light energy harvesting and charge transport. Examples of charge extraction models from the literature are summarized to understand the mechanism of interfacial carrier dynamics and to rationalize experimental observations. We focus on a working principle of the constituent components and linking the photosynthetic activity with the proposed models. This work gives a new perspective on artificial photosynthesis by taking simultaneous advantages of photon absorption and charge transfer, outlining an encouraging roadmap towards solar fuels. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Heterojunction PbS Nanocrystal Solar Cells with Oxide Charge-Transport Layers

    KAUST Repository

    Hyun, Byung-Ryool

    2013-12-23

    Oxides are commonly employed as electron-transport layers in optoelectronic devices based on semiconductor nanocrystals, but are relatively rare as hole-transport layers. We report studies of NiO hole-transport layers in PbS nanocrystal photovoltaic structures. Transient fluorescence experiments are used to verify the relevant energy levels for hole transfer. On the basis of these results, planar heterojunction devices with ZnO as the photoanode and NiO as the photocathode were fabricated and characterized. Solution-processed devices were used to systematically study the dependence on nanocrystal size and achieve conversion efficiency as high as 2.5%. Optical modeling indicates that optimum performance should be obtained with thinner oxide layers than can be produced reliably by solution casting. Roomerature sputtering allows deposition of oxide layers as thin as 10 nm, which enables optimization of device performance with respect to the thickness of the charge-transport layers. The best devices achieve an open-circuit voltage of 0.72 V and efficiency of 5.3% while eliminating most organic material from the structure and being compatible with tandem structures. © 2013 American Chemical Society.

  16. Interdisciplinary Research to Elucidate Mechanisms Governing Silver Nanoparticle Fate and Transport in Porous Media

    Science.gov (United States)

    Pennell, K. D.; Mittleman, A.; Taghavy, A.; Fortner, J.; Lantagne, D.; Abriola, L. M.

    2015-12-01

    Interdisciplinary Research to Elucidate Mechanisms Governing Silver Nanoparticle Fate and Transport in Porous Media Anjuliee M. Mittelman, Amir Taghavy, Yonggang Wang, John D. Fortner, Daniele S. Lantagne, Linda M. Abriola and Kurt D. Pennell* Detailed knowledge of the processes governing nanoparticle transport and reactivity in porous media is essential for accurate predictions of environmental fate, water and wastewater treatment system performance, and assessment of potential risks to ecosystems and water supplies. To address these issues, an interdisciplinary research team combined experimental and mathematical modeling studies to investigate the mobility, dissolution, and aging of silver nanoparticles (nAg) in representative aquifer materials and ceramic filters. Results of one-dimensional column studies, conducted with water-saturated sands maintained at pH 4 or 7 and three levels of dissolved oxygen (DO), revealed that fraction of silver mass eluted as Ag+ increased with increasing DO level, and that the dissolution of attached nAg decreased over time as a result of surface oxidation. A hybrid Eulerain-Lagragian nanoparticle transport model, which incorporates DO-dependent dissolution kinetics and particle aging, was able to accurately simulate nAg mobility and Ag+ release measured in the column experiments. Model sensitivity analysis indicated that as the flow velocity and particle size decrease, nAg dissolution and Ag+ transport processes increasingly govern silver mobility. Consistent results were obtained in studies of ceramic water filters treated with nAg, where silver elution was shown to be governed by nAg dissolution to form Ag+ and subsequent cation exchange reactions. Recent studies explored the effects of surface coating aging on nAg aggregation, mobility and dissolution. Following ultraviolet light, nAg retention in water saturated sand increased by 25-50%, while up to 50% of the applied mass eluted as Ag+ compared to less than 1% for un-aged n

  17. Influence of Magnetic Field on Electric Charge Transport in Holomiun Thin Films at Low Temperatures

    Directory of Open Access Journals (Sweden)

    Jan Dudas

    2005-01-01

    Full Text Available Holmium thin films were prepared by evaporation in ultrahigh vacuum (UHV and high precision electrical resistance measurements were performed on them as well as on holomium bulk sample in the wide temperature range from 4,2 K up to the room temperature. Electric charge transport is profoundly influenced by the magnetic structure at low temperatures and a "knee-like" resistance anomaly was observed near the transportation from paramagnetic state to basal-plane spiral structure in bulk with the Neel temperature TN=128,9 K and below ~ 122 K in thin Ho films in a thickness range from 98 nm to 215 nm. Unexpected resistance minimum at ~ 9 K and a slope´s charge of the R vs. T curve near ~ 170 K was observed in 215 nm thin film. Application of magnetic field parallel to the substrate and thin film plane for temperatures below ~ 150 K caused the decrease of resistence value with increasing magnetic flux density. Increasing suppression of the TN value up to ~ 5 K with increasing flux density value up to 5 T was observed in Ho films. 

  18. Common Mitochondrial DNA Mutations generated through DNA-mediated Charge Transport#

    Science.gov (United States)

    Merino, Edward J.; Davis, Molly L.; Barton, Jacqueline K.

    2009-01-01

    Mutation sites that arise in human mitochondrial DNA as a result of oxidation by a rhodium photooxidant have been identified. HeLa cells were incubated with [Rh(phi)2bpy]Cl3 (phi = 9,10-phenanthrenequinone diimine), an intercalating photooxidant, to allow the complex to enter the cell and bind mitochondrial DNA. Photoexcitation of DNA-bound [Rh(phi)2bpy]3+ can promote the oxidation of guanine from a distance through DNA-mediated charge transport. After two rounds of photolysis and growth of cells incubated with the rhodium complex, DNA mutations in a portion of the mitochondrial genome were assessed via manual sequencing. The mutational pattern is consistent with dG to dT transversions in the repetitive guanine tracts. Significantly, the mutational pattern found overlaps oxidative damage hot spots seen previously. These mutations are found within conserved sequence block II, a critical regulatory element involved in DNA replication, and these have been identified as sites of low oxidation potential to which oxidative damage is funneled. Based upon this mutational analysis and its correspondence to sites of long range oxidative damage, we infer a critical role for DNA charge transport in generating these mutations and, thus, in regulating mitochondrial DNA replication under oxidative stress. PMID:19128037

  19. Dynamic character of charge transport parameters in disordered organic semiconductor field-effect transistors.

    Science.gov (United States)

    Chen, Y; Lee, B; Yi, H T; Lee, S S; Payne, M M; Pola, S; Kuo, C-H; Loo, Y-L; Anthony, J E; Tao, Y T; Podzorov, V

    2012-11-07

    In this perspective article, we discuss the dynamic instability of charge carrier transport in a range of popular organic semiconductors. We observe that in many cases field-effect mobility, an important parameter used to characterize the performance of organic field-effect transistors (OFETs), strongly depends on the rate of the gate voltage sweep during the measurement. Some molecular systems are so dynamic that their nominal mobility can vary by more than one order of magnitude, depending on how fast the measurements are performed, making an assignment of a single mobility value to devices meaningless. It appears that dispersive transport in OFETs based on disordered semiconductors, those with a high density of localized trap states distributed over a wide energy range, is responsible for the gate voltage sweep rate dependence of nominal mobility. We compare such rate dependence in different materials and across different device architectures, including pristine and trap-dominated single-crystal OFETs, as well as solution-processed polycrystalline thin-film OFETs. The paramount significance given to a single mobility value in the organic electronics community and the practical importance of OFETs for applications thus suggest that such an issue, previously either overlooked or ignored, is in fact a very important point to consider when engaging in fundamental studies of charge carrier mobility in organic semiconductors or designing applied circuits with organic semiconductors.

  20. Signatures of dynamics in charge transport through organic molecules; Dynamisches Verhalten beim Ladungstransport durch organische Molekuele

    Energy Technology Data Exchange (ETDEWEB)

    Secker, Daniel

    2008-06-03

    The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)

  1. Simulation of photon and charge transport in X-ray imaging semiconductor sensors

    CERN Document Server

    Nilsson, H E; Hjelm, M; Bertilsson, K

    2002-01-01

    A fully stochastic model for the imaging properties of X-ray silicon pixel detectors is presented. Both integrating and photon counting configurations have been considered, as well as scintillator-coated structures. The model is based on three levels of Monte Carlo simulations; photon transport and absorption using MCNP, full band Monte Carlo simulation of charge transport and system level Monte Carlo simulation of the imaging performance of the detector system. In the case of scintillator-coated detectors, the light scattering in the detector layers has been simulated using a Monte Carlo method. The image resolution was found to be much lower in scintillator-coated systems due to large light spread in thick scintillator layers. A comparison between integrating and photon counting readout methods shows that the image resolution can be slightly enhanced using a photon-counting readout. In addition, the proposed model has been used to study charge-sharing effects on the energy resolution in photon counting dete...

  2. Kinetic phenomena in charged particle transport in gases, swarm parameters and cross section data

    International Nuclear Information System (INIS)

    Petrovic, Z Lj; Suvakov, M; Nikitovic, Z; Dujko, S; Sasic, O; Jovanovic, J; Malovic, G; Stojanovic, V

    2007-01-01

    In this review we discuss the current status of the physics of charged particle swarms, mainly electrons. The whole field is analysed mainly through its relationship to plasma modelling and illustrated by some recent examples developed mainly by our group. The measurements of the swarm coefficients and the availability of the data are briefly discussed. More time is devoted to the development of complete electron-molecule cross section sets along with recent examples such as NO, CF 4 and HBr. We extend the discussion to the availability of ion and fast neutral data and how swarm experiments may serve to provide new data. As a point where new insight into the kinetics of charge particle transport is provided, the role of kinetic phenomena is discussed and recent examples are listed. We focus here on giving two examples on how non-conservative processes make dramatic effects in transport, the negative absolute mobility and the negative differential conductivity for positrons in argon. Finally we discuss the applicability of swarm data in plasma modelling and the relationship to other fields where swarm experiments and analysis make significant contributions. (topical review)

  3. Colloidal metal oxide nanocrystals as charge transporting layers for solution-processed light-emitting diodes and solar cells.

    Science.gov (United States)

    Liang, Xiaoyong; Bai, Sai; Wang, Xin; Dai, Xingliang; Gao, Feng; Sun, Baoquan; Ning, Zhijun; Ye, Zhizhen; Jin, Yizheng

    2017-03-21

    Colloidal metal oxide nanocrystals offer a unique combination of excellent low-temperature solution processability, rich and tuneable optoelectronic properties and intrinsic stability, which makes them an ideal class of materials as charge transporting layers in solution-processed light-emitting diodes and solar cells. Developing new material chemistry and custom-tailoring processing and properties of charge transporting layers based on oxide nanocrystals hold the key to boosting the efficiency and lifetime of all-solution-processed light-emitting diodes and solar cells, and thereby realizing an unprecedented generation of high-performance, low-cost, large-area and flexible optoelectronic devices. This review aims to bridge two research fields, chemistry of colloidal oxide nanocrystals and interfacial engineering of optoelectronic devices, focusing on the relationship between chemistry of colloidal oxide nanocrystals, processing and properties of charge transporting layers and device performance. Synthetic chemistry of colloidal oxide nanocrystals, ligand chemistry that may be applied to colloidal oxide nanocrystals and chemistry associated with post-deposition treatments are discussed to highlight the ability of optimizing processing and optoelectronic properties of charge transporting layers. Selected examples of solution-processed solar cells and light-emitting diodes with oxide-nanocrystal charge transporting layers are examined. The emphasis is placed on the correlation between the properties of oxide-nanocrystal charge transporting layers and device performance. Finally, three major challenges that need to be addressed in the future are outlined. We anticipate that this review will spur new material design and simulate new chemistry for colloidal oxide nanocrystals, leading to charge transporting layers and solution-processed optoelectronic devices beyond the state-of-the-art.

  4. Spin-charge separation in the t-J model: Magnetic and transport anomalies

    International Nuclear Information System (INIS)

    Weng, Z.Y.; Sheng, D.N.; Ting, C.S.

    1995-01-01

    A real spin-charge separation scheme is found based on a saddle-point state of the t-J model. In the one-dimensional (1D) case, such a saddle-point reproduces the correct asymptotic correlations at the strong-coupling fixed point of the model. In the two-dimensional (2D) case, the transverse gauge field confining spinon and holon is shown to be gapped at finite doping so that a spin-charge deconfinement is obtained for its first time in 2D. The gap in the gauge fluctuation disappears at half-filling limit, where a long-range antiferromagnetic order is recovered at zero temperature and spinons become confined. The most interesting features of spin dynamics and transport are exhibited at finite doping where exotic residual couplings between spin and charge degrees of freedom lead to systematic anomalies with regard to a Fermi-liquid system. In spin dynamics, a commensurate antiferromagnetic fluctuation with a small, doping-dependent energy scale is found, which is characterized in momentum space by a Gaussian peak at (π/a,π/a) with a doping-dependent width. This commensurate magnetic fluctuation contributes a non-Korringa behavior for the NMR spin-lattice relaxation rate. There also exists a characteristic temperature scale below thich a pseudogap behavior appears in the spin dynamics. Furthermore, an incommensurate magnetic fluctuation is also obtained at a finite energy regime. In the transport, a strong-range phase intereference leads to an effective holon Lagrangian which can give rise to a series of interesting phenomena including linear-T resistivity and a T 2 Hall angle. We discuss the striking similarities of these theoretical features with those found in the high-T c cuprates and give a consistent picture for the latter. Electronic properties like Fermi surface and superconducting pairing in this framework are also discussed

  5. Generation of discrete scattering cross sections and demonstration of Monte Carlo charged particle transport in the Milagro IMC code package

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, J. A. [Department of Nuclear Science and Engineering, Massachusetts Institute of Technology, NW12-312 Albany, St. Cambridge, MA 02139 (United States); Palmer, T. S. [Department of Nuclear Engineering and Radiation Health Physics, Oregon State University, 116 Radiation Center, Corvallis, OR 97331 (United States); Urbatsch, T. J. [XTD-5: Air Force Systems, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

    2013-07-01

    A new method for generating discrete scattering cross sections to be used in charged particle transport calculations is investigated. The method of data generation is presented and compared to current methods for obtaining discrete cross sections. The new, more generalized approach allows greater flexibility in choosing a cross section model from which to derive discrete values. Cross section data generated with the new method is verified through a comparison with discrete data obtained with an existing method. Additionally, a charged particle transport capability is demonstrated in the time-dependent Implicit Monte Carlo radiative transfer code package, Milagro. The implementation of this capability is verified using test problems with analytic solutions as well as a comparison of electron dose-depth profiles calculated with Milagro and an already-established electron transport code. An initial investigation of a preliminary integration of the discrete cross section generation method with the new charged particle transport capability in Milagro is also presented. (authors)

  6. REVERSE CHARGING PURCHASES TO INTRA-TRANSPORTATION MEANS IN THE CONTEXT OF NEW TAX REGULATIONS

    Directory of Open Access Journals (Sweden)

    Ecobici Nicolae

    2009-05-01

    Full Text Available New tax rules with effect from 1 May 2009 with a series of changes on the tax deductibility of the value added acquisitions related to transport and fuel use. The measure is very obvious nature of politics in order to bring the state budget amounts as required under the current government crisis in the financial world. The book focuses on not commenting policy modifications as required on the implications that they bring in on the accounting chargeback. Therefore, in the paper we will address the resolution of these legal provisions in the economic accounts.

  7. Charge mobility and recombination in a new hole transporting polymer and its photovoltaic blend.

    Science.gov (United States)

    Tan, Mein Jin; Goh, Wei-Peng; Li, Jun; Pundir, Gaurav; Chellappan, Vijila; Chen, Zhi-Kuan

    2010-05-01

    The charge mobility in a new hole transporting polymer, poly(2,6-bis(thiophene-2-yl)-3,5-dipentadecyldithieno[3,2-b;2',3'-d]thiophene) (PBTDTT-15), and its blend with (6,6)-phenyl-C(70)-butyric acid methyl ester (PC(70)BM) in a weight ratio of 1:3 at ambient atmosphere condition was investigated using time-of-flight (TOF) photoconductivity and photoinduced charge extraction by linearly increasing voltage (PhotoCELIV) techniques. The bulk heterojunction based photovoltaic (PV) blend (PBTDTT-15:PC(70)BM (1:3)) exhibited a promising power conversion efficiency (PCE) of 3.23% under air mass 1.5 global (AM 1.5G) illumination of 100mW/cm(2). The charge mobility and recombination properties of the best performing cells were investigated. The hole mobility in the pure PBTDTT-15 was in the range of 4 x 10(-4) cm(2)/(V s), which was reduced almost 5 times in the PBTDTT-15:PC(70)BM (1:3) blend. The PhotoCELIV transient observed for the photovoltaic (PV) blend was dominated by electrons, with the charge mobility of the order of 10(-3) cm(2)/(V s), and a weak shoulder at a long time scale due to holes. The effective bimolecular recombination coefficient (beta) obtained for the PV blend deviated significantly from the Langevin recombination coefficient (beta(L)) indicating a phase-separated morphology. The obtained results indicate that the PBTDTT-15:PC(70)BM blend can be potential for organic solar cell applications.

  8. Mechanism of Crystallization and Implications for Charge Transport in Poly(3-ethylhexylthiophene) Thin Films

    KAUST Repository

    Duong, Duc T.

    2014-04-09

    In this work, crystallization kinetics and aggregate growth of poly(3-ethylhexylthiophene) (P3EHT) thin films are studied as a function of film thickness. X-ray diffraction and optical absorption show that individual aggregates and crystallites grow anisotropically and mostly along only two packing directions: the alkyl stacking and the polymer chain backbone direction. Further, it is also determined that crystallization kinetics is limited by the reorganization of polymer chains and depends strongly on the film thickness and average molecular weight. Time-dependent, field-effect hole mobilities in thin films reveal a percolation threshold for both low and high molecular weight P3EHT. Structural analysis reveals that charge percolation requires bridged aggregates separated by a distance of ≈2-3 nm, which is on the order of the polymer persistence length. These results thus highlight the importance of tie molecules and inter-aggregate distance in supporting charge percolation in semiconducting polymer thin films. The study as a whole also demonstrates that P3EHT is an ideal model system for polythiophenes and should prove to be useful for future investigations into crystallization kinetics. Recrystallization kinetics and its relationship to charge transport in poly(3-ethylhexylthiophene) (P3EHT) thin films are investigated using a combination of grazing incidence X-ray diffraction, optical absorption, and field-effect transistor measurements. These results show that thin film crystallization kinetics is limited by polymer chain reorganization and that charge percolation depends strongly on the edge-to-edge distance between aggregates. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Invariance of molecular charge transport upon changes of extended molecule size and several related issues

    Directory of Open Access Journals (Sweden)

    Ioan Bâldea

    2016-03-01

    Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.

  10. Disorder Effects in Charge Transport and Spin Response of Topological Insulators

    Science.gov (United States)

    Zhao, Lukas Zhonghua

    Topological insulators are a class of solids in which the non-trivial inverted bulk band structure gives rise to metallic surface states that are robust against impurity backscattering. First principle calculations predicted Bi2Te3, Sb2Te3 and Bi2Se3 to be three-dimensional (3D) topological insulators with a single Dirac cone on the surface. The topological surface states were subsequently observed by angle-resolved photoemission (ARPES) and scanning tunneling microscopy (STM). The investigations of charge transport through topological surfaces of 3D topological insulators, however, have faced a major challenge due to large charge carrier densities in the bulk donated by randomly distributed defects such as vacancies and antisites. This bulk disorder intermixes surface and bulk conduction channels, thereby complicating access to the low-energy (Dirac point) charge transport or magnetic response and resulting in the relatively low measured carrier mobilities. Moreover, charge inhomogeneity arising from bulk disorder can result in pronounced nanoscale spatial fluctuations of energy on the surface, leading to the formation of surface `puddles' of different carrier types. Great efforts have been made to combat the undesirable effects of disorder in 3D topological insulators and to reduce bulk carriers through chemical doping, nanostructure fabrication, and electric gating. In this work we have developed a new way to reduce bulk carrier densities using high-energy electron irradiation, thereby allowing us access to the topological surface quantum channels. We also found that disorder in 3D topological insulators can be beneficial. It can play an important part in enabling detection of unusual magnetic response from Dirac fermions and in uncovering new excitations, namely surface superconductivity in Dirac `puddles'. In Chapter 3 we show how by using differential magnetometry we could probe spin rotation in the 3D topological material family (Bi2Se 3, Bi2Te3 and Sb2Te3

  11. Raising Climate Finance from International Transport Sectors. Identification and Analysis of Governance Structures

    Energy Technology Data Exchange (ETDEWEB)

    Faber, J. [CE Delft, Delft (Netherlands); Pahuja, N.; Garg, A. [The Energy and Resources Institute TERI, New Delhi (India)

    2012-03-15

    Market based instruments (MBIs) for maritime transport have the potential to reduce emissions while at the same time raising funds for climate policies in developing countries. GHG emissions from international aviation and maritime transport accounted for approximately 5% of global anthropogenic emissions in 2005 and are rising rapidly. There is a clear need to address these emissions in order not to undermine policies for mitigating land based emissions. Developing countries need financial support to carry out climate policies, both adaptation and mitigation. The UN Framework Convention on Climate Change (UNFCCC) makes policies by developing countries conditional on climate finance. In the current economic and financial circumstances, there is a need for new sources of finance. The governance of such MBIs should ensure that they are neither an international tax nor require hypothecation of fiscal revenues, while they should provide new and additional finance. MBIs which are in fact an international tax would not be politically feasible, and likewise hypothecation would be opposed by many states. This report finds that an emissions trading scheme (ETS) can satisfy these criteria, provided that: (1) it transfers a share of allowances directly to developing countries in order to ensure there is no net incidence on them; developing countries could auction these allowances in order to raise revenue; (2) it transfers allowances to the Green Climate Fund to support climate policies; auctioning these allowances would provide revenues for the Fund; (3) it transfers allowances to IMO or another organisation in order to finance fuel-efficiency improvements in international transport.

  12. Microstructure defects mediated charge transport in Nb-doped epitaxial BaTiO3 thin films

    Science.gov (United States)

    Zhou, Jian; Jing, Xiaosai; Alexe, Marin; Dai, Jiyan; Qin, Minghui; Wu, Sujuan; Zeng, Min; Gao, Jinwei; Lu, Xubing; Liu, J.-M.

    2016-05-01

    Nb-doped BaTiO3 (BNTO) films were deposited on MgO substrates at different substrate temperatures by pulsed laser deposition. The temperature dependence of their resistivity, carrier mobility and carrier concentration were systematically investigated. It reveals that the BNTO films deposited at lower temperature show higher resistivity and lower carrier mobility, and only show semiconductor characteristics at measurement temperatures ranging from 10 to 400 K. There is a metal-semiconductor transition at about 20 K for the films grown at relatively higher temperature. The intrinsic mechanism responsible for the different charge transport behavior was revealed by microstructure studies. Low crystal quality and high density of microstructure defects, observed for BNTO films grown at low temperatures, are, in particular, massively affecting the charge transport behavior of the BNTO films. The mediated charge transport of the microstructure defects is dominated by the thermal excitation process.

  13. 41 CFR 301-71.214 - Does mandatory use of the Government contractor-issued travel charge card change the employee's...

    Science.gov (United States)

    2010-07-01

    ... the Government contractor-issued travel charge card change the employee's obligation to pay his/her travel card bill by the due date? 301-71.214 Section 301-71.214 Public Contracts and Property Management Federal Travel Regulation System TEMPORARY DUTY (TDY) TRAVEL ALLOWANCES AGENCY RESPONSIBILITIES 71-AGENCY...

  14. 41 CFR 301-75.201 - May we allow the interviewee to use individual Government contractor-issued charge cards for pre...

    Science.gov (United States)

    2010-07-01

    ... interviewee to use individual Government contractor-issued charge cards for pre-employment interview travel? 301-75.201 Section 301-75.201 Public Contracts and Property Management Federal Travel Regulation System TEMPORARY DUTY (TDY) TRAVEL ALLOWANCES AGENCY RESPONSIBILITIES 75-PRE-EMPLOYMENT INTERVIEW TRAVEL...

  15. Experimental study on the supercritical startup and heat transport capability of a neon-charged cryogenic loop heat pipe

    International Nuclear Information System (INIS)

    Guo, Yuandong; Lin, Guiping; He, Jiang; Bai, Lizhan; Zhang, Hongxing; Miao, Jianyin

    2017-01-01

    Highlights: • A neon-charged CLHP integrated with a G-M cryocooler was designed and investigated. • The CLHP can realize the supercritical startup with an auxiliary heat load of 1.5 W. • Maximum heat transport capability of the CLHP was 4.5 W over a distance of 0.6 m. • There existed an optimum auxiliary heat load to expedite the supercritical startup. • There existed an optimum charged pressure to reach the largest heat transfer limit. - Abstract: Neon-charged cryogenic loop heat pipe (CLHP) can realize efficient cryogenic heat transport in the temperature range of 30–40 K, and promises great application potential in the thermal control of future space infrared exploration system. In this work, extensive experimental studies on the supercritical startup and heat transport capability of a neon-charged CLHP integrated with a G-M cryocooler were carried out, where the effects of the auxiliary heat load applied to the secondary evaporator and charged pressure of the working fluid were investigated. Experimental results showed that the CLHP could successfully realize the supercritical startup with an auxiliary heat load of 1.5 W, and there existed an optimum auxiliary heat load and charged pressure of the working fluid respectively, to achieve the maximum temperature drop rate of the primary evaporator during the supercritical startup. The CLHP could reach a maximum heat transport capability of 4.5 W over a distance of 0.6 m corresponding to the optimum charged pressure of the working fluid; however, the heat transport capability decreased with the increase of the auxiliary heat load. Furthermore, the inherent mechanisms responsible for the phenomena observed in the experiments were analyzed and discussed, to provide a better understanding from the theoretical view.

  16. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

    2010-01-01

    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  17. Local charge transport properties of hydrazine reduced monolayer graphene oxide sheets prepared under pressure condition

    DEFF Research Database (Denmark)

    Ryuzaki, Sou; Meyer, Jakob Abild Stengaard; Petersen, Søren Vermehren

    2014-01-01

    Charge transport properties of chemically reduced graphene oxide (RGO) sheets prepared by treatment with hydrazine were examined using conductive atomic force microscopy. The current-voltage (I-V) characteristics of monolayer RGO sheets prepared under atmospheric pressure followed an exponentially...... increase due to 2D variable-range hopping conduction through small graphene domains in an RGO sheet containing defect regions of residual sp3carbon clusters bonded to oxygen groups, whereas RGO sheets prepared in a closed container under moderate pressure showed linear I-V characteristics...... with a conductivity of 267.2-537.5S/m. It was found that the chemical reduction under pressure results in larger graphene domains (sp2networks) in the RGO sheets when compared to that prepared under atmospheric pressure, indicating that the present reduction of GO sheets under the pressure is one of the effective...

  18. Charge transport and storage of low programming voltage SONOS/MONOS memory devices

    Science.gov (United States)

    Libsch, Frank R.; White, Marvin H.

    1990-01-01

    In this paper, a model based on two carrier conduction (electrons and holes) at both injecting boundaries (semiconductor bulk and gate electrode) is introduced to interpret the ERASE/WRITE characteristics of scaled SONOS devices. The amphoteric statistics describe the positive and negative charging of the deep-level traps in the nitride "memory" layer. Scaled SONOS/MONOS (polysilicon-oxide-nitride-oxide-semiconductor)/(metal-oxide- nitride-oxide-semiconductor) transistors and capacitors with the bottom ('tunnel') oxide layer thickness around 20 Å, the final nitride layer thickness below 100 Å, and the top ('blocking') oxide layer thickness between 35-50 Å, have been fabricated and characterized. The results of the model are consistent with the experimental data, which permits physical insight into the mechanisms of charge injection, transport and storage during the ERASE/WRITE operation. Lattice imaging electron microscopy (TEM), ellipsometry, electrical capacitance, and chemical etchback techniques have been used to determine scaled SONOS/MONOS material parameters. The linear voltage ramp technique, which simultaneously measures the flatband voltage shift and separates the charges at the injecting boundary, and the dynamic pulse techniques of flatband tracking and threshold monitoring, which measure ERASE/WRITE, retention and endurance operations, have been employed to electrically characterize the scaled SONOS/MONOS devices. We have demonstrated a differential, saturated ERASE/WRITE flatband shift of 3.8 V with a ±5 V programming voltage for scaled-down SONOS/MONOS devices with dimensions of 20 Å for the tunnel oxide, 50 Å for the nitride, and 35 Å for the blocking oxide. With ±5 V saturated ERASE/WRITE programming voltages and 10 6 ERASE/WRITE cycles, extrapolated retention gives a projected 10 year 0.5 V memory window at room temperature.

  19. Electron-Hole Symmetry Breaking in Charge Transport in Nitrogen-Doped Graphene.

    Science.gov (United States)

    Li, Jiayu; Lin, Li; Rui, Dingran; Li, Qiucheng; Zhang, Jincan; Kang, Ning; Zhang, Yanfeng; Peng, Hailin; Liu, Zhongfan; Xu, H Q

    2017-05-23

    Graphitic nitrogen-doped graphene is an excellent platform to study scattering processes of massless Dirac Fermions by charged impurities, in which high mobility can be preserved due to the absence of lattice defects through direct substitution of carbon atoms in the graphene lattice by nitrogen atoms. In this work, we report on electrical and magnetotransport measurements of high-quality graphitic nitrogen-doped graphene. We show that the substitutional nitrogen dopants in graphene introduce atomically sharp scatters for electrons but long-range Coulomb scatters for holes and, thus, graphitic nitrogen-doped graphene exhibits clear electron-hole asymmetry in transport properties. Dominant scattering processes of charge carriers in graphitic nitrogen-doped graphene are analyzed. It is shown that the electron-hole asymmetry originates from a distinct difference in intervalley scattering of electrons and holes. We have also carried out the magnetotransport measurements of graphitic nitrogen-doped graphene at different temperatures and the temperature dependences of intervalley scattering, intravalley scattering, and phase coherent scattering rates are extracted and discussed. Our results provide an evidence for the electron-hole asymmetry in the intervalley scattering induced by substitutional nitrogen dopants in graphene and shine a light on versatile and potential applications of graphitic nitrogen-doped graphene in electronic and valleytronic devices.

  20. Temperature-mediated polymorphism in molecular crystals: The impact on crystal packing and charge transport

    KAUST Repository

    Stevens, Loah A.

    2015-01-13

    We report a novel synthesis to ultra high purity 7,14-bis((trimethylsilyl)ethynyl)dibenzo[b,def]-chrysene (TMS-DBC) and the use of this material in the growth of single crystals by solution and vapor deposition techniques. We observe that the substrate temperature has a dramatic impact on the crystal growth, producing two distinct polymorphs of TMS-DBC; low temperature (LT) fine red needles and high temperature (HT) large yellow platelets. Single crystal X-ray crystallography confirms packing structures where the LT crystals form a 1D slipped-stack structure, while the HT crystals adopt a 2D brickwork motif. These polymorphs also represent a rare example where both are extremely stable and do not interconvert to the other crystal structure upon solvent or thermal annealing. Single crystal organic field-effect transistors of the LT and HT crystals show that the HT 2D brickwork motif produces hole mobilities as high as 2.1 cm2 V-1 s-1, while the mobility of the 1D structure is significantly lower, at 0.028 cm2 V-1 s-1. Electronic-structure calculations indicate that the superior charge transport in the brickwork polymorph in comparison to the slipped-stack polymorph is due to the presence of an increased dimensionality of the charge migration pathways.

  1. Momentum transfer theory of non-conservative charged particle transport in crossed electric and magnetic fields

    International Nuclear Information System (INIS)

    Vrhovac, S.B.; Petrovic, Z.Lj.

    1995-01-01

    Momentum - transfer approximation is applied to momentum and energy balance equations describing reacting particle swarms in gases in crossed electric and magnetic fields. Transport coefficients of charged particles undergoing both inelastic and reactive, non-particle-conserving collisions with a gas of neutral molecules are calculated. Momentum - transfer theory (MTT) has been developed mainly by Robson and collaborators. It has been applied to a single reactive gas and mixtures of reactive gases in electric field only. MTT has also been applied in crossed electric and magnetic fields recently and independently of our work but the reactive collisions were not considered. Consider a swarm of electrons of charge e and mass m moving with velocity rvec v through a neutral gas under the influence of an applied electric rvec E and magnetic rvec B field. The collision processes which we shall investigate are limited to elastic, inelastic and reactive collisions of electrons with gas molecules. Here we interpret reactive collisions as collisions which produce change in number of the swarm particles. Reactive collisions involve creation (ionization by electron impact) or loss (electron attachment) of swarm particles. We consider only single ionization in approximation of the mass ratio m/m 0 0 are masses of electrons and neutral particles, respectively. We assume that the stage of evolution of the swarm is the hydrodynamic limit (HDL). In HDL, the space - time dependence of all properties is carried by the number density n of swarm particles

  2. Mode-selective vibrational modulation of charge transport in organic electronic devices

    KAUST Repository

    Bakulin, Artem A.

    2015-08-06

    The soft character of organic materials leads to strong coupling between molecular, nuclear and electronic dynamics. This coupling opens the way to influence charge transport in organic electronic devices by exciting molecular vibrational motions. However, despite encouraging theoretical predictions, experimental realization of such approach has remained elusive. Here we demonstrate experimentally that photoconductivity in a model organic optoelectronic device can be modulated by the selective excitation of molecular vibrations. Using an ultrafast infrared laser source to create a coherent superposition of vibrational motions in a pentacene/C60 photoresistor, we observe that excitation of certain modes in the 1,500–1,700 cm−1 region leads to photocurrent enhancement. Excited vibrations affect predominantly trapped carriers. The effect depends on the nature of the vibration and its mode-specific character can be well described by the vibrational modulation of intermolecular electronic couplings. This presents a new tool for studying electron–phonon coupling and charge dynamics in (bio)molecular materials.

  3. Focused transport of intense charged particle beams. Final technical report FY/93

    International Nuclear Information System (INIS)

    1997-01-01

    Many recent developments in accelerator technology have increased the need for a better understanding of the physics of intense-beam transport. Of particular interest to the work described here is the appearance, as beam intensities are increased, of a class of nonlinear phenomena which involve the collective interaction of the beam particles. Beam intensity, used as a measure of the importance of space-charge collective behavior, depends on the ratio of current to emittance. The nonlinear beam dynamics, and any resulting emittance growth, which are characteristic of the intense-beam regime, can therefore occur even at low currents in any accelerator system with sufficiently high intensity, especially in the low beta section. Furthermore, since emittance of a beam is difficult to reduce, the ultimate achievement of necessary beam luminosities requires the consideration of possible causes of longitudinal and transverse emittance growth at every stage of the beam lifetime. The research program described here has addressed the fundamental physics which comes into play during the transport, acceleration and focusing of intense beams. Because of the long term and ongoing nature of the research program discussed here, this report is divided into two sections. The first section constitutes a long term revue of the accomplishments which have resulted from the research effort reported, especially in pioneering the use of particle-in-cell (PIC) computer simulation techniques for simulation of the dynamics of space-charge-dominated beams in particle accelerators. The following section emphasizes, in more detail, the accomplishments of the FY 92/93 period immediately prior to the termination of this particular avenue of support. 41 refs

  4. Dihedral angle control to improve the charge transport properties of conjugated polymers in organic field effect transistors

    Science.gov (United States)

    Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam

    2018-03-01

    Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.

  5. Microscopic observation of lateral and vertical charge transportation in Si nanocrystals sandwiched by amorphous SiC layers

    Science.gov (United States)

    Xu, Jie; Ji, Yang; Lu, Peng; Bai, Gang; Ren, Qingying; Xu, Jun

    2018-01-01

    Charge injection and transportation process is a fundamental problem to Si nanocrystals (Si-ncs) based electric and photonic devices. In the manuscript, a single layer of Si-ncs sandwiched by amorphous Si carbide (a-SiC) was prepared by excimer laser annealing of a-SiC/a-Si/a-SiC multilayers, and the charging effect was then characterized by Kelvin probe force microscopy (KPFM) on the microscopic scale. Opposite charges were injected into Si-ncs through the biased tip and formed a core-ring or up-down shaped distribution. The decay characteristics showed that these opposite charges would not only vertically tunnel through the bottom a-SiC layer to substrate but also laterally transport and recombine with each other driven by the attractive Coulomb force. Besides, the charge retention time was also found dependent on the injection biases, which is tentatively ascribed to the charge trapping by the Si-ncs/a-SiC interface states under high bias scanning. The analysis was further supported by conductive atomic force microscopy (CAFM) measurement, in which the current-voltage curves gradually shifted during the repetition test, probably because of bias screening by the trapped charges at these interface states.

  6. In situ characterization of the film coverage and the charge transport in the alkylated-organic thin film transistor

    Science.gov (United States)

    Watanabe, Takeshi; Koganezawa, Tomoyuki; Kikuchi, Mamoru; Muraoka, Hiroki; Ogawa, Satoshi; Yoshimoto, Noriyuki; Hirosawa, Ichiro

    2018-03-01

    We propose an in situ experimental method of investigating the correlations of the film coverage of the organic semiconductor layers and charge transport properties of organic thin film transistors during vacuum deposition. The coverage of each monolayer was estimated using the intensity of off-specular diffuse scattering and diffraction. Experimental data were obtained from the in situ measurements of two-dimensional grazing incidence X-ray scattering and charge transport. The source-drain current increased over the film coverage of the first monolayer (= 0.48). This is in agreement with the critical percolation coverage, indicating that the conductivities of the first and second monolayers are different.

  7. Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps

    KAUST Repository

    Mei, Yaochuan

    2017-08-02

    The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.

  8. Spectra and Charge Transport of Polar Molecular Photoactive Layers Used for Solar Cells

    Directory of Open Access Journals (Sweden)

    Yuanzuo Li

    2015-01-01

    Full Text Available The ground state structures, HOMO and LUMO energy levels, band gaps ΔH-L, ionization potentials (IP, and electron affinities (EA of three types of copolymer P1 and its derivatives P2, P3, and PBDT-BTA were investigated by using density functional theory (DFT with B3LYP and 6-31G (d basis set. On the base of optimized structures of ground states, their absorption spectra were obtained by using TD-DFT//Cam-B3LYP/6-31 G (d. Research shows that with the increasing conjugated units, HOMO energy levels increased, LUMO energy levels decreased, and band gaps decreased gradually. Moreover, their ionization potentials decreased and electron affinities increased along with the increase of conjugated chains, and absorption spectra red-shifted. In addition, the side chain has a significant effect on the properties of ground and excited states. In order to investigate the influence of conjugated units and side chain on the charge transport, their hole and electron reorganization energies were calculated, and the results indicated that Pb have a good hole transport capability. Considering the practical application, the HOMO and LUMO energy levels, band gaps, and absorption spectra under external electric field were studied, and the results proved that the external electric field has an effect on the optical and electronic properties.

  9. Dopant effects on charge transport to enhance performance of phosphorescent white organic light emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Liping; Chen, Jiangshan; Ma, Dongge, E-mail: mdg1014@ciac.ac.cn [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, University of Chinese Academy of Sciences, Changchun 130022 (China)

    2015-11-07

    We compared the performance of phosphorescent white organic light emitting diodes (WOLEDs) with red-blue-green and green-blue-red sequent emissive layers. It was found that the influence of red and green dopants on electron and hole transport in emissive layers leads to the large difference in the efficiency of fabricated WOLEDs. This improvement mechanism is well investigated by the current density-voltage characteristics of single-carrier devices based on dopant doped emissive layers and the comparison of electroluminescent and photoluminescence spectra, and attributed to the different change of charge carrier transport by the dopants. The optimized device achieves a maximum power efficiency, current efficiency, and external quantum efficiency of 37.0 lm/W, 38.7 cd/A, and 17.7%, respectively, which are only reduced to 32.8 lm/W, 38.5 cd/A, and 17.3% at 1000 cd/m{sup 2} luminance. The critical current density is as high as 210 mA/cm{sup 2}. It can be seen that the efficiency roll-off in phosphorescent WOLEDs can be well improved by effectively designing the structure of emissive layers.

  10. NON-AXISYMMETRIC PERPENDICULAR DIFFUSION OF CHARGED PARTICLES AND THEIR TRANSPORT ACROSS TANGENTIAL MAGNETIC DISCONTINUITIES

    Energy Technology Data Exchange (ETDEWEB)

    Strauss, R. D.; Engelbrecht, N. E.; Dunzlaff, P. [Center for Space Research, North-West University, Potchefstroom, 2522 (South Africa); Roux, J. A. le [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 3585 (United States); Ruffolo, D., E-mail: dutoit.strauss@nwu.ac.za [Department of Physics, Faculty of Science, Mahidol University, Bangkok 10400 (Thailand)

    2016-07-01

    We investigate the transport of charged particles across magnetic discontinuities, focusing specifically on stream interfaces associated with co-rotating interaction regions in the solar wind. We argue that the magnetic field fluctuations perpendicular to the magnetic discontinuity, and usually also perpendicular to the mean magnetic field, are strongly damped in the vicinity of such a magnetic structure, leading to anisotropic perpendicular diffusion. Assuming that perpendicular diffusion arises from drifts in a turbulent magnetic field, we adopt a simplified approach to derive the relevant perpendicular diffusion coefficient. This approach, which we believe gives the correct principal dependences as expected from more elaborate calculations, allows us to investigate transport in different turbulent geometries, such as longitudinal compressional turbulence that may be present near the heliopause. Although highly dependent on the (possibly anisotropic) perpendicular length scales and turbulence levels, we generally find perpendicular diffusion to be strongly damped at magnetic discontinuities, which may in turn provide an explanation for the large particle gradients associated with these structures.

  11. Role of reduced pi-pi stacking in the charge transport in polyfluorene

    Energy Technology Data Exchange (ETDEWEB)

    Bajpai, Manisha, E-mail: mansa83@gmail.com [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Department of Physics, Banaras Hindu University, Varanasi 221005 (India); Srivastava, Ritu [Centre for Organic Electronics, National Physical Laboratory (Council of Scientific and Industrial Research), Dr. K. S. Krishnan Road, New Delhi 110012 (India); Dhar, Ravindra [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Tiwari, R.S. [Department of Physics, Banaras Hindu University, Varanasi 221005 (India)

    2016-10-15

    Highlights: • Role of bulky copolymer on the hole transport properties of polyfluorene thin films has been studied. • Photophysical measurement shows that the introduction of a SY in PFO effectively suppresses pi-stacking/aggregation of conjugated polymers in the solid state. • Current density decreases on blending for a given applied bias. - Abstract: We investigated the effect of blending of a bulky copolymer on the hole transport properties of poly (9,9-dihexyl fluorenyl-2,7-diyl)(PFO) thin films (∼120 nm) at different temperatures by obtaining the current density-voltage measurement. The poly (phenylenevinylene) based copolymer ‘‘Super Yellow” (SY) has been used as a blending component. Such polymer blending matrix is useful as it combines the host polymer (PFO) with the guest polymer of bulky side groups where pi-pi stacking is hindered by bulky side groups. This makes polyflorene much interesting and versatile material for lighting application. It has been found that the current density decreases on blending for a given applied bias. We demonstrated that the current conduction mechanism is bulk limited. It has been analyzed by trapped charge limited currents (TCLC) with electric field. We conclude that the relatively low hole mobility in blends as compared to pristine PFO would result due to increase in the pi-pi stacking distance and disorder.

  12. Third-Order Transport with MAD Input: A Computer Program for Designing Charged Particle Beam Transport Systems

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Karl

    1998-10-28

    TRANSPORT has been in existence in various evolutionary versions since 1963. The present version of TRANSPORT is a first-, second-, and third-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems.

  13. Characterization of Charge-Carrier Transport in Semicrystalline Polymers: Electronic Couplings, Site Energies, and Charge-Carrier Dynamics in Poly(bithiophene- alt -thienothiophene) [PBTTT

    KAUST Repository

    Poelking, Carl

    2013-01-31

    We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.

  14. Role of Individual Positive Charges in the Membrane Orientation and Activity of Transporters of the Small Multidrug Resistance Family

    NARCIS (Netherlands)

    Kolbusz, Magdalena A.; Slotboom, Dirk Jan; Lolkema, Juke S.

    2012-01-01

    The effect of individual positively charged residues on the orientation in the membrane was analyzed in three dual-topology transporters of the small. multidrug resistance (SMR) family: AAVE4701aave of Acidovorax avenae, EMREecol of Escherichia coli, and RRUA0272rrub of Rhodospirillum rubrum. It is

  15. Tuning electrical conductivity, charge transport, and ferroelectricity in epitaxial BaTiO3 films by Nb-doping

    Science.gov (United States)

    Jing, Xiaosai; Xu, Wenchao; Yang, Cheng; Feng, Jiajun; Zhang, Aihua; Zeng, Yanping; Qin, Minghui; Zeng, Min; Fan, Zhen; Gao, Jinwei; Gao, Xingsen; Zhou, Guofu; Lu, Xubing; Liu, J.-M.

    2017-05-01

    The electrical conductivity, charge transport behavior, and ferroelectricity of epitaxial BaNbxTi1-xO3 films (BNTO, 0.0 ≤ x ≤ 0.5) prepared by pulsed laser deposition are investigated. It is found that Nb-doping can tune the conventional insulating BaTiO3 films from an insulating to highly conductive semiconducting or metallic state, resulting in a variation of the electrical conductivity of the BNTO films over 105. For x ≤ 0.25, the charge transport is dominated by the small polaron hopping mechanism, while the charge transport for x = 0.5 transits from the bipolaron to the small-polaron, and then the thermal phonon scattering mechanisms with increasing temperature. Interestingly, the piezo-force microscopy imaging reveals the presence of ferroelectricity in the properly Nb-doped conductive BNTO films (x ≤ 0.25) deposited in the presence of a small amount of oxygen (3 × 10-3 Pa). Our work provides additional technical roadmaps to manipulate the conductivity and charge transport behaviors in ferroelectric films, which will boost potential applications in future information storage, sensors, and photovoltaic devices.

  16. Role of Li2O2@Li2CO3 Interfaces on Charge Transport in Nonaqueous Li−Air Batteries

    DEFF Research Database (Denmark)

    Mekonnen, Yedilfana Setarge; García Lastra, Juan Maria; Hummelshøj, Jens S.

    2015-01-01

    vacancies accumulate at the peroxide part of the interface during charge, reducing the coherent electron transport by two to three orders of magnitude compared with pristine Li2O2. During discharge, Li2O2@Li2CO3 interfaces may, however, provide an alternative in-plane channel for fast electron polaron...

  17. New aspects of light-induced charge transport in potassium tantalate crystals doped by copper and iron

    Czech Academy of Sciences Publication Activity Database

    Badalyan, A. G.; Azzoni, C. B.; Galinetto, P.; Mozzati, M. C.; Jastrabík, Lubomír; Rosa, Jan; Hrabovský, Miroslav; Syrnikov, P. P.; Trepakov, Vladimír

    2007-01-01

    Roč. 4, č. 3 (2007), s. 1368-1371 ISSN 1862-6351 R&D Projects: GA MŠk(CZ) 1M06002 Institutional research plan: CEZ:AV0Z10100521; CEZ:AV0Z10100522 Keywords : potassium tantalate crystals * light-induced charge transport Subject RIV: BH - Optics, Masers, Lasers

  18. Charge Transport Across Insulating Self-Assembled Monolayers: Non-equilibrium Approaches and Modeling To Relate Current and Molecular Structure

    NARCIS (Netherlands)

    Mirjani, F.; Thijssen, J.M.; Whitesides, G.M.; Ratner, M.A.

    2014-01-01

    This paper examines charge transport by tunneling across a series of electrically insulating molecules with the structure HS(CH2)4CONH(CH2)2R) in the form of self-assembled monolayers (SAMs), supported on silver. The molecules examined were studied experimentally by Yoon et al. (Angew. Chem. Int.

  19. Charge Recombination, Transport Dynamics, and Interfacial Effects in Organic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Heeger, Alan [Univ. of California, Santa Barbara, CA (United States); Bazan, Guillermo [Univ. of California, Santa Barbara, CA (United States); Nguyen, Thuc-Quyen [Univ. of California, Santa Barbara, CA (United States); Wudl, Fred [Univ. of California, Santa Barbara, CA (United States)

    2015-02-12

    The need for renewable sources of energy is well known. Conversion of sunlight to electricity using solar cells is one of the most important opportunities for creating renewable energy sources. The research carried out under DE-FG02-08ER46535 focused on the science and technology of “Plastic” solar cells comprised of organic (i.e. carbon based) semiconductors. The Bulk Heterojunction concept involves a phase separated blend of two organic semiconductors each with dimensions in the nano-meter length scale --- one a material that functions as a donor for electrons and the other a material that functions as an acceptor for electrons. The nano-scale inter-penetrating network concept for “Plastic” solar cells was created at UC Santa Barbara. A simple measure of the impact of this concept can be obtained from a Google search which gives 244,000 “hits” for the Bulk Heterojunction solar cell. Research funded through this program focused on four major areas: 1. Interfacial effects in organic photovoltaics, 2. Charge transfer and photogeneration of mobile charge carriers in organic photovoltaics, 3. Transport and recombination of the photogenerated charge carriers in organic photovoltaics, 4. Synthesis of novel organic semiconducting polymers and semiconducting small molecules, including conjugated polyelectrolytes. Following the discovery of ultrafast charge transfer at UC Santa Barbara in 1992, the nano-organic (Bulk Heterojunction) concept was formulated. The need for a morphology comprising two interpenetrating bicontinuous networks was clear: one network to carry the photogenerated electrons (negative charge) to the cathode and one network to carry the photo-generated holes (positive charge) to the anode. This remarkable self-assembled network morphology has now been established using Transmission electron Microscopy (TEM) either in the Phase Contrast mode or via TEM-Tomography. The steps involved in delivering power from a solar cell to an external circuit

  20. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    Energy Technology Data Exchange (ETDEWEB)

    Goodman, Samuel M.; Singh, Vivek [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Noh, Hyunwoo [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Cha, Jennifer N. [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Nagpal, Prashant, E-mail: pnagpal@colorado.edu [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); BioFrontiers Institute, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Renewable and Sustainable Energy Institute, University of Colorado Boulder, 2445 Kittredge Loop, Boulder, Colorado 80309 (United States)

    2015-02-23

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  1. Mechanisms Governing Interannual Variability of Stratosphere-to-Troposphere Ozone Transport

    Science.gov (United States)

    Albers, John R.; Perlwitz, Judith; Butler, Amy H.; Birner, Thomas; Kiladis, George N.; Lawrence, Zachary D.; Manney, Gloria L.; Langford, Andrew O.; Dias, Juliana

    2018-01-01

    Factors governing the strength and frequency of stratospheric ozone intrusions over the Pacific-North American region are considered for their role in modulating tropospheric ozone on interannual timescales. The strength of the association between two major modes of climate variability—the El Niño-Southern Oscillation (ENSO) and the Northern Annular Mode (NAM)—and the amount of ozone contained in stratospheric intrusions are tested in the context of two mechanisms that modulate stratosphere-to-troposphere transport (STT) of ozone: (StratVarO3) the winter season buildup of ozone abundances in the lowermost stratosphere (LMS) and (JetVar) Pacific jet and wave breaking variability during spring. In essence, StratVarO3 corresponds to variability in the amount of ozone per intrusion, while JetVar governs the frequency of intrusions. The resulting analysis, based on two different reanalysis products, suggests that StratVarO3 is more important than JetVar for driving interannual variations in STT of ozone over the Pacific-North American region. In particular, the abundance of ozone in the LMS at the end of winter is shown to be a robust indicator of the amount of ozone that will be contained in stratospheric intrusions during the ensuing spring. Additionally, it is shown that the overall strength of the winter season stratospheric NAM is a useful predictor of ozone intrusion strength. The results also suggest a nuanced relationship between the phase of ENSO and STT of ozone. While ENSO-related jet variability is associated with STT variability, it is wave breaking frequency rather than typical ENSO teleconnection patterns that is responsible for the ENSO-STT relationship.

  2. Impact of charge transport on current–voltage characteristics and power-conversion efficiency of organic solar cells

    Science.gov (United States)

    Würfel, Uli; Neher, Dieter; Spies, Annika; Albrecht, Steve

    2015-01-01

    This work elucidates the impact of charge transport on the photovoltaic properties of organic solar cells. Here we show that the analysis of current–voltage curves of organic solar cells under illumination with the Shockley equation results in values for ideality factor, photocurrent and parallel resistance, which lack physical meaning. Drift-diffusion simulations for a wide range of charge-carrier mobilities and illumination intensities reveal significant carrier accumulation caused by poor transport properties, which is not included in the Shockley equation. As a consequence, the separation of the quasi Fermi levels in the organic photoactive layer (internal voltage) differs substantially from the external voltage for almost all conditions. We present a new analytical model, which considers carrier transport explicitly. The model shows excellent agreement with full drift-diffusion simulations over a wide range of mobilities and illumination intensities, making it suitable for realistic efficiency predictions for organic solar cells. PMID:25907581

  3. Manipulation of Chain Conformation for Optimum Charge-Transport Pathways in Conjugated Polymers.

    Science.gov (United States)

    Jeon, Seolhee; Lee, Jung Hun; Park, Jai Il; Jo, Bonghyun; Whang, Dong Ryeol; Ahn, Tae Kyu; Park, Hui Joon; Kim, Sung Dong; Lee, Wi Hyoung; Kim, Bong-Gi

    2017-07-12

    A pair of different diketopyrrolopyrrole-based conjugated polymers (CPs) were designed and synthesized to investigate the effect of chain conformation on their molecular assembly. Conformation management was achieved by the incorporation of different linkers during polymerization. Through the use of computational calculations and UV-vis absorption measurements, the resulting CPs (PDPP-T and PDPP-BT) were found to exhibit partly modulated chain geometry. Grazing incident X-ray diffraction experiments with a two-dimensional detector revealed that PDPP-T having a planar chain conformation exhibited an edge-on type molecular arrangement, which evolved to a face-on type chain assembly when the planar geometry was altered to a slightly twisted one as in PDPP-BT. In addition, it was verified that the directional electric carrier mobility of CPs was critically distinguished by the distinctive chain arrangement in spite of their similar chemical structure. Concentration-dependent absorption measurements could provide an improved understanding of the assembly mechanism of CP chains: the planar conformation of PDPP-T facilitates the formation of preassembled chains in a concentrated solution and further directs the edge-on stacking, while the twisted dihedral angle along the benzothiophene in PDPP-BT prevents chain assembly, resulting in the face-on stacking. Because CP chain conformation is inevitably connected with the generation of preassembled chains, manipulating CP geometry could be an efficient tool for extracting an optimum chain assembly that is connected with the principal charge-transport pathway in CPs.

  4. Pure crystal orientation and anisotropic charge transport in large-area hybrid perovskite films

    KAUST Repository

    Cho, Nam Chul

    2016-11-10

    Controlling crystal orientations and macroscopic morphology is vital to develop the electronic properties of hybrid perovskites. Here we show that a large-area, orientationally pure crystalline (OPC) methylammonium lead iodide (MAPbI3) hybrid perovskite film can be fabricated using a thermal-gradient-assisted directional crystallization method that relies on the sharp liquid-to-solid transition of MAPbI3 from ionic liquid solution. We find that the OPC films spontaneously form periodic microarrays that are distinguishable from general polycrystalline perovskite materials in terms of their crystal orientation, film morphology and electronic properties. X-ray diffraction patterns reveal that the film is strongly oriented in the (112) and (200) planes parallel to the substrate. This film is structurally confined by directional crystal growth, inducing intense anisotropy in charge transport. In addition, the low trap-state density (7.9 × 1013 cm−3) leads to strong amplified stimulated emission. This ability to control crystal orientation and morphology could be widely adopted in optoelectronic devices.

  5. Molecular weight dependent structure and charge transport in MAPLE-deposited poly(3-hexylthiophene) thin films

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Ban Xuan [Department of Materials Science and Engineering, Biointerfaces Institute, University of Michigan, Ann Arbor Michigan 48109; Smith, Mitchell [Department of Chemistry, University of Michigan, Ann Arbor Michigan 48109; Strzalka, Joseph [X-Ray Science Division, Argonne National Laboratory, Argonne Illinois 60439; Li, Huanghe [Macromolecular Science and Engineering, University of Michigan, Ann Arbor Michigan 48109; McNeil, Anne J. [Department of Chemistry, University of Michigan, Ann Arbor Michigan 48109; Macromolecular Science and Engineering, University of Michigan, Ann Arbor Michigan 48109; Stein, Gila E. [Department of Chemical and Biomolecular Engineering, University of Tennessee, Knoxville Tennessee 37996; Green, Peter F. [Department of Materials Science and Engineering, Biointerfaces Institute, University of Michigan, Ann Arbor Michigan 48109; Macromolecular Science and Engineering, University of Michigan, Ann Arbor Michigan 48109; National Renewable Energy Laboratory, 15013 Denver W Pkwy, Golden Colorado 80401

    2018-02-06

    In this work, poly(3-hexylthiophene) (P3HT) films prepared using the matrix-assisted pulsed laser evaporation (MAPLE) technique are shown to possess morphological structures that are dependent on molecular weight (MW). Specifically, the structures of low MW samples of MAPLE-deposited film are composed of crystallites/aggregates embedded within highly disordered environments, whereas those of high MW samples are composed of aggregated domains connected by long polymer chains. Additionally, the crystallite size along the side-chain (100) direction decreases, whereas the conjugation length increases with increasing molecular weight. This is qualitatively similar to the structure of spin-cast films, though the MAPLE-deposited films are more disordered. In-plane carrier mobilities in the MAPLE-deposited samples increase with MW, consistent with the notion that longer chains bridge adjacent aggregated domains thereby facilitating more effective charge transport. The carrier mobilities in the MAPLE-deposited simples are consistently lower than those in the solvent-cast samples for all molecular weights, consistent with the shorter conjugation length in samples prepared by this deposition technique.

  6. Organic 2D Optoelectronic Crystals: Charge Transport, Emerging Functions, and Their Design Perspective.

    Science.gov (United States)

    Park, Sang Kyu; Kim, Jin Hong; Park, Soo Young

    2018-04-16

    2D organic semiconductor crystals are emerging as a fascinating platform with regard to their applications in organic field-effect transistors (OFETs), attributed to their enhanced charge transport efficiency and their new optoelectronic functions, based on their unique morphological features. Advances in material processing techniques have not only enabled easy fabrication of few-monolayered 2D nanostructures but also facilitated exploration of the interesting properties induced by characteristic 2D morphologies. However, to date, only a limited number of representative organic semiconductors have been utilized in organic 2D optoelectronics. Therefore, in order to further spur this research, an intuitive crystal engineering principle for realizing organic 2D crystals is required. In this regard, here, not only the important implications of applying 2D structures to OFET devices are discussed but also a crystal engineering protocol is provided that first predicts molecular arrangements depending on the molecular factors, which is followed by realizing 2D supramolecular synthon networks for different molecular packing motifs. It is expected that 2D organic semiconductor crystals developed by this approach will pave a promising way toward next-generation organic 2D optoelectronics. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Photoconductivity enhancement and charge transport properties in ruthenium-containing block copolymer/carbon nanotube hybrids.

    Science.gov (United States)

    Lo, Kin Cheung; Hau, King In; Chan, Wai Kin

    2018-04-05

    Functional polymer/carbon nanotube (CNT) hybrid materials can serve as a good model for light harvesting systems based on CNTs. This paper presents the synthesis of block copolymer/CNT hybrids and the characterization of their photocurrent responses by both experimental and computational approaches. A series of functional diblock copolymers was synthesized by reversible addition-fragmentation chain transfer polymerizations for the dispersion and functionalization of CNTs. The block copolymers contain photosensitizing ruthenium complexes and modified pyrene-based anchoring units. The photocurrent responses of the polymer/CNT hybrids were measured by photoconductive atomic force microscopy (PCAFM), from which the experimental data were analyzed by vigorous statistical models. The difference in photocurrent response among different hybrids was correlated to the conformations of the hybrids, which were elucidated by molecular dynamics simulations, and the electronic properties of polymers. The photoresponse of the block copolymer/CNT hybrids can be enhanced by introducing an electron-accepting block between the photosensitizing block and the CNT. We have demonstrated that the application of a rigorous statistical methodology can unravel the charge transport properties of these hybrid materials and provide general guidelines for the design of molecular light harvesting systems.

  8. Study of charge Transport in Silicon Detectors Non-Irradiated and Irradiated

    CERN Document Server

    Leroy, C; Casse, G L; Glaser, M; Grigoriev, E; Lemeilleur, F

    1998-01-01

    The electrical characteristics of silicon detectors (standard planar float zone and MESA detectors) as a function of the particle fluence can be extracted by the application of a model describing the transport of charge carriers generated in the detectors by ionizing particles. The current pulse response induced by $\\alpha$ and $\\beta$ particles in non-irradiated detectors and detectors irradiated up to fluences $\\Phi \\approx 3 \\cdot 10^{14}$ particles/cm$^2$ is reproduced via this model: i) by adding a small n-type region 15 $\\mu$m deep on the $p^+$ side for the detectors at fluences beyond the n to p-type inversion and ii) for the MESA detectors, by considering one additional dead layer of 14 $\\mu$m (observed experimentally) on each side of the detector, and introducing a second (delayed) component to the current pulse response. For both types of detectors, the model gives mobilities decreasing linearily up to fluences of about $5 \\cdot 10^{13}$ particles/cm$^2$ and converging, beyond, to saturation values ...

  9. Charge transport mechanism and low temperature phase transitions in KIO3

    Science.gov (United States)

    Abdel Kader, M. M.; El-Kabbany, F.; Naguib, H. M.; Gamal, W. M.

    2013-04-01

    Our report deals with the measurement of some electrical properties, namely the ac conductivity σ(ω,T) and the complex dielectric permittivity epsilon*(ω, T) in the temperature interval 95K < T < 280K and at some selected frequencies (0.7kHz - 20kHz) for polycrystalline samples of potassium iodate KIO3 using a computerized RLC meter. The improper character of the ferroelectricity over the mentioned temperature range has been achieved by recording the ferroelectric hysteresis loops. The temperature dependence of each electrical parameter reveals that the compound undergoes two phase transitions at T ≈ 258K and at T ≈ 110K. The frequency dependent conductivity seems to be in accordance with the power law σ(ω,T)αωs(T) and the trend of temperature dependence of the frequency exponent s (0 < s < 1) suggests that the quantum mechanical tunneling (QMT) model is the main mechanism of the charge transport. Comparison with the behavior of the NH4IO3 in the same temperature range was outlined.

  10. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    Science.gov (United States)

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  11. Influence of surface wettability on transport mechanisms governing water droplet evaporation.

    Science.gov (United States)

    Pan, Zhenhai; Weibel, Justin A; Garimella, Suresh V

    2014-08-19

    Prediction and manipulation of the evaporation of small droplets is a fundamental problem with importance in a variety of microfluidic, microfabrication, and biomedical applications. A vapor-diffusion-based model has been widely employed to predict the interfacial evaporation rate; however, its scope of applicability is limited due to incorporation of a number of simplifying assumptions of the physical behavior. Two key transport mechanisms besides vapor diffusion-evaporative cooling and natural convection in the surrounding gas-are investigated here as a function of the substrate wettability using an augmented droplet evaporation model. Three regimes are distinguished by the instantaneous contact angle (CA). In Regime I (CA ≲ 60°), the flat droplet shape results in a small thermal resistance between the liquid-vapor interface and substrate, which mitigates the effect of evaporative cooling; upward gas-phase natural convection enhances evaporation. In Regime II (60 ≲ CA ≲ 90°), evaporative cooling at the interface suppresses evaporation with increasing contact angle and counterbalances the gas-phase convection enhancement. Because effects of the evaporative cooling and gas-phase convection mechanisms largely neutralize each other, the vapor-diffusion-based model can predict the overall evaporation rates in this regime. In Regime III (CA ≳ 90°), evaporative cooling suppresses the evaporation rate significantly and reverses entirely the direction of natural convection induced by vapor concentration gradients in the gas phase. Delineation of these counteracting mechanisms reconciles previous debate (founded on single-surface experiments or models that consider only a subset of the governing transport mechanisms) regarding the applicability of the classic vapor-diffusion model. The vapor diffusion-based model cannot predict the local evaporation flux along the interface for high contact angle (CA ≥ 90°) when evaporative cooling is strong and the

  12. A multi-agent quantum Monte Carlo model for charge transport: Application to organic field-effect transistors

    International Nuclear Information System (INIS)

    Bauer, Thilo; Jäger, Christof M.; Jordan, Meredith J. T.; Clark, Timothy

    2015-01-01

    We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves

  13. Morphological and charge transport properties of amorphous and crystalline P3HT and PBTTT: insights from theory.

    Science.gov (United States)

    Alberga, Domenico; Perrier, Aurélie; Ciofini, Ilaria; Mangiatordi, Giuseppe Felice; Lattanzi, Gianluca; Adamo, Carlo

    2015-07-28

    We explore the relation between the morphological and the charge transport properties of poly(3-hexylthiophene) (P3HT) and poly(2,5-bis(3-alkylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT) semiconductor polymers in both amorphous and crystalline phases. Using molecular dynamics to simulate bulk supercells and the Marcus theory to analyze the transport properties we found that amorphous systems display a reduced hole mobility due to the loss of nematic order and π-π stacking leading to a reduction in the electronic coupling between two chains. In the crystal phase, PBTTT displays a larger charge mobility than P3HT due to the interdigitation of the side chains enhancing the stability of the conjugated rings on the backbones. This more stable π-π stacking reduces the energetic disorder with respect to P3HT and increases the electronic coupling. In contrast, in the amorphous phase, PBTTT displays a reduced charge mobility with respect to P3HT due to the absence of side chains attached to the thienothiophenes, which increases their fluctuations and the energetic disorder. In addition, we show that it is possible to calculate the reorganization energy neglecting the side chains of the polymers and thus saving computational time. Within this approximation, we obtained mobility values matching the experimental measurements, thus confirming that the side chains are crucial to shape the morphology of the polymeric systems but are not involved in the charge transport process.

  14. Description of charge transport in polyethylene using a fluid model with a constant mobility: fitting model and experiments

    International Nuclear Information System (INIS)

    Le Roy, S; Teyssedre, G; Laurent, C; Montanari, G C; Palmieri, F

    2006-01-01

    A numerical model for describing bipolar charge transport and storage in polyethylene has been developed recently. The present paper proposes a comparison of the model outputs with experimental data in three different direct current (DC) voltage application protocols (step field increase and polarization/depolarization schemes). Three kinds of measurement have been realized for the three different protocols: space charge distribution using the pulsed electro-acoustic method, external current and electroluminescence. Simulation under AC stress has also been attempted on the basis of the model parameters that were derived from the DC case. Model limitations and possible improvements are discussed

  15. Optically induced charge transport in mesoscopic semiconductor systems; Optisch induzierter Ladungstransport in mesoskopischen Halbleitersystemen

    Energy Technology Data Exchange (ETDEWEB)

    Hof, Klaus-Dieter

    2009-07-13

    In the framework of this thesis optoelectronic processes in a to a quantum-dot contact nanostructured heterostructure were studied. In the experiment thereby by means of a laser in a 2DES heterostructure charge carriers were optically induced in the neighbourhood of a quantum-dot contact. Thereafter their effect on the electronic transport through the quantum-dot contact in the sample is studied. In the planely etched samples the purely electronic conductivity measurements indicate with the conductivity stages a one-dimensional subband quantization. The energetic distance of the subband bottoms amounts up to 5 meV. Furthermore the measurement in the magnetic field shows a transition of the subband structure over magnetoelectric bands to the pure Landau quantization. First photoresponse measurement s show under illumination the effect of an unwanted parallel conductivity. This effect can be suppressed by changed sample design and optimized wafer material. By this photoresponse measurements on the free-sttanding bridge samples and planely etched qunatum-dot contact samples. In low-frequency photoresponse measurements in both sample types the effect of an optically induced conductivity change can be identified. A simple model of the optically induced photoconductivity is introduced, which shows in the framework of a numerical simulation a very good agreement with the measurement data and allows the identification of the experimentally determined time constant. By application of for radiofrequencies suited components the experiment can be performed also at higher-frequent modulation of the optical excitation. Thereby it was proved that the effect of the photoinduced conductivity change because of its relatively high time constant generates for excitations in the MHz range a quasi-static conductivity state and the sample conductivity experiences therefore on a fast time scale no change.

  16. The impact of membrane surface charges on the ion transport in MoS2 nanopore power generators

    Science.gov (United States)

    Huang, Zhuo; Zhang, Yan; Hayashida, Tomoki; Ji, Ziwei; He, Yuhui; Tsutsui, Makusu; Miao, Xiang Shui; Taniguchi, Masateru

    2017-12-01

    Recent experiments demonstrated giant osmotic effects induced in a single-atomic-layer MoS2 nanopore by imposing a KCl concentration bias, thereby highlighting the prospect of ultrathin nanopores as power generators. In this work, we report on an electrokinetic analysis of the ionic transport in the MoS2 nanopore system. By taking membrane surface chemistry into account, we found profound roles of surface charges in and out of the nanopore on the cross-pore ion transport, which shed light on the intriguing experimental observations of a high pore conductance with a large open-circuit voltage in the MoS2 system. The present work establishes a theoretical model capable of dealing with ultrathin membrane surface charges for evaluating the energy conversion performance of nanopore power generators constructed with two-dimensional materials.

  17. Role of redox centre in charge transport investigated by novel self-assembled conjugated polymer molecular junctions.

    Science.gov (United States)

    Wang, Zongrui; Dong, Huanli; Li, Tao; Hviid, Rune; Zou, Ye; Wei, Zhongming; Fu, Xiaolong; Wang, Erjing; Zhen, Yonggang; Nørgaard, Kasper; Laursen, Bo W; Hu, Wenping

    2015-06-18

    Molecular electronics describes a field that seeks to implement electronic components made of molecular building blocks. To date, few studies have used conjugated polymers in molecular junctions despite the fact that they potentially transport charge more efficiently than the extensively investigated small-molecular systems. Here we report a novel type of molecular tunnelling junction exploring the use of conjugated polymers, which are self-assembled into ultrathin films in a distinguishable 'planar' manner from the traditional vertically oriented small-molecule monolayers. Electrical measurements on the junctions reveal molecular-specific characteristics of the polymeric molecules in comparison with less conjugated small molecules. More significantly, we decorate redox-active functionality into polymeric backbones, demonstrating a key role of redox centre in the modulation of charge transport behaviour via energy level engineering and external stimuli, and implying the potential of employing tailor-made polymeric components as alternatives to small molecules for future molecular-scale electronics.

  18. Influence of orientation mismatch on charge transport across grain boundaries in tri-isopropylsilylethynyl (TIPS) pentacene thin films.

    Science.gov (United States)

    Steiner, Florian; Poelking, Carl; Niedzialek, Dorota; Andrienko, Denis; Nelson, Jenny

    2017-05-03

    We present a multi-scale model for charge transport across grain boundaries in molecular electronic materials that incorporates packing disorder, electrostatic and polarisation effects. We choose quasi two-dimensional films of tri-isopropylsilylethynyl pentacene (TIPS-P) as a model system representative of technologically relevant crystalline organic semiconductors. We use atomistic molecular dynamics, with a force-field specific for TIPS-P, to generate and equilibrate polycrystalline two-dimensional thin films. The energy landscape is obtained by calculating contributions from electrostatic interactions and polarization. The variation in these contributions leads to energetic barriers between grains. Subsequently, charge transport is simulated using a kinetic Monte-Carlo algorithm. Two-grain systems with varied mutual orientation are studied. We find relatively little effect of long grain boundaries due to the presence of low impedance pathways. However, effects could be more pronounced for systems with limited inter-grain contact areas. Furthermore, we present a lattice model to generalize the model for small molecular systems. In the general case, depending on molecular architecture and packing, grain boundaries can result in interfacial energy barriers, traps or a combination of both with qualitatively different effects on charge transport.

  19. Kelvin Probe Force Microscopy and Calculation of Charge Transport in a Graphene/Silicon Dioxide System at Different Relative Humidity.

    Science.gov (United States)

    Konečný, Martin; Bartošík, Miroslav; Mach, Jindřich; Švarc, Vojtěch; Nezval, David; Piastek, Jakub; Procházka, Pavel; Cahlík, Aleš; Šikola, Tomáš

    2018-04-11

    The article shows how the dynamic mapping of surface potential (SP) measured by Kelvin probe force microscopy (KPFM) in combination with calculation by a diffusion-like equation and the theory based on the Brunauer-Emmett-Teller (BET) model of water condensation and electron hopping can provide the information concerning the resistivity of low conductive surfaces and their water coverage. This is enabled by a study of charge transport between isolated and grounded graphene sheets on a silicon dioxide surface at different relative humidity (RH) with regard to the use of graphene in ambient electronic circuits and especially in sensors. In the experimental part, the chemical vapor-deposited graphene is precisely patterned by the mechanical atomic force microscopy (AFM) lithography and the charge transport is studied through a surface potential evolution measured by KPFM. In the computational part, a quantitative model based on solving the diffusion-like equation for the charge transport is used to fit the experimental data and thus to find the SiO 2 surface resistivity ranging from 10 7 to 10 10 Ω and exponentially decreasing with the RH increase. Such a behavior is explained using the formation of water layers predicted by the BET adsorption theory and electron-hopping theory that for the SiO 2 surface patterned by AFM predicts a high water coverage even at low RHs.

  20. Acceptor-compensated charge transport and surface chemical reactions in Au-implanted SnO₂ nanowires.

    Science.gov (United States)

    Katoch, Akash; Sun, Gun-Joo; Choi, Sun-Woo; Hishita, Shunichi; Kulish, Vadym V; Wu, Ping; Kim, Sang Sub

    2014-04-09

    A new deep acceptor state is identified by density functional theory calculations, and physically activated by an Au ion implantation technique to overcome the high energy barriers. And an acceptor-compensated charge transport mechanism that controls the chemical sensing performance of Au-implanted SnO2 nanowires is established. Subsequently, an equation of electrical resistance is set up as a function of the thermal vibrations, structural defects (Au implantation), surface chemistry (1 ppm NO2), and solute concentration. We show that the electrical resistivity is affected predominantly not by the thermal vibrations, structural defects, or solid solution, but the surface chemistry, which is the source of the improved chemical sensing. The response and recovery time of chemical sensing is respectively interpreted from the transport behaviors of major and minor semiconductor carriers. This acceptor-compensated charge transport mechanism provides novel insights not only for sensor development but also for research in charge and chemical dynamics of nano-semiconductors.

  1. Hot Charging and Transporting to Continuous Discussion on Casting Slab at Tanggang

    Directory of Open Access Journals (Sweden)

    Dai Jun

    2017-01-01

    Full Text Available This paper introduces technological design and equipment of hot delivery and hot charge in Tanggang and Steel Co and its notable economic benefit.At the same ,the difficulty and problems in realizing hot delivery and charge are point out.

  2. Charge transport in polycrystalline alumina materials: application to the optimization of dielectric breakdown strength; Transport de charges dans les alumines polycristallines: application a l'optimisation de la rigidite dielectrique

    Energy Technology Data Exchange (ETDEWEB)

    Touzin, M.

    2005-12-15

    Dielectric breakdown constitutes an important limitation in the use of insulating materials under high-tension since it leads to the local fusion and the sublimation of material. The microstructure (average grain size, intergranular phase) has a great influence on the ability of material to resist this catastrophic phenomenon. Indeed, the interfaces between the various phases constitute potential sites of trapping for the charges. The optimization of the dielectric breakdown strength of a polycrystalline alumina sintered with a liquid phase passes necessarily through the control of the microstructural parameters. Thus, it is shown that by controlling the conditions of the process (rate of sintering aids, powder grain size and thermal cycle), it is possible to control the density (by the average grain size) but also the nature (by the crystallization or not of anorthite) of the grain boundaries. The study of the influence of these two parameters as well temperature on the properties of charge transport and storage was carried out by methods ICM and SEMME. The results, interpreted in light of the numerical simulation of the charge transport in bulk alumina sample during electron beam irradiation, allowed to highlight behaviors, and the corresponding microstructures, favourable to the dielectric breakdown resistance according to the considered temperature. Thus, at room temperature a high density of interfaces (low grain size and crystallized intergranular phase) makes it possible material to durably trap a great amount of charges, which leads to a high dielectric strength. On the other hand, at higher temperature, the presence of shallow traps (vitreous intergranular phase) supports the charge diffusion and makes it possible to delay breakdown. (author)

  3. Surface potential, charging and local current transport of individual Ge quantum dots grown by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Singha, R.K. [Department of Physics, Visva-Bharati, Santiniketan 731235 (India); Manna, S.; Bar, R.; Das, S. [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India); Ray, S.K., E-mail: physkr@phy.iitkgp.ernet.in [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India)

    2017-06-15

    Highlights: We have elaborately explained the individual Ge QD charging phenomena and current transport, which is very important to understand the Ge/Si nano devices. This paper will give a flavor to properly understand these phenomena linked together along with the photocurrent mechanism which is related to the Ge/Si valence band offset. • Both the CAFM and KPFM techniques point out the functionality of doping nature of the underneath Si substrate on the aforementioned characteristics of Ge QDs. • Analysis of the surface potential mapping using KPFM technique yields an approximate valence band offset measurement which is required to understand the intra-valence transition of holes for the realization of long wavelength infrared photodetector. • KPFM and CAFM can be utilized to explore the charging/discharging phenomena of dots and their composition variations. • Current-voltage (I–V) characteristics of the individual Ge QD strongly depends on the individual QD size. • Energy band diagrams for diamond tip and Ge QD shows the higher barrier for electrons and lower barrier for holes allowing the easy tunneling for holes to dominate the transport. - Abstract: It is fundamentally important to understand the nanoscale electronic properties of a single quantum dot (QD) contrary to an ensemble of QDs. Kelvin probe force microscopy (KPFM) and conductive atomic force microscopy (CAFM) are two important tools, which could be employed to probe surface potential, charging phenomena, and current transport mechanism of individual QD. We demonstrate the aforementioned characteristics of self-assembled Ge QDs, which was grown on Si substrates by solid source molecular beam epitaxy driven by the Stranski-Krastanov method. Study reveals that each Ge QD acts as charge storage node even at zero applied bias. The shape, size and density of QDs could be well probed by CAFM and KPFM, whereas QD facets could be better resolved by the conductive tip. The CAFM investigation

  4. Dimensionality-dependent charge transport in close-packed nanoparticle arrays: from 2D to 3D

    Science.gov (United States)

    Wang, Ying; Duan, Chao; Peng, Lianmao; Liao, Jianhui

    2014-12-01

    Charge transport properties in close-packed nanoparticle arrays with thickness crossing over from two dimensions to three dimensions have been studied. The dimensionality transition of nanoparticle arrays was realized by continually printing spatially well-defined nanoparticle monolayers on top of the device in situ. The evolution of charge transport properties depending on the dimensionality has been investigated in both the Efros-Shaklovskii variable-range-hopping (ES-VRH) (low temperature) regime and the sequential hopping (SH) (medium temperature) regime. We find that the energy barriers to transport decrease when the thickness of nanoparticle arrays increases from monolayer to multilayers, but start to level off at the thickness of 4-5 monolayers. The energy barriers are characterized by the coefficient βD at ES-VRH regime and the activation energy Ea at SH regime. Moreover, a turning point for the temperature coefficient of conductance was observed in multilayer nanoparticle arrays at high temperature, which is attributed to the increasing mobility with decreasing temperature of hopping transport in three dimensions.

  5. An Equation-Type Approach for the Numerical Solution of the Partial Differential Equations Governing Transport Phenomena in Porous Media

    KAUST Repository

    Sun, Shuyu

    2012-06-02

    A new technique for the numerical solution of the partial differential equations governing transport phenomena in porous media is introduced. In this technique, the governing equations as depicted from the physics of the problem are used without extra manipulations. In other words, there is no need to reduce the number of governing equations by some sort of mathematical manipulations. This technique enables the separation of the physics part of the problem and the solver part, which makes coding more robust and could be used in several other applications with little or no modifications (e.g., multi-phase flow in porous media). In this method, one abandons the need to construct the coefficient matrix for the pressure equation. Alternatively, the coefficients are automatically generated within the solver routine. We show examples of using this technique to solving several flow problems in porous media.

  6. Longitudinal transport coefficients of a magnetized plasma consisting of hydrogen and a single impurity element in arbitrarily populated charge states

    International Nuclear Information System (INIS)

    Claassen, H.A.; Gerhauser, H.; El-Sharif, R.N.

    1991-01-01

    The coefficients determining the transport processes along the magnetic field in a magnetized plasma consisting of electrons, protons/deuterons and impurity ions in various charge states have been calculated on the basis of Grad's 21 moment approximation. Assuming a single impurity element, the determinants appearing in the transport coefficients are evaluated analytically for arbitrary ratios m z /m + between the impurity and hydrogen masses. The general formulae are then simplified for the important case m z /m + ≥ 1 and compared with existing data given by V.M. Zhdanov et al. and Yu.L. Igitkhanov et al. Whereas with minor modifications the proton/deuteron and electron coefficients agree well, there are remarkable differences in the impurity ion transport coefficients, which are discussed. (orig.)

  7. Studies of Charge Transport in DNA Films Using the Time-of-Flight (TOF) Technique (Postprint)

    Science.gov (United States)

    2011-09-01

    larger amounts of charge injection and higher mean velocities, which can enhance the definition of the propagating charge cloud. The challenge was...depends primarily on the capacitance C of the test device. Ideally, the time constant RLC << tTR is recommended to minimize instrumental influence on...and Isao Endo, "Analysis of TOF Transient Currents Affected by Circuit Time Constants," Elect. Eng. Japan 143, 367-372 (2003). 15. Scott, J. C., L. Th

  8. Understanding the impact of polymer self-organization on the microstructure and charge transport in poly(3-hexylthiophene)

    Science.gov (United States)

    Aiyar, Avishek R.

    Conjugated polymers represent the next generation of conducting materials that will enable technological devices incorporating thin film transistors, photovoltaic (PV) cells etc. in a cost effective roll-to-roll manner. The charge carrier mobility, which characterizes the ease with which charges can be transported through the material, is the key metric by which these materials are gaged and is also a decisive factor that limits device performance. Given the impact of microstructure on charge transport, ordered self-assembly in polymeric semiconductors assumes paramount relevance. This thesis outlines a fundamental investigation of the correlations between the morphology and microstructure of a model conjugated polymer, poly(3-hexylthiophene) (P3HT), and its corresponding charge transport properties in an organic field effect transistor (OFET) geometry. Moreover, the evolution of the structural and electrical properties are mapped, which provide new insights into the self-assembly process. The variation in the electrical properties is studied as film formation evolves as a function of solvent evaporation from a sessile P3HT solution droplet. The channel formation process is mapped using four contact field effect measurements. The channel formation study is complimented by interrogating the evolution of the polymer chain conformations using in situ Raman spectroscopy, which reveals the presence of an intermediate lyotropic liquid crystalline phase before film crystallization. The manifestation of the liquid crystalline phase offers a potential rationale to the mobility profiles recorded by the in situ electrical measurements. A joint investigation of both measurements reveals that the onset of channel current occurs well before polymer crystallization and that the subtle structural changes in the P3HT film continue to evolve even after crystallization, which further impact the observed drain current. The large impact of polymer chain conformations on the drain

  9. Theoretical and experimental study of electron-deficient core substitution effect of diketopyrrolopyrrole derivatives on optoelectrical and charge transport properties

    Science.gov (United States)

    Ding, Guodong; Mahmood, Asif; Tang, Ailing; Chen, Fan; Zhou, Erjun

    2018-01-01

    Three new diketopyrrolopyrrole based compounds with Acceptor-Donor-Acceptor-Donor-Acceptor (A-D-A-D-A) skeletons were designed and synthesized through varying the electron-deficient core from diphenylquinoxaline (DP-Qx), thieno[3,4-c]pyrrole-4,6-dione (DP-TPD) to 2-dodecyl-6,7-diphenyl-2H-[1,2,3]triazole[4,5-g]quinoxaline (DP-TQx). We have calculated and studied the effect of central acceptor units on electronic, optical and non-optical properties. As well as, we have predicted the charge transport properties. Results indicate that change of central acceptor unit remarkably affects the molecular electronic, optical and non-optical properties. And the molecular band gap and UV/vis adsorption spectra are significantly changed. It should be noted that Compound 3 with 2-dodecyl-6,7-diphenyl-2H-[1,2,3]triazole[4,5-g]quinoxaline as core show superior non-optical properties as compare to other compounds. Our study here indicate that inserting the strong electron-deficient moieties improves intramolecular charge transfer (ICT) and charge transport properties dramatically.

  10. Continuity of operations/continuity of government for state-level transportation organizations.

    Science.gov (United States)

    2011-09-01

    The Homeland Security Presidential Directive 20 (HSPD-20) requires all local, state, tribal and territorial government agencies, : and private sector owners of critical infrastructure and key resources (CI/KR) to create a Continuity of Operations/Con...

  11. Electrical bistability and charge-transport mechanisms in cuprous sulfide nanosphere-poly(N-vinylcarbazole) composite films

    International Nuclear Information System (INIS)

    Tang Aiwei; Teng Feng; Liu Jie; Wang Yichao; Peng Hongshang; Hou Yanbing; Wang Yongsheng

    2011-01-01

    In this study, electrically bistable devices were fabricated by incorporating cuprous sulfide (Cu 2 S) nanospheres with mean size less than 10 nm into a poly(N-vinylcarbazole) (PVK) matrix. A remarkable electrical bistability was clearly observed in the current–voltage curves of the devices due to an electric-field-induced charge transfer between the dodecanethiol-capped Cu 2 S nanospheres and PVK. The maximum ON/OFF current ratio reached up to value as large as 10 4 , which was dependent on the mass ratios of Cu 2 S nanospheres to PVK, the amplitude of the scanning voltages, and the film thickness. The charge-transport mechanisms of the electrically bistable devices were described on the basis of the experimental results using different theoretical models of organic electronics.

  12. Entanglements in Marginal Solutions: A Means of Tuning Pre-Aggregation of Conjugated Polymers with Positive Implications for Charge Transport

    KAUST Repository

    Hu, Hanlin

    2015-06-17

    The solution-processing of conjugated polymers, just like commodity polymers, is subject to solvent and molecular weight-dependent solubility, interactions and chain entanglements within the polymer, all of which can influence the crystallization and microstructure development in semi-crystalline polymers and consequently affect charge transport and optoelectronic properties. Disentanglement of polymer chains in marginal solvents was reported to work via ultrasonication, facilitating the formation of photophysically ordered polymer aggregates. In this contribution, we explore how a wide range of technologically relevant solvents and formulations commonly used in organic electronics influence chain entanglement and the aggregation behaviour of P3HT using a combination of rheological and spectrophotometric measurements. The specific viscosity of the solution offers an excellent indication of the degree of entanglements in the solution, which is found to be related to the solubility of P3HT in a given solvent. Moreover, deliberately disentangling the solution in the presence of solvophobic driving forces, leads consistently to formation of photophysically visible aggregates which is indicative of local and perhaps long range order in the solute. We show for a broad range of solvents and molecular weights that disentanglement ultimately leads to significant ordering of the polymer in the solid state and a commensurate increase in charge transport properties. In doing so we demonstrate a remarkable ability to tune the microstructure which has important implications for transport properties. We discuss its potential implications in the context of organic photovoltaics.

  13. Experimental evidence of high pressure decoupling between charge transport and structural dynamics in a protic ionic glass-former.

    Science.gov (United States)

    Wojnarowska, Z; Rams-Baron, M; Knapik-Kowalczuk, J; Połatyńska, A; Pochylski, M; Gapinski, J; Patkowski, A; Wlodarczyk, P; Paluch, M

    2017-08-01

    In this paper the relaxation dynamics of ionic glass-former acebutolol hydrochloride (ACB-HCl) is studied as a function of temperature and pressure by using dynamic light scattering and broadband dielectric spectroscopy. These unique experimental data provide the first direct evidence that the decoupling between the charge transport and structural relaxation exists in proton conductors over a wide T-P thermodynamic space, with the time scale of structural relaxation being constant at the liquid-glass transition (τ α  = 1000 s). We demonstrate that the enhanced proton transport, being a combination of intermolecular H + hopping between cation and anion as well as tautomerization process within amide moiety of ACB molecule, results in a breakdown of the Stokes-Einstein relation at ambient and elevated pressure with the fractional exponent k being pressure dependent. The dT g /dP coefficient, stretching exponent β KWW and dynamic modulus E a /ΔV # were found to be the same regardless of the relaxation processes studied. This is in contrast to the apparent activation volume parameter that is different when charge transport and structural dynamics are considered. These experimental results together with theoretical considerations create new ideas to design efficient proton conductors for potential electrochemical applications.

  14. Influence of Morphological Disorder on In- and Out-of-Plane Charge Transport in Conjugated Polymer Films

    Science.gov (United States)

    Dong, Ban; Li, Anton; Green, Peter

    We report the unequal impacts of morphological disorder on in- and out-of-plane charge transport in thin films of poly(3-hexylthiophene) (P3HT) fabricated by both conventional spin-casting and the novel technique Matrix-Assisted Pulsed Laser Evaporation (MAPLE). MAPLE produces films with inhomogeneous globular subfeatures with dimensions on the order of 100 nm. Optical absorbance spectroscopy corroborates that MAPLE-deposited films are more energetically disordered, but possesses average conjugation lengths comparable to spin-cast P3HT. Both in- and out-of-plane carrier transport measurements of MAPLE-deposited films show characteristics that reflect a higher degree of energetic disorder and broadened density of states. Whereas in-plane carrier mobilities of MAPLE-deposited thin-film transistors are comparable to spin-cast analogues (8.3 x 10-3 cm2V-1s-1 versus 5.5 x 10-3 cm2V-1s-1) , the out-of-plane mobilities of MAPLE-deposited samples are nearly an order of magnitude lower (4.1 x 10-4 cm2V-1s-1 versus 2.7 x 10-3 cm2V-1s-1) . The unusual ensemble of properties and behaviors arising from the unique morphologies produced by MAPLE provide important perspectives on the extent to which disorder impacts different mechanisms of charge transport in conjugated polymers.

  15. The Role of the Federal Government in the Development of the US Air Transportation System

    Science.gov (United States)

    Vittek, J. F.

    1972-01-01

    Reviewed are the roles of the various Federal agencies in the regulation, control, and development of the Air System, with major emphasis on the Department of Transportation (Office of the Secretary, Federal Aviation Administration, and National Transportation Safety Board) and the Civil Aeronautics Board.

  16. Charge and Spin Transport in Graphene Heterostructures and Cr2Ge2Te6

    Science.gov (United States)

    Lin, Zhisheng

    This dissertation summarizes my past work on hydrogenation of graphene, development of Al2O3 tunnel barrier, pressure effects on Cr2Ge 2Te6 (CGT), and proximity effects in graphene/WSe2 heterostructures. There are three main parts. The first part is the study of hydrogenation of graphene and the development of atomically smooth Al2O3 tunnel barrier. Graphene device is coated with hydrogen silsesquioxane (HSQ) resist and exposed with electron beam. Graphene is hydrogenated by forming the covalently bonds to the hydrogen atoms and transforms from sp2 to sp3 bonds. By breaking the inversion symmetry perpendicular to the graphene plane, Rashba spin orbit coupling (SOC) is enhanced. We characterized the hydrogenation effects by performing Raman spectroscopy measurements. A clear D and D' peak grow abruptly with small hydrogenation dosage and keep growing with higher dosage, indicating the increased defects density in graphene. Electrical transport properties are characterized by measuring the gate voltage dependence at different hydrogenation percentages: mobility decreases and graphene becomes more electron-doped upon hydrogenation. The hydrogenation process is reversible, which means the hydrogenation effects are almost gone after annealing. Nonlocal resistivity is 1 to 3 orders of magnitude larger than that of the pristine graphene, which cannot be accounted for by the ohmic contribution assuming uniform graphene channel. The problems of nonlocal measurement method are discussed. The rest of first part is focused on developing the atomically smooth Al2O3 tunnel barrier by sputtering a thin layer of aluminum first and oxidizing it in O 2 atmosphere. The second part is about the pressure effects on the magnetic anisotropy of CGT. Magnetoresistance of CGT bulk crystal is measured under applied hydrostatic pressures up to 2 GPa. Upon the application of hydrostatic pressure, we observe an induced transition of easy axis from c axis to the ab plane of the crystal

  17. Effect of five-membered ring and heteroatom substitution on charge transport properties of perylene discotic derivatives: A theoretical approach

    Energy Technology Data Exchange (ETDEWEB)

    Navarro, Amparo, E-mail: anavarro@ujaen.es; Fernández-Liencres, M. Paz; Peña-Ruiz, Tomás; Granadino-Roldán, José M.; Fernández-Gómez, Manuel [Departamento de Química Física y Analítica, Universidad de Jaén, Campus Las Lagunillas, E23071 Jaén (Spain); García, Gregorio [Instituto de Energía Solar and Departamento TFB, E.T.S.I. Telecomunicación, Universidad Politécnica de Madrid, Ciudad Universitaria, Madrid 28040 (Spain)

    2016-08-07

    Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier compared to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.

  18. Sucrose- and H-dependent charge movements associated with the gating of sucrose transporter ZmSUT1.

    Directory of Open Access Journals (Sweden)

    Armando Carpaneto

    Full Text Available BACKGROUND: In contrast to man the majority of higher plants use sucrose as mobile carbohydrate. Accordingly proton-driven sucrose transporters are crucial for cell-to-cell and long-distance distribution within the plant body. Generally very negative plant membrane potentials and the ability to accumulate sucrose quantities of more than 1 M document that plants must have evolved transporters with unique structural and functional features. METHODOLOGY/PRINCIPAL FINDINGS: To unravel the functional properties of one specific high capacity plasma membrane sucrose transporter in detail, we expressed the sucrose/H(+ co-transporter from maize ZmSUT1 in Xenopus oocytes. Application of sucrose in an acidic pH environment elicited inward proton currents. Interestingly the sucrose-dependent H(+ transport was associated with a decrease in membrane capacitance (C(m. In addition to sucrose C(m was modulated by the membrane potential and external protons. In order to explore the molecular mechanism underlying these C(m changes, presteady-state currents (I(pre of ZmSUT1 transport were analyzed. Decay of I(pre could be best fitted by double exponentials. When plotted against the voltage the charge Q, associated to I(pre, was dependent on sucrose and protons. The mathematical derivative of the charge Q versus voltage was well in line with the observed C(m changes. Based on these parameters a turnover rate of 500 molecules sucrose/s was calculated. In contrast to gating currents of voltage dependent-potassium channels the analysis of ZmSUT1-derived presteady-state currents in the absence of sucrose (I =  Q/τ was sufficient to predict ZmSUT1 transport-associated currents. CONCLUSIONS: Taken together our results indicate that in the absence of sucrose, 'trapped' protons move back and forth between an outer and an inner site within the transmembrane domains of ZmSUT1. This movement of protons in the electric field of the membrane gives rise to the presteady

  19. Spin and charge transport in double-junction Fe/MgO/GaAs/MgO/Fe heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Wolski, S., E-mail: wolski@prz.edu.pl; Szczepański, T. [Department of Physics, Rzeszów University of Technology, Al. Powstańców Warszawy 6, 35-959 Rzeszów (Poland); Dugaev, V. K. [Department of Physics, Rzeszów University of Technology, Al. Powstańców Warszawy 6, 35-959 Rzeszów (Poland); Departamento de Física and CFIF, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Barnaś, J. [Faculty of Physics, Adam Mickiewicz University, ul. Umultowska 85, 61-614 Poznań (Poland); Institute of Molecular Physics, Polish Academy of Sciences, Smoluchowskiego 17, 60-179 Poznań (Poland); Landgraf, B.; Slobodskyy, T.; Hansen, W. [Institute for Applied Physics, University of Hamburg, Jungiusstraße 11, 20355 Hamburg (Germany)

    2015-01-28

    We present theoretical and experimental results on tunneling current in single Fe/MgO/GaAs and double Fe/MgO/GaAs/MgO/Fe tunnel junctions. The charge and spin currents are calculated as a function of external voltage for different sets of parameters characterizing the semiconducting GaAs layer. Transport characteristics of a single Fe/MgO/GaAs junction reveal typical diode as well as spin diode features. The results of numerical calculations are compared with current-voltage characteristics measured experimentally for double tunnel junction structures, and a satisfactory agreement of the theoretical and experimental results has been achieved.

  20. Charge transport in 2DEG/s-wave superconductor junction with Dresselhaus-type spin-orbit coupling

    International Nuclear Information System (INIS)

    Sawa, Y.; Yokoyama, T.; Tanaka, Y.

    2007-01-01

    We study spin-dependent charge transport in superconducting junctions. We consider ballistic two-dimensional electron gas (2DEG)/s-wave superconductor junctions with Dresselhaus-type spin-orbit coupling (DSOC). We calculate the conductance normalized by that in the normal state of superconductor in order to study the effect of DSOC in 2DEG on conductance, changing the height of insulating barrier. We find the DSOC suppresses the conductance for low insulating barrier, while it can slightly enhance the conductance for high insulating barrier. It has a reentrant dependence on DSOC for middle strength insulating barrier. The effect of DSOC is weaken as the insulating barrier becomes high

  1. Application of TiO2 nanotubes in dye-sensitised solar cells for improved charge transport

    CSIR Research Space (South Africa)

    Cummings, F

    2010-09-01

    Full Text Available their operation • 20 years onwards and big strides have been made, however head2right Efficiency of best manufactured DSCs ~ 11% mark and 7% for DSC panels Dye-sensitised Solar Cells • Relatively inexpensive – Made in non-vacuum setting – Simple... in dye- sensitised solar cells for improved charge transport Franscious Cummings Energy and Processes Materials Science and Manufacturing © CSIR 2010 Slide 1 Rhodes Workshop 7 – 8 September 2010 circle6 Background circle6 Problem Statement...

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. Charge transport in dual-gate organic field-effect transistors

    NARCIS (Netherlands)

    Brondijk, J.J.; Spijkman, M.; Torricelli, F.; Blom, P.W.M.; Leeuw, D.M. de

    2012-01-01

    The charge carrier distribution in dual-gate field-effect transistors is investigated as a function of semiconductor thickness. A good agreement with 2-dimensional numerically calculated transfer curves is obtained. For semiconductor thicknesses larger than the accumulation width, two spatially

  4. Finite-temperature charge transport in the one-dimensional Hubbard model

    NARCIS (Netherlands)

    Jin, F.; Steinigeweg, R.; Heidrich-Meisner, F.; Michielsen, K.; De Raedt, H.

    2015-01-01

    We study the charge conductivity of the one-dimensional repulsive Hubbard model at finite temperature using the method of dynamical quantum typicality, focusing at half filling. This numerical approach allows us to obtain current autocorrelation functions from systems with as many as 18 sites, way

  5. 75 FR 65401 - Schedule of Charges Outside the United States

    Science.gov (United States)

    2010-10-22

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Schedule of Charges Outside the United States AGENCY: Federal Aviation... announcing the availability of Advisory Circular (AC) 187-1D which transmits an updated schedule of charges...

  6. 78 FR 61446 - Schedule of Charges Outside the United States

    Science.gov (United States)

    2013-10-03

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Schedule of Charges Outside the United States AGENCY: Federal Aviation... announcing the availability of Advisory Circular (AC) 187-1G which transmits an updated schedule of charges...

  7. 77 FR 60005 - Schedule of Charges Outside the United States

    Science.gov (United States)

    2012-10-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Federal Aviation Administration Schedule of Charges Outside the United States AGENCY: Federal Aviation... of charges for services of FAA Flight Standards Aviation Safety Inspectors outside the United States...

  8. Review of the bases for regulations governing the transport of fissile and other radioactive material

    International Nuclear Information System (INIS)

    Smith, D.R.; Thomas, J.T.

    1978-01-01

    The outstanding record of transport of radioactive materials prompted this brief review of the history of the regulations. IAEA as well as DOT regulations are discussed, as are all classes of shipments and materials (Class I, II, III)

  9. Transportation policy and governance in the northeast corridor : an overview of major public agencies.

    Science.gov (United States)

    2009-08-01

    One of the most consistent topics of discussion about the Northeast Corridor (hereafter : NEC or the Corridor), particularly the central portion between Boston and Washington, : D.C., is the viability and efficiency of its transportation ...

  10. Local Government GIS and Geospatial Capabilities : Suitability for Integrated Transportation & Land Use Planning (California SB 375)

    Science.gov (United States)

    2009-11-01

    This report examines two linked phenomena in transportation planning: the geospatial analysis capabilities of local planning agencies and the increasing demands on such capabilities imposed by comprehensive planning mandates.

  11. Examining the effects of transportation governance on infrastructure adaptation to climate change.

    Science.gov (United States)

    2015-05-01

    Transportation agencies across the United States are faced with the challenge of effectively : adapting infrastructure to withstand the predicted effects of climate change. This challenge is : magnified by a nationwide funding shortage, uncertainty a...

  12. Scanning tunneling potentiometry, charge transport, and Landauer's resistivity dipole from the quantum to the classical transport regime

    Science.gov (United States)

    Morr, Dirk K.

    2017-05-01

    Using the nonequilibrium Keldysh formalism, we investigate the spatial relation between the electrochemical potential measured in scanning tunneling potentiometry, and local current patterns over the entire range from the quantum to the classical transport regime. These quantities show similar spatial patterns near the quantum limit but are related by Ohm's law only in the classical regime. We demonstrate that defects induce a Landauer residual resistivity dipole in the electrochemical potential with the concomitant spatial current pattern representing the field lines of the dipole.

  13. Wall thickness and charge transport properties of nano-honeycomb TiO2 structures prepared by photoetching

    International Nuclear Information System (INIS)

    Oekermann, Torsten; Yoshida, Tsukasa; Nakazawa, Jun; Yasuno, Satoshi; Sugiura, Takashi; Minoura, Hideki

    2007-01-01

    Time- and frequency-resolved photoelectrochemical studies have been performed on nano-honeycomb porous TiO 2 electrodes prepared by photoelectrochemical etching (photoetching). The remaining walls in the porous layers prepared by photoetching are found to become approximately as thin as double the thickness of the space charge layer of the material. Therefore, slow electron transport by diffusion in the walls contributes to the photocurrent generation in addition to the fast transport by field-driven migration in the bulky part of the electrode, as noticed from the appearance of a slow component in the photocurrent transient response. Addition of electron donors such as monoethanolamine (MEOA) to the electrolyte further enhances the contribution of the electron diffusion to the overall current response. The results of intensity modulated photocurrent spectroscopy (IMPS) measurements are dominated by the bulky part of the electrode, reflecting the RC times of the cells

  14. Transport of charged particles in the plasma of an ECRIS; Transport des particules chargees dans le plasma d'ECRIS

    Energy Technology Data Exchange (ETDEWEB)

    Girard, A.; Perrer, Douysset; Melin, G. [Dept. de Recherche Fondamentale sur la Matiere Condensee CEA Centre d' Etudes de Grenoble, 38 (France)

    1999-07-01

    The paper has the following contents: 1. Introduction; 2. Electron transport. 2.1. Experiments - Lifetime measurements - Contradiction. 2.2. Modelling; 3. Ion transport. 3.1. Experiments - Measurement of argon K{sub {alpha}}. 3.2. Lifetime. 3.3. Proposed model, controversy; 4. Conclusion. A setup of the experiment and the results concerning the electron density, energy content, mean energy, current density, electron lifetime and lifetime of electron energy as a function of rf power are presented. The results are interpreted and modelled. Also, the experimental setup for the study of ion transport is presented. The density of argon ions is determined by means of the high resolution X ray spectra which, by making use of a simple collisional radiative model, is able to single out the argon K{sub {alpha}} rays corresponding to different ions. These results are also interpreted and modelled. In conclusion, with an electron dynamics controlled by rf, due to a high mirror ratio, the losses are limited. According to the scale law the higher the frequency the higher is the energy content of the electrons and consequently the higher are the performances. The ions are cool and colliding. Their lifetime increases with the charge. If it increases linearly their transport is controlled by the spatial diffusion in the ambipolar electric field. A correct lifetime requires plasma of high dimensions and low ionic temperature.

  15. Inter-local government collaboration and perceived transaction costs in Indonesian metropolitan transport planning

    NARCIS (Netherlands)

    Miharja, Miming; Woltjer, Johan

    2010-01-01

    The Indonesian reformation of 1998 marked a fundamental turning point of this country's democracy. In the administrative sector, the so-called Decentralisation Act 22/1999 was enacted to reform a formerly centralistic system. A strong central government used to maintain a hierarchical spatial

  16. A numerical model for charge transport and energy conversion of perovskite solar cells.

    Science.gov (United States)

    Zhou, Yecheng; Gray-Weale, Angus

    2016-02-14

    Based on the continuity equations and Poisson's equation, we developed a numerical model for perovskite solar cells. Due to different working mechanisms, the model for perovskite solar cells differs from that of silicon solar cells and Dye Sensitized Solar Cells. The output voltage and current are calculated differently, and in a manner suited in particular to perovskite organohalides. We report a test of our equations against experiment with good agreement. Using this numerical model, it was found that performances of solar cells increase with charge carrier's lifetimes, mobilities and diffusion lengths. The open circuit voltage (Voc) of a solar cell is dependent on light intensities, and charge carrier lifetimes. Diffusion length and light intensity determine the saturated current (Jsc). Additionally, three possible guidelines for the design and fabrication of perovskite solar cells are suggested by our calculations. Lastly, we argue that concentrator perovskite solar cells are promising.

  17. Transport properties of monolayer and bilayer graphene p-n junctions with charge puddles in the quantum Hall regime

    International Nuclear Information System (INIS)

    Cheng Shuguang

    2010-01-01

    Recent experiments have confirmed that the electron-hole inhomogeneity in graphene is a new type of charge disorder. Motivated by such confirmation, we theoretically study the transport properties of a monolayer graphene (MLG) based p-n junction and a bilayer graphene (BLG) p-n junction in the quantum Hall regime where electron-hole puddles are considered. By using the non-equilibrium Green function method, both the current and conductance are obtained. We find that, in the presence of the electron-hole inhomogeneity, the lowest quantized conductance plateau at e 2 /h emerges in the MLG p-n junction under very small charge puddle disorder strength. For a BLG p-n junction, however, the conductance in the p-n region is enhanced with charge puddles, and the lowest quantized conductance plateau emerges at 2e 2 /h. Besides, when an ideal quantized conductance plateau is formed for a MLG p-n junction, the universal conductance fluctuation is found to be 2e 2 /3h. Furthermore, we also investigate the influence of Anderson disorder on such p-n junctions and the comparison and discussion are given accordingly. To compare the two models with different types of disorder, we investigate the conductance distribution specially. Finally the influence of disorder strength on the conductance of a MLG p-n junction is investigated.

  18. Molecular structure of the discotic liquid crystalline phase of hexa-peri-hexabenzocoronene/oligothiophene hybrid and their charge transport properties

    International Nuclear Information System (INIS)

    Bag, Saientan; Maingi, Vishal; Maiti, Prabal K.; Yelk, Joe; Glaser, Matthew A.; Clark, Noel A.; Walba, David M.

    2015-01-01

    Using atomistic molecular dynamics simulation, we study the discotic columnar liquid crystalline (LC) phases formed by a new organic compound having hexa-peri-Hexabenzocoronene (HBC) core with six pendant oligothiophene units recently synthesized by Nan Hu et al. [Adv. Mater. 26, 2066 (2014)]. This HBC core based LC phase was shown to have electric field responsive behavior and has important applications in organic electronics. Our simulation results confirm the hexagonal arrangement of columnar LC phase with a lattice spacing consistent with that obtained from small angle X-ray diffraction data. We have also calculated various positional and orientational correlation functions to characterize the ordering of the molecules in the columnar arrangement. The molecules in a column are arranged with an average twist of 25° having an average inter-molecular separation of ∼5 Å. Interestingly, we find an overall tilt angle of 43° between the columnar axis and HBC core. We also simulate the charge transport through this columnar phase and report the numerical value of charge carrier mobility for this liquid crystal phase. The charge carrier mobility is strongly influenced by the twist angle and average spacing of the molecules in the column

  19. Effect of CdS nanocrystals on charge transport mechanism in poly(3-hexylthiophene)

    Science.gov (United States)

    Khan, Mohd Taukeer; Almohammedi, Abdullah

    2017-08-01

    The present manuscript demonstrates the optical and electrical characteristics of poly(3-hexylthiophene) (P3HT) and cadmium sulphide (CdS) hybrid nanocomposites. Optical results suggest that there is a formation of charge transfer complex (CTC) between host P3HT and guest CdS nanocrystals (NCs). Electrical properties of P3HT and P3HT-CdS thin films have been studied in hole only device configurations at different temperatures (290 K-150 K), and results were analysed by the space charge limited conduction mechanism. Density of traps and characteristic trap energy increase on incorporation of inorganic NCs in the polymer matrix, which might be due to the additional favourable energy states created by CdS NCs in the band gap of P3HT. These additional trap states assist charge carriers to move quicker which results in enhancement of hole mobility from 7 × 10-6 to 5.5 × 10-5 cm2/V s in nanocomposites. These results suggest that the P3HT-CdS hybrid system has desirable optical and electrical properties for its applications to photovoltaics devices.

  20. Modulation of charge transport properties in poly(3,4-ethylenedioxythiophene) nanocomposites for thermoelectric applications

    Science.gov (United States)

    Galliani, Daniela; Battiston, Simone; Ruffo, Riccardo; Trabattoni, Silvia; Narducci, Dario

    2018-01-01

    Conjugated polymer poly(3,4-dioxyethylenthiofene) (PEDOT) has recently gained attention for room-temperature thermoelectric applications due to its low cost, safety and the possibility of easy processing. This makes it an interesting prospective alternative to tellurides commonly used around room temperature. Still, low thermoelectric efficiencies of polymers might be more easily increased, were a model of its transport properties available. The aim of this paper is to validate a model recently reported, making use of the concept of transport energy to frame the onset of transport properties reported over the last few years in the literature. To this aim, PEDOT and PEDOT-based nanocomposites embedding CuO nanoplatelets were prepared and analysed. We found that the model adequately fits the trends observed in pure PEDOT and in its nanocomposites. Transport and Fermi energy were verified to depend on the polymer oxidation level only,while the transport coefficient was found to be sensitive to PEDOT stacking and was modulated by the introduction of CuO nanoplatelets.

  1. Enabling two-phase microfluidic thermal transport systems using a novel thermal-flux degassing and fluid charging approach

    International Nuclear Information System (INIS)

    Singh Dhillon, Navdeep; Pisano, Albert P

    2014-01-01

    A novel two-port thermal-flux method has been proposed and demonstrated for degassing and charging two-phase microfluidic thermal transport systems with a degassed working fluid. In microscale heat pipes and loop heat pipes (mLHPs), small device volumes and large capillary forces associated with smaller feature sizes render conventional vacuum pump-based degassing methods quite impractical. Instead, we employ a thermally generated pressure differential to purge non-condensable gases from these devices before charging them with a degassed working fluid in a two-step process. Based on the results of preliminary experiments studying the effectiveness and reliability of three different high temperature-compatible device packaging approaches, an optimized compression packaging technique was developed to degas and charge a mLHP device using the thermal-flux method. An induction heating-based noninvasive hermetic sealing approach for permanently sealing the degassed and charged mLHP devices has also been proposed. To demonstrate the efficacy of this approach, induction heating experiments were performed to noninvasively seal 1 mm square silicon fill-hole samples with donut-shaped solder preforms. The results show that the minimum hole sealing induction heating time is heat flux limited and can be estimated using a lumped capacitance thermal model. However, further continued heating of the solder uncovers the hole due to surface tension-induced contact line dynamics of the molten solder. It was found that an optimum mass of the solder preform is required to ensure a wide enough induction-heating time window for successful sealing of a fill-hole. (paper)

  2. A Green's function method for high charge and energy ion transport

    Science.gov (United States)

    Chun, S. Y.; Khandelwal, G. S.; Wilson, J. W.

    1996-01-01

    A heavy-ion transport code using Green's function methods is developed. The low-order perturbation terms exhibiting the greatest energy variation are used as dominant energy-dependent terms, and the higher order collision terms are evaluated using nonperturbative methods. The recently revised NUCFRG database is used to evaluate the solution for comparison with experimental data for 625A MeV 20Ne and 517A MeV 40Ar ion beams. Improved agreements with the attenuation characteristics for neon ions are found, and reasonable agreement is obtained for the transport of argon ions in water.

  3. Modelling of charge carrier mobility for transport between elastic polyacetylene-like polymer nanorods

    Czech Academy of Sciences Publication Activity Database

    Menšík, Miroslav; Sun, S. J.; Toman, Petr; Král, Karel

    2017-01-01

    Roč. 61, č. 2 (2017), s. 127-135 ISSN 0862-5468 R&D Projects: GA MŠk(CZ) LD14011; GA ČR(CZ) GA15-05095S Grant - others:European Commission(XE) COST Act ion MP1202 HINT; AV ČR(CZ) KONNECT-007 Program:Bilaterální spolupráce Institutional support: RVO:61389013 ; RVO:68378271 Keywords : charge carrier mobility * polymers * electron-phonon coupling Subject RIV: CF - Physical ; Theoretical Chemistry; CF - Physical ; Theoretical Chemistry (FZU-D) OBOR OECD: Physical chemistry; Physical chemistry (FZU-D) Impact factor: 0.439, year: 2016

  4. Charge transport in quantum dot organic solar cells with Si quantum dots sandwiched between poly(3-hexylthiophene) (P3HT) absorber and bathocuproine (BCP) transport layers

    Science.gov (United States)

    Verma, Upendra Kumar; Kumar, Brijesh

    2017-10-01

    We have modeled a multilayer quantum dot organic solar cell that explores the current-voltage characteristic of the solar cell whose characteristics can be tuned by varying the fabrication parameters of the quantum dots (QDs). The modeled device consists of a hole transport layer (HTL) which doubles up as photon absorbing layer, several quantum dot layers, and an electron transport layer (ETL). The conduction of charge carriers in HTL and ETL has been modeled by the drift-diffusion transport mechanism. The conduction and recombination in the quantum dot layers are described by a system of coupled rate equations incorporating tunneling and bimolecular recombination. Analysis of QD-solar cells shows improved device performance compared to the similar bilayer and trilayer device structures without QDs. Keeping other design parameters constant, solar cell characteristics can be controlled by the quantum dot layers. Bimolecular recombination coefficient of quantum dots is a prime factor which controls the open circuit voltage (VOC) without any significant reduction in short circuit current (JSC).

  5. Theory of charge transport in diffusive normal metal/unconventional singlet superconductor contacts

    NARCIS (Netherlands)

    Tanaka, Y.; Nazarov, Yu. V.; Golubov, Alexandre Avraamovitch; Kashiwaya, S.

    2004-01-01

    We analyze the transport properties of contacts between unconventional superconductor and normal diffusive metal in the framework of the extended circuit theory. We obtain a general boundary condition for the Keldysh-Nambu Green's functions at the interface that is valid for arbitrary transparencies

  6. Features of charge carrier transport determined from carrier extraction current in .mu.c-Si:H

    Czech Academy of Sciences Publication Activity Database

    Juška, G.; Arlauskas, K.; Nekrašas, N.; Stuchlík, Jiří; Niquille, X.; Wyrsch, N.

    299-302, - (2002), s. 375-379 ISSN 0022-3093 Grant - others:VMSF(LT) 01SP-02 Institutional research plan: CEZ:AV0Z1010914 Keywords : mobility of majority carriers * photoconductivity transport Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.435, year: 2002

  7. Mild hypothermic preservation for transport purposes of the AMC bioartificial liver charged with porcine hepatocytes

    NARCIS (Netherlands)

    Poyck, Paul P. C.; Hoekstra, Ruurdtje; van Wijk, Albert C. W. A.; ten Bloemendaal, Lysbeth; Chamuleau, Robert A. F. M.; van Gulik, Thomas M.

    2005-01-01

    Background. Preservation conditions play a crucial role during transport of a bioartificial liver (BAL) from the laboratory to the hospital. We assessed the possibility to preserve the AMC-BAL loaded with freshly isolated porcine hepatocytes at mild hypothermic temperatures. Methods. Two

  8. Toward a better understanding of the complex geochemical processes governing subsurface contaminant transport

    International Nuclear Information System (INIS)

    Puls, R.W.

    1990-01-01

    Identification and understanding of the geochemical processes, including ion exchange, precipitation, organic partitioning, chemisorption, aqueous complexation, and colloidal stability and transport, controlling subsurface contamination is essential for making accurate predictions of the fate and transport of these constituents. Current approaches to quantify the effect of these processes primarily involve laboratory techniques, including the use of closed static systems (batch experiments) where small amounts of aquifer solids or minerals are contacted with an aqueous phase containing the components of interest for relatively short durations; and dynamic systems (column experiments) where a larger segment of the aquifer is investigated by analyzing the breakthrough profiles of reactive and non-reactive species. Both approaches are constrained by differences in scale, alteration of media during sample collection and use, and spatial variability. More field reactivity studies are needed to complement established laboratory approaches for the determination of retardation factors and scaling factors, corroboration of batch and column results, and validation of sampling techniques. These studies also serve to accentuate areas of geochemical process research where data deficiencies exist, such as the kinetics of adsorption-desorption, metal-organic-mineral interactions, and colloidal mobility. The advantages and disadvantages of the above approaches are discussed in the context of achieving a more completely integrated approach to geochemical transport experiments, with supportive data presented from selected studies. (Author) (16 refs., 4 figs., 2 tabs.)

  9. Charge transport and glassy dynamics of poly(ethylene oxide)-based single-ion conductors under geometrical confinement

    Science.gov (United States)

    Runt, James; Iacob, Ciprian

    2015-03-01

    Segmental and local dynamics as well as charge transport are investigated in a series of poly(ethylene oxide)-based single-ion conductors (ionomers) with varying counterions (Li +, Na +) confined in uni-directional nanoporous silica membranes. The dynamics are explored over a wide frequency and temperature range by broadband dielectric relaxation spectroscopy. Slowing of segmental dynamics and a decrease in dc conductivity (strongly coupled with segmental relaxation) of the confined ionomers are associated with surface effects - resulting from interfacial hydrogen bonding between the host nanoporous silica membrane and the guest ionomers. These effects are significantly reduced or eliminated upon pore surface modification through silanization. The primary transport properties for the confined ionomers decrease by about one decade compared to the bulk ionomer. A model assuming reduced mobility of an adsorbed layer at the pore wall/ionomer interface is shown to provide a quantitative explanation for the decrease in effective transport quantities in non-silanized porous silica membranes. Additionally, the effect of confinement on ion aggregation in ionomers by using X-ray scattering will also be discussed. Supported by the National Science Foundation, Polymers Program.

  10. 41 CFR 102-34.205 - May I use a Government motor vehicle for transportation between my residence and place of...

    Science.gov (United States)

    2010-07-01

    ... motor vehicle for transportation between my residence and place of employment? 102-34.205 Section 102-34... Motor Vehicles § 102-34.205 May I use a Government motor vehicle for transportation between my residence... your residence and place of employment unless your agency authorizes such use after making the...

  11. Enhanced Charge Transport in Tantalum Nitride Nanotube Photoanodes for Solar Water Splitting.

    Science.gov (United States)

    Wang, Lei; Nguyen, Nhat Truong; Zhou, Xuemei; Hwang, Imgon; Killian, Manuela S; Schmuki, Patrik

    2015-08-24

    In the present work we grow anodic self-organized Ta2O5 nanotube layers, which are converted by ammonolysis to Ta3 N5 nanotubes, and then are used as photoanodes for photoanalytic water splitting. We introduce a two-step anodization process that not only improves order (reduced growth defects) and overall light absorption in the nanotube layers, but also provides a significantly reduced interface charge resistance at the nitride/metal interface due to subnitride (TaNx ) formation. As a result, such nanotube anodes afford a 15-fold increase of the photocurrent compared with conventional nanotubular Ta3 N5 electrodes under AM 1.5 G simulated sunlight (100 mW cm(-2)) conditions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Manipulation of charge transfer and transport in plasmonic-ferroelectric hybrids for photoelectrochemical applications

    Science.gov (United States)

    Wang, Zhijie; Cao, Dawei; Wen, Liaoyong; Xu, Rui; Obergfell, Manuel; Mi, Yan; Zhan, Zhibing; Nasori, Nasori; Demsar, Jure; Lei, Yong

    2016-01-01

    Utilizing plasmonic nanostructures for efficient and flexible conversion of solar energy into electricity or fuel presents a new paradigm in photovoltaics and photoelectrochemistry research. In a conventional photoelectrochemical cell, consisting of a plasmonic structure in contact with a semiconductor, the type of photoelectrochemical reaction is determined by the band bending at the semiconductor/electrolyte interface. The nature of the reaction is thus hard to tune. Here instead of using a semiconductor, we employed a ferroelectric material, Pb(Zr,Ti)O3 (PZT). By depositing gold nanoparticle arrays and PZT films on ITO substrates, and studying the photocurrent as well as the femtosecond transient absorbance in different configurations, we demonstrate an effective charge transfer between the nanoparticle array and PZT. Most importantly, we show that the photocurrent can be tuned by nearly an order of magnitude when changing the ferroelectric polarization in PZT, demonstrating a versatile and tunable system for energy harvesting. PMID:26753764

  13. The Charge Transport Properties of a HWCVD a-Si:H Thin Film under Bending Pressure

    Directory of Open Access Journals (Sweden)

    M. Boshta

    2008-01-01

    Full Text Available The transient thermoelectric effects (TTEs method is used to measure the ambipolar space charge built up in a low-pressure hot wire chemical vapor deposition (HWCVD technique a-Si:H layer deposited on a glass substrate. The stage 2 TTE-transients yield the trap state density difference with and without bending pressure up to 9 bars. The a-Si:H sample shows a reduction of the negative storage peaks at 0.045 eV and 0.026 eV with increasing pressure, while the positive (hole trap peak and the zero crossing practically do not change with the pressure. At the maximum bending pressure, the negative peaks are almost zero and shifted into the band gap or toward the conduction band. Our result shows that it is necessary to produce and mount hydrogenated thin film solar cell stress-free.

  14. Charge photogeneration and transport in side-chain carbazole polymers and co-polymers

    KAUST Repository

    Li, Huawei

    2011-07-01

    The photoconductivity, hole mobility and charge photogeneration efficiency of a series of side-chain carbazole homopolymers and copolymers (with azo side-chains) have been investigated. Cyclic voltammetry measurement of frontier orbitals energies show that the HOMO energy is determined by the nature and the position of attachment of the linker between the main chain and the carbazole, the azo-moiety being not relevant in this respect. Hole mobility is not influenced by the HOMO energy but seems to depend on the degree of conformational mobility of the side-chains, reaching values of the order of 10-3cm2V-1s-1 in the best cases. The HOMO energy is instead extremely important when considering photogeneration efficiency, that can change by 10 orders of magnitude depending on the density of the carbazole side-chains in co-polymers and on the linker nature and attachment position. © 2011 Elsevier B.V. All rights reserved.

  15. MODELLING OF CHARGE CARRIER MOBILITY FOR TRANSPORT BETWEEN ELASTIC POLYACETYLENE-LIKE POLYMER NANORODS

    Directory of Open Access Journals (Sweden)

    M. Mensik

    2017-03-01

    Full Text Available A quantum model solving the charge carrier mobility between polyacetylene-like polymer nanorods is presented. The model assumes: a Quantum mechanical calculation of hole on-chain delocalization involving electron-phonon coupling leading to the Peierls instability, b Hybridization coupling between the polymer backbone and side-groups (or environmental states, which act as hole traps, and c Semiclassical description of the inter-chain hole transfer in an applied voltage based on Marcus theory. We have found that mobility resonantly depends on the hybridization coupling between polymer and linked groups. We observed also non-trivial mobility dependences on the difference of energies of the highest occupied molecular orbitals localized on the polymer backbone and side-groups, respectively, and hole concentration. Those findings are important for optimization of hybrid opto-electronic devices.

  16. The Danish Rejsekortet ( Smart Card for Public Transportation ): Project Governance for Failure or Success ?

    DEFF Research Database (Denmark)

    Harboe, Peter Georg; Riis, Eva

    The authors examine a project regarded as a major failure in Danish public investments: The Smart Card for Public Transportation whose introduction was delayed for 9 years with an estimated cost overrun of 125 million EURO. After 3 years of operation, the Smart Card system only covers seven...... is on the whole life-cycle from project initiation to long-term use of the smart card. We rely on theory building using three cases. The Danish Smart Card will be compared to two other cases - the Oyster Card in the London Metropolitan Area and the Singaporean EZ-Link Card. In all three cases, the focus...

  17. Lateral gas transport in soil adjacent to an old landfill: factors governing gas migration

    DEFF Research Database (Denmark)

    Christophersen, Mette; Kjeldsen, Peter

    2001-01-01

    was observed. There was a good correlation between pressure above the barometric pressure and the methane concentration in the soil, indicating that advective flow was the controlling process. This was confirmed by calculations. Diurnal measurement during a drop in barometric pressure showed that lateral......Field experiments investigating lateral gas transport in soil adjacent to an old landfill in Denmark during a one-year period were conducted. A significant seasonal variation, with low concentrations of methane and high concentrations of carbon dioxide in the summer, caused by methane oxidation...

  18. Spin-polarized charge transport in HgTe/CdTe quantum well topological insulator under a ferromagnetic metal strip

    Science.gov (United States)

    Wu, Zhenhua; Luo, Kun; Yu, Jiahan; Wu, Xiaobo; Lin, Liangzhong

    2018-02-01

    Electron tunneling through a single magnetic barrier in a HgTe topological insulator has been theoretically investigated. We find that the perpendicular magnetic field would not lead to spin-flip of the edge states due to the conservation of the angular moment. By tuning the magnetic field and the Fermi energy, the edge channels can be transited from switch-on states to switch-off states and the current from unpolarized states can be filtered to fully spin polarized states. These features offer us an efficient way to control charge/spin transport in a HgTe/CdTe quantum well, and pave a way to construct the nanoelectronic devices utilizing the topological edge states.

  19. Synthesis of Dimethyl-Substituted Polyviologen and Control of Charge Transport in Electrodes for High-Resolution Electrochromic Displays

    Directory of Open Access Journals (Sweden)

    Kan Sato

    2017-03-01

    Full Text Available Electrochromic (EC polymers such as polyviologens have been attracting considerable attention as wet-processable electrodes for EC displays, thanks to their brilliant color change accompanied with reversible redox reactions. To establish wider usage, achieving multicolor and high-resolution characteristics is indispensable. In this paper, we demonstrated that the introduction of substituents such as methyl groups into bipyridine units changed the stereostructure of the cation radicals, and thus shifted the color (e.g., ordinary purple to blue. Also, by relaxing excessive π-stacking between the viologen moieties, the response rate was improved by a factor of more than 10. The controlled charge transport throughout the polyviologen layer gave rise to the fabrication of EC displays which are potentially suitable for the thin film transistor (TFT substrate as the counter electrodes with submillimeter pixels. The findings can be versatilely used for the new design of polyviologens with enhanced electrochemical properties and high-resolution, multicolor EC displays.

  20. Thiazole-induced rigidification in substituted dithieno-tetrathiafulvalene: the effect of planarisation on charge transport properties

    Directory of Open Access Journals (Sweden)

    Rupert G. D. Taylor

    2015-07-01

    Full Text Available Two novel tetrathiafulvalene (TTF containing compounds 1 and 2 have been synthesised via a four-fold Stille coupling between a tetrabromo-dithienoTTF 5 and stannylated thiophene 6 or thiazole 4. The optical and electrochemical properties of compounds 1 and 2 have been measured by UV–vis spectroscopy and cyclic voltammetry and the results compared with density functional theory (DFT calculations to confirm the observed properties. Organic field effect transistor (OFET devices fabricated from 1 and 2 demonstrated that the substitution of thiophene units for thiazoles was found to increase the observed charge transport, which is attributed to induced planarity through S–N interactions of adjacent thiazole nitrogen atoms and TTF sulfur atoms and better packing in the bulk.

  1. Characterization of the charge-carrier transport properties of IIa-Tech SC diamond for radiation detection applications

    Energy Technology Data Exchange (ETDEWEB)

    Pomorski, M.; Delfaure, C.; Tromson, D.; Bergonzo, P. [CEA, LIST, Diamond Sensors Laboratory, Gif-sur-Yvette (France); Vaissiere, N.; Bensalah, H.; Barjon, J.; Pinault-Thaury, M.A. [Groupe d' Etude de la Matiere Condensee (GEMaC), Centre National de la Recherche Scientifique, Universite de Versailles Saint Quentin en Yvelines (UVSQ), Versailles (France)

    2015-11-15

    Single crystal (SC) diamond has since years demonstrated its interest for the fabrication of radiation detectors, especially where the material properties are providing superior interests with respect to the detection application. Among the industrial suppliers able to provide on a commercial basis high-grade single crystal diamond, IIa-Tech has recently appeared in the market as a new player. The aim of this paper is to assess the quality of one SC sample when characterized under α-particles for the measurement of its carrier transport properties. We observed that full charge collection could be observed at biases as low as 0.11 V/μm with no space charge build-up (conventionally typical bias values used are closer to 1 V/μm). Velocity reached values of 38 μm/ns and 53 μm/ns for electrons and holes, respectively (values probed at 0.33 V/μm). Similarly, the α detection spectrum displays a sharp line demonstrating the good uniformity of the material over its surface. By combining the measurements with more conventional optical observations such as birefringence and cathodoluminescence spectroscopy, it comes that the material demonstrates its ability to be used as a detector, with properties that can compare with the highest grade materials today available on the market. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  2. Charge transport and magnetoresistance of G4-DNA molecular device modulated by counter ions and dephasing effect

    International Nuclear Information System (INIS)

    Kang, Da-wei; Sun, Meng-le; Zuo, Zheng-wei; Wang, Hui-xian; Lv, Shi-jie; Li, Xin-zhong; Li, Li-ben

    2016-01-01

    The charge transport properties of the G4-DNA molecular device in the presence of counter ions and dephasing effect are investigated based on the Green function method and Landauer–Büttiker theory. The currents through the G4-DNA molecular device depend on the interference patterns at different coupling configurations. There is an effective electrostatic interaction between the counter ions and the G4-DNA molecule which introduces disorder into the on-site energies of G bases. The current through the device can be enhanced by the small disorder which avoids the strong interference of electrons at the same energy in some coupling configurations, however the diagonal disorder can suppress the overall current due to the Anderson localization of charge carriers when the disorder is large. In the presence of dephasing effect the current through the device at all coupling configurations can be enhanced as a result of the phase coherence losing of electron. As for the magnetic field response, the magnetoresistance of the device is always suppressed by the counter ions and dephasing effect. - Highlights: • The counter ions can some times enhance the current through G4-DNA molecule. • The dephasing effect can enhance the current of the device at all four coupling configurations. • The magnetoresistance is always suppressed by the counter ions and dephasing effect.

  3. Charge-altering releasable transporters (CARTs) for the delivery and release of mRNA in living animals.

    Science.gov (United States)

    McKinlay, Colin J; Vargas, Jessica R; Blake, Timothy R; Hardy, Jonathan W; Kanada, Masamitsu; Contag, Christopher H; Wender, Paul A; Waymouth, Robert M

    2017-01-24

    Functional delivery of mRNA to tissues in the body is key to implementing fundamentally new and potentially transformative strategies for vaccination, protein replacement therapy, and genome editing, collectively affecting approaches for the prevention, detection, and treatment of disease. Broadly applicable tools for the efficient delivery of mRNA into cultured cells would advance many areas of research, and effective and safe in vivo mRNA delivery could fundamentally transform clinical practice. Here we report the step-economical synthesis and evaluation of a tunable and effective class of synthetic biodegradable materials: charge-altering releasable transporters (CARTs) for mRNA delivery into cells. CARTs are structurally unique and operate through an unprecedented mechanism, serving initially as oligo(α-amino ester) cations that complex, protect, and deliver mRNA and then change physical properties through a degradative, charge-neutralizing intramolecular rearrangement, leading to intracellular release of functional mRNA and highly efficient protein translation. With demonstrated utility in both cultured cells and animals, this mRNA delivery technology should be broadly applicable to numerous research and therapeutic applications.

  4. The effects of localized tail states on charge transport mechanisms in amorphous zinc tin oxide Schottky diodes

    Science.gov (United States)

    Son, Youngbae; Peterson, Rebecca L.

    2017-12-01

    Temperature-dependent current–voltage measurements were performed on vertical Schottky diodes made with solution-processed amorphous zinc tin oxide (a-ZTO) semiconductor and palladium rectifying contacts. Above 260 K, forward bias electron transport occurs via thermionic emission over an inhomogeneous, voltage-dependent Schottky barrier with {\\bar{φ }}b0 = 0.72 eV, σ 0 = 0.12 eV, and A* = 44 A cm‑2 K‑2, where {\\bar{φ }}b0 and {σ }0 are the mean potential barrier and its standard deviation at zero bias, respectively, and A* is Richardson’s constant. For large currents, the series ohmic resistance of the bulk semiconductor dominates. At temperatures below 260 K, less carriers are excited from localized states below the conduction band edge, and space-charge-limited current (SCLC) dominates. The exponential tail density of states parameters extracted for a-ZTO are g tc = 1.34 × 1019 cm‑3 eV‑1 and kT t = 26 meV. The intermediate tail state density in a-ZTO, less than that of amorphous silicon and greater than that of amorphous indium gallium zinc oxide, allows for experimental observation of a temperature-dependent transition of bulk charge transport mechanisms in strong forward bias from semiconductor-like ohmic conduction near room temperature to insulator-like SCLC at lower temperatures. In reverse bias, the same tail states lead to modified Poole–Frenkel emission, reducing the leakage current. The frequency response of a half-wave rectifier and diode impedance spectroscopy confirm that the Schottky diode cut-off frequency is above 1 MHz.

  5. Lateral gas transport in soil adjacent to an old landfill: factors governing emissions and methane oxidation

    DEFF Research Database (Denmark)

    Christophersen, Mette; Kjeldsen, Peter; Holst, Helle

    2001-01-01

    Field investigations of lateral gas transport and subsequent emissions in soil adjacent to an old landfill in Denmark have been conducted during a one-year period. A significant seasonal variation in the emissions with high carbon dioxide and low methane fluxes in the summer (May to October......) was observed. This was attributed to methane oxidation. Diurnal measurements during a drop in barometric pressure showed that the fluxes of landfill gas changed dramatically within a very short time. The concentrations and the soil moisture content in the upper part of the soil profile had significant...... influence on the fluxes, as did the distance from the landfill border, temperature, barometric pressure and the pressure gradient. Statistical analyses proved that soil moisture described the largest part of the variation. No methane at all emitted during the summer. Calculations and isotope analyses showed...

  6. Consistency evaluation between EGSnrc and Geant4 charged particle transport in an equilibrium magnetic field

    Science.gov (United States)

    Yang, Y. M.; Bednarz, B.

    2013-02-01

    Following the proposal by several groups to integrate magnetic resonance imaging (MRI) with radiation therapy, much attention has been afforded to examining the impact of strong (on the order of a Tesla) transverse magnetic fields on photon dose distributions. The effect of the magnetic field on dose distributions must be considered in order to take full advantage of the benefits of real-time intra-fraction imaging. In this investigation, we compared the handling of particle transport in magnetic fields between two Monte Carlo codes, EGSnrc and Geant4, to analyze various aspects of their electromagnetic transport algorithms; both codes are well-benchmarked for medical physics applications in the absence of magnetic fields. A water-air-water slab phantom and a water-lung-water slab phantom were used to highlight dose perturbations near high- and low-density interfaces. We have implemented a method of calculating the Lorentz force in EGSnrc based on theoretical models in literature, and show very good consistency between the two Monte Carlo codes. This investigation further demonstrates the importance of accurate dosimetry for MRI-guided radiation therapy (MRIgRT), and facilitates the integration of a ViewRay MRIgRT system in the University of Wisconsin-Madison's Radiation Oncology Department.

  7. Charge-carrier transport and recombination in heteroepitaxial CdTe

    International Nuclear Information System (INIS)

    Kuciauskas, Darius; Farrell, Stuart; Dippo, Pat; Moseley, John; Moutinho, Helio; Li, Jian V.; Allende Motz, A. M.; Kanevce, Ana; Zaunbrecher, Katherine; Gessert, Timothy A.; Levi, Dean H.; Metzger, Wyatt K.; Colegrove, Eric; Sivananthan, S.

    2014-01-01

    We analyze charge-carrier dynamics using time-resolved spectroscopy and varying epitaxial CdTe thickness in undoped heteroepitaxial CdTe/ZnTe/Si. By employing one-photon and nonlinear two-photon excitation, we assess surface, interface, and bulk recombination. Two-photon excitation with a focused laser beam enables characterization of recombination velocity at the buried epilayer/substrate interface, 17.5 μm from the sample surface. Measurements with a focused two-photon excitation beam also indicate a fast diffusion component, from which we estimate an electron mobility of 650 cm 2 (Vs) −1 and diffusion coefficient D of 17 cm 2  s −1 . We find limiting recombination at the epitaxial film surface (surface recombination velocity S surface  = (2.8 ± 0.3) × 10 5  cm s −1 ) and at the heteroepitaxial interface (interface recombination velocity S interface  = (4.8 ± 0.5) × 10 5  cm s −1 ). The results demonstrate that reducing surface and interface recombination velocity is critical for photovoltaic solar cells and electronic devices that employ epitaxial CdTe.

  8. Ca2+ transport by reconstituted synaptosomal ATPase is associated with H+ countertransport and net charge displacement.

    Science.gov (United States)

    Salvador, J M; Inesi, G; Rigaud, J L; Mata, A M

    1998-07-17

    The synaptosomal plasma membrane Ca2+-ATPase (PMCA) purified from pig brain was reconstituted with liposomes prepared by reverse phase evaporation at a lipid to protein ratio of 150/1 (w/w). ATP-dependent Ca2+ uptake and H+ ejection by the reconstituted proteoliposomes were demonstrated by following light absorption and fluorescence changes undergone by arsenazo III and 8-hydroxy-1,3, 6-pyrene trisulfonate, respectively. Ca2+ uptake was increased up to 2-3-fold by the H+ ionophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone, consistent with relief of an inhibitory transmembrane pH gradient (i.e. lumenal alkalinization) generated by H+ countertransport. The stoichiometric ratio of Ca2+/H+ countertransport was 1.0/0.6, and the ATP/Ca2+ coupling stoichiometry was 1/1 at 25 degrees C. The electrogenic character of the Ca2+/H+ countertransport was demonstrated by measuring light absorption changes undergone by oxonol VI. It was shown that a 20 mV steady state potential (positive on the lumenal side) was formed as a consequence of net charge transfer associated with the 1/1 Ca2+/H+ countertransport. Calmodulin stimulated ATPase activity, Ca2+ uptake, and H+ ejection, demonstrating that these parameters are linked by the same mechanism of PMCA regulation.

  9. A charge transport study in diamond, surface passivated by high-k dielectric oxides

    Energy Technology Data Exchange (ETDEWEB)

    Kovi, Kiran Kumar, E-mail: KiranKumar.Kovi@angstrom.uu.se; Majdi, Saman; Gabrysch, Markus; Isberg, Jan [Division for Electricity, Department of Engineering Sciences, Box 534, Uppsala University, Uppsala SE-751 21 (Sweden)

    2014-11-17

    The recent progress in the growth of high-quality single-crystalline diamond films has sparked interest in the realization of efficient diamond power electronic devices. However, finding a suitable passivation is essential to improve the reliability and electrical performance of devices. In the current work, high-k dielectric materials such as aluminum oxide and hafnium oxide were deposited by atomic layer deposition on intrinsic diamond as a surface passivation layer. The hole transport properties in the diamond films were evaluated and compared to unpassivated films using the lateral time-of-flight technique. An enhancement of the near surface hole mobility in diamond films of up to 27% is observed when using aluminum oxide passivation.

  10. Diffusion, Coulombic interactions and multicomponent ionic transport of charged species in saturated porous media

    DEFF Research Database (Denmark)

    Rolle, Massimo; Muniruzzaman, Muhammad

    of their aqueous diffusion coefficients also the electrostatic interactions significantly affect solute displacement. We investigated electrostatic interactions between ionic species under flow-through conditions resulting in multicomponent ionic dispersion: the dispersive fluxes of the different ions in the pore...... water are cross-coupled due to the effects of Coulombic interactions. Such effects are illustrated in flow-through experiments in saturated porous media. Simple strong electrolytes (i.e., salts and strong acid solutions) were selected as tracers and their transport was studied under different advection......-dominated conditions in homogeneous and heterogeneous porous media [2-3]. The model-based interpretation of the experimental results is challenging since it requires a multicomponent ionic formulation with an accurate description of local hydrodynamic dispersion and explicitly accounting for the cross...

  11. Charge transport through O-deficient Au-MgO-Au junctions

    KAUST Repository

    Fadlallah, M. M.

    2009-12-29

    Metal-oxide heterostructures have been attracting considerable attention in recent years due to various technological applications. We present results of electronic structure and transport calculations for the Au-MgO-Au (metal-insulator-metal) heterostructure based on density-functional theory and the nonequilibrium Green’s functions method. The dependence of the conductance of the heterostructure on the thickness of the MgO interlayer and the interface spacing is studied. In addition, we address the effects of O vacancies. We observe deviations from an exponentially suppressed conductance with growing interlayer thickness caused by Au-O chemical bonds. Electronic states tracing back to O vacancies can increase the conductance. Furthermore, this effect can be enhanced by enlarging the interface spacing as the vacancy induced Mg states are shifted toward the Fermi energy.

  12. Relation between Microstructure and Charge Transport in Polymers of Different Regioregularity

    KAUST Repository

    McMahon, David P.

    2011-10-06

    A methodology to link an atomistic description of a polymeric semiconductor with the experimental electrical characteristics of real devices is proposed. Microscopic models of poly(3-hexylthiophene) (P3HT) of different regioregularity are generated using molecular dynamics and their electronic structure determined via an approximate quantum chemistry scheme. The resulting density of trap states and distribution of localized and delocalized states is then compared with that obtained from thin film transistor measurements of P3HT at different regioregularities. The two complementary methodologies provide a converging description of the electron transport in semicrystalline P3HT and the role of regioregularity. States at the valence band edge are localized, but delocalized "band-like" states are thermally accessible and quantitatively characterized. Both theory and experiment agree that contrary to a commonly held belief the trap density and the DOS shape are little affected by the presence of regioregularity defects. © 2011 American Chemical Society.

  13. Water-induced charge transport in tablets of microcrystalline cellulose of varying density: dielectric spectroscopy and transient current measurements

    International Nuclear Information System (INIS)

    Nilsson, Martin; Alderborn, Goeran; Stroemme, Maria

    2003-01-01

    Room temperature dielectric frequency response data taken over 13 decades in frequency on microcrystalline cellulose (MCC) tablets of varying density are presented. The frequency response shows on three different processes: the first one is a high-frequency relaxation process whose magnitude increases and reaches a plateau as the tablet density increases. This process is associated with orientational motions of local chain segments via glycosidic bonds. The second relaxation process, related to the presence of water in the MCC matrix, is insensitive to changes in tablet density. At lower frequencies, dc-like imperfect charge transport dominates the dielectric spectrum. The dc conductivity was found to decrease with increasing tablet density and increase exponentially with increasing humidity. Transient current measurements indicated that two different ionic species, protons and OH - ions, lied behind the observed conductivity. At ambient humidity of 22%, only one in a billion of the water molecules present in the tablet matrix participated in long range dc conduction. The diffusion coefficient of the protons and OH - ions were found to be of the order of 10 -9 cm 2 /s, which is the same as for small salt building ions in MCC. This shows that ionic drugs leaving a tablet matrix may diffuse in the same manner as the constituent ions of water and, thus, elucidates the necessity to understand the water transport properties of excipient materials to be able to tailor the drug release process from pharmaceutical tablets

  14. Trap-induced charge transfer/transport at energy harvesting assembly

    Science.gov (United States)

    Cho, Seongeun; Paik, Hanjong; Kim, Tae Wan; Park, Byoungnam

    2017-02-01

    Understanding interfacial electronic properties between electron donors and acceptors in hybrid optoelectronic solar cells is crucial in governing the device parameters associated with energy harvesting. To probe the electronic localized states at an electron donor/acceptor interface comprising a representative hybrid solar cell, we investigated the electrical contact properties between Al-doped zinc oxide (AZO) and poly (3-hexylthiophene) (P3HT) using AZO as the source and drain electrodes, pumping carriers from AZO into P3HT. The injection efficiency was evaluated using the transmission line method (TLM) in combination with field effect transistor characterizations. Highly conductive AZO films worked as the source and drain electrodes in the devices for TLM and field effect measurements. A comparable contact resistance difference between AZO/P3HT/AZO and Au/P3HT/Au structures contradicts the fact that a far larger energy barrier exists for electrons and holes between AZO and P3HT compared with between P3HT and Au based on the Schottky-Mott model. It is suggested that band to band tunneling accounts for the contradiction through the initial hop from AZO to P3HT for hole injection. The involvement of the tunneling mechanism in determining the contact resistance implies that there is a high density of electronic traps in the organic side.

  15. Modeling diffusion-governed solidification of ternary alloys - Part 2: Macroscopic transport phenomena and macrosegregation.

    Science.gov (United States)

    Wu, M; Li, J; Ludwig, A; Kharicha, A

    2014-09-01

    Part 1 of this two-part investigation presented a multiphase solidification model incorporating the finite diffusion kinetics and ternary phase diagram with the macroscopic transport phenomena (Wu et al., 2013). In Part 2, the importance of proper treatment of the finite diffusion kinetics in the calculation of macrosegregation is addressed. Calculations for a two-dimensional (2D) square casting (50 × 50 mm 2 ) of Fe-0.45 wt.%C-1.06 wt.%Mn considering thermo-solutal convection and crystal sedimentation are performed. The modeling result indicates that the infinite liquid mixing kinetics as assumed by classical models (e.g., the Gulliver-Scheil or lever rule), which cannot properly consider the solute enrichment of the interdendritic or inter-granular melt at the early stage of solidification, might lead to an erroneous estimation of the macrosegregation. To confirm this statement, further theoretical and experimental evaluations are desired. The pattern and intensity of the flow and crystal sedimentation are dependent on the crystal morphologies (columnar or equiaxed); hence, the potential error of the calculated macrosegregation caused by the assumed growth kinetics depends on the crystal morphology. Finally, an illustrative simulation of an engineering 2.45-ton steel ingot is performed, and the results are compared with experimental results. This example demonstrates the model applicability for engineering castings regarding both the calculation efficiency and functionality.

  16. Curl flux, coherence, and population landscape of molecular systems: Nonequilibrium quantum steady state, energy (charge) transport, and thermodynamics

    International Nuclear Information System (INIS)

    Zhang, Z. D.; Wang, J.

    2014-01-01

    We established a theoretical framework in terms of the curl flux, population landscape, and coherence for non-equilibrium quantum systems at steady state, through exploring the energy and charge transport in molecular processes. The curl quantum flux plays the key role in determining transport properties and the system reaches equilibrium when flux vanishes. The novel curl quantum flux reflects the degree of non-equilibriumness and the time-irreversibility. We found an analytical expression for the quantum flux and its relationship to the environmental pumping (non-equilibriumness quantified by the voltage away from the equilibrium) and the quantum tunneling. Furthermore, we investigated another quantum signature, the coherence, quantitatively measured by the non-zero off diagonal element of the density matrix. Populations of states give the probabilities of individual states and therefore quantify the population landscape. Both curl flux and coherence depend on steady state population landscape. Besides the environment-assistance which can give dramatic enhancement of coherence and quantum flux with high voltage at a fixed tunneling strength, the quantum flux is promoted by the coherence in the regime of small tunneling while reduced by the coherence in the regime of large tunneling, due to the non-monotonic relationship between the coherence and tunneling. This is in contrast to the previously found linear relationship. For the systems coupled to bosonic (photonic and phononic) reservoirs the flux is significantly promoted at large voltage while for fermionic (electronic) reservoirs the flux reaches a saturation after a significant enhancement at large voltage due to the Pauli exclusion principle. In view of the system as a quantum heat engine, we studied the non-equilibrium thermodynamics and established the analytical connections of curl quantum flux to the transport quantities such as energy (charge) transfer efficiency, chemical reaction efficiency, energy

  17. Effects of bulk charged impurities on the bulk and surface transport in three-dimensional topological insulators

    International Nuclear Information System (INIS)

    Skinner, B.; Chen, T.; Shklovskii, B. I.

    2013-01-01

    In the three-dimensional topological insulator (TI), the physics of doped semiconductors exists literally side-by-side with the physics of ultrarelativistic Dirac fermions. This unusual pairing creates a novel playground for studying the interplay between disorder and electronic transport. In this mini-review, we focus on the disorder caused by the three-dimensionally distributed charged impurities that are ubiquitous in TIs, and we outline the effects it has on both the bulk and surface transport in TIs. We present self-consistent theories for Coulomb screening both in the bulk and at the surface, discuss the magnitude of the disorder potential in each case, and present results for the conductivity. In the bulk, where the band gap leads to thermally activated transport, we show how disorder leads to a smaller-than-expected activation energy that gives way to variable-range hopping at low temperatures. We confirm this enhanced conductivity with numerical simulations that also allow us to explore different degrees of impurity compensation. For the surface, where the TI has gapless Dirac modes, we present a theory of disorder and screening of deep impurities, and we calculate the corresponding zero-temperature conductivity. We also comment on the growth of the disorder potential in passing from the surface of the TI into the bulk. Finally, we discuss how the presence of a gap at the Dirac point, introduced by some source of time-reversal symmetry breaking, affects the disorder potential at the surface and the mid-gap density of states

  18. Synthetic principles directing charge transport in low-band-gap dithienosilole-benzothiadiazole copolymers

    KAUST Repository

    Beaujuge, Pierre

    2012-05-30

    Given the fundamental differences in carrier generation and device operation in organic thin-film transistors (OTFTs) and organic photovoltaic (OPV) devices, the material design principles to apply may be expected to differ. In this respect, designing organic semiconductors that perform effectively in multiple device configurations remains a challenge. Following "donor-acceptor" principles, we designed and synthesized an analogous series of solution-processable π-conjugated polymers that combine the electron-rich dithienosilole (DTS) moiety, unsubstituted thiophene spacers, and the electron-deficient core 2,1,3-benzothiadiazole (BTD). Insights into backbone geometry and wave function delocalization as a function of molecular structure are provided by density functional theory (DFT) calculations at the B3LYP/6-31G(d,p) level. Using a combination of X-ray techniques (2D-WAXS and XRD) supported by solid-state NMR (SS-NMR) and atomic force microscopy (AFM), we demonstrate fundamental correlations between the polymer repeat-unit structure, molecular weight distribution, nature of the solubilizing side-chains appended to the backbones, and extent of structural order attainable in p-channel OTFTs. In particular, it is shown that the degree of microstructural order achievable in the self-assembled organic semiconductors increases largely with (i) increasing molecular weight and (ii) appropriate solubilizing-group substitution. The corresponding field-effect hole mobilities are enhanced by several orders of magnitude, reaching up to 0.1 cm 2 V -1 s -1 with the highest molecular weight fraction of the branched alkyl-substituted polymer derivative in this series. This trend is reflected in conventional bulk-heterojunction OPV devices using PC 71BM, whereby the active layers exhibit space-charge-limited (SCL) hole mobilities approaching 10 -3 cm 2 V -1 s -1, and yield improved power conversion efficiencies on the order of 4.6% under AM1.5G solar illumination. Beyond structure

  19. Matrix-oriented implementation for the numerical solution of the partial differential equations governing flows and transport in porous media

    KAUST Repository

    Sun, Shuyu

    2012-09-01

    In this paper we introduce a new technique for the numerical solution of the various partial differential equations governing flow and transport phenomena in porous media. This method is proposed to be used in high level programming languages like MATLAB, Python, etc., which show to be more efficient for certain mathematical operations than for others. The proposed technique utilizes those operations in which these programming languages are efficient the most and keeps away as much as possible from those inefficient, time-consuming operations. In particular, this technique is based on the minimization of using multiple indices looping operations by reshaping the unknown variables into one-dimensional column vectors and performing the numerical operations using shifting matrices. The cell-centered information as well as the face-centered information are shifted to the adjacent face-center and cell-center, respectively. This enables the difference equations to be done for all the cells at once using matrix operations rather than within loops. Furthermore, for results post-processing, the face-center information can further be mapped to the physical grid nodes for contour plotting and stream lines constructions. In this work we apply this technique to flow and transport phenomena in porous media. © 2012 Elsevier Ltd.

  20. Graphene: A membrane with steadily improving charge and spin transport properties

    Science.gov (United States)

    Beschoten, Bernd

    Long electron spin lifetimes are an important prerequisite for enabling advanced spintronic devices. In this respect the 1-ns benchmark is of high technological interest as it marks the threshold at which manipulation of spins with electrical high frequency technology becomes feasible (1 ns 1 GHz). For a long time, the measured spin lifetimes were shorter than 1 ns. Here we report on a major improvement in device fabrication which pushes the spin lifetimes to 12.6 ns in single layer graphene spin transport devices at room temperature which results in spin diffusion lengths as long as 30.5 μm. This is accomplished by the fabrication of Co/MgO-electrodes on a Si/SiO2 substrate and the subsequent dry transfer of a graphene/hexagonal boron nitride (hBN) stack on top of this electrode structure where a large hBN flake is needed in order to diminish the ingress of solvents along the hBN-to-substrate interface. We demonstrate that the spin lifetime does not depend on the contact resistance area products in these devices, indicating that spin absorption at the contacts is not the predominant source for spin dephasing which may pave the way towards probing intrinsic spin properties of graphene. In the second part, we summarize our effort to replace natural by synthetically grown graphene. We report on an advanced transfer technique that allows both reusing the copper substrate of the CVD graphene growth process and making devices with carrier mobilities as high as three million cm2/(Vs) thus rivaling exfoliated ''natural'' graphene. This material quality allows truly ballistic experiments with electron mean free paths exceeding 28 μm which brings novel electron-optic devices into reach. In collaboration with M. Drögeler, C. Franzen, F. Volmer, L. Banszerus, M. Schmitz, S. Engels, J. Dauber, M. Goldsche, M. Oellers, T. Pohlmann, M. Wolter, F. Haupt, K. Watanabe, T. Taniguchi, and C. Stampfer.

  1. Rapid transport of nano-particles having a fractional elementary charge on average in capacitively-coupled rf discharges by amplitude-modulating discharge voltage.

    Science.gov (United States)

    Shiratani, Masaharu; Koga, Kazunori; Iwashita, Shinya; Nunomura, Syota

    2008-01-01

    We have observed transport of nano-particles having, on average, a fractional elementary charge in single pulse and double pulse capacitively-coupled rf discharges both without and with an Amplitude Modulation (AM) of the discharge voltage, using a two-dimensional laser-light scattering method. Rapid transport of nano-particles towards the grounded electrode is realized using rf discharges with AM. Two important parameters for the rapid transport of nano-particles are the discharge voltage and the period of AM. An important key of the rapid transport is fast redistribution of ion current over the whole discharge region; that is, fast change of spatial distribution of forces exerted on nano-particles. The longer period of the modulation is needed for rapid transport for the larger nano-particles. The higher discharge voltage of the modulation is needed for rapid transport of nano-particles having a smaller mean charge. Local perturbation of electric potential using a probe does not bring about global rapid transport of nano-particles, whereas it leads to their local transport near the probe.

  2. Effects of Packing Structure on the Optoelectronic and Charge Transport Properties in Poly(9,9-di-n-octylfluorene-alt-benzothiadiazole)

    DEFF Research Database (Denmark)

    Donley, C.L.; Zaumseil, J.; Andreasen, Jens Wenzel

    2005-01-01

    on the optoelectronic and charge transport properties of these films. A model based on quantum chemical calculations, wide-angle X-ray scattering, atomic force microscopy, Raman spectroscopy, photoluminescence, and electron mobility measurements was developed to describe the restructuring of the polymer film...

  3. Carrier transport and collection in fully depleted semiconductors by a combined action of the space charge field and the field due to electrode voltages

    Science.gov (United States)

    Rehak, P.; Gatti, E.

    1984-02-24

    A semiconductor charge transport device and method for making same, characterized by providing a thin semiconductor wafer having rectifying functions on its opposing major surfaces and including a small capacitance ohmic contact, in combination with bias voltage means and associated circuit means for applying a predetermined voltage to effectively deplete the wafer in regions thereof between the rectifying junctions and the ohmic contact. A charge transport device of the invention is usable as a drift chamber, a low capacitance detector, or a charge coupled device each constructed according to the methods of the invention for making such devices. Detectors constructed according to the principles of the invention are characterized by having significantly higher particle position indicating resolution than is attainable with prior art detectors, while at the same time requiring substantially fewer readout channels to realize such high resolution.

  4. The elusive role of NbLi bound polaron energy in hopping charge transport in Fe: LiNbO3

    Science.gov (United States)

    Guilbert, Laurent; Vittadello, Laura; Bazzan, Marco; Mhaouech, Imed; Messerschmidt, Simon; Imlau, Mirco

    2018-03-01

    Charge transport due to small polarons hopping among defective (bound polarons) and regular (free polarons) sites is shown to depend in a non-trivial way on the value of the stabilization energy provided by the lattice distortion surrounding the charge carriers. This energy, normally not directly accessible for bound polarons using spectroscopic techniques, is determined here by a combination of experimental and numerical methods for the important case of small electron polarons bound to NbLi defects in the prototype ferroelectric oxide lithium niobate. Our findings provide an estimation of the NbLi polaron stabilization energy E_GP=(0.75+/-0.05)~eV and demonstrate that in lithium niobate both free and bound polarons contribute to charge transport at room temperature, explaining the fast decay of the light-induced bound polaron population observed by transient absorption spectroscopy.

  5. Application of the charge regulation model to transport of ions through hydrophilic membranes : one-dimensional transport model for narrow pores (nanofiltration)

    NARCIS (Netherlands)

    Samuel de Lint, W.B.; Biesheuvel, P.M.; Verweij, H.

    2002-01-01

    The charge regulation concept is combined with the Navier-Stokes and Nernst-Planck equations to describe the ion retention of nanofiltration membranes consisting of narrow cylindrical pores. The charge regulation approach replaces the assumption of a constant charge or a constant potential at the

  6. Application of the charge regulation model to transport of ions through hydrophilic membranes: one-dimensional transport model for narrow pores (nanofiltration)

    NARCIS (Netherlands)

    de Lint, W.B.S.; Biesheuvel, Pieter Maarten; Biesheuvel, P.M.; Verweij, H.

    2002-01-01

    The charge regulation concept is combined with the Navier-Stokes and Nernst-Planck equations to describe the ion retention of nanofiltration membranes consisting of narrow cylindrical pores. The charge regulation approach replaces the assumption of a constant charge or a constant potential at the

  7. Carrier multiplication and charge transport in artificial quantum-dot solids probed by ultrafast photocurrent spectroscopy (Conference Presentation)

    Science.gov (United States)

    Klimov, Victor I.

    2017-05-01

    Understanding and controlling carrier transport and recombination dynamics in colloidal quantum dot films is key to their application in electronic and optoelectronic devices. Towards this end, we have conducted transient photocurrent measurements to monitor transport through quantum confined band edge states in lead selenide quantum dots films as a function of pump fluence, temperature, electrical bias, and surface treatment. Room temperature dynamics reveal two distinct timescales of intra-dot geminate processes followed by non-geminate inter-dot processes. The non-geminate kinetics is well described by the recombination of holes with photoinjected and pre-existing electrons residing in mid-gap states. We find the mobility of the quantum-confined states shows no temperature dependence down to 6 K, indicating a tunneling mechanism of early time photoconductance. We present evidence of the importance of the exciton fine structure in controlling the low temperature photoconductance, whereby the nanoscale enhanced exchange interaction between electrons and holes in quantum dots introduces a barrier to charge separation. Finally, side-by-side comparison of photocurrent transients using excitation with low- and high-photon energies (1.5 vs. 3.0 eV) reveals clear signatures of carrier multiplication (CM), that is, generation of multiple excitons by single photons. Based on photocurrent measurements of quantum dot solids and optical measurements of solution based samples, we conclude that the CM efficiency is unaffected by strong inter-dot coupling. Therefore, the results of previous numerous spectroscopic CM studies conducted on dilute quantum dot suspensions should, in principle, be reproducible in electronically coupled QD films used in devices.

  8. Novel Energy Sources -Material Architecture and Charge Transport in Solid State Ionic Materials for Rechargeable Li ion Batteries

    Energy Technology Data Exchange (ETDEWEB)

    Katiyar, Ram S; Gómez, M; Majumder, S B; Morell, G; Tomar, M S; Smotkin, E; Bhattacharya, P; Ishikawa, Y

    2009-01-19

    Since its introduction in the consumer market at the beginning of 1990s by Sony Corporation ‘Li-ion rechargeable battery’ and ‘LiCoO2 cathode’ is an inseparable couple for highly reliable practical applications. However, a separation is inevitable as Li-ion rechargeable battery industry demand more and more from this well serving cathode. Spinel-type lithium manganate (e.g., LiMn2O4), lithium-based layered oxide materials (e.g., LiNiO2) and lithium-based olivine-type compounds (e.g., LiFePO4) are nowadays being extensively studied for application as alternate cathode materials in Li-ion rechargeable batteries. Primary goal of this project was the advancement of Li-ion rechargeable battery to meet the future demands of the energy sector. Major part of the research emphasized on the investigation of electrodes and solid electrolyte materials for improving the charge transport properties in Li-ion rechargeable batteries. Theoretical computational methods were used to select electrodes and electrolyte material with enhanced structural and physical properties. The effect of nano-particles on enhancing the battery performance was also examined. Satisfactory progress has been made in the bulk form and our efforts on realizing micro-battery based on thin films is close to give dividend and work is progressing well in this direction.

  9. Highly efficient exciton harvesting and charge transport in ternary blend solar cells based on wide- and low-bandgap polymers.

    Science.gov (United States)

    Wang, Yanbin; Ohkita, Hideo; Benten, Hiroaki; Ito, Shinzaburo

    2015-10-28

    We have designed highly efficient ternary blend solar cells based on a wide-bandgap crystalline polymer, poly(3-hexylthiophene) (P3HT), and a low-bandgap polymer, poly[(4,4'-bis(2-ethylhexyl)dithieno[3,2-b:2'3'-d]silole)-2,6-diyl-alt-(2,1,3-benzothiadiazole)-4,7-diyl] (PSBTBT), and a fullerene derivative (PCBM). By using highly crystalline P3HT, high fill factors were obtained even for ternary blend solar cells, suggesting efficient charge transport due to large P3HT crystalline domains. In such large crystalline domains, some P3HT excitons could not diffuse into the interface with PCBM but can be collected in PSBTBT domains by efficient energy transfer because of large spectral overlap between the P3HT fluorescence and the PSBTBT absorption. Consequently, all the P3HT excitons can contribute to the photocurrent generation at the P3HT/PCBM interface and/or PSBTBT domains mixed with PCBM in the ternary blends. As a result, P3HT/PSBTBT/PCBM ternary blend solar cells exhibit a power conversion efficiency of 5.6%, which is even higher than those of both individual binary devices of P3HT/PCBM and PSBTBT/PCBM.

  10. Electroactivity of a starburst hole-transport material in Langmuir-Blodgett films. Solid state effects and intervalence charge transfer.

    Science.gov (United States)

    Parra, Vicente; Del Caño, Teodosio; Rodríguez-Méndez, María L; De Saja, José A; Bouvet, Marcel; Shirota, Yasuhiko

    2007-06-14

    Here we report on the electroactivity properties of Langmuir-Blodgett (LB) films of the hole-transport molecule 4,4',4''-tris[3-methylphenyl(phenyl)amino] triphenylamine (m-MTDATA). Fairly stable Langmuir films at the air-water interface are accomplished, despite the non-amphiphilic character of the molecule. The reflection-absorption infrared spectroscopy (RAIRS) and Fourier transform infrared (FT-IR) analysis revealed that the molecules arrange with no neat preferential orientation, in agreement with the amorphous glassy nature of this starburst molecule. However, there is a tendency of the molecules to organize in a more planar conformation due to the intermolecular stacking induced by the LB technique. On the other hand, the fundamental electrochemistry (by cyclic voltammetry, CV) of the films is also analyzed. The CV studies of both solution and films reveal that both the solid state and the electrolyte's anions clearly affect the m-MTDATA's electroactivity, exhibiting a unique and broad redox process instead of the two reversible oxidations observed in solution. The oxidization mechanism is discussed. Finally, the spectroelectrochemistry studies evidence that the oxidization of the films leads to new absorption bands, among which the emerging bands in the NIR region ascribed to intervalence charge transfer (IVCT) between the generated aminyl radical cations should be pointed out.

  11. Spontaneously formed high-performance charge-transport layers of organic single-crystal semiconductors on precisely synthesized insulating polymers

    Science.gov (United States)

    Makita, Tatsuyuki; Sasaki, Masayuki; Annaka, Tatsuro; Sasaki, Mari; Matsui, Hiroyuki; Mitsui, Chikahiko; Kumagai, Shohei; Watanabe, Shun; Hayakawa, Teruaki; Okamoto, Toshihiro; Takeya, Jun

    2017-04-01

    Charge-transporting semiconductor layers with high carrier mobility and low trap-density, desired for high-performance organic transistors, are spontaneously formed as a result of thermodynamic phase separation from a blend of π-conjugated small molecules and precisely synthesized insulating polymers dissolved in an aromatic solvent. A crystal film grows continuously to the size of centimeters, with the critical conditions of temperature, concentrations, and atmosphere. It turns out that the molecular weight of the insulating polymers plays an essential role in stable film growth and interfacial homogeneity at the phase separation boundary. Fabricating the transistor devices directly at the semiconductor-insulator boundaries, we demonstrate that the mixture of 3,11-didecyldinaphtho[2,3-d:2',3'-d']benzo[1,2-b:4,5-b']dithiophene and poly(methyl methacrylate) with the optimized weight-average molecular weight shows excellent device performances. The spontaneous phase separation with a one-step fabrication process leads to a high mobility up to 10 cm2 V-1 s-1 and a low subthreshold swing of 0.25 V dec-1 even without any surface treatment such as self-assembled monolayer modifications on oxide gate insulators.

  12. Improvement of charged particles transport across a transverse magnetic filter field by electrostatic trapping of magnetized electrons

    International Nuclear Information System (INIS)

    Das, B. K.; Hazarika, P.; Chakraborty, M.; Bandyopadhyay, M.

    2014-01-01

    A study on the transport of charged particles across a magnetic filter field has been carried out in a double plasma device (DPD) and presented in this manuscript. The DPD is virtually divided into two parts viz. source and target regions by a transverse magnetic field (TMF) which is constructed by inserting strontium ferrite magnets into two stainless steel rectangular tubes. Plasma electrons are magnetized but ions are unmagnetized inside the TMF region. Negative voltages are applied to the TMF tubes in order to reduce the loss of electrons towards them. Plasma is produced in the source region by filament discharge method and allowed to flow towards the target region through this negatively biased TMF. It is observed that in the target region, plasma density can be increased and electron temperature decreased with the help of negatively biased TMF. This observation is beneficial for negative ion source development. Plasma diffusion across the negatively biased TMF follows Bohm or anomalous diffusion process when negative bias voltage is very less. At higher negative bias, diffusion coefficient starts deviating from the Bohm diffusion value, associated with enhanced plasma flow in the target region

  13. Improvement of charged particles transport across a transverse magnetic filter field by electrostatic trapping of magnetized electrons

    Energy Technology Data Exchange (ETDEWEB)

    Das, B. K., E-mail: bdyt.ds@rediffmail.com; Hazarika, P.; Chakraborty, M. [Centre of Plasma Physics-Institute for Plasma Research, Tepesia-782402, Kamrup, Assam (India); Bandyopadhyay, M., E-mail: mainak@iter-india.org [ITER-India, Institute for Plasma Research, Gandhinagar-382025, Gujarat (India)

    2014-07-15

    A study on the transport of charged particles across a magnetic filter field has been carried out in a double plasma device (DPD) and presented in this manuscript. The DPD is virtually divided into two parts viz. source and target regions by a transverse magnetic field (TMF) which is constructed by inserting strontium ferrite magnets into two stainless steel rectangular tubes. Plasma electrons are magnetized but ions are unmagnetized inside the TMF region. Negative voltages are applied to the TMF tubes in order to reduce the loss of electrons towards them. Plasma is produced in the source region by filament discharge method and allowed to flow towards the target region through this negatively biased TMF. It is observed that in the target region, plasma density can be increased and electron temperature decreased with the help of negatively biased TMF. This observation is beneficial for negative ion source development. Plasma diffusion across the negatively biased TMF follows Bohm or anomalous diffusion process when negative bias voltage is very less. At higher negative bias, diffusion coefficient starts deviating from the Bohm diffusion value, associated with enhanced plasma flow in the target region.

  14. Evaluation of an Acoustic Charge Transport (ACT) device for adaptive interference suppression in spread spectrum communications systems

    Science.gov (United States)

    Mills, Michael S.

    1993-12-01

    Analytical results have shown that adaptive filtering can be a powerful tool for the rejection of narrowband interference in a direct sequence spread spectrum receiver. However, the complexity of adaptive filtering hardware has hindered the experimental validation of these results. This thesis describes a unique adaptive filter architecture for implementing the Widrow-Hoff least mean square (LMS) algorithm using two state of the art acoustic charge transport (ACT) programmable transversal filters (PTF's). Signal to noise ratio improvement measurements demonstrate the effectiveness of the adaptive filter for suppressing single- and dual-tone jammers at jammer to signal ratios (JSR's) of up to 30 dB. It is shown that the ACT adaptive interference rejection system can consistently produce 55 dB notch depths with 3-dB bandwidths as low as 300 kHz with minimal degradation to the spread spectrum signal. It is also shown that the adaptive system can eliminate single tone jammers at any frequency within the spread spectrum bandwidth at any of 10, 20, or 30 dB JSRs within 10 to 15 iterations of the adaptive algorithm. The only drawback with the adaptive system as tested is the amount of time taken to perform an iteration because of the requirement to update the PTF tap weights sequentially. Suggestions are given as to how this particular parameter of the adaptive interference system could be optimized.

  15. Transportation Safety of Lithium Iron Phosphate Batteries - A Feasibility Study of Storing at Very Low States of Charge.

    Science.gov (United States)

    Barai, Anup; Uddin, Kotub; Chevalier, Julie; Chouchelamane, Gael H; McGordon, Andrew; Low, John; Jennings, Paul

    2017-07-11

    In freight classification, lithium-ion batteries are classed as dangerous goods and are therefore subject to stringent regulations and guidelines for certification for safe transport. One such guideline is the requirement for batteries to be at a state of charge of 30%. Under such conditions, a significant amount of the battery's energy is stored; in the event of mismanagement, or indeed an airside incident, this energy can lead to ignition and a fire. In this work, we investigate the effect on the battery of removing 99.1% of the total stored energy. The performance of 8Ah C 6 /LiFePO 4 pouch cells were measured following periods of calendar ageing at low voltages, at and well below the manufacturer's recommended value. Battery degradation was monitored using impedance spectroscopy and capacity tests; the results show that the cells stored at 2.3 V exhibited no change in cell capacity after 90 days; resistance rise was negligible. Energy-dispersive X-ray spectroscopy results indicate that there was no significant copper dissolution. To test the safety of the batteries at low voltages, external short-circuit tests were performed on the cells. While the cells discharged to 2.3 V only exhibited a surface temperature rise of 6 °C, cells at higher voltages exhibited sparks, fumes and fire.

  16. Mean carrier transport properties and charge collection dynamics of single-crystal, natural type IIa diamonds from ion-induced conductivity measurements

    Energy Technology Data Exchange (ETDEWEB)

    Han, Sung Su [Univ. of California, Berkeley, CA (United States)

    1993-09-01

    Ion-induced conductivity has been used to investigate the detector characteristics of diamond detectors. Both integrated-charge, and time-resolved current measurements were performed to examine the mean carrier transport properties of diamond and the dynamics of charge collection under highly-localized and high-density excitation conditions. The integrated-charge measurements were conducted with a standard pulse-counting system with 241Am radioactivity as the excitation source for the detectors. The time-resolved current measurements were performed using a 70 GHz random sampling oscilloscope with the detectors incorporated into high-speed microstrip transmission lines and the excitation source for these measurements was an ion beam of either 5-MeV He+ or 10-MeV Si3+. The detectors used in both experiments can be described as metal-semiconductor-metal (MSM) devices where a volume of the detector material is sandwiched between two metal plates. A charge collection model was developed to interpret the integrated-charge measurements which enabled estimation of the energy required to produce an electron-hole pair (ϵdi) and the mean carrier transport properties in diamond, such as carrier mobility and lifetime, and the behavior of the electrical contacts to diamond.

  17. Rational design of organoboron derivatives as chemosensors for fluoride and cyanide anions and charge transport and luminescent materials for organic light-emitting diodes.

    Science.gov (United States)

    Jin, Ruifa; Tang, Shanshan; Luo, Dongmei

    2014-03-01

    The interactions between chemosensors, donor-π-acceptor (D-π-A) dipolar organoboron derivatives, and different (CN⁻, F⁻, Cl⁻, and Br⁻) anions have been theoretically investigated using DFT approaches. Theoretical investigations have been performed to explore the optical, electronic, charge transport, and stability properties of organoboron derivatives as charge transport and luminescent materials for organic light emitting devices (OLEDs). It turned out that the unique selectivity of organoboron derivatives for F⁻/CN⁻ is ascribed to the formation of chemosensors complexes. The frontier molecular orbitals (FMOs) and local density of states analysis have turned out that the vertical electronic transitions of absorption and emission for chemosensors and their F⁻/CN⁻ complexes are characterized as intramolecular charge transfer (ICT). The formation of complexes has effect on the distribution of FMOs and the flowing direction of electronic density for vertical transition. The study of substituent effects suggests that the derivatives with thiophene (2), furan (3), and 1H-pyrrole (4) fragments, are expected to be promising candidates for ratiometric fluorescent fluoride and cyanide chemosensors as well as chromogenic chemosensors, whereas derivatives with pyridine (5) and pyrimidine (6) fragments can serve as chromogenic chemosensors only. Furthermore, all the derivatives are promising luminescent and hole transport materials and 2, 3, 5, and 6 can serve as electron transport materials for OLEDs.

  18. Sustainable transition of socio-technological systems: How can Governance Network Research and Transition Theory contribute to the transition to biofuel for transportation?

    DEFF Research Database (Denmark)

    Hansen, Ole Erik; Stærdahl, Jens; Søndergård, Bent

    The paper suggests that the challenge of sustainability demands a shift of the attention of environmental planning and policy to the transition of socio-technological systems. Deliberate planning for sustainability then becomes a question of addressing governance structures of socio-technological...... activities provides both a theoretical and empirical body of knowledge of such governance processes. The paper presents these approaches and demonstrates how they can be used in relation to the process of developing bio-fuel systems for transportation.......-technological systems, calling attention to how such governance structures emerge, stabilize and become dominant, which functions governance structures have to serve to become efficient, and how they can be made subject to deliberate and purposeful shaping and transition. Taking this approach, research in planning...

  19. Predictive DFT-based approaches to charge and spin transport in single-molecule junctions and two-dimensional materials: successes and challenges.

    Science.gov (United States)

    Quek, Su Ying; Khoo, Khoong Hong

    2014-11-18

    CONSPECTUS: The emerging field of flexible electronics based on organics and two-dimensional (2D) materials relies on a fundamental understanding of charge and spin transport at the molecular and nanoscale. It is desirable to make predictions and shine light on unexplained experimental phenomena independently of experimentally derived parameters. Indeed, density functional theory (DFT), the workhorse of first-principles approaches, has been used extensively to model charge/spin transport at the nanoscale. However, DFT is essentially a ground state theory that simply guarantees correct total energies given the correct charge density, while charge/spin transport is a nonequilibrium phenomenon involving the scattering of quasiparticles. In this Account, we critically assess the validity and applicability of DFT to predict charge/spin transport at the nanoscale. We also describe a DFT-based approach, DFT+Σ, which incorporates corrections to Kohn-Sham energy levels based on many-electron calculations. We focus on single-molecule junctions and then discuss how the important considerations for DFT descriptions of transport can differ in 2D materials. We conclude that when used appropriately, DFT and DFT-based approaches can play an important role in making predictions and gaining insight into transport in these materials. Specifically, we shall focus on the low-bias quasi-equilibrium regime, which is also experimentally most relevant for single-molecule junctions. The next question is how well can the scattering of DFT Kohn-Sham particles approximate the scattering of true quasiparticles in the junction? Quasiparticles are electrons (holes) that are surrounded by a constantly changing cloud of holes (electrons), but Kohn-Sham particles have no physical significance. However, Kohn-Sham particles can often be used as a qualitative approximation to quasiparticles. The errors in standard DFT descriptions of transport arise primarily from errors in the Kohn-Sham energy levels

  20. Mapping nanoscale effects of localized noise-source activities on photoconductive charge transports in polymer-blend films.

    Science.gov (United States)

    Shekhar, Shashank; Cho, Duckhyung; Cho, Dong-Guk; Yang, Myungjae; Hong, Seunghun

    2018-05-18

    We develolped a method to directly image the nanoscale effects of localized noise-source activities on photoconducting charge transports in domain structures of phase-separated polymer-blend films of Poly(9,9-di-n-octylfluorenyl-2,7-diyl) and Poly(9,9-di-n-octylfluorene-alt-benzothiadiazole). For the imaging, current and noise maps of the polymer-blend were recorded using a conducting nanoprobe in contact with the surface, enabling the conductivity (σ) and noise-source density (N T ) mappings under an external stimulus. The blend-films exhibited the phase-separation between the constituent polymers at domains level. Within a domain, high σ (low N T ) and low σ (high N T ) regions were observed, which could be associated with the ordered and disordered regions of a domain. In the N T maps, we observed that noise-sources strongly affected the conduction mechanism, resulting in a scaling behavior of σ ∝ [Formula: see text] in both ordered and disordered regions. When a blend film was under an influence of an external stimulus such as a high bias or an illumination, an increase in the σ was observed, but that also resulted in increases in the N T as a trade-off. Interestingly, the Δσ versus ΔN T plot exhibited an unusual scaling behavior of Δσ ∝ [Formula: see text] which is attributed to the de-trapping of carriers from deep traps by the external stimuli. In addition, we found that an external stimulus increased the conductivity at the interfaces without significantly increasing their N T , which can be the origin of the superior performances of polymer-blend based devices. These results provide valuable insight about the effects of noise-sources on nanoscale optoelectronic properties in polymer-blend films, which can be an important guideline for improving devices based on polymer-blend.

  1. Mapping nanoscale effects of localized noise-source activities on photoconductive charge transports in polymer-blend films

    Science.gov (United States)

    Shekhar, Shashank; Cho, Duckhyung; Cho, Dong-Guk; Yang, Myungjae; Hong, Seunghun

    2018-05-01

    We develolped a method to directly image the nanoscale effects of localized noise-source activities on photoconducting charge transports in domain structures of phase-separated polymer-blend films of Poly(9,9-di-n-octylfluorenyl-2,7-diyl) and Poly(9,9-di-n-octylfluorene-alt-benzothiadiazole). For the imaging, current and noise maps of the polymer-blend were recorded using a conducting nanoprobe in contact with the surface, enabling the conductivity (σ) and noise-source density (N T) mappings under an external stimulus. The blend-films exhibited the phase-separation between the constituent polymers at domains level. Within a domain, high σ (low N T) and low σ (high N T) regions were observed, which could be associated with the ordered and disordered regions of a domain. In the N T maps, we observed that noise-sources strongly affected the conduction mechanism, resulting in a scaling behavior of σ ∝ {{N}{{T}}}-0.5 in both ordered and disordered regions. When a blend film was under an influence of an external stimulus such as a high bias or an illumination, an increase in the σ was observed, but that also resulted in increases in the N T as a trade-off. Interestingly, the Δσ versus ΔN T plot exhibited an unusual scaling behavior of Δσ ∝ {{Δ }}{{N}{{T}}}0.5, which is attributed to the de-trapping of carriers from deep traps by the external stimuli. In addition, we found that an external stimulus increased the conductivity at the interfaces without significantly increasing their N T, which can be the origin of the superior performances of polymer-blend based devices. These results provide valuable insight about the effects of noise-sources on nanoscale optoelectronic properties in polymer-blend films, which can be an important guideline for improving devices based on polymer-blend.

  2. The role of transport processes of nonequilibrium charge carriers in radiative properties of arrays of InAs/GaAs quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Shkolnik, A. S., E-mail: alix@mbepl.ioffe.ru [Russian Academy of Sciences, Ioffe Physicotechnical Institute (Russian Federation); Savelyev, A. V. [St. Petersburg State Polytechnical University (Russian Federation); Karachinsky, L. Ya.; Gordeev, N. Yu.; Seisyan, R. P.; Zegrya, G. G. [Russian Academy of Sciences, Ioffe Physicotechnical Institute (Russian Federation); Pellegrini, S.; Buller, G. S. [Heriot-Watt University, School of Engineering and Physical Science (United Kingdom); Evtikhiev, V. P. [Russian Academy of Sciences, Ioffe Physicotechnical Institute (Russian Federation)

    2008-03-15

    The results of time-resolved photoluminescence studies of heterostructures containing monolayer arrays of InAs/GaAs quantum dots are presented. A two-component time dependence of intensity of photoluminescence from the ground state of quantum dots, with characteristic times of the slow component up to hundreds of nanoseconds and those of rapid one several nanoseconds, is studied. It is shown that the slow component is determined by the transport of nonequilibrium charge carriers between the quantum dots. At low temperatures, the time of the slow component is determined by tunneling, and at high temperatures by thermal escape of nonequilibrium charge carriers. The ratio of the contributions of tunneling and thermal escape is determined by the degree of isolation of quantum dots. A theoretical model is constructed that describes the effect of the dynamics of carrier transport on the emergence and decay of the slow component of photoluminescence.

  3. Charge transport in TiO.sub.2./sub. films with complex percolation pathways investigated by time-resolved terahertz spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Němec, Hynek; Zajac, Vít; Rychetský, Ivan; Fattakhova-Rohlfing, D.; Mandlmeier, B.; Bein, T.; Mics, Zoltan; Kužel, Petr

    2013-01-01

    Roč. 3, č. 3 (2013), s. 302-313 ISSN 2156-342X R&D Projects: GA ČR GAP204/12/0232; GA ČR GA13-12386S Grant - others:AVČR(CZ) M100101218 Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO 2 nanoparticles Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 4.342, year: 2013

  4. Optical and charge transport properties of N-butyl-1,8-naphthalimide derivatives as organic light-emitting materials: A theoretical study

    International Nuclear Information System (INIS)

    Sun, Fuyu; Jin, Ruifa

    2014-01-01

    A series of N-butyl-1,8-naphthalimide derivatives have been designed to explore their optical, electronic, and charge transport properties as charge transport and/or luminescent materials for organic light-emitting diodes (OLEDs). The frontier molecular orbitals (FMOs) analysis has turned out that the vertical electronic transitions of absorption and emission are characterized as intramolecular charge transfer (ICT). The calculated results show that the optical and electronic properties of N-butyl-1,8-naphthalimide derivatives are affected by the substituent groups in 4-position of 1,8-naphthalimide ring. Our results suggest that N-butyl-1,8-naphthalimide derivatives with biphenyl (1), 2-phenylthiophene (2), 2-(thiophen-2-yl)thiophene (3), 2,3-dihydrothieno[3,4-b][1,4]dioxine (4), 2-phenyl-1,3,4-oxadiazole (5), benzo[c][1,2,5]thiadiazole (6), benzo[c]thiophene (7), and benzo[d]thieno[3,2-b]thiophene (8) fragments are expected to be promising candidates for luminescent materials for OLEDs, particularly for 1–3 and 5. In addition, 7 and 8 can be used as promising hole transport materials for OLEDs. - Highlights: • A series of N-butyl-1,8-naphthalimide derivatives is investigated. • Optical and electronic properties are affected by their substituent groups. • The vertical electronic transitions are characterized as intramolecular charge transfer. • All derivatives are promising luminescent materials for OLEDs. • Some derivatives can be used as promising hole transport materials for OLEDs

  5. Semimetallic and charge-ordered α -(BEDT-TTF)2I3: On the role of disorder in dc transport and dielectric properties

    Science.gov (United States)

    Ivek, Tomislav; Čulo, Matija; Kuveždić, Marko; Tutiš, Eduard; Basletić, Mario; Mihaljević, Branimir; Tafra, Emil; Tomić, Silvia; Löhle, Anja; Dressel, Martin; Schweitzer, Dieter; Korin-Hamzić, Bojana

    2017-08-01

    α -(BEDT-TTF)2I3 is a prominent example of charge ordering among organic conductors. In this work, we explore the details of transport within the charge-ordered as well as semimetallic phase at ambient pressure. In the high-temperature semimetallic phase, the mobilities and concentrations of both electrons and holes conspire in such a way to create an almost temperature-independent conductivity as well as a low Hall effect. We explain these phenomena as a consequence of a predominantly interpocket scattering which equalizes mobilities of the two types of charge carriers. At low temperatures, within the insulating charge-ordered phase two channels of conduction can be discerned: a temperature-dependent activation, which follows the mean-field behavior, and a nearest-neighbor-hopping contribution. Together with negative magnetoresistance, the latter relies on the presence of disorder. The charge-ordered phase also features a prominent dielectric peak which bears a similarity to relaxor ferroelectrics. Its dispersion is determined by free-electron screening and pushed by disorder well below the transition temperature. The source of this disorder can be found in the anion layers which randomly perturb BEDT-TTF molecules through hydrogen bonds.

  6. Photoconductivity and Charge-Carrier Photogeneration in Photorefractive Polymers

    NARCIS (Netherlands)

    Däubler, Thomas K.; Kulikovsky, Lazar; Neher, Dieter; Cimrová, Vera; Hummelen, J.C.; Mecher, Erwin; Bittner, Reinhard; Meerholz, Klaus; Lawson, M.; Meerholz, Klaus

    2002-01-01

    We have studied photogeneration, transport, trapping and recombination as the governing mechanisms for the saturation field strength and the time response of the photorefractive (PR) effect in PVK-based PR materials, utilizing xerographic discharge and photoconductivity experiments. Both the charge

  7. Investigation of exciton photodissociation, charge transport and photovoltaic response of poly(N-vinyl carbazole):TiO2 nanocomposites for solar cell applications

    International Nuclear Information System (INIS)

    Dridi, C; Chaabane, H; Barlier, V; Davenas, J; Ouada, H Ben

    2008-01-01

    The photogeneration of charge carriers in spin-coated thin films of nanocrystalline (nc-)TiO 2 particles dispersed in a semiconducting polymer, poly(N-vinylcarbazole) (PVK), has been studied by photoluminescence and charge transport measurements. The solvent and the TiO 2 particle concentration have been selected to optimize the composite morphology. A large number of small domains leading to a large interface and an improved exciton dissociation could be obtained with tetrahydrofuran (THF). The charge transport mechanism and trap distribution at low and high voltage in ITO/nc-TiO 2 :PVK/Al diodes in the dark could be identified by current-voltage measurements and impedance spectroscopy. The transport mechanism is space charge limited with an exponential trap distribution in the high voltage regime (1-4 V), whereas a Schottky process with a barrier height of about 0.9 eV is observed at low bias voltages ( sc and open circuit voltage V oc for a 30% TiO 2 volume content corresponding to the morphology exhibiting the best dispersion of TiO 2 particles. A degradation of the photovoltaic properties is induced at higher compositions by the formation of larger TiO 2 aggregates. A procedure has been developed to extract the physical parameters from the J-V characteristics in the dark and under illumination on the basis of an equivalent circuit. The variation of the solar cell parameters with the TiO 2 composition confirms that the photovoltaic response is optimum for 30% TiO 2 volume content. It is concluded that the photovoltaic properties of nc-TiO 2 :PVK nanocomposites are controlled by the interfacial area between the donor and the acceptor material and are limited by the dispersion of the TiO 2 nanoparticles in the polymer

  8. The surface charge of oxides and its role in deposition and transport of radioactivity in water-cooled nuclear reactors

    International Nuclear Information System (INIS)

    Tewari, P.H.; Campbell, A.B.

    1972-01-01

    The role of surface charges in the deposition of suspended oxides on surfaces is discussed. Results of deposition of corrosion-product oxides on surfaces at room temperature and 200 o C are reported. These, together with results of the specific adsorption of Co(II) on negatively charged Fe 3 O 4 suspensions are used to explain the growth of Co-60 radiation fields in water-cooled reactors. (author)

  9. Study of Charge-Dependent Transport and Toxicity of Peptide-Functionalized Silver Nanoparticles Using Zebrafish Embryos and Single Nanoparticle Plasmonic Spectroscopy

    Science.gov (United States)

    Lee, Kerry J.; Browning, Lauren M.; Nallathamby, Prakash D.; Xu, Xiao-Hong Nancy

    2013-01-01

    Nanomaterials possess unusually high surface area-to-volume ratios, and surface-determined physicochemical properties. It is essential to understand their surface-dependent toxicity in order to rationally design biocompatible nanomaterials for a wide variety of applications. In this study, we have functionalized the surfaces of silver nanoparticles (Ag NPs, 11.7 ± 2.7 nm in diameters) with three biocompatible peptides (CALNNK, CALNNS, CALNNE) to prepare positively (Ag-CALNNK NPs+ζ), negatively (Ag-CALNNS NPs−2ζ), and more negatively charged NPs (Ag-CALNNE NPs−4ζ), respectively. Each peptide differs in a single amino acid at its C-terminus, which minimizes the effects of peptide sequences and serves as a model molecule to create positive, neutral and negative charges on the surface of the NPs at pH 4–10. We have studied their charge-dependent transport into early-developing (cleavage-stage) zebrafish embryos and their effects on embryonic development using dark-field optical microscopy and spectroscopy (DFOMS). We found that all three Ag-peptide NPs passively diffused into the embryos via their chorionic pore canals, and stayed inside the embryos throughout their entire development (120 h), showing charge-independent diffusion modes and charge-dependent diffusion coefficients. Notably, the NPs create charge-dependent toxic effects on embryonic development, showing that the Ag-CALNNK NPs+ζ (positively charged) are the most biocompatible while the Ag-CALNNE NPs–4ζ (more negatively charged) are the most toxic. By comparing with our previous studies of the same sized citrated Ag and Au NPs, the Ag-peptide NPs are much more biocompatible than the citrated Ag NPs, and nearly as biocompatible as the Au NPs, showing the dependence of nanotoxicity upon the surface charges, surface functional groups and chemical compositions of the NPs. This study also demonstrates powerful applications of single NP plasmonic spectroscopy for quantitative analysis of single NPs

  10. Charge Storage, Conductivity and Charge Profiles of Insulators As Related to Spacecraft Charging

    OpenAIRE

    Dennison, JR; Frederickson, A. R.; Swaminathan, Prasanna

    2003-01-01

    Dissipation of charges built up near the surface of insulators due to space environment interaction is central to understanding spacecraft charging. Conductivity of insulating materials is key to determine how accumulated charge will distribute across the spacecraft and how rapidly charge imbalance will dissipate. To understand these processes requires knowledge of how charge is deposited within the insulator, the mechanisms for charge trapping and charge transport within the insulator, and h...

  11. Effect of Fixed Charge Groups and Counter Ions on the Transport Phenomena of Paraffin and Olefin across Anhydrous Negatively Charged Membranes.

    Science.gov (United States)

    Matsumoto; Tanioka; Kawauchi

    1998-12-01

    Permeability coefficients, apparent diffusion coefficients, and apparent solubility coefficients of n-butane and 1-butene gases across anhydrous sulfonated and carboxylated polyperfluorocarbon-type cation exchange membranes which have different counterions of Na+, Ag+, Co2+, and Ni2+ were investigated at 25 degreesC. Prior to the n-butane and 1-butene gas permeability measurements, O2 gas permeabilities were measured. From the results, it was shown that those membranes appeared to dense membranes. In each membrane, the permeability of 1-butene was higher than that of n-butane. In comparison with the same counterion membranes, the sulfonated membrane had higher permeability than the carboxylated membrane for both gases. The Ag+-form sulfonated membrane exhibited the highest permeability coefficient for 1-butene and the ideal separation factor of 1-butene/n-butane was 10.3. This is caused by the high solubility of 1-butene gas. From the calculated result using the MO method, it was shown that the interaction between the olefin and metal ions was weakened by the influence of a charged group. Therefore, the affinity between the olefin and Co2+ or Ni2+ did not function in the membrane as expected because of the divalent ions. This is the reason why the solubility coefficients of Co2+- and Ni2+-form membranes were smaller than those of the Ag+-form membrane. Copyright 1998 Academic Press.

  12. New battery model considering thermal transport and partial charge stationary effects in photovoltaic off-grid applications

    Science.gov (United States)

    Sanz-Gorrachategui, Iván; Bernal, Carlos; Oyarbide, Estanis; Garayalde, Erik; Aizpuru, Iosu; Canales, Jose María; Bono-Nuez, Antonio

    2018-02-01

    The optimization of the battery pack in an off-grid Photovoltaic application must consider the minimum sizing that assures the availability of the system under the worst environmental conditions. Thus, it is necessary to predict the evolution of the state of charge of the battery under incomplete daily charging and discharging processes and fluctuating temperatures over day-night cycles. Much of previous development work has been carried out in order to model the short term evolution of battery variables. Many works focus on the on-line parameter estimation of available charge, using standard or advanced estimators, but they are not focused on the development of a model with predictive capabilities. Moreover, normally stable environmental conditions and standard charge-discharge patterns are considered. As the actual cycle-patterns differ from the manufacturer's tests, batteries fail to perform as expected. This paper proposes a novel methodology to model these issues, with predictive capabilities to estimate the remaining charge in a battery after several solar cycles. A new non-linear state space model is proposed as a basis, and the methodology to feed and train the model is introduced. The new methodology is validated using experimental data, providing only 5% of error at higher temperatures than the nominal one.

  13. Effects of Molecular Structure on Intramolecular Charge Carrier Transport in Dithieno [3,2-b: 2,3-d] Pyrrole-Based Conjugated Copolymers

    Directory of Open Access Journals (Sweden)

    Yoshihito Honsho

    2012-01-01

    Full Text Available Intramolecular mobility of positive charge carriers in conjugated polymer films based on dithieno [2,3-b: 2,3-d] pyrrole (DTP is studied by time-resolved microwave conductivity (TRMC. A series of DTP homopolymer and copolymers combined with phenyl, 2,2-biphenyl, thiophene, 2,2-bithiophene, and 9,9-dioctylfluorene were synthesized by Suzuki-Miyaura and Yamamoto coupling reactions. Polymers containing DTP unit are reported to show high value of hole mobility measured by FET method, and this type of polymers is expected to have stable HOMO orbitals which are important for hole transportation. Among these copolymers, DTP coupled with 9,9-dioctylfluorene copolymer showed the highest charge carrier mobility as high as 1.7 cm2/Vs, demonstrating an excellent electrical property on rigid copolymer backbones.

  14. Photovoltaic Properties in Interpenetrating Heterojunction Organic Solar Cells Utilizing MoO3 and ZnO Charge Transport Buffer Layers

    Directory of Open Access Journals (Sweden)

    Tetsuro Hori

    2010-11-01

    Full Text Available Organic thin-film solar cells with a conducting polymer (CP/fullerene (C60 interpenetrating heterojunction structure, fabricated by spin-coating a CP onto a C60 deposit thin film, have been investigated and demonstrated to have high efficiency. The photovoltaic properties of solar cells with a structure of indium-tin-oxide/C60/ poly(3-hexylthiophene (PAT6/Au have been improved by the insertion of molybdenum trioxide (VI (MoO3 and zinc oxide charge transport buffer layers. The enhanced photovoltaic properties have been discussed, taking into consideration the ground-state charge transfer between PAT6 and MoO3 by measurement of the differential absorption spectra and the suppressed contact resistance at the interface between the organic and buffer layers.

  15. The Impact of Molecular p-Doping on Charge Transport in High-Mobility Small-Molecule/Polymer Blend Organic Transistors

    KAUST Repository

    Paterson, Alexandra F.

    2017-12-27

    Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.

  16. Charge-carrier transport in epitactical strontium titanate layers for the application in superconducting components; Ladungstraegertransport in epitaktischen Strontiumtitanat-Schichten fuer den Einsatz in supraleitenden Bauelementen

    Energy Technology Data Exchange (ETDEWEB)

    Grosse, Veit

    2011-02-01

    In this thesis thin STO layers were epitactically deposited on YBCO for a subsequent electrical characterization. YBCO layers with a roughness of less than 2 nm (RMS), good out-of-plane orientation with a half-width in the rocking curve in the range (0.2..0.3) at only slightly diminished critical temperature could be reached. The STO layers exhibited also very good crystallographic properties. The charge-carrier transport in STO is mainly dominated by interface-limited processes. By means of an in thesis newly developed barrier model thereby the measured dependencies j(U,T) respectively {sigma}(U,T) could be described very far-reachingly. At larger layer thicknesses and low temperatures the charge-carrier transport succeeds by hopping processes. So in the YBCO/STO/YBCO system the variable-range hopping could be identified as dominating transport process. Just above U>10 V a new behaviour is observed, which concerning its temperature dependence however is also tunnel-like. The STO layers exhibit here very large resistances, so that fields up to 10{sup 7}..10{sup 8} V/m can be reached without flowing of significant leakage currents through the barrier. In the system YBCO/STO/Au the current transport can be principally in the same way as in the YBCO/STO/YBCO system. The special shape and above all the asymmetry of the barrier however work out very distinctly. It could be shown that at high temperatures according to the current direction a second barrier on the opposite electrode must be passed. So often observed breakdown effects can be well described. For STO layer-thicknesses in the range around 25 nm in the whole temperature range studied inelastic tunneling over chains of localized states was identified as dominating transport process. It could however for the first time be shown that at very low temperatures in the STO layers Coulomb blockades can be formed.

  17. The effect of space charge on beam transport through the injection system of the Lund Pelletron accelerator

    International Nuclear Information System (INIS)

    Dymnikov, A.; Hellborg, R.; Pallon, J.; Skog, G.; Yang, C.; Ohlen, G.

    1993-01-01

    A new recursive technique is used for the solution of the equations of motion for charged particles, taking into account the effect of space charge. The paraxial equations are solved for an infinitely long beam with an elliptical cross-section in a static electric field. An effective computer code, based on the method of a continuous generalized analogue of the Gauss brackets and on the method of the envelope matrix, has been written. The code has been used to study the beam dynamics in the injection system of the Pelletron electrostatic accelerator in Lund. (orig.)

  18. The effect of space charge on beam transport through the injection system of the Lund Pelletron accelerator

    Science.gov (United States)

    Dymnikov, A.; Hellborg, R.; Pallon, J.; Skog, G.; Yang, C.; Ohlén, G.

    1993-04-01

    A new recursive technique is used for the solution of the equations of motion for charged particles, taking into account the effect of space charge. The paraxial equations are solved for an infinitely long beam with an elliptical cross-section in a static electric field. An effective computer code, based on the method of a continuous generalized analogue of the Gauss brackets and on the method of the envelope matrix, has been written. The code has been used to study the beam dynamics in the injection system of the Pelletron electrostatic accelerator in Lund.

  19. Self-Assembled Poly(3,4-ethylene dioxythiophene):Poly(styrenesulfonate)/Graphene Quantum Dot Organogels for Efficient Charge Transport in Photovoltaic Devices.

    Science.gov (United States)

    Lim, Hong Chul; Min, Sa Hoon; Lee, Eunwoo; Jang, Jyongsik; Kim, Sung Hyun; Hong, Jong-In

    2015-06-03

    We report the self-assembly of poly(3,4-ethylene dioxythiophene):poly(styrenesulfonate) ( PSS) organogel films incorporating graphene quantum dots (GQDs). Because of the electrostatic interaction between the GQDs and the PEDOT chains, GQD@PEDOT core-shell nanostructures are readily formed. We demonstrate that the GQDs affect the reorientation of PEDOT chains and the formation of interconnected structure of PEDOT-rich domains, improving the charge transport pathway. The power conversion efficiency of the organic photovoltaic device containing the self-assembled organogel as the hole extraction layer (HEL) was 26% higher than the device with pristine PEDOT-PSS as the HEL.

  20. Ellipsometric and Electrochemical Characterization of Charge Transport in Electroactive Polymers and of the Surface Phase Produced by Electrochemical Activation of Glassy Carbon Electrodes

    Science.gov (United States)

    Kepley, Larry Joe

    1990-01-01

    In situ ellipsometry was used to study the electrodeposition of polymer films formed by oxidation of bipyrazine, polyvinylferrocene (PVF), and aniline; the deposition of a viologen-containing siloxane polymer (PQ^{2+/+}) formed by electroreduction of N,N^' -bis (-3-(trimethoxysilyl)propyl) -4,4^ '-bipyridinium dichloride (I) solutions and by spin-casting solutions of I; and the oxidation-dependent swelling of spin-cast films of two structurally similar, ferrocene-containing polyamides. Electrodeposited films displayed good optical characteristics (i.e., high reflectivity, uniform coverage, and homogeneity) for thicknesses up to 400 nm in some cases. Nonideal illipsometric behavior was observed when film morphology varied with film growth. The complex refractive index, film thickness, and the viologen and ferrocene concentrations in the films were measured as a function of oxidation state, both during depositions and after transferring coated-electrodes into blank electrolyte solutions. The voltammetry of the redox polymers was studied and charge-transport modeled by finite -difference simulations of charge diffusion and diffusion coupled to dimerization/monomerization reactions. Equations were derived for linear-sweep voltammetry of a reversible couple in equilibrium with its dimer in a thin-layer cell. Ellipsometric data during electrolysis of the redox films by potential sweeps and steps were compared to theoretical curves for diffusional transport to determine the mechanism of charge transport and to optically measure its rate. The influence of redox-induced thickness changes and solvent sorption on charge transport and voltammetric behavior is described. The electrochemical activation of glassy carbon electrodes for electrolysis of aromatic molecules, such as catechol and hydroquinone, was studied by combined ellipsometric and voltammetric measurements. Ellipsometry was used to detect the anodic growth of nearly transparent layer which activated the surface. X

  1. Impact of unbalanced charge transport on the efficiency of normal and inverted solar cells (Applied Physics Letters 100 (013306))

    NARCIS (Netherlands)

    Kotlarski, J.D.; Blom, P.W.M.

    2012-01-01

    In a normal solar cell, most charge carriers are generated close to the anode, such that electrons have to travel a longer distance as compared to the holes. In an inverted solar cell, holes have to travel a longer distance. We use a combined optical and electronic model to simulate the effect of

  2. Local government GIS and geospatial capabilities : suitability for integrated transportation and land use planning (California SB 375).

    Science.gov (United States)

    2009-11-01

    This report examines two linked phenomena in transportation planning: the geospatial analysis capabilities of local planning agencies and the increasing demands on such capabilities imposed by comprehensive planning mandates. The particular examples ...

  3. The governing processes and timescales of stratosphere-to-troposphere transport and its contribution to ozone in the Arctic troposphere

    Science.gov (United States)

    Liang, Q.; Douglass, A. R.; Duncan, B. N.; Stolarski, R. S.; Witte, J. C.

    2009-05-01

    We used the seasonality of a combination of atmospheric trace gases and idealized tracers to examine stratosphere-to-troposphere transport and its influence on tropospheric composition in the Arctic. Maximum stratosphere-to-troposphere transport of CFCs and O3 occurs in April as driven by the Brewer-Dobson circulation. Stratosphere-troposphere exchange (STE) occurs predominantly between 40° N to 80° N with stratospheric influx in the mid-latitudes (30-70° N) accounting for 67-81% of the air of stratospheric origin in the Northern Hemisphere extratropical troposphere. Transport from the lower stratosphere to the lower troposphere (LT) takes three months on average, one month to cross the tropopause, the second month to travel from the upper troposphere (UT) to the middle troposphere (MT), and the third month to reach the LT. During downward transport, the seasonality of a trace gas can be greatly impacted by wet removal and chemistry. A comparison of idealized tracers with varying lifetimes suggests that when initialized with the same concentrations and seasonal cycles at the tropopause, trace gases that have shorter lifetimes display lower concentrations, smaller amplitudes, and earlier seasonal maxima during transport to the LT. STE contributes to O3 in the Arctic troposphere directly from the transport of O3 and indirectly from the transport of NOy. Direct transport of O3 from the stratosphere accounts for 78% of O3 in the Arctic UT with maximum contributions occurring from March to May. The stratospheric contribution decreases significantly in the MT/LT (20-25% of total O3) and shows a very weak March-April maximum. Our NOx budget analysis in the Arctic UT shows that during spring and summer, the stratospheric injection of NOy-rich air increases NOx concentrations above the 20 pptv threshold level, thereby shifting the Arctic UT from a regime of net photochemical ozone loss to one of net production with rates as high as +16 ppbv/month.

  4. Environmental Evaluation of Traffic Side Space for Urban Development by Collaborating Management between Government, Transportation Operators and Residents

    OpenAIRE

    Sakurai, Yusuke; Yamamoto, Sari

    2016-01-01

    Session: Global prospection of Art and Design researches : cross-linking of Academia, government and Industry by art and design ; September 18, 2016Conference: Tsukuba Global Science Week 2016 (TGSW2016)Date: September 17-19, 2016Venue: Tsukuba International Congress CenterSponsored: University of Tsukuba

  5. 41 CFR 301-70.102 - What governing policies must we establish for authorization and payment of transportation expenses?

    Science.gov (United States)

    2010-07-01

    ... rail under §§ 301-10.123 and 301-10.162, and lowest first-class accommodations for ship under § 301-10... consider use of a POV advantageous to the Government, such as travel to/from common carrier terminals, or...

  6. CIEMAT results in the frame of the european project Mechanisms governing the behaviour and transport of transuranics (analogues) and other radionuclides in marine ecosystems

    International Nuclear Information System (INIS)

    Gasco, C.; Anton, M.P.

    1996-01-01

    This report summarises the objectives and more relevant conclusions obtained by CIEMAT in the frame of the project Mechanisms governing the behaviour and transport of transuranics (analogues) and other radionuclides in marine ecosystems. The overall objective of this project was to identify the basic mechanisms and define the key parameters governing the physico-chemical speciation, vertical and horizontal mobility, biological magnification, incorporation to seabed sediments and ultimate fate of transuranium and other long-lived radionuclides in the marine environment, with a view to providing high-quality data of a universal character for use in the development and validation of predictive models based on fundamental mechanisms rather than the simpler box-model approach. This research was carried out in different European marine ecosystems: those directly affected by controlled releases from Nuclear Industries and/or accidents and those characterized by being preferent radionuclides accumulation sites (submarine canyons, estuaries, etc.). (Author)

  7. Transport and handling of dangerous goods. Training of persons in charge of vehicles or vessels carrying dangerous goods by road or by inland waterways (Dangerous Goods 1979 No.1)

    International Nuclear Information System (INIS)

    1979-01-01

    This Order supplements the Regulations of 15 April 1945 on the transport of dangerous goods by rail, land and inland waterways. It deals with the training of persons in charge of vehicles or boats carrying dangerous goods by road or by inland waterways. It refers in particular to transport of radioactive materials. (NEA) [fr

  8. Mass and charge transport relevant to the formation of toroidal lithium peroxide nanoparticles in an aprotic lithium-oxygen battery: An experimental and theoretical modelling study

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Xiangyi; Amine, Rachid; Lau, Kah Chun; Lu, Jun; Zhan, Chun; Curtiss, Larry A.; Hallaj, Said Al; Chaplin, Brian P.; Amine, Khalil

    2017-12-01

    The discharge and charge mechanisms of rechargeable Li-O-2 batteries have been the subject of extensive investigation recently. However, they are not fully understood yet. Here we report a systematic study of the morphological transition of Li2O2 from a single crystalline structure to a toroid like particle during the discharge-charge cycle, with the help of a theoretical model to explain the evolution of the Li2O2 at different stages of this process. The model suggests that the transition starts in the first monolayer of Li2O2, and is subsequently followed by a transition from particle growth to film growth if the applied current exceeds the exchange current for the oxygen reduction reaction in a Li-O-2 cell. Furthermore, a sustainable mass transport of the diffusive active species (e.g., O-2 and Li+) and evolution of the underlying interfaces are critical to dictate desirable oxygen reduction (discharge) and evolution (charge) reactions in the porous carbon electrode of a Li-O-2 cell.

  9. Who's in charge here anyway? Polycentric governance configurations and the development of policy on invasive alien species in the semisovereign Caribbean

    NARCIS (Netherlands)

    Vaas, J.|info:eu-repo/dai/nl/412502976; Driessen, P.P.J.|info:eu-repo/dai/nl/069081417; Giezen, Mendel; van Laerhoven, F.S.J.|info:eu-repo/dai/nl/314406832; Wassen, M.J.|info:eu-repo/dai/nl/07165710X

    2017-01-01

    We address the development of policy by polycentric governance configurations, taking Caribbean overseas territories and their advancements on invasive alien species (IAS) policy as an example. The British, Dutch, and French islands in the Caribbean address this matter to different degrees, which we

  10. Unraveling the Solution-State Supramolecular Structures of Donor-Acceptor Polymers and their Influence on Solid-State Morphology and Charge-Transport Properties.

    Science.gov (United States)

    Zheng, Yu-Qing; Yao, Ze-Fan; Lei, Ting; Dou, Jin-Hu; Yang, Chi-Yuan; Zou, Lin; Meng, Xiangyi; Ma, Wei; Wang, Jie-Yu; Pei, Jian

    2017-11-01

    Polymer self-assembly in solution prior to film fabrication makes solution-state structures critical for their solid-state packing and optoelectronic properties. However, unraveling the solution-state supramolecular structures is challenging, not to mention establishing a clear relationship between the solution-state structure and the charge-transport properties in field-effect transistors. Here, for the first time, it is revealed that the thin-film morphology of a conjugated polymer inherits the features of its solution-state supramolecular structures. A "solution-state supramolecular structure control" strategy is proposed to increase the electron mobility of a benzodifurandione-based oligo(p-phenylene vinylene) (BDOPV)-based polymer. It is shown that the solution-state structures of the BDOPV-based conjugated polymer can be tuned such that it forms a 1D rod-like structure in good solvent and a 2D lamellar structure in poor solvent. By tuning the solution-state structure, films with high crystallinity and good interdomain connectivity are obtained. The electron mobility significantly increases from the original value of 1.8 to 3.2 cm 2 V -1 s -1 . This work demonstrates that "solution-state supramolecular structure" control is critical for understanding and optimization of the thin-film morphology and charge-transport properties of conjugated polymers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Direct Determination of Energy Level Alignment and Charge Transport at Metal/ Alq 3 Interfaces via Ballistic-Electron-Emission Spectroscopy (BEES)

    Science.gov (United States)

    Jiang, J. S.; Pearson, J. E.; Bader, S. D.

    2011-03-01

    In organic electronic devices, the difference between the electrode work function and the organic lowest unoccupied molecular orbital (LUMO) or highest occupied molecular orbital (HOMO) is a crucial parameter in determining the nature of charge transport. However, experimental determination of LUMO is challenging. For the archetypal electroluminescent organic semiconductor tris-(8-hydroxyquinoline) aluminum (Alq 3), various techniques gave significantly different HOMO-LUMO gap values. Using BEES, we directly determined the energy barrier for electron injection at clean interfaces of Alq 3 with Al and Fe to be 2.1 eV and 2.2 eV, respectively. We quantitatively modeled the sub-barrier BEES spectra with an accumulated space charge layer, and found that the transport of non-ballistic electrons is consistent with random hopping over the injection barrier. Supported by U.S. DOE Office of Science Basic Energy Sciences, under Contract No. DE-AC02-06CH11357. J. C. Scott, J. Vac. Sci. Tech, A 21, 521 (2003).

  12. Photoinduced charge dissociation and transport at P3HT/ITO interfaces: studied by modulated surface spectroscopy

    International Nuclear Information System (INIS)

    Rujisamphan, Nopporn; Supasai, Thidarat; Dittrich, Thomas

    2016-01-01

    Results of a temperature dependence study of photoinduced charge separation across P3HT nanocrystals at P3HT/ITO interfaces have been investigated by modulated surface photovoltage (SPV) spectroscopy in a fixed capacitor arrangement. The SPV measurements were correlated with the crystalline sizes of P3HT nanocrystals determined by grazing incidence X-ray diffraction (GIXRD). The crystalline sizes of P3HT nanocrystals were varied systematically by progressive heating/cooling cycles identical for SPV and GIXRD measurements. Photovoltage signals, indication of photoinduced charge dissociation in space, at the P3HT/ITO interface were collected, and electrons were separated across the first monolayer of P3HT nanocrystals at the P3HT/ITO interface due to band bending. The activation energies for quenching of the in-phase and phase-shifted by 90 SPV signals were 0.7 and 0.6 eV, respectively. Thermal activation of the formation of P3HT nanocrystals was of the same order as the enthalpy of fusion of ideal crystals from regioregular P3HT. A schematic drawing of photoinduced charge separation at the P3HT/ITO is proposed. (orig.)

  13. Photoinduced charge dissociation and transport at P3HT/ITO interfaces: studied by modulated surface spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Rujisamphan, Nopporn [King Mongkut' s University of Technology Thonburi, Department of Physics, Faculty of Science, Bangkok (Thailand); Institute of Heterogeneous Materials, Helmholtz Center Berlin for Materials and Energy, Berlin (Germany); Supasai, Thidarat [Kasetsart University, Department of Materials Science, Faculty of Science, Bangkok (Thailand); Dittrich, Thomas [Institute of Heterogeneous Materials, Helmholtz Center Berlin for Materials and Energy, Berlin (Germany)

    2016-02-15

    Results of a temperature dependence study of photoinduced charge separation across P3HT nanocrystals at P3HT/ITO interfaces have been investigated by modulated surface photovoltage (SPV) spectroscopy in a fixed capacitor arrangement. The SPV measurements were correlated with the crystalline sizes of P3HT nanocrystals determined by grazing incidence X-ray diffraction (GIXRD). The crystalline sizes of P3HT nanocrystals were varied systematically by progressive heating/cooling cycles identical for SPV and GIXRD measurements. Photovoltage signals, indication of photoinduced charge dissociation in space, at the P3HT/ITO interface were collected, and electrons were separated across the first monolayer of P3HT nanocrystals at the P3HT/ITO interface due to band bending. The activation energies for quenching of the in-phase and phase-shifted by 90 SPV signals were 0.7 and 0.6 eV, respectively. Thermal activation of the formation of P3HT nanocrystals was of the same order as the enthalpy of fusion of ideal crystals from regioregular P3HT. A schematic drawing of photoinduced charge separation at the P3HT/ITO is proposed. (orig.)

  14. 49 CFR 1018.92 - Administrative charges.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 8 2010-10-01 2010-10-01 false Administrative charges. 1018.92 Section 1018.92 Transportation Other Regulations Relating to Transportation (Continued) SURFACE TRANSPORTATION BOARD, DEPARTMENT... Administrative charges. In accordance with 49 CFR 1018.30, all administrative charges incurred in connection with...

  15. Temperature dependent charge transport studies across thermodynamic glass transition in P3HT:PCBM bulk heterojunction: insight from J-V and impedance spectroscopy

    Science.gov (United States)

    Sarkar, Atri; Rahaman, Abdulla Bin; Banerjee, Debamalya

    2018-03-01

    Temperature dependent charge transport properties of P3HT:PCBM bulk heterojunction are analysed by dc and ac measurements under dark conditions across a wide temperature range of 110-473 K, which includes the thermodynamic glass transition temperature (Tg ˜320 K) of the system. A change from Ohmic conduction to space charge limited current conduction at higher (⩾1.2 V) applied bias voltages above  ⩾200 K is observed from J-V characteristics. From capacitance-voltage (C-V) measurement at room temperature, the occurrence of a peak near the built-in voltage is observed below the dielectric relaxation frequency, originating from the competition between drift and diffusion driven motions of charges. Carrier concentration (N) is calculated from C-V measurements taken at different temperatures. Room temperature mobility values at various applied bias voltages are in accordance with that obtained from transient charge extraction by linearly increasing voltage measurement. Sample impedance is measured over five decades of frequency across temperature range by using lock-in detection. This data is used to extract temperature dependence of carrier mobility (μ), and dc conductivity (σ_dc ) which is low frequency extrapolation of ac conductivity. An activation energy of  ˜126 meV for the carrier hopping process at the metal-semiconductor interface is estimated from temperature dependence of σ_dc . Above T g, μ levels off to a constant value, whereas σ_dc starts to decrease after a transition knee at T g that can be seen as a combined effect of changes in μ and N. All these observed changes across T g can be correlated to enhanced polymer motion above the glass transition.

  16. Charge transport simulations of NaCl in an external magnetic field: the quest for the Hall effect

    Science.gov (United States)

    Mouhat, F.; Bonella, S.; Pierleoni, C.

    2013-12-01

    In this paper, we set the stage for molecular dynamics studies of the transport properties of molten salts in the presence of external electric and magnetic fields by introducing an original propagator to integrate the equations of motion. Using this algorithm, we compute, within linear response theory, transport properties of molten sodium chloride focusing, in particular, on the conductivity tensor at different intensities of the magnetic field. Finally, in view of full non-equilibrium calculations on the system in which an electric field is also applied, an adapted thermalisation mechanism, which extends to these systems Nosé-Hoover thermostatting, is derived.

  17. Transport phenomena in a model cheese: the influence of the charge and shape of solutes on diffusion.

    Science.gov (United States)

    Silva, J V C; Peixoto, P D S; Lortal, S; Floury, J

    2013-10-01

    During cheese ripening, microorganisms grow as immobilized colonies, metabolizing substrates present in the matrix and generating products from enzymatic reactions. Local factors that limit the rates of diffusion, either within the general cheese matrix or near the colonies, may influence the metabolic activity of the bacteria during ripening, affecting the final quality of the cheese. The objective of this study was to determine the diffusion coefficients of solutes as a function of their different physicochemical characteristics (size, charge, and shape) in an ultrafiltrate (UF) model cheese (based on ultrafiltered milk) to enable better understanding of the ripening mechanisms. Diffusion coefficients of fluorescein isothiocyanate (FITC)-dextrans (4 kDa to 2 MDa) and FITC-labeled dairy proteins (α-lactalbumin, β-lactoglobulin, and BSA) were measured using the technique of fluorescence recovery after photobleaching (FRAP). This study showed that macromolecules up to 2 MDa and proteins could diffuse through the UF model cheese. The larger FITC-dextrans were not more hindered by the structure of the UF model cheese compared with the smaller ones. Any decrease in the diffusion coefficients of solutes was related only to their hydrodynamic radii. The FITC-dextran diffusion data were fitted to an obstruction model, resulting in a constant obstruction factor (k ~0.42). Diffusion in the model cheese was sensitive to the physicochemical characteristics of the solute. The FITC-dairy proteins studied (rigid and negatively charged molecules) were hindered to a greater degree than the FITC-dextrans (flexible and charge-neutral molecules) in the UF model cheese. The existence of steric and electrostatic interactions between the protein matrix of the UF model cheese and the FITC-dairy proteins could explain the decrease in diffusion compared with FITC-dextrans. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Superoperator nonequilibrium Green's function theory of many-body systems; applications to charge transfer and transport in open junctions

    International Nuclear Information System (INIS)

    Harbola, U.; Mukamel, S.

    2008-01-01

    Nonequilibrium Green's functions provide a powerful tool for computing the dynamical response and particle exchange statistics of coupled quantum systems. We formulate the theory in terms of the density matrix in Liouville space and introduce superoperator algebra that greatly simplifies the derivation and the physical interpretation of all quantities. Expressions for various observables are derived directly in real time in terms of superoperator nonequilibrium Green's functions (SNGF), rather than the artificial time-loop required in Schwinger's Hilbert-space formulation. Applications for computing interaction energies, charge densities, average currents, current induced fluorescence, electroluminescence and current fluctuation (electron counting) statistics are discussed

  19. Space Charge Effects

    CERN Document Server

    Ferrario, M.; Palumbo, L.

    2014-12-19

    The space charge forces are those generated directly by the charge distribution, with the inclusion of the image charges and currents due to the interaction of the beam with a perfectly conducting smooth pipe. Space charge forces are responsible for several unwanted phenomena related to beam dynamics, such as energy loss, shift of the synchronous phase and frequency , shift of the betatron frequencies, and instabilities. We will discuss in this lecture the main feature of space charge effects in high-energy storage rings as well as in low-energy linacs and transport lines.

  20. Breaking down the barriers to commercialization of fuel cells in transportation through Government - industry R&D programs

    Energy Technology Data Exchange (ETDEWEB)

    Chalk, S.G. [Dept. of Energy, Washington, DC (United States); Venkateswaran, S.R. [Energetics, Inc., Columbia, MD (United States)

    1996-12-31

    PEM fuel cell technology is rapidly emerging as a viable propulsion alternative to the internal combustion engine. Fuel cells offer the advantages of low emissions, high efficiency, fuel flexibility, quiet and continuous operation, and modularity. Over the last decade, dramatic advances have been achieved in the performance and cost of PEM fuel cell technologies for automotive applications. However, significant technical barriers remain to making fuel cell propulsion systems viable alternatives to the internal combustion engine. This paper focuses on the progress achieved and remaining technical barriers while highlighting Government-industry R&D efforts that are accelerating fuel cell technology toward commercialization.