Nuclear shape transition in light gold isotopes
International Nuclear Information System (INIS)
Wallmeroth, K.; Bollen, G.; Dohn, A.; Egelhof, P.; Kroenert, U.; Heyde, K.; Coster, C. de; Wood, J.L.; Kluge, H.J.; European Organization for Nuclear Research, Geneva; European Organization for Nuclear Research, Geneva
1989-01-01
The hyperfine structure and isotope shifts of short-lived gold isotopes with 185≤A≤190 and the 11/2 - isomer of 189 Au have been investigated by application of on-line resonance ionization mass spectroscopy. A detection efficiency of ε=10 -8 for gold atoms was observed at a background of about one event per 1000 laser shots. The deduced charge radii show a drastic change between A=187 and A=186 which is interpreted as an onset of strong deformation (β 2 ≅ 0.25) in 186 Au and 185 Au due to the influence of the π1h 9/2 intruder orbital. (orig.)
Shape coexistence in 186Hg and the decay of 186Tl
International Nuclear Information System (INIS)
Cole, J.D.; Ramayya, A.V.; Hamilton, J.H.; Kawakami, H.; van Nooijen, B.; Nettles, W.G.; Riedinger, L.L.; Turner, F.E.; Bingham, C.R.; Carter, H.K.; Spejewski, E.H.; Mlekodaj, R.L.; Schmidt-Ott, W.D.; Zganjar, E.F.; Sastry, K.S.R.; Avignone, F.T. III; Toth, K.S.; Ijaz, M.A.
1977-01-01
Details of the identification of 186 Tl and its decay to 186 Hg as investigated with an isotope separator are presented. Conversion electrons, γ, γ-γ, and e-γ studies establish two bands in 186 Hg; one built on a near-spherical ground state and one on a more strongly deformed shape with a band head at 522 keV. The levels are discussed in the framework of recent theoretical calculations
Laser spectroscopy of laser-desorbed gold isotopes
International Nuclear Information System (INIS)
Savard, G.; Crawford, J.E.; Lee, J.K.P.; Thekkadath, G.
1990-01-01
Changes in mean-square charge radius δ 2 >, and magnetic dipole moments μ I have been measured for a series of neutron-deficient gold isotopes between A=186 and 196, and for neutron-rich 198,199 Au, using the PILIS system on-line with the ISOCELE mass separator. These measurements confirm the existence of the shape transition between A=186 and 187. The measured μ I values have been compared with calculations using Nilsson, and symmetric-rotor-plus-quasiparticle models. The results are consistent with the interpretation that 186 Au is prolate, and that the heavier isotopes have oblate, or possibly triaxial deformation. (orig.)
International Nuclear Information System (INIS)
Reitz, B.; Heydorn, K.
1993-01-01
A new method is presented for the determination of Au and Pt in biological materials based on neutron activation analysis with radiochemical separation of gold. Separation of gold by electrolytic deposition on a niobium cathode ascertains thee highest radiochemical purity without any interference from calcium or other major elements. With 199 Au as indicator for platinum the gold content of the sample not only strongly affects the limit of detection, but also causes interference by double neutron capture. Replicate analyses of BCR Certified Reference Materials No. 184, 185 and 186 were carried out. (author) 18 refs.; 3 figs.; 2 tabs
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Tall oil. 186.1557 Section 186.1557 Food and Drugs... Substances Affirmed as GRAS § 186.1557 Tall oil. (a) Tall oil (CAS Reg. No. 8002-26-4) is essentially the sap... consists mainly of tall oil resin acids and tall oil fatty acids. (b) In accordance with § 186.1(b)(1), the...
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Japan wax. 186.1555 Section 186.1555 Food and Drugs... Substances Affirmed as GRAS § 186.1555 Japan wax. (a) Japan wax (CAS Reg. No. 8001-39-6), also known as Japan... fruits of the oriental sumac, Rhus succedanea (Japan, Taiwan, and Indo-China), R. vernicifera (Japan...
21 CFR 186.1256 - Clay (kaolin).
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Clay (kaolin). 186.1256 Section 186.1256 Food and... Substances Affirmed as GRAS § 186.1256 Clay (kaolin). (a) Clay (kaolin) Al2O3.2SiO2.nH2O, Cas Reg. No. 1332-58-7) consists of hydrated aluminum silicate. The commercial products of clay (kaolin) contain...
21 CFR 186.1316 - Formic acid.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Formic acid. 186.1316 Section 186.1316 Food and... Substances Affirmed as GRAS § 186.1316 Formic acid. (a) Formic acid (CH2O2, CAS Reg. No. 64-18-6) is also referred to as methanoic acid or hydrogen carboxylic acid. It occurs naturally in some insects and is...
21 CFR 186.1093 - Sulfamic acid.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sulfamic acid. 186.1093 Section 186.1093 Food and... Substances Affirmed as GRAS § 186.1093 Sulfamic acid. (a) Sulfamic acid (H3NO3S, CAS Reg. No. 5329-14-6) is a white crystalline solid manufactured from urea, sulfur trioxide, and sulfuric acid. It is soluble and...
21 CFR 186.1374 - Iron oxides.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Iron oxides. 186.1374 Section 186.1374 Food and... Substances Affirmed as GRAS § 186.1374 Iron oxides. (a) Iron oxides (oxides of iron, CAS Reg. No. 1332-37-2) are undefined mixtures of iron (II) oxide (CAS Reg. No. 1345-25-1, black cubic crystals) and iron (III...
Laser spectroscopy of neutron deficient gold and platinum isotopes
International Nuclear Information System (INIS)
Savard, G.
1988-03-01
A new method for on-line laser spectroscopy of radioactive atoms based on the resonant ionization spectroscopy of laser-desorbed radioactive samples has been devised. An experimental setup has been installed on-line at the ISOCELE mass separator in Orsay (France) and experiments have been performed on the region of transitional nuclei around Z=79. Isotopic shift measurements on four new isotopes 194 Au, 196 Au, 198 Au, 199 Au have been performed on gold and results on the neutron deficient isotopes down to 186 Au have been obtained confirming the nuclear ground-state shape transition from oblate to prolate between 187 Au and 186 Au. The first isotopic shift measurements on radioactive platinum isotopes have been obtained on 186 Pt, 188 Pt, 189 Pt. Indications of a shape transition have been observed between 186 Pt and 188 Pt. The extracted experimental changes in mean square charge radii δ 2 > A,A' along isotopic chains are compared to self-consistent Hartree-Fock plus BCS calculations
L-Reactor 186-basin cleaning alternatives
International Nuclear Information System (INIS)
Turcotte, M.D.S.
1983-01-01
Operation of L Reactor will necessitate annual cleaning of the L Area 186 basins. Alternatives are presented for sediment discharge due to 186-basin cleaning activities as a basis for choosing the optimal cleaning method. Current cleaning activities (i.e. removal of accumulated sediments) for the P, C and K-Area 186 basins result in suspended solids concentrations in the effluent waters above the NPDES limits, requiring an exemption from the NPDES permit for these short-term releases. The objective of mitigating the 186-basin cleaning activities is to decrease the suspended solids concentrations to within permit limits while continuing satisfactory operation of the basins
12 CFR 18.6 - Signature and attestation.
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Signature and attestation. 18.6 Section 18.6 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY DISCLOSURE OF FINANCIAL AND OTHER INFORMATION BY NATIONAL BANKS § 18.6 Signature and attestation. A duly authorized officer of the...
21 CFR 186.1551 - Hydrogenated fish oil.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Hydrogenated fish oil. 186.1551 Section 186.1551... Listing of Specific Substances Affirmed as GRAS § 186.1551 Hydrogenated fish oil. (a) Hydrogenated fish oil (CAS Reg. No. 91078-95-4) is a class of oils produced by partial hydrogenation of oils expressed...
21 CFR 133.186 - Sap sago cheese.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Sap sago cheese. 133.186 Section 133.186 Food and... Products § 133.186 Sap sago cheese. (a) Description. (1) Sap sago cheese is the food prepared by the... method described in § 133.5. Sap sago cheese is not less than 5 months old. (2) One or more of the dairy...
Biomolecule labelling by 186 Re
International Nuclear Information System (INIS)
Lungu, Valeria Viorica; Mihailescu, Gabriela; Dumitrescu, Gabriela
1998-01-01
The aim of this study is to develop and improve the existing radiolabelling techniques of peptides and monoclonal antibodies with 186 Re and 188 Re as potential agents for cancer targeted radiotherapy. We selected the following methods and techniques for direct labelling of peptides and monoclonal antibody: 1. Prereduction of -S-S- bridges of biomolecule to sulfhydryls using reducing agents: ascorbic acid, cysteine, active hydrogen, 2,3 dimercaptopropanol. The prereduction reactions are controlled by massic ratios of reduction agents/biomolecule, pH, temperature and time of incubation; 2. Reduction of 186 Re O 4 - stannous chloride in acid and alkaline pH; 3. Coupling reaction of 186 Re (red) with the biomolecule controlled by the time and temperature of incubation, the influence of pH regarding the binding of 186 Re to the biomolecules. The quality control was effected by chromatography techniques (paper and elution gel chromatography) on labeled biomolecule before and after purification. The elution gel chromatography was spectrophotometricaly monitored at 280 nm. In the same time the radioactivity of samples was measured using a gamma counter. All the results confirm in vitro stability of labeled biomolecule. The biological evaluation studies regarding accumulation and biological affinity will be controlled by scintigraphy method. Biodistribution studies will be effected to Walker tumor bearing animals at 4 and 24 hours after injections. (authors)
Spectroscopy of 186 Pb with mass identification
International Nuclear Information System (INIS)
Baxter, A.M.; Byrne, A.P.; Australian National Univ., Canberra, ACT; Dracoulis, G.D.; Janssens, R.V.F.; Bearden, I.G.; Henry, R.G.
1993-10-01
Transitions in the very neutron-deficient isotope 186 Pb have been identified in mass-gated, recoil-γ and recoil-γ-γ coincidence data obtained with a Fragment Mass Analyser and Compton-suppressed Ge-detector array. The results of the present work confirm and extend a band of levels tentatively proposed in earlier work done elsewhere, and provide a definitive mass assignment of the observed transitions. The band observed in 186 Pb bears a very close resemblance to the yrast band in the isotones 184 Hg, supporting the view that the 186 Pb band is built upon a prolate structure. 11 refs., 4 figs., 1 tab
Accelerator Production and Separations for High Specific Activity Rhenium-186
Energy Technology Data Exchange (ETDEWEB)
Jurisson, Silvia S. [Univ. of Missouri, Columbia, MO (United States); Wilbur, D. Scott [Univ. of Washington, Seattle, WA (United States)
2016-04-01
Tungsten and osmium targets were evaluated for the production of high specific activity rhenium-186. Rhenium-186 has potential applications in radiotherapy for the treatment of a variety of diseases, including targeting with monoclonal antibodies and peptides. Methods were evaluated using tungsten metal, tungsten dioxide, tungsten disulfide and osmium disulfide. Separation of the rhenium-186 produced and recycling of the enriched tungsten-186 and osmium-189 enriched targets were developed.
Rhenium-186 direct labelling HIgG
International Nuclear Information System (INIS)
Lungu, V.; Mihailescu, G.; Dumitrescu, G.
2001-01-01
The aim of this study is to develop and improve existing radiolabelling techniques of peptides and monoclonal antibodies with 186 Re for achievement of potential agents for cancer targeted radiotherapy. There were selected methods and techniques for the direct labelling of intact HIgG by studding chemical and radiochemical processes of -S-S- bridges prereduction, reduction of 186 ReO 4 - and coupling reaction of rhenium with HIgG. The -S-S- bridges prereduction of HIgG to sulfhydryls was effected using different reducing agents: ascorbic acid, 2,3 dimercaptopropanol, cysteine, active hydrogen. The prereduction reactions are controlled by masic ratios of HIgG/reduction agent, pH, temperature and time of incubation. A pH=4.5 and a 24 hours incubation time are in the advantage of the prereduction yield. The labelling with 186 Re of prereduced HIgG with ascorbic acid or active hydrogen and 37 deg. C incubation in 22 hours releases 92% radiochemical purity. (author)
Energy Technology Data Exchange (ETDEWEB)
Moustapha, Moustapha E. [Department of Chemistry, University of Missouri-Columbia, Columbia, MO 65211 (United States); University of Missouri Research Reactor (MURR), University of Missouri-Columbia, Columbia, MO 65211 (United States); Ehrhardt, Gary J. [Department of Chemistry, University of Missouri-Columbia, Columbia, MO 65211 (United States); University of Missouri Research Reactor (MURR), University of Missouri-Columbia, Columbia, MO 65211 (United States); Smith, Charles J. [Department of Radiology, University of Missouri-Columbia, Columbia, MO 65211 (United States); University of Missouri Research Reactor (MURR), University of Missouri-Columbia, Columbia, MO 65211 (United States); Research Services, Harry S. Truman Memorial Veterans' Hospital, Columbia, MO 65201 (United States); Szajek, Lawrence P. [Positron Emission Tomography Department, National Institutes of Health, Bethesda, MD 20892-1180 (United States); Eckelman, William C. [Positron Emission Tomography Department, National Institutes of Health, Bethesda, MD 20892-1180 (United States); Jurisson, Silvia S. [Department of Chemistry, University of Missouri-Columbia, Columbia, MO 65211 (United States)]. E-mail: jurissons@missouri.edu
2006-01-15
The radioisotopes {sup 186}Re and {sup 188}Re have been extensively investigated for various forms of radiotherapy due to their useful and high-abundance {beta} particle emissions, low-abundance and imageable {gamma}-rays, and chemical resemblance to technetium. In addition, {sup 188}Re is available in no-carrier-added (NCA) form from long lived W-188 generators, whereas {sup 186}Re can be produced in large quantities from reactors, although not in NCA form. However, NCA {sup 186}Re can be produced on a cyclotron by a (p,n) reaction on {sup 186}W. The purpose of this study was to compare labeling of the peptide bombesin with these three forms of rhenium radioisotopes. Cyclotron-produced NCA {sup 186}Re was separated radiochemically from enriched {sup 186}W (96.9%) targets using high-purity methyl ethyl ketone (MEK). The resulting {sup 186}Re-MEK was then loaded onto a small alumina column to separate the resulting NCA {sup 186}Re from any remaining {sup 186}W. The experimental levels of impurities associated with {sup 186}Re at the end of the separation process were found to be 5.7x10{sup -6} Ci of {sup 182}Re (0.57%, t {sub 1/2}=12.7 h) and 1.283x10{sup -5} Ci of {sup 182m}Re (1.28%, t {sub 1/2}=2.67 days). The radionuclidic purity of the separated {sup 186}Re was found to be 99.6%, whereas the chemical identity was determined by reversed phase high-performance liquid chromatography (RP-HPLC) to be perrhenate ({sup 186}ReO{sub 4} {sup -}). Generator-produced {sup 188}ReO{sub 4} {sup -} from a {sup 188}W/{sup 188}Re generator (Oak Ridge National Laboratory) and CA {sup 186}ReO{sub 4} {sup -} produced from a {sup 185}Re(n,{gamma}){sup 186}Re reaction at the University of Missouri Research Reactor (MURR) were used for comparison with the NCA {sup 186}Re in subsequent studies. N{sub 3}S-5-Ava-BBN(7-14)NH{sub 2} conjugates provide flexibility for designing {sup 186,188}Re-labeled conjugates that retain high in vitro and in vivo specificity targeting of GRP receptor
Energy Technology Data Exchange (ETDEWEB)
Balkin, Ethan R.; Gagnon, Katherine; Dorman, Eric [Washington Univ., Seattle, WA (United States). Dept. of Radiation Oncology; and others
2017-07-01
Production of high specific activity {sup 186g}Re is of interest for development of theranostic radiopharmaceuticals. Previous studies have shown that high specific activity {sup 186g}Re can be obtained by cyclotron irradiation of enriched {sup 186}W via the {sup 186}W(d,2n){sup 186g}Re reaction, but most irradiations were conducted at low beam currents and for short durations. In this investigation, enriched {sup 186}W metal targets were irradiated at high incident deuteron beam currents to demonstrate production rates and contaminants produced when using thick targets. Full-stopping thick targets, as determined using SRIM, were prepared by uniaxial pressing of powdered natural abundance W metal or 96.86% enriched {sup 186}W metal encased between two layers of graphite flakes for target material stabilization. An assessment of structural integrity was made on each target preparation. To assess the performance of graphite-encased thick {sup 186}W metal targets, along with the impact of encasing on the separation chemistry, targets were first irradiated using a 22 MeV deuteron beam for 10 min at 10, 20, and 27 μA, with an estimated nominal deuteron energy of 18.7 MeV on the {sup 186}W target material (after energy degradation correction from top graphite layer). Gamma-ray spectrometry was performed post EOB on all targets to assess production yields and radionuclidic byproducts. The investigation also evaluated a method to recover and recycle enriched target material from a column isolation procedure. Material composition analyses of target materials, pass-through/wash solutions and recycling process isolates were conducted with SEM, FTIR, XRD, EDS and ICP-MS spectrometry. To demonstrate scaled-up production, a graphite-encased {sup 186}W target made from recycled {sup 186}W was irradiated for ∝2 h with 18.7 MeV deuterons at a beam current of 27 μA to provide 0.90 GBq (24.3 mCi) of {sup 186g}Re, decay-corrected to the end of bombardment. ICP-MS analysis of the
31 CFR 103.186 - Special measures against Burma.
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Special measures against Burma. 103.186 Section 103.186 Money and Finance: Treasury Regulations Relating to Money and Finance FINANCIAL RECORDKEEPING AND REPORTING OF CURRENCY AND FOREIGN TRANSACTIONS Anti-Money Laundering Programs Law Enforcement...
Energy Technology Data Exchange (ETDEWEB)
Bucerius, J.; Biersack, H.J.; Palmedo, H. [Klinik und Poliklinik fuer Nuklearmedizin, Universitaetsklinikum Bonn (Germany); Wallny, T. [Orthopaedische Klinik l, Klinik fuer Orthopaedische Chirurgie, St. Bernhard-Hospital Kamp-Lintfort (Germany); Klinik und Poliklinik fuer Orthopaedie, Universitaetsklinikum Bonn (Germany); Brackmann, H.H. [Inst. fuer experimentelle Haematologie und Transfusionsmedizin, Universitaetsklinikum Bonn (Germany)
2006-03-15
Chronic arthritis is very common and is associated with a variety of systemic diseases whereas hemophilic arthropathy is one of the most common clinical manifestations of hemophilia, mainly of hemophilia type A. All of these polyarticular diseases are associated with progressive pain and increasing lack of mobility. Therapy is based on conservative treatment such as medication with non-steroidal anti-inflammatory drugs, selective therapy strategies such as intraarticular injections of e.g. radioactive substances (radiosynoviorthesis) or surgical interventions. However, in some cases, the disease does not respond to one of these treatment options or cannot be continued due to important side-effects. Systemic application of radioisotopes like {sup 186}Re HEDP has been successfully administered for pain palliation of osseous metastases. Today, only few data exist for systemic therapy with {sup 186}Re HEDP in patients suffering from benign polyarticular disease. In a prospective study with patients suffering from chronic arthritis a single systemic application of {sup 186}Re HEDP led to a reduction of disease activity in six of eight and to a reduction of the number of painful or swollen joints in five of eight included patients. In a further prospective study with 12 patients with hemophilic arthropathy, 19 of 36 (52.7%) most painful joints could be successfully treated with one systemic {sup 186}Re HEDP therapy. Furthermore, a reduction of global pain could be observed in those patients. However, further randomized studies with larger study populations are necessary in order to confirm this promising results. (orig.)
International Nuclear Information System (INIS)
Nyarku, M.
2009-02-01
Instrumental Neutron Activation Analysis (INAA) has been used to quantify the concentrations of arsenic, gold and antimony in particle-size fractions of a gold ore. The ore, which was taken from the Ahafo project site of Newmont Ghana Gold Ltd, was first fractionated into fourteen (14) particle-size fractions using state-of-the-art analytical sieve machine. The minimum sieve mesh size used was 36 microns and grains >2000 microns were not considered for analysis. Results of the sieving were analysed with easysieve software. The < 36 microns sub fraction was found to be the optimum, hosting bulk of all three elements. For arsenic, the element was found to be highly concentrated in < 36 to +100 microns size fractions and erratically distributed from +150 microns fraction and above. For gold, in exception of the sub fraction <36 which had exceptionally high concentration, the element is distributed in all the size fractions but slightly 'plays out' in the +150 to +400 microns fractions. Antimony occurrence in the sample was relatively high in <36 microns size fraction followed by 600 - 800, 800 - 1000, 400 - 600 and 36 - 40 microns size fractions in that order. Gold content in the sample was far higher than that of arsenic and antimony. Gold concentration in the composite sample was in the range 564 - 8420 ppm. Arsenic levels were higher as compared to antimony. The range of arsenic concentration in the composite sample was 14.33 - 186.92 ppm. Antimony concentration was in the range 1.09 - 9.48 ppm. (au)
Preparation of 186Re complexes of dimercaptosuccinic acid hydroxy ethylidine diphosphonate
International Nuclear Information System (INIS)
Kothari, K.; Pillai, M.R.A.; Unni, P.R.; Mathakar, A.R.; Shimpi, H.H.; Noronha, O.P.D.; Samuel, A.M.
1998-01-01
99m Tc(V)-DMSA and 99m Tc-HEDP are widely used for imaging medullary carcinoma and bone, respectively. 186 Re-HEDP is now well established as a therapeutic radiopharmaceutical for palliation of pain due to bone metastases. It is expected that 186/188 Re(V)-DMSA could find application for treating medullary carcinoma. In the present paper we report the work carried out for the preparation of 186 Re complexes of DMSA and HEDP and their bio-distribution studies in Wistar rats. 186 Re was prepared by irradiation of natural Re metal at a flux of 3x10 13 neutrons/cm 2 /s for seven days and processed after a cooling period of four days. The specific activity of 186 Re formed was ∼35 mCi/mg. Complexes with RC purity >98% could be prepared in both the cases by carefully optimizing the reaction conditions. Bio-distribution studies carried out in rats revealed that pharmacological behaviour of 186 Re(V)-DMSA was similar to that of 99m Tc(V)-DMSA. 186 Re-HEDP showed a bone uptake of ∼ 30% at 3 h post injection which remained almost constant for 48 h. (author)
40 CFR 96.186 - Withdrawal from CAIR NOX Annual Trading Program.
2010-07-01
... Trading Program. 96.186 Section 96.186 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) NOX BUDGET TRADING PROGRAM AND CAIR NOX AND SO2 TRADING PROGRAMS FOR STATE IMPLEMENTATION PLANS CAIR NOX Opt-in Units § 96.186 Withdrawal from CAIR NOX Annual Trading...
Preparation of rhenium-186 tin colloid as radio synovectomy agent
International Nuclear Information System (INIS)
Cecep T Rustendi; Martalena Ramli; M Subur
2010-01-01
Radio synovectomy is an alternative therapy besides surgery whereby a beta-emitting radiopharmaceutical is delivered into the affected synovial compartment in order to threat rheumatoid arthritis. One of radiopharmaceuticals that could be applied as radio synovectomy agent is 186 Re-Sn colloid. Preparation of 186 Re-Sn colloid has been carried out by searching the best condition of the reaction to obtain a high labeling efficiency (>95%), appropriate particle size and stable at room temperature. Preparation of 186 Re-Sn colloid has been done successfully using a mol ratio of Sn to Re with value 1000:1 (~50 mg SnCl 2 .2H 2 O) by heating for 90 minutes and resulting >95% labeling efficiency. Stability of 186 Re-Sn colloid was found to be good enough when it was stored at room temperature for 24 hours. The 186 Re-Sn colloid was also found to have an appropriate particle size for radiopharmaceutical agent for radio synovectomy. (author)
Study on the pharmacal of 186,188Re-SZ39
International Nuclear Information System (INIS)
Zu Jianhua; Wu Yuanfang; Dong Mo; Li Huiyuan; ZhangYulong
2000-01-01
The stability, immunocompetence and cytotoxicity in tumor as well as tumor inhibiting rate of 186,188 Re-SZ39 are investigated. The results indicate that 186,188 Re-SZ39 is stable in vivo by imaging and the volume of tumor of nude mice reduced obviously. So 186,188 Re-SZ39 has a strong cytotoxicity effect against glioma cells and is of good prospect as immuno-radiotherapeutic agent
40 CFR 97.186 - Withdrawal from CAIR NOX Annual Trading Program.
2010-07-01
... Trading Program. 97.186 Section 97.186 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) FEDERAL NOX BUDGET TRADING PROGRAM AND CAIR NOX AND SO2 TRADING PROGRAMS CAIR NOX Opt-In Units § 97.186 Withdrawal from CAIR NOX Annual Trading Program. Except as provided...
27 CFR 53.186 - Accounting procedures for like articles.
2010-04-01
... like articles. 53.186 Section 53.186 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... Accounting procedures for like articles. (a) Identification of manufacturer. In applying section 6416 of the Code and the regulations thereunder, a person who has purchased like articles from various...
International Nuclear Information System (INIS)
Nyarku, M.; Nyarko, B.J.B.; Serfor-Armah, Y.; Osae, S.
2010-01-01
Instrumental neutron activation analysis (INAA) has been used to quantify concentrations of arsenic (As), gold (Au) and antimony (Sb) in grain-size fractions of a gold ore. The ore, which was taken from the Ahafo project site of Newmont Ghana Gold Ltd., was fractionated into 14 grain-size fractions using state-of-the-art analytical sieve machine. The minimum sieve mesh size used was 36 μm and grains >2000 μm were not considered for analysis. Result of the sieving was analysed with easysieve (registered) software. The<36 μm subfraction was found to be the optimum, hosting bulk of all three elements. Arsenic was found to be highly concentrated in<36-100 μm size fractions and erratically distributed in from 150 μm fraction and above. For gold, with the exception of the subfraction <36 μm which had exceptionally high concentration, the element was found to be approximately equally distributed in all the size fractions but slightly 'played out' in 150-400 μm size fractions. Antimony occurrence in the sample was relatively high in <36 μm size fraction followed by 600, 800, 400 and 36 μm size fractions in that order. Gold content in the sample was comparatively far greater than arsenic and antimony; this is indicative of level of gold mineralization in the concession where the sample ore was taken. The concentration of gold in the composite sample was in the range 564-8420 ppm as compared to 14.33-186.92 ppm for arsenic and 1.09-9.48 ppm for antimony. Elemental concentrations were correlated with each other and with grain-size fractions and the relationships between these descriptive parameters were established.
Preparation and quality control of 186Re compounds
International Nuclear Information System (INIS)
Noto, M.G.; Amor, R.A.; Caviglia, D.A.; Ratner, M.T.; Schroder, A.M.; Rocco, J.C.; Mancini, A.C.
1987-01-01
The optimal conditions were investigated in order to label the methylendiphosphonate (MDP), hydroxyethylendiphosphonate (HEDP), pyrophosphonate (PYP) and ethylendiaminotetramethylenphosphoric (EDTMP) with 186 Re. The biodistribution of these compounds in experimental animals were studied to determine the most suitable therapeutic agent for its eventual use as pain palliative in patients with bone metastases. The biodistribution assays were performed in Wistar rats, and the 186 Re HEDP was finally chosen. (M.E.L.) [es
Developing the 186 Re radiolabelling procedures of peptides and monoclonal antibodies
International Nuclear Information System (INIS)
Lungu, V.; Mihailescu, G.
1999-01-01
Mono and poli-clonal antibodies are the most recent candidate molecules for the radiopharmaceutical preparation used in radioimmunotherapy and radiodiagnostic. Our study presents results in 186 Re direct labelling of HIgG (Human Immunoglobulin G) poli-clonal antibody. The steps in labelling process are: 1. pre-reduction -S-S- bridges of HIgG molecule with ascorbic acid in pH = 3.5 - 4.5; 2. preparation of the reducing system for 186 ReO 4 - in presence of Sn 2+ ions excess and 3. coupling 186 Re (red) to -SH groups of biomolecules. The specific reactions of each step above are controlled by: incubation time and temperature, pH, molar ratio 186 Re: HIgG. 186 Re-HIgG samples were purified by gel elution chromatography method and the quality control was performed by chromatography techniques. To labelled of HIgG we effected the pre-reduction of -S-S- bridges of biomolecules to sulfhydryls using the following reducing agents: ascorbic acid, cysteine, active hydrogen, 2,3 dimercaptopropanol. The pre-reduction reactions are controlled by mass ratios of reduction agent/biomolecule, pH, temperature and time of incubation. HIgG was the biomolecule used in the pre-reduction reactions. The specific parameters for each systems are presented. The stannous chloride was used as reducing agent in two systems, SnCl 2 : 0.05 N HCl and SnCl 2 : 20 mg/ml citric acid. The coupling reaction of 186 Re (red) with the biomolecule has been controlled by time and incubation temperature and the influence of pH regarding the binding of 186 Re to the biomolecule. 186 Re-HIgG was obtained by: i) incubation at the room temperature, 1 hour time of HIgG in thiol form and 186 Re in reducing form and ii) incubation of HIgG in thiol form, at 37 deg C and 22 hours time, with adding after pre-reduction of SnCl 2 and Na 186 ReO 4 . Quality control was effected by chromatography techniques (paper and gel chromatography) on labelled biomolecule before and after purification. The elution gel chromatography
miR-186 inhibits cell proliferation in multiple myeloma by repressing Jagged1
International Nuclear Information System (INIS)
Liu, Zengyan; Zhang, Guoqiang; Yu, Wenzheng; Gao, Na; Peng, Jun
2016-01-01
MicroRNAs (miRNAs) are small, noncoding ribonucleic acids that regulate gene expression by targeting mRNAs for translational repression and degradation. Accumulating experimental evidence supports a causal role of miRNAs in hematology tumorigenesis. However, the specific functions of miRNAs in the pathogenesis of multiple myeloma (MM) remain to be established. In this study, we demonstrated that miR-186 is commonly downregulated in MM cell lines and patient MM cells. Ectopic expression of miR-186 significantly inhibited cell growth, both in vitro and in vivo, and induced cell cycle G_0/G_1 arrest. Furthermore, miR-186 induced downregulation of Jagged1 protein expression by directly targeting its 3′-untranslated region (3′-UTR). Conversely, overexpression of Jagged1 rescued cells from miR-186-induced growth inhibition. Our collective results clearly indicate that miR-186 functions as a tumor suppressor in MM, supporting its potential as a therapeutic target for the disease. - Highlights: • miR-186 expression is decreased in MM. • miR-186 inhibits MM cell proliferation in vitro and in vivo. • Jagged1 is regulated by miR-186. • Overexpression of Jagged1 reverses the effects of miR-186.
miR-186 inhibits cell proliferation in multiple myeloma by repressing Jagged1
Energy Technology Data Exchange (ETDEWEB)
Liu, Zengyan [Department of Hematology, Qilu Hospital, Shandong University, 107 Wenhuaxi Road, Jinan, Shandong 250012 (China); Department of Hematology, Hospital Affiliated to Binzhou Medical University, 661 Second Huanghe Street, Binzhou 256603 (China); Zhang, Guoqiang [Department of Thyroid and Breast Surgery, Hospital Affiliated to Binzhou Medical University, 661 Second Huanghe Street, Binzhou 256603 (China); Yu, Wenzheng; Gao, Na [Department of Hematology, Hospital Affiliated to Binzhou Medical University, 661 Second Huanghe Street, Binzhou 256603 (China); Peng, Jun, E-mail: junpeng885@sina.com [Department of Hematology, Qilu Hospital, Shandong University, 107 Wenhuaxi Road, Jinan, Shandong 250012 (China)
2016-01-15
MicroRNAs (miRNAs) are small, noncoding ribonucleic acids that regulate gene expression by targeting mRNAs for translational repression and degradation. Accumulating experimental evidence supports a causal role of miRNAs in hematology tumorigenesis. However, the specific functions of miRNAs in the pathogenesis of multiple myeloma (MM) remain to be established. In this study, we demonstrated that miR-186 is commonly downregulated in MM cell lines and patient MM cells. Ectopic expression of miR-186 significantly inhibited cell growth, both in vitro and in vivo, and induced cell cycle G{sub 0}/G{sub 1} arrest. Furthermore, miR-186 induced downregulation of Jagged1 protein expression by directly targeting its 3′-untranslated region (3′-UTR). Conversely, overexpression of Jagged1 rescued cells from miR-186-induced growth inhibition. Our collective results clearly indicate that miR-186 functions as a tumor suppressor in MM, supporting its potential as a therapeutic target for the disease. - Highlights: • miR-186 expression is decreased in MM. • miR-186 inhibits MM cell proliferation in vitro and in vivo. • Jagged1 is regulated by miR-186. • Overexpression of Jagged1 reverses the effects of miR-186.
Determination of radiochemical yields of 186Re-labelled complexes using thin layer chromatography
International Nuclear Information System (INIS)
Konirova, R.; Kohlickova, M.; Jedinakova-Krizova, V.
1999-01-01
The reaction conditions for synthesis of three rhenium complexes 186 Re-methylendiphosphonate (MDP), 186 Re-hydroxyethylidendiphosphonate (HEDP) and 186 Re-citrate have been investigated. Radiochemical yield of complexation has been determined by thin layer chromatography and paper chromatography. The rhenium complexation with corresponding ligand is dependent on pH values of reaction mixture, concentration of studied ligand (MDP, HEDP and sodium citrate) and concentration of reducing agent. Stannous chloride with ascorbic acid (as antioxidant) was used for reduction of perrhenate. The labeling yield of 186 Re-MDP was about 90 %, of 186 Re-HEDP more than 80 % and more than 75 % for 186 Re-citrate under optimum conditions. Besides, the possibility of application of porphyrins as organic ligands for complexation with rhenium isotopes is examined. (authors)
International Nuclear Information System (INIS)
Bucerius, J.; Biersack, H.J.; Palmedo, H.; Wallny, T.; Brackmann, H.H.
2006-01-01
Chronic arthritis is very common and is associated with a variety of systemic diseases whereas hemophilic arthropathy is one of the most common clinical manifestations of hemophilia, mainly of hemophilia type A. All of these polyarticular diseases are associated with progressive pain and increasing lack of mobility. Therapy is based on conservative treatment such as medication with non-steroidal anti-inflammatory drugs, selective therapy strategies such as intraarticular injections of e.g. radioactive substances (radiosynoviorthesis) or surgical interventions. However, in some cases, the disease does not respond to one of these treatment options or cannot be continued due to important side-effects. Systemic application of radioisotopes like 186 Re HEDP has been successfully administered for pain palliation of osseous metastases. Today, only few data exist for systemic therapy with 186 Re HEDP in patients suffering from benign polyarticular disease. In a prospective study with patients suffering from chronic arthritis a single systemic application of 186 Re HEDP led to a reduction of disease activity in six of eight and to a reduction of the number of painful or swollen joints in five of eight included patients. In a further prospective study with 12 patients with hemophilic arthropathy, 19 of 36 (52.7%) most painful joints could be successfully treated with one systemic 186 Re HEDP therapy. Furthermore, a reduction of global pain could be observed in those patients. However, further randomized studies with larger study populations are necessary in order to confirm this promising results. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Manenti, Simone; Persico, Elisa; Bonardi, Mauro L.; Gini, Luigi; Groppi, Flavia [LASA, Univ. degli Studi di Milano, Segrate (Italy); INFN Milano (Italy); Abbas, Kamel; Holzwarth, Uwe; Simonelli, Federica [Institute for Health and Consumer Protection, IHCP, JRC-Ispra, Ispra (Italy)
2014-10-01
Excitation functions, thin- and thick-target yields for the {sup 181-186g}Re and {sup 187}W radionuclides were measured by the activation stacked-foil technique on natural tungsten foils for deuteron energies up to 18.0 MeV. These cross sections were validated by comparing the experimental results for thick-target yields with those calculated by integration of the thin-target yields. It was found that the maximum {sup 186g}Re content by irradiation of natural tungsten is about 55%, a higher value compared with the one found for proton beam, but not sufficient to use natural tungsten for medical purposes yet. Thus, in order to have a higher specific activity A{sub S} of {sup 186g}Re, the use of enriched {sup 186}W target is necessary. Therefore the irradiation of a thick target of enriched {sup 186}W by accelerated deuterons was studied and the results for the production of {sup 186g}Re were compared with those obtained from the irradiation of the same target by accelerated protons. It was found that the deuteron irradiation is preferable for three reasons: larger yield, less contamination by tantalum radioisotopes and smaller required amount of the target, which simplify the separation of the {sup 186g}Re from the target itself.
Formation, tidal evolution, and habitability of the Kepler-186 system
International Nuclear Information System (INIS)
Bolmont, Emeline; Raymond, Sean N.; Selsis, Franck; Hersant, Franck; Von Paris, Philip; Quintana, Elisa V.; Barclay, Thomas
2014-01-01
The Kepler-186 system consists of five planets orbiting an early M dwarf. The planets have physical radii of 1.0-1.50 R ⊕ and orbital periods of 4-130 days. The 1.1 R ⊕ Kepler-186f with a period of 130 days is of particular interest. Its insolation of roughly 0.32 S ⊕ places it within the surface liquid water habitable zone (HZ). We present a multifaceted study of the Kepler-186 system, using two sets of parameters which are consistent with the data and also self-consistent. First, we show that the distribution of planet masses can be roughly reproduced if the planets were accreted from a high surface density disk presumably sculpted by an earlier phase of migration. However, our simulations predict the existence of one to two undetected planets between planets e and f. Next, we present a dynamical analysis of the system including the effect of tides. The timescale for tidal evolution is short enough that the four inner planets must have small obliquities and near-synchronous rotation rates. The tidal evolution of Kepler-186f is slow enough that its current spin state depends on a combination of its initial spin state, its dissipation rate, and the stellar age. Finally, we study the habitability of Kepler-186f with a one-dimensional climate model. The planet's surface temperature can be raised above 273 K with 0.5-5 bars of CO 2 , depending on the amount of N 2 present. Kepler-186f represents a case study of an Earth-sized planet in the cooler regions of the HZ of a cool star.
Energy Technology Data Exchange (ETDEWEB)
Berenger, N.; Lebtahi, R.; Piketty, M.L.; Merienne, L.; Turak, B.; Bok, R.; Askienazy, S. (Hopital Sainte-Anne, 75 - Paris (France)); Munari, C. (Centre Hospitalier Universitaire, 38 - Grenoble (France))
1993-01-01
Forty-three patients with craniopharyngioma cysts were treated by intracystic injection of 186-rhenium. Leakage of colloid isotope into the CSF spaces during the ''test'' or ''therapeutic'' injection was detected by scintigraphic follow-up (15 cases/58 intracystic injections). In fact the physical characteristics of [sup 186]Re are well adapted to the requirements of treatment and, with the gamma emission, also allows early detection of leakage, avoiding irradiation of neighbouring structures. Follow-up studies revealed that craniopharyngioma cysts were effectively treated, with cessation of fluid formation, progressive shrinkage of the cysts leading to total disappearance in 14 cases (10-156 months, mean 52.5) and a considerable decrease in 13 cases (5-53 months, mean 23).
Plasmonic Optical Fiber Sensor Based on Double Step Growth of Gold Nano-Islands.
de Almeida, José M M M; Vasconcelos, Helena; Jorge, Pedro A S; Coelho, Luis
2018-04-20
It is presented the fabrication and characterization of optical fiber sensors for refractive index measurement based on localized surface plasmon resonance (LSPR) with gold nano-islands obtained by single and by repeated thermal dewetting of gold thin films. Thin films of gold deposited on silica (SiO₂) substrates and produced by different experimental conditions were analyzed by Scanning Electron Microscope/Dispersive X-ray Spectroscopy (SEM/EDS) and optical means, allowing identifying and characterizing the formation of nano-islands. The wavelength shift sensitivity to the surrounding refractive index of sensors produced by single and by repeated dewetting is compared. While for the single step dewetting, a wavelength shift sensitivity of ~60 nm/RIU was calculated, for the repeated dewetting, a value of ~186 nm/RIU was obtained, an increase of more than three times. It is expected that through changing the fabrication parameters and using other fiber sensor geometries, higher sensitivities may be achieved, allowing, in addition, for the possibility of tuning the plasmonic frequency.
Plasmonic Optical Fiber Sensor Based on Double Step Growth of Gold Nano-Islands
Vasconcelos, Helena
2018-01-01
It is presented the fabrication and characterization of optical fiber sensors for refractive index measurement based on localized surface plasmon resonance (LSPR) with gold nano-islands obtained by single and by repeated thermal dewetting of gold thin films. Thin films of gold deposited on silica (SiO2) substrates and produced by different experimental conditions were analyzed by Scanning Electron Microscope/Dispersive X-ray Spectroscopy (SEM/EDS) and optical means, allowing identifying and characterizing the formation of nano-islands. The wavelength shift sensitivity to the surrounding refractive index of sensors produced by single and by repeated dewetting is compared. While for the single step dewetting, a wavelength shift sensitivity of ~60 nm/RIU was calculated, for the repeated dewetting, a value of ~186 nm/RIU was obtained, an increase of more than three times. It is expected that through changing the fabrication parameters and using other fiber sensor geometries, higher sensitivities may be achieved, allowing, in addition, for the possibility of tuning the plasmonic frequency. PMID:29677108
Formation, tidal evolution, and habitability of the Kepler-186 system
Energy Technology Data Exchange (ETDEWEB)
Bolmont, Emeline; Raymond, Sean N.; Selsis, Franck; Hersant, Franck [Univ. Bordeaux, Laboratoire d' Astrophysique de Bordeaux, UMR 5804, F-33270 Floirac (France); Von Paris, Philip [Institut für Planetenforschung, Deutsches Zentrum für Luft- und Raumfahrt (DLR), Rutherfordstrasse 2, D-12489 Berlin (Germany); Quintana, Elisa V. [SETI Institute, 189 Bernardo Avenue, Suite 100, Mountain View, CA 94043 (United States); Barclay, Thomas, E-mail: bolmont@obs.u-bordeaux1.fr [NASA Ames Research Center, Moffett Field, CA 94035 (United States)
2014-09-20
The Kepler-186 system consists of five planets orbiting an early M dwarf. The planets have physical radii of 1.0-1.50 R {sub ⊕} and orbital periods of 4-130 days. The 1.1 R {sub ⊕} Kepler-186f with a period of 130 days is of particular interest. Its insolation of roughly 0.32 S {sub ⊕} places it within the surface liquid water habitable zone (HZ). We present a multifaceted study of the Kepler-186 system, using two sets of parameters which are consistent with the data and also self-consistent. First, we show that the distribution of planet masses can be roughly reproduced if the planets were accreted from a high surface density disk presumably sculpted by an earlier phase of migration. However, our simulations predict the existence of one to two undetected planets between planets e and f. Next, we present a dynamical analysis of the system including the effect of tides. The timescale for tidal evolution is short enough that the four inner planets must have small obliquities and near-synchronous rotation rates. The tidal evolution of Kepler-186f is slow enough that its current spin state depends on a combination of its initial spin state, its dissipation rate, and the stellar age. Finally, we study the habitability of Kepler-186f with a one-dimensional climate model. The planet's surface temperature can be raised above 273 K with 0.5-5 bars of CO{sub 2}, depending on the amount of N{sub 2} present. Kepler-186f represents a case study of an Earth-sized planet in the cooler regions of the HZ of a cool star.
Present status of research on Re-186 radiopharmaceuticals at Radioisotope Production Center
Energy Technology Data Exchange (ETDEWEB)
Mutalib, A [Radioisotope Production Center, National Atomic Energy Agency Kawasan PUSPIPTEK, Serpong (Indonesia)
1998-10-01
Rhenium shows a close chemical similarity to technetium and is suitable for radiotherapy because the {beta}-emitting radionuclides {sup 186}Re (t{sub 1/2} 90 h, E{sub {beta}} = 1.1 MeV, E{sub {gamma}} = 137 keV) and {sup 188}Re (t{sub 1/2} = 17 h, E{sub {beta}} = 2.1 MeV). The {gamma}-emission associated with decay of {sup 186}Re is also useful in scintigraphy. The research on {sup 186}Re radiopharmaceuticals at Radioisotope Production Center has been carried out since April 1997. Interest in radioimmunotherapy (RIT) led us to the development of labeling antibodies with rhenium isotopes. Although there are several methods for coupling radiometal to antibody, we prefer an indirect labeling method in which a bifunctional chelating agent is used for coupling of {sup 186}Re to monoclonal antibodies. In this report we outline the study on the preparation of {sup 186}Re DMSA-TFP as precursor for labeling with monoclonal antibody. (author)
40 CFR 61.186 - Reporting requirements.
2010-07-01
...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS National Emission Standard for Inorganic Arsenic Emissions From Arsenic Trioxide and Metallic Arsenic Production Facilities § 61.186 Reporting requirements... at least 30 days prior notice of each reference opacity level determination required in § 61.183(a...
Fisiognomica a Qumran: a proposito di 4Q186
Directory of Open Access Journals (Sweden)
Catastini, Alessandro
2010-06-01
Full Text Available In a previous study, the Author singled out physiognomonic practice by Essenes according to Flavius Josephus’ source in Ant II, 119-161. In this article, the research is extended to the Qumranic manuscript 4Q186, a parchment carrying a text whose content is manifestly physiognomonic. In consequence of a comparison between this text and the so-called Two Spirits Treatise of 1QS, the Author argues that the expression רוח לו, utilised in 4Q186, points out the “typology” of the spirit of the individuals that are considered in this text.
En un estudio previo, el autor había estudiado la práctica fisiognómica de los esenios a partir de la evidencia recogida por Flavio Josefo (Ant II, 119-161. En esta ocasión, la investigación se extiende al manuscrito 4Q186, cuyo texto tiene un contenido claramente fisiognómico. La comparación entre este texto y el denominado Tratado de los Dos Espíritus (1QS, lleva al autor a señalar que la expresión רוח לו utilizada en 4Q186 muestra la «tipología» del espíritu de los individuos de los que trata este texto.
Probing intruder configurations in $^{186, 188}$Pb using Coulomb excitation
Columb excitation measurements to study the shape coexistence, mixing and quadrupole collectivity of the low-lying levels in neutron-deficient $^{188}$Pb nuclei are proposed with a view to extending similar studies to the $^{186}$Pb midshell nucleus. The HIE-ISOLDE beam of $^{186,188}$Pb nuclei will be delivered to MINIBALL+SPEDE set-up for simultaneous in-beam $\\gamma$-ray and conversion electron spectroscopy. The proposed experiment will allow the sign of the quadrupole deformation parameter to be extracted for the two lowest 2$^{+}$ states in $^{188}$Pb. Moreover, the advent of SPEDE will allow probing of the bandhead 0$^{+}$ states via direct measurements of E0 transitions. Beam development is requested to provide pure and instense $^{186}$Pb beam.
Effect of S186 for decoporated radiostrontium compared with BADE in rats
International Nuclear Information System (INIS)
Zhang Meizhen; Luo Meichu; Chen Guibao; Liu Shijing; Tong Shungao; Sun Meizhen
1995-01-01
The efficacy of S186 for decorporated radiostrontium compared with BADE in rats was studied. The experimental results showed that administered S186 (in 100∼800 mg/kg) increased the 85+89 Sr excretion in urine and reduced 85+89 Sr retention in body being distinctly superior to that of the equal dose BADE (P<0.05). When administered the dose of S186 that was the half dose of BADE could produce the same effect of BADE for removing radiostrontium
Pox 186: A Nearby Protogalaxy?
Corbin, Michael
1999-07-01
Blue Compact Dwarf Galaxies {BCDGs} typically consist of clusters of early-type stars embedded in older, evolved stellar populations similar in size and shape to normal dwarf ellipticals. However, deep ground-based CCD images of one faint BCDG, Pox 186, reveal a very compact { 5" diameter} structure with no evidence of an underlying older population. Optical spectroscopy of this object also indicates that a large number of Wolf-Rayet stars are present, which implies that a burst of star formation must have occurred very recently {Pox 186 is a protogalaxy, forming its very first generation of stars. Further investigation of this possibility requires the high angular resolution and ultraviolet spectral coverage that only HST can provide. Using WFPC2, we propose to image the galaxy in the U, V, and I bands, in order to better test for the presence of an underlying evolved population and to reveal any substructure in its star-forming regions. Using STIS, we will obtain low-resolution ultraviolet spectra of the galaxy for combination with ground-based spectra covering the optical through near infrared. This will allow us to determine its spectral energy distribution, metallicity, and dust content, which will in turn constrain its age and star formation history.
POX 186: A Dwarf Galaxy Under Construction?
Corbin, M. R.; Vacca, W. D.
2000-12-01
We have obtained deep images of the ultracompact ( ~ 3'') blue compact dwarf galaxy POX 186 in the F336W, F555W, and F814W filters of the Planetary Camera of the Hubble Space Telescope. We have additionally obtained a low-resolution near ultraviolet spectrum of the object with STIS and combine this with a ground-based spectrum covering the visible continuum and emission lines. Our images confirm this object to be highly compact, with a maximum projected size of only ~ 240 pc, making it one of the smallest galaxies known. We also confirm that the outer regions of the galaxy consist of an evolved stellar population, ruling out earlier speculations that POX 186 is a protogalaxy. However, the PC images reveal the galaxy to have a highly irregular morphology, with a pronounced tidal arm on its western side. This morphology is strongly suggestive of a recent collision between two smaller components which has in turn triggered the central starburst. The F336W image also shows that the material in this tidal stream is actively star forming. Given the very small ( ~ 100 pc) sizes of the colliding components, POX 186 may be a dwarf galaxy in the early stages of formation, which would be consistent with current ``downsizing'' models of galaxy formation in which the least massive objects are the last to form. This work is supported by NASA and the Space Telescope Science Institute.
Plasmonic Optical Fiber Sensor Based on Double Step Growth of Gold Nano-Islands
Directory of Open Access Journals (Sweden)
José M. M. M. de Almeida
2018-04-01
Full Text Available It is presented the fabrication and characterization of optical fiber sensors for refractive index measurement based on localized surface plasmon resonance (LSPR with gold nano-islands obtained by single and by repeated thermal dewetting of gold thin films. Thin films of gold deposited on silica (SiO2 substrates and produced by different experimental conditions were analyzed by Scanning Electron Microscope/Dispersive X-ray Spectroscopy (SEM/EDS and optical means, allowing identifying and characterizing the formation of nano-islands. The wavelength shift sensitivity to the surrounding refractive index of sensors produced by single and by repeated dewetting is compared. While for the single step dewetting, a wavelength shift sensitivity of ~60 nm/RIU was calculated, for the repeated dewetting, a value of ~186 nm/RIU was obtained, an increase of more than three times. It is expected that through changing the fabrication parameters and using other fiber sensor geometries, higher sensitivities may be achieved, allowing, in addition, for the possibility of tuning the plasmonic frequency.
187Os-186Os and He Isotope Systematics of Iceland Picrites
Brandon, A. D.; Brandon, A. D.; Graham, D.; Gautason, B.
2001-12-01
Iceland is one of the longest-lived modern plumes, and seismic imaging supports a model where the roots of this plume are at the base of the lower mantle. Hence, Os isotopic data for lavas from this plume are ideal for further testing the role of core-mantle chemical exchange at the site of plume generation in the lower mantle, and for addressing the origin of Os-He isotopic variation in plumes. Recent work has shown that lavas from some plume systems (Hawaii, Noril'sk-Siberia, Gorgona) show coupled enrichments in 186Os/188Os and 187Os/188Os, not observed in upper mantle materials including abyssal peridotites. Picrites from Hawaii display a positive correlation between 186Os/188Os and He isotopes (R/Ra), where range in 186Os/188Os of 0.119834+/-28 to 0.1198475+/-29 and corresponding R/Ra from +7 to +25. These systematics are consistent with a lower mantle source for the radiogenic 186Os signal in the Hawaiian plume. The coupled Os enrichments in these plumes has been attributed to core-mantle chemical exchange, consistent with generation of the Hawaiian plume at the base of the lower mantle in D". Other potentially viable models await additional scrutiny. New He isotope and high precision 186Os/188Os and 187Os/188Os measurements for Iceland picrites show unique systematics compared to Hawaii. These picrites have 187Os/188Os ranging from 0.1297 to 0.1381 and R/Ra of +9 to +18, with generally higher R/Ra correlating with higher 187Os/188Os. Unlike the Hawaiian picrites from Hualalai and Loihi, which have coupled enrichments in 186Os/188Os and 187Os/188Os, the Iceland picrites show no enrichment 186Os/188Os - 0.1198363+/-28 (2s, n=14). Such Os-He isotopic variations require one end-member source that has high R/Ra, coupled with a long term elevated Re/Os and Pt/Os similar to that of the upper mantle. These systematics are inconsistent with either known upper mantle materials or those purported for ancient recycled slabs and may be a previously unidentified component
Combined in-beam electron and γ-ray spectroscopy of 184,186Hg
International Nuclear Information System (INIS)
Scheck, M.; Butler, P. A.; Gaffney, L. P.; Carrol, R. J.; Cox, D.; Joss, D. T.; Herzberg, R.-D.; Page, R. D.; Papadakis, P.; Watkins, H. V.; Bree, N.; Huyse, M.; Van Duppen, P.; Grahn, T.; Greenlees, P. T.; Herzan, A.; Jakobsson, U.; Jones, P.; Julin, R.; Juutinen, S.
2011-01-01
By exploiting the SAGE spectrometer a simultaneous measurement of conversion electrons and γ rays emitted in the de-excitation of excited levels in the neutron-deficient nuclei 184,186 Hg was performed. The light Hg isotopes under investigation were produced using the 4n channels of the fusion-evaporation reactions of 40 Ar and 148,150 Sm. The measured K- and L-conversion electron ratios confirmed the stretched E2 nature of several transitions of the yrast bands in 184,186 Hg. Additional information on the E0 component of the 2 2 + →2 1 + transition in 186 Hg was obtained.
Combined in-beam electron and gamma-ray spectroscopy of (184,186)Hg
Scheck, M; Rahkila, P; Butler, P A; Larsen, A C; Sandzelius, M; Scholey, C; Carrol, R J; Papadakis, P; Jakobsson, U; Grahn, T; Joss, D T; Watkins, H V; Juutinen, S; Bree, N; Cox, D; Huyse, M; Uusitalo, J; Leino, M; Ruotsalainen, P; Nieminen, P; Srebrny, J; Van Duppen, P; Herzan, A; Greenlees, P T; Julin, R; Herzberg, R D; Hauschild, K; Pakarinen, J; Page, R D; Peura, P; Gaffney, L P; Kowalczyk, M; Rinta-Antila, S; Saren, J; Lopez-Martens, A; Sorri, J; Ketelhut, S
2011-01-01
By exploiting the SAGE spectrometer a simultaneous measurement of conversion electrons and gamma rays emitted in the de-excitation of excited levels in the neutron-deficient nuclei (184,186)Hg was performed. The light Hg isotopes under investigation were produced using the 4n channels of the fusion-evaporation reactions of (40)Ar and (148,150)Sm. The measured K- and L-conversion electron ratios confirmed the stretched E2 nature of several transitions of the yrast bands in (184,186)Hg. Additional information on the E0 component of the 2(2)(+) -> 2(1)(+) transition in (186)Hg was obtained.
Half-life measurements in doubly-odd sup(186,188,190)Au nuclei and the 188Hg -> Au decay
International Nuclear Information System (INIS)
Abreu, M.C.; Berg, V.; Fransson, K.; Hoeglund, A.; Oms, J.; Porquet, M.G.
1985-01-01
A level scheme has been established for 188 Hg -> Au decay which was studied with the online isotope separator ISOCELE. Precise conversion-electron measurements were performed with a semicircular magnetic spectrograph. The half-lives of the 16.0, 82.7 and 114.8 keV levels in 188 Au were measured with a lens electron spectrometer and reduced transition rates were deduced. Similarly the half-lives of the 36.1, 113.9, 227.7, 251.5, 288.0 and 363.6 keV levels in 186 Au and of the 28.9 and 171.5 keV levels in 190 Au were measured. Comparison of the reduced e.m. transition rates shows that a 1 + and a 2 - state have respectively the same structure in sup(186,) sup(188,) sup(190,) 192 Au, the same conclusion holding for the 1 - sub(g.s.) of sup(188,) sup(190,) 192 Au. Additional measurements in 189 , 191 Hg and 185 , 187 Au together with data from the literature enable us to interpret them as a coupling of certain quasiparticle states of neighbouring odd-A nuclei corresponding to oblate shapes. Indications are given that some other negative- and positive-parity states in 188 Au also belong to an oblate system. The nucleus 188 Au appears as the last of a series of doubly-odd gold nuclei where no shape coexistence has, as yet, been observed. (orig.)
47 CFR 0.186 - Emergency Relocation Board.
2010-10-01
..., Defense and Emergency Preparedness Functions § 0.186 Emergency Relocation Board. (a) As specified in the... functions of the Commission. Relocation may be required to accommodate a variety of emergency scenarios... require the evacuation of FCC headquarters with little or no advance notice, but for only a short duration...
Lifescience Database Archive (English)
Full Text Available keru Nakazato (Database Center for Life Science) アゲハチョウ(ナミアゲハ) Papilio xuthus 標本風の写真もあるかと思うので探してみます。 (もしくは撮り直す) nakazato 2008/12/22 09:47:51 2010/01/14 19:54:38 ... ...Asian Swallowtail Papilio xuthus Papilio_xuthus_L.png 186.png Takeru Nakazato (Database Center for Life Scie...nce) licensed under CC Attribution2.1 Japan 撮影:仲里猛留(ライフサイエンス統合データベースセンター) Photo: Ta
Influence of S186 on trace elements in organs of dogs
International Nuclear Information System (INIS)
Luo Meichu; Li Landi; Chen Guibao; Zhang Meizhen
1993-01-01
The authors report the influence of a radiostrontium de-cooperating agents, S186 (calcium sodium N-acetylproplysmine 1, 1-diphosphonate), on trace elements in internal organs of dogs. The trace elements contents were determined with a PE-3030 atomic absorption spectrophotometer. Compared with the control group, the trace elements (Cu, Zn and Mn) contents and the Cu/Zn ratio in organs of Beagle dogs after intramuscular injection of S186 for 30 days did not change obviously except the Cu content in the liver increased
Production of {sup 186}Re and {sup 188}Re, and synthesis of {sup 188}Re-DTPA
Energy Technology Data Exchange (ETDEWEB)
Hashimoto, Kazuyuki; Motoishi, Shoji; Kobayashi, Katsutoshi; Izumo, Mishiroku [Department of Radioisotopes, Japan Atomic Energy Research Institute, Tokai, Ibaraki (Japan); Musdja, Muhammad Yanis
1999-08-01
Production of radioactive rhenium isotopes {sup 186}Re and {sup 188}Re, and synthesis of {sup 188}Re-DTPA have been studied. For {sup 186}Re, a production method by the {sup 185}Re(n, {gamma}) {sup 186}Re reaction in a reactor has been established. For {sup 188}Re, a production method by the double neuron capture reaction of {sup 186}W, which produces a {sup 188}W/{sup 188}Re generator, has been established. For synthesis of {sup 188}Re-DTPA, the optimum conditions, including pH, the amounts of regents and so on, have been determined. (author)
Gold film with gold nitride - A conductor but harder than gold
International Nuclear Information System (INIS)
Siller, L.; Peltekis, N.; Krishnamurthy, S.; Chao, Y.; Bull, S.J.; Hunt, M.R.C.
2005-01-01
The formation of surface nitrides on gold films is a particularly attractive proposition, addressing the need to produce harder, but still conductive, gold coatings which reduce wear but avoid the pollution associated with conventional additives. Here we report production of large area gold nitride films on silicon substrates, using reactive ion sputtering and plasma etching, without the need for ultrahigh vacuum. Nanoindentation data show that gold nitride films have a hardness ∼50% greater than that of pure gold. These results are important for large-scale applications of gold nitride in coatings and electronics
Energy Technology Data Exchange (ETDEWEB)
Kakavand, T., E-mail: Tayeb@znu.ac.ir [Department of Physics, Faculty of Science, Imam Khomeini International University, Qazvin (Iran, Islamic Republic of); Mirzaii, M.; Khaleghi, M. [Agricultural, Medical and Industrial Research School, Nuclear Science and Technology Research Institute, AEOI, Karaj (Iran, Islamic Republic of); Eslami, M. [Department of Physics, Faculty of Science, University of Zanjan, Zanjan (Iran, Islamic Republic of)
2016-01-01
Highlights: • Optimization of tungsten sedimentation for bulk production of {sup 186}Re. • Influence of targetry parameters on stress-bearing of the target during proton irradiation. • Activity measurement for {sup 186}Re produced via {sup nat}W(p,xn) reaction. - Abstract: Tungsten is recognized as one of the important metals used in cyclotron targets for production of several vital radioisotopes. Adequate adhesion of the prepared targets to its substrate is a significant parameter that makes them optimized for high current beam collisions. The target morphology should be paid special attention as another important parameter. In this work, a rather thick layer of tungsten is deposited on a copper substrate by sedimentation technique to produce {sup 186g}Re radionuclide via {sup 186}W(p,n) reaction. Consecutive sedimentation experiments are carried out to determine the best suspension solution. The prepared targets are evaluated in morphology by scanning electron microscope. A mixture of 1 g tungsten powder, 250 mg ethyl cellulose and 5 mL acetone is concluded for desirable target adhesion. Irradiation of the targets by 20 μA proton current (15 MeV energy) for 5 h shows that they can withstand the proton beam.
Determination of gold in gold ores
International Nuclear Information System (INIS)
Keedy, C.R.; Parson, L.; Shen, J.
1989-01-01
The gold content of placer gold flakes and gold bearing ores was determined by instrumental and radiochemical neutron activation analysis, respectively. It was discovered that significant errors result in the instrumental method for gold flakes as small as 10 mg due to sample self-absorption of neutrons during irradiation. Reliable results were obtained for both ore samples and gold flakes by dissolving the samples in aqua regia prior to irradiation. (author) 7 refs.; 3 tabs
27 CFR 25.186 - Record of beer transferred.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Record of beer transferred..., DEPARTMENT OF THE TREASURY LIQUORS BEER Removals Without Payment of Tax Transfer to Another Brewery of Same Ownership § 25.186 Record of beer transferred. (a) Preparation of invoice. When beer is transferred between...
2012-04-10
...-01] Announcing DRAFT Revisions to Federal Information Processing Standard (FIPS) 186-3, Digital... Technology (NIST) requests comments on revisions to Federal Information Processing Standard (FIPS) 186-3... 25, 2012. ADDRESSES: Written comments may be sent to: Chief, Computer Security Division, Information...
Biosynthesis of gold nanoparticles using diatoms-silica-gold and EPS-gold bionanocomposite formation
Schröfel, Adam; Kratošová, Gabriela; Bohunická, Markéta; Dobročka, Edmund; Vávra, Ivo
2011-01-01
Novel synthesis of gold nanoparticles, EPS-gold, and silica-gold bionanocomposites by biologically driven processes employing two diatom strains (Navicula atomus, Diadesmis gallica) is described. Transmission electron microscopy (TEM) and electron diffraction analysis (SAED) revealed a presence of gold nanoparticles in the experimental solutions of the diatom culture mixed with tetrachloroaureate. Nature of the gold nanoparticles was confirmed by X-ray diffraction studies. Scanning electron m...
Structure of the Kπ = 4+ bands in 186,188Os
Phillips, A. A.; Garrett, P. E.; Bettermann, L.; Braun, N.; Burke, D. G.; Demand, G. A.; Faestermann, T.; Finlay, P.; Green, K. L.; Hertenberger, R.; Krü; cken, R.; Leach, K. G.; Schumaker, M. A.; Svensson, C. E.; Wirth, H.-F.; Wong, J.
2009-01-01
The structures of 3+ states in Os have been debated over several decades. Based on measured B(E2) values they were interpreted in 186-192Os as Kπ = 4+ two-phonon vibrations, whereas inelastic scattering, and (t,α) work imply a hexadecapole phonon description. To clarify the nature of these Kπ = 4+ bands in 186,188Os, we performed a (3He,d) reaction on 185,187Re targets using 30 MeV 3He beams and a Q3D spectrograph. Absolute cross sections were obtained for excited states up to 3 MeV at 9 angles from 5° to 50°. Results indicate a significant 5/2+[402]π+3/2+[402]π component in agreement with quasiparticle phonon model predictions for a single hexadecapole phonon structure.
TEM microstructural analysis of creep deformed CM186LC single crystal Ni-base superalloy
Energy Technology Data Exchange (ETDEWEB)
Dubiel, B.; Czyrska-Filemonowicz, A. [AGH Univ. of Science and Technology, Krakow (Poland); Blackler, M. [Howmet Ltd., Exeter (United Kingdom); Barnard, P.M. [ALSTOM Power Turbo-Systems Technology Centre, Rugby (United Kingdom)
2006-07-01
The nickel based single crystal superalloy CM186LC was extensively investigated as a potential low cost material for industrial gas turbine vanes within the COST522 programme. The alloy exhibits inhomogeneous structure consisting of dendritic regions and eutectic colonies. In the present work attention is focused on microstructural changes observed in single crystal CM186LC following creep deformation at 750 C. Creep tests were conducted at 750 C with an applied stress of 560 or 675 MPa for up to 11440 hours. The microstructure o ruptured and terminated specimens was investigated by scanning (SEM) and transmission (TEM) electron microscopy. TEM analysis revealed the microstructural changes in the CM186LC at primary and secondary creep as well as after creep rupture. (orig.)
Coliphage 186 replication is delayed when the host cell is UV irradiated before infection
International Nuclear Information System (INIS)
Hooper, I.; Woods, W.H.; Egan, B.
1981-01-01
In contrast to results with injections by lambda and P2, the latent period for infection by coliphage 186 is extended when the host cell is UV irradiated before infection. We find that 186 replication is significantly delayed in such a cell, even though the phage itself has not been irradiated. In contrast, replication of the closely related phage P2 under the same conditions is not affected
Palliative effect of Re-186 HEDP in different cancer patients with bone metastases
International Nuclear Information System (INIS)
Kucuk, N.O.; Ibis, E.; Aras, G.; Soylu, A.; Baltaci, S.; Beduk, Y.; Ozalp, G.; Canakci, N.
2001-01-01
The clinical picture of bone metastases is manifested by pain and loss of mechanical stability. Standard treatment options for bone metastases include external beam radiotherapy and the use of analgesics. Due to a large number of lesions in many patients, the use of radionuclide therapy with beta emitters may be preferable. Re-186 hydroxyethydilene diphosphonate (Re-186 HEDP) is one of the radiopharmaceuticals suitable for palliative treatment of metastatic bone pain. The aim of this study was to investigate palliative and side effects of Re-186 HEDP in pts with different type of cancers. Material and method: Thirty one (17 male, 14 female) patients with cancer (10 prostate, 10 breast, 4 rectum, 5 lung, 2 nasopharynx) and bone metastases were included in the study. Therapy was started with a fixed dose of 1295 MBq of Re-186 HEDP. If necessary, the same dose was repeated at least 3 times after an interval of 10-12 weeks A total of 40 standard doses (1295 MBq Re HEDP, Mallinckrodt, Holland) were given; 6 pts received repeated doses (3 doses in 3 pts, 2 doses in 3 pts). The pts with bone marrow suppression were excluded from the study. The pain relief was assessed with ECOG and Karnofsky status index. All pts were evaluated with standard evaluation forms filled daily a maximum of 10 weeks. Results: The respond rate was found as 87.5% in pts with breast and prostate Ca, 75% in pts with rectum Ca, 50% in pts with nasopharynx Ca and 20% in pts with lung Ca. The overall response rate was 67.5%. The palliation period varied between 6 to 10 weeks. The mean palliation period was 8.1 ± 1.3 weeks. Maximal palliation effect was observed between the 3 rd and the 7 th weeks. Any serious side effects were not seen except mild haematologic toxicity. Discussion and conclusion: It is concluded that Re-186 HEDP is a highly effective agent in the palliation of metastatic bone pain in pts with prostate, breast, rectum cancer, mildly effective in pts with nasopharynx cancer, but not
International Nuclear Information System (INIS)
Koca, Go Khan; Ozsoy, Ha Kan; Atilgan, Hasan Ikbal; Demirel, Koray; Dincel, Veysel Ercan; Korkmaz, Meliha
2012-01-01
After surgical therapy of diffuse pigmented villonodular synovitis (DPVNS), recurrence is seen in almost half of the patients. The effectiveness of radiosynovectomy (RSV)in preventing recurrence and complaints of DPVNS is well known. Elbow involvement in DPVNS is a very rare condition; therefore, RSV in elbow hasn't been experienced widely. The aim of this case report is to show the effectiveness of RSV with rhenium 186 (Re 186)sulfide colloid. We applied Re 186 sulfide colloid to the elbow joint of DPVNS patients six weeks after arthroscopic synovectomy. As a result, the patient did not have any complaints, and our findings are compatible with residue or recurrence on magnetic resonance imaging (MRI)in sixth and twentieth month controls after administration. We concluded that Re 186 is an effective adjuvant therapy for the prevention of recurrence and complaints
Directory of Open Access Journals (Sweden)
Kathrin Doppler
Full Text Available Multifocal motor neuropathy is an immune mediated disease presenting with multifocal muscle weakness and conduction block. IgM auto-antibodies against the ganglioside GM1 are detectable in about 50% of the patients. Auto-antibodies against the paranodal proteins contactin-1 and neurofascin-155 and the nodal protein neurofascin-186 have been detected in subgroups of patients with chronic inflammatory demyelinating polyneuropathy. Recently, auto-antibodies against neurofascin-186 and gliomedin were described in more than 60% of patients with multifocal motor neuropathy. In the current study, we aimed to validate this finding, using a combination of different assays for auto-antibody detection. In addition we intended to detect further auto-antibodies against paranodal proteins, specifically contactin-1 and neurofascin-155 in multifocal motor neuropathy patients' sera. We analyzed sera of 33 patients with well-characterized multifocal motor neuropathy for IgM or IgG anti-contactin-1, anti-neurofascin-155 or -186 antibodies using enzyme-linked immunosorbent assay, binding assays with transfected human embryonic kidney 293 cells and murine teased fibers. We did not detect any IgM or IgG auto-antibodies against contactin-1, neurofascin-155 or -186 in any of our multifocal motor neuropathy patients. We conclude that auto-antibodies against contactin-1, neurofascin-155 and -186 do not play a relevant role in the pathogenesis in this cohort with multifocal motor neuropathy.
UV induction of coliphage 186: Prophage induction as an SOS function
Energy Technology Data Exchange (ETDEWEB)
Lamont, I.; Brumby, A.M.; Egan, J.B.
1989-07-01
Our results show that UV induction of the 186 prophage depends upon the phage function Tum, with the mutant phenotype of turbid plaques on mitomycin plates and the expression of which is controlled by the host LexA protein. Tum function, encoded near the right-hand end of the coliphage 186 chromosome, is under the control of promoter p95. This promoter is overlapped by a sequence closely related to the consensus sequence of the LexA-binding site. It is proposed that inactivation of LexA after UV irradiation (or by genetic means) leads to prophage induction by permitting expression of Tum which, by unknown means, induces prophage. This mechanism is basically different from that seen with the UV-inducible lambdoid coliphages, which are not regulated by LexA.
Gold monetization and gold discipline
Robert P. Flood; Peter M. Garber
1981-01-01
The paper is a study of the price level and relative price effects of a policy to monetize gold and fix its price at a given future time and at the then prevailing nominal price. Price movements are analyzed both during the transition to the gold standard and during the post-monetization period. The paper also explores the adjustments to fiat money which are necessary to ensure that this type of gold monetization is non-inflationary. Finally, some conditions which produce a run on the governm...
Takahashi, Fumihiro; Takei, Koji; Tsuda, Kikumi; Palumbo, Joseph
2017-10-01
In the 24-week double-blind study of edaravone in ALS (MCI186-16), edaravone did not show a statistically significant difference versus placebo for the primary efficacy endpoint. For post-hoc analyses, two subpopulations were identified in which edaravone might be expected to show efficacy: the efficacy-expected subpopulation (EESP), defined by scores of ≥2 points on all 12 items of the ALS Functional Rating Scale-Revised (ALSFRS-R) and a percent predicted forced vital capacity (%FVC) ≥80% at baseline; and the definite/probable EESP 2 years (dpEESP2y) subpopulation which, in addition to EESP criteria, had definite or probable ALS diagnosed by El Escorial revised criteria, and disease duration of ≤2 years. In the 36-week extension study of MCI186-16, a 24-week double-blind comparison followed by 12 weeks of open-label edaravone (MCI186-17; NCT00424463), analyses of ALSFRS-R scores of the edaravone-edaravone group and edaravone-placebo group for the full analysis set (FAS) and EESP, as prospectively defined, were reported in a previous article. Here we additionally report results in patients who met dpEESP2y criteria at the baseline of MCI186-16. In the dpEESP2y, the difference in ALSFRS-R changes from 24 to 48 weeks between the edaravone-edaravone and edaravone-placebo groups was 2.79 (p = 0.0719), which was greater than the differences previously reported for the EESP and the FAS. The pattern of adverse events in the dpEESP2y did not show any additional safety findings to those from the earlier prospective study. In conclusion, this post-hoc analysis suggests a potential effect of edaravone between 24 and 48 weeks in patients meeting dpEESP2y criteria at baseline.
Coal-gold agglomeration: an alternative separation process in gold recovery
Energy Technology Data Exchange (ETDEWEB)
Akcil, A.; Wu, X.Q.; Aksay, E.K. [Suleyman Demirel University, Isparta (Turkey). Dept. of Mining Engineering
2009-07-01
Considering the increasing environmental concerns and the potential for small gold deposits to be exploited in the future, the uses of environmentally friendly processes are essential. Recent developments point to the potential for greatly increased plant performance through a separation process that combines the cyanide and flotation processes. In addition, this kind of alternative treatment processes to the traditional gold recovery processes may reduce the environmental risks of present small-scale gold mining. Gold recovery processes that applied to different types of gold bearing ore deposits show that the type of deposits plays an important role for the selection of mineral processing technologies in the production of gold and other precious metals. In the last 25 years, different alternative processes have been investigated on gold deposits located in areas where environmental issues are a great concern. In 1988, gold particles were first recovered by successful pilot trial of coal-gold agglomeration (CGA) process in Australia. The current paper reviews the importance of CGA in the production of gold ore and identifies areas for further development work.
Development of a 186Re-HEDP formulation and radio pharmacokinetics comparison with 153Sm-EDTMP
International Nuclear Information System (INIS)
Bribiesca C, A.I.
1998-01-01
Because of the growing interest in the use of the beta emitters radiopharmaceuticals applied to therapy in different cancer cases, we developed a formulation of 186 Re-HEDP (hydroxy ethylidene diphosphonate) as a pain palliative in osseous metastases. Besides serving like therapeutic agent, together with the 153 Sm-EDTMP (ethylene diamine tetra methylene phosphonate), which has already been synthesized and proved, labels EHDP could be very useful like a diagnostic agent in the pursuit of the illness. The irradiation conditions for Rhenium-186 were established by ORIGIN 2 codes for TRIGA reactors. A pharmaceutical formulation was developed employing a factorial experimental design obtaining a complex with a radiochemical purity over 90 %. The complexes 186 Re-HEDP 153 Sm-EDTMP were intravenous administered in BALB-C mice sacrifying them in several intervals of time in order to determine the cumulated activity in each organ to perform absorbed dose calculation by MIRD methodology (Medical Internal Radiation Dose). Radio pharmacokinetic data demonstrated that both complexes follow a biexponential kinetic of first order behavior. In the case of the 186 Re-HEDP the value of the α constant was 0.2789 and β 0.0006 with an effective dose of 2.56 (mSv)/MBq , while for the complex 153 Sm-EDTMP the values of α to and β were 0.9012 and and 0.616 respectively and the effective dose was 0.262 (mSv)/MBq. In conclusion, radiopharmaceutical 153 Sm-EDTMP, showed a greater bone uptake and a minor effective dose, for which it is a better radiopharmaceutical, respect to with the formulation of 186 Re-HEDP. (Author)
Phage based green chemistry for gold ion reduction and gold retrieval.
Setyawati, Magdiel I; Xie, Jianping; Leong, David T
2014-01-22
The gold mining industry has taken its toll on the environment, triggering the development of more environmentally benign processes to alleviate the waste load release. Here, we demonstrate the use of bacteriophages (phages) for biosorption and bioreduction of gold ions from aqueous solution, which potentially can be applied to remediate gold ions from gold mining waste effluent. Phage has shown a remarkably efficient sorption of gold ions with a maximum gold adsorption capacity of 571 mg gold/g dry weight phage. The product of this phage mediated process is gold nanocrystals with the size of 30-630 nm. Biosorption and bioreduction processes are mediated by the ionic and covalent interaction between gold ions and the reducing groups on the phage protein coat. The strategy offers a simple, ecofriendly and feasible option to recover of gold ions to form readily recoverable products of gold nanoparticles within 24 h.
19 CFR 18.6 - Short shipments; shortages; entry and allowance.
2010-04-01
... 19 Customs Duties 1 2010-04-01 2010-04-01 false Short shipments; shortages; entry and allowance...; DEPARTMENT OF THE TREASURY TRANSPORTATION IN BOND AND MERCHANDISE IN TRANSIT General Provisions § 18.6 Short shipments; shortages; entry and allowance. (a) When there has been a short shipment and the short-shipped...
31 CFR 100.4 - Gold coin and gold certificates in general.
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Gold coin and gold certificates in... EXCHANGE OF PAPER CURRENCY AND COIN In General § 100.4 Gold coin and gold certificates in general. Gold coins, and gold certificates of the type issued before January 30, 1934, are exchangeable, as provided...
Energy Technology Data Exchange (ETDEWEB)
Bribiesca C, A I
1998-12-01
Because of the growing interest in the use of the beta emitters radiopharmaceuticals applied to therapy in different cancer cases, we developed a formulation of {sup 186} Re-HEDP (hydroxy ethylidene diphosphonate) as a pain palliative in osseous metastases. Besides serving like therapeutic agent, together with the {sup 153} Sm-EDTMP (ethylene diamine tetra methylene phosphonate), which has already been synthesized and proved, labels EHDP could be very useful like a diagnostic agent in the pursuit of the illness. The irradiation conditions for Rhenium-186 were established by ORIGIN 2 codes for TRIGA reactors. A pharmaceutical formulation was developed employing a factorial experimental design obtaining a complex with a radiochemical purity over 90 %. The complexes {sup 186} Re-HEDP {sup 153} Sm-EDTMP were intravenous administered in BALB-C mice sacrifying them in several intervals of time in order to determine the cumulated activity in each organ to perform absorbed dose calculation by MIRD methodology (Medical Internal Radiation Dose). Radio pharmacokinetic data demonstrated that both complexes follow a biexponential kinetic of first order behavior. In the case of the {sup 186} Re-HEDP the value of the {alpha} constant was 0.2789 and {beta} 0.0006 with an effective dose of 2.56 (mSv)/MBq , while for the complex {sup 153} Sm-EDTMP the values of {alpha} to and {beta} were 0.9012 and and 0.616 respectively and the effective dose was 0.262 (mSv)/MBq. In conclusion, radiopharmaceutical {sup 153} Sm-EDTMP, showed a greater bone uptake and a minor effective dose, for which it is a better radiopharmaceutical, respect to with the formulation of {sup 186} Re-HEDP. (Author)
Gold and gold working in Late Bronze Age Northern Greece
Vavelidis, M.; Andreou, S.
2008-04-01
Numerous objects of gold displaying an impressive variety of types and manufacturing techniques are known from the Late Bronze Age (LBA) contexts of Mycenaean Greece, but very little is known about the origin and processing of gold during the second millennium b.c. Ancient literature and recent research indicate that northern Greece is probably the richest gold-bearing region in Greece, and yet, very little evidence exists regarding the exploitation of its deposits and the production as well as use of gold in the area during prehistory. The unusual find of a group of small stone crucibles at the prehistoric settlement of Thessaloniki Toumba, one with visible traces of gold melting, proves local production and offers a rare opportunity to examine the process of on-site gold working. Furthermore, the comparison of the chemical composition of prehistoric artefacts from two settlements with those of gold deposits in their immediate areas supports the local extraction of gold and opens up the prospect for some of the Mycenaean gold to have originated in northern Greece. The scarcity of gold items in northern Greek LBA contexts may not represent the actual amount of gold produced and consumed, but could be a result of the local social attitudes towards the circulation and deposition of artefacts from precious metals.
DEFF Research Database (Denmark)
Raaballe, J.; Grundy, B.D.
2002-01-01
Based on standard option pricing arguments and assumptions (including no convenience yield and sustainable property rights), we will not observe operating gold mines. We find that asymmetric information on the reserves in the gold mine is a necessary and sufficient condition for the existence...... of operating gold mines. Asymmetric information on the reserves in the mine implies that, at a high enough price of gold, the manager of high type finds the extraction value of the company to be higher than the current market value of the non-operating gold mine. Due to this under valuation the maxim of market...
Pox 186: An ultracompact galaxy with dominant ionized gas emission
Guseva, N. G.; Papaderos, P.; Izotov, Y. I.; Noeske, K. G.; Fricke, K. J.
2004-07-01
We present a ground-based optical spectroscopic and HST U, V, I photometric study of the blue compact dwarf (BCD) galaxy Pox 186. It is found that the emission of the low-surface brightness (LSB) component in Pox 186 at radii ⪉3 arcsec (⪉270 pc in linear scale) is mainly gaseous in origin. We detect Hα emission out to radii as large as 6 arcsec. At radii ⪆3 arcsec the light of the LSB component is contaminated by the emission of background galaxies complicating the study of the outermost regions. The surface brightness distribution in the LSB component can be approximated by an exponential law with a scale length α ⪉ 120 pc. This places Pox 186 among the most compact dwarf galaxies known. The derived α is likely to be an upper limit to the scale length of the LSB component because of the strong contribution of the gaseous emission. The oxygen abundance in the bright H II region derived from the 4.5 m Multiple Mirror Telescope (MMT) and 3.6 m ESO telescope spectra are 12 + log (O/H) = 7.76 ± 0.02 and 7.74 ± 0.01 (˜Z⊙/15), respectively, in accordance with previous determinations. The helium mass fractions found in this region are Y = 0.248 ± 0.009 (MMT) and Y = 0.248 ± 0.004 (3.6 m) suggesting a high primordial helium abundance. The MMT Observatory is a joint facility of the Smithsonian Institution and the University of Arizona. Based on observations collected at the European Southern Observatory, Chile, ESO program 71.B-0032(A). 12+\\log(O/H)⊙ = 8.92 (Anders & Grevesse \\cite{Anders89}).
Wang, Shengyu; Gong, Wei; Tian, Yao; Yang, Min
2015-11-01
The prevalence of lung obstruction is probably underestimated. Early detection and screening may alter the course and prognosis associated with lung disease. We investigated the effectiveness of voluntary lung function screening program and the agreement between the Global Initiative for Chronic Obstructive Lung Disease (GOLD) and the lower limit of normal (LLN) standard for public screening in Xi'an China. Pulmonary function testing was conducted on volunteers recruited from eight community centers in Xi'an, China between July and August 2012. Participants underwent three forced vital capacity (FVC) maneuvers. The maneuver with the best FEV1 was retained. Participants filled out a medical history survey before undergoing pulmonary function testing. Patients that self-reported lung disease on the health survey were excluded from the analysis. A total of 803 volunteers participated in this study. And 722 participants (93.8%) did not self-report chronic lung disease and were analyzed. Of these participants, 143 subjects (19.8%) were diagnosed by GOLD standard and 134 subjects (18.6%) had obstruction with LLN definition. GOLD definition can identify more asymptomatic subjects (19.1%) with respect to LLN. GOLD definition can detect more lung obstruction in elder subjects compared with young people, the difference is significant (P=0.0007). The overall agreement between the 2 methods was good: the kappa estimate was 0.822. The agreement in subjects aged 40-49, 50-59 and 60-69 years was good: the kappa estimate was 0.82, 0.936 and 0.907 respectively and the agreement in subjects aged 18-29 was inferior: the kappa estimate was only 0.555. Voluntary lung function screening program with GOLD standard may be a simple and effective approach to ensuring high yield detection of lung obstruction in subjects aged 40-69.
Bone marrow adsorbed dose of rhenium-186-HEDP and the relationship with decreased platelet counts
International Nuclear Information System (INIS)
Klerk, J.M.H. de; Dieren, E.B. van; Schip, A.D. van het
1996-01-01
Rhenium-186(Sn)-1,1-hydroxyethylidene diphosphonate ( 186 Re-HEDP) has been used for palliation of metastatic bone pain. The purpose of this study was to find a relationship between the bone marrow absorbed dose and the toxicity, expressed as the percentage decrease in the peripheral blood platelet count. The bone marrow absorbed dose was calculated according to the MIRD model using data obtained from ten treatments of patients suffering from metastatic prostate cancer; noninvasive and pharmacokinetic method were used. The bone marrow doses were related to toxicity using the pharmacodynamic sigmoid E max model. The mean bone marrow absorbed doses using the noninvasive and pharmacokinetic methods were in a close range to each other (1.07 mGy/MBq and 1.02 mGy/MBq, respectively). There was a good relationship between the toxicity and the bone marrow absorbed dose (r = 0.80). Furthermore, the EDrm 50 (i.e., the bone marrow absorbed dose producing a 50% platelet decrease) to bone marrow for 186 Re-HEDP was on the order of 2 Gy. Although the function of normal bone marrow is affected by metastases in patients with metastatic bone disease, the MIRD model can be used to relate toxicity to the bone marrow absorbed dose after a therapeutic dosage of 186 Re-HEDP. 33 refs., 1 fig., 1 tab
Gold Nanoparticles Obtained by Bio-precipitation from Gold(III) Solutions
International Nuclear Information System (INIS)
Gardea-Torresdey, J.L.; Tiemann, K.J.; Gamez, G.; Dokken, K.; Tehuacanero, S.; Jose-Yacaman, M.
1999-01-01
The use of metal nanoparticles has shown to be very important in recent industrial applications. Currently gold nanoparticles are being produced by physical methods such as evaporation. Biological processes may be an alternative to physical methods for the production of gold nanoparticles. Alfalfa biomass has shown to be effective at passively binding and reducing gold from solutions containing gold(III) ions and resulting in the formation of gold(0) nanoparticles. High resolution microscopy has shown that five different types of gold particles are present after reaction with gold(III) ions with alfalfa biomass. These particles include: fcc tetrahedral, hexagonal platelet, icosahedral multiple twinned, decahedral multiple twinned, and irregular shaped particles. Further analysis on the frequency of distribution has shown that icosahedral and irregular particles are more frequently formed. In addition, the larger particles observed may be formed through the coalescence of smaller particles. Through modification of the chemical parameters, more uniform particle size distribution may be obtained by the alfalfa bio-reduction of gold(III) from solution
Determination of (187)Os in molybdenite by ICP-MS with neutron-induced (186)Os and (188)Os spikes.
Qu, W; Du, A; Zhao, D
2001-10-31
The article describes a method for the determination of (187)Os in molybdenite by isotope dilution inductively coupled plasma-mass spectrometry (ID-ICP-MS) with neutron-induced (186)Os and (188)Os spike. The spike used in the present work was prepared in line with the principle by which artificial nuclides are produced in a nuclear reaction. The concentration and isotopic composition of osmium in the prepared spike were evaluated accurately with the isotope dilution method, using negative thermal ion mass spectrometry (N-TIMS). The advantage of this method is that using (186)Os and (188)Os double spikes can effectively compensate for the mass discrimination effects of ICP-MS. Thus, the common correction practice for mass bias in the isotope dilution method with a single spike is unnecessary. In addition, the method enables one to reduce the determined error arising from instrumental instability. The precision for the (187)Os/((186)Os+(188)Os) ratio was approximately 2% (2sigma, RSD), but in the case of (187)Os/(186)Os, (187)Os/(188)Os and (186)Os/(188)Os, precision ranged from 2.0 to 8% (2sigma, RSD). The results for (187)Os concentration in a molybdenite sample determined with this method showed good agreement with reference values.
Size fraction assaying of gold bearing rocks (for gold extraction) by ...
African Journals Online (AJOL)
A novel method has been developed for processing and extraction of gold from gold bearing rocks for use by small-scale gold miners in Ghana. The methodology involved crushing of gold bearing hard rocks to fine particles to form a composite sample and screening at a range of sizes. Gold distribution in the composite ...
186Re-HEDP for metastatic bone pain in breast cancer patients
International Nuclear Information System (INIS)
Lam, Marnix G.E.H.; Rijk, Peter P. van; Klerk, John M.H. de
2004-01-01
Two-thirds of patients with metastatic cancer suffer from pain. Pain originating from skeletal metastases is the most common form of cancer-related pain. Bone pain, often exacerbated by pressure or movement, limits the patient's autonomy and social life. Pain palliation with bone-seeking radiopharmaceuticals has proven to be an effective treatment modality in patients with metastatic bone pain. These bone-seeking radiopharmaceuticals are extremely powerful in treating scattered painful bone metastases, for which external beam radiotherapy is impossible because of the large field of irradiation. 186 Re-hydroxyethylidene diphosphonate (HEDP) is a potentially useful radiopharmaceutical for this purpose, having numerous advantageous characteristics. Bone marrow toxicity is limited and reversible, which makes repetitive treatment safe. Studies have shown encouraging clinical results of palliative therapy using 186 Re-HEDP, with an overall response rate of ca. 70% in painful bone metastases. It is effective for fast palliation of painful bone metastases from various tumours and the effect tends to last longer if patients are treated early in the course of their disease. 186 Re-HEDP is at least as effective in breast cancer patients with painful bone metastases as in patients with metastatic prostate cancer. It is to be preferred to radiopharmaceuticals with a long physical half-life in this group of patients, who tend to have more extensive haematological toxicity since they have frequently been pretreated with bone marrow suppressive chemotherapy. This systemic form of radionuclide therapy is simple to administer and complements other treatment options. It has been associated with marked pain reduction, improved mobility in many patients, reduced dependence on analgesics, and improved performance status and quality of life. (orig.)
TUG1 mediates methotrexate resistance in colorectal cancer via miR-186/CPEB2 axis.
Li, Changfeng; Gao, Yongjian; Li, Yongchao; Ding, Dayong
2017-09-16
Colorectal cancer (CRC) is a common malignancy, most of which remain unresponsive to chemotherapy. Methotrexate (MTX) is one of the earliest cytotoxic drugs and serves as an anti-metabolite and anti-folate chemotherapy for various types of cancer. However, MTX resistance prevents its clinical application in cancer therapy. Thereby, overcoming the drug resistance is an alternative strategy to maximize the efficacy of MTX therapies in clinics. Long non-coding RNAs (lncRNAs) have gained widespread attention in recent years. More and more evidences have shown that lncRNAs play regulatory roles in various biological activities and disease progression including drug resistance in cancer cells. Here, we observed lncRNA TUG1 was associated to the MTX resistant in colorectal cancer cells. Firstly, quantitative analysis indicated that TUG1 was significantly increased in tumors which were resistant to MTX treatment. TUG1 knockdown re-sensitized the MTX resistance in colorectal cancer cells, which were MTX-resistant colorectal cell line. Furthermore, bioinformatics analysis showed that miR-186 could directly bind to TUG1, suggesting TUG1 might worked as a ceRNA to sponge miR-186. Extensively, our study also showed that CPEB2 was the direct target of miR-186 in colorectal cancer cells. Taken together, our study suggests that lncRNA TUG1 mediates MTX resistance in colorectal cancer via miR-186/CPEB2 axis. Copyright © 2017. Published by Elsevier Inc.
Joseph G. Haubrich
1998-01-01
The price of gold commands attention because it serves as an indicator of general price stability or inflation. But gold is also a commodity, used in jewelry and by industry, so demand and supply affect its pricing and need to be considered when gold is a factor in monetary policy decisions.
Energy Technology Data Exchange (ETDEWEB)
Youxiang, Zhuang [Chinese Nuclear Data Center, Beijing, BJ (China)
1996-06-01
The medical radioisotopes are used for diagnostic and therapeutic purposes, as well as metabolism and physiological function researches in modern medicine. The major applications are of functional imaging using PET agents for {sup 18}F, various therapeutic pharmaceuticals via auger electrons for {sup 77}Br, cancers diagnosis and therapy for {sup 186}Re. The evaluations of experimental data and theoretical calculations for {sup 18}O, {sup 77}Se, {sup 187}W(p,n) reactions up to 80 MeV are presented and analysed. The recommended values for {sup 18}O(p,n){sup 18}F, {sup 77}Se(p,n){sup 77}Br and {sup 186}W(p,n){sup 186}Re reaction cross sections are given. (6 figs.).
Why the 18.6 year tide cannot explain the change of sign observed in j2
Directory of Open Access Journals (Sweden)
F. Deleflie
2003-01-01
Full Text Available Recent studies show a change, starting in 1998, in the behavior of the variation of the dynamical flattening of the Earth (J2, supposed to be constant (secular, and mainly due to the post glacial rebound effect. In this paper, we study to what extent this behavior can be correlated or not with the 18.6 year tide: with more than twenty years of tracking data on LAGEOS-1, that is to say more than a period of 18.6 years, this effect can now be separated from the secular variation. We use our theory of mean orbital motion, dedicated to studies of the long period effects on the orbital motion. We build one single arc of LAGEOS-1 from 1980 to 2002, which provides a continuous description of the orbital parameters. This is the great originality of our approach. We focus our attention on the ascending node of LAGEOS-1, and we show that the change observed in j2 cannot be attributed to a statistical error due to a correlation, in short arcs results, between the secular variation of J2 and the 18.6 year tide. The proof is based on the adjustment of amplitudes and phases of the long period tides, and on the shape of the residuals.Key words. secular variation of J2, 18.6 year tide, mean orbital motione
Gold 100: proceedings of the international conference on gold. V. 2
International Nuclear Information System (INIS)
Fivaz, C.E.; King, R.P.
1986-01-01
The proceedings of Gold 100 have been published in three separate volumes. The first deals with the mining of gold, the second with the extractive metallurgy of gold, and the third with industrial uses of gold. In this second volume, the papers on extractive metallurgy presented at the Conference reflect most of the problems that are currently of significant technical interest to the industry. This volume is divided in six main parts covering plant design, carbon-in-pulp technology, refractory gold, new technology, grinding and concentration, and leaching. The part on new technology includes papers on x-ray fluorescence analyzers, Moessbauer spectroscopy and leaching processes for uranium, while the part on grinding and concentration includes papers on nuclear and radiotracer techniques for the recovery of gold as well as various flotation parameters in the flotation behaviour of gold and uranium
Paper Money but a Gold Debt. Italy in the Gold Standard
Giuseppe Tattara; or consequences)
2002-01-01
During the 52 years between the Unification of the Kingdom of Italy and World War 1, the lira was legally convertible into metal for a limited period of time. Although not formally committed to gold, the lira exchange towards the gold standard countries proved remarkably stable, \\223shadowing\\224 gold. It is widely claimed that being one of the successful members of the gold standard circle entailed a number of advantages. If the lira was closely linked to gold, suggesting that there was only...
GOLD IS EARNED FROM THE PRODUCTION OF THAI GOLD LEAF
Directory of Open Access Journals (Sweden)
Dirk Bax
2010-06-01
Full Text Available Thai people like to cover sacred objects or things dear to them with gold leaf.. Statues of Buddha are sometimes covered with so many layers of gold leaf that they become formless figures, that can hardly be recognized. Portraits of beloved ancestors, statues of elephants and grave tombs are often covered with gold leaf. If one considers the number of Thai people and the popularity of the habit, the amount of gold involved could be considerable.
Brandon, Alan D.; Walker, Richard J.; Puchtel, Igor S.; Becker, Harry; Humayun, Munir; Revillon, Sidonie
2003-02-01
The presence of coupled enrichments in 186Os/ 188Os and 187Os/ 188Os in some mantle-derived materials reflects long-term elevation of Pt/Os and Re/Os relative to the primitive upper mantle. New Os data for the 89 Ma Gorgona Island, Colombia komatiites indicate that these lavas are also variably enriched in 186Os and 187Os, with 186Os/ 188Os ranging between 0.1198397±22 and 0.1198470±38, and with γOs correspondingly ranging from +0.15 to +4.4. These data define a linear trend that converges with the previously reported linear trend generated from data for modern Hawaiian picritic lavas and a sample from the ca. 251 Ma Siberian plume, to a common component with a 186Os/ 188Os of approximately 0.119870 and γOs of +17.5. The convergence of these data to this Os isotopic composition may imply a single ubiquitous source in the Earth's interior that mixes with a variety of different mantle compositions distinguished by variations in γOs. The 187Os- and 186Os-enriched component may have been generated via early crystallization of the solid inner core and consequent increases in Pt/Os and Re/Os in the liquid outer core, with time leading to suprachondritic 186Os/ 188Os and γOs in the outer core. The presence of Os from the outer core in certain portions of the mantle would require a mechanism that could transfer Os from the outer core to the lower mantle, and thence to the surface. If this is the process that generated the isotopic enrichments in the mantle sources of these plume-derived systems, then the current understanding of solid metal-liquid metal partitioning of Pt, Re and Os requires that crystallization of the inner core began prior to 3.5 Ga. Thus, the Os isotopic data reported here provide a new source of data to better constrain the timing of inner core formation, complementing magnetic field paleo-intensity measurements as data sources that constrain models based on secular cooling of the Earth.
Enhancement of gold recovery using bioleaching from gold concentrate
Choi, S. H.; Cho, K. H.; Kim, B. J.; Choi, N. C.; Park, C. Y.
2012-04-01
The gold in refractory ores is encapsulated as fine particles (sometimes at a molecular level) in the crystal structure of the sulfide (typically pyrite with or without arsenopyrite) matrix. This makes it impossible to extract a significant amount of refractory gold by cyanidation since the cyanide solution cannot penetrate the pyrite/arsenopyrite crystals and dissolve gold particles, even after fine grinding. To effectively extract gold from these ores, an oxidative pretreatment is necessary to break down the sulfide matrix. The most popular methods of pretreatment include nitric acid oxidation, roasting, pressure oxidation and biological oxidation by microorganisms. This study investigated the bioleaching efficiency of Au concentrate under batch experimental conditions (adaptation cycles and chemical composition adaptation) using the indigenous acidophilic bacteria collected from gold mine leachate in Sunsin gold mine, Korea. We conducted the batch experiments at two different chemical composition (CuSO4 and ZnSO4), two different adaptation cycles 1'st (3 weeks) and 2'nd (6 weeks). The results showed that the pH in the bacteria inoculating sample decreased than initial condition and Eh increased. In the chemical composition adaptation case, the leached accumulation content of Fe and Pb was exhibited in CuSO4 adaptation bacteria sample more than in ZnSO4 adaptation bacteria samples, possibly due to pre-adaptation effect on chalcopyrite (CuFeS2) in gold concentrate. And after 21 days on the CuSO4 adaptation cycles case, content of Fe and Pb was appeared at 1'st adaptation bacteria sample(Fe - 1.82 and Pb - 25.81 times per control sample) lower than at 2'nd adaptation bacteria sample(Fe - 2.87 and Pb - 62.05 times per control sample). This study indicates that adaptation chemical composition and adaptation cycles can play an important role in bioleaching of gold concentrate in eco-/economic metallurgy process.
Energy Technology Data Exchange (ETDEWEB)
Fassbender, M.E.; Ballard, B.; Birnbaum, E.R. [Los Alamos National Laboratory, Los Alamos, NM (United States). Chemistry Div.] [and others
2013-08-01
Rhenium-186g (T{sub 1/2} = 89.2 h) is a {beta}{sup -} emitter suitable for therapeutic applications. Current production methods rely on reactor production via {sup 185}Re(n,{gamma}) which results in low specific activities, thereby limiting its use. Production by p,d activation of enriched {sup 186}W results in a {sup 186g}Re product with a higher specific activity, allowing it to be used for targeted therapy with limited receptors. A test target consisting of pressed, sintered {sup nat}WO{sub 3} was proton irradiated at Los Alamos (LANL-IPF) to evaluate product yield and impurities, irradiation parameters and wet chemical Re recovery for proof-of-concept for bulk production of {sup 186g}Re. We demonstrated isolation of {sup 186g}Re in 97% yield from irradiated {sup nat}WO{sub 3} targets within 12 h of end of bombardment (EOB) via an alkaline dissolution followed by anion exchange. The recovery process has potential for automation, and WO{sub 3} can be easily recycled for recurrent irradiations. A {sup 186g}Re batch yield of 42.7 {+-} 2.2 {mu}Ci/{mu}Ah or 439 {+-} 23 MBq/C was obtained after 24 h in an 18.5 {mu}A proton beam. The target entrance energy was determined to be 15.6 MeV. The specific activity of {sup 186g}Re at EOB was measured to be 1.9 kCi (70.3 TBq) mmol{sup -1}, which agrees well with the result of a previous {sup 185,186m}Re co-production EMPIRE and TALYS modeling study assuming similar conditions. Utilizing enriched {sup 186}WO{sub 3}, we anticipate that a proton beam of 250 {mu}A for 24 h will provide batch yields of 256 mCi (9.5 GBq) of {sup 186g}Re at EOB with specific activities even higher than 1.9 kCi (70.3 TBq) mmol{sup -1}, suitable for therapy applications. (orig.)
Calculation and evaluation of the activation cross sections for 187Re(n,2n)186m,gRe reactions
International Nuclear Information System (INIS)
Huang Xiaolong; Lu Hanlin; Zhou Chunmei
1998-01-01
The activation cross sections for 187 Re(n,2n) 186m,g Re reactions are calculated using UNF code. The calculations are in good agreement with the re-evaluated measured data. Finally the excitation function for 187 Re(n,2n) 186m,g Re reactions are evaluated and recommended based on present calculations and evaluated decay data
Enrichment of Gold in Antimony Matte by Direct Smelting of Refractory Gold Concentrate
Yang, Tianzu; Xie, Boyi; Liu, Weifeng; Zhang, Duchao; Chen, Lin
2018-06-01
Conventional cyanidation technology achieves low gold recovery when used to process refractory gold concentrate. Based on the geochemical characteristics of gold deposit mineralization, a new method is proposed herein for gold enrichment in antimony matte by smelting of refractory gold concentrate. The effects of the FeO/SiO2 and CaO/SiO2 ratios, smelting temperature, and smelting time on the gold recovery were investigated in detail. The optimum conditions were determined to be FeO/SiO2 ratio of 1.2, CaO/SiO2 ratio of 0.4, smelting temperature of 1200°C, and smelting time of 45 min. The gold content in antimony matte and smelting slag was 96.68 and 1.13 g/t, respectively. The gold, antimony, and arsenic recovery was 97.72%, 26.89%, and 6.56%, respectively, with most of the antimony and arsenic volatilized into dust. Mineral liberation analyzer results showed that the antimony matte mainly consisted of FeS and FeO, with three phases, viz. FeAs, SbAs, and AuSb, embedded between them, indicating that gold was easily enriched with antimony and arsenic during smelting of refractory gold concentrate.
Enrichment of Gold in Antimony Matte by Direct Smelting of Refractory Gold Concentrate
Yang, Tianzu; Xie, Boyi; Liu, Weifeng; Zhang, Duchao; Chen, Lin
2018-04-01
Conventional cyanidation technology achieves low gold recovery when used to process refractory gold concentrate. Based on the geochemical characteristics of gold deposit mineralization, a new method is proposed herein for gold enrichment in antimony matte by smelting of refractory gold concentrate. The effects of the FeO/SiO2 and CaO/SiO2 ratios, smelting temperature, and smelting time on the gold recovery were investigated in detail. The optimum conditions were determined to be FeO/SiO2 ratio of 1.2, CaO/SiO2 ratio of 0.4, smelting temperature of 1200°C, and smelting time of 45 min. The gold content in antimony matte and smelting slag was 96.68 and 1.13 g/t, respectively. The gold, antimony, and arsenic recovery was 97.72%, 26.89%, and 6.56%, respectively, with most of the antimony and arsenic volatilized into dust. Mineral liberation analyzer results showed that the antimony matte mainly consisted of FeS and FeO, with three phases, viz. FeAs, SbAs, and AuSb, embedded between them, indicating that gold was easily enriched with antimony and arsenic during smelting of refractory gold concentrate.
The geology of the gold deposits of Prestea gold belt of Ghana ...
African Journals Online (AJOL)
This paper presents the geology of the gold deposits along the Prestea gold belt of Ghana to assist exploration work for new orebodies along the belt. Prestea district is the third largest gold producer in West Africa after Obuasi and Tarkwa districts (over 250 metric tonnes Au during the last century). The gold deposits are ...
Gold Leaching Characteristics and Intensification of a High S and As-Bearing Gold Concentrate
Yang, Yong-bin; Liu, Xiao-liang; Jiang, Tao; Li, Qian; Xu, Bin; Zhang, Yan
Some high sulfur and arsenic-bearing gold concentrate has a gold leaching rate less than 80% by oxidation roasting-pickling-cyanidation process. The characteristics and intensification of gold leaching were studied systemically. By combining chemical composition and phase analysis, the low gold leaching rate was found to lie in the capsulation of gold by iron-containing phases including iron oxides, arsenopyrite and pyrite. 96.66% of gold in the industrial leaching residue was capsulated and 95.88% of the capsulated turned out to be in the iron-containing phases. The results of laboratory pickling-cyanidation experiments on the calcine and industrial leaching residue presented further demonstration for the fact that gold capsulated in the iron-containing phases was hard to be leached. However, the gold cyanide leaching rate of calcine could be raised over 95% by a reduction roasting-pickling pretreatment which played such a significant role in exposing the capsulated gold that gold leaching was intensified remarkably.
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-03-01
Production of the radioactive rhenium isotopes {sup 186}Re and {sup 188}Re, and synthesis of their labeled compounds have been studied together with the biodistributions of the compounds. This work was carried out by the Working Group on Radioactive Rhenium, consisting of researchers of JAERI and some universities, in the Subcommittee for Production and Radiolabeling under the Consultative Committee of Research on Radioisotopes. For {sup 186}Re, production methods by the {sup 185}Re(n,{gamma}){sup 186}Re reaction in a reactor and by the {sup 186}W(p,n){sup 186}Re reaction with an accelerator, which can produce nocarrier-added {sup 186}Re, have been established. For {sup 188}Re, a production method by the double neutron capture reaction of {sup 186}W, which produces a {sup 188}W/{sup 188}Re generator, has been established. For labeling of bisphosphonate, DMSA, DTPA, DADS, aminomethylenephosphonate and some monoclonal antibodies with the radioactive rhenium isotopes, the optimum conditions, including pH, the amounts of reagents and so on, have been determined for each compound. The biodistributions of each of the labeled compounds in mice have been also obtained. (author)
Oxidation state of gold and arsenic in gold-bearing arsenian pyrite
Energy Technology Data Exchange (ETDEWEB)
Simon, G.; Huang, H.; Penner-Hahn, J.E.; Kesler, S.E.; Kao, L.S. [Univ. of Michigan, Ann Arbor, MI (United States)
1999-07-01
XANES measurements on gold-bearing arsenian pyrite from the Twin Creeks Carlin-type gold deposits show that gold is present as both Au{sup 0} and Au{sup 1+} and arsenic is present as As{sup 1{minus}}. Au{sup 0} is attributed to sub-micrometer size inclusions of free gold, whereas Au{sup 1+} is attributed to gold in the lattice of the arsenian pyrite. STEM observations suggest that As{sup 1{minus}} is probably concentrated in angstrom-scale, randomly distributed layers with a marcasite or arsenopyrite structure. Ionic gold (Au{sup 1+}) could be concentrated in these layers as well, and is present in both twofold- and fourfold-coordinated forms, with fourfold-coordinated Au{sup 1+} more abundant. Twofold-coordinated Au{sup 1+} is similar to gold in Au{sub 2}S in which it is linearly coordinated to two sulfur atoms. The nature of fourfold-coordinated Au{sup 1+} is not well understood, although it might be present as an Au-As-S compound where gold is bonded in fourfold coordination to sulfur and arsenic atoms, or in vacancy positions on a cation site in the arsenian pyrite. Au{sup 1+} was probably incorporated into arsenian pyrite by adsorption onto pyrite surfaces during crystal growth. The most likely compound in the case of twofold-coordinated Au{sup 1+} was probably a tri-atomic surface complex such as S{sub pyrite}-Au{sup 1+}-S{sub bi-sulfide}H or Au{sup 1+}-S-Au{sup 1+}. The correlation between gold and arsenic might be related to the role of arsenic in enhancing the adsorption of gold complexes of this type on pyrite surfaces, possibly through semiconductor effects.
Biodistribution and dosimetric evaluation of 186Re hydroxy ethylen diphosphate
International Nuclear Information System (INIS)
Noto, M.G.; Manzini, Alberto
1987-01-01
The pharmacokinetics and the dose of radiation absorbed in different body tissues by the administration of 186 Re HEDP (hydroxyethylendiphosphate). The radiation dose in the standard man was established between 5,5 and 25 rad/mCi for red marrow, and red marrow and bone respectively; the radiation dose in metastases would be of 125 rad/mCi. It is concluded that this radiopharmaceutical is suitable for palliative treatment for pain with the mentioned patollogy. (M.E.L.) [es
186 Etude théorique du transport électronique par la simulation ...
African Journals Online (AJOL)
youness
Choukria SAYAH et al. 186. Etude théorique du ... For that we carried out the microscopic simulations, based on the Monte. Carlo method. ... intervalles, piezoelectric as well as the interactions of alloy and on ionized impurities. ..... SAYA et al. 198. [5] - R. W. Hockney, J. W. Eastwood, "Computer simulation using particles",.
A novel copper(II) coordination at His186 in full-length murine prion protein
Energy Technology Data Exchange (ETDEWEB)
Watanabe, Yasuko [Laboratory of Radiation Biology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan); Hiraoka, Wakako [Laboratory of Biophysics, School of Science and Technology, Meiji University, Kawasaki 214-8571 (Japan); Igarashi, Manabu; Ito, Kimihito [Department of Global Epidemiology, Hokkaido University Research Center for Zoonosis Control, Sapporo 001-0020 (Japan); Shimoyama, Yuhei [Soft-Matter Physics Laboratory, Graduate School of Emergent Science, Muroran Institute of Technology, Muroran 050-8585 (Japan); Horiuchi, Motohiro [Laboratory of Prion Diseases, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan); Yamamori, Tohru; Yasui, Hironobu; Kuwabara, Mikinori [Laboratory of Radiation Biology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan); Inagaki, Fuyuhiko [Laboratory of Structural Biology, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo 060-0812 (Japan); Inanami, Osamu, E-mail: inanami@vetmed.hokudai.ac.jp [Laboratory of Radiation Biology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan)
2010-04-09
To explore Cu(II) ion coordination by His{sup 186} in the C-terminal domain of full-length prion protein (moPrP), we utilized the magnetic dipolar interaction between a paramagnetic metal, Cu(II) ion, and a spin probe introduced in the neighborhood of the postulated binding site by the spin labeling technique (SDSL technique). Six moPrP mutants, moPrP(D143C), moPrP(Y148C), moPrP(E151C), moPrP(Y156C), moPrP(T189C), and moPrP(Y156C,H186A), were reacted with a methane thiosulfonate spin probe and a nitroxide residue (R1) was created in the binding site of each one. Line broadening of the ESR spectra was induced in the presence of Cu(II) ions in moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) but not moPrP(D143R1). This line broadening indicated the presence of electron-electron dipolar interaction between Cu(II) and the nitroxide spin probe, suggesting that each interspin distance was within 20 A. The interspin distance ranges between Cu(II) and the spin probes of moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) were estimated to be 12.1 A, 18.1 A, 10.7 A, and 8.4 A, respectively. In moPrP(Y156R1,H186A), line broadening between Cu(II) and the spin probe was not observed. These results suggest that a novel Cu(II) binding site is involved in His186 in the Helix2 region of the C-terminal domain of moPrP{sup C}.
A novel copper(II) coordination at His186 in full-length murine prion protein
International Nuclear Information System (INIS)
Watanabe, Yasuko; Hiraoka, Wakako; Igarashi, Manabu; Ito, Kimihito; Shimoyama, Yuhei; Horiuchi, Motohiro; Yamamori, Tohru; Yasui, Hironobu; Kuwabara, Mikinori; Inagaki, Fuyuhiko; Inanami, Osamu
2010-01-01
To explore Cu(II) ion coordination by His 186 in the C-terminal domain of full-length prion protein (moPrP), we utilized the magnetic dipolar interaction between a paramagnetic metal, Cu(II) ion, and a spin probe introduced in the neighborhood of the postulated binding site by the spin labeling technique (SDSL technique). Six moPrP mutants, moPrP(D143C), moPrP(Y148C), moPrP(E151C), moPrP(Y156C), moPrP(T189C), and moPrP(Y156C,H186A), were reacted with a methane thiosulfonate spin probe and a nitroxide residue (R1) was created in the binding site of each one. Line broadening of the ESR spectra was induced in the presence of Cu(II) ions in moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) but not moPrP(D143R1). This line broadening indicated the presence of electron-electron dipolar interaction between Cu(II) and the nitroxide spin probe, suggesting that each interspin distance was within 20 A. The interspin distance ranges between Cu(II) and the spin probes of moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) were estimated to be 12.1 A, 18.1 A, 10.7 A, and 8.4 A, respectively. In moPrP(Y156R1,H186A), line broadening between Cu(II) and the spin probe was not observed. These results suggest that a novel Cu(II) binding site is involved in His186 in the Helix2 region of the C-terminal domain of moPrP C .
Robert J. Barro; Sanjay P. Misra
2013-01-01
From 1836 to 2011, the average real rate of price change for gold in the United States is 1.1% per year and the standard deviation is 13.1%, implying a one-standard-deviation confidence band for the mean of (0.1%, 2.1%). The covariances of gold's real rate of price change with consumption and GDP growth rates are small and statistically insignificantly different from zero. These negligible covariances suggest that gold's expected real rate of return--which includes an unobserved dividend yiel...
Coal-oil gold agglomeration assisted flotation to recover gold from refractory ore
Otsuki, A.; Yue, C.
2017-07-01
This study aimed to investigate the applicability of coal-oil gold agglomeration (CGA) assisted flotation to recover gold from a refractory ore. The ore with the grade of 2-5 g/t was tested with the CGA-flotation process in six different size fractions from 38 to 300 urn using different collector types and dosages. In addition, the flotation without CGA was performed under the same condition for comparison. The results showed that the higher gold grade and recovery were achieved by applying the CGA-flotation, compared with the flotation without CGA. More than 20-60 times grade increase from the head grade was obtained with CGA-flotation. The elemental analysis of gold and sulphur explained their relationship with gold recovery. The results well indicated the applicability of CGA to upgrade the refractory gold ore.
Shape mixing in sup(184,186)Hg
International Nuclear Information System (INIS)
Baba, C.V.K.
1976-01-01
Recent potential energy calculations on even Hg isotopes have shown that sup(184,186)Hg are possibly deformed with two energy minima one each for oblate (β 2 =-0.14) and prolate (β 2 =0.28) shapes. The quasi-rotational levels in these nuclei have been studied by heavy ion reactions at Berley and Chalk River. The salient features of these studies are: a deviation of the energy levels from a rotational sequence for I + →2 + and 2 + →0 + , E2 transition rates from the rotational value with β 2 =0.28. These features of the spectra are explained on the basis of mixing of bands based on the oblate and prolate shapes. The results of a simple band mixing calculation are presented and they reproduce the observed level spacings and B(E2) values. (author)
Gold and gold-copper nanoparticles in 2-propanol: A radiation chemical study
International Nuclear Information System (INIS)
Dey, G.R.
2011-01-01
The studies on the reduction of Au 3+ to gold nanoparticles in presence and absence of Cu 2+ under deoxygenated conditions in 2-propanol by radiolytic method have been carried out. On γ-radiolysis, preliminary yellow colored solution of Au 3+ changed to purple color owing to gold nanoparticles formation, which exhibits an absorption peak at around 540 nm. In the presence of Cu 2+ , absorption of gold-copper nanoparticles, which was also produced during γ-radiolysis, was red shifted in contrast to the system containing no Cu 2+ . Under DLS studies the sizes of gold nanoparticles in the absence and the presence of Cu 2+ were found to be larger (>400 nm). However, in presence of polyethylene glycol, a stabilizer the nanoparticle sizes became smaller, sizes measured for gold and gold-copper nanoparticles are 40 and 140 nm, respectively. Moreover, the change in UV-vis spectra in the Cu 2+ and Au 3+ mixed system highlights the formation of gold-copper nanoparticles in core-shell type arrangement. - Highlights: → Present radiation chemical study highlights high reactivity of Au ·2+ with Cu 2+ . → Absorption of gold-copper nanoparticles is blue shifted as compared to copper nanoparticles. → Change in UV-vis spectra with dose emphasizes core-shell type arrangement of Au-Cu nanoparticles.
International Nuclear Information System (INIS)
Girling, C.A.; Peterson, P.J.
1980-01-01
Many plants have the ability to take up gold from the soil and to accumulate it in their tisssue. Advances have been made in understanding these processes to the point where their exploitation in the field of prospecting for gold appears practically feasible. Neutron activation analysis is used for the determination of the small quantities of gold in plants
Koděra, Peter; Kozák, Jaroslav; Brčeková, Jana; Chovan, Martin; Lexa, Jaroslav; Jánošík, Michal; Biroň, Adrián; Uhlík, Peter; Bakos, František
2018-03-01
The Biely Vrch deposit in the Western Carpathians is assigned to the shallow, sulfide-poor porphyry gold deposit type and has an exceptionally low Cu/Au ratio. According to 3-D geochemical models, there is a limited spatial correlation between Au and Cu due to the primary introduction of gold by a salt melt and Cu by low-density vapor. Despite a rough spatial correlation of gold grades with quartz stockwork intensity, gold is hosted mostly by altered rock, exclusively in native form. Three main gold mineral assemblages were recognized here. In the deepest parts of the system, the K- and Ca-Na silicate gold assemblage is associated with minerals of high-temperature alteration (plagioclase, K-feldspar, actinolite), with gold grades and fineness depending on depth and potassium content of the host rock: K-silicate alteration hosts the lowest fineness gold ( 914), whereas Ca-Na silicate alteration has the highest ( 983). The intermediate argillic gold assemblage is the most widespread, with gold hosted mainly by chlorite, illite, smectite, and interstratified illite-chlorite-smectite minerals. The gold fineness is mostly variable (875-990) and inherited from the former gold mineral assemblages. The latest advanced argillic gold assemblage has its gold mostly in kaolinite. The extremely high fineness ( 994) results from gold remobilization by late-stage aqueous magmatic-hydrothermal fluids. Uncommon bonanza-grade appears where the earlier gold mineral assemblages were further enriched by this remobilized gold. Primary precipitation of gold occurred during ascent and cooling of salt melts at 450 to 309 °C, mostly during retrograde quartz solubility.
Gaffney, L P; Page, R.D.; Grahn, T.; Scheck, M.; Butler, P.A.; Bertone, P.F.; Bree, N.; Carroll, R.J.; Carpenter, M.P.; Chiara, C.J.; Dewald, A.; Filmer, F.; Fransen, C.; Huyse, M.; Janssens, R.V.F.; Joss, D.T.; Julin, R.; Kondev, F.G.; Nieminen, P.; Pakarinen, J.; Rigby, S.V.; Rother, W.; Van Duppen, P.; Watkins, H.V.; Wrzosek-Lipska, K.; Zhu, S.
2014-01-01
The neutron-deficient mercury isotopes, $^{184,186}$Hg, were studied with the Recoil Distance Doppler Shift (RDDS) method using the Gammasphere array and the K\\"oln Plunger device. The Differential Decay Curve Method (DDCM) was employed to determine the lifetimes of the yrast states in $^{184,186}$Hg. An improvement on previously measured values of yrast states up to $8^{+}$ is presented as well as first values for the $9_{3}$ state in $^{184}$Hg and $10^{+}$ state in $^{186}$Hg. $B(E2)$ values are calculated and compared to a two-state mixing model which utilizes the variable moment of inertia (VMI) model, allowing for extraction of spin-dependent mixing strengths and amplitudes.
Moessbauer study of the chemical state of gold in gold ores
International Nuclear Information System (INIS)
Wagner, F.E.; Marion, P.H.; Regnard, J.-R.
1986-01-01
Information on the chemical state of gold in gold ores has been obtained by 197 Au Moessbauer spectroscopy in cases where the state of this element cannot be determined by such standard methods as optical or electron microscopy. Ore concentrates consisting mainly of pyrite or arsenopyrite and roasted ore and matte samples were studied. The results yielded directly the respective amounts of metallic and chemically bound gold. Unless the gold is metallic, its chemical state in the ores turns out to be different from that in the minerals studied so far as reference materials. The chemical processes taking place during various treatments of the ores, such as roasting or leaching, can also be followed by Moessbauer spectroscopy. It is hoped that Moessbauer spectroscopy will eventually facilitate the development of more efficient methods of gold extraction
Mahl, Dirk; Diendorf, Jörg; Ristig, Simon; Greulich, Christina; Li, Zi-An; Farle, Michael; Köller, Manfred; Epple, Matthias
2012-10-01
Silver, gold, and silver-gold-alloy nanoparticles were prepared by citrate reduction modified by the addition of tannin during the synthesis, leading to a reduction in particle size by a factor of three. Nanoparticles can be prepared by this easy water-based synthesis and subsequently functionalized by the addition of either tris(3-sulfonatophenyl)phosphine or poly( N-vinylpyrrolidone). The resulting nanoparticles of silver (diameter 15-25 nm), gold (5-6 nm), and silver-gold (50:50; 10-12 nm) were easily dispersable in water and also in cell culture media (RPMI + 10 % fetal calf serum), as shown by nanoparticle tracking analysis and differential centrifugal sedimentation. High-resolution transmission electron microscopy showed a polycrystalline nature of all nanoparticles. EDX on single silver-gold nanoparticles indicated that the concentration of gold is higher inside a nanoparticle. The biologic action of the nanoparticles toward human mesenchymal stem cells (hMSC) was different: Silver nanoparticles showed a significant concentration-dependent influence on the viability of hMSC. Gold nanoparticles showed only a small effect on the viability of hMSC after 7 days. Surprisingly, silver-gold nanoparticles had no significant influence on the viability of hMSC despite the silver content. Silver nanoparticles and silver-gold nanoparticles in the concentration range of 5-20 μg mL-1 induced the activation of hMSC as indicated by the release of IL-8. In contrast, gold nanoparticles led to a reduction of the release of IL-6 and IL-8.
Gold deposit styles and placer gold characterisation in northern and east-central Madagascar
Pitfield, Peter E. J; Styles, Michael T.; Taylor, Cliff D.; Key, Roger M.; Bauer,; Ralison, A
2009-01-01
Microchemical characterisation of bedrock and placer gold grains from six gold districts within the Archaean domains and intervening Neoproterozoic Anaboriana-Manampotsy belt of northern and east-central Madagascar show few opaque inclusions (e.g pyrrhotite, Bi tellurides) but wide range of Ag contents (40wt%). Some districts exhibit multiple source populations of grains. The ‘greenstone belt’ terranes have an orogenic gold signature locally with an intrusion-related to epithermal overprint. Proterozoic metasediments with felsic to ultramafic bodies yield dominantly intrusion-related gold. A high proportion of secondary gold (<0.5wt% Ag) is related to recycling of paleoplacers and erosion of post-Gondwana planation surfaces and indicates that some mesothermal gold systems were already partially to wholly removed by erosion by the PermoTriassic.
Analysis of gold and silver concentration on gold mining tailings by neutron activation analysis
International Nuclear Information System (INIS)
Sadikov, I.I.; Salimov, M.I.; Sadykova, Z.O.
2014-01-01
Full text: Instrumental neutron-activation analysis without radiochemical separation is one of most applicable and often used methods to analyze the concentration of gold, silver and other rare and noble metals in gold ores. This method is not suitable for analyzing low concentration of gold and silver in gold mining tailings due to rather high concentration of some elements. Samples are dissolved by boiling in a mixture of concentrated hydrochloric and nitric acids to extract gold and silver into the solution. Chemical yield of gold and silver after dissolution of the sample and further chromatographic separation is between 92 and 95 percent respectively
International Nuclear Information System (INIS)
Salvadori, M. C.; Teixeira, F. S.; Araújo, W. W. R.; Sgubin, L. G.; Cattani, M.; Spirin, R. E.; Brown, I. G.
2012-01-01
We describe work in which gold nanoparticles were formed in diamond-like carbon (DLC), thereby generating a Au-DLC nanocomposite. A high-quality, hydrogen-free DLC thin film was formed by filtered vacuum arc plasma deposition, into which gold nanoparticles were introduced using two different methods. The first method was gold ion implantation into the DLC film at a number of decreasing ion energies, distributing the gold over a controllable depth range within the DLC. The second method was co-deposition of gold and carbon, using two separate vacuum arc plasma guns with suitably interleaved repetitive pulsing. Transmission electron microscope images show that the size of the gold nanoparticles obtained by ion implantation is 3-5 nm. For the Au-DLC composite obtained by co-deposition, there were two different nanoparticle sizes, most about 2 nm with some 6-7 nm. Raman spectroscopy indicates that the implanted sample contains a smaller fraction of sp 3 bonding for the DLC, demonstrating that some sp 3 bonds are destroyed by the gold implantation.
International Nuclear Information System (INIS)
Goldrosen, M.H.; Biddle, W.C.; Pancook, J.; Bakshi, S.; Vanderheyden, J.L.; Fritzberg, A.R.; Morgan, A.C. Jr.; Foon, K.A.
1990-01-01
Biodistribution, pharmacokinetic, and radioimaging studies were performed with 186Re-labeled NR-LU-10 whole antibody in athymic nude mice bearing the LS174T tumor growing either s.c. or in an experimental hepatic metastasis model. NR-LU-10 is an IgG2b murine monoclonal antibody (MAb) that reacts with virtually all human tumors of epithelial origin. NR-BC-1, a IgG2b murine MAb that reacts with normal human B-cell and B malignancies, was used as an isotype-matched control. These MAbs were radiolabeled with 186Re by a preformed chelate approach by using the triamide thiolate ligand system. 186Re-labeled NR-LU-10 (50 microCi) was injected into nude mice bearing LS174T tumors growing s.c. Biodistribution studies revealed that the LS174T tumor retained the highest concentration of 186Re-labeled NR-LU-10 at day 6. The tumor:blood ratio ranged from 0.1:1 to 10.8:1 by day 6, the last day of analysis. In contrast the tumor:blood ratio of 186Re-labeled NR-BC-1, the isotype-matched MAb control, was 1:1 on day 6. Pharmacokinetic analysis indicated that the t1/2 beta of NR-LU-10 for blood and other tissues ranged from 21 to 25 h, while the t1/2 beta for the LS174T tumor averaged 52 h. The area under the curve for tumor compared to blood was 2.8- to 5.7-fold higher than the area under the curve for all other tissues and organs. The mean residence time for NR-LU-10 in blood and all other organs ranged from 23 to 26 h, while the mean residence time for NR-LU-10 in the LS174T tumor was 72 h. Scintigraphic images revealed selective uptake of the 186Re-labeled NR-LU-10, but not of the 186Re-labeled NR-BC-1, at the LS174T tumor site. Studies in an experimental model of hepatic metastasis revealed a similar selective pattern of 186Re-labeled NR-LU-10 accumulation. Scintigraphic images of the LS174T tumor growing within the athymic nude mouse liver were obtained
Obliquity Variations of Habitable Zone Planets Kepler-62f and Kepler-186f
Shan, Yutong; Li, Gongjie
2018-06-01
Obliquity variability could play an important role in the climate and habitability of a planet. Orbital modulations caused by planetary companions and the planet’s spin axis precession due to the torque from the host star may lead to resonant interactions and cause large-amplitude obliquity variability. Here we consider the spin axis dynamics of Kepler-62f and Kepler-186f, both of which reside in the habitable zone around their host stars. Using N-body simulations and secular numerical integrations, we describe their obliquity evolution for particular realizations of the planetary systems. We then use a generalized analytic framework to characterize regions in parameter space where the obliquity is variable with large amplitude. We find that the locations of variability are fine-tuned over the planetary properties and system architecture in the lower-obliquity regimes (≲40°). As an example, assuming a rotation period of 24 hr, the obliquities of both Kepler-62f and Kepler-186f are stable below ∼40°, whereas the high-obliquity regions (60°–90°) allow moderate variabilities. However, for some other rotation periods of Kepler-62f or Kepler-186f, the lower-obliquity regions could become more variable owing to resonant interactions. Even small deviations from coplanarity (e.g., mutual inclinations ∼3°) could stir peak-to-peak obliquity variations up to ∼20°. Undetected planetary companions and/or the existence of a satellite could also destabilize the low-obliquity regions. In all cases, the high-obliquity region allows for moderate variations, and all obliquities corresponding to retrograde motion (i.e., >90°) are stable.
Energy Technology Data Exchange (ETDEWEB)
Mahl, Dirk; Diendorf, Joerg; Ristig, Simon [University of Duisburg-Essen, Department of Inorganic Chemistry, Center for Nanointegration Duisburg-Essen (CeNIDE) (Germany); Greulich, Christina [Ruhr-University of Bochum, Bergmannsheil University Hospital/Surgical Research (Germany); Li Zian; Farle, Michael [University of Duisburg-Essen, Faculty of Physics, Center for Nanointegration Duisburg-Essen (CeNIDE) (Germany); Koeller, Manfred [Ruhr-University of Bochum, Bergmannsheil University Hospital/Surgical Research (Germany); Epple, Matthias, E-mail: matthias.epple@uni-due.de [University of Duisburg-Essen, Department of Inorganic Chemistry, Center for Nanointegration Duisburg-Essen (CeNIDE) (Germany)
2012-10-15
Silver, gold, and silver-gold-alloy nanoparticles were prepared by citrate reduction modified by the addition of tannin during the synthesis, leading to a reduction in particle size by a factor of three. Nanoparticles can be prepared by this easy water-based synthesis and subsequently functionalized by the addition of either tris(3-sulfonatophenyl)phosphine or poly(N-vinylpyrrolidone). The resulting nanoparticles of silver (diameter 15-25 nm), gold (5-6 nm), and silver-gold (50:50; 10-12 nm) were easily dispersable in water and also in cell culture media (RPMI + 10 % fetal calf serum), as shown by nanoparticle tracking analysis and differential centrifugal sedimentation. High-resolution transmission electron microscopy showed a polycrystalline nature of all nanoparticles. EDX on single silver-gold nanoparticles indicated that the concentration of gold is higher inside a nanoparticle. The biologic action of the nanoparticles toward human mesenchymal stem cells (hMSC) was different: Silver nanoparticles showed a significant concentration-dependent influence on the viability of hMSC. Gold nanoparticles showed only a small effect on the viability of hMSC after 7 days. Surprisingly, silver-gold nanoparticles had no significant influence on the viability of hMSC despite the silver content. Silver nanoparticles and silver-gold nanoparticles in the concentration range of 5-20 {mu}g mL{sup -1} induced the activation of hMSC as indicated by the release of IL-8. In contrast, gold nanoparticles led to a reduction of the release of IL-6 and IL-8.
International Nuclear Information System (INIS)
Mahl, Dirk; Diendorf, Jörg; Ristig, Simon; Greulich, Christina; Li Zian; Farle, Michael; Köller, Manfred; Epple, Matthias
2012-01-01
Silver, gold, and silver–gold-alloy nanoparticles were prepared by citrate reduction modified by the addition of tannin during the synthesis, leading to a reduction in particle size by a factor of three. Nanoparticles can be prepared by this easy water-based synthesis and subsequently functionalized by the addition of either tris(3-sulfonatophenyl)phosphine or poly(N-vinylpyrrolidone). The resulting nanoparticles of silver (diameter 15–25 nm), gold (5–6 nm), and silver–gold (50:50; 10–12 nm) were easily dispersable in water and also in cell culture media (RPMI + 10 % fetal calf serum), as shown by nanoparticle tracking analysis and differential centrifugal sedimentation. High-resolution transmission electron microscopy showed a polycrystalline nature of all nanoparticles. EDX on single silver–gold nanoparticles indicated that the concentration of gold is higher inside a nanoparticle. The biologic action of the nanoparticles toward human mesenchymal stem cells (hMSC) was different: Silver nanoparticles showed a significant concentration-dependent influence on the viability of hMSC. Gold nanoparticles showed only a small effect on the viability of hMSC after 7 days. Surprisingly, silver–gold nanoparticles had no significant influence on the viability of hMSC despite the silver content. Silver nanoparticles and silver–gold nanoparticles in the concentration range of 5–20 μg mL −1 induced the activation of hMSC as indicated by the release of IL-8. In contrast, gold nanoparticles led to a reduction of the release of IL-6 and IL-8.
Energy Technology Data Exchange (ETDEWEB)
Souto, D.; Cunha, K. [Observatório Nacional, Rua General José Cristino, 77, 20921-400 São Cristóvão, Rio de Janeiro, RJ (Brazil); García-Hernández, D. A.; Zamora, O.; Prieto, C. Allende; Jönsson, H.; Pérez, A. E. García [Instituto de Astrofísica de Canarias (IAC), Vía Lactea S/N, E-38205, La Laguna, Tenerife (Spain); Smith, V. V. [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Mahadevan, S. [Department of Astronomy and Astrophysics, The Pennsylvania State University (United States); Blake, C. [Department of Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Johnson, J. A.; Pinsonneault, M. [Department of Astronomy, The Ohio State University, Columbus, OH 43210 (United States); Holtzman, J. [New Mexico State University, Las Cruces, NM 88003 (United States); Majewski, S. R.; Sobeck, J. [Department of Astronomy, University of Virginia, Charlottesville, VA 22904-4325 (United States); Shetrone, M. [University of Texas at Austin, McDonald Observatory (United States); Teske, J. [Department of Terrestrial Magnetism, Carnegie Institution for Science, Washington, DC 20015 (United States); Nidever, D. [Department of Astronomy, University of Michigan, Ann Arbor, MI, 48104 (United States); Schiavon, R. [Astrophysics Research Institute, Liverpool John Moores University, 146 Brownlow Hill, Liverpool, L3 5RF (United Kingdom); and others
2017-02-01
We report the first detailed chemical abundance analysis of the exoplanet-hosting M-dwarf stars Kepler-138 and Kepler-186 from the analysis of high-resolution ( R ∼ 22,500) H -band spectra from the SDSS-IV–APOGEE survey. Chemical abundances of 13 elements—C, O, Na, Mg, Al, Si, K, Ca, Ti, V, Cr, Mn, and Fe—are extracted from the APOGEE spectra of these early M-dwarfs via spectrum syntheses computed with an improved line list that takes into account H{sub 2}O and FeH lines. This paper demonstrates that APOGEE spectra can be analyzed to determine detailed chemical compositions of M-dwarfs. Both exoplanet-hosting M-dwarfs display modest sub-solar metallicities: [Fe/H]{sub Kepler-138} = −0.09 ± 0.09 dex and [Fe/H]{sub Kepler-186} = −0.08 ± 0.10 dex. The measured metallicities resulting from this high-resolution analysis are found to be higher by ∼0.1–0.2 dex than previous estimates from lower-resolution spectra. The C/O ratios obtained for the two planet-hosting stars are near-solar, with values of 0.55±0.10 for Kepler-138 and 0.52±0.12 for Kepler-186. Kepler-186 exhibits a marginally enhanced [Si/Fe] ratio.
International Nuclear Information System (INIS)
Young, J.E.
1993-01-01
Gold is found in minute quantities and gold mining generates enormous amounts of waste materials and long history of environmental destruction: mercury in tailing, eroded land, and acid mine drainage are legacies of the past. The problem has become worse in recent years in North America, Australia, the Amazon basin, Philippines. This paper describes the economics of gold and the changes in the world economy which has precipitated the new gold rushes. Current technology uses a cyanide solution for leaching small amounts of gold from tons of waste, and mercury remains a toxic waste of gold mining. Both short and long term results of gold mining, on the environment and on indiginous populations are described
Ahmed A. Mohamed
2015-01-01
Basic chemistry of gold tells us that it can bond to sulfur, phosphorous, nitrogen, and oxygen donor ligands. The Frontiers in Gold Chemistry Special Issue covers gold complexes bonded to the different donors and their fascinating applications. This issue covers both basic chemistry studies of gold complexes and their contemporary applications in medicine, materials chemistry, and optical sensors. There is a strong belief that aurophilicity plays a major role in the unending applications of g...
Directory of Open Access Journals (Sweden)
Jian ZHANG
2010-04-01
Full Text Available Background and objective Curcumin, a natural compound, is derived from the rthizom of Curcuma longa. In vitro and in vivo preclinical studies have shown its anti-inflammatory, antioxidant, anticancer activities and so on. miR-186*, which was found by microarray technology, was highly expressed in lung carcinoma cells A549/DDP. The aim of this study is to illustrate whether Curcumin could promote the apoptosis of A549/DDP cells through regulating the expression of miR-186*. Methods An oligonucleotide microarray chip was used to profile microRNA (miRNA expressions in A549/DDP cells treated with and without Curcumin. The significantly differentially expressed miRNA, which was selected from microarray chip, validated by quantitative real-time PCR. Ultimately, the remarkably expressed miRNA modulated the apoptosis assaying by flow cytometry expriments and the survival rate was measured by MTT method. Results The microarray chip results demonstrated: Curcumin altered the expression level of miRNAs compared with untreated control in A549/DDP cell line, miR-186* was significantly down-regulated after Curcumin treatment, which confirmed by quantitative real-time PCR. Downregulation of miR-186* expression by curcumin elevated the apoptosis, and the survival rate of A549/DDP cells decreased; but up-regulation of miR-186* expression by transfection its mimics restrained the apoptosis, the survival rate of A549/DDP cells increased, which were assayed by flow cytometry expriments and MTT method. Conclusion Modulation of miRNAs expression may be an important mechanism underlying the biological roles of Curcumin.
International Nuclear Information System (INIS)
Kinuya, S.; Hiramatsu, T.; Michigishi, T.
2006-01-01
A treatment adjuvant to surgical resection of the primary lesion has been proven to be beneficial in improving the prognosis of patients with high risks of peritoneal dissemination of colon cancer. This study was performed to determine the comparative efficacy of intraperitoneal radioimmunotherapy (RIT) using Re-186 or I-131 labeled murine antibodies in the extermination of cancer cells. A murine anti-colorectal IgG1, A7 monoclonal antibody, was radio-labeled either with I-131 (by the chloramine-T method) or Re-186 (by the MAG3 pre-chelated method). A total number of 16 mice were subjected to RIT with Re-186 A7 (N=8) or I-131 A7 (N=8) at equitoxic doses in Balb/c bu/nu mice 10 min after intraperitoneal injection of LS180 human colon cancer cells. A third group of mice were subjected to chemotherapy with 5-fluorouracil at 30 mg/kg for 4 consecutive days following the intraperitoneal injection of the same LS180 human colon cancer cells. There were 19 mice in the control group who were not subjected to any form of therapy. The results revealed that the mean survival of mice in the control (N-19), I-131 A7 RIT (N=8) and Chemotherapy (N=6) groups were 33.8 ± 1.0, 80.1 ± 2.5 and 49.3 ± 5.3 days respectively. The eight mice who were subjected to Re-186 A7 RIT showed much better survival compared to the other groups. Two of the eight mice from this group died at 105 and 111 days following Re-186 A7 RIT. Other six mice were sacrificed at 172 days, and autopsy revealed no macroscopic peritoneal tumor growth. Based on this pilot study we concluded that individual tumor cells in the peritoneal cavity would be effectively exterminated by intraperitoneal RIT with Re-186 A7. (author)
Direct formation of gold nanorods on surfaces using polymer-immobilised gold seeds
Directory of Open Access Journals (Sweden)
Majid K. Abyaneh
2016-06-01
Full Text Available Herein, we present the formation of gold nanorods (GNRs on novel gold–poly(methyl methacrylate (Au–PMMA nanocomposite substrates with unprecedented growth control through the polymer molecular weight (Mw and gold-salt-to-polymer weight ratio. For the first time, GNRs have been produced by seed-mediated direct growth on surfaces that were pre-coated with polymer-immobilised gold seeds. A Au–PMMA nanocomposite formed by UV photoreduction has been used as the gold seed. The influence of polymer Mw and gold concentration on the formation of GNRs has been investigated and discussed. The polymer nanocomposite formed with a lower Mw PMMA and 20 wt % gold salt provides a suitable medium for growing well-dispersed GNRs. In this sample, the average dimension of produced GNRs is 200 nm in length with aspect ratios up to 10 and a distribution of GNRs to nanoparticles of nearly 22%. Suitable characterization techniques such as AFM and SEM have been used to support concept of the proposed growth method.
Moessbauerspectroscopy on Gold Ruby Glass
International Nuclear Information System (INIS)
Haslbeck, S.
2005-01-01
In this thesis, the chemical states of gold and the physical mechanisms of the growing process of the particles under the influence of additional ingredients like tin, lead, antimony and selenium before, during and after the colouring process are investigated by using the Moessbauer spectroscopy on 197 Au, 119 Sn and 121 Sb, optical spectroscopy and X-ray-diffraction. Gold in an unnealed, colourless state of the glasses consists of monovalent forming linear bonds to two neighbouring oxygen atoms. The Lamb-Moessbauer factor of these gold oxide bondings is observed as 0.095 at 4.2 K. The gold in it's oxide state transforms to gold particles with a diameter of 3 nm to 60 nm. The size of the gold particles is quite definable within the optical spectra and certain sizes are also discernable within the Moessbauer spectra. One component of the Moessbauer spectra is assigned to the surface layer of the gold particles. By comparing this surface component with the amount of the bulk metallic core, one can calculate the size of the gold particles. In the Moessbauer spectra of the colourless glass one also can find parts of bulk metallic gold. Investigations with X-ray diffraction show that these are gold particles with a diameter of 100 nm to 300 nm and therefore have no additional colouring effect within the visible spectrum. The Moessbauer spectra on gold of the remelt glasses are similar to those which have been measured on the initial colourless glasses
Immunological properties of gold nanoparticles.
Dykman, Lev A; Khlebtsov, Nikolai G
2017-03-01
In the past decade, gold nanoparticles have attracted strong interest from the nanobiotechnological community owing to the significant progress made in robust and easy-to-make synthesis technologies, in surface functionalization, and in promising biomedical applications. These include bioimaging, gene diagnostics, analytical sensing, photothermal treatment of tumors, and targeted delivery of various biomolecular and chemical cargos. For the last-named application, gold nanoparticles should be properly fabricated to deliver the cargo into the targeted cells through effective endocytosis. In this review, we discuss recent progress in understanding the selective penetration of gold nanoparticles into immune cells. The interaction of gold nanoparticles with immune cell receptors is discussed. As distinct from other published reviews, we present a summary of the immunological properties of gold nanoparticles. This review also summarizes what is known about the application of gold nanoparticles as an antigen carrier and adjuvant in immunization for the preparation of antibodies in vivo . For each of the above topics, the basic principles, recent advances, and current challenges are discussed. Thus, this review presents a detailed analysis of data on interaction of gold nanoparticles with immune cells. Emphasis is placed on the systematization of data over production of antibodies by using gold nanoparticles and adjuvant properties of gold nanoparticles. Specifically, we start our discussion with current data on interaction of various gold nanoparticles with immune cells. The next section describes existing technologies to improve production of antibodies in vivo by using gold nanoparticles conjugated with specific ligands. Finally, we describe what is known about adjuvant properties of bare gold or functionalized nanoparticles. In the Conclusion section, we present a short summary of reported data and some challenges and perspectives.
International Nuclear Information System (INIS)
Wolter, D.
1974-01-01
The silver isotopes Ag 105 and Agsup(110m) and the gold isotopes Au 195 and Au 199 were used for isotope effect measurements. The isotope effect of the gold self-diffusion was measured on four monocrystals samples at about 850 0 C, that of silver in gold monocrystals at five different temperatures between 731 0 C and 1050 0 C. Furthermore, the isotope effect for silver at 904 0 C was measured on seven silver-gold alloys of varying silver concentration. The correlation factor was determined from the measurements. (HPOE/LH) [de
The giant Jiaodong gold province: The key to a unified model for orogenic gold deposits?
Directory of Open Access Journals (Sweden)
David I. Groves
2016-05-01
Full Text Available Although the term orogenic gold deposit has been widely accepted for all gold-only lode-gold deposits, with the exception of Carlin-type deposits and rare intrusion-related gold systems, there has been continuing debate on their genesis. Early syngenetic models and hydrothermal models dominated by meteoric fluids are now clearly unacceptable. Magmatic-hydrothermal models fail to explain the genesis of orogenic gold deposits because of the lack of consistent spatially – associated granitic intrusions and inconsistent temporal relationships. The most plausible, and widely accepted, models involve metamorphic fluids, but the source of these fluids is hotly debated. Sources within deeper segments of the supracrustal successions hosting the deposits, the underlying continental crust, and subducted oceanic lithosphere and its overlying sediment wedge all have their proponents. The orogenic gold deposits of the giant Jiaodong gold province of China, in the delaminated North China Craton, contain ca. 120 Ma gold deposits in Precambrian crust that was metamorphosed over 2000 million years prior to gold mineralization. The only realistic source of fluid and gold is a subducted oceanic slab with its overlying sulfide-rich sedimentary package, or the associated mantle wedge. This could be viewed as an exception to a general metamorphic model where orogenic gold has been derived during greenschist- to amphibolite-facies metamorphism of supracrustal rocks: basaltic rocks in the Precambrian and sedimentary rocks in the Phanerozoic. Alternatively, if a holistic view is taken, Jiaodong can be considered the key orogenic gold province for a unified model in which gold is derived from late-orogenic metamorphic devolatilization of stalled subduction slabs and oceanic sediments throughout Earth history. The latter model satisfies all geological, geochronological, isotopic and geochemical constraints but the precise mechanisms of auriferous fluid release, like many
Facts and Fantasies about Gold
Klement, Joachim
2015-01-01
Due to the increasing popularity of gold as an investment the demand for effective risk management techniques for gold investments has increased as well. In this paper we analyze several drivers of the price of gold that have been proposed in the past. Our analysis indicates that short-term volatility of the price of gold remains rather unpredictable with many of the explanations like the fund flows in physical gold ETF either unreliable or unstable over time. Our analysis suggests that there...
Occurrences of dendritic gold at the McLaughlin Mine hot-spring gold deposit
Sherlock, R. L.; Lehrman, N. J.
1995-06-01
Two styles of gold dendrites are variably developed at the McLaughlin Mine. The most abundant occurrence is hosted by amber-coloured hydrocarbon-rich opal. Silica likely precipitated from a boiling hydrothermal fluid and complexed with immiscible hydrocarbons forming an amorphous hydrocarbon-silica phase. This phase likely scavenged particulate gold by electrostatic attraction to the hydrocarbon-silica phase. The dendritic nature of the gold is secondary and is the result of dewatering of the amorphous hydrocarbon-silica phase and crystallization of gold into syneresis fractures. The second style of dendritic gold is hosted within vein swarms that focused large volumes of fluid flow. The dendrites occur along with hydrocarbon-rich silica at the upper contact of the vein margins which isolated the dendrites allowing sufficient time for them to grow. In a manner similar to the amber-coloured opal, the dendrites may have formed by scavenging particulate gold by electrostatic attraction to the hydrocarbon-silica phase.
International Nuclear Information System (INIS)
Karczmarczyk, Aleksandra; Celebanska, Anna; Nogala, Wojciech; Sashuk, Volodymyr; Chernyaeva, Olga; Opallo, Marcin
2014-01-01
Graphical abstract: - Highlights: • Gold nanoparticulate film electrodes were prepared by layer-by-layer method from oppositely charged nanoparticles. • Positively charged nanoparticles play dominant role in glucose oxidation in alkaline solution. • Gold and gold-carbon nanoparticulate film electrodes exhibit similar glucose oxidation current and onset potential. - Abstract: Electrocatalytic oxidation of glucose was studied at nanoparticulate gold and gold-carbon film electrodes. These electrodes were prepared by a layer-by-layer method without application of any linker molecules. Gold nanoparticles were stabilized by undecane thiols functionalized by trimethyl ammonium or carboxylate groups, whereas the carbon nanoparticles were covered by phenylsulfonate functionalities. The gold nanoparticulate electrodes were characterized by UV-vis and XPS spectroscopy, atomic force microscopy and voltammetry, before and after heat-treatment. Heat-treatment facilitates the aggregation of the nanoparticles and affects the structure of the film. The comparison of the results obtained with film electrodes prepared from gold nanoparticles with the same charge and with gold-carbon nanoparticulate electrodes, proved that positively charged nanoparticles are responsible for the high electrocatalytic activity, whereas negatively charged ones act rather as a linker of the film
A non-diazo approach to α-oxo gold carbenes via gold-catalyzed alkyne oxidation.
Zhang, Liming
2014-03-18
For the past dozen years, homogeneous gold catalysis has evolved from a little known topic in organic synthesis to a fully blown research field of significant importance to synthetic practitioners, due to its novel reactivities and reaction modes. Cationic gold(I) complexes are powerful soft Lewis acids that can activate alkynes and allenes toward efficient attack by nucleophiles, leading to the generation of alkenyl gold intermediates. Some of the most versatile aspects of gold catalysis involve the generation of gold carbene intermediates, which occurs through the approach of an electrophile to the distal end of the alkenyl gold moiety, and their diverse transformations thereafter. On the other hand, α-oxo metal carbene/carbenoids are highly versatile intermediates in organic synthesis and can undergo various synthetically challenging yet highly valuable transformations such as C-H insertion, ylide formation, and cyclopropanation reactions. Metal-catalyzed dediazotizations of diazo carbonyl compounds are the principle and most reliable strategy to access them. Unfortunately, the substrates contain a highly energetic diazo moiety and are potentially explosive. Moreover, chemists need to use energetic reagents to prepare them, putting further constrains on operational safety. In this Account, we show that the unique access to the gold carbene species in homogeneous gold catalysis offers an opportunity to generate α-oxo gold carbenes if both nucleophile and electrophile are oxygen. Hence, this approach would enable readily available and safer alkynes to replace hazardous α-diazo carbonyl compounds as precursors in the realm of gold carbene chemistry. For the past several years, we have demonstrated that alkynes can indeed effectively serve as precursors to versatile α-oxo gold carbenes. In our initial study, we showed that a tethered sulfoxide can be a suitable oxidant, which in some cases leads to the formation of α-oxo gold carbene intermediates. The
A Non-Diazo Approach to α-Oxo Gold Carbenes via Gold-Catalyzed Alkyne Oxidation
2015-01-01
For the past dozen years, homogeneous gold catalysis has evolved from a little known topic in organic synthesis to a fully blown research field of significant importance to synthetic practitioners, due to its novel reactivities and reaction modes. Cationic gold(I) complexes are powerful soft Lewis acids that can activate alkynes and allenes toward efficient attack by nucleophiles, leading to the generation of alkenyl gold intermediates. Some of the most versatile aspects of gold catalysis involve the generation of gold carbene intermediates, which occurs through the approach of an electrophile to the distal end of the alkenyl gold moiety, and their diverse transformations thereafter. On the other hand, α-oxo metal carbene/carbenoids are highly versatile intermediates in organic synthesis and can undergo various synthetically challenging yet highly valuable transformations such as C–H insertion, ylide formation, and cyclopropanation reactions. Metal-catalyzed dediazotizations of diazo carbonyl compounds are the principle and most reliable strategy to access them. Unfortunately, the substrates contain a highly energetic diazo moiety and are potentially explosive. Moreover, chemists need to use energetic reagents to prepare them, putting further constrains on operational safety. In this Account, we show that the unique access to the gold carbene species in homogeneous gold catalysis offers an opportunity to generate α-oxo gold carbenes if both nucleophile and electrophile are oxygen. Hence, this approach would enable readily available and safer alkynes to replace hazardous α-diazo carbonyl compounds as precursors in the realm of gold carbene chemistry. For the past several years, we have demonstrated that alkynes can indeed effectively serve as precursors to versatile α-oxo gold carbenes. In our initial study, we showed that a tethered sulfoxide can be a suitable oxidant, which in some cases leads to the formation of α-oxo gold carbene intermediates. The
Surface-stabilized gold nanocatalysts
Dai, Sheng [Knoxville, TN; Yan, Wenfu [Oak Ridge, TN
2009-12-08
A surface-stabilized gold nanocatalyst includes a solid support having stabilizing surfaces for supporting gold nanoparticles, and a plurality of gold nanoparticles having an average particle size of less than 8 nm disposed on the stabilizing surfaces. The surface-stabilized gold nanocatalyst provides enhanced stability, such as at high temperature under oxygen containing environments. In one embodiment, the solid support is a multi-layer support comprising at least a first layer having a second layer providing the stabilizing surfaces disposed thereon, the first and second layer being chemically distinct.
A halogen-free synthesis of gold nanoparticles using gold(III) oxide
International Nuclear Information System (INIS)
Sashuk, Volodymyr; Rogaczewski, Konrad
2016-01-01
Gold nanoparticles are one of the most used nanomaterials. They are usually synthesized by the reduction of gold(III) chloride. However, the presence of halide ions in the reaction mixture is not always welcome. In some cases, these ions have detrimental influence on the morphology and structure of resulting nanoparticles. Here, we present a simple and halogen-free procedure to prepare gold nanoparticles by reduction of gold(III) oxide in neat oleylamine. The method provides the particles with an average size below 10 nm and dispersity of tens of percent. The process of nanoparticle formation was monitored using UV–Vis spectroscopy. The structure and chemical composition of the nanoparticles was determined by SEM, XPS and EDX. We also proposed the mechanism of reduction of gold(III) oxide based on MS, IR and NMR data. Importantly, the synthetic protocol is general and applicable for the preparation of other coinage metal nanoparticles from the corresponding metal oxides. For instance, we demonstrated that the absence of halogen enables efficient alloying of metals when preparing gold–silver bimetallic nanoparticles.
Structure and bonding in gold compounds
International Nuclear Information System (INIS)
Parish, R.V.
1988-01-01
Recent developments in chemical applications of 197 Au Moessbauer spectroscopy are reviewed. For gold(I) and gold(III), systematic variations in isomer shift and quadrupole splitting are seen as the ligands are changed; the effects of change in coordination number of the gold atoms are also systematic. Data for gold(II) systems involving gold-gold bonds lie between those for corresponding gold(I) and gold(III) materials, showing a small increase in isomer shift and a larger increase in quadrupole splitting as the oxidation state decreases; these trends are explained in terms of the structures. Data for mixed-metal cluster compounds are much more sensitive to structural effects than in homonuclear clusters. Both sets of data show systematic changes with increase in the number of metal atoms to which the gold atom is bound. The connectivity also influences the recoil-free fraction. (orig.)
POX 186: A Dwarf Galaxy in the Process of Formation?
Corbin, Michael R.; Vacca, William D.
2002-12-01
We present deep U-, V-, and I-band images of the ``ultracompact'' blue dwarf galaxy POX 186 obtained with the Planetary Camera 2 of the Hubble Space Telescope. We have also obtained a near-ultraviolet spectrum of the object with the Space Telescope Imaging Spectrograph and combine this with a new ground-based optical spectrum. The images confirm the galaxy to be extremely small, with a maximum extent of only 300 pc, a luminosity of ~10-4L*, and an estimated mass of ~107 Msolar. Its morphology is highly asymmetric, with a tail of material on its western side that may be tidal in origin. The U-band image shows this tail to be part of a stream of material in which stars have recently formed. Most of the star formation in the galaxy is, however, concentrated in a central, compact (d~10-15 pc) star cluster. We estimate this cluster to have a total mass of ~105 Msolar, to be forming stars at a rate of less than 0.05 yr-1, and to have a maximum age of a few million years. The outer regions of the galaxy are significantly redder than the cluster, with V-I colors consistent with a population dominated by K and M stars. From our analysis of the optical spectrum we find the galaxy to have a metallicity Z~=0.06 Zsolar and to contain a significant amount of internal dust [E(B-V)~=0.28] both values agree with previous estimates. While these results rule out earlier speculation that POX 186 is a protogalaxy, its morphology, mass, and active star formation suggest that it represents a recent (within ~108 yr) collision between two clumps of stars of subgalactic size (~100 pc). POX 186 may thus be a very small dwarf galaxy that, dynamically speaking, is still in the process of formation. This interpretation is supported by the fact that it resides in a void, so its morphology cannot be explained as the result of an encounter with a more massive galaxy. Clumps of stars this small may represent the building blocks required by hierarchical models of galaxy formation, and these results
12 CFR 303.186 - Exemptions from insurance requirements for a state branch of a foreign bank.
2010-01-01
... availability of credit to all sectors of the United States economy, including the international trade finance... CORPORATION PROCEDURE AND RULES OF PRACTICE FILING PROCEDURES International Banking § 303.186 Exemptions from...
Knowledge-driven GIS modeling technique for gold exploration, Bulghah gold mine area, Saudi Arabia
Directory of Open Access Journals (Sweden)
Ahmed A. Madani
2011-12-01
Full Text Available This research aims to generate a favorability map for gold exploration at the Bulghah gold mine area using integration of geo-datasets within a GIS environment. Spatial data analyses and integration of different geo-datasets are carried out based on knowledge-driven and weighting technique. The integration process involves the weighting and scoring of different layers affecting the gold mineralization at the study area using the index overlay method within PCI Geomatica environment. Generation of the binary predictor maps for lithology, lineaments, faults and favorable contacts precede the construction of the favorability map. About 100 m buffer zones are generated for favorable contacts, lineaments and major faults layers. Internal weighting is assigned to each layer based on favorability for gold mineralization. The scores for lithology, major faults, lineaments and favorable contacts layers in the constructed favorability map are 50%, 25%, 10% and 15%, respectively. Final favorability map for the Bulghah gold mine area shows the recording of two new sites for gold mineralization located at the northern and southern extensions of tonalite–diorite intrusions. The northern new site is now exploited for gold from the Bulghah North mine. The southern new site is narrow and small; its rocks resemble those of the Bulghah gold mine.
Energy Technology Data Exchange (ETDEWEB)
Orlova, Anna; Tran, Thuy A. [Uppsala University, Division of Biomedical Radiation Sciences, Rudbeck Laboratory, Uppsala (Sweden); Ekblad, Torun; Karlstroem, Amelie Eriksson [Royal Institute of Technology, School of Biotechnology, Division of Molecular Biotechnology, Stockholm (Sweden); Tolmachev, Vladimir [Uppsala University, Division of Biomedical Radiation Sciences, Rudbeck Laboratory, Uppsala (Sweden); Uppsala University, Division of Nuclear Medicine, Department of Medical Sciences, Uppsala (Sweden)
2010-02-15
Affibody molecules are a novel class of tumour-targeting proteins, which combine small size (7 kDa) and picomolar affinities. The Affibody molecule Z{sub HER2:342} has been suggested for imaging of HER2 expression in order to select patients for trastuzumab therapy. When optimizing chelators for {sup 99m}Tc-labelling, we have found that synthetic Z{sub HER2:342} conjugated with mercaptoacetyl-glycyl-glycyl-glycyl (maGGG) and mercaptoacetyl-glycyl-seryl-glycyl (maGSG) chelators provides relatively low renal uptake of radioactivity and could be suitable for therapy. maGGG-Z{sub HER2:342} and maGSG-Z{sub HER2:342} were labelled with {sup 186}Re and their biodistribution was studied in normal mice. Dosimetric evaluation and tumour targeting to HER2-overexpressed xenografts (SKOV-3) by {sup 186}Re-maGSG-Z{sub HER2:342} were studied. Gluconate-mediated labelling of maGGG-Z{sub HER2:342} and maGSG-Z{sub HER2:342} with {sup 186}Re provided a yield of more than 95% within 60 min. The conjugates were stable and demonstrated specific binding to HER2-expressing SKOV-3 cells. Biodistribution in normal mice demonstrated rapid blood clearance, low accumulation of radioactivity in the kidney and other organs, accumulating free perrhenate. Both {sup 186}Re-maGGG-Z{sub HER2:342} and {sup 186}Re-maGSG-Z{sub HER2:342} demonstrated lower renal uptake than their {sup 99m}Tc-labelled counterparts. {sup 186}Re-maGSG-Z{sub HER2:342} provided the lowest uptake in healthy tissues. Biodistribution of {sup 186}Re-maGSG-Z{sub HER2:342} in nude mice bearing SKOV-3 xenografts showed specific targeting of tumours. Tumour uptake 24 h after injection (5.84{+-}0.54%ID/g) exceeded the concentration in blood by more than 500-fold, and uptake in kidneys by about 8-fold. Preliminary dosimetric evaluation showed that dose-to-tumour should exceed dose-to-kidney by approximately 5-fold. Optimization of chelators improves biodistribution properties of rhenium-labelled small scaffold proteins and enables
Determination of Gold from Gold Matrix of North Western Nigeria ...
African Journals Online (AJOL)
The research paper presents analytical results of Au, Mn and V concentrations of some Nigerian gold ores using two techniques: epithermal neutron activation analysis (ENAA) and proton induced X-ray emission (PIXE). Fourteen samples were collected from gold fields of North Western Nigeria, prepared separately to a ...
Directory of Open Access Journals (Sweden)
Haoyou Wang
2017-04-01
Full Text Available Background/Aims: Long non-coding RNAs (lncRNAs are key players in the development and progression of human cancers. The lncRNA XIST (X-inactive specific transcript has been shown to be upregulated in human non-small cell lung cancer (NSCLC; however, its role and molecular mechanisms in NSCLC cell progression remain unclear. Methods: qRT-PCR was conducted to assess the expression of XIST and miR-186. Cell proliferation was detected using MTT assay. Cell invasion and migration were evaluated using transwell assay. Cell cycle distribution and apoptosis rates were analyzed by flow cytometry. Luciferase reporter assay was used to identify the direct regulation of XIST and miR-186. A RNA immunoprecipitation was used to analyze whether XIST was associated with the RNA-induced silencing complex (RISC. Results: We confirmed that XIST was upregulated in NSCLC cell lines and tissues. Functionally, XIST knockdown inhibited cancer cell proliferation and invasion, and induced apoptosis in vitro, and suppressed subcutaneous tumor growth in vivo. Mechanistic investigations revealed a reciprocal repressive interaction between XIST and miR-186-5p. Furthermore, we showed that miR-186-5p has a binding site for XIST. Our data also indicated that XIST and miR-186-5p are likely in the same RNA induced silencing complex. Conclusion: Together, our data revealed that XIST knockdown confers suppressive function in NSCLC and XIST may be a novel therapeutic marker in this disease.
Analysis of gold(I/III)-complexes by HPLC-ICP-MS demonstrates gold(III) stability in surface waters.
Ta, Christine; Reith, Frank; Brugger, Joël; Pring, Allan; Lenehan, Claire E
2014-05-20
Understanding the form in which gold is transported in surface- and groundwaters underpins our understanding of gold dispersion and (bio)geochemical cycling. Yet, to date, there are no direct techniques capable of identifying the oxidation state and complexation of gold in natural waters. We present a reversed phase ion-pairing HPLC-ICP-MS method for the separation and determination of aqueous gold(III)-chloro-hydroxyl, gold(III)-bromo-hydroxyl, gold(I)-thiosulfate, and gold(I)-cyanide complexes. Detection limits for the gold species range from 0.05 to 0.30 μg L(-1). The [Au(CN)2](-) gold cyanide complex was detected in five of six waters from tailings and adjacent monitoring bores of working gold mines. Contrary to thermodynamic predictions, evidence was obtained for the existence of Au(III)-complexes in circumneutral, hypersaline waters of a natural lake overlying a gold deposit in Western Australia. This first direct evidence for the existence and stability of Au(III)-complexes in natural surface waters suggests that Au(III)-complexes may be important for the transport and biogeochemical cycling of gold in surface environments. Overall, these results show that near-μg L(-1) enrichments of Au in environmental waters result from metastable ligands (e.g., CN(-)) as well as kinetically controlled redox processes leading to the stability of highly soluble Au(III)-complexes.
International Nuclear Information System (INIS)
Husak, V.; Myslivecek, M.
1995-01-01
The aim of this paper was to assess whether the ambulatory (outpatient) therapy with 186 Re-HEDP and 153 Sm-EDTMP is possible in the Czech Republic. Physical characteristics, administered activity, biokinetics of radiopharmaceuticals, radiation protection characteristics, irradiation of patients relatives as well as comparison with limits for rhenium-186 and samarium-153 radiopharmaceuticals are given. The outpatient administration of 186 Re-HEDP and 153 Sm-EDTMP with the subsequent keeping the patient for 6 hours in a department of nuclear medicine appears to be in compliance with regulations proposed in the Czech Republic as well as ICRP Recommendations. (J.K.) 1 tab., 12 refs
Energy Technology Data Exchange (ETDEWEB)
Husak, V; Myslivecek, M [Univ. Hospital, Olomouc (Czech Republic). Department of Nuclear Medicine
1996-12-31
The aim of this paper was to assess whether the ambulatory (outpatient) therapy with {sup 186}Re-HEDP and {sup 153}Sm-EDTMP is possible in the Czech Republic. Physical characteristics, administered activity, biokinetics of radiopharmaceuticals, radiation protection characteristics, irradiation of patients relatives as well as comparison with limits for rhenium-186 and samarium-153 radiopharmaceuticals are given. The outpatient administration of {sup 186}Re-HEDP and {sup 153}Sm-EDTMP with the subsequent keeping the patient for 6 hours in a department of nuclear medicine appears to be in compliance with regulations proposed in the Czech Republic as well as ICRP Recommendations. (J.K.) 1 tab., 12 refs.
2013-07-19
...-01] Announcing Approval of Federal Information Processing Standard 186-4, Digital Signature Standard.... SUMMARY: This notice announces the Secretary of Commerce's approval of Federal Information Processing... changes are effective on July 19, 2013. FOR FURTHER INFORMATION CONTACT: Elaine Barker (301) 975-2911...
Directory of Open Access Journals (Sweden)
Jiankang Jin
2014-01-01
Full Text Available Five gold stocks in Chinese Shanghai and Shenzhen A-share and Comex gold futures are chosen to form the sample, for the purpose of analysing the impact of the fluctuation of the international gold prices on the gold stocks in Chinese Shanghai and Shenzhen A-share. Using the methods of unit root test, Granger causality test, VAR model, and impulse response function, this paper has analysed the relationship between the price change of the international gold futures and the price fluctuation of gold stocks in Chinese Shanghai and Shenzhen comprehensively. The results suggest the fluctuation of the international gold futures has a strong influence on the domestic futures.
Formation of gold nanorods and gold nanorod films for surface-enhanced Raman scattering spectroscopy
International Nuclear Information System (INIS)
Trotsyuk, L.L.; Kulakovich, O.S.; Shabunya-Klyachkovskaya, E.V.; Gaponenko, S.V.; Vashchenko, S.V.
2016-01-01
The formation of gold nanorods as well as thin films prepared via electrostatic deposition of gold nanorods has been investigated. The obtained gold nanorods films have been used as substrates for the surface-enhanced Raman scattering analysis of sulfur-free organic molecules mitoxantrone and malachite green as well as inorganic malachite microcrystals for the first time. The additional modification of films with L-cysteine allows one to significantly extend the use of gold nanorods for the surface-enhanced Raman scattering analysis. (authors)
Metallic gold beads in hyaluronic acid
DEFF Research Database (Denmark)
Pedersen, Dan Sonne; Tran, Thao Phuong; Smidt, Kamille
2013-01-01
. In conclusion, our findings support that bio-liberation of gold from metallic gold surfaces have anti-inflammatory properties similar to classic gold compounds, warranting further studies into the pharmacological potential of this novel gold-treatment and the possible synergistic effects of hyaluronic acid....... by exploiting macrophage-induced liberation of gold ions (dissolucytosis) from gold surfaces. Injecting gold beads in hyaluronic acid (HA) as a vehicle into the cavities of the brain can delay clinical signs of disease progression in the MS model, experimental autoimmune encephalitis (EAE). This study...... investigates the anti-inflammatory properties of metallic gold/HA on the gene expression of tumor necrosis factor (Tnf-α), Interleukin (Il)-1β, Il-6, Il-10, Colony-stimulating factor (Csf)-v2, Metallothionein (Mt)-1/2, Bcl-2 associated X protein (Bax) and B cell lymphoma (Bcl)-2 in cultured J774 macrophages...
AdVEGF-B186 and AdVEGF-DΔNΔC induce angiogenesis and increase perfusion in porcine myocardium.
Nurro, Jussi; Halonen, Paavo J; Kuivanen, Antti; Tarkia, Miikka; Saraste, Antti; Honkonen, Krista; Lähteenvuo, Johanna; Rissanen, Tuomas T; Knuuti, Juhani; Ylä-Herttuala, Seppo
2016-11-01
Coronary heart disease remains a significant clinical problem, and new therapies are needed especially for patients with refractory angina for whom the current therapies do not provide sufficient relief. The aim of this study was to find out if angiogenic gene therapy using new members of the vascular endothelial growth factor (VEGF) family, VEGF-B 186 and VEGF-D ΔNΔC , increase myocardial perfusion as measured by the positron emission tomography (PET) 15 O-imaging, and whether there would be coronary steal effect to the contralateral side. Furthermore, safety of intramyocardial angiogenic adenoviral gene transfer was evaluated. Intramyocardial adenoviral (Ad) VEGF-B 186 or AdVEGF-D ΔNΔC gene transfers were given endovascularly into the porcine posterolateral wall of the left ventricle (n=34). Six days later, PET 15 O-imaging for myocardial perfusion and coronary angiography were performed. AdVEGF-B 186 and AdVEGF-D ΔNΔC induced angiogenesis and increased total microvascular area 1.8-fold (95% CI 0.2 to 3.5) and 2.8-fold (95% CI 1.4 to 4.3), respectively. At rest, perfusion was maintained at normal levels, but at stress, relative perfusion was increased 1.4-fold (95% CI 1.1 to 1.7) for AdVEGF-B 186 and 1.3-fold (95% CI 1.0 to 1.7) for AdVEGF-D ΔNΔC , without causing coronary steal effect in the control area. The therapy was well tolerated and did not lead to any significant changes in laboratory safety parameters. Both AdVEGF-B 186 and AdVEGF-D ΔNΔC gene transfers induced efficient angiogenesis in the myocardium resulting in an increased myocardial perfusion measured by PET. Importantly, local perfusion increase did not induce any coronary steal effect. As such, both treatments seem suitable new candidates for the induction of therapeutic angiogenesis for the treatment of refractory angina. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
A study on gold detection in Wenyu gold mine with XRF techniques
International Nuclear Information System (INIS)
Liu Liuchun
1988-01-01
A portable X ray fluorescence analyzer was used for detecting fluorcescent X rays from the elements associated with gold ores. Fe, As and Ni were chosen to be the indicator elements to analyse rock samples in Wenyu gold mine. Optimum indicators were determined, and it had proved to be successful to detect gold indirectly by measuring the yields of characteristic X rays of the elements. The method provided also valuable information on geology mapping and deposits forming environment
Energy Technology Data Exchange (ETDEWEB)
Wall, N.C.; Hughes-Narborough, C.; Willey, G. [Davy (Stockton) Ltd., Stockton-on-Tees (United Kingdom)
1994-11-01
Coal Gold Agglomeration (CGA) was developed by BP Minerals and involves the selective recovery of oleophilic gold particles from an aqueous slurry into coal-oil agglomerates. These agglomerates are allowed to build up to a high gold loading and are then separated from the slurry. The loaded agglomerates are burned and the gold is finally recovered from the ash residue by dissolution and precipitation or by direct smelting. 6 figs.
Annealing relaxation of ultrasmall gold nanostructures
Chaban, Vitaly
2015-01-01
Except serving as an excellent gift on proper occasions, gold finds applications in life sciences, particularly in diagnostics and therapeutics. These applications were made possible by gold nanoparticles, which differ drastically from macroscopic gold. Versatile surface chemistry of gold nanoparticles allows coating with small molecules, polymers, biological recognition molecules. Theoretical investigation of nanoscale gold is not trivial, because of numerous metastable states in these systems. Unlike elsewhere, this work obtains equilibrium structures using annealing simulations within the recently introduced PM7-MD method. Geometries of the ultrasmall gold nanostructures with chalcogen coverage are described at finite temperature, for the first time.
Vishiti, A.; Suh, C. E.; Lehmann, B.; Egbe, J. A.; Shemang, E. M.
2015-11-01
The Batouri area hosts lode-gold mineralization under several-m-thick lateritic cover. Pitting to bed rock on a geochemical Au anomaly defined from previous reconnaissance soil sampling identified five horizons ranging from saprock at the base to laterite at the top. Analysis of bulk samples from each horizon by fire assay shows that most of the horizons are barren although 119 ppb and 48 ppb Au values were obtained from one laterite horizon and one saprolite horizon, respectively, from two separate pits. All the horizons were panned and particulate gold was also recovered only from these two horizons. The gold grains from both horizons are morphologically and compositionally indistinguishable with rare quartz, pyrite and galena inclusions. The grains have irregular, sub-rounded, bean to elongated shapes and they show a remarkable core-rim zonation. Electron microprobe analysis of the grains recorded high gold content in the rims (86.3-100 wt%) and along fissures within the grains (95.1-100 wt%). The cores are relatively Ag rich (11.8-14 wt% Ag) while the rims (0.63-13.7 wt% Ag, most of the values fall within the lower limit of this range) and fissures (0.03-5.02 wt% Ag) are poor in Ag. The low Ag concentration in the rims and along fissures is attributed to preferential leaching of Ag; a process recognized in gold grains and platiniferous alloys from alluvia. The core composition of the grains is similar to that of primary gold composition in the bedrock. These results show that gold in the soil is relic particulate gold derived from the primary source with no evidence of secondary gold precipitation in the weathering cycle. In all the pits no horizon was systematically enriched in gold suggesting there has been no chemical remobilization of gold in this environment. Rather the dispersion of gold here is in the particulate form. Therefore combining particulate gold features with assay data is relevant to exploration in such tropical environments.
International Nuclear Information System (INIS)
Ahmed, K.; Dampare, S.B.; Addo, M.A.; Osae, S.; Adotey, D.K.; Adomako, D.
2005-01-01
A novel method has been developed for processing and extraction of gold from gold bearing rocks for use by small-scale gold miners in Ghana. The methodology involved crushing of gold bearing hard rocks to fine particles to form a composite sample and screening at a range of sizes. Gold distribution in the composite sample was determined as a function of particle size by using Instrumental Neutron Activation Analysis. The concentrations of gold for the corresponding particle sizes were 16.4 ± 0.17mg/kg for sizes <63μm; 161± 0.75 mg/kg for 63 - 125 μm, 0.53 + 0.03 mg/kg for 125 - 250 μm, 4.66± 0.07 mg/kg for 250 - 355 μm, 1.55 ± 0.06 for 355 - 425 μm, 0.80 ± 0.008 mg/kg for 425 -1000 μm, and 1.27 + 0.05 mg/kg for 1000-2000 μm. The average gold content in a 7.127 kg composite sample based on particle size found to be 3.08 mg/kg. (au)
International Nuclear Information System (INIS)
James, G.S.; Davidson, R.J.
1977-01-01
A process for extracting gold and uranium from an ore containing them both comprising the steps of pulping the finely comminuted ore with a suitable cyanide solution at an alkaline pH, acidifying the pulp for uranium dissolution, adding carbon activated for gold recovery to the pulp at a suitable stage, separating the loaded activated carbon from the pulp, and recovering gold from the activated carbon and uranium from solution
International Nuclear Information System (INIS)
Zafeirakis, Athanasios; Papatheodorou, Georgios; Arhontakis, Athanasios; Gouliamos, Athanasios; Vlahos, Lambros; Limouris, Georgios S.
2010-01-01
To prospectively evaluate the predictive value of various bone formation and resorption markers in patients with bone metastases from prostate cancer after palliative treatment with 186 Re-1,1-hydroxyethylidene diphosphonate ( 186 Re-HEDP). Included in the study were 36 men with prostate cancer, suffering from painful osseous metastases and treated with 186 Re-HEDP. None had received any treatment that would have interfered with bone metabolism before 186 Re-HEDP treatment or throughout the follow-up period. For each patient, pretreatment and posttreatment serum levels of osteocalcin (OC), bone alkaline phosphatase (BALP), aminoterminal (PINP) and carboxyterminal (PICP) propeptides of type I collagen, amino-terminal (NTx) and carboxyterminal (CTx) telopeptides of type I collagen and their combinations were compared with the level and duration of pain response to radionuclide treatment. Pain response was correlated only with pretreatment ΝΤx/PINP, PICP/PINP and NTx/CTx ratios and posttreatment decrease in baseline NTx and PICP values (p=0.0025-0.035). According to multivariate and ROC analyses, the best marker-derived predictors of better and longer duration of response to 186 Re-HEDP treatment were a posttreatment decrease in NTx of ≥20% (RR=3.44, p=0.0005) and a pretreatment NTx/PINP ratio of ≥1.2 (RR=3.04, p=0.036) NTx, a potent collagenous marker of bone resorption, along with the novel NTx/PINP ratio provide useful cut-off values for identifying a group of patients suffering from painful osseous metastases from hormone-refractory prostatic carcinoma who do not respond to palliative treatment with 186 Re-HEDP. This information could help avoid an inefficient and expensive radionuclide treatment. Also, in the cohort of patients who will eventually undergo such treatment, the medium-term posttreatment changes in NTx offer valuable predictive information regarding long-term palliative response. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Marquez L, M B [Universidad Autonoma del Estado de Mexico. Facultad de Quimica. Toluca (Mexico)
1998-06-01
Among the radiopharmaceuticals used for neoplasia, we can find the dimercaptosuccinic acid (Dmsa) labelled with {sup 99m} Tc and {sup 186/188} Re. Initially, the {sup 99m} Tc-(III)-Dmsa was employed as a renal image agent. Nevertheless, when it is prepared into a basic solution, the {sup 99m} Tc-(V)-Dmsa complex is produced in high yield being cumulated by cells with a great metabolic activity. This property makes it a useful radiopharmaceutical for the detection of medullary thyroid carcinoma (MTC), soft-tissue tumors and other head and neck tumors. On the other hand, the renewed interest in {beta} - emitting radionuclides, suggests that the {sup 186} Re-(V)-Dmsa complex could be used as antineoplastic agent in therapy. However, the techniques reported for the preparation of these compounds lack of stability studies and they are still in process of investigation, compromising to continue on the development of the radiopharmaceuticals by introducing new possibilities for better products already known, obtaining in this way, the approximation to the ideal radiopharmaceutical. The objective of this work is to design a freeze dried kit formulation for the instant preparation of {sup 99m} Tc-(V)-Dmsa and {sup 186} Re-(V)-Dmsa complexes useful in the diagnostic and therapy of soft-tissue tumors and other head and neck tumors. We obtained a freeze dried stable formulation for the preparation of {sup 99m} Tc-(V)-Dmsa kit with a radiochemical purity higher than 90 %, which fulfills with the quality control of radiopharmaceuticals. Furthermore, we developed analytical techniques for the determination of the different chemical compounds into the lyophilized kit. On the other hand, we obtained the optimum conditions for preparation of {sup 186} Re-(V)-Dmsa complex in high radiochemical yields (>90%). (Author).
Free gold recovery by coal-oil agglomeration
Energy Technology Data Exchange (ETDEWEB)
Kotze, W.; Petersen, F.W. [Cape Technikon Cape Town (South Africa). Dept. of Chemical Engineering
2000-02-01
The gold mining industry has mainly relied upon the use of highly polluting chemicals, such as mercury and cyanide to recover gold from its ores. The Coal Gold Agglomeration (CGA) process was developed some years ago and has the advantage in that gold is recovered by a procedure which has little or no negative impact on the environment. A gold ore containing liberated gold particles is contacted with coal-oil agglomerates, whereby the gold is recovered into the coal/oil phase. Laboratory scale batch tests were performed on an artificial mixture gold slurry and gold recoveries of up to 85% were found under optimized conditions. By recycling the coal/oil phase, it was found that the gold loading onto the agglomerates was increased. Tests performed on an industrial ore yielded slightly lower gold recoveries, and X-ray Diffraction (XRD) analysis on the coal/oil phase showed that minerals other than gold were recovered into this phase. A comparative study was conducted whereby the CGA process was compared to mercury amalgamation. Gold recoveries obtained through amalgamation were 15% lower than by the agglomeration process, which indicates that this process can be considered favourably as an alternative to amalgamation. 16 refs., 2 figs., 6 tabs.
Spectroscopic diagnostic of gold plasma
Energy Technology Data Exchange (ETDEWEB)
Busquet, M.
1986-06-01
Results of a simulation of a gold-aluminium alloy target irradiated by laser are presented. FCI code has been used with a processing out of LTE of atomic physics of gold and of multigroup photonics. Emission and reabsorption of gold and aluminium lines are included.
Activation analysis in gold industry
International Nuclear Information System (INIS)
Kist, A. A.
2003-01-01
Nuclear techniques and methods were, are, and will be very important for many fields of science, agriculture, industry, etc. Among other examples one can remember role of the nuclear medicine (radiotherapy and radiodiagnostic methods) or semiconductors (communication, computing, information, etc.) which industrial production has been on initial stage based on activation analysis. One of very illustrative examples is application of nuclear methods in gold industry. This is given by favorable nuclear properties of gold. Uzbekistan is one of the main producers of gold. Open-cast mining and hydro metallurgic extraction (using leaching by cyanide and sorption by ion-exchange resin) is the mostly used technology. The typical gold ores are sulfide and contain elevated concentration of As and Sb. That needs special technology of gold extraction. Importance of gold for Uzbekistan economy is a reason why for many years there are carried out studies concerning to gold production. These studies include also nuclear methods and their results are successfully used in gold industry. The present paper gives a brief overview for period of 25 years. For many reasons most of these studies were not published before completely. Despite some results are obtained decades ago we decided to present the overview as an example how nuclear methods can cover requirements of the whole process. We are trying to sort these studies according to methods and applications
Directory of Open Access Journals (Sweden)
Arifudin Idrus
2014-06-01
Full Text Available DOI: 10.17014/ijog.v6i1.114In 2008, placer gold was discovered in Langkowala area (Bombana Regency, Southeast Sulawesi, Indonesia, and more than 60,000 traditional gold miners in the early 2009 have been operating by digging vertical pits and panning active stream sediments. The grade of placer gold ranges from 50 to 140 g/t. Local geological framework indicates that the placer gold is not related to volcanic rock-related hydrothermal gold deposit, e.g. epithermal, skarn or porphyry. This paper describes a preliminary study on possible primary deposit type as a source of the Langkowala (Bombana secondary placer gold. A field study indicates that the Langkowala (Bombana placer/paleoplacer gold is possibly related to gold-bearing quartz veins/veinlets hosted by metamorphic rocks particularly mica schist and metasediments in the area. These quartz veins/veinlets are currently recognized in metamorphic rocks at Wumbubangka Mountains, a northern flank of Rumbia Mountain Range. Sheared, segmented quartz veins/veinlets are of 2 cm to 2 m in width and contain gold in a grade varying between 2 and 61 g/t. At least, there are two generations of the quartz veins. The first generation of quartz vein is parallel to foliation of mica schist and metasediments with general orientation of N 300oE/60o; the second quartz vein generation crosscut the first quartz vein and the foliation of the wallrock. The first quartz veins are mostly sheared/deformed, brecciated, and occasionally sigmoidal, whereas the second quartz veins are relatively massive. The similar quartz veins/veinlets types are also probably present in Mendoke Mountain Range, in the northern side of Langkowala area. This primary gold deposit is called as ‘orogenic gold type’. The orogenic gold deposit could be a new target of gold exploration in Indonesia in the future.
Low energy excitations in superconducting La1.86Sr0.14CuO4
DEFF Research Database (Denmark)
Mason, T.E.; Aeppli, G.; Hayden, S.M.
1993-01-01
We present magnetic neutron scattering and specific heat data on the high-T(c) superconductor La1.86Sr0.14CuO4. Even when the samples are superconducting and the magnetic response, chi'', is suppressed, there are excitations with energies well below 3.5k(B)T(c). The wave-vector dependence of chi...
International Nuclear Information System (INIS)
Parish, R.V.; Cottrill, S.M.
1987-01-01
A major use of gold compounds in the pharmaceutical industry is for anti-arthritic agents. The disease itself is not understood and little is known about the way in which the drugs act, but detailed pictures of the distribution of gold in the body are available, and some of the relevant biochemistry is beginning to emerge. The purpose of this article is to give a survey of the types of compounds presently employed in medicine, of the distribution of gold in the body which results from their use, and of some relevant chemistry. Emphasis is placed on results obtained in the last few years
Spectroscopic diagnostic of gold plasma
International Nuclear Information System (INIS)
Busquet, M.
1986-01-01
Results of a simulation of a gold-aluminium alloy target irradiated by laser are presented. FCI code has been used with a processing out of LTE of atomic physics of gold and of multigroup photonics. Emission and reabsorption of gold and aluminium lines are included [fr
Design of a formulation for the preparation of 99m Tc-(V)-Dmsa and 186 Re-(V)-Dmsa
International Nuclear Information System (INIS)
Marquez L, M.B.
1998-01-01
Among the radiopharmaceuticals used for neoplasia, we can find the dimercaptosuccinic acid (Dmsa) labelled with 99m Tc and 186/188 Re. Initially, the 99m Tc-(III)-Dmsa was employed as a renal image agent. Nevertheless, when it is prepared into a basic solution, the 99m Tc-(V)-Dmsa complex is produced in high yield being cumulated by cells with a great metabolic activity. This property makes it a useful radiopharmaceutical for the detection of medullary thyroid carcinoma (MTC), soft-tissue tumors and other head and neck tumors. On the other hand, the renewed interest in β - emitting radionuclides, suggests that the 186 Re-(V)-Dmsa complex could be used as antineoplastic agent in therapy. However, the techniques reported for the preparation of these compounds lack of stability studies and they are still in process of investigation, compromising to continue on the development of the radiopharmaceuticals by introducing new possibilities for better products already known, obtaining in this way, the approximation to the ideal radiopharmaceutical. The objective of this work is to design a freeze dried kit formulation for the instant preparation of 99m Tc-(V)-Dmsa and 186 Re-(V)-Dmsa complexes useful in the diagnostic and therapy of soft-tissue tumors and other head and neck tumors. We obtained a freeze dried stable formulation for the preparation of 99m Tc-(V)-Dmsa kit with a radiochemical purity higher than 90 %, which fulfills with the quality control of radiopharmaceuticals. Furthermore, we developed analytical techniques for the determination of the different chemical compounds into the lyophilized kit. On the other hand, we obtained the optimum conditions for preparation of 186 Re-(V)-Dmsa complex in high radiochemical yields (>90%). (Author)
Spherical aggregates composed of gold nanoparticles
International Nuclear Information System (INIS)
Chen, C-C; Kuo, P-L; Cheng, Y-C
2009-01-01
Alkylated triethylenetetramine (C12E3) was synthesized and used as both a reductant in the preparation of gold nanoparticles by the reduction of HAuCl 4 and a stabilizer in the subsequent self-assembly of the gold nanoparticles. In acidic aqueous solution, spherical aggregates (with a diameter of about 202 ± 22 nm) of gold nanoparticles (with the mean diameter of ∼18.7 nm) were formed. The anion-induced ammonium adsorption of the alkylated amines on the gold nanoparticles was considered to provide the electrostatic repulsion and steric hindrance between the gold nanoparticles, which constituted the barrier that prevented the individual particles from coagulating. However, as the amino groups became deprotonated with increasing pH, the ammonium adsorption was weakened, and the amino groups were desorbed from the gold surface, resulting in discrete gold particles. The results indicate that the morphology of the reduced gold nanoparticles is controllable through pH-'tunable' aggregation under the mediation of the amino groups of alkylated amine to create spherical microstructures.
Preliminary measurements of k{sub 0} values for W-186
Energy Technology Data Exchange (ETDEWEB)
Barros, Lívia F.; Dias, Mauro S.; Koskinas, Marina F.; Yamazaki, Ione M.; Semmler, Renato, E-mail: lfbarros@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNE-SP), Sao Paulo, SP (Brazil)
2017-07-01
There are various methods of neutron activation analysis, one of these is the k{sub 0} Method for quantitative reactor Neutron Activation Analysis (NAA). The k{sub 0}-NAA procedure is nowadays widely used in numerous laboratories performing NAA all over the world. Among these reactions, {sup 186}W(n, γ){sup 187}W can be considered important because it can be used for a W concentration measurements. The irradiations were performed at position 24A, near the core of the IEA-R1 4.5 MW swimming-pool nuclear research reactor of the Instituto de Pesquisas Energeticas e Nucleares (IPEN-CNEN/SP - Nuclear and Energy Research Institute), in Sao Paulo, Brazil. Two irradiations were carried out in sequence, using two sets of samples: the first with a cadmium cover around the samples and the second without, in a total of three data sets with and without Cd cover performed in 2014 and 2015. The activity measurements were carried out in an HPGe gamma-ray spectrometer. Standard sources of {sup 152}Eu, {sup 133}Ba, {sup 60}Co and {sup 137}Cs supplied by the IAEA were used in order to obtain the HPGe gamma-ray peak efficiency as a function of the energy. The covariance matrix methodology was applied to all uncertainties involved. The preliminary values of k{sub 0} for {sup 186}W(n, γ){sup 187}W reaction for the gamma transition energy of 479.53 keV was 3.17 x 10{sup -2}(5), for 618.77 keV was 9.08 x 10{sup -3}(15) and for 685.77 keV was 3.88x10{sup -2}(6). These preliminary values for k{sub 0} have been compared with the literature. (author)
['Gold standard', not 'golden standard'
Claassen, J.A.H.R.
2005-01-01
In medical literature, both 'gold standard' and 'golden standard' are employed to describe a reference test used for comparison with a novel method. The term 'gold standard' in its current sense in medical research was coined by Rudd in 1979, in reference to the monetary gold standard. In the same
2010-07-01
... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Gold. 101-45.002 Section... PERSONAL PROPERTY § 101-45.002 Gold. (a) Gold will be sold in accordance with this section and part 102-38 of the Federal Management Regulation. (b) Sales of gold shall be processed to— (1) Use the sealed bid...
Poly-thiosemicarbazide Membrane for Gold Adsorption and In-situ Growth of Gold Nanoparticles
Parra, Luis F.
2012-12-01
In this work the synergy between a polymer containing chelate sites and gold ions was explored by the fabrication of a polymeric membrane with embedded gold nanoparticles inside its matrix and by developing a process to recover gold from acidic solutions. After realizing that the thiosemicarbazide groups present in the monomeric unit of poly-thiosemicarbazide (PTSC) formed strong complexes with Au ions, membrane technology was used to exploit this property to its maximum. The incorporation of metal nanoparticles into polymeric matrices with current technologies involves either expensive and complicated procedures or leads to poor results in terms of agglomeration, loading, dispersion, stability or efficient use of raw materials. The fabrication procedure described in this thesis solves these problems by fabricating a PTSC membrane containing 33.5 wt% in the form of 2.9 nm gold nanoparticles (AuNPs) by a three step simple and scalable procedure. It showed outstanding results in all of the areas mentioned above and demonstrated catalytic activity for the reduction of 4-Nitrophenol (4−NP) to 4-Aminophenol (4−AP). The current exponential demand of gold for electronics has encouraged the development of efficient processes to recycle it. Several adsorbents used to recover gold from acidic solutions can be found in the literature with outstanding maximum uptakes,yet, poor kinetics leading to an overall inefficient process. The method developed in this dissertation consisted in permeating the gold-containing solution through a PTSC membrane that will capture all the Au ions by forming a metal complex with them. Forcing the ions through the pores of the membrane eliminates the diffusion limitations and the adsorption will only depended on the fast complexation kinetics, resulting in a very efficient process. A flux as high as 1868 L/h m2 was enough to capture >90% of the precious metal present in a solution of 100 ppm Au. The maximum uptake achieved without sacrificing
Gold mineralogy and extraction
International Nuclear Information System (INIS)
Cashion, J.D.; Brown, L.J.
1998-01-01
Several examples are examined in which Moessbauer spectroscopic analysis of gold mineral samples, treated concentrates and extracted species has provided information not obtainable by competing techniques. Descriptions are given of current work on bacterial oxidation of pyritic ores and on the adsorbed species from gold extracted from cyanide and chloride solutions onto activated carbon and polyurethane foams. The potential benefits for the gold mining industry from Moessbauer studies and some limitations on the use of the technique are also discussed
Gold mineralogy and extraction
Energy Technology Data Exchange (ETDEWEB)
Cashion, J.D.; Brown, L.J. [Monash University, Physics Department (Australia)
1998-12-15
Several examples are examined in which Moessbauer spectroscopic analysis of gold mineral samples, treated concentrates and extracted species has provided information not obtainable by competing techniques. Descriptions are given of current work on bacterial oxidation of pyritic ores and on the adsorbed species from gold extracted from cyanide and chloride solutions onto activated carbon and polyurethane foams. The potential benefits for the gold mining industry from Moessbauer studies and some limitations on the use of the technique are also discussed.
Idrus, Arifudin; Nur, I; Warmada, I. W; Fadlin, Fadlin
2011-01-01
DOI: 10.17014/ijog.v6i1.114In 2008, placer gold was discovered in Langkowala area (Bombana Regency), Southeast Sulawesi, Indonesia, and more than 60,000 traditional gold miners in the early 2009 have been operating by digging vertical pits and panning active stream sediments. The grade of placer gold ranges from 50 to 140 g/t. Local geological framework indicates that the placer gold is not related to volcanic rock-related hydrothermal gold deposit, e.g. epithermal, skarn or porphyry. This pa...
Improving accuracy and reliability of 186-keV measurements for unattended enrichment monitoring
International Nuclear Information System (INIS)
Ianakiev, Kiril D.; Boyer, Brian D.; Swinhoe, Martyn T.; Moss, Cal E.; Goda, Joetta M.; Favalli, Andrea; Lombardi, Marcie; Paffet, Mark T.; Hill, Thomas R.; MacArthur, Duncan W.; Smith, Morag K.
2010-01-01
Improving the quality of safeguards measurements at Gas Centrifuge Enrichment Plants (GCEPs), whilst reducing the inspection effort, is an important objective given the number of existing and new plants that need to be safeguarded. A useful tool in many safeguards approaches is the on-line monitoring of enrichment in process pipes. One aspect of this measurement is a simple, reliable and precise passive measurement of the 186-keV line from 235 U. (The other information required is the amount of gas in the pipe. This can be obtained by transmission measurements or pressure measurements). In this paper we describe our research efforts towards such a passive measurement system. The system includes redundant measurements of the 186-keV line from the gas and separately from the wall deposits. The design also includes measures to reduce the effect of the potentially important background. Such an approach would practically eliminate false alarms and can maintain the operation of the system even with a hardware malfunction in one of the channels. The work involves Monte Carlo modeling and the construction of a proof-of-principle prototype. We will carry out experimental tests with UF 6 gas in pipes with and without deposits in order to demonstrate the deposit correction.
Energy Technology Data Exchange (ETDEWEB)
Zafeirakis, Athanasios [401 Army Hospital of Athens, Department of Nuclear Medicine, Athens (Greece); Papatheodorou, Georgios [401 Army Hospital of Athens, Clinical Research Unit, Athens (Greece); Arhontakis, Athanasios [401 Army Hospital of Athens, Department of Urology, Athens (Greece); Gouliamos, Athanasios; Vlahos, Lambros [Aretaieion University Hospital, Athens Medical School, Department of Radiology, Athens (Greece); Limouris, Georgios S. [Aretaieion University Hospital, Athens Medical School, Department of Nuclear Medicine, Athens (Greece)
2010-01-15
To prospectively evaluate the predictive value of various bone formation and resorption markers in patients with bone metastases from prostate cancer after palliative treatment with {sup 186}Re-1,1-hydroxyethylidene diphosphonate ({sup 186}Re-HEDP). Included in the study were 36 men with prostate cancer, suffering from painful osseous metastases and treated with {sup 186}Re-HEDP. None had received any treatment that would have interfered with bone metabolism before {sup 186}Re-HEDP treatment or throughout the follow-up period. For each patient, pretreatment and posttreatment serum levels of osteocalcin (OC), bone alkaline phosphatase (BALP), aminoterminal (PINP) and carboxyterminal (PICP) propeptides of type I collagen, amino-terminal (NTx) and carboxyterminal (CTx) telopeptides of type I collagen and their combinations were compared with the level and duration of pain response to radionuclide treatment. Pain response was correlated only with pretreatment {nu}{tau}x/PINP, PICP/PINP and NTx/CTx ratios and posttreatment decrease in baseline NTx and PICP values (p=0.0025-0.035). According to multivariate and ROC analyses, the best marker-derived predictors of better and longer duration of response to {sup 186}Re-HEDP treatment were a posttreatment decrease in NTx of {>=}20% (RR=3.44, p=0.0005) and a pretreatment NTx/PINP ratio of {>=}1.2 (RR=3.04, p=0.036) NTx, a potent collagenous marker of bone resorption, along with the novel NTx/PINP ratio provide useful cut-off values for identifying a group of patients suffering from painful osseous metastases from hormone-refractory prostatic carcinoma who do not respond to palliative treatment with {sup 186}Re-HEDP. This information could help avoid an inefficient and expensive radionuclide treatment. Also, in the cohort of patients who will eventually undergo such treatment, the medium-term posttreatment changes in NTx offer valuable predictive information regarding long-term palliative response. (orig.)
Measurement of 230Pa and 186Re Production Cross Sections Induced by Deuterons at Arronax Facility
Duchemin, Charlotte; Guertin, Arnaud; Metivier, Vincent; Haddad, Ferid; Michel, Nathalie
2014-02-01
A dedicated program has been launched on production of innovative radionuclides for PET imaging and for β- and α targeted radiotherapy using proton or α particles at the ARRONAX cyclotron. Since the accelerator is also able to deliver deuteron beams up to 35 MeV, we have reconsidered the possibility of using them to produce medical isotopes. Two isotopes dedicated to targeted therapy have been considered: 226Th, a decay product of 230Pa, and 186Re. The production cross sections of 230Pa and 186Re, as well as those of the contaminants created during the irradiation, have been determined by the stacked-foil technique using deuteron beams. Experimental values have been quantified using a referenced cross section. The measured cross sections have been used to determine expected production yields and compared with the calculated values obtained using the Talys code with default parameters.
Nanotoxicity of gold and gold-cobalt nanoalloy.
Girgis, E; Khalil, W K B; Emam, A N; Mohamed, M B; Rao, K V
2012-05-21
Nanotoxicology test of gold nanoparticles (Au NPs) and gold-cobalt (Au-Co) nanoalloy is an important step in their safety evaluation for biomedical applications. The Au and Au-Co NPs were prepared by reducing the metal ions using sodium borohydride (NaBH(4)) in the presence of polyvinyl pyrrolidone (PVP) as a capping material. The average size and shape of the nanoparticles (NPs) were characterized using high resolution transmission electron microscopy (HRTEM). Cobalt presence in the nanoalloy was confirmed by energy dispersive X-ray spectroscopy (EDX) analysis, and the magnetic properties of these particles were determined using a vibrating sample magnetometer (VSM). The Gold and gold-cobalt NPs of average size 15 ± 1.5 nm were administered orally to mice with a dose of 80, 160, and 320 mg/kg per body weight (bw) using gavages. Samples were collected after 7 and 14 days of the treatment. The results indicated that the Au-Co NPs were able to induce significant alteration in the tumor-initiating genes associated with an increase of micronuclei (MNs) formation and generation of DNA adduct (8-hydroxy-2-deoxyguanosine, 8-OHdG) as well as a reduction in the glutathione peroxidase activity. This action of Au-Co NPs was observed using 160 and 320 mg/kg bw at both time intervals. However, Au NPs had much lower effects than Au-Co NPs on alteration in the tumor-initiating genes, frequency of MNs, and generation of 8-OHdG as well as glutathione peroxidase activity except with the highest dose of Au NPs. This study suggests that the potential to cause in vivo genetic and antioxidant enzyme alterations due to the treatment by Au-Co nanoalloy may be attributed to the increase in oxidative stress in mice.
In harmony with gold and uranium
International Nuclear Information System (INIS)
Anon.
1983-01-01
A profile is given on Mr Clive Knobbs as managing director of Harmony gold mine. From March 1 1983 he succeeded as deputy chairman of the group's gold and uranium division, and became the Rand Mines representative on the Gold Producers Committee and the Executive Committee of the Chamber of Mines. The article also takes a look at gold and uranium mining in general
The extractive metallurgy of gold
Kongolo, K.; Mwema, M. D.
1998-12-01
Mössbauer spectroscopy has been successfully used in investigation of the gold compounds present in ores and the gold species which occur during the process metallurgy of this metal. This paper is a survey of the basic recovery methods and techniques used in extractive metallurgy of gold. Process fundamentals on mineral processing, ore leaching, zinc dust cementation, adsorption on activated carbon, electrowinning and refining are examined. The recovery of gold as a by-product of the copper industry is also described. Alternative processing methods are indicated in order to shed light on new interesting research topics where Mössbauer spectroscopy could be applied.
The extractive metallurgy of gold
International Nuclear Information System (INIS)
Kongolo, K.; Mwema, M.D.
1998-01-01
Moessbauer spectroscopy has been successfully used in investigation of the gold compounds present in ores and the gold species which occur during the process metallurgy of this metal. This paper is a survey of the basic recovery methods and techniques used in extractive metallurgy of gold. Process fundamentals on mineral processing, ore leaching, zinc dust cementation, adsorption on activated carbon, electrowinning and refining are examined. The recovery of gold as a by-product of the copper industry is also described. Alternative processing methods are indicated in order to shed light on new interesting research topics where Moessbauer spectroscopy could be applied
The extractive metallurgy of gold
Energy Technology Data Exchange (ETDEWEB)
Kongolo, K.; Mwema, M.D. [University of Lubumbashi, Zaire, Gecamines Metallurgical Research Centre, Likasi, Zaire, c/o Gecamines Brussels (Belgium)
1998-12-15
Moessbauer spectroscopy has been successfully used in investigation of the gold compounds present in ores and the gold species which occur during the process metallurgy of this metal. This paper is a survey of the basic recovery methods and techniques used in extractive metallurgy of gold. Process fundamentals on mineral processing, ore leaching, zinc dust cementation, adsorption on activated carbon, electrowinning and refining are examined. The recovery of gold as a by-product of the copper industry is also described. Alternative processing methods are indicated in order to shed light on new interesting research topics where Moessbauer spectroscopy could be applied.
Recovery of carrier-free gold-195
International Nuclear Information System (INIS)
Iofa, B.Z.; Ivanova, N.A.
1995-01-01
It is known that gold(III) is readily extracted from nitric acid solutions with ethers. The authors have studied extraction of trace amounts of gold(III) from nitric acid solutions with diethyl and diisopropyl ethers in the presence of significant excess of Pt(IV). Distribution coefficients of gold(III) were measured radiometrically using carrier-free gold-195 or spectrophotometrically in the presence of platinum(IV). Very high coefficients of gold separation from platinum may be achieved. Preliminary experiments have shown that zinc-65 was not extracted with ethers from nitric acid solutions. As an extraction system, the authors have chosen the system 10 M HNO 3 -diisopropyl ether. After model experiments, the authors have performed recovery of carrier-free gold-195 from a real platinum target irradiated with protons in a cyclotron
Gold--a controversial sensitizer
DEFF Research Database (Denmark)
Bruze, M; Andersen, Klaus Ejner
1999-01-01
allergy to gold sodium thiosulfate were published at the beginning of the 1990s, the allergic nature of the reported positive patch test reactions to gold was questioned. The major argument for such questioning was the lack of demonstrable clinical relevance in most positive reactors. A major reason......Until recently, gold allergy was considered to be extremely rare. Gold has been used and worshipped for thousands of years without any obvious complaints of skin problems, either in those participating in mining and other ways of prospecting, or in those wearing jewellery. When studies on contact...... for the questioning may have been confusion in differentiating between contact allergy and allergic contact dermatitis. To arrive at a diagnosis of allergic contact dermatitis, 3 steps have, in principle, to be fulfilled: (i) establishment of contact allergy; (ii) demonstration of present exposure; (iii) assessment...
Penetration of gold nanoparticles across the stratum corneum layer of thick-Skin.
Raju, Gayathri; Katiyar, Neeraj; Vadukumpully, Sajini; Shankarappa, Sahadev A
2018-02-01
Transdermal particulate penetration across thick-skin, such as that of palms and sole, is particularly important for drug delivery for disorders such as small fiber neuropathies. Nanoparticle-based drug delivery across skin is believed to have much translational applications, but their penetration especially through thick-skin, is not clear. This study specifically investigates the effectiveness of gold nanoparticles (AuNPs) for thick-skin penetration, especially across the stratum corneum (SC) as a function of particle size. The thick-skinned hind-paw of rat was used to characterize depth and distribution of AuNPs of varying sizes, namely, 22±3, 105±11, and 186±20nm. Epidermal penetration of AuNPs was characterized both, in harvested skin from the hind-paw using a diffusion chamber, as well as in vivo. Harvested skin segments exposed to 22nm AuNPs for only 3h demonstrated higher penetration (pthick-skin allows nanoparticle penetration and acts as a depot for release of AuNPs into circulation long after the initial exposure has ceased. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.
Efraín Sánchez Cabra
2003-01-01
On 22 december 1939, the Banco de la República, the Central Bank of Colombia, purchased a 23.5 centimetres high pre-Columbian gold arte fact weighing 777·7 grams that was to become the Gold M useum's foundation stone. Described as a Quimbaya poporo, it is a masterpiece of pre-Hispanic goldwork, an object of beauty whose brightly burnished body and neck, crowned with four sphere-like or naments, rest on an exquisite cast metal tiligree base and which seems to ftoat in a space of its own. The b...
Lifescience Database Archive (English)
Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT
Gold nano-particles fixed on glass
International Nuclear Information System (INIS)
Worsch, Christian; Wisniewski, Wolfgang; Kracker, Michael; Rüssel, Christian
2012-01-01
Highlights: ► We produced wear resistant gold–ruby coatings on amorphous substrates. ► Thin sputtered gold layers were covered by or embedded in silica coatings. ► Annealing above T g of the substrate glass led to the formation of gold nano particles. ► A 1 1 1-texture of the gold particles is observed via XRD and EBSD. ► EBSD-patterns can be acquired from crystals covered by a thin layer of glass. - Abstract: A simple process for producing wear resistant gold nano-particle coatings on transparent substrates is proposed. Soda-lime-silica glasses were sputtered with gold and subsequently coated with SiO 2 using a combustion chemical vapor deposition technique. Some samples were first coated with silica, sputtered with gold and then coated with a second layer of silica. The samples were annealed for 20 min at either 550 or 600 °C. This resulted in the formation of round, well separated gold nano-particles with sizes from 15 to 200 nm. The color of the coated glass was equivalent to that of gold–ruby glasses. Silica/gold/silica coatings annealed at 600 °C for 20 min were strongly adherent and scratch resistant. X-ray diffraction and electron backscatter diffraction (EBSD) were used to describe the crystal orientations of the embedded particles. The gold particles are preferably oriented with their (1 1 1) planes perpendicular to the surface.
Nature vs. nurture: gold perpetuates "stemness".
Paul, Willi; Sharma, Chandra P; Deb, Kaushik Dilip
2011-01-01
Adult tissues contain quiescent reservoirs of multipotent somatic stem cells and pluripotent embryonic-like stem cells (ELSCs). Credited with regenerative properties gold is used across both -contemporary and -ancient medicines. Here, we show that gold exerted these effects by enhancing the pool of pluripotent ELSC while improving their stemness. We used hESCs as an in-vitro model to understand if gold could enhance self-renewal and pluripotency. Swarna-bhasma (SB), an ancient Indian gold microparticulate (41.1 nm), preparation, reduced spontaneous-differentiation, improved self-renewal, pluripotency and proliferation of hESCs. Colloidal gold-nanoparticles (GNP) (15.59 nm) were tested to confirm that the observations were attributable to nanoparticulate-gold. SB and GNP exposure: maintained -stemness, -karyotypic stability, enhanced pluripotency till day-12, increased average colony-sizes, and reduced the number of autonomously-derived differentiated FGFR1 positive fibroblast-niche-cells/colony. Particulate-gold induced upregulation of FGFR1 and IGF2 expression, and decrease in IGF1 secretion indicates IGF1/2 mediated support for enhanced pluripotency and self-renewal in hESCs.
Carbonate hosted gold deposit in Tasmania, Australia
International Nuclear Information System (INIS)
Abadi, M.H.
1999-01-01
Full text: This study uses elemental and isotopic composition of carbonates associated with gold from Henty and Beaconsfield in Tasmania, Australia, to illustrate source of gold-bearing fluids, salinity, temperature and dissolution and reprecipitation of carbonate. The Beaconsfield and Henty gold mines are located in northern and western Tasmania respectively. Gold mineralisation in Beaconsfield occurs within the quartz-carbonate Tasmania Reef (Lower to Middle Palaeozoic sequence, Hills, 1998). The Henty gold mine is located at the base of the Cambrian Tyndall Group (volcano-sedimentary succession, White and McPhie, 1996) close to Henty Fault. Gold in carbonate samples from Henty ranges from 7.7 to 9360 ppm and in Beaconsfield ranges from 0.01 to 434 ppm. The amount of carbonate in samples from Henty and Beaconsfield gold mines varies from approximately 24 to 99.8%. Bivariate plot of Ca relative to total amounts of Mg, Fe and Mn illustrates that the major carbonate minerals at Beaconsfield and Henty gold mines are magnesian ankerite and calcite. The difference in carbonate mineralogy, at Henty and Beaconsfield gold mines, is attributed to the composition of fluids responsible for carbonate alteration. Gold and magnesium in Beaconsfield ankerite are derived from the leaching of Cambrian ultramafic rocks during the Devonian by the passage of meteoric fluids through tectonically affected Ordovician carbonates (Rao and Adabi, 1999). The total concentration of Fe and Mn are low (0.5 to 2%) in Henty and high (1 to 17.5%) in Beaconsfield ankerite, possibly due to oxidising conditions at Henty and reducing conditions at Beaconsfield gold mines during gold mineralisation. Variation of Sr values between Beaconsfield ankerite and Henty calcite is related to dissolution of limestone that increase Sr concentrations in gold mineralising fluids. Na values in both Beaconsfield (20 to 1100 ppm) and Henty carbonates (25 to 1650 ppm) suggest low salinity fluids responsible for gold
Energy Technology Data Exchange (ETDEWEB)
Lee, K. M.; Sun, G. M. [KAERI, Daejeon (Korea, Republic of)
2016-05-15
The purpose of this study is to develop fake gold bar detecting method by using Prompt-gamma activation analysis (PGAA) facility at the Korea Atomic Energy Research Institute (KAERI). PGAA is an established nuclear analytical technique for non-destructive determination of elemental and isotopic compositions. For a preliminary study on detecting fake gold bar, Monte Carlo simulation of neutron transmission in gold bar was conducted and the possibility for detecting fake gold bar was confirmed. Under the gold bullion standard, it guaranteed the government would redeem any amount of currency for its value in gold. After the gold bullion standard ended, gold bars have been the target for investment as ever. But it is well known that fake gold bar exist in the gold market. This cannot be identified easily without performing a testing as it has the same appearance as the pure gold bar. In order to avoid the trading of fake gold bar in the market, they should be monitored thoroughly. Although the transmissivity of cold neutrons are low comparing that of thermal neutrons, the slower neutrons are more apt to be absorbed in a target, and can increase the prompt gamma emission rate. Also the flux of both thermal and cold neutron beam is high enough to activate thick target. If the neutron beam is irradiated on the front and the reverse side of gold bar, all insides of it can be detected.
International Nuclear Information System (INIS)
Lee, K. M.; Sun, G. M.
2016-01-01
The purpose of this study is to develop fake gold bar detecting method by using Prompt-gamma activation analysis (PGAA) facility at the Korea Atomic Energy Research Institute (KAERI). PGAA is an established nuclear analytical technique for non-destructive determination of elemental and isotopic compositions. For a preliminary study on detecting fake gold bar, Monte Carlo simulation of neutron transmission in gold bar was conducted and the possibility for detecting fake gold bar was confirmed. Under the gold bullion standard, it guaranteed the government would redeem any amount of currency for its value in gold. After the gold bullion standard ended, gold bars have been the target for investment as ever. But it is well known that fake gold bar exist in the gold market. This cannot be identified easily without performing a testing as it has the same appearance as the pure gold bar. In order to avoid the trading of fake gold bar in the market, they should be monitored thoroughly. Although the transmissivity of cold neutrons are low comparing that of thermal neutrons, the slower neutrons are more apt to be absorbed in a target, and can increase the prompt gamma emission rate. Also the flux of both thermal and cold neutron beam is high enough to activate thick target. If the neutron beam is irradiated on the front and the reverse side of gold bar, all insides of it can be detected
DEFF Research Database (Denmark)
Larsen, Agnete; Kolind, Kristian; Pedersen, Dan Sonne
2008-01-01
neural stem cell response. We conclude that bio-liberated gold ions possess pronounced anti-inflammatory and neuron-protective capacities in the brain and suggest that metallic gold has clinical potentials. Intra-cerebral application of metallic gold as a pharmaceutical source of gold ions represents......Traumatic brain injury results in loss of neurons caused as much by the resulting neuroinflammation as by the injury. Gold salts are known to be immunosuppressive, but their use are limited by nephrotoxicity. However, as we have proven that implants of pure metallic gold release gold ions which do...... not spread in the body, but are taken up by cells near the implant, we hypothesize that metallic gold could reduce local neuroinflammation in a safe way. Bio-liberation, or dissolucytosis, of gold ions from metallic gold surfaces requires the presence of disolycytes i.e. macrophages and the process...
Intensification Behavior of Mercury Ions on Gold Cyanide Leaching
Directory of Open Access Journals (Sweden)
Qiang Zhong
2018-01-01
Full Text Available Cyanidation is the main method used to extract gold from gold raw materials; however, a serious problem with this method is the low leaching rate. In order to improve gold leaching, the intensification behavior of mercury ions on gold cyanide leaching, for two types of materials, sulphide gold concentrate and oxide gold ore, was investigated. The results showed that mercury ions, with only a 10−5 M dosage, could significantly intensify leaching and gold recovery. The dissolution behavior of gold plate was also intensified by 10−5 M mercury ions. Microstructure analysis showed that mercury ions intensified the cyanidation corrosion of the gold surface, resulting in a loose structure, where a large number of deep ravines and raised particles were evident across the whole gold surface. The loose structure added contact surface between the gold and cyanide, and accelerated gold dissolution. Moreover, mercury ions obstructed the formation of insoluble products, such as AuCN, Au(OHCN, and Au(OHx, that lead to a passivation membrane on the gold surface, reducing contact between the gold and cyanide. These effects, brought about by mercury ions, change the structure and product of the gold surface during gold cyanidation and promote gold leaching.
2011-04-20
... Rooms, 1828 L Street, NW., Suite 805, Washington, DC 20036. FOR FURTHER INFORMATION CONTACT: RTCA Secretariat, 1828 L Street, NW., Suite 805, Washington, DC, 20036, (202) 833-9339; fax (202) 833-9434; Web.... 035-11/SC186-307 FAA Surveillance and Broadcast Services (SBS) Program Status Traffic Situation...
International Nuclear Information System (INIS)
Salamandra Martinez, Carlos
2004-01-01
The main purpose of this work is to offer a general panoramic of the processes or experiences pilot that are carried out in the Project Green Gold, as strategy of environmental sustainability and organizational invigoration in Choco, especially in the 12 communities of the municipalities of Tado and Condoto. It is also sought to offer a minimum of information on the techniques of handmade production and to show the possibilities to carry out in a rational way the use and use of the natural resources. The Project Green Gold is carried out by the Corporation Green Gold (COV) and co-financed with resources of international and national character, the intervention of the financial resources it achievement mainly for the use of clean processes in the extraction stages and metals benefit. The project is centered primarily in the absence of use of products or toxic substances as the mercury, fair trade, organizational invigoration, execution of 11 approaches and certification of the metals Gold and Platinum. The COV, it has come executing the proposal from the year 2001 with the premise of contributing to the balance between the rational exploitation of the natural resources and the conservation of the environment in the Choco. In the project they are used technical handmade characteristic of the region framed inside the mining activity and production activities are diversified in the productive family units. Those producing with the support of entities of juridical character, specify the necessary game rules for the extraction and products commercialization
Gold nanoparticles produced in a microalga
International Nuclear Information System (INIS)
Luangpipat, Tiyaporn; Beattie, Isabel R.; Chisti, Yusuf; Haverkamp, Richard G.
2011-01-01
An efficient biological route to production of gold nanoparticles which allows the nanoparticles to be easily recovered remains elusive. Live cells of the green microalga Chlorella vulgaris were incubated with a solution of gold chloride and harvested by centrifugation. Nanoparticles inside intact cells were identified by transmission electron microscopy and confirmed to be metallic gold by synchrotron based X-ray powder diffraction and X-ray absorption spectroscopy. These intracellular gold nanoparticles were 40–60 nm in diameter. At a concentration of 1.4% Au in the alga, a better than 97% recovery of the gold from solution was achieved. A maximum of 4.2% Au in the alga was obtained. Exposure of C. vulgaris to solutions containing dissolved salts of palladium, ruthenium, and rhodium also resulted in the production of the corresponding nanoparticles within the cells. These were surmised to be also metallic, but were produced at a much lower intracellular concentration than achieved with gold. Iridium was apparently toxic to the alga. No nanoparticles were observed using platinum solutions. C. vulgaris provides a possible route to large scale production of gold nanoparticles.
Gold Nanoparticle Mediated Phototherapy for Cancer
International Nuclear Information System (INIS)
Yao, C.; Zhang, L.; Wang, J.; He, Y.; Xin, J.; Wang, S.; Xu, H.; Zhang, Z.
2016-01-01
Gold nanoparticles exhibit very unique physiochemical and optical properties, which now are extensively studied in range of medical diagnostic and therapeutic applications. In particular, gold nanoparticles show promise in the advancement of cancer treatments. This review will provide insights into the four different cancer treatments such as photothermal therapy, gold nanoparticle-aided photodynamic therapy, gold nanoparticle-aided radiation therapy, and their use as drug carrier. We also discuss the mechanism of every method and the adverse effects and its limitations
Kalies, Stefan; Gentemann, Lara; Schomaker, Markus; Heinemann, Dag; Ripken, Tammo; Meyer, Heiko
2014-01-01
Gold nanoparticle mediated (GNOME) laser transfection/perforation fulfills the demands of a reliable transfection technique. It provides efficient delivery and has a negligible impact on cell viability. Furthermore, it reaches high-throughput applicability. However, currently only large gold particles (> 80 nm) allow successful GNOME laser perforation, probably due to insufficient sedimentation of smaller gold nanoparticles. The objective of this study is to determine whether this aspect can be addressed by a modification of silica particles with gold nanoparticles. Throughout the analysis, we show that after the attachment of gold nanoparticles to silica particles, comparable or better efficiencies to GNOME laser perforation are reached. In combination with 1 µm silica particles, we report laser perforation with gold nanoparticles with sizes down to 4 nm. Therefore, our investigations have great importance for the future research in and the fields of laser transfection combined with plasmonics. PMID:25136494
Linear Optical Properties of Gold Colloid
Directory of Open Access Journals (Sweden)
Jingmin XIA
2015-11-01
Full Text Available Gold colloid was prepared by reducing HAuCl4·4H2O with Na3C6H5O7·2H2O. The morphology, size of gold nanoparticles and the optical property of colloid were characterized by transmission electron microscope and UV-Vis spectrophotometer, respectively. It shows that the gold nanoparticles are in the shape of spheres with diameters less than 8 nm, and the surface plasmon resonance absorption peak is located at about 438 nm. As the volume fraction of gold particles increases, the intensity of absorption peak strengthens. The optical property of gold colloid was analyzed by Maxwell-Garnett (MG effective medium theory in the company of Drude dispersion model. The results show that the matrix dielectric constant is a main factor, which influences the optical property of gold colloid.DOI: http://dx.doi.org/10.5755/j01.ms.21.4.9558
Coal-oil assisted flotation for the gold recovery
Energy Technology Data Exchange (ETDEWEB)
Sen, S.; Seyrankaya, A.; Cilingir, Y. [Dokuz Eylul University, Izmir (Turkey). Mining Engineering Department
2005-09-01
Using coal-oil agglomeration method for free or native gold recovery has been a research subject for many researchers over the years. In this study, a new approach 'coal-oil assisted gold flotation' was used to recover gold particles. The coal-oil-gold agglomeration process considers the preferential wetting of coal and gold particles. The method takes advantage of the greater hydrophobicity and oleophilicity of coal and gold compared to that the most gangue materials. Unlike the previous studies about coal-oil-gold agglomeration, this method uses a very small amount of coal and agglomerating agents. Some experiments were conducted on synthetic gold ore samples to reveal the reaction of the coal-oil assisted gold flotation process against the size and the number of gold particles in the feed. It was observed that there is no significant difference in process gold recoveries for feeds assaying different Au. Although there was a slight decrease for coarse gold particles, the process seems to be effective for the recovery of gold grains as coarse as 300 {mu} m. The decrease in the finest size ({lt} 53 {mu} m) is considered to be the decrease in the collision efficiency between the agglomerates and the finest gold particles. The effect of changing coal quantity for constant ore and oil amounts was also investigated. The experiments showed that the process gives very similar results for both artificial and natural ore samples; the best results have been obtained by using 30/1 coal-oil ratio.
International Nuclear Information System (INIS)
Hoehn, R.; Herzig, C.
1986-01-01
The thermodynamic activity of the gold component was directly measured in Au-Pd alloys in the concentration range between X Au =0.048 and 0.850 and in the temperature range 1070 and 1300 K. The ratio of the vapour pressures of pure gold and of the gold component of the alloys was determined - after effusion from a Knudsen twin cell and condensation on a collecting plate - by analysing the decay rate of the radioisotopes 195 Au and 198 Au in an intrinsic germanium well-type detector. The partial mixing enthalpy and the partial mixing entropy of Au were directly obtained from these results. By Gibbs-Duhem integration the integral mixing functions were deduced. Similar measurements were performed in several ternary Au-Ag-Pd alloys of fixed mole fraction X Ag /X Pd =1/9. A comparison of the directly measured partial free excess enthalpy of Au in these ternary alloys with data obtained by the approximate models of Kohler, Toop and Bonnier using data of the corresponding three binary systems yields satisfactory agreement. (orig.) [de
Cancer caused by radioactive gold rings
International Nuclear Information System (INIS)
Callary, E.M.
1989-01-01
Two recent cases of skin cancer caused by radioactive gold rings are described. The gold was contaminated with radon daughters from hollow goldseeds used to hold radon, back in the 1930s or possibly later. Other radioactive gold rings are probably being worn. The Canadian AECB offers free testing
Synthesis of camptothecin-loaded gold nanomaterials
International Nuclear Information System (INIS)
Xing Zhimin; Liu Zhiguo; Zu Yuangang; Fu Yujie; Zhao Chunjian; Zhao Xiuhua; Meng Ronghua; Tan Shengnan
2010-01-01
Camptothecin-loaded gold nanomaterials have been synthesized by the sodium borohydride reduction method under a strong basic condition. The obtained gold nanomaterials have been characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM) and UV-vis absorption spectroscopy. The camptothecin-loaded gold colloidal solution was very stable and can be stored for more than two months at room temperature without obvious changes. The color of the colloidal solution can change from wine red to purple and blue during the acidifying process. It was revealed that the release of camptothecin and the aggregation of gold nanoparticles can be controlled by tuning the solution pH. The present study implied that the gold nanomaterials can be used as the potential carrier for CPT delivery.
Synthesis of camptothecin-loaded gold nanomaterials
Energy Technology Data Exchange (ETDEWEB)
Xing Zhimin [Key Laboratory of Forest Plant Ecology of Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Engineering Research Center of Forest Bio-preparation, Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Liu Zhiguo, E-mail: zguoliu@yahoo.com.cn [Key Laboratory of Forest Plant Ecology of Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Engineering Research Center of Forest Bio-preparation, Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Zu Yuangang, E-mail: nefunano@yahoo.com.cn [Key Laboratory of Forest Plant Ecology of Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Engineering Research Center of Forest Bio-preparation, Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Fu Yujie; Zhao Chunjian; Zhao Xiuhua; Meng Ronghua; Tan Shengnan [Key Laboratory of Forest Plant Ecology of Ministry of Education, Northeast Forestry University, Harbin 150040 (China); Engineering Research Center of Forest Bio-preparation, Ministry of Education, Northeast Forestry University, Harbin 150040 (China)
2010-04-01
Camptothecin-loaded gold nanomaterials have been synthesized by the sodium borohydride reduction method under a strong basic condition. The obtained gold nanomaterials have been characterized by transmission electron microscopy (TEM), atomic force microscopy (AFM) and UV-vis absorption spectroscopy. The camptothecin-loaded gold colloidal solution was very stable and can be stored for more than two months at room temperature without obvious changes. The color of the colloidal solution can change from wine red to purple and blue during the acidifying process. It was revealed that the release of camptothecin and the aggregation of gold nanoparticles can be controlled by tuning the solution pH. The present study implied that the gold nanomaterials can be used as the potential carrier for CPT delivery.
Albumin-gold-glutathione is a probable auranofin metabolite
International Nuclear Information System (INIS)
Shaw, C.F. III; Coffer, M.; Isab, A.A.
1989-01-01
The newly licensed gold drug, auranofin ((2,3,4,6-tetra-O-acetyl-β-1-D-gluco-pyranosato-S-)triethylphoshine-gold(I)) crosses cell membranes and enters cells which are inaccessible to parenteral gold drugs. In vivo, the triethylphosphine ligand and gold of auranofin, but not the thio-sugar moiety, accumulate in and subsequently efflux from red blood cells (RBCs). Extracellular albumin increases in the extent of gold efflux and acts as a gold binding site. The rate of efflux is first-order in RBC gold concentration. Studies using RBCs in which labelled [ 14 C]-glutathione is generated in situ incorporation of [ 14 C]- glycine demonstrate that glutathione also effluxes from the RBCs and forms a gold-glutathione-albumin complex. This may be the immunopharmacologically active complex
International Nuclear Information System (INIS)
Breitz, H.B.; Durham, J.S.; Fisher, D.R.
1995-01-01
Pharmacokinetics, biodistribution and radiation dose estimates following intraperitoneal administration of a 186 Re-labeled murine antibody, NR-LU-10, were assessed in 27 patients with advanced ovarian cancer. Quantitative gamma camera imaging and gamma counting of serum and intraperitoneal fluid radioactivity were used to obtain data for dosimetry estimation. The MIRD intraperitoneal model was used to estimate dose to normal organs from radioactivity within the peritoneal cavity. The absorbed dose to normal peritoneum was estimated in two ways: from the gamma camera activity and peritoneal fluid samples. Serum activity peaked at 44 hr and depended on the concentration of radioactivity in the peritoneal fluid. Mean cumulative urinary excretion of 186 Re was 50% by 140 hr. Estimates of radiation absorbed dose to normal organs in rad/mCi administered (mean ± s.d.) were whole body 0.7 ± 0.3; marrow 0.4 ±0.1; liver 1.9 ±0.9; lungs 1.3 ± 0.7; kidneys 0.2 ± 0.2; intestine 0.2 ±0.2. Peritoneal surface dose estimates varied depending on the volume of fluid infused and the method of dose determination. Using gamma camera data, the peritoneal dose ranged for 7 to 36 rad/mCi. Using peritoneal fluid sample data, the dose ranged from 2 to 25 rad/mCi. Significant myelosuppression was observed at marrow doses above 100 rad. Noninvasive methods of dose estimation for intraperitoneal administration of radioimmunoconjugates provide reasonable estimates when compared with previously described methods. 31 refs., 6 figs., 2 tabs
Kalies, Stefan; Heinemann, Dag; Schomaker, Markus; Gentemann, Lara; Meyer, Heiko; Ripken, Tammo
2014-01-01
Abstract. In comparison to standard transfection methods, gold nanoparticle-mediated laser transfection has proven to be a versatile alternative. This is based on its minor influence on cell viability and its high efficiency, especially for the delivery of small molecules like small interfering RNA. However, in order to transfer it to routine usage, a safety aspect is of major concern: The avoidance of nanoparticle uptake by the cells is desired. The immobilization of the gold nanoparticles on cell culture surfaces can address this issue. In this study, we achieved this by silanization of the appropriate surfaces and the binding of gold nanoparticles to them. Comparable perforation efficiencies to the previous approaches of gold nanoparticle-mediated laser transfection with free gold nanoparticles are demonstrated. The uptake of the immobilized particles by the cells is unlikely. Consequently, these investigations offer the possibility of bringing gold nanoparticle-mediated laser transfection closer to routine usage. PMID:25069006
High temperature creep of single crystals of gold, silver and solid solution gold silver 50-50
International Nuclear Information System (INIS)
Dorizzi, Paul
1973-01-01
We have studied in compression creep along a direction, single crystals of gold, silver and a 50-50 gold-silver solid solution. The experiments were made at temperatures above 0.7 Tf. We have shown that under these conditions and for these three metals a new slip system is operating: the deformation is due to the slip of dislocations having a 1/2 burgers vector on the {110} planes. For gold the activation energy for creep is equal to the self-diffusion energy. We found the same result for silver when the contribution of divacancies to the self-diffusion energy is taken into account. For the alloy the activation energy for creep is very close to the self-diffusion energy of gold in a 50-50 gold-silver alloy, gold being the slower diffusing species in the alloy. The curves giving the creep rate versus the stress can be fitted with the following laws: ε 0 = σ 5 for gold; ε 0 = σ 2,2 for silver and ε 0 = σ 2,5 for the alloy. The dislocation substructure was studied using the crystalline contrast given by the electron microprobe. This new method gives images which are very sensitive to the sub-grains misorientation. The substructure is made of parallelepipedic cells divided by tilt boundaries that are perpendicular to the {110} slip planes. (author) [fr
Gold - Old Drug with New Potentials.
Faa, Gavino; Gerosa, Clara; Fanni, Daniela; Lachowicz, Joanna I; Nurchi, Valeria M
2018-01-01
Research into gold-based drugs for a range of human diseases has seen a revival in recent years. This article reviews the most important applications of gold products in different fields of human pathology. Au(I) and Au(III) compounds have been re-introduced in clinical practice for targeting the cellular components involved in the onset and progression of viral and parasitic diseases, rheumatoid arthritis and cancer. After some brief historical notes, this article takes into account the applications of gold compounds against Mycobacterium tuberculosis, and also in tuberculosis and in rheumatoid arthritis treatment. The use of gold containing drugs in the cure of cancer are then considered, with special emphasis to the use of nanoparticles and to the photo-thermal cancer therapy. The use of colloidal gold in diagnostics, introduced in the last decade is widely discussed. As a last point a survey on the adverse effects and on the toxicity of the various gold derivatives in use in medicine is presented. In this review, we described the surprisingly broad spectrum of possible uses of gold in diagnostics and in therapeutic approaches to multiple human diseases, ranging from degenerative to infectious diseases, and to cancer. In particular, gold nanoparticles appear as attractive elements in modern clinical medicine, combining high therapeutic properties, high selectivity in targeting cancer cells and low toxicity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
International Nuclear Information System (INIS)
White, Shane A.; Landry, Guillaume; Reniers, Brigitte; Fonseca, Gabriel Paiva; Holt, Randy; Rusch, Thomas; Beaulieu, Luc; Verhaegen, Frank
2014-01-01
Purpose: The recently updated guidelines for dosimetry in brachytherapy in TG-186 have recommended the use of model-based dosimetry calculations as a replacement for TG-43. TG-186 highlights shortcomings in the water-based approach in TG-43, particularly for low energy brachytherapy sources. The Xoft Axxent is a low energy ( w,m ) and dose to medium (D m,m ), for the heterogeneous simulations. All results were compared against TG-43-based dose distributions and evaluated using dose ratio maps and DVH metrics. Changes in skin and PTV dose were highlighted. Results: All simulated heterogeneous models showed a reduced dose to the DVH metrics that is dependent on the method of dose reporting and patient geometry. Based on a prescription dose of 34 Gy, the average D 90 to PTV was reduced by between ∼4% and ∼40%, depending on the scoring method, compared to the TG-43 result. Peak skin dose is also reduced by 10%–15% due to the absence of backscatter not accounted for in TG-43. The balloon applicator also contributed to the reduced dose. Other ROIs showed a difference depending on the method of dose reporting. Conclusions: TG-186-based calculations produce results that are different from TG-43 for the Axxent source. The differences depend strongly on the method of dose reporting. This study highlights the importance of backscatter to peak skin dose. Tissue heterogeneities, applicator, and patient geometries demonstrate the need for a more robust dose calculation method for low energy brachytherapy sources
Structure of the Kπ=4+ bands in Os186,188
Phillips, A. A.; Garrett, P. E.; Lo Iudice, N.; Sushkov, A. V.; Bettermann, L.; Braun, N.; Burke, D. G.; Demand, G. A.; Faestermann, T.; Finlay, P.; Green, K. L.; Hertenberger, R.; Leach, K. G.; Krücken, R.; Schumaker, M. A.; Svensson, C. E.; Wirth, H.-F.; Wong, J.
2010-09-01
The (He3,d) single-proton stripping reaction has been performed on targets of Re185,187 to investigate the structures of the 43+ states in Os186,188. The experiment employed 30 MeV He3 beams, and the reaction products were analyzed with a Q3D spectrograph. Absolute cross sections were determined at nine angles between 5° and 50° for states up to approximately 3 MeV in excitation energy. Large (5)/(2)+[402]π+(3)/(2)+[402]π two-quasiparticle components are deduced for the 43+ levels of both isotopes. Their magnitudes are in agreement with calculations performed using the quasiparticle phonon model, which predicts a coexistence of a large hexadecapole with a smaller, but sizable, γ-γ component in the 43+.
Red gold analysis by using gamma absorption tchnique
International Nuclear Information System (INIS)
Kurtoglu, A.; Tugrul, A.B.
2001-01-01
Gold is a valuable metal and also preferable materials for antique artefacts and some advanced technology products. It can be offered for the analysis of the gold as namely; neutron activation analysis, X-ray florescence technique, Auger spectroscopy, atomic absorption and wet chemistry. Some limitations exist in practice for these techniques, especially in the points of financial and applicability concepts. An advanced a practical technique is gamma absorption technique for the gold alloys. This technique is based on discontinuities in the absorption coefficient for gamma rays at corresponding to the electronic binding energies of the absorber. If irradiation is occurred at gamma absorption energy for gold, absorption rates of the red gold changes via the gold amounts in the alloy. Red gold is a basic and generally preferable alloy that has copper and silver additional of the gold in it. The gold amount defines as carat of the gold. Experimental studies were observed for four different carats of red gold; these are 8, 14, 18 and 22 carats. K-edge energy level of the gold is on 80 keV energy. So, Ba-133 radioisotope is preferred as the gamma source because of it has gamma energy peak in that energy. Experiments observed in the same geometry for all samples. NaI(Tl) detector and multichannel analyser were used for measurements. As a result of the experiments, the calibration curves could be drawn for red gold. For examine this curve, unknown samples are measured in experimental set and it can be determined the carat of it with the acceptability. So the red gold analysis can be observed non-destructively, easily and quickly by using the gamma absorption technique
MANSUROV R.KH.
2016-01-01
The relevance of the discussed issue is caused by the need to detect a new gold ore deposits within the Yenisei ridge to replenish the mineral resources of gold ore in Russia. The main aim of the study is to explore the features of geological structure and gold ore mineralized zones of ore occurrence Yuzhnoe in order to forecast gold ore bodies, and to substantiate the continuation of geological exploration. The prospecting is realized by the express method of prospecting of gold ore deposits...
Diazonium-derived aryl films on gold nanoparticles: evidence for a carbon-gold covalent bond.
Laurentius, Lars; Stoyanov, Stanislav R; Gusarov, Sergey; Kovalenko, Andriy; Du, Rongbing; Lopinski, Gregory P; McDermott, Mark T
2011-05-24
Tailoring the surface chemistry of metallic nanoparticles is generally a key step for their use in a wide range of applications. There are few examples of organic films covalently bound to metal nanoparticles. We demonstrate here that aryl films are formed on gold nanoparticles from the spontaneous reduction of diazonium salts. The structure and the bonding of the film is probed with surface-enhanced Raman scattering (SERS). Extinction spectroscopy and SERS show that a nitrobenzene film forms on gold nanoparticles from the corresponding diazonium salt. Comparison of the SERS spectrum with spectra computed from density functional theory models reveals a band characteristic of a Au-C stretch. The observation of this stretch is direct evidence of a covalent bond. A similar band is observed in high-resolution electron energy loss spectra of nitrobenzene layers on planar gold. The bonding of these types of films through a covalent interaction on gold is consistent with their enhanced stability observed in other studies. These findings provide motivation for the use of diazonium-derived films on gold and other metals in applications where high stability and/or strong adsorbate-substrate coupling are required.
Directory of Open Access Journals (Sweden)
Qian Li
2017-05-01
Full Text Available A total gold extraction of 70.2% could only be reached via direct cyanidation from a refractory As-, S- and C-bearing gold concentrate calcine, and the gold extraction varied noticeably with different size fractions. The reasons for unsatisfactory gold extraction from the calcine were studied through analyses of chemical composition, chemical phase and SEM-EDS of different sizes of particles. It was found that a significant segregation of compositions occurred during the grinding of gold ore before flotation. As a result, for the calcine obtained after oxidative roasting, the encapsulation of gold by iron oxides was easily engendered in finer particles, whilst in coarser particles the gold encapsulation by silicates was inclined to occur likely due to melted silicates blocking the porosity of particles. The improvement of gold leaching from different size fractions was further investigated through pretreatments with alkali washing, acid pickling or sulfuric acid curing-water leaching. Finally, a novel process was recommended and the total gold extraction from the calcine could be increased substantially to 93.6% by the purposeful pretreatment with alkali washing for the relatively coarse size fraction (+37 μm and sulfuric acid curing–water leaching for the fine size fraction (−37 μm.
Qiu, Xiao-bin; Wen, Jian-kang; Huang, Song-tao; Yang, Hong-ying; Liu, Mei-lin; Wu, Biao
2017-10-01
To extract gold from a low-grade (13.43 g/t) and high-sulfur (39.94wt% sulfide sulfur) Carlin-type gold concentrate from the Nibao deposit, Guizhou, a bio-pretreatment followed by carbon-in-pulp (CIP) cyanide leaching process was used. Various methods were used to detect the low-grade gold in the concentrate; however, only time-of-flight secondary-ion mass spectrometry (TOF-SIMS) was successful. With bio-pretreatment, the gold recovery rate increased by approximately 70.16% compared with that obtained by direct cyanide leaching of the concentrate. Various attempts were made to increase the final gold recovery rate. However, approximately 20wt% of the gold was non-extractable. To determine the nature of this non-extractable gold, mineralogy liberation analysis (MLA), formation of secondary product during the bio-pretreatment, and the preg-robbing capacity of the carbonaceous matter in the ore were investigated. The results indicated that at least four factors affected the gold recovery rate: gold occurrence, tight junctions of gold-bearing pyrite with gangue minerals, jarosite coating of the ore, and the carbonaceous matter content.
NUCLEATION STUDIES OF GOLD ON CARBON ELECTRODES
Directory of Open Access Journals (Sweden)
S. SOBRI
2008-04-01
Full Text Available Interest has grown in developing non-toxic electrolytes for gold electrodeposition to replace the conventional cyanide-based bath for long term sustainability of gold electroplating. A solution containing thiosulphate and sulphite has been developed specially for microelectronics applications. However, at the end of the electrodeposition process, the spent electrolyte can contain a significant amount of gold in solution. This study has been initiated to investigate the feasibility of gold recovery from a spent thiosulphate-sulphite electrolyte. We have used flat-plate glassy carbon and graphite electrodes to study the mechanism of nucleation and crystal growth of gold deposition from the spent electrolyte. It was found that at the early stages of reduction process, the deposition of gold on glassy carbon exhibits an instantaneous nucleation of non-overlapping particles. At longer times, the particles begin to overlap and the deposition follows a classic progressive nucleation phenomenon. On the other hand, deposition of gold on graphite does not follow the classical nucleation phenomena.
International Nuclear Information System (INIS)
Bleser, Ed
1992-01-01
On April 24, Brookhaven's Alternating Gradient Synchrotron (AGS) started to deliver gold ions at 11.4 GeV per nucleon (2,000 GeV per ion) to experimenters who were delighted not only to receive the world's highest energy gold beam but also to receive it on schedule
Marczenko, Z; Jankowski, K
1985-04-01
The gold(I)-iodide-Methylene Blue (MB) system is suitable for flotation separation and spectrophotometric determination of gold. Under the optimum conditions [(MB(+))(AuI(2)(-))].3[(MB(+))(I(3)(-))] is formed, and floated with cyclohexane. The product is dissolved in methanol and its absorbance measured. The molar absorptivity is 3.4 x 10(5)1.mole(-1).cm(-1) at 655 nm. The proposed method is more than three times as sensitive as the Rhodamine B method. Pt, Pd, Ag and Hg interfere seriously, and Ir, Rh, Bi and Cd to a smaller extent. Preliminary separation of gold by precipitation with tellurium as a collector is recommended. The method has been applied to determination of gold traces (about 1 x 10(-4)%) in a copper sample.
Laparoscopic finding of female infertility-a study of 186 cases at a tertiary care hospital
International Nuclear Information System (INIS)
Yasir, N.; Fatima, A.; Parveen, S.; Tariq, H.
2014-01-01
Objective: To study the various causes of female infertility, diagnosed at laparoscopy. Study Design: Descriptive study. Place and Duration of Study: The study was conducted at Military Hospital Rawalpindi, Pakistan from April 2008 to December 2010. Patients and Methods: A series of 186 patients, having either primary or secondary infertility admitted through gynae outpatient department undergoing diagnostic laparoscopy and meeting inclusion criteria were studied. The data was collected prospectively and analysed in the form of frequency and percentages by using SPSS version 10. Results: Amongst the cohort of 186 patients, 148 (79.6%) had primary and 38 (20.4%) had secondary infertility. Their ages ranged from 20 to 43 years. Mean age of study participants was 30.14 +- 4.04 years. Mean duration of infertility was 9.5 years. No laparoscopic abnormality was found in 51 (27.9%), while there were abnormal findings in 135 (72.6%) patients. Conclusion: Commonest etiological factor was tubal blockade in both types of infertility. Other factors were endometriosis, pelvic adhesions and fibroids. Laparoscopy is minimally invasive yet a reliable procedure for visualization of internal architecture of the female pelvis. (author)
Precipitation of lamellar gold nanocrystals in molten polymers
International Nuclear Information System (INIS)
Palomba, M.; Carotenuto, G.
2016-01-01
Non-aggregated lamellar gold crystals with regular shape (triangles, squares, pentagons, etc.) have been produced by thermal decomposition of gold chloride (AuCl) molecules in molten amorphous polymers (polystyrene and poly(methyl methacrylate)). Such covalent inorganic gold salt is high soluble into non-polar polymers and it thermally decomposes at temperatures compatible with the polymer thermal stability, producing gold atoms and chlorine radicals. At the end of the gold precipitation process, the polymer matrix resulted chemically modified because of the partial cross-linking process due to the gold atom formation reaction.
International Nuclear Information System (INIS)
Tan Yiqing; Wang Yase; Dai Hongxiu; Li Haitao; Deng Yi; Xiong Liqin
2011-01-01
Objective: To evaluate selective salpingo-catheterization recanalization therapy in treating partial fallopian tube obstruction through comparing its clinical effectiveness with that of non-interventional radiology methods. Methods: During the period from January 2008 to October 2010, a total of 186 infertility women with partial fallopian tube obstruction, which was confirmed with hysterosalpingography, were encountered in authors' hospital. This study protocol was approved by our hospital ethics committee, and informed consent was obtained from all patients. According of different treatment methods, 186 patients were divided into two groups. Patients (n=78) in group A received non-interventional radiology methods, including hydrotubation, enema, laparoscopy, physical therapy and traditional Chinese medication, while patients (n=108) in group B received selective salpingo-catheterization recanalization therapy. All 186 patients were followed up for more than six months. Close observation on the pregnancy incidence after different treatments and fallopian tube patency was carried out. The clinical findings were documented. The results were statistically analyzed by using paired 'x2' test. Results: Half a year after different procedures, in group A the pregnancy rate was 12.82% (n=10), and different degrees of fallopian tube obstruction were found in 31.58% patients. Whereas in group B, during the same period of observation, the pregnancy rate was 58.33% (n=63), and partial occlusion in cornual region was seen in one patient (0.47%). Significant difference in both pregnancy rate and fallopian tube occlusion rate existed between two groups (P<0.05). Conclusion: Because of its minimal invasiveness, high effectiveness and safety, the selective salpingography together with fallopian tube recanalization procedures are well accepted by the patients. The selective salpingo-catheterization recanalization therapy is superior to non-interventional radiology methods in
Synthesis of radioactive gold nanoparticle in surfactant medium
International Nuclear Information System (INIS)
Swadesh Mandal
2014-01-01
The present study describes the synthesis of radioactive gold nanoparticle in surfactant medium. Proton irradiated stable 197 Au and radioactive 198 Au were simultaneously used for production of radioactive gold nanoparticle. Face centered cubic gold nanoparticles with size of 4-50 nm were found in proton irradiated gold foil. However, the size of nanoparticle varies with pH using both stable and radioactive gold. (author)
Establishment of gold-quartz standard GQS-1
Millard, Hugh T.; Marinenko, John; McLane, John E.
1969-01-01
A homogeneous gold-quartz standard, GQS-1, was prepared from a heterogeneous gold-bearing quartz by chemical treatment. The concentration of gold in GQS-1 was determined by both instrumental neutron activation analysis and radioisotope dilution analysis to be 2.61?0.10 parts per million. Analysis of 10 samples of the standard by both instrumental neutron activation analysis and radioisotope dilution analysis failed to reveal heterogeneity within the standard. The precision of the analytical methods, expressed as standard error, was approximately 0.1 part per million. The analytical data were also used to estimate the average size of gold particles. The chemical treatment apparently reduced the average diameter of the gold particles by at least an order of magnitude and increased the concentration of gold grains by a factor of at least 4,000.
Diatom. A potential bio-accumulator of gold
International Nuclear Information System (INIS)
Chakraborty, N.; Pal, R.; Ramaswami, A.; Nayak, D.; Lahiri, S.
2006-01-01
The bioaccumulation of gold in trace concentration by Nitzschia obtusa and Navicula minima, two members of bacillariophyceae, has been studied. It has been observed that Nitzschia obtusa showed better accumulation of gold in acidic pH in comparison to neutral and basic pH. Maximum accumulation was observed with 1 mg x kg -1 or less gold concentration. However, the accumulation by the living cells was reduced when the matrix concentration was higher. Navicula minima, on the other hand, found to be a better accumulator of gold in wide ranges of pH and substrate concentration of the media. It was also inferred that the gold accumulation by diatom was mainly due to adsorption by biosilica (siliceous frustules of dead diatom cells). Accumulated gold was recovered with conc. HNO 3 . (author)
International Nuclear Information System (INIS)
Lengke, M. F.; Ravel, B.; Fleet, M. E.; Wanger, G.; Gordon, R. A.; Southam, G.
2007-01-01
The mechanisms of gold precipitation by the interaction of cyanobacteria (Plectonema boryanum UTEX 485) and gold(III) chloride aqueous solutions (7.6 mmol/L final gold) have been studied at 25, 60, and 80 C, using both laboratory and real-time synchrotron radiation absorption spectroscopy experiments. Addition of aqueous gold(III) chloride to the cyanobacterial culture initially promoted the precipitation of amorphous gold(I) sulfide at the cell walls and finally caused the formation of octahedral (111) platelets (<1 to 6 (micro)m) of gold metal near cell surfaces and in solutions. X-ray absorption spectroscopy results confirmed that the reduction mechanism of gold(III) chloride to elemental gold by cyanobacteria involves the formation of an intermediate Au(I) species, gold(I) sulfide, with sulfur originating from cyanobacterial proteins, presumably cysteine or methionine. Although the bioreduction of gold(III) chloride to gold(I) sulfide was relatively rapid at all temperatures, the reaction rate increased with the increase in temperature. At the completion of the experiments, elemental gold was the major species present at all temperatures
Energy Technology Data Exchange (ETDEWEB)
Harish, S. [Electrodics and Electrocatalysis Division, CSIR-Central Electrochemical Research Institute, Karaikudi 630006, Tamilnadu (India); Joseph, James, E-mail: jameskavlam@yahoo.com [Electrodics and Electrocatalysis Division, CSIR-Central Electrochemical Research Institute, Karaikudi 630006, Tamilnadu (India); Phani, K.L.N. [Electrodics and Electrocatalysis Division, CSIR-Central Electrochemical Research Institute, Karaikudi 630006, Tamilnadu (India)
2011-06-30
Highlights: > In group IB, Cu and Ag form Prussian blue analogues but similar formation of gold hexacyanoferrate was not found in the literature and non-existence of gold hexacyanoferrate remains a mystery. > Potential cycling of gold chloride and potassium ferro/ferri cyanide was resulted in the formation of Au-PB nano-composite. > Redox reaction between gold chloride and potassium ferrocyanide ion is spontaneous but no reaction occurs when gold chloride and potassium ferricyanide is mixed. > We are proposing the formation of a compound with general formula 'KFe{sub x}[Au(CN){sub 2}]{sub y}' and discussing the formation of gold hexacyanoferrate is not feasible by simple chemical or electrochemical reaction in contrast to other PB analogues. - Abstract: Prussian blue analogues are a class of compounds formed by the reaction between metal salt and potassium hexacyanoferrate (II/III). In our earlier report, the formation of Au-Prussian blue nano-composite was noticed on potential cycling the glassy carbon electrode in a medium containing gold (III) chloride and potassium hexacyanoferrate (III). Hence in this work, the formation of gold hexacyanoferrate was attempted by a simple chemical reaction. The reaction of gold (III) chloride with potassium hexacyanoferrate (II/III) was examined by UV-Vis spectroscopy and found that there is no redox reaction between gold (III) chloride and potassium hexacyanoferrate (III). However, the redox reaction occurs between gold (III) chloride and potassium hexacyanoferrate (II) leading to the formation of charge transfer band and the conversion of hexacyanoferrate (II) to hexacyanoferrate (III) was evidenced by the emergence of new absorption peaks in UV-Vis spectra. The oxidation state of gold in Au-Fe complex was found to be +1 from X-ray photoelectron spectroscopy. The stability of the Au-Fe complex was also studied by cyclic voltammetry. Cyclic voltammetric results indicated the presence of high spin iron in Au
International Nuclear Information System (INIS)
Harish, S.; Joseph, James; Phani, K.L.N.
2011-01-01
Highlights: → In group IB, Cu and Ag form Prussian blue analogues but similar formation of gold hexacyanoferrate was not found in the literature and non-existence of gold hexacyanoferrate remains a mystery. → Potential cycling of gold chloride and potassium ferro/ferri cyanide was resulted in the formation of Au-PB nano-composite. → Redox reaction between gold chloride and potassium ferrocyanide ion is spontaneous but no reaction occurs when gold chloride and potassium ferricyanide is mixed. → We are proposing the formation of a compound with general formula 'KFe x [Au(CN) 2 ] y ' and discussing the formation of gold hexacyanoferrate is not feasible by simple chemical or electrochemical reaction in contrast to other PB analogues. - Abstract: Prussian blue analogues are a class of compounds formed by the reaction between metal salt and potassium hexacyanoferrate (II/III). In our earlier report, the formation of Au-Prussian blue nano-composite was noticed on potential cycling the glassy carbon electrode in a medium containing gold (III) chloride and potassium hexacyanoferrate (III). Hence in this work, the formation of gold hexacyanoferrate was attempted by a simple chemical reaction. The reaction of gold (III) chloride with potassium hexacyanoferrate (II/III) was examined by UV-Vis spectroscopy and found that there is no redox reaction between gold (III) chloride and potassium hexacyanoferrate (III). However, the redox reaction occurs between gold (III) chloride and potassium hexacyanoferrate (II) leading to the formation of charge transfer band and the conversion of hexacyanoferrate (II) to hexacyanoferrate (III) was evidenced by the emergence of new absorption peaks in UV-Vis spectra. The oxidation state of gold in Au-Fe complex was found to be +1 from X-ray photoelectron spectroscopy. The stability of the Au-Fe complex was also studied by cyclic voltammetry. Cyclic voltammetric results indicated the presence of high spin iron in Au-Fe complex. Hence 'as
Physicochemical Properties of Gold Nanostructures Deposited on Glass
Directory of Open Access Journals (Sweden)
Zdenka Novotna
2014-01-01
Full Text Available Properties of gold films sputtered onto borosilicate glass substrate were studied. UV-Vis absorption spectra were used to investigate optical parameters. XRD analysis provided information about the gold crystalline nanostructure, the texture, and lattice parameter and biaxial tension was also determined by the XRD method. The surface morphology was examined by atomic force microscopy (AFM; chemical structure of sputtered gold nanostructures was examined by X-ray photoelectron spectroscopy (ARXPS. The gold crystallites are preferentially [111] oriented on the sputtered samples. Gold deposition leads to dramatic changes in the surface morphology in comparison to pristine glass substrate. Oxygen is not incorporated into the gold layer during gold deposition. Experimental data on lattice parameter were also confirmed by theoretical investigations of nanoclusters using tight-binding potentials.
Electroplating of gold using a sulfite-based electrolyte
Smalbrugge, E.; Jacobs, B.; Falcone, S.; Geluk, E.J.; Karouta, F.; Leijtens, X.J.M.; Besten, den J.H.
2000-01-01
Electroplating of gold is often used in optoelectronic and microelectronic devices for air-bridges, heat-sinks or gold-bumps for flip-chip techniques. The gold-cyanide electrolytes, which are commonly used in gold-electroplating, are toxic and attack resist patterns causing cracks during the plating
Energy Technology Data Exchange (ETDEWEB)
Singh, J. (Canterbury Univ. (United Kingdom). Biological Lab.); Reghebi, K.; Lazarus, C.R.; Clarke, S.E.M. (Guy' s Hospital, London (United Kingdom)); Callahan, A.P.; Knapp, F.F. Jr. (Oak Ridge National Lab., TN (United States)); Blower, P.J. (Kent and Canterbury Hospital (United Kingdom))
1993-03-01
The preparative conditions for [sup 186]Re(V)DMSA and [sup 188]Re(V)DMSA (DMSA = meso-dimercaptosuccinic acid), [beta]-emitting radiopharmaceuticals that have been shown to localize in medullary thyroid carcinoma, require modification depending on the amount of carrier rhenium and the chemical form and medium in which the rhenium is supplied. Preparative conditions are described for use with carrier-free [sup 188]ReO[sub 4][sup -] in saline, and for use with [sup 186]ReO[sub 4][sup -] in saline, sodium hydroxide or nitric acid. Preparation of [sup 186]Re(V)DMSA (carrier present up to 2 mg per 2.5 ml reaction volume) requires a DMSA:SnCl[sub 2]:Re ratio of 10:5:1 at 100[sup o]C for 30 min. Addition of excess nitric acid or hydrochloric acid up to a concentration of 155 mM does not reduce the yield from 100%. A commercial DMSA kit vial (e.g. Amerscan DMSA) can be used for preparation of [sup 188]Re(V)DMSA (carrier free) provided the required is in a volume of less than 1 ml per vial. A convenient method of concentrating the [sup 188]Re generator eluate to the required volume is described. (Author).
Urban artisanal gold shops and mercury emissions
International Nuclear Information System (INIS)
Cordy, P.; Veiga, M.; Carrasco, V.H.G.
2008-01-01
Artisanal miners in developing countries use mercury amalgamation processes to extract gold. The amalgams are then refined before being sold on to urban gold shops. The amalgams can often contain between 2 to 40 per cent mercury. Unburned amalgams are also often sold directly to gold shops. There are serious health risks for shop employees and nearby populations when the gold is melted and further purified. Studies have shown that mercury concentrations in the ambient air of gold shops often exceeds World Health Organization (WHO) limits by an order of magnitude or more. This study examined the practices and technologies used to refine gold in Latin America and Indonesia. The study compared and contrasted various refining methods and their resulting mercury emissions. Methods of reducing mercury emissions were also investigated, including a filtration system designed to capture 80 per cent of mercury emissions. Barriers to implementing mercury emissions reduction plans were also investigated. It was concluded that the design of urban gold shops must include condensers, fume hoods, and efficient mercury capture systems. 15 refs
Gold analysis by the gamma absorption technique
International Nuclear Information System (INIS)
Kurtoglu, Arzu; Tugrul, A.B.
2003-01-01
Gold (Au) analyses are generally performed using destructive techniques. In this study, the Gamma Absorption Technique has been employed for gold analysis. A series of different gold alloys of known gold content were analysed and a calibration curve was obtained. This curve was then used for the analysis of unknown samples. Gold analyses can be made non-destructively, easily and quickly by the gamma absorption technique. The mass attenuation coefficients of the alloys were measured around the K-shell absorption edge of Au. Theoretical mass attenuation coefficient values were obtained using the WinXCom program and comparison of the experimental results with the theoretical values showed generally good and acceptable agreement
Surface vertical deposition for gold nanoparticle film
International Nuclear Information System (INIS)
Diao, J J; Qiu, F S; Chen, G D; Reeves, M E
2003-01-01
In this rapid communication, we present the surface vertical deposition (SVD) method to synthesize the gold nanoparticle films. Under conditions where the surface of the gold nanoparticle suspension descends slowly by evaporation, the gold nanoparticles in the solid-liquid-gas junction of the suspension aggregate together on the substrate by the force of solid and liquid interface. When the surface properties of the substrate and colloidal nanoparticle suspension define for the SVD, the density of gold nanoparticles in the thin film made by SVD only depends on the descending velocity of the suspension surface and on the concentration of the gold nanoparticle suspension. (rapid communication)
[Biosynthesis of gold nanoparticles by Azospirillum brasilense].
Kupriashina, M A; Vetchinkina, E P; Burov, A M; Ponomareva, E G; Nikitina, V E
2014-01-01
Plant-associated nitrogen-fixing soil bacteria Azospirillum brasilense were shown to reduce the gold of chloroauric acid to elemental gold, resulting in formation of gold nanoparicles. Extracellular phenoloxidizing enzymes (laccases and Mn peroxidases) were shown to participate in reduction of Au+3 (HAuCl4) to Au(0). Transmission electron microscopy revealed accumulation of colloidal gold nanoparticles of diverse shape in the culture liquid of A. brasilense strains Sp245 and Sp7. The size of the electron-dense nanospheres was 5 to 50 nm, and the size of nanoprisms varied from 5 to 300 nm. The tentative mechanism responsible for formation of gold nanoparticles is discussed.
Biomass processing over gold catalysts
Simakova, Olga A; Murzin, Dmitry Yu
2014-01-01
The book describes the valorization of biomass-derived compounds over gold catalysts. Since biomass is a rich renewable feedstock for diverse platform molecules, including those currently derived from petroleum, the interest in various transformation routes has become intense. Catalytic conversion of biomass is one of the main approaches to improving the economic viability of biorefineries. In addition, Gold catalysts were found to have outstanding activity and selectivity in many key reactions. This book collects information about transformations of the most promising and important compounds derived from cellulose, hemicelluloses, and woody biomass extractives. Since gold catalysts possess high stability under oxidative conditions, selective oxidation reactions were discussed more thoroughly than other critical reactions such as partial hydrogenation, acetalization, and isomerization. The influence of reaction conditions, the role of the catalyst, and the advantages and disadvantages of using gold are pre...
Optical trapping of gold aerosols
DEFF Research Database (Denmark)
Schmitt, Regina K.; Pedersen, Liselotte Jauffred; Taheri, S. M.
2015-01-01
Aerosol trapping has proven challenging and was only recently demonstrated.1 This was accomplished by utilizing an air chamber designed to have a minimum of turbulence and a laser beam with a minimum of aberration. Individual gold nano-particles with diameters between 80 nm and 200 nm were trapped...... in air using a 1064 nm laser. The positions visited by the trapped gold nano-particle were quantified using a quadrant photo diode placed in the back focal plane. The time traces were analyzed and the trapping stiffness characterizing gold aerosol trapping determined and compared to aerosol trapping...... of nanometer sized silica and polystyrene particles. Based on our analysis, we concluded that gold nano-particles trap more strongly in air than similarly sized polystyrene and silica particles. We found that, in a certain power range, the trapping strength of polystyrene particles is linearly decreasing...
Directed Assembly of Gold Nanoparticles
DEFF Research Database (Denmark)
Westerlund, Axel Rune Fredrik; Bjørnholm, Thomas
2009-01-01
As a complement to common "top-down" lithography techniques, "bottom-up" assembly techniques are emerging as promising tools to build nanoscale structures in a predictable way. Gold nanoparticles that are stable and relatively easy to synthesize are important building blocks in many such structures...... due to their useful optical and electronic properties. Programmed assembly of gold nanoparticles in one, two, and three dimensions is therefore of large interest. This review focuses on the progress from the last three years in the field of directed gold nanoparticle and nanorod assembly using...
Energy Technology Data Exchange (ETDEWEB)
Choi, Munsik; Kim, Nak-hyeon; Eom, Seyoung [Department of Biomedical Engineering, Kyung Hee University, Yongin 446-701 (Korea, Republic of); Kim, Tae Woo [School of East–West Medical Science, Kyung Hee University, Yongin 446-701 (Korea, Republic of); Byun, Kyung Min, E-mail: kmbyun@khu.ac.kr [Department of Biomedical Engineering, Kyung Hee University, Yongin 446-701 (Korea, Republic of); Park, Hyeong-Ho, E-mail: hyeongho.park@kanc.re.kr [Nano Process Division, Korea Advanced Nano Fab Center, Suwon 443-270 (Korea, Republic of)
2015-07-31
We report on a versatile method to fabricate gold nanocrown arrays on a thin gold film based on ultraviolet nanoimprint lithography and tilted evaporation technique. We realize highly ordered 2-dimensional nanocrown arrays and characterize their sizes and morphologies using scanning electron microscopy. To demonstrate an enhanced surface plasmon resonance (SPR) detection by the fabricated gold nanocrown samples, biosensing experiments are performed by measuring SPR angle shift for biotin–streptavidin interaction and bulk refractive index change of dielectric medium. We hope that the suggested plasmonic platform with a high sensitivity could be extended to a variety of biomolecular binding reactions. - Highlights: • Gold nanocrown arrays are produced by nanoimprint lithography and tilted evaporation. • Use of gold nanocrown arrays can improve the sensor sensitivity significantly. • Improved sensitivity is due to enhanced field–matter interaction at gold nanocrowns.
Roy, Sam; Upton, Phaedra; Craw, Dave
2018-01-01
Formation of placer accumulations in fluvial environments requires 103-106 or even greater times concentration of heavy minerals. For this to occur, regular sediment supply from erosion of adjacent topography is required, the river should remain within a single course for an extended period of time and the material must be reworked such that a high proportion of the sediment is removed while a high proportion of the heavy minerals remains. We use numerical modeling, constrained by observations of circum-Pacific placer gold deposits, to explore processes occurring in evolving river systems in dynamic tectonic environments. A fluvial erosion/transport model is used to determine the mobility of placer gold under variable uplift rate, storm intensity, and rock mass strength conditions. Gold concentration is calculated from hydraulic and bedload grain size conditions. Model results suggest that optimal gold concentration occurs in river channels that frequently approach a threshold between detachment-limited and transport-limited hydraulic conditions. Such a condition enables the accumulation of gold particles within the framework of a residual gravel lag. An increase in transport capacity, which can be triggered by faster uplift rates, more resistant bedrock, or higher intensity storm events, will strip all bedload from the channel. Conversely, a reduction in transport capacity, triggered by a reduction in uplift rate, bedrock resistance, or storm intensity, will lead to a greater accumulation of a majority of sediments and a net decrease in gold concentration. For our model parameter range, the optimal conditions for placer gold concentration are met by 103 times difference in strength between bedrock and fault, uplift rates between 1 and 5 mm a-1, and moderate storm intensities. Fault damage networks are shown to be a critical factor for high Au concentrations and should be a target for exploration.
Porous Gold Films Fabricated by Wet-Chemistry Processes
Directory of Open Access Journals (Sweden)
Aymeric Pastre
2016-01-01
Full Text Available Porous gold films presented in this paper are formed by combining gold electroless deposition and polystyrene beads templating methods. This original approach allows the formation of conductive films (2 × 106 (Ω·cm−1 with tailored and interconnected porosity. The porous gold film was deposited up to 1.2 μm on the silicon substrate without delamination. An original zirconia gel matrix containing gold nanoparticles deposited on the substrate acts both as an adhesion layer through the creation of covalent bonds and as a seed layer for the metallic gold film growth. Dip-coating parameters and gold electroless deposition kinetics have been optimized in order to create a three-dimensional network of 20 nm wide pores separated by 20 nm thick continuous gold layers. The resulting porous gold films were characterized by GIXRD, SEM, krypton adsorption-desorption, and 4-point probes method. The process is adaptable to different pore sizes and based on wet-chemistry. Consequently, the porous gold films presented in this paper can be used in a wide range of applications such as sensing, catalysis, optics, or electronics.
International Nuclear Information System (INIS)
Constantinescu, B.; Vasilescu, A.; Radtke, M.; Reinholz, U.
2009-01-01
The goal of the study is to verify if Transylvanian gold was used to manufacture Romanian archaeological objects using information related to trace elements: Sb, Te, Pb - recognized fingerprints for Carpathian Mountains mines and Sn characteristic for the panned river-bed (alluvional) gold. To solve these issues, samples (grains, nuggets,fine gold s and ) from various Transylvanian mines and rivers and some very small (few milligrams) fragments of archaeological objects are measured. During the experiment, point spectra for 22 natural gold samples from Tran sylvania and 18 m icronic s amples from archaeological objects were acquired at 34 keV excitation SR energy, using a spatially resolved SR-XRF set-up mounted for analyses at the hard X-ray beam line - BAMline at BESSY, Berlin. A summary for the characterization of Transylvanian native gold is the following: high (8 - 30%) Ag amounts and low (0.2 - 1%) Cu amounts; placer deposits (Valea Oltului, Stanija, Valea Pianului) contain as fingerprint Sn (150-300 ppm) - most probably from river bed cassiterite; primary deposits present as fingerprints Te (200-2000 ppm), Sb (150-300 ppm) - however, the samples are very inhomogeneous; primary deposit Sacaramb contains Te 0,25%, Sb (500 ppm), but also Sn ( 200 ppm); primary deposit Fizesti presents a big amount of Pb 1%, Sb (350 ppm), traces of Te and also Sn. As concerning the k oson d acian coins, the type w ith monogram i s made from refined (more than 97%) gold with no Sb, Te or Sn traces (remelted gold) and the type w ithout monogram i s clearly made from alluvial gold, partially combined with primary Transylvanian gold (Sn and Sb traces detected). A spectacular application of the micro-SR-XRF studies on native gold was the one of authentication of some recovered heritage artifacts: five Dacian gold bracelets exhibited at the National Museum of Romania's History, Bucharest. The Dacian multi-spiraled bracelets were made of gold; they belong to the classical period of the
International Nuclear Information System (INIS)
Papanikolos, G.; Lyra, M.; Kontogeorgakos, D.; Jordanou, J.; Vlahos, L.; Limouris, G.
2005-01-01
Full text: Optimum therapeutic management of patients suffering from metastatic bone pain, requires accurate calculations concerning absorbed dose by metastatic lesions and other critical organs, such as red marrow. Mean absorbed dose, which is the current parameter used to predict the efficacy of the treatment, can either overestimate or underestimate, actual doses delivered in these organs/tissues of interest (TOIs). This study presents differences in dosimetric calculations derived utilizing parameters from different sources (MIRDOSE3, MIRD Pamphlet No 11 and S values published by Bouchet et al.), in therapeutic schemes with Re186HEDP and Sm153EDTMP. A set of planar scintigraphic images for 2 groups of patients (1 for Re 186 patients and the other for Sm153 patients) were obtained in the following sequence: 2 during the first 24h post injection (the last of which at 24h post injection) and 2 more from 24h 7d post injection. Processing of the obtained images utilizing ROI quantitative methods, previously calibrated with waterphantom measurements, determine residence times and radionuclide uptakes not only by TOIs but by specific skeletal sites as well. Dosimetric calculations were performed using MIRDOSE3 computer code, S values from MIRD Pamphlet No 11 and site specific Re 186 and Sm 153 S values for several source target combinations within trabecular and cortical bone, reported by Bouchet et al. (J Nucl Med 2000; 41:189 212), along with cumulative site specific activities derived from values obtained by image processing. Skeletal averaged Re 186 and Sm 153 S values were also used from the aforementioned study by Bouchet et al. Time activity curves for various skeletal sites were generated for both groups of patients. Absorbed dose distributions along with time dose rate curves were derived for both red marrow and different regions of the skeleton. Comparisons are made between these parameters and mean absorbed doses calculated using skeletal averaged S values
International Nuclear Information System (INIS)
Chou Chau, Yuan-Fong; Lim, Chee Ming; Kumara, N. T. R. N.; Yoong, Voo Nyuk; Lee, Chuanyo; Huang, Hung Ji; Lin, Chun-Ting; Chiang, Hai-Pang
2016-01-01
Tunable surface plasmon resonance (SPR) and dipole cavity plasmon modes of the scattering cross section (SCS) spectra on the single solid-gold/gold-shell nanorod have been numerically investigated by using the finite element method. Various effects, such as the influence of SCS spectra under x- and y-polarizations on the surface of the single solid-gold/gold-shell nanorod, are discussed in detail. With the single gold-shell nanorod, one can independently tune the relative SCS spectrum width by controlling the rod length and rod diameter, and the surface scattering by varying the shell thickness and polarization direction, as well as the dipole peak energy. These behaviors are consistent with the properties of localized SPRs and offer a way to optically control and produce selected emission wavelengths from the single solid-gold/gold-shell nanorod. The electric field and magnetic distributions provide us a qualitative idea of the geometrical properties of the single solid-gold/gold-shell nanorod on plasmon resonance.
Physiological investigation of gold nanorods toward watermelon.
Wan, Yujie; Li, Junli; Ren, Hongxuan; Huang, Jin; Yuan, Hong
2014-08-01
The objective of the present study was to evaluate the phytotoxicity and oxidant stress of the gold nanorods toward watermelon, and hence give a quantitative risk assessment of both seeds and plants phase. The seed germination, the activity of antioxidant enzymes, and the contents of soluble protein and malondialdehyde (MDA) have been measured while the plant roots were observed by transmission electron microscopy (TEM). It was found that the gold nanorods significantly promoted the root elongation. Furthermore, the results on the enzymes activities of plant indicated that oxidative stress happened in the plant treated with gold nanorods. However, the gold nanorods resulted in the phytotoxicity toward plant especially at high concentration. The TEM images of the plant roots with and without the treatment of gold nanorods showed the significant different size of starch granules. In conclusion, significant physiological changes of plant occurred after treatment with the gold nanorods.
Gold leaf counter electrodes for dye-sensitized solar cells
Shimada, Kazuhiro; Toyoda, Takeshi
2018-03-01
In this study, a gold leaf 100 nm thin film is used as the counter electrode in dye-sensitized solar cells. The traditional method of hammering gold foil to obtain a thin gold leaf, which requires only small amounts of gold, was employed. The gold leaf was then attached to the substrate using an adhesive to produce the gold electrode. The proposed approach for fabricating counter electrodes is demonstrated to be facile and cost-effective, as opposed to existing techniques. Compared with electrodes prepared with gold foil and sputtered gold, the gold leaf counter electrode demonstrates higher catalytic activity with a cobalt-complex electrolyte and higher cell efficiency. The origin of the improved performance was investigated by surface morphology examination (scanning electron microscopy), various electrochemical analyses (cyclic voltammetry, linear sweep voltammetry, and electrochemical impedance spectroscopy), and crystalline analysis (X-ray diffractometry).
Electrochemical Oxidation of Glycerol Using Gold Electrode
International Nuclear Information System (INIS)
Mohamed Rozali Othman; Amirah Ahmad
2015-01-01
Cyclic voltammetry, potential linear V and chronocuolometry methods were carried out to gain electrochemical behavior of glycerol at a gold electrode. Potassium hydroxide and sulfuric acid were chosen to be the electrolyte for the electro-oxidation of this organic compound. Besides gold plate electrode, gold composite electrode (Au-PVC) was also used as the working electrode. The Au-PVC composite electrode was characterized by Scanning Electron Microscopy (SEM) to determine its morphological aspects before and after used in electrochemical oxidation of glycerol. In alkaline solution, the adsorption of hydroxide species onto the surface of both gold plate and composite Au-PVC electrodes occurs at potential around 500 mV vs SCE. However, at gold plate electrode, there was a small, broad peak before the drastic escalation of current densities which indicates the charge transfer of the chemisorbed OH - anion. In acidic media, the gold oxide was formed after potential 1.0 V. From the cyclic voltammogram glycerol undergo oxidation twice in potassium hydroxide at gold plate and Au-PVC composite electrodes, while in sulfuric acid, oxidation reaction happened once for glycerol on the gold plate electrode. Overall, electrochemical oxidation of glycerol was more effective in alkaline media. Tafel graph which plotted from potential linear V method shows that Au-PVC composite electrode is better than gold plate electrode for the electro-oxidation of glycerol in alkaline solution. Electrochemical oxidation of glycerol products as analyzed by Gas Chromatography-Mass Spectrometry (GC-MS) produced several carboxylic acids and phenolic compounds. (author)
Hydrofluorination of Alkynes Catalysed by Gold Bifluorides.
Nahra, Fady; Patrick, Scott R; Bello, Davide; Brill, Marcel; Obled, Alan; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David; Nolan, Steven P
2015-01-01
We report the synthesis of nine new N -heterocyclic carbene gold bifluoride complexes starting from the corresponding N -heterocyclic carbene gold hydroxides. A new methodology to access N,N' -bis(2,6-diisopropylphenyl)imidazol-2-ylidene gold(I) fluoride starting from N,N' -bis(2,6-diisopropylphenyl)imidazol-2-ylidene gold(I) hydroxide and readily available potassium bifluoride is also reported. These gold bifluorides were shown to be efficient catalysts in the hydrofluorination of symmetrical and unsymmetrical alkynes, thus affording fluorinated stilbene analogues and fluorovinyl thioethers in good to excellent yields with high stereo- and regioselectivity. The method is exploited further to access a fluorinated combretastatin analogue selectively in two steps starting from commercially available reagents.
Gold, currencies and market efficiency
Kristoufek, Ladislav; Vosvrda, Miloslav
2016-05-01
Gold and currency markets form a unique pair with specific interactions and dynamics. We focus on the efficiency ranking of gold markets with respect to the currency of purchase. By utilizing the Efficiency Index (EI) based on fractal dimension, approximate entropy and long-term memory on a wide portfolio of 142 gold price series for different currencies, we construct the efficiency ranking based on the extended EI methodology we provide. Rather unexpected results are uncovered as the gold prices in major currencies lay among the least efficient ones whereas very minor currencies are among the most efficient ones. We argue that such counterintuitive results can be partly attributed to a unique period of examination (2011-2014) characteristic by quantitative easing and rather unorthodox monetary policies together with the investigated illegal collusion of major foreign exchange market participants, as well as some other factors discussed in some detail.
Gold prices: Analyzing its cyclical behavior
Directory of Open Access Journals (Sweden)
Martha Gutiérrez
2013-07-01
Full Text Available Gold is a commodity that is seen as a safe haven when a financial crisis strikes, but when stock markets are prosperous, these are more attractive investment alternatives, and so the gold cycle goes on and on. The DJIA/GF (Dow Jones Industrial Average and Gold Fix ratio is chosen to establish the evolution of gold prices in relation to the NYSE. This paper has two goals: to prove that the DJIA/GF ratio is strongly cyclical by using Fourier analysis and to set a predictive neural networks model to forecast the behavior of this ratio during 2011-2020. To this end, business cycle events like the Great Depression along with the 1970s crisis, and the 1950s boom along with the world economic recovery of the 1990s are contrasted in light of the mentioned ratio. Gold prices are found to evolve cyclically with a dominant period of 37 years and are mainly affected by energy prices, financial markets and macroeconomic indicators.
Gold-Decorated Supraspheres of Block Copolymer Micelles
Kim, M. P.; Kang, D. J.; Kannon, A. G.; Jung, D.-W.; Yi, G. R.; Kim, B. J.
2012-02-01
Gold-decorated supraspheres displaying various surface morphologies were prepared by infiltration of gold precursor into polystyrene-b-poly(2-vinylpyridine) (PS-b-P2VP) supraspheres under acidic condition. The supraspheres were fabricated by emulsifying PS-b-P2VP polymer solution into surfactant solution. Selective swelling of P2VP in the suprasphere by gold precursor under acidic condition resulted in the formation of gold-decorated supraspheres with various surface structures. As evidenced by TEM and SEM images, dot pattern was formed in the case of smaller supraspheres than 800 nm; whereas fingerprint-like pattern was observed in larger supraspheres than 800 nm. Gold nanoparticles were located inside P2VP domains near the surface of prepared supraspheres as confirmed by TEM. The optical property of the supraspheres was characterized using UV-vis absorption spectroscopy and the maximum absorption peak at around 580 nm was observed, which means that gold nanoparticles densely packed into P2VP domain on the suprasphere. Our approach to prepare gold-decorated supraspheres can be extended to other metallic particles such as iron oxide or platinum nanoparticles, and those precursors can be also selectively incorporated into the P2VP domain.
López-Muñoz, Gerardo A; Estévez, M-Carmen; Vázquez-García, Marc; Berenguel-Alonso, Miguel; Alonso-Chamarro, Julián; Homs-Corbera, Antoni; Lechuga, Laura M
2018-05-01
Ultrasmooth gold/silver/gold trilayer nanostructured plasmonic sensors were obtained using commercial Blu-ray optical discs as nanoslits-based flexible polymer substrates. A thin gold film was used as an adhesion and nucleation layer to improve the chemical stability and reduce the surface roughness of the overlying silver film, without increasing ohmic plasmon losses. The structures were physically and optically characterized and compared with nanostructures of single gold layer. Ultrasmooth and chemically stable trilayer nanostructures with a surface roughness <0.5 nm were obtained following a simple and reproducible fabrication process. They showed a figure of merit (FOM) value up to 69.2 RIU -1 which is significantly higher (more than 95%) than the gold monolayer counterpart. Their potential for biosensing was demonstrated by employing the trilayer sensor for the direct and refractometric (label-free) detection of C-reactive protein (CRP) biomarker in undiluted urine achieving a Limit of Detection (LOD) in the pM order. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Glyco-gold nanoparticles: synthesis and applications
Compostella, Federica; Pitirollo, Olimpia; Silvestri, Alessandro; Polito, Laura
2017-01-01
Glyco-gold nanoparticles combine in a single entity the peculiar properties of gold nanoparticles with the biological activity of carbohydrates. The result is an exciting nanosystem, able to mimic the natural multivalent presentation of saccharide moieties and to exploit the peculiar optical properties of the metallic core. In this review, we present recent advances on glyco-gold nanoparticle applications in different biological fields, highlighting the key parameters which inspire the glyco ...
Cross-correlations and influence in world gold markets
Lin, Min; Wang, Gang-Jin; Xie, Chi; Stanley, H. Eugene
2018-01-01
Using the detrended cross-correlation analysis (DCCA) coefficient and the detrended partial cross-correlation analysis (DPCCA) coefficient, we investigate cross-correlations and net cross-correlations among five major world gold markets (London, New York, Shanghai, Tokyo, and Mumbai) at different time scales. We propose multiscale influence measures for examining the influence of individual markets on other markets and on the entire system. We find (i) that the cross-correlations, net cross-correlations, and net influences among the five gold markets vary across time scales, (ii) that the cross-market correlation between London and New York at each time scale is intense and inherent, meaning that the influence of other gold markets on the London-New York market is negligible, (iii) that the remaining cross-market correlations (i.e., those other than London-New York) are greatly affected by other gold markets, and (iv) that the London gold market significantly affects the other four gold markets and dominates the world-wide gold market. Our multiscale findings give market participants and market regulators new information on cross-market linkages in the world-wide gold market.
DEFF Research Database (Denmark)
Neumann, Tim; Rasmussen, Mette; Ghith, Nermin
2013-01-01
To evaluate the real-life effect of an evidence-based Gold Standard Programme (GSP) for smoking cessation interventions in disadvantaged patients and to identify modifiable factors that consistently produce the highest abstinence rates.......To evaluate the real-life effect of an evidence-based Gold Standard Programme (GSP) for smoking cessation interventions in disadvantaged patients and to identify modifiable factors that consistently produce the highest abstinence rates....
Gold nanoprobes for theranostics
Panchapakesan, Balaji; Book-Newell, Brittany; Sethu, Palaniappan; Rao, Madhusudhana; Irudayaraj, Joseph
2011-01-01
Gold nanoprobes have become attractive diagnostic and therapeutic agents in medicine and life sciences research owing to their reproducible synthesis with atomic level precision, unique physical and chemical properties, versatility of their morphologies, flexibility in functionalization, ease of targeting, efficiency in drug delivery and opportunities for multimodal therapy. This review highlights some of the recent advances and the potential for gold nanoprobes in theranostics. PMID:22122586
The effect of cysteine on electrodeposition of gold nanoparticle
International Nuclear Information System (INIS)
Dolati, A.; Imanieh, I.; Salehi, F.; Farahani, M.
2011-01-01
Highlights: → Cysteine was found as an appropriate additive for electrodeposition of gold nanoparticles. → The deposition mechanism of gold nanoparticle was determined as instantaneous nucleation. → Oxygen reduction on the gold nanoparticle surface was eight times greater than that on the conventional gold deposits. - Abstract: The most applications of gold nanoparticles are in the photo-electronical accessories and bio-chemical sensors. Chloride solution with cysteine additive was used as electrolyte in gold nanoparticles electrodeposition. The nucleation and growing mechanism were studied by electrochemical techniques such as cyclic voltammetry and chronoamperometry, in order to obtain a suitable nano structure. The deposition mechanism was determined as instantaneous nucleation and the dimension of particles was controlled in nanometric particle size range. Atomic Force Microscope was used to evaluate the effect of cysteine on the morphology and topography of gold nanoparticles. Finally the catalytic property of gold nanoparticle electrodeposited was studied in KOH solution, where oxygen reduction on the gold nanoparticle surface was eight times greater than that on the conventional gold deposits.
Structure and reactivity of a mononuclear gold(II) complex
Preiß, Sebastian; Förster, Christoph; Otto, Sven; Bauer, Matthias; Müller, Patrick; Hinderberger, Dariush; Hashemi Haeri, Haleh; Carella, Luca; Heinze, Katja
2017-12-01
Mononuclear gold(II) complexes are very rare labile species. Transient gold(II) species have been suggested in homogeneous catalysis and in medical applications, but their geometric and electronic structures have remained essentially unexplored: even fundamental data, such as the ionic radius of gold(II), are unknown. Now, an unprecedentedly stable neutral gold(II) complex of a porphyrin derivative has been isolated, and its structural and spectroscopic features determined. The gold atom adopts a 2+2 coordination mode in between those of gold(III) (four-coordinate square planar) and gold(I) (two-coordinate linear), owing to a second-order Jahn-Teller distortion enabled by the relativistically lowered 6s orbital of gold. The reactivity of this gold(II) complex towards dioxygen, nitrosobenzene and acids is discussed. This study provides insight on the ionic radius of gold(II), and allows it to be placed within the homologous series of nd9 Cu/Ag/Au divalent ions and the 5d8/9/10 Pt/Au/Hg 'relativistic' triad in the periodic table.
Chaves, Joana Darc Souza; Damasceno, Jaqueline Lopes; Paula, Marcela Cristina Ferreira; de Oliveira, Pollyanna Francielli; Azevedo, Gustavo Chevitarese; Matos, Renato Camargo; Lourenço, Maria Cristina S; Tavares, Denise Crispim; Silva, Heveline; Fontes, Ana Paula Soares; de Almeida, Mauro Vieira
2015-10-01
Novel gold(I) and gold(III) complexes containing derivatives of D-galactose, D-ribose and D-glucono-1,5-lactone as ligands were synthesized and characterized by IR, (1)H, and (13)C NMR, high resolution mass spectra and cyclic voltammetry. The compounds were evaluated in vitro for their cytotoxicity against three types of tumor cells: cervical carcinoma (HeLa) breast adenocarcinoma (MCF-7) and glioblastoma (MO59J) and one non-tumor cell line: human lung fibroblasts (GM07492A). Their antitubercular activity was evaluated as well expressed as the minimum inhibitory concentration (MIC90) in μg/mL. In general, the gold(I) complexes were more active than gold(III) complexes, for example, the gold(I) complex (1) was about 8.8 times and 7.6 times more cytotoxic than gold(III) complex (8) in MO59J and MCF-7 cells, respectively. Ribose and alkyl phosphine derivative complexes were more active than galactose and aryl phosphine complexes. The presence of a thiazolidine ring did not improve the cytotoxicity. The study of the cytotoxic activity revealed effective antitumor activities for the gold(I) complexes, being more active than cisplatin in all the tested tumor cell lines. Gold(I) compounds (1), (2), (3), (4) and (6) exhibited relevant antitubercular activity even when compared with first line drugs such as rifampicin.
Increased cellular uptake of peptide-modified PEGylated gold nanoparticles.
He, Bo; Yang, Dan; Qin, Mengmeng; Zhang, Yuan; He, Bing; Dai, Wenbing; Wang, Xueqing; Zhang, Qiang; Zhang, Hua; Yin, Changcheng
2017-12-09
Gold nanoparticles are promising drug delivery vehicles for nucleic acids, small molecules, and proteins, allowing various modifications on the particle surface. However, the instability and low bioavailability of gold nanoparticles compromise their clinical application. Here, we functionalized gold nanoparticles with CPP fragments (CALNNPFVYLI, CALRRRRRRRR) through sulfhydryl PEG to increase their stability and bioavailability. The resulting gold nanoparticles were characterized with transmission electron microscopy (TEM), dynamic light scattering (DLS), UV-visible spectrometry and X-ray photoelectron spectroscopy (XPS), and the stability in biological solutions was evaluated. Comparing to PEGylated gold nanoparticles, CPP (CALNNPFVYLI, CALRRRRRRRR)-modified gold nanoparticles showed 46 folds increase in cellular uptake in A549 and B16 cell lines, as evidenced by the inductively coupled plasma atomic emission spectroscopy (ICP-AES). The interactions between gold nanoparticles and liposomes indicated CPP-modified gold nanoparticles bind to cell membrane more effectively than PEGylated gold nanoparticles. Surface plasmon resonance (SPR) was used to measure interactions between nanoparticles and the membrane. TEM and uptake inhibitor experiments indicated that the cellular entry of gold nanoparticles was mediated by clathrin and macropinocytosis. Other energy independent endocytosis pathways were also identified. Our work revealed a new strategy to modify gold nanoparticles with CPP and illustrated the cellular uptake pathway of CPP-modified gold nanoparticles. Copyright © 2017 Elsevier Inc. All rights reserved.
Antifungal activity of gold nanoparticles prepared by solvothermal method
Energy Technology Data Exchange (ETDEWEB)
Ahmad, Tokeer, E-mail: tahmad3@jmi.ac.in [Nanochemistry Laboratory, Department of Chemistry, Jamia Millia Islamia, New Delhi 110025 (India); Wani, Irshad A.; Lone, Irfan H.; Ganguly, Aparna [Nanochemistry Laboratory, Department of Chemistry, Jamia Millia Islamia, New Delhi 110025 (India); Manzoor, Nikhat; Ahmad, Aijaz [Department of Biosciences, Jamia Millia Islamia, New Delhi 110025 (India); Ahmed, Jahangeer [Department of Chemistry, Michigan State University, East Lansing, MI 48824 (United States); Al-Shihri, Ayed S. [Department of Chemistry, Faculty of Science, King Khalid University, Abha 61413, P.O. Box 9004 (Saudi Arabia)
2013-01-15
Graphical abstract: Gold nanoparticles (7 and 15 nm) of very high surface area (329 and 269 m{sup 2}/g) have been successfully synthesized through solvothermal method by using tin chloride and sodium borohydride as reducing agents. As-prepared gold nanoparticles shows very excellent antifungal activity against Candida isolates and activity increases with decrease in the particle size. Display Omitted Highlights: ► Effect of reducing agents on the morphology of gold nanoparticles. ► Highly uniform and monodisperse gold nanoparticles (7 nm). ► Highest surface area of gold nanoparticles (329 m{sup 2/}g). ► Excellent antifungal activity of gold nanoparticles against Candida strains. -- Abstract: Gold nanoparticles have been successfully synthesized by solvothermal method using SnCl{sub 2} and NaBH{sub 4} as reducing agents. X-ray diffraction studies show highly crystalline and monophasic nature of the gold nanoparticles with face centred cubic structure. The transmission electron microscopic studies show the formation of nearly spherical gold nanoparticles of average size of 15 nm using SnCl{sub 2}, however, NaBH{sub 4} produced highly uniform, monodispersed and spherical gold nanoparticles of average grain size of 7 nm. A high surface area of 329 m{sup 2}/g for 7 nm and 269 m{sup 2}/g for 15 nm gold nanoparticles was observed. UV–vis studies assert the excitations over the visible region due to transverse and longitudinal surface plasmon modes. The gold nanoparticles exhibit excellent size dependant antifungal activity and greater biocidal action against Candida isolates for 7 nm sized gold nanoparticles restricting the transmembrane H{sup +} efflux of the Candida species than 15 nm sized gold nanoparticles.
Antifungal activity of gold nanoparticles prepared by solvothermal method
International Nuclear Information System (INIS)
Ahmad, Tokeer; Wani, Irshad A.; Lone, Irfan H.; Ganguly, Aparna; Manzoor, Nikhat; Ahmad, Aijaz; Ahmed, Jahangeer; Al-Shihri, Ayed S.
2013-01-01
Graphical abstract: Gold nanoparticles (7 and 15 nm) of very high surface area (329 and 269 m 2 /g) have been successfully synthesized through solvothermal method by using tin chloride and sodium borohydride as reducing agents. As-prepared gold nanoparticles shows very excellent antifungal activity against Candida isolates and activity increases with decrease in the particle size. Display Omitted Highlights: ► Effect of reducing agents on the morphology of gold nanoparticles. ► Highly uniform and monodisperse gold nanoparticles (7 nm). ► Highest surface area of gold nanoparticles (329 m 2/ g). ► Excellent antifungal activity of gold nanoparticles against Candida strains. -- Abstract: Gold nanoparticles have been successfully synthesized by solvothermal method using SnCl 2 and NaBH 4 as reducing agents. X-ray diffraction studies show highly crystalline and monophasic nature of the gold nanoparticles with face centred cubic structure. The transmission electron microscopic studies show the formation of nearly spherical gold nanoparticles of average size of 15 nm using SnCl 2 , however, NaBH 4 produced highly uniform, monodispersed and spherical gold nanoparticles of average grain size of 7 nm. A high surface area of 329 m 2 /g for 7 nm and 269 m 2 /g for 15 nm gold nanoparticles was observed. UV–vis studies assert the excitations over the visible region due to transverse and longitudinal surface plasmon modes. The gold nanoparticles exhibit excellent size dependant antifungal activity and greater biocidal action against Candida isolates for 7 nm sized gold nanoparticles restricting the transmembrane H + efflux of the Candida species than 15 nm sized gold nanoparticles.
The gold standard: gold nanoparticle libraries to understand the nano-bio interface.
Alkilany, Alaaldin M; Lohse, Samuel E; Murphy, Catherine J
2013-03-19
Since the late 1980s, researchers have prepared inorganic nanoparticles of many types--including elemental metals, metal oxides, metal sulfides, metal selenides, and metal tellurides--with excellent control over size and shape. Originally many researchers were primarily interested in exploring the quantum size effects predicted for such materials. Applications of inorganic nanomaterials initially centered on physics, optics, and engineering but have expanded to include biology. Many current nanomaterials can serve as biochemical sensors, contrast agents in cellular or tissue imaging, drug delivery vehicles, or even as therapeutics. In this Account we emphasize that the understanding of how nanomaterials will function in a biological system relies on the knowledge of the interface between biological systems and nanomaterials, the nano-bio interface. Gold nanoparticles can serve as excellent standards to understand more general features of the nano-bio interface because of its many advantages over other inorganic materials. The bulk material is chemically inert, and well-established synthetic methods allow researchers to control its size, shape, and surface chemistry. Gold's background concentration in biological systems is low, which makes it relatively easy to measure it at the part-per-billion level or lower in water. In addition, the large electron density of gold enables relatively simple electron microscopic experiments to localize it within thin sections of cells or tissue. Finally, gold's brilliant optical properties at the nanoscale are tunable with size, shape, and aggregation state and enable many of the promising chemical sensing, imaging, and therapeutic applications. Basic experiments with gold nanoparticles and cells include measuring the toxicity of the particles to cells in in vitro experiments. The species other than gold in the nanoparticle solution can be responsible for the apparent toxicity at a particular dose. Once the identity of the toxic
Subchronic inhalation toxicity of gold nanoparticles
Directory of Open Access Journals (Sweden)
Chung Yong
2011-05-01
Full Text Available Abstract Background Gold nanoparticles are widely used in consumer products, including cosmetics, food packaging, beverages, toothpaste, automobiles, and lubricants. With this increase in consumer products containing gold nanoparticles, the potential for worker exposure to gold nanoparticles will also increase. Only a few studies have produced data on the in vivo toxicology of gold nanoparticles, meaning that the absorption, distribution, metabolism, and excretion (ADME of gold nanoparticles remain unclear. Results The toxicity of gold nanoparticles was studied in Sprague Dawley rats by inhalation. Seven-week-old rats, weighing approximately 200 g (males and 145 g (females, were divided into 4 groups (10 rats in each group: fresh-air control, low-dose (2.36 × 104 particle/cm3, 0.04 μg/m3, middle-dose (2.36 × 105 particle/cm3, 0.38 μg/m3, and high-dose (1.85 × 106 particle/cm3, 20.02 μg/m3. The animals were exposed to gold nanoparticles (average diameter 4-5 nm for 6 hours/day, 5 days/week, for 90-days in a whole-body inhalation chamber. In addition to mortality and clinical observations, body weight, food consumption, and lung function were recorded weekly. At the end of the study, the rats were subjected to a full necropsy, blood samples were collected for hematology and clinical chemistry tests, and organ weights were measured. Cellular differential counts and cytotoxicity measurements, such as albumin, lactate dehydrogenase (LDH, and total protein were also monitored in a cellular bronchoalveolar lavage (BAL fluid. Among lung function test measurements, tidal volume and minute volume showed a tendency to decrease comparing control and dose groups during the 90-days of exposure. Although no statistically significant differences were found in cellular differential counts, histopathologic examination showed minimal alveoli, an inflammatory infiltrate with a mixed cell type, and increased macrophages in the high-dose rats. Tissue
Genesis of uranium-gold pyritic conglomerates
International Nuclear Information System (INIS)
Myers, W.B.
1981-01-01
The ancient pyritic ore conglomerates have a common origin best exemplified by the Witwatersrand deposits. All contain detrital pyrite and uraninite, which are unstable in modern oxygenated environments and were deposited in a reducing atmosphere. The Rand reefs are not similar to modern gold placers. Placers result from the near incapacity of streams and currents to transport coarse gold. Placers as rich as Rand reef occur only in narrow paystreaks within 15 kilometers of a coarse-gold source. The board dispersion of gold in the reefs is due to solution transport of metal complexed as aurous sulfide, leached anoxygenically from crustal rocks, probably from sea-floor basalt, and precipitated by a slow reaction driven by the radioactive decay of detrital uraninite. Radiolysis of water on shallow marine unconformities resulted in diffusion of hydrogen to the atmosphere and a slight excess of hydroxyl free radical in the reef environment. The mild oxidizing tendency slowly dissolved uranium, precipitated gold, and oxygenated thucholite. These actions define a maturing process. A uraninite placer accumulating on an unconformity becomes progressively converted to a gold reef with little residual uraninite. The most mature reefs tend to grade toward the thucholite-seam type, very thin but exceedingly rich in gold. A combination of chemical attack and physical reworking accounts for the general thinness of mature reefs. Pyrite, like uraninite, decreases in abundance with increasing maturity; buffering by pyrite moderated the oxidative depletion of uranium. Where pyrite was scanty or absent, uraninite was completely dissolved by the effects of radiolysis and no ore formed
Single layer porous gold films grown at different temperatures
International Nuclear Information System (INIS)
Zhang Renyun; Hummelgard, Magnus; Olin, Hakan
2010-01-01
Large area porous gold films can be used in several areas including electrochemical electrodes, as an essential component in sensors, or as a conducting material in electronics. Here, we report on evaporation induced crystal growth of large area porous gold films at 20, 40 and 60 deg. C. The gold films were grown on liquid surface at 20 deg. C, while the films were grown on the wall of beakers when temperature increased to 40 and 60 deg. C. The porous gold films consisted of a dense network of gold nanowires as characterized by TEM and SEM. TEM diffraction results indicated that higher temperature formed larger crystallites of gold wires. An in situ TEM imaging of the coalescence of gold nanoparticles mimicked the process of the growth of these porous films, and a plotting of the coalescence time and the neck radius showed a diffusion process. The densities of these gold films were also characterized by transmittance, and the results showed film grown at 20 deg. C had the highest density, while the film grown at 60 deg. C had the lowest consistent with SEM and TEM characterization. Electrical measurements of these gold films showed that the most conductive films were the ones grown at 40 deg. C. The conductivities of the gold films were related to the amount of contamination, density and the diameter of the gold nanowires in the films. In addition, a gold film/gold nanoparticle hybrid was made, which showed a 10% decrease in transmittance during hybridization, pointing to applications as chemical and biological sensors.
CO oxidation on gold nanoparticles: Theoretical studies
DEFF Research Database (Denmark)
Remediakis, Ioannis; Lopez, Nuria; Nørskov, Jens Kehlet
2005-01-01
We present a summary of our theoretical results regarding CO oxidation on both oxide-supported and isolated gold nanoparticles. Using Density Functional Theory we have studied the adsorption of molecules and the oxidation reaction of CO on gold clusters. Low-coordinated sites on the gold...... nanoparticles can adsorb small inorganic molecules such as O2 and CO, and the presence of these sites is the key factor for the catalytic properties of supported gold nanoclusters. Other contributions, induced by the presence of the support, can provide parallel channels for the reaction and modulate the final...
Use of coal-oil agglomerates for particulate gold recovery
Energy Technology Data Exchange (ETDEWEB)
Calvez, J.P.S.; Kim, M.J.; Wong, P.L.M.; Tran, T. [University of New South Wales, Sydney, NSW (Australia). School of Chemical Engineering and Industrial Chemistry
1998-09-01
The underlying principles by which gold is recovered by coal-oil agglomerates was investigated. The effects of various parameters such as oil:coal ratios, agglomerate:ore ratios, pH and coal particle size on gold recovery were evaluated using synthetic gold bearing samples, bituminous coal, and diesel oil and kerosene. The effects of sulfides on gold recovery and the depth of gold particle penetration within the agglomerates were also investigated. Results showed that gold recovery was increased by increasing agglomerate:ore ratio, decreasing oil:coal ratio and decreasing coal particle size. There was no significant difference in gold recoveries at pH range of 4-12 and at up to 5% sulfides in the feed.
Preparation of gold nanoparticles by arc discharge in water
International Nuclear Information System (INIS)
Lung, Jen-Kuang; Huang, Jen-Chuen; Tien, Der-Chi; Liao, Chih-Yu; Tseng, Kuo-Hsiung; Tsung, Tsing-Tshin; Kao, Wen-Shiow; Tsai, Teh-Hua; Jwo, Ching-Song; Lin, Hong-Ming; Stobinski, Leszek
2007-01-01
Gold nanoparticles have been attracting attention due to their extensive application in chemistry, physics, material science, electronics, catalysis and bionanotechnology. Synthesis of gold nanoparticles often involves toxic and expensive physical-chemistry methods. Preparation of gold nanoparticles by arc discharge in water is proposed for the first time. Fabrication of gold nanostructures in deionized water has been successfully established. The evidence of gold particles' light absorbance reveals a unique surface plasmon resonance for Au nanoparticles suspended in deionized water. Gold nanostructures uniformly dispersed in water, their UV-Vis absorption and crystalline size are shown. Our experimental results demonstrate that fabrication of gold nanoparticles by arc discharge in water is an alternative, cheap, effective and environmentally friendly method
Geochemical indicators of gold ore fields
International Nuclear Information System (INIS)
Shcherbakov, Yu.G.
1995-01-01
The principles of selection of indicators for genetic reconstructions and prognostic valuations of gold mineralization of diverse morphological and geochemical types have been substantiated. The neutron-activation analysis with radiochemical separation and detection limit of 1-10 -8 %, instrumental neutron-activation analysis and atomic-absorption analysis are the main methods of determination of gold low contents in the rocks, as well as diverse elements, including transition, rare earth elements and tellurium, in gold. 50 refs.; 1 fig.; 3 tabs
Glyco-gold nanoparticles: synthesis and applications
Directory of Open Access Journals (Sweden)
Federica Compostella
2017-05-01
Full Text Available Glyco-gold nanoparticles combine in a single entity the peculiar properties of gold nanoparticles with the biological activity of carbohydrates. The result is an exciting nanosystem, able to mimic the natural multivalent presentation of saccharide moieties and to exploit the peculiar optical properties of the metallic core. In this review, we present recent advances on glyco-gold nanoparticle applications in different biological fields, highlighting the key parameters which inspire the glyco nanoparticle design.
Thiosulfate leaching of gold from waste mobile phones.
Ha, Vinh Hung; Lee, Jae-chun; Jeong, Jinki; Hai, Huynh Trung; Jha, Manis K
2010-06-15
The present communication deals with the leaching of gold from the printed circuit boards (PCBs) of waste mobile phones using an effective and less hazardous system, i.e., a copper-ammonia-thiosulfate solution, as an alternative to the conventional and toxic cyanide leaching of gold. The influence of thiosulfate, ammonia and copper sulfate concentrations on the leaching of gold from PCBs of waste mobile phones was investigated. Gold extraction was found to be enhanced with solutions containing 15-20 mM cupric, 0.1-0.14 M thiosulfate, and 0.2-0.3 M ammonia. Similar trends were obtained for the leaching of gold from two different types of scraps and PCBs of waste mobile phones. From the scrap samples, 98% of the gold was leached out using a solution containing 20 mM copper, 0.12 M thiosulfate and 0.2 M ammonia. Similarly, the leaching of gold from the PCBs samples was also found to be good, but it was lower than that of scrap samples in similar experimental conditions. In this case, only 90% of the gold was leached, even with a contact time of 10h. The obtained data will be useful for the development of processes for the recycling of gold from waste mobile phones. Copyright 2010 Elsevier B.V. All rights reserved.
Geochemical methodology for gold prospect ion in Uruguay
International Nuclear Information System (INIS)
Spangenber, J.
1987-01-01
This work is about the history of gold prospection in Uruguay. In this study there are considered the geochemical aspects, the gold performance, the applicability to mining prospection and the gold prospection aluvionar
Directory of Open Access Journals (Sweden)
Vestbo J
2012-09-01
Full Text Available Jørgen VestboUniversity of Manchester, Manchester, UKI read with interest the paper entitled "Diagnosis of airway obstruction in the elderly: contribution of the SARA study" by Sorino et al in a recent issue of this journal.1 Being involved in the Global Initiative for Obstructive Lung Diseases (GOLD, it is nice to see the interest sparked by the GOLD strategy document. However, in the paper by Sorino et al, there are a few misunderstandings around GOLD and the fixed ratio (forced expiratory volume in 1 second/forced volume vital capacity < 0.70 that need clarification.View original paper by Sorino and colleagues.
Directory of Open Access Journals (Sweden)
Leonarda F. Liotta
2014-07-01
Full Text Available Gold is an element that has fascinated mankind for millennia. The catalytic properties of gold have been a source of debate, due to its complete chemical inertness when in a bulk form, while it can oxidize CO at temperatures as low as ~200 K when in a nanocrystalline state, as discovered by Haruta in the late 1980s [1]. Since then, extensive activity in both applied and fundamental research on gold has been initiated. The importance of the catalysis by gold represents one of the fasted growing fields in science and is proven by the promising applications in several fields, such as green chemistry and environmental catalysis, in the synthesis of single-walled carbon nanotubes, as modifiers of Ni catalysts for methane steam and dry reforming reactions and in biological and electrochemistry applications. The range of reactions catalyzed by gold, as well as the suitability of different supports and the influence of the preparation conditions have been widely explored and optimized in applied research [2]. Gold catalysts appeared to be very different from the other noble metal-based catalysts, due to their marked dependence on the preparation method, which is crucial for the genesis of the catalytic activity. Several methods, including deposition-precipitation, chemical vapor deposition and cation adsorption, have been applied for the preparation of gold catalysts over reducible oxides, like TiO2. Among these methods, deposition-precipitation has been the most frequently employed method for Au loading, and it involves the use of tetrachloroauric (III acid as a precursor. On the other hand, the number of articles dealing with Au-loaded acidic supports is smaller than that on basic supports, possibly because the deposition of [AuCl4]− or [AuOHxCl4−x]− species on acidic supports is difficult, due to their very low point of zero charge. Despite this challenge, several groups have reported the use of acidic zeolites as supports for gold. Zeolites
Phytomining for Artisanal Gold Mine Tailings Management
Directory of Open Access Journals (Sweden)
Baiq Dewi Krisnayanti
2016-08-01
Full Text Available Mine tailings are generally disposed of by artisanal and small scale gold miners in poorly constructed containment areas and this leads to environmental risk. Gold phytomining could be a possible option for tailings management at artisanal and small-scale gold mining (ASGM locations where plants accumulate residual gold in their above ground biomass. The value of metal recovered from plants could offset some of the costs of environmental management. Getting gold into plants has been repeatedly demonstrated by many research groups; however, a simple working technology to get gold out of plants is less well described. A field experiment to assess the relevance of the technology to artisanal miners was conducted in Central Lombok, Indonesia between April and June 2015. Tobacco was planted in cyanidation tailings (1 mg/kg gold and grown for 2.5 months before the entire plot area was irrigated with NaCN to induce metal uptake. Biomass was then harvested (100 kg, air dried, and ashed by miners in equipment currently used to ash activated carbon at the end of a cyanide leach circuit. Borax and silver as a collector metal were added to the tobacco ash and smelted at high temperature to extract metals from the ash. The mass of the final bullion (39 g was greater than the mass of silver used as a collector (31 g, indicating recovery of metals from the biomass through the smelt process. The gold yield of this trial was low (1.2 mg/kg dry weight biomass concentration, indicating that considerable work must still be done to optimise valuable metal recovery by plants at the field scale. However, the described method to process the biomass was technically feasible, and represents a valid technique that artisanal and small-scale gold miners are willing to adopt if the economic case is good.
Multifunctional gold nanoparticles for photodynamic therapy of cancer
Khaing Oo, Maung Kyaw
As an important and growing branch of photomedicine, photodynamic therapy (PDT) is being increasingly employed in clinical applications particularly for the treatment of skin cancer. This dissertation focuses on the synthesis, characterization and deployment of gold nanoparticles for enhanced PDT of fibrosarcoma cancer cells. We have developed robust strategies and methods in fabrication of gold nanoparticles with positively- and negatively-tethered surface charges by photo-reduction of gold chloride salt using branched polyethyleneimine and sodium citrate respectively. An optimal concentration window of gold salt has been established to yield the most stable and monodispersed gold nanoparticles. 5-aminolevulinic acid (5-ALA), a photosensitizing precursor, has been successfully conjugated on to positively charged gold nanoparticles through electrostatic interactions. The 5-ALA/gold nanoparticle conjugates are biocompatible and have shown to be preferably taken up by cancer cells. Subsequent light irradiation results in the generation of reactive oxygen species (ROS) in cancer cells, leading to their destruction without adverse effects on normal fibroblasts. We have demonstrated for the first time that gold nanoparticles can enhance PDT efficacy by 50% compared to the treatment with 5-ALA alone. Collected evidence has strongly suggested that this enhancement stems from the elevated formation of ROS via the strongly localized electric field of gold nanoparticles. Through single cell imaging using surface-enhanced Raman scattering enabled by the very same gold nanoparticles, we have shown that multifunctionality of gold nanoparticles can be harvested concurrently for biomedical applications in general and for PDT in specific. In other words, gold nanoparticles can be used not only for targeted drug delivery and field-enhanced ROS formation, but also for monitoring cell destructions during PDT. Finally, our COMSOL Multiphysics simulation of the size-dependent electric
Morphology dependent electrical transport behavior in gold nanostructures
International Nuclear Information System (INIS)
Alkhatib, A.; Souier, T.; Chiesa, M.
2011-01-01
The mechanism of electron transport in ultra-thin gold films is investigated and its dependence on the gold islands size is reported. For gold films of thickness below 38 nm, the electrical transport occurs by tunneling within electrically discontinuous islands of gold. Simmons model for metal-insulator-metal junction describes the non-ohmic experimental current-voltage curves obtained by means of conductive atomic force microscopy. Field emission is the predominant transport for thicknesses below 23 nm while direct tunneling occurs in thicker films. The transition between the two regimes is controlled by the gold islands size and their inter-distance.
Formation of neutral and charged gold carbonyls on highly facetted gold nanostructures
Chau, Thoi-Dai; Visart de Bocarmé, Thierry; Kruse, Norbert; Wang, Richard L. C.; Kreuzer, Hans Jürgen
2003-12-01
We show that gold mono- and di-carbonyls are formed on gold field emitter tips during interaction with carbon monoxide gas at room temperature and in the presence of high electrostatic fields. The experiments are done in a time-of-flight atom probe to obtain mass spectra. The yield of monocarbonyl cations is about twice that of di-carbonyl ions. Density functional theory calculations are reported that explain the field stabilization of adsorbed carbonyls and the desorption yield of their cations.
Phospholipid-assisted synthesis of size-controlled gold nanoparticles
International Nuclear Information System (INIS)
He Peng; Zhu Xinyuan
2007-01-01
Morphology and size control of gold nanoparticles (AuNPs) by phospholipids (PLs) has been reported. It was found that gold entities could form nanostructures with different sizes controlled by PLs in an aqueous solution. During the preparation of 1.5 nm gold seeds, AuNPs were obtained from the reduction of gold complex by sodium borohydride and capped by citrate for stabilization. With the different ratios between seed solution and growth solution, which was composed by gold complex and PLs, gold seeds grew into larger nanoparticles step by step until enough large size up to 30 nm. The main discovery of this work is that common biomolecules, such as PLs can be used to control nanoparticle size. This conclusion has been confirmed by transmission electron micrographs, particle size analysis, and UV-vis spectra
Determination of gold coating thickness measurement by using EDXRF
International Nuclear Information System (INIS)
Meor Yusoff Meor Sulaian; Masliana Muslimin; Fadlullah Jili Fursani
2005-01-01
The paper relates a study on the development of an analysis procedure for measuring the gold coating thickness using EDXRF technique. Gold coating thickness was measured by relating the counts under the Au L? peak its thickness value. In order to get a reasonably accurate result, a calibration graph was plotted using five gold-coated reference standards of different thickness. The calibration graph shows a straight line for thin coating measurement until 0.9 μm. Beyond this the relationship was not linear and this may be resulted from the self-absorption effect. Quantitative analysis was also performed on two different samples of gold coated jewelry and a phone connector. Result from the phone connector analysis seems to agree with the manufacturer gold coating value. From the analysis of gold-coated jewelry it had been able to differentiate the two articles as gold wash and gold electroplated. (Author)
Gold nanoparticle-based electrochemical biosensors
International Nuclear Information System (INIS)
Pingarron, Jose M.; Yanez-Sedeno, Paloma; Gonzalez-Cortes, Araceli
2008-01-01
The unique properties of gold nanoparticles to provide a suitable microenvironment for biomolecules immobilization retaining their biological activity, and to facilitate electron transfer between the immobilized proteins and electrode surfaces, have led to an intensive use of this nanomaterial for the construction of electrochemical biosensors with enhanced analytical performance with respect to other biosensor designs. Recent advances in this field are reviewed in this article. The advantageous operational characteristics of the biosensing devices designed making use of gold nanoparticles are highlighted with respect to non-nanostructured biosensors and some illustrative examples are commented. Electrochemical enzyme biosensors including those using hybrid materials with carbon nanotubes and polymers, sol-gel matrices, and layer-by-layer architectures are considered. Moreover, electrochemical immunosensors in which gold nanoparticles play a crucial role in the electrode transduction enhancement of the affinity reaction as well as in the efficiency of immunoreagents immobilization in a stable mode are reviewed. Similarly, recent advances in the development of DNA biosensors using gold nanoparticles to improve DNA immobilization on electrode surfaces and as suitable labels to improve detection of hybridization events are considered. Finally, other biosensors designed with gold nanoparticles oriented to electrically contact redox enzymes to electrodes by a reconstitution process and to the study of direct electron transfer between redox proteins and electrode surfaces have also been treated
Gold nanoparticle-based electrochemical biosensors
Energy Technology Data Exchange (ETDEWEB)
Pingarron, Jose M.; Yanez-Sedeno, Paloma; Gonzalez-Cortes, Araceli [Department of Analytical Chemistry, Faculty of Chemistry, University Complutense of Madrid, 28040 Madrid (Spain)
2008-08-01
The unique properties of gold nanoparticles to provide a suitable microenvironment for biomolecules immobilization retaining their biological activity, and to facilitate electron transfer between the immobilized proteins and electrode surfaces, have led to an intensive use of this nanomaterial for the construction of electrochemical biosensors with enhanced analytical performance with respect to other biosensor designs. Recent advances in this field are reviewed in this article. The advantageous operational characteristics of the biosensing devices designed making use of gold nanoparticles are highlighted with respect to non-nanostructured biosensors and some illustrative examples are commented. Electrochemical enzyme biosensors including those using hybrid materials with carbon nanotubes and polymers, sol-gel matrices, and layer-by-layer architectures are considered. Moreover, electrochemical immunosensors in which gold nanoparticles play a crucial role in the electrode transduction enhancement of the affinity reaction as well as in the efficiency of immunoreagents immobilization in a stable mode are reviewed. Similarly, recent advances in the development of DNA biosensors using gold nanoparticles to improve DNA immobilization on electrode surfaces and as suitable labels to improve detection of hybridization events are considered. Finally, other biosensors designed with gold nanoparticles oriented to electrically contact redox enzymes to electrodes by a reconstitution process and to the study of direct electron transfer between redox proteins and electrode surfaces have also been treated. (author)
Highly active thermally stable nanoporous gold catalyst
Energy Technology Data Exchange (ETDEWEB)
Biener, Juergen; Wittstock, Arne; Biener, Monika M.; Bagge-Hansen, Michael; Baeumer, Marcus; Wichmann, Andre; Neuman, Bjoern
2016-12-20
In one embodiment, a system includes a nanoporous gold structure and a plurality of oxide particles deposited on the nanoporous gold structure; the oxide particles are characterized by a crystalline phase. In another embodiment, a method includes depositing oxide nanoparticles on a nanoporous gold support to form an active structure and functionalizing the deposited oxide nanoparticles.
Gold Photoluminescence: Wavelength and Polarization Engineering
DEFF Research Database (Denmark)
Andersen, Sebastian Kim Hjælm; Pors, Anders Lambertus; Bozhevolnyi, Sergey I.
2015-01-01
We demonstrate engineering of the spectral content and polarization of photoluminescence (PL) from arrayed gold nanoparticles atop a subwavelength-thin dielectric spacer and optically-thick gold film, a configuration that supports gap-surface plasmon resonances (GSPRs). Choice of shapes...... and dimensions of gold nanoparticles influences the GSPR wavelength and polarization characteristics, thereby allowing us to enhance and spectrally mold the plasmon-assisted PL while simultaneously controlling its polarization. In order to understand the underlying physics behind the plasmon-enhanced PL, we...
Gold Rushes and mineral property rights allocation
DEFF Research Database (Denmark)
Sinding, Knud
, is to handle the other projects that are generated by the "gold rush" informational externalities created by the initial discovery. At the core of the problems of dealing with a gold rush situation is both the informational externality and an institutional framework which is not designed to deal with large...... influxes of prospectors competing for a very limited area. This paper charts significant gold rush events in the mineral industry in recent decades and uses preliminary data on the areas impacted by these gold rushes to argue that many mineral tenure systems should be modified in order to be better able...
Adsorption-induced restructuring of gold nanochains
DEFF Research Database (Denmark)
Bahn, Sune Rastad; Lopez, Nuria; Nørskov, Jens Kehlet
2002-01-01
The chemical properties of single-atomic chains of gold atoms are investigated using density functional calculations. The nanochains are shown to be unusually chemically active with strong chemisorption of oxygen atoms and carbon monoxide. The chemisorption energies vary significantly with the st......The chemical properties of single-atomic chains of gold atoms are investigated using density functional calculations. The nanochains are shown to be unusually chemically active with strong chemisorption of oxygen atoms and carbon monoxide. The chemisorption energies vary significantly...... with the strain/stress conditions for the chain. Oxygen atoms are found to energetically prefer to get incorporated into a chain forming a new type of gold-oxygen nanochain with a conductance of one quantum unit. We suggest that the long bond lengths observed in electron microscopy investigations of gold chains...
International Nuclear Information System (INIS)
Clarkson, R.
1998-01-01
In the summers of 1992 and 1994, the author designed and carried out a statistically valid research program using radioactivated gold particles as tracers (radiotracers). Two types of fully cased normal circulation (N / C) drills, two types of reverse circulation (R/C) drills and three solid auger drills were evaluated under a variety of field conditions. A frozen cylindrical core of compacted gravels containing four sizes ( 1.2, 0.60, 0.30 and 0.15 mm), (+l4,+28,+48and+100 mesh)of radiotracers was placed in 44 drill holes and the holes were re drilled. Scintillometers were used to track free gold losses due to spillage and blow-by around the collar (top) of the hole. Some gold particles were located in temporary traps in the drilling equipment and these particles would have contaminated subsequent samples (as carry-over). Several myths commonly attributed to particular drilling methods were dispelled. There was no significant difference between the recovery of the four sizes of gold particles with any of the drills tested. Observations and down-hole scintillometer records indicated that the free gold particles did not follow the bit down the hole and were either carried out of the hole or forced onto the sides of the hole at or above the depth at which the radioactive gold was positioned. A comparative evaluation of the results of these tests is presented
Fabrication of gold nanoparticle arrays by block copolymer
Energy Technology Data Exchange (ETDEWEB)
Chen, Xiao Ling
2011-02-15
Gold nanoparticle is one of the widely research objects in various fields including catalysis and biotechnology. Precise control of gold nanoparticles placement and their integration is essential to take full advantage of these unique properties for applications. An approach to self-assembling of gold nanoparticles (AuNPs) from reconstructed block copolymer was introduced. Highly ordered polystyrene-block-poly(2-vinylpyridine)(PS-b-P2VP) micellar arrays were obtained by solvent annealing. Subsequent immersion of the films in a preferential solvent for P2VP caused a reorganization of the film to generate a porous structure upon drying. PEG-coated AuNPs were spin-coated onto this reconstruction PS-b-P2VP template. When such films were exposed to toluene vapor-which is non-selective solvent for PEO and P2VP, AuNPs were drawn into those porous to form ordered arrays. Gold nanospheres with size 12±1.8 nm were synthesized by reducing HAuCl{sub 4} via sodium citrate. Gold nanorods (aspect ratio about 6) were prepared from seed-mediated surfactant capping wet chemical method and the aspect ratio is tunable by changing surfactant amount. PEG ligand is used to modify gold nanoparticle surface by removing the original surfactant (sodium citrate -gold nanospheres: CTAB-gold nanorods), which have affinity with certain block copolymer component. Once gold nanoparticle is modified with PEG thiol, they were spin coated onto PS-b-P2VP template, which was prepared by solvent annealing and surface reconstruction process. So gold nanoparticle array was fabricated by this self-assembling process. The same idea can be applied on other nanoparticles.
Fabrication of gold nanoparticle arrays by block copolymer
International Nuclear Information System (INIS)
Chen, Xiao Ling
2011-02-01
Gold nanoparticle is one of the widely research objects in various fields including catalysis and biotechnology. Precise control of gold nanoparticles placement and their integration is essential to take full advantage of these unique properties for applications. An approach to self-assembling of gold nanoparticles (AuNPs) from reconstructed block copolymer was introduced. Highly ordered polystyrene-block-poly(2-vinylpyridine)(PS-b-P2VP) micellar arrays were obtained by solvent annealing. Subsequent immersion of the films in a preferential solvent for P2VP caused a reorganization of the film to generate a porous structure upon drying. PEG-coated AuNPs were spin-coated onto this reconstruction PS-b-P2VP template. When such films were exposed to toluene vapor-which is non-selective solvent for PEO and P2VP, AuNPs were drawn into those porous to form ordered arrays. Gold nanospheres with size 12±1.8 nm were synthesized by reducing HAuCl 4 via sodium citrate. Gold nanorods (aspect ratio about 6) were prepared from seed-mediated surfactant capping wet chemical method and the aspect ratio is tunable by changing surfactant amount. PEG ligand is used to modify gold nanoparticle surface by removing the original surfactant (sodium citrate -gold nanospheres: CTAB-gold nanorods), which have affinity with certain block copolymer component. Once gold nanoparticle is modified with PEG thiol, they were spin coated onto PS-b-P2VP template, which was prepared by solvent annealing and surface reconstruction process. So gold nanoparticle array was fabricated by this self-assembling process. The same idea can be applied on other nanoparticles
Effects of dissolucytotic gold ions on recovering brain lesions.
Danscher, Gorm; Larsen, Agnete
2010-04-01
Recent experimental research has shown that metallic gold releases charged gold atoms when placed intracerebrally and that the liberated gold ions affect inflammation in the brain. The observations suggest that metallic gold can be used as a safe suppressor of inflammation in the central nervous system.
Hallmarking as an essential need of gold industry
International Nuclear Information System (INIS)
Mahmood, K.; Alam, S.; Ahmed, T.
2006-01-01
As gold is a soft metal, for Jewellery making it is alloyed with Silver or Copper so that its strength may increase. Other main alloying elements include; Zinc, Cadmium and Nickel. These alloying elements help to reduce cost, improve appearance and to improve chemical properties of gold. The percentage of alloying elements determines the caratages of gold. The gold Jewellery sold in local market is often under-carated. In order to improve the quality of product sold, complete quality assessment of gold should be done. A complete quality assessment includes both Assaying and Hallmarking. Assaying is the analysis of an individual sample of gold from a customer to find out it's composition and Hallmarking refers to physically marking: a piece of Jewellery according to specific laws to certify the purity of metal. In this paper we have assessed and compared the quality of locally manufactured gold ornaments and its alloying components with international market as well as standards of gold and its alloys. And as Hallmarking is one of the main strategic initiatives to improve the quality of product sold for domestic and export consumption, this paper discusses the necessary steps leading to Hallmarking. We have used micro-XRF spectrometer for assaying and Laser Engraving machine for the purpose of Hallmarking. (author)
Gold sales forecasting: The Box-Jenkins methodology
Directory of Open Access Journals (Sweden)
Johannes Tshepiso Tsoku
2017-02-01
Full Text Available The study employs the Box-Jenkins Methodology to forecast South African gold sales. For a resource economy like South Africa where metals and minerals account for a high proportion of GDP and export earnings, the decline in gold sales is very disturbing. Box-Jenkins time series technique was used to perform time series analysis of monthly gold sales for the period January 2000 to June 2013 with the following steps: model identification, model estimation, diagnostic checking and forecasting. Furthermore, the prediction accuracy is tested using mean absolute percentage error (MAPE. From the analysis, a seasonal ARIMA(4,1,4×(0,1,112 was found to be the “best fit model” with an MAPE value of 11% indicating that the model is fit to be used to predict or forecast future gold sales for South Africa. In addition, the forecast values show that there will be a decrease in the overall gold sales for the first six months of 2014. It is hoped that the study will help the public and private sectors to understand the gold sales or output scenario and later plan the gold mining activities in South Africa. Furthermore, it is hoped that this research paper has demonstrated the significance of Box-Jenkins technique for this area of research and that they will be applied in the future.
Directory of Open Access Journals (Sweden)
BRANIMIR N. GRGUR
2005-02-01
Full Text Available Surface modification of the electrodes was conducted from sulfuric acid solutions containing the corresponding metalchloride complexes using cyclic voltammetry. Comparing the charges of the hydrogen underpotential deposition region, and the corresponding oxide reduction regions, it is concluded that a platinum overlayer on gold forms 3D islands, while gold on platinum forms 2D islands. Foreign metals present in an amount of up to one monolayer exert an influence on the change in reaction rate with respect to both hydrogen evolution (HER and oxygen reduction (ORR reactions. Aplatinum overlayer on a gold substrate increases the activity forHER and for ORR, compared with pure gold. These results can be understood in terms of a simple model, in which the change in the H and OH binding energies are directly proportional to the shift of the d-bond center of the overlayer. On the contrary, a gold layer on platinum slightly decreases the activity for both reactions compared with pure platinum.
Biodistribution of gold nanoparticles following intratracheal instillation in mouse lung
DEFF Research Database (Denmark)
Sadauskas, Evaldas; Jacobsen, Nicklas R.; Danscher, Gorm
2009-01-01
plasma mass spectrometry (ICP-MS) and neutron activation analysis (NAA). The liver is the major site of deposition of circulating gold nanoparticles. Therefore the degree of translocation was determined by the hepatic deposition of gold. Mice were instilled with 5 intratracheal doses of gold...... repeatedly during 3 weeks, the load was substantial. Ultrastructurally, AMG silver enhanced gold nanoparticles were found in lysosome-/endosome-like organelles of the macrophages and analysis with AMG, ICP-MS and NAA of the liver revealed an almost total lack of translocation of nanoparticles. In mice given...... repeated instillations of 2 nm gold nanoparticles, 1.4‰ (by ICP-MS) to 1.9‰ (by NAA) of the instilled gold was detected in the liver. With the 40 nm gold, no gold was detected in the liver (detection level 2 ng, 0.1‰) except for one mouse in which 3‰ of the instilled gold was found in the liver. No gold...
The in vitro formation of placer gold by bacteria
Southam, Gordon; Beveridge, Terrance J.
1994-10-01
A laboratory simulation was developed to provide mechanistic information about placer (nugget) gold development in the natural environment. To initiate the simulation, ionic gold was immobilized to a high capacity by Bacillus subtilis 168 (116.2 μg/mg dry weight bacteria) as fine-grained intracellular colloids (5-50 nm). During the low-temperature diagenesis experiment (60°C), the release of organics due to bacterial autolysis coincided with the in vitro formation of hexagonal-octahedral gold crystals (20 μm). This octahedral gold was observed to aggregate, forming fine-grained placer gold (50 μm). In addition to achieving a fundamental understanding into secondary gold deposition, a significant economic benefit could be realized by employing this environmentally safe procedure to concentrate widely dispersed gold in placer deposits to facilitate mining by conventional methodologies.
Site-Specific Biomolecule Labeling with Gold Clusters
Ackerson, Christopher J.; Powell, Richard D.; Hainfeld, James F.
2010-01-01
Site-specific labeling of biomolecules in vitro with gold clusters can enhance the information content of electron cryomicroscopy experiments. This chapter provides a practical overview of well-established techniques for forming biomolecule/gold cluster conjugates. Three bioconjugation chemistries are covered: Linker-mediated bioconjugation, direct gold–biomolecule bonding, and coordination-mediated bonding of nickel(II) nitrilotriacetic acid (NTA)-derivatized gold clusters to polyhistidine (...
Photoemission on gold-55-clusters derived from gold-phosphine AuP(C6H5)3Cl
International Nuclear Information System (INIS)
Quinten, M.; Sander, I.; Steiner, P.; Kreibig, U.; Fauth, K.; Schmid, G.
1991-01-01
We measured XPS and UPS spectra of gold clusters with 55 atoms, embedded in an electrically isolating phosphine matrix, and of gold-phosphine, from which the clusters were chemically derived. Compared to the spectra of bulk gold the valence band spectrum and the core level spectra of the clusters showed shifts of the peaks and the fermi level to higher binding energies. The shift of the peaks could qualitatively be interpreted by a final state effect. We succeeded in a separation of bulk and surface contributions to the core level spectra and in a reasonable quantitative analysis of the valence band spectrum of the clusters. The Au 4f core level spectrum of gold-phosphine showed two peaks at 1.5 eV higher binding energies than the corresponding peaks of the clusters. (orig.)
Koppe, Manuel; Schaijk, Frank van; Roos, Jan; Leeuwen, Paul van; Heider, Karl-Heinz; Kuthan, Hartmut; Bleichrodt, Robert
2004-12-01
The aim of this prospective study was to evaluate the safety, pharmacokinetics, immunogenicity, and biodistribution of (186)Re-labeled humanized anti-CD44v6 monoclonal antibody (MAb( BIWA 4 (Bivatuzumab( in 9 patients with early-stage breast cancer. Radioimmunoscintigraphy (RIS( was performed within 1, 24, and 72 hours after administration. BIWA 4 concentration in plasma (ELISA and radioactivity measurements( and the development of human antihuman antibody (HAHA( responses was determined. The biodistribution of (186)Re-BIWA 4 was determined by radioactivity measurements in tumor and normal tissue biopsies obtained during surgery 1 week after administration. Administration of (186)Re-BIWA 4 was well tolerated by all patients and no HAHA responses were observed. The mean t(1/2) in plasma of BIWA 4 (ELISA( was 81 hours (range, 67-97(, whereas the mean radioactivity t(1/2) tended to be longer, at 105 hours (range, 90-114(. RIS unmistakably showed the tumor in 3 patients. Less clear identifications were established in 3 additional patients. In 2 patients, the tumor was wrongly identified in the contralateral breast. Median tumor CD44v6 expression, as determined by immunohistochemistry, was 70% (range, 10-90%). Mean tumor uptake was 2.96% ID/kg (range, 0.92-6.27(, with no apparent correlation with either tumor CD44v6 expression, tumor-cell cellularity, or tumor diameter. Tumor-to-nontumor ratios were unfavorable for blood, bone marrow, mammary gland tissue, and skin. The (186)Re-labeled humanized MAb BIWA 4 can safely be administered to patients with early-stage breast cancer. Tumorto- nontumor ratios were unfavorable, with no apparent correlation with CD44v6 expression, tumor-cell cellularity, or tumor diameter. BIWA 4, therefore, appears to have limitations as a vehicle for radioimmunotherapy in patients with breast cancer.
Su, Chen-Ming; Tang, Chih-Hsin; Chi, Meng-Ju; Lin, Chih-Yang; Fong, Yi-Chin; Liu, Yueh-Ching; Chen, Wei-Cheng; Wang, Shih-Wei
2018-05-03
Chondrosarcoma is a common primary malignant tumor of the bone that can metastasize through the vascular system to other organs. A key step in the metastatic process, lymphangiogenesis, involves vascular endothelial growth factor-C (VEGF-C). However, the effects of lymphangiogenesis in chondrosarcoma metastasis remain to be clarified. Accumulating evidence shows that resistin, a cytokine secreted from adipocytes and monocytes, also promotes tumor pathogenesis. Notably, chondrosarcoma can easily metastasize. In this study, we demonstrate that resistin enhances VEGF-C expression and lymphatic endothelial cells (LECs)-associated lymphangiogenesis in human chondrosarcoma cells. We also show that resistin triggers VEGF-C-dependent lymphangiogenesis via the c-Src signaling pathway and down-regulating micro RNA (miR)-186. Overexpression of resistin in chondrosarcoma cells significantly enhanced VEGF-C production and LECs-associated lymphangiogenesis in vitro and tumor-related lymphangiogenesis in vivo. Resistin levels were positively correlated with VEGF-C-dependent lymphangiogenesis via the down-regulation of miR-186 expression in clinical samples from chondrosarcoma tissue. This study is the first to evaluate the mechanism underlying resistin-induced promotion of LECs-associated lymphangiogenesis via the upregulation of VEGF-C expression in human chondrosarcomas. We suggest that resistin may represent a molecular target in VEGF-C-associated tumor lymphangiogenesis in chondrosarcoma metastasis. Copyright © 2018 Elsevier Inc. All rights reserved.
Study on Sumbawa gold recovery using centrifuge
Ferdana, A. D.; Petrus, H. T. B. M.; Bendiyasa, I. M.; Prijambada, I. D.; Hamada, F.; Sachiko, T.
2018-01-01
The Artisanal Small Gold Mining in Sumbawa has been processing gold with mercury (Hg), which poses a serious threat to the mining and global environment. One method of gold processing that does not use mercury is by gravity method. Before processing the ore first performed an analysis of Mineragraphy and analysis of compound with XRD. Mineragraphy results show that gold is associated with chalcopyrite and covelite and is a single particle (native) on size 58.8 μm, 117 μm up to 294 μm. characterization with XRD shows that the Sumbawa Gold Ore is composed of quartz, pyrite, pyroxene, and sericite compounds. Sentrifugation is one of separation equipment of gravity method to increase concentrate based on difference of specific gravity. The optimum concentration result is influenced by several variables, such as water flow rate and particle size. In this present research, the range of flow rate is 5 lpm and 10 lpm, the particle size - 100 + 200 mesh and -200 +300 mesh. Gold concentration in concentrate is measured by EDX. The result shows that the optimum condition is obtained at a separation with flow rate 5 lpm and a particle size of -100 + 200 mesh.
International Nuclear Information System (INIS)
Ahmed, K.; Dampare, S.B.; Addo, M.A.; Osae, S.; Adotey, D. K.; Adomako, D.
2005-01-01
This paper examines the possibility of improving the extraction process of gold from gold bearing rocks by small-scale gold miners in Ghana. The investigation involved crushing of 25 hard rock gold ore samples with a total weight of 7,126.98g to fine particles to form a composite sample and screening at a range of grind sizes. This was followed by the determination of gold distribution as a function of 'particle size' in the composite sample using INAA. The following concentrations of gold for the corresponding particle sizes are reported: 63-125 μm, 161±0.75 mg/kg; Sub 63 μm, 16.4 ± 0.17 mg/kg; 250-355 μm, 4.66 ± 0. 07; 355-425μm, 1.55 ± 0.06 mg/kg; 1000-2000 μm, 1.27±005 mg/kg; 125-250 μm, 0.53 ± 0.03 mg/kg; 425-1000 μm, 0.180 ± 0.008 mg/kg. An estimate for gold in the composite sample based on particle size yielded an average value of 3.80 mg/kg. (au)
The Complete Reconfiguration of Dendritic Gold
Paneru, Govind; Flanders, Bret
2014-03-01
Reconfigurability-by-design is an important strategy in modern materials science, as materials with this capability could potentially be used to confer hydrophobic, lipophobic, or anti-corrosive character to substrates in a regenerative manner. The present work extends the directed electrochemical nanowire assembly (DENA) methodology, which is a technique that employs alternating voltages to grow single crystalline metallic nanowires and nano-dendrites from simple salt solutions, to enable the complete dissolution of macroscopic arrays of metallic dendrites following their growth. Our main finding is that structural reconfiguration of dendritic gold is induced by changes in the MHz-level frequencies of voltages that are applied to the dendrites. Cyclic voltammetry and micro-Raman spectroscopy have been used to show that dendritic gold grows and dissolves by the same chemical mechanisms as bulk gold. Hence, the redox chemistry that occurs at the crystal-solution interface is no different than the established electrochemistry of gold. What differs in this process and allows for reconfiguration to occur is the diffusive behavior of the gold chloride molecules in the solution adjacent to the interface. We will present a simple model that captures the physics of this behavior.
Protracted elimination of gold nanoparticles from mouse liver
DEFF Research Database (Denmark)
Sadauskas, Evaldas; Wallin, Håkan; Stoltenberg, Meredin
2009-01-01
The present study aims at revealing the fate of 40-nm gold nanoparticles after intravenous injections. The gold nanoparticles were traced histochemically with light and transmission electron microscopy using autometallographic (AMG) staining, and the gold content in the liver was determined with ...
Guidez, Emilie B; Aikens, Christine M
2015-04-09
The origin of the emission of the gold phosphine thiolate complex (TPA)AuSCH(CH3)2 (TPA = 1,3,5-triaza-7-phosphaadamantanetriylphosphine) is investigated using time-dependent density functional theory (TDDFT). This system absorbs light at 3.6 eV, which corresponds mostly to a ligand-to-metal transition with some interligand character. The P-Au-S angle decreases upon relaxation in the S1 and T1 states. Our calculations show that these two states are strongly spin-orbit coupled at the ground state geometry. Ligand effects on the optical properties of this complex are also discussed by looking at the simple AuP(CH3)3SCH3 complex. The excitation energies differ by several tenths of an electronvolt. Excited state optimizations show that the excited singlet and triplet of the (TPA)AuSCH(CH3)2 complex are bent. On the other hand, the Au-S bond breaks in the excited state for the simple complex, and TDDFT is no longer an adequate method. The excited state energy landscape of gold phosphine thiolate systems is very complex, with several state crossings. This study also shows that the formation of the [(TPA)AuSCH(CH3)2]2 dimer is favorable in the ground state. The inclusion of dispersion interactions in the calculations affects the optimized geometries of both ground and excited states. Upon excitation, the formation of a Au-Au bond occurs, which results in an increase in energy of the low energy excited states in comparison to the monomer. The experimentally observed emission of the (TPA)AuSCH(CH3)2 complex at 1.86 eV cannot be unambiguously assigned and may originate from several excited states.
Zhang, Hui; Ma, Xiaoyuan; Liu, Ying; Duan, Nuo; Wu, Shijia; Wang, Zhouping; Xu, Baocai
2015-12-15
Salmonella typhimurium and Staphylococcus aureus are most common causes of food-associated disease. A Raman based biosensor was developed for S. typhimurium and S. aureus detection simultaneously. The biosensor was based on nanoparticles enhanced Raman intensity and the specific recognition of aptamer. The Raman signal probe and the capture probe are built. Gold nanoparticles (GNPs) modified with Raman molecules (Mercaptobenzoic acid and 5,5'-Dithiobis(2-nitrobenzoic acid)) and aptamer are used as the signal probe for S. typhimurium and S. aureus, respectively. Fe3O4 magnetic gold nanoparticles (MGNPs) immobilized with both aptamer of S. typhimurium and S. aureus are used as the capture probe. When S. typhimurium and S. aureus are added in the reaction system, the capture probe will capture the target bacteria through the specific binding effect of aptamer. And then the signal probe will be connected to the bacteria also by the effect of aptamer to form the sandwich like detection structure. The Raman intensified spectrum was measured to quantify S. typhimurium and S. aureus. Under optimal conditions, the SERS intensity of MBA at 1582 cm(-1) are used to measure S. typhimurium (y=186.4762+704.8571x, R(2)=0.9921) and the SERS intensity of DNTB at 1333 cm(-1) are used to measure S. aureus (y=135.2381+211.4286x, R(2)=0.9946) in the range of 10(2)-10(7) cfu mL(-1). The LOD is 35 cfu mL(-1) for S. aureus and 15 cfu mL(-1) for S. typhimurium. This method is simple and rapid, results in high sensitivity and specificity, and can be used to detect actual samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Gold Nanoparticle Microwave Synthesis
Energy Technology Data Exchange (ETDEWEB)
Krantz, Kelsie E. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Christian, Jonathan H. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Coopersmith, Kaitlin [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Washington, II, Aaron L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Murph, Simona H. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)
2016-07-27
At the nanometer scale, numerous compounds display different properties than those found in bulk material that can prove useful in areas such as medicinal chemistry. Gold nanoparticles, for example, display promise in newly developed hyperthermia therapies for cancer treatment. Currently, gold nanoparticle synthesis is performed via the hot injection technique which has large variability in final particle size and a longer reaction time. One underdeveloped area by which these particles could be produced is through microwave synthesis. To initiate heating, microwaves agitate polar molecules creating a vibration that gives off the heat energy needed. Previous studies have used microwaves for gold nanoparticle synthesis; however, polar solvents were used that partially absorbed incident microwaves, leading to partial thermal heating of the sample rather than taking full advantage of the microwave to solely heat the gold nanoparticle precursors in a non-polar solution. Through this project, microwaves were utilized as the sole heat source, and non-polar solvents were used to explore the effects of microwave heating only as pertains to the precursor material. Our findings show that the use of non-polar solvents allows for more rapid heating as compared to polar solvents, and a reduction in reaction time from 10 minutes to 1 minute; this maximizes the efficiency of the reaction, and allows for reproducibility in the size/shape of the fabricated nanoparticles.
Gold Nanoparticle Microwave Synthesis
International Nuclear Information System (INIS)
Krantz, Kelsie E.; Christian, Jonathan H.; Coopersmith, Kaitlin; Washington II, Aaron L.; Murph, Simona H.
2016-01-01
At the nanometer scale, numerous compounds display different properties than those found in bulk material that can prove useful in areas such as medicinal chemistry. Gold nanoparticles, for example, display promise in newly developed hyperthermia therapies for cancer treatment. Currently, gold nanoparticle synthesis is performed via the hot injection technique which has large variability in final particle size and a longer reaction time. One underdeveloped area by which these particles could be produced is through microwave synthesis. To initiate heating, microwaves agitate polar molecules creating a vibration that gives off the heat energy needed. Previous studies have used microwaves for gold nanoparticle synthesis; however, polar solvents were used that partially absorbed incident microwaves, leading to partial thermal heating of the sample rather than taking full advantage of the microwave to solely heat the gold nanoparticle precursors in a non-polar solution. Through this project, microwaves were utilized as the sole heat source, and non-polar solvents were used to explore the effects of microwave heating only as pertains to the precursor material. Our findings show that the use of non-polar solvents allows for more rapid heating as compared to polar solvents, and a reduction in reaction time from 10 minutes to 1 minute; this maximizes the efficiency of the reaction, and allows for reproducibility in the size/shape of the fabricated nanoparticles.
A Comparative XAFS Study of Gold-thiolate Nanoparticles and Nanoclusters
International Nuclear Information System (INIS)
Chevrier, D M; Chatt, A; Zhang, P; Sham, T K
2013-01-01
Tiopronin-capped gold nanoparticles and gold nanoclusters of sizes 3.0 and 1.5 nm, respectively, were investigated with XAFS at the gold L 3 -edge. The specific EXAFS fitting procedure is discussed for obtaining reliable fit parameters for each system. The difficulties and challenges faced when analysing EXAFS data for gold nanoparticles and nanoclusters are also mentioned. Fitting results for gold nanoparticles reveal a small amount of surface Au-thiolate interactions with a large Au-Au metal core. For gold nanoclusters, only a one-shell fit was obtainable. Instead of Au-Au metal core, long-range interactions are expected for gold nanoclusters. Tiopronin-capped gold nanoclusters are proposed to be polymeric in nature, which helps explain the observed red luminescence.
Controlled adsorption of cytochrome c to nanostructured gold surfaces
International Nuclear Information System (INIS)
Gomes, Inês; Feio, Maria J.; Santos, Nuno C.; Eaton, Peter; Serro, Ana Paula; Saramago, Benilde; Pereira, Eulália; Franco, Ricardo
2012-01-01
Controlled electrostatic physisorption of horse heart cytochrome c (Cyt c) onto nanostructured gold surfaces was investigated using Quartz-Crystal Microbalance measurements in planar gold surfaces with or without functionalization using a self-assembled monolayer (SAM) of the alkanethiol mercaptoundecanoic acid (MUA). MUA is a useful functionalization ligand for gold surfaces, shedding adsorbed biomolecules from the excessive electron density of the metal. A parallel analysis was conducted in the corresponding curved surfaces of 15 nm gold nanoparticles (AuNPs), using zeta-potential and UV– visible spectroscopy. Atomic Force Microscopy of both types of functionalized gold surfaces with a MUA SAM, allowed for visualization of Cyt c deposits on the nanostructured gold surface. The amount of Cyt c adsorbed onto the gold surface could be controlled by the solution pH. For the assays conducted at pH 4.5, when MUA SAM- functionalized planar gold surfaces are positive or neutral, and Cyt c has a positive net charge, only 13 % of the planar gold surface area was coated with protein. In contrast, at pH 7.4, when MUA SAM-functionalized planar gold surfaces and Cyt c have opposite charges, a protein coverage of 28 % could be observed implying an adsorption process strongly governed by electrostatic forces. Cyt c adsorption on planar and curved gold surfaces are found to be greatly favored by the presence of a MUA-capping layer. In particular, on the AuNPs, the binding constant is three times larger than the binding constant obtained for the original citrate-capped AuNPs.
Controlled adsorption of cytochrome c to nanostructured gold surfaces
Energy Technology Data Exchange (ETDEWEB)
Gomes, Ines [Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, REQUIMTE, Departamento de Quimica (Portugal); Feio, Maria J. [Faculdade de Ciencias da Universidade do Porto, REQUIMTE, Departamento de Quimica e Bioquimica (Portugal); Santos, Nuno C. [Faculdade de Medicina da Universidade de Lisboa, Instituto de Medicina Molecular (Portugal); Eaton, Peter [Faculdade de Ciencias da Universidade do Porto, REQUIMTE, Departamento de Quimica e Bioquimica (Portugal); Serro, Ana Paula; Saramago, Benilde [Centro de Quimica Estrutural, Instituto Superior Tecnico (Portugal); Pereira, Eulalia [Faculdade de Ciencias da Universidade do Porto, REQUIMTE, Departamento de Quimica e Bioquimica (Portugal); Franco, Ricardo, E-mail: ricardo.franco@fct.unl.pt [Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, REQUIMTE, Departamento de Quimica (Portugal)
2012-12-15
Controlled electrostatic physisorption of horse heart cytochrome c (Cyt c) onto nanostructured gold surfaces was investigated using Quartz-Crystal Microbalance measurements in planar gold surfaces with or without functionalization using a self-assembled monolayer (SAM) of the alkanethiol mercaptoundecanoic acid (MUA). MUA is a useful functionalization ligand for gold surfaces, shedding adsorbed biomolecules from the excessive electron density of the metal. A parallel analysis was conducted in the corresponding curved surfaces of 15 nm gold nanoparticles (AuNPs), using zeta-potential and UV- visible spectroscopy. Atomic Force Microscopy of both types of functionalized gold surfaces with a MUA SAM, allowed for visualization of Cyt c deposits on the nanostructured gold surface. The amount of Cyt c adsorbed onto the gold surface could be controlled by the solution pH. For the assays conducted at pH 4.5, when MUA SAM- functionalized planar gold surfaces are positive or neutral, and Cyt c has a positive net charge, only 13 % of the planar gold surface area was coated with protein. In contrast, at pH 7.4, when MUA SAM-functionalized planar gold surfaces and Cyt c have opposite charges, a protein coverage of 28 % could be observed implying an adsorption process strongly governed by electrostatic forces. Cyt c adsorption on planar and curved gold surfaces are found to be greatly favored by the presence of a MUA-capping layer. In particular, on the AuNPs, the binding constant is three times larger than the binding constant obtained for the original citrate-capped AuNPs.
Gold and Silver Extraction from Leach Solutions
Bagdaulet K. Kenzhaliyev; Renata R. Iskhakova; Zamzagul D. Dosymbaeva; Esen N. Sulejmenov
2014-01-01
There has been carried out an investigation on the extraction of gold and silver from thiosulfate solutions: standard test and technological solutions of chemical and electrochemical leaching. The influence of related metals on the process of extracting gold from solution was studied. There has been conducted a comparative study of the IR spectra of solutions after the sorption of gold, silver and related metals.
Site-Specific Biomolecule Labeling with Gold Clusters
Ackerson, Christopher J.; Powell, Richard D.; Hainfeld, James F.
2013-01-01
Site-specific labeling of biomolecules in vitro with gold clusters can enhance the information content of electron cryomicroscopy experiments. This chapter provides a practical overview of well-established techniques for forming biomolecule/gold cluster conjugates. Three bioconjugation chemistries are covered: Linker-mediated bioconjugation, direct gold–biomolecule bonding, and coordination-mediated bonding of nickel(II) nitrilotriacetic acid (NTA)-derivatized gold clusters to polyhistidine (His)-tagged proteins. PMID:20887859
Gold and Silver Extraction from Leach Solutions
Directory of Open Access Journals (Sweden)
Bagdaulet K. Kenzhaliyev
2014-03-01
Full Text Available There has been carried out an investigation on the extraction of gold and silver from thiosulfate solutions: standard test and technological solutions of chemical and electrochemical leaching. The influence of related metals on the process of extracting gold from solution was studied. There has been conducted a comparative study of the IR spectra of solutions after the sorption of gold, silver and related metals.
The giant Kalgoorlie Gold Field revisited
Directory of Open Access Journals (Sweden)
Noreen Mary Vielreicher
2016-05-01
Direct timing constraints on gold mineralization indicate that Fimiston- and Mt Charlotte-style mineralization formed within a relative short period of time around 2.64 Ga, and, as such, support a model of progressive deformation of a rheologically heterogeneous rock package late in the structural history. Fluid characteristics, combined with the structural, metamorphic and absolute timing, support description of gold mineralization at the Golden Mile as orogenic and mesozonal, and this allows direct correlation with orogenic gold deposits worldwide, which classically formed during accretion along convergent margins throughout Earth history.
International Nuclear Information System (INIS)
Zhang, Qian-Li; Zhou, Dan-Ling; Wang, Ai-Jun; Qin, Su-Fang; Feng, Jiu-Ju; Li, Yong-Fang
2014-01-01
A simple method was developed for synthesis of network-like gold nanochains and gold nanoflowers in the presence of cytosine by reduction of tetrachloroauric acid with sodium borohydride and ascorbic acid, respectively. The resulting gold nanocrystals were coated with microperoxidase-11 via electrostatic interactions. Electrodes modified with protein-coated gold nanochains or nanoflowers display well-defined and quasi reversible redox peaks and enhanced high electrocatalytic activity toward the reduction of H 2 O 2 that is due to direct electron transfer to the protein. The effects were exploited for the amperometric detection of H 2 O 2 with a linear response from 0.5 μM to 0.13 mM (for the gold nanochains) and from 1.0 μM to 0.11 mM (for the gold nanoflowers), respectively. The sensor shows lower detection limit and faster response time than sensors based on the use of spherical gold nanoparticles. (author)
Beneficiation of the gold bearing ore by gravity and flotation
Gül, Alim; Kangal, Olgaç; Sirkeci, Ayhan A.; Önal, Güven
2012-02-01
Gold concentration usually consists of gravity separation, flotation, cyanidation, or the combination of these processes. The choice among these processes depends on the mineralogical characterization and gold content of the ore. Recently, the recovery of gold using gravity methods has gained attention because of low cost and environmentally friendly operations. In this study, gold pre-concentrates were produced by the stepwise gravity separation and flotation techniques. The Knelson concentrator and conventional flotation were employed for the recovery of gold. Gold bearing ore samples were taken from Gümüşhane Region, northern east part of Turkey. As a result of stepwise Knelson concentration experiments, a gold concentrate assaying around 620 g/t is produced with 41.4wt% recovery. On the other hand, a gold concentrate about 82 g/t is obtained with 89.9wt% recovery from a gold ore assaying 6 g/t Au by direct flotation.
Gold and oil futures markets: Are markets efficient?
Energy Technology Data Exchange (ETDEWEB)
Narayan, Paresh Kumar; Zheng, Xinwei [School of Accounting, Economics and Finance, Faculty of Business and Law, Deakin University, 221 Burwood Highway, Burwood, Victoria 3125 (Australia); Narayan, Seema [School of Economics Finance and Marketing, RMIT University, Melbourne (Australia)
2010-10-15
In this paper we examine the long-run relationship between gold and oil spot and futures markets. We draw on the conceptual framework that when oil price rises, it creates inflationary pressures, which instigate investments in gold as a hedge against inflation. We test for the long-run relationship between gold and oil futures prices at different maturity and unravel evidence of cointegration. This implies that: (a) investors use the gold market as a hedge against inflation and (b) the oil market can be used to predict the gold market prices and vice versa, thus these two markets are jointly inefficient, at least for the sample period considered in this study. (author)
Gold and oil futures markets: Are markets efficient?
International Nuclear Information System (INIS)
Narayan, Paresh Kumar; Zheng, Xinwei; Narayan, Seema
2010-01-01
In this paper we examine the long-run relationship between gold and oil spot and futures markets. We draw on the conceptual framework that when oil price rises, it creates inflationary pressures, which instigate investments in gold as a hedge against inflation. We test for the long-run relationship between gold and oil futures prices at different maturity and unravel evidence of cointegration. This implies that: (a) investors use the gold market as a hedge against inflation and (b) the oil market can be used to predict the gold market prices and vice versa, thus these two markets are jointly inefficient, at least for the sample period considered in this study. (author)
Benchmarking Density Functionals for Chemical Bonds of Gold
DEFF Research Database (Denmark)
Kepp, Kasper Planeta
2017-01-01
Gold plays a major role in nanochemistry, catalysis, and electrochemistry. Accordingly, hundreds of studies apply density functionals to study chemical bonding with gold, yet there is no systematic attempt to assess the accuracy of these methods applied to gold. This paper reports a benchmark aga...
Basic electrochemical properties of sputtered gold film electrodes
International Nuclear Information System (INIS)
Libansky, Milan; Zima, Jiri; Barek, Jiri; Reznickova, Alena; Svorcik, Vaclav; Dejmkova, Hana
2017-01-01
Gold nanolayers made by sputtering of pure gold (physical vapour deposition) are commonly used for many biophysical and material applications. However, the use of sputtering method for fabrication of working electrodes for electroanalytical purposes is less common. This paper focuses on the testing and characterization of sputtered working roughened gold nanostructured film electrodes, which fall into category of upcoming desirable new generation of nanostructured gold working electrodes. Gold nanostructured films (80 nm thin) were sputtered onto 50 μm thin PTFE substrates with three different types of treatment: pristine, plasma treated, and plasma treated and subsequently spontaneously grafted with biphenyl-4,4′-dithiol. The characterization of gold nanostructured film electrodes was carried out by examination of the electrode reaction of standard redox probes (ferrocyanide/ferricyanide, hydroquinone/benzoquinone) in different types of supporting electrolytes (BR buffers of various pH, KCl, KNO 3 , H 2 SO 4 ), by exploration of the electrode surface by scanning electron microscopy, by atomic force microscopy accompanied by elementary analysis and contact angle measurements. The testing of electrodes was complemented by an attempt to calculate their real surface areas from Randles-Sevcik equation. All results were compared to conventional bulk gold electrode. The practical applicability of the nanostructured gold electrodes as sensors for the determination of environmental pollutants was verified by voltammetric determination of hydroquinone as a model electrochemically oxidisable organic environmental pollutant.
International Nuclear Information System (INIS)
Kothari, Kanchan; Samuel, Grace; Banerjee, Sharmila; Unni, P.R.; Sarma, H.D.; Chaudhari, P.R.; Unnikrishnan, T.P.; Pillai, M.R.A.
2001-01-01
In connection with our work on the development of 186 Re-tetra-phosphonates with optimum properties for use in bone pain palliation, a novel cyclic tetraphosphonate derivative, has been synthesized, complexed with 186 Re and evaluated with promising results. The ligand, which consists of a cyclic array of tetra-aminomethylphosphonate groups, was synthesized using orthophosphorus acid, 1,4,8,11-tetraazacyclotetradecane and formaldehyde. The labeling conditions with 186 Re have been standardized under varying reaction conditions to give maximum yield. In a reaction volume of 1 mL, maximum complexation yield of 98% was observed at pH 2 using 0.1 mg Re (37-370 MBq) for a ligand concentration at 9x10 -2 M/L, under heating at 100 deg. C for 30 min with 2 mg of stannous chloride. The complex was found to be stable for 6 days with RC purity remaining ∼97%. The complex was characterized by paper chromatography in saline and acetone, wherein the R f exhibited were 0.9 and 0, respectively. Biodistribution studies of the complex were performed in male Wistar rats. Activity in femur which was observed to be 1.8%/g (equivalent to about 23% of the injected activity in skeleton) at 3 h post injection remained almost constant up to 48 h. Minimum activity was observed in blood and other soft tissues. The complex showed major renal clearance. Scintigraphic images in rabbits after injecting 70-100 MBq of 186 Re-CTMP and using a dual head gamma camera were observed to be superior to 186 Re-HEDP, prepared by a procedure standardized by us. Insignificant activity was observed in other vital organs. The results suggest the suitability of the complex for further evaluation in higher animals for bone pain palliation
Numerical simulations of nanostructured gold films
DEFF Research Database (Denmark)
Repän, Taavi; Frydendahl, Christian; Novikov, Sergey M.
2017-01-01
We present an approach to analyse near-field effects on nanostructured gold films by finite element simulations. The studied samples are formed by fabricating gold films near the percolation threshold and then applying laser damage. Resulting samples have complicated structures, which...
Stability of gold atoms and dimers adsorbed on graphene
International Nuclear Information System (INIS)
Varns, R; Strange, P
2008-01-01
We report density functional theory (DFT) calculations for gold atoms and dimers on the surface of graphene. The calculations were performed using the plane wave pseudopotential method. Calculations were performed for a variety of geometries, and both the graphene surface and gold atoms were allowed to fully relax. In agreement with experiment, our results show that the gold-gold interaction is considerably stronger than the gold-graphene interaction, implying that uniform coverage could not be attained. The minimum energy configuration for a single gold atom is found to be directly above a carbon atom, while for the dimer it is perpendicular to the surface and directly above a carbon-carbon bond. Our results are consistent with previous similar calculations
Gold 100: proceedings of the international conference on gold. V. 1
International Nuclear Information System (INIS)
Wagner, H.; King, R.P.
1986-01-01
The papers collected in this, the first of three volumes, reflect the tremendous interest in technology of mining as it is applied to the recovery of gold from a variety of orebodies. The emphasis at 'Gold 100' was very largely associated with the problem of deep level mining of tabular orebodies and the challenges facing the mining engineer. The technical problems created by the need to overcome the threat of ever-increasing costs as the mines enter an increasingly hostile and difficult environment are prominent in the papers collected in this volume. The material collected here reflects the remarkable improvements in technology now taking place
Simple fabrication of gold nanobelts and patterns.
Directory of Open Access Journals (Sweden)
Renyun Zhang
Full Text Available Gold nanobelts are of interest in several areas; however, there are only few methods available to produce these belts. We report here on a simple evaporation induced self-assembly (EISA method to produce porous gold nanobelts with dimensions that scale across nanometer (thickness ∼80 nm and micrometer (width ∼20 µm, to decimeter (length ∼0.15 m. The gold nanobelts are well packed on the beaker wall and can be easily made to float on the surface of the solution for depositing onto other substrates. Microscopy showed that gold nanobelts had a different structure on the two sides of the belt; the density of gold nanowires on one side was greater than on the other side. Electrical measurements showed that these nanobelts were sensitive to compressive or tensile forces, indicating a potential use as a strain sensor. The patterned nanobelts were further used as a template to grow ZnO nanowires for potential use in applications such as piezo-electronics.
Moessbauer investigation of gold-bearing pyrite-rich concentrates
International Nuclear Information System (INIS)
Wagner, F.E.; Harris, D.C.
1994-01-01
A gold-bearing pyrite-rich concentrate of a refractory ore from the Golden Bear mine, northwestern British Columbia, and a pyrite-rich concentrate from Newhawk's west zone, Brucejack Lake area, northern British Columbia, containing 38 and 316 ppm Au and 0.57% and 0.19% As, respectively, have been investigated using 197 Au and 57 Fe Moessbauer spectroscopy. In the Golden Bear sample, the gold is mainly chemically bound in the pyrite with minor amounts present as an Au-Ag alloy, whereas in the Newhawk sample, the gold occurs mainly as an Au-Ag alloy with a composition close to Au 0.5 Ag 0.5 and is only partly bound in the pyrite. Having mean isomer shifts of +3.2 and +4.0 mm/s with respect to a Pt metal source, the gold in pyrite exhibits shifts similar to those observed for gold in arsenopyrite. The nature of the lattice sites occupied by the gold in pyrite is discussed. (orig.)
Marçôa, Raquel; Rodrigues, Daniela Marta; Dias, Margarida; Ladeira, Inês; Vaz, Ana Paula; Lima, Ricardo; Guimarães, Miguel
2018-02-01
Chronic Obstructive Pulmonary Disease (COPD) is a major cause of morbidity and mortality worldwide. The Global Initiative for Chronic Obstructive Lung Disease (GOLD) project has been working to improve awareness, prevention and management of this disease. The aim of this study is to evaluate how COPD patients are reclassified by the 2017 GOLD system (versus GOLD 2011), to calculate the level of agreement between these two classifications in allocation to categories and to compare the performance of each classification to predict future exacerbations. Two-hundred COPD patients (>40 years, post bronchodilator forced expiratory volume in one second/forced vital capacity<0.7) followed in pulmonology consultation were recruited into this prospective multicentric study. Approximately half of the patients classified as GOLD D [2011] changed to GOLD B [2017]. The extent of agreement between GOLD 2011 and GOLD 2017 was moderate (Cohen's Kappa = 0.511; p < 0.001) and the ability to predict exacerbations was similar (69.7% and 67.6%, respectively). GOLD B [2017] exacerbated 17% more than GOLD B [2011] and had a lower percent predicted post bronchodilator forced expiratory volume in one second (FEV1). GOLD B [2017] turned to be the predominant category, more heterogeneous and with a higher risk of exacerbation versus GOLD B [2011]. Physicians should be cautious in assessing the GOLD B [2017] patients. The assessment of patients should always be personalized. More studies are needed to evaluate the impact of the 2017 reclassification in predicting outcomes such as future exacerbations and mortality.
Geobiological Cycling of Gold: From Fundamental Process Understanding to Exploration Solutions
Directory of Open Access Journals (Sweden)
Frank Reith
2013-11-01
Full Text Available Microbial communities mediating gold cycling occur on gold grains from (sub-tropical, (semi-arid, temperate and subarctic environments. The majority of identified species comprising these biofilms are β-Proteobacteria. Some bacteria, e.g., Cupriavidus metallidurans, Delftia acidovorans and Salmonella typhimurium, have developed biochemical responses to deal with highly toxic gold complexes. These include gold specific sensing and efflux, co-utilization of resistance mechanisms for other metals, and excretion of gold-complex-reducing siderophores that ultimately catalyze the biomineralization of nano-particulate, spheroidal and/or bacteriomorphic gold. In turn, the toxicity of gold complexes fosters the development of specialized biofilms on gold grains, and hence the cycling of gold in surface environments. This was not reported on isoferroplatinum grains under most near-surface environments, due to the lower toxicity of mobile platinum complexes. The discovery of gold-specific microbial responses can now drive the development of geobiological exploration tools, e.g., gold bioindicators and biosensors. Bioindicators employ genetic markers from soils and groundwaters to provide information about gold mineralization processes, while biosensors will allow in-field analyses of gold concentrations in complex sampling media.
Energy Technology Data Exchange (ETDEWEB)
Yoo, Ji Min; Lee, Dong Hun; Jeong, Jae Jun [Pusan National University, Busan (Korea, Republic of)
2016-05-15
Condensation heat transfer under the presence of noncondensable gases (NCGs) is an important issue in nuclear safety because the presence of even a small quantity of NC gases in the vapor largely reduces the condensation rate. The extensive assessment of the condensation model of the safety analysis codes has been also performed. When NCGs are present, the condensation phenomenon is largely reduced by accumulated NCGs near the condensing surface. Since the total pressure remains constant, the partial pressure of vapor at the liquid-vapor interface is lower than that in the bulk mixture, providing the driving force for vapor diffusion towards the liquid-vapor interface. The main objective of the present study is the assessment of the condensation heat transfer model of the severe accident code MELCOR 1.8.6 under the presence of NCGs. In this study, the condensation heat transfer model of the MELCOR 1.8.6 is assessed using various experiments which have 4 different types of geometry. Through the comparison of the results, it was shown that the MELCOR code generally under-predicts the condensation heat transfer except the condensation on outer surface of vertical pipes and improvement is needed for other geometries.
Synthesis method of asymmetric gold particles.
Jun, Bong-Hyun; Murata, Michael; Hahm, Eunil; Lee, Luke P
2017-06-07
Asymmetric particles can exhibit unique properties. However, reported synthesis methods for asymmetric particles hinder their application because these methods have a limited scale and lack the ability to afford particles of varied shapes. Herein, we report a novel synthetic method which has the potential to produce large quantities of asymmetric particles. Asymmetric rose-shaped gold particles were fabricated as a proof of concept experiment. First, silica nanoparticles (NPs) were bound to a hydrophobic micro-sized polymer containing 2-chlorotritylchloride linkers (2-CTC resin). Then, half-planar gold particles with rose-shaped and polyhedral structures were prepared on the silica particles on the 2-CTC resin. Particle size was controlled by the concentration of the gold source. The asymmetric particles were easily cleaved from the resin without aggregation. We confirmed that gold was grown on the silica NPs. This facile method for synthesizing asymmetric particles has great potential for materials science.
A Novel Strategy for Synthesis of Gold Nanoparticle Self Assemblies
Verma, Jyoti; Lal, Sumit; van Veen, Henk A.; van Noorden, Cornelis J. F.
2014-01-01
Gold nanoparticle self assemblies are one-dimensional structures of gold nanoparticles. Gold nanoparticle self assemblies exhibit unique physical properties and find applications in the development of biosensors. Methodologies currently available for lab-scale and commercial synthesis of gold
The Stability of Supported Gold Catalysts
Masoud, Nazila
2018-01-01
Gold has supreme cultural and financial value and, in form of nanoparticles smaller than 10 nm, is a unique catalyst for different industrially relevant reactions. Intriguing properties of the gold catalysts have spurred demand in the chemical industry for Au catalysts, the application of which
Gold-coated nanoparticles for use in biotechnology applications
Berning, Douglas E [Los Alamos, NM; Kraus, Jr., Robert H.; Atcher, Robert W [Los Alamos, NM; Schmidt, Jurgen G [Los Alamos, NM
2009-07-07
A process of preparing gold-coated magnetic nanoparticles is disclosed and includes forming a suspension of magnetic nanoparticles within a suitable liquid, adding an amount of a reducible gold compound and a reducing agent to the suspension, and, maintaining the suspension for time sufficient to form gold-coated magnetic nanoparticles.
Radiofrequency Heating Pathways for Gold Nanoparticles
Collins, C. B.; McCoy, R. S.; Ackerson, B. J.; Collins, G. J.
2015-01-01
This feature article reviews the thermal dissipation of nanoscopic gold under radiofrequency (RF) irradiation. It also presents previously unpublished data addressing obscure aspects of this phenomenon. While applications in biology motivated initial investigation of RF heating of gold nanoparticles, recent controversy concerning whether thermal effects can be attributed to nanoscopic gold highlight the need to understand the involved mechanism or mechanisms of heating. Both the nature of the particle and the nature of the RF field influence heating. Aspects of nanoparticle chemistry and physics, including the hydrodynamic diameter of the particle, the oxidation state and related magnetism of the core, and the chemical nature of the ligand shell may all strongly influence to what extent a nanoparticle heats in an RF field. Aspects of RF include: power, frequency and antenna designs that emphasize relative strength of magnetic or electric fields, and also influence the extent to which a gold nanoparticle heats in RF. These nanoparticle and RF properties are analysed in the context of three heating mechanisms proposed to explain gold nanoparticle heating in an RF field. This article also makes a critical analysis of the existing literature in the context of the nanoparticle preparations, RF structure, and suggested mechanisms in previously reported experiments. PMID:24962620
DEFF Research Database (Denmark)
Jønsson, Jesper Bosse; Bryceson, Deborah Fahy
2009-01-01
African rural dwellers have faced depressed economic prospects for several decades. Now, in a number of mineral-rich countries, multiple discoveries of gold and precious stones have attracted large numbers of prospective small-scale miners. While their 'rush' to, and activities within, mining sit...... affluent than the others, suggesting that movement can be rewarding for those willing to 'try their luck' with the hard work and social networking demands of mining another site.......African rural dwellers have faced depressed economic prospects for several decades. Now, in a number of mineral-rich countries, multiple discoveries of gold and precious stones have attracted large numbers of prospective small-scale miners. While their 'rush' to, and activities within, mining sites...
Immunological properties of gold nanoparticles
Dykman, Lev A.; Khlebtsov, Nikolai G.
2016-01-01
In the past decade, gold nanoparticles have attracted strong interest from the nanobiotechnological community owing to the significant progress made in robust and easy-to-make synthesis technologies, in surface functionalization, and in promising biomedical applications. These include bioimaging, gene diagnostics, analytical sensing, photothermal treatment of tumors, and targeted delivery of various biomolecular and chemical cargos. For the last-named application, gold nanoparticles should be...
Effects of gold coating on experimental implant fixation
DEFF Research Database (Denmark)
Zainali, Kasra; Danscher, Gorm; Jakobsen, Thomas
2009-01-01
Insertions of orthopedic implants are traumatic procedures that trigger an inflammatory response. Macrophages have been shown to liberate gold ions from metallic gold. Gold ions are known to act in an antiinflammatory manner by inhibiting cellular NF-kappa B-DNA binding and suppressing I-kappa B......-kinase activation. The present study investigated whether gilding implant Surfaces augmented early implant osseointegration and implant fixation by its modulatory effect on the local inflammatory response. Ion release was traced by autometallographic silver enhancement. Gold-coated cylindrical porous coated Ti6Al4V...
Extracellular mycosynthesis of gold nanoparticles using Fusarium solani
Gopinath, K.; Arumugam, A.
2014-08-01
The development of eco-friendly methods for the synthesis of nanomaterial shape and size is an important area of research in the field of nanotechnology. The present investigation deals with the extracellular rapid biosynthesis of gold nanoparticles using Fusarium solani culture filtrate. The UV-vis spectra of the fungal culture filtrate medium containing gold ion showed peak at 527 nm corresponding to the plasmon absorbance of gold nanoparticles. FTIR spectra provide an evidence for the presence of heterocyclic compound in the culture filtrate, which increases the stability of the synthesized gold nanoparticles. The X-ray analysis respects the Bragg's law and confirmed the crystalline nature of the gold nanoparticles. AFM analysis showed the results of particle sizes (41 nm). Transmission electron microscopy (TEM) showed that the gold nanoparticles are spherical in shape with the size range from 20 to 50 nm. The use of F. solani will offer several advantages since it is considered as a non-human pathogenic organism. The fungus F. solani has a fast growth rate, rapid capacity of metallic ions reduction, NPs stabilization and facile and economical biomass handling. Extracellular biosynthesis of gold nanoparticles could be highly advantageous from the point of view of synthesis in large quantities, time consumption, eco-friendly, non-toxic and easy downstream processing.
Natural gold composition studied by proton activation analysis (PAA)
International Nuclear Information System (INIS)
Cojocaru, V.; Badica, T.; Popescu, I.V.
2003-01-01
The minor and trace element concentration of natural gold is essential for provenance studies of gold archaeological artifacts. In this work proton activation analysis is used in order to find what elements can be put into evidence in natural gold. For that purpose some gold nuggets from Romania were used. It was found that PAA is a good supplemental method to neutron activation analysis. (authors)
Encapsulation of gold nanoparticles into self-assembling protein nanoparticles
Directory of Open Access Journals (Sweden)
Yang Yongkun
2012-10-01
Full Text Available Abstract Background Gold nanoparticles are useful tools for biological applications due to their attractive physical and chemical properties. Their applications can be further expanded when they are functionalized with biological molecules. The biological molecules not only provide the interfaces for interactions between nanoparticles and biological environment, but also contribute their biological functions to the nanoparticles. Therefore, we used self-assembling protein nanoparticles (SAPNs to encapsulate gold nanoparticles. The protein nanoparticles are formed upon self-assembly of a protein chain that is composed of a pentameric coiled-coil domain at the N-terminus and trimeric coiled-coil domain at the C-terminus. The self-assembling protein nanoparticles form a central cavity of about 10 nm in size, which is ideal for the encapsulation of gold nanoparticles with similar sizes. Results We have used SAPNs to encapsulate several commercially available gold nanoparticles. The hydrodynamic size and the surface coating of gold nanoparticles are two important factors influencing successful encapsulation by the SAPNs. Gold nanoparticles with a hydrodynamic size of less than 15 nm can successfully be encapsulated. Gold nanoparticles with citrate coating appear to have stronger interactions with the proteins, which can interfere with the formation of regular protein nanoparticles. Upon encapsulation gold nanoparticles with polymer coating interfere less strongly with the ability of the SAPNs to assemble into nanoparticles. Although the central cavity of the SAPNs carries an overall charge, the electrostatic interaction appears to be less critical for the efficient encapsulation of gold nanoparticles into the protein nanoparticles. Conclusions The SAPNs can be used to encapsulate gold nanoparticles. The SAPNs can be further functionalized by engineering functional peptides or proteins to either their N- or C-termini. Therefore encapsulation of gold
GOLD NANOPARTICLES: A REVIVAL IN PRECIOUS METAL ADMINISTRATION TO PATIENTS
Thakor, AS; Jokerst, J; Zaveleta, C; Massoud, TF; Gambhir, SS
2011-01-01
Gold has been used as a therapeutic agent to treat a wide variety of rheumatic diseases including psoriatic arthritis, juvenile arthritis and discoid lupus erythematosus. Although the use of gold has been largely superseded by newer drugs, gold nanoparticles are being used effectively in laboratory based clinical diagnostic methods whilst concurrently showing great promise in vivo either as a diagnostic imaging agent or a therapeutic agent. For these reasons, gold nanoparticles are therefore well placed to enter mainstream clinical practice in the near future. Hence, the present review summarizes the chemistry, pharmacokinetics, bio-distribution, metabolism and toxicity of bulk gold in humans based on decades of clinical observation and experiments in which gold was used to treat patients with rheumatoid arthritis. The beneficial attributes of gold nanoparticles, such as their ease of synthesis, functionalization and shape control are also highlighted demonstrating why gold nanoparticles are an attractive target for further development and optimization. The importance of controlling the size and shape of gold nanoparticles to minimize any potential toxic side effects is also discussed. PMID:21846107
International Nuclear Information System (INIS)
Lei, Kin Fong
2011-01-01
Electrical detection of the concentration of protein immobilized on a biochip is demonstrated. The concentration of the direct immobilized protein can be determined by the resistance values measured by an ohm-meter directly. Indium tin oxide interdigitated electrodes were utilized as the detection sites on the biochip. Protein, i.e. antibody, of certain concentration was first immobilized on the detection site. Gold nanoparticles were then applied to indicate the immobilized protein. Since the gold nanoparticles were tiny, a detectable electrical signal could not be generated. Hence, a gold enhancement process was performed for signal amplification. Gold nanoparticles were enlarged physically, such that a conductive metal layer was formed on the detection site. The presence and concentration of protein can be determined by the resistance value across the electrode measured by an ohm-meter. An immobilized protein concentration ranging from 50 to 1000 ng ml −1 can be detected quantitatively by the resistance values from 4300 to 1700 Ω. The proposed technique is potentially extended for the detection of immunoassay on the biochip. Since the protocol of the electrical detection does not involve sophisticated equipment, it can therefore be used for the development of a portable immunoassay device
Directory of Open Access Journals (Sweden)
Vogelmeier C
2016-12-01
Full Text Available Claus Vogelmeier,1 Nanshan Zhong,2 Michael J Humphries,3 Karen Mezzi,4 Robert Fogel,5 Giovanni Bader,4 Francesco Patalano,4 Donald Banerji5 1Department of Medicine, Pulmonary and Critical Care Medicine, University Medical Center Giessen and Marburg, Philipps-University Marburg, Member of the German Center for Lung Research (DZL, Marburg, Germany; 2State Key Laboratory, Guangzhou Institute of Respiratory Diseases, First Affiliated Hospital, Guangzhou Medical University, Guangzhou, 3Beijing Novartis Pharma Co. Ltd., Shanghai, People’s Republic of China; 4Novartis Pharma AG, Basel, Switzerland; 5Novartis Pharmaceuticals Corporation, East Hanover, NJ, USA Background: Indacaterol/glycopyrronium (IND/GLY is approved for maintenance treatment of adult patients with COPD. This post hoc analysis explored the efficacy and safety of IND/GLY versus salmeterol/fluticasone (SFC in symptomatic (Global Initiative for Chronic Obstructive Lung Disease [GOLD] B and GOLD D patients with moderate-to-severe COPD.Patients and methods: Data from LANTERN and ILLUMINATE studies were pooled and analyzed. In both studies, symptomatic COPD patients were randomized to once-daily IND/GLY 110 µg/50 µg or twice-daily SFC 50 µg/500 µg. End points were pre-dose trough forced expiratory volume in one second (FEV1, standardized area under the curve for FEV1 from 0 to 12 hours (FEV1 AUC0–12 hours, peak FEV1, peak forced vital capacity (FVC, pre-dose trough FVC, Transition Dyspnea Index (TDI total score, St George’s Respiratory Questionnaire total score, rescue medication use and safety.Results: A total of 1,263 patients were classified as either GOLD B (n=809 or GOLD D (n=454. At week 26, IND/GLY demonstrated statistically significant improvement in all lung function parameters versus SFC in patients in both the GOLD B and GOLD D subgroups. TDI total score and rescue medication use were significantly improved with IND/GLY versus SFC in the overall population and in the
The activation analysis of gold in small refractory pebbles
International Nuclear Information System (INIS)
Bibby, D.M.; Chaix, R.P.
1975-08-01
The gold content of a suite of small pebbles, residual to the milling and leach of a gold bearing ore, has been investigated by means of neutron activation analysis (NAA). An NAA technique presenting a sensitivity of 0.02μgm gold, was used as being appropriate to the samples under investigation. An alternative NAA technique developed with the same sample suite showed a sensitivity of the order of 10 -4 to 10 -5 μgm gold. The NAA techniques developed, are appropriate to the determination of gold in small samples of ore not normally amenable to milling and/or dissolution
A new route to gold nanoflowers
Liebig, Ferenc; Henning, Ricky; Sarhan, Radwan M.; Prietzel, Claudia; Bargheer, Matias; Koetz, Joachim
2018-05-01
Catanionic vesicles spontaneously formed by mixing the anionic surfactant bis(2-ethylhexyl) sulfosuccinate sodium salt with the cationic surfactant cetyltrimethylammonium bromide were used as a reducing medium to produce gold clusters, which are embedded and well-ordered into the template phase. The gold clusters can be used as seeds in the growth process that follows by adding ascorbic acid as a mild reducing component. When the ascorbic acid was added very slowly in an ice bath round-edged gold nanoflowers were produced. When the same experiments were performed at room temperature in the presence of Ag+ ions, sharp-edged nanoflowers could be synthesized. The mechanism of nanoparticle formation can be understood to be a non-diffusion-limited Ostwald ripening process of preordered gold nanoparticles embedded in catanionic vesicle fragments. Surface-enhanced Raman scattering experiments show an excellent enhancement factor of 1.7 · 105 for the nanoflowers deposited on a silicon wafer.
Fusion and quasifission studies for the 40Ca+186W,192Os reactions
Prasad, E.; Hinde, D. J.; Williams, E.; Dasgupta, M.; Carter, I. P.; Cook, K. J.; Jeung, D. Y.; Luong, D. H.; Palshetkar, C. S.; Rafferty, D. C.; Ramachandran, K.; Simenel, C.; Wakhle, A.
2017-09-01
Background: All elements above atomic number 113 have been synthesized using hot fusion reactions with calcium beams on statically deformed actinide target nuclei. Quasifission and fusion-fission are the two major mechanisms responsible for the very low production cross sections of superheavy elements. Purpose: To achieve a quantitative measurement of capture and quasifission characteristics as a function of beam energy in reactions forming heavy compound systems using calcium beams as projectiles. Methods: Fission fragment mass-angle distributions were measured for the two reactions 40Ca+186W and 40C+192Os, populating 226Pu and 232Cm compound nuclei, respectively, using the Heavy Ion Accelerator Facility and CUBE spectrometer at the Australian National University. Mass ratio distributions, angular distributions, and total fission cross sections were obtained from the experimental data. Simulations to match the features of the experimental mass-angle distributions were performed using a classical phenomenological approach. Results: Both 40Ca+186W and 40C+192Os reactions show strong mass-angle correlations at all energies measured. A maximum fusion probability of 60 -70 % is estimated for the two reactions in the energy range of the present study. Coupled-channels calculations assuming standard Woods-Saxon potential parameters overpredict the capture cross sections. Large nuclear potential diffuseness parameters ˜1.5 fm are required to fit the total capture cross sections. The presence of a weak mass-asymmetric quasifission component attributed to the higher angular momentum events can be reproduced with a shorter average sticking time but longer mass-equilibration time constant. Conclusions: The deduced above-barrier capture cross sections suggest that the dissipative processes are already occurring outside the capture barrier. The mass-angle correlations indicate that a compact shape is not achieved for deformation aligned collisions with lower capture barriers
International Nuclear Information System (INIS)
McDougall, G.J.; Hancock, R.D.
1980-01-01
The literature on activated carbon is reviewed so as to provide a general background with respect to the effect of source material and activation procedure on carbon properties, the structure and chemical nature of the surface of the activated carbon, and the nature of absorption processes on carbon. The various theories on the absorption of gold and silver from cyanide solutions are then reviewed, followed by a discussion of processes for the recovery of gold and silver from cyanide solutions using activated carbon, including a comparison with zinc precipitation
POX 186: the ultracompact blue compact dwarf galaxy reveals its nature
Doublier, V.; Kunth, D.; Courbin, F.; Magain, P.
2000-01-01
High resolution, ground based R and I band observations of the ultra compact dwarf galaxy POX 186 are presented. The data, obtained with the ESO New Technology Telescope (NTT), are analyzed using a new deconvolution algorithm which allows one to resolve the innermost regions of this stellar-like object into three Super-Star Clusters (SSC). Upper limits to both masses (M ~ 105 Msun) and physical sizes (<=60pc) of the SSCs are set. In addition, and maybe most importantly, extended light emission underlying the compact star-forming region is clearly detected in both bands. The R-I color rules out nebular Hα contamination and is consistent with an old stellar population. This casts doubt on the hypothesis that Blue Compact Dwarf Galaxies (BCDG) are young galaxies. based on observations carried out at NTT in La Silla, operated by the European Southern Observatory, during Director's Discretionary Time.
Gold recovery from low concentrations using nanoporous silica adsorbent
Aledresse, Adil
The development of high capacity adsorbents with uniform porosity denoted 5%MP-HMS (5% Mercaptopropyl-Hexagonal Mesoporous Structure) to extract gold from noncyanide solutions is presented. The preliminary studies from laboratory simulated noncyanide gold solutions show that the adsorption capacities of these materials are among the highest reported. The high adsorption saturation level of these materials, up to 1.9 mmol/g (37% of the adsorbent weight) from gold chloride solutions (potassium tetrachloroaurate) and 2.9 mmol/g (57% of the adsorbent weight) from gold bromide solutions (potassium tetrabromoaurate) at pH = 2, is a noteworthy feature of these materials. This gold loading from [AuC4]- and [AuBr4 ]- solutions corresponds to a relative Au:S molar ratio of 2.5:1 and 3.8:1, respectively. These rates are significantly higher than the usual 1:1 (Au:S) ratio expected for metal ion binding with the material. The additional gold ions loaded have been spontaneously reduced to metallic gold in the mesoporous material. Experimental studies indicated high maximum adsorptions of gold as high as 99.9% recovery. Another promising attribute of these materials is their favourable adsorption kinetics. The MP-HMS reaches equilibrium (saturation) in less than 1 minute of exposure in gold bromide and less than 10 minutes in gold chloride. The MP-HMS materials adsorption is significantly improved by agitation and the adsorption capacity of Au (III) ions increases with the decrease in pH. The recovery of adsorbed gold and the regeneration of spent adsorbent were investigated for MP-HMS adsorbent. The regenerated adsorbent (MP-HMS) maintained its adsorption capacity even after repeated use and all the gold was successfully recovered from the spent adsorbent. For the fist time, a promising adsorbent system has been found that is capable of effectively concentrating gold thiosulphate complexes, whereas conventional carbon-inpulp (CIP) and carbon-in-leach (CIL) systems fail. The
A grand unified model for liganded gold clusters
Xu, Wen Wu; Zhu, Beien; Zeng, Xiao Cheng; Gao, Yi
2016-12-01
A grand unified model (GUM) is developed to achieve fundamental understanding of rich structures of all 71 liganded gold clusters reported to date. Inspired by the quark model by which composite particles (for example, protons and neutrons) are formed by combining three quarks (or flavours), here gold atoms are assigned three `flavours' (namely, bottom, middle and top) to represent three possible valence states. The `composite particles' in GUM are categorized into two groups: variants of triangular elementary block Au3(2e) and tetrahedral elementary block Au4(2e), all satisfying the duet rule (2e) of the valence shell, akin to the octet rule in general chemistry. The elementary blocks, when packed together, form the cores of liganded gold clusters. With the GUM, structures of 71 liganded gold clusters and their growth mechanism can be deciphered altogether. Although GUM is a predictive heuristic and may not be necessarily reflective of the actual electronic structure, several highly stable liganded gold clusters are predicted, thereby offering GUM-guided synthesis of liganded gold clusters by design.
Ben Haddada , Maroua; Hübner , Maria; Casale , Sandra; Knopp , Dietmar; Niessner , Reinhard; Salmain , Michele; Boujday , Souhir
2016-01-01
International audience; We investigated the assembly of Gold nanoparticles (AuNPs) on Gold and Silicon sensors with two final objectives: (i) understanding the factors governing the interaction and (ii) building up a nanostructured piezoelectric immunosensor for diclofenac, a small-sized pharmaceutical pollutant. Different surface chemistries were devised to achieve AuNPs assembly on planar substrates. These surface chemistries included amines to immobilize AuNPs via electrostatic interaction...
Ionization model for nickel-like gold
International Nuclear Information System (INIS)
Busquet, M.; Bruneau, J.
1986-04-01
Before we build an extensive population model for gold ionized 49 to 52 times, we have studied with a more simple model the effect of accounting for cascades (or dielectronic recombination) and Δn = 0 transitions. These transitions allow some understanding of typical feature of experimental gold spectra
Formation of gold nanoparticles by glycolipids of Lactobacillus casei
Kikuchi, Fumiya; Kato, Yugo; Furihata, Kazuo; Kogure, Toshihiro; Imura, Yuki; Yoshimura, Etsuro; Suzuki, Michio
2016-01-01
Gold nanoparticles have particular properties distinct from those of bulk gold crystals, and such nanoparticles are used in various applications in optics, catalysis, and drug delivery. Many reports on microbial synthesis of gold nanoparticles have appeared. However, the molecular details (reduction and dispersion) of such synthesis remain unclear. In the present study, we studied gold nanoparticle synthesis by Lactobacillus casei. A comparison of L. casei components before and after addition...
A series of intrinsically chiral gold nanocage structures.
Liu, X J; Hamilton, I P
2017-07-27
We present a series of intrinsically chiral gold nanocage structures, Au 9n+6 , which are stable for n ≥ 2. These structures consist of an Au 9n tube which is capped with Au 3 units at each end. Removing the Au 3 caps, we obtain a series of intrinsically chiral gold nanotube structures, Au 9n , which are stable for n ≥ 4. The intrinsic chirality of these structures results from the helicity of the gold strands which form the tube and not because an individual Au atom is a chiral center. The symmetry of these structures is C 3 and substructures of gold hexagons with a gold atom in the middle are particularly prominent. We focus on the properties of Au 42 (C 3 ) and Au 105 (C 3 ) which are the two smallest gold nanocage structures to be completely tiled by these Au 7 "golden-eye" substructures. Our main focus is on Au 42 (C 3 ) since gold clusters in the 40-50 atom regime are currently being investigated in gas phase experiments. We show that the intrinsically chiral Au 42 cage structure is energetically comparable with previously reported achiral cage and compact Au 42 structures. Cage structures are of particular interest because species can be encapsulated (and stabilized) inside the cage and we provide strong evidence that Au 6 @Au 42 (C 3 ) is the global minimum Au 48 structure. The intrinsically chiral gold nanocage structures, which exhibit a range of size-related properties, have potential applications in chiral catalysis and as components in nanostructured devices.
Biosensors based on gold nanostructures
Vidotti,Marcio; Carvalhal,Rafaela F.; Mendes,Renata K.; Ferreira,Danielle C. M.; Kubota,Lauro T.
2011-01-01
The present review discusses the latest advances in biosensor technology achieved by the assembly of biomolecules associated with gold nanoparticles in analytical devices. This review is divided in sections according to the biomolecule employed in the biosensor development: (i) immunocompounds; (ii) DNA/RNA and functional DNA/RNA; and (iii) enzymes and Heme proteins. In order to facilitate the comprehension each section was subdivided according to the transduction mode. Gold nanoparticles bas...
Luan Truong, Xuan; Luong Le, Van; Quang Truong, Xuan
2015-04-01
Daksa gold deposit is the biggest gold deposits in Vietnam. The Daksa geological structure complicated, distributed mainly metamorphosed sedimentary NuiVu formation (PR3-?1nv2). The sulfide gold ore bodies distributed in quartz schist, quartz - biotite related to faut and distribution wing anticline. The gold ore bodies form circuits, network circuits, circuits lenses; fill the cup surface layer of the developing northeast - southwest; is the less than or west longitude north - SE. The results show that, Au and accompanying elements (Ag, Pb and Zn) have correlated pretty closely. All of its consistent with the logarithmic distribution standard, in accordance with the law of distribution of content mineral rare. The structure functions have nugget effect and spherical models with show that Au and accompanying elements special variation are changes. Au contents shown local anisotropy, no clearly anisotropy (K=1,17) and weakly anisotropy (K=1,4). Intensity mineralization of the ore bodies are quite high with demand spherical conversion coefficient ranging from 0.49 to 0.75 and from 0.66 to 0.97 (for other body). With nugget effects, ore bodies shown that it is consistent with mineralization in the ore bodies study, ore erasable, micro vein, infilling fractures in quartz vein. All of variogram presents local anisotropy, indicated gold mineralization at study area has least two-mineralization stages, consistent with the analysis of mineralography samples. By the results of the structure function study, the authors present the system optimization for exploration deposit and used to evaluate gold reserves by Ordinary Kriging. High accuracy of Kriging estimation results are expressed in the minimum Kriging variance, by compare the results calculated by some other methods (such as distance inverse weighting method, ..) and specially compare to the results of a some blocks have been exploited. Key words: Geostat and gold deposits VN. Daksa and gold mineralization. Geostat
Structure of the 4^+3 States in ^186,188Os
Phillips, A. A.; Garrett, P. E.; Demand, G. A.; Finlay, P.; Green, K. L.; Leach, K. G.; Schumaker, M. A.; Svensson, C. E.; Wong, J.; Hertenberger, R.; Faestermann, T.; Krücken, R.; Wirth, H.-F.; Bettermann, L.; Braun, N.; Burke, D. G.
2007-10-01
The structures of 4^+3 states in the Os nuclei have been the subject of debate for the past several decades. Based on measured B(E2) values, they were interpreted in ^186-192Os as K^π=4^+ two-phonon γ vibrations, whereas inelastic scattering results, and single-proton transfer (d,^3He) and (t,α) imply a hexadecapole phonon description. Uncertainties in the (t,α) reaction mechanism, however, were cited as preventing a firm conclusion based on those data. To help clarify the nature of these K^π=4^+ bands, we have performed a (^3He,d) stripping reaction on targets of ^185,187Re using 30 MeV ^3He beams provided by the MP-tandem facility of the LMU/TUM in Garching. With an energy resolution of 13 keV, the deuterons were analyzed at 9 angles ranging from 5^o to 50^o with the Q3D spectrograph, and absolute cross sections were obtained for levels up to 3 MeV in excitation energy. Preliminary results will be presented.
Interaction of β-sheet folds with a gold surface.
Directory of Open Access Journals (Sweden)
Martin Hoefling
Full Text Available The adsorption of proteins on inorganic surfaces is of fundamental biological importance. Further, biomedical and nanotechnological applications increasingly use interfaces between inorganic material and polypeptides. Yet, the underlying adsorption mechanism of polypeptides on surfaces is not well understood and experimentally difficult to analyze. Therefore, we investigate here the interactions of polypeptides with a gold(111 surface using computational molecular dynamics (MD simulations with a polarizable gold model in explicit water. Our focus in this paper is the investigation of the interaction of polypeptides with β-sheet folds. First, we concentrate on a β-sheet forming model peptide. Second, we investigate the interactions of two domains with high β-sheet content of the biologically important extracellular matrix protein fibronectin (FN. We find that adsorption occurs in a stepwise mechanism both for the model peptide and the protein. The positively charged amino acid Arg facilitates the initial contact formation between protein and gold surface. Our results suggest that an effective gold-binding surface patch is overall uncharged, but contains Arg for contact initiation. The polypeptides do not unfold on the gold surface within the simulation time. However, for the two FN domains, the relative domain-domain orientation changes. The observation of a very fast and strong adsorption indicates that in a biological matrix, no bare gold surfaces will be present. Hence, the bioactivity of gold surfaces (like bare gold nanoparticles will critically depend on the history of particle administration and the proteins present during initial contact between gold and biological material. Further, gold particles may act as seeds for protein aggregation. Structural re-organization and protein aggregation are potentially of immunological importance.
Accumulation of gold using Baker's yeast, Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Roy, Kamalika; Lahiri, Susanta; Sinha, P.
2006-01-01
Authors have reported preconcentration of 152 Eu, a long-lived fission product, by yeast cells, Saccharomyces cerevisiae. Gold being a precious metal is used in electroplating, hydrogenation catalyst, etc. Heterogeneous composition of samples and low concentration offers renewed interest in its selective extraction of gold using various extractants. Gold can be recovered from different solutions using various chemical reagents like amines, organophosphorus compounds, and extractants containing sulphur as donor atom, etc. In the present work, two different strains of baker's yeast, Saccharomyces cerevisiae have been used to study the preconcentration of gold at various experimental conditions
The use of gold nanoparticles to enhance radiotherapy in mice
International Nuclear Information System (INIS)
Hainfeld, James F; Slatkin, Daniel N; Smilowitz, Henry M
2004-01-01
Mice bearing subcutaneous EMT-6 mammary carcinomas received a single intravenous injection of 1.9 nm diameter gold particles (up to 2.7 g Au/kg body weight), which elevated concentrations of gold to 7 mg Au/g in tumours. Tumour-to-normal-tissue gold concentration ratios remained ∼8:1 during several minutes of 250 kVp x-ray therapy. One-year survival was 86% versus 20% with x-rays alone and 0% with gold alone. The increase in tumours safely ablated was dependent on the amount of gold injected. The gold nanoparticles were apparently non-toxic to mice and were largely cleared from the body through the kidneys. This novel use of small gold nanoparticles permitted achievement of the high metal content in tumours necessary for significant high-Z radioenhancement. (note)
Chromaticity and Glossiness of Gold, Silver, and Bronze Colors
Directory of Open Access Journals (Sweden)
Tomohisa Matsumoto
2011-05-01
Full Text Available Appearance of metallic colors, such as gold, silver and bronze, depends on chromaticity and glossiness of a surface. We aim to obtain the chromaticity region of gold, silver, and bronze by using CG simulated surfaces with various glossiness. The physical glossiness was defined by the intensity ratio of specular reflectance of the surface stimulus. The observer estimated degree of perceived glossiness, and also degree of gold, silver, or bronze appearance of the stimulus with a physical glossiness and a chromaticity. The results showed that the stimulus began to appear gold, silver or bronze at a certain chromaticity point only when the stimulus had glossiness. The chromaticity range, where gold, silver and bronze colors were observed, expanded as the degree of glossiness increased. Furthermore the ratio of the degree of gold, silver or bronze colors to that of glossiness of the stimulus was found to be different among the chromaticity points of the stimulus. This ratio was highest with highly saturated stimuli for gold and bronze colors, and with achromatic stimuli for silver color.
Recovery of Silver and Gold from Copper Anode Slimes
Chen, Ailiang; Peng, Zhiwei; Hwang, Jiann-Yang; Ma, Yutian; Liu, Xuheng; Chen, Xingyu
2015-02-01
Copper anode slimes, produced from copper electrolytic refining, are important industrial by-products containing several valuable metals, particularly silver and gold. This article provides a comprehensive overview of the development of the extraction processes for recovering silver and gold from conventional copper anode slimes. Existing processes, namely pyrometallurgical processes, hydrometallurgical processes, and hybrid processes involving the combination of pyrometallurgical and hydrometallurgical technologies, are discussed based in part on a review of the form and characteristics of silver and gold in copper anode slimes. The recovery of silver and gold in pyrometallurgical processes is influenced in part by the slag and matte/metal chemistry and related characteristics, whereas the extraction of these metals in hydrometallurgical processes depends on the leaching reagents used to break the structure of the silver- and gold-bearing phases, such as selenides. By taking advantage of both pyrometallurgical and hydrometallurgical techniques, high extraction yields of silver and gold can be obtained using such combined approaches that appear promising for efficient extraction of silver and gold from copper anode slimes.
Peptide-functionalized iron oxide magnetic nanoparticle for gold mining
Energy Technology Data Exchange (ETDEWEB)
Shen, Wei-Zheng; Cetinel, Sibel; Sharma, Kumakshi; Borujeny, Elham Rafie; Montemagno, Carlo, E-mail: montemag@ualberta.ca [Ingenuity Lab, 1-070C (Canada)
2017-02-15
Here, we present our work on preparing a novel nanomaterial composed of inorganic binding peptides and magnetic nanoparticles for inorganic mining. Two previously selected and well-characterized gold-binding peptides from cell surface display, AuBP1 and AuBP2, were exploited. This nanomaterial (AuBP-MNP) was designed to fulfill the following two significant functions: the surface conjugated gold-binding peptide will recognize and selectively bind to gold, while the magnetic nano-sized core will respond and migrate according to the applied external magnetic field. This will allow the smart nanomaterial to mine an individual material (gold) from a pool of mixture, without excessive solvent extraction, filtration, and concentration steps. The working efficiency of AuBP-MNP was determined by showing a dramatic reduction of gold nanoparticle colloid concentration, monitored by spectroscopy. The binding kinetics of AuBP-MNP onto the gold surface was determined using surface plasmon resonance (SPR) spectroscopy, which exhibits around 100 times higher binding kinetics than peptides alone. The binding capacity of AuBP-MNP was demonstrated by a bench-top mining test with gold microparticles.
Photochemical Synthesis of the Bioconjugate Folic Acid-Gold Nanoparticles
DEFF Research Database (Denmark)
León, John Jairo Castillo; Bertel, Linda; Páez-Mozo, Edgar
2013-01-01
In this paper we present a rapid and simple onepot method to obtain gold nanoparticles functionalized with folic acid using a photochemistry method. The bioconjugate folic acid-gold nanoparticle was generated in one step using a photo-reduction method, mixing hydrogen tetrachloroaurate with folic...... at 4°C prolongs the stability of folic acid-gold nanoparticle suspensions to up to 26 days. Ultraviolet visible and Fourier transform infrared spectroscopy showed a surface plasmon band of around 534nm and fluorescence spectroscopy exhibited a quenching effect on gold nanoparticles in the fluorescence...... emission of folic acid and thus confirmed the conjugation of folic acid to the surface of gold nanoparticles. In this study we demonstrate the use of a photochemistry method to obtain folic acid-gold nanoparticles in a simple and rapid way without the use of surfactants and long reaction times...
Synthesis and catalytic activity of the metastable phase of gold phosphide
Energy Technology Data Exchange (ETDEWEB)
Fernando, Deshani; Nigro, Toni A.E.; Dyer, I.D. [Department of Chemistry, 107 Physical Sciences I, Oklahoma State University, Stillwater, OK 74078 (United States); Alia, Shaun M.; Pivovar, Bryan S. [Chemical and Materials Science Center, National Renewable Energy Laboratory, Golden, CO 80401 (United States); Vasquez, Yolanda, E-mail: yolanda.vasquez@okstate.edu [Department of Chemistry, 107 Physical Sciences I, Oklahoma State University, Stillwater, OK 74078 (United States)
2016-10-15
Recently, transition metal phosphides have found new applications as catalysts for the hydrogen evolution reaction that has generated an impetus to synthesize these materials at the nanoscale. In this work, Au{sub 2}P{sub 3} was synthesized utilizing the high temperature decomposition of tri-n-octylphosphine as a source of elemental phosphorous. Gold nanorods were used as morphological templates with the aim of controlling the shape and size of the resulting gold phosphide particles. We demonstrate that the surface capping ligand of the gold nanoparticle precursors can influence the purity and extent to which the gold phosphide phase will form. Gold nanorods functionalized with 1-dodecanethiol undergo digestive ripening to produce discrete spherical particles that exhibit reduced reactivity towards phosphorous, resulting in low yields of the gold phosphide. In contrast, gold phosphide was obtained as a phase pure product when cetyltrimethylammonium bromide functionalized gold nanorods are used instead. The Au{sub 2}P{sub 3} nanoparticles exhibited higher activity than polycrystalline gold towards the hydrogen evolution reaction. - Graphical abstract: Au{sub 2}P{sub 3} was synthesized utilizing the high temperature decomposition of tri-n-octylphosphine as a source of elemental phosphorous and gold nanoparticles as reactants. We demonstrate that the surface capping ligand of the gold nanoparticle precursors influence the purity and extent to which the Au{sub 2}P{sub 3} phase will form. Gold nanorods functionalized with 1-dodecanethiol undergo digestive ripening to produce discrete spherical particles that exhibit reduced reactivity towards phosphorous, resulting in low yields of the gold phosphide. In contrast, gold phosphide was obtained as a phase pure product when cetyltrimethylammonium bromide functionalized gold nanoparticles are used instead. The Au{sub 2}P{sub 3} nanoparticles exhibited higher activity than polycrystalline gold towards the hydrogen evolution
The Golden Target: Analyzing the Tracking Performance of Leveraged Gold ETFs
Tim Leung; Brian Ward
2015-01-01
This paper studies the empirical tracking performance of leveraged ETFs on gold, and their price relationships with gold spot and futures. For tracking the gold spot, we find that our optimized portfolios with short-term gold futures are highly effective in replicating prices. The market-traded gold ETF (GLD) also exhibits a similar tracking performance. However, we show that leveraged gold ETFs tend to underperform their corresponding leveraged benchmark. Moreover, the underperformance worse...
Characterisation of a thiosulphate-sulphite gold electrodeposition process
International Nuclear Information System (INIS)
J-Liew, M.; Sobri, S.; Roy, S.
2005-01-01
Electrodeposition of soft gold is an important process in the fabrication of micro devices for electronics, optics etc. Traditional gold electroplating is based on a gold cyanide process which is not applicable for the stringent requirements in state of the art micro device manufacture. Newcastle University has been involved in the development of an industrial process based on a mixed ligand electrolyte-the gold thiosulphate-sulphite system. Here we present methods for the formulation of this electrolyte in the laboratory which ensure bath stability and process compatibility. In addition, we have carried out spectrophotometry to elucidate the possible reasons of its chemical stability. Standard rotating disk and cyclic voltammetry has been carried out to determine the electrochemical behaviour of the gold thiosulphate-sulphite system. The changes in electrochemical behaviour as the bath ages are also discussed
Naked Gold Nanoparticles and hot Electrons in Water.
Ghandi, Khashayar; Wang, Furong; Landry, Cody; Mostafavi, Mehran
2018-05-08
The ionizing radiation in aqueous solutions of gold nanoparticles, stabilized by electrostatic non-covalent intermolecular forces and steric interactions, with antimicrobial compounds, are investigated with picosecond pulse radiolysis techniques. Upon pulse radiolysis of an aqueous solution containing very low concentrations of gold nanoparticles with naked surfaces available in water (not obstructed by chemical bonds), a change to Cerenkov spectrum over a large range of wavelengths are observed and pre-solvated electrons are captured by gold nanoparticles exclusively (not by ionic liquid surfactants used to stabilize the nanoparticles). The solvated electrons are also found to decay rapidly compared with the decay kinetics in water. These very fast reactions with electrons in water could provide an enhanced oxidizing zone around gold nanoparticles and this could be the reason for radio sensitizing behavior of gold nanoparticles in radiation therapy.
Gold-Pluronic core-shell nanoparticles: synthesis, characterization and biological evaluation
Energy Technology Data Exchange (ETDEWEB)
Simon, Timea; Boca, Sanda [Babes-Bolyai University, Nanobiophotonics and Laser Microspectroscopy Center, Interdisciplinary Research Institute on Bio-Nano-Sciences and Faculty of Physics (Romania); Biro, Dominic [Sapientia University, Department of Mechanical Engineering, Faculty of Technical and Human Sciences (Romania); Baldeck, Patrice [Universite Joseph Fourier and CNRS, Laboratoire Interdisciplinaire de Physique, UMR 5588, CNRS (France); Astilean, Simion, E-mail: simion.astilean@phys.ubbcluj.ro [Babes-Bolyai University, Nanobiophotonics and Laser Microspectroscopy Center, Interdisciplinary Research Institute on Bio-Nano-Sciences and Faculty of Physics (Romania)
2013-04-15
This study presents the synthesis of gold-Pluronic core-shell nanoparticles by a two-step method and investigates their biological impact on cancer cells, specifically nanoparticle internalization and cytotoxicity. Uniform, 9-10-nm-sized, hydrophobic gold nanoparticles were synthesized in organic phase by reducing gold salt with oleylamine, after which oleylamine-protected gold nanoparticles were phase-transferred into aqueous medium using Pluronic F127 block copolymer, resulting in gold-Pluronic core-shell nanoparticles with a mean hydrodynamic diameter of {approx}35 nm. The formation and phase-transfer of gold nanoparticles were analyzed by UV-Vis absorption spectroscopy, transmission electron microscopy, and dynamic light scattering. The obtained gold-Pluronic core-shell nanoparticles proved to be highly stable in salted solution. Cytotoxicity tests showed no modification of cellular viability in the presence of properly purified particles. Furthermore, dark-field cellular imaging demonstrated that gold-Pluronic nanoparticles were able to be efficiently uptaken by cells, being internalized through nonspecific endocytosis. The high stability, proven biocompatibility, and imaging properties of gold-Pluronic core-shell nanoparticles hold promise for relevant intracellular applications, with such a design providing the feasibility to combine all multiple functionalities in one nanoparticle for simultaneous detection and imaging.
Quinone-Enriched Gold Nanoparticles in Bioelectrochemistry and Charge Storage
DEFF Research Database (Denmark)
Wagner, Michal; Qvortrup, Katrine; Tanner, David Ackland
for merging gold nanoparticles with resultant anthraquinones include one-pot microwave assisted synthesis or after-mixing of separately prepared gold nanoparticles with selected compounds. The quinone-enriched gold nanoparticles can be transferred onto different electrode surfaces, thus enabling facile...
Enhancement of radiation effect on cancer cells by gold-pHLIP
Antosh, Michael P.; Wijesinghe, Dayanjali D.; Shrestha, Samana; Lanou, Robert; Huang, Yun Hu; Hasselbacher, Thomas; Fox, David; Neretti, Nicola; Sun, Shouheng; Katenka, Natallia; Cooper, Leon N; Andreev, Oleg A.; Reshetnyak, Yana K.
2015-01-01
Previous research has shown that gold nanoparticles can increase the effectiveness of radiation on cancer cells. Improved radiation effectiveness would allow lower radiation doses given to patients, reducing adverse effects; alternatively, it would provide more cancer killing at current radiation doses. Damage from radiation and gold nanoparticles depends in part on the Auger effect, which is very localized; thus, it is important to place the gold nanoparticles on or in the cancer cells. In this work, we use the pH-sensitive, tumor-targeting agent, pH Low-Insertion Peptide (pHLIP), to tether 1.4-nm gold nanoparticles to cancer cells. We find that the conjugation of pHLIP to gold nanoparticles increases gold uptake in cells compared with gold nanoparticles without pHLIP, with the nanoparticles distributed mostly on the cellular membranes. We further find that gold nanoparticles conjugated to pHLIP produce a statistically significant decrease in cell survival with radiation compared with cells without gold nanoparticles and cells with gold alone. In the context of our previous findings demonstrating efficient pHLIP-mediated delivery of gold nanoparticles to tumors, the obtained results serve as a foundation for further preclinical evaluation of dose enhancement. PMID:25870296
International Nuclear Information System (INIS)
Rezvani Nikabadi, H; Shahtahmasebi, N; Rezaee Rokn-Abadi, M; Bagheri Mohagheghi, M M; Goharshadi, E K
2013-01-01
In this paper, a facile method for the synthesis of gold nanoseeds on the functionalized surface of silica nanoparticles has been investigated. Mono-dispersed silica particles and gold nanoparticles were prepared by the chemical reduction method. The thickness of the Au shell was well controlled by repeating the reduction time of HAuCl 4 on silica/3-aminopropyltriethoxysilane (APTES)/initial gold nanoparticles. The prepared SiO 2 -gold core/shell nanoparticles were studied using x-ray diffraction, scanning electron microscopy, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy and ultraviolet visible (UV-Vis) spectroscopy. The TEM images indicated that the silica nanoparticles were spherical in shape with 100 nm diameters and functionalizing silica nanoparticles with a layer of bi-functional APTES molecules and tetrakis hydroxy methyl phosphonium chloride. The gold nanoparticles show a narrow size of up to 5 nm and by growing gold nanoseeds over the silica cores a red shift in the maximum absorbance of UV-Vis spectroscopy from 524 to 637 nm was observed.
GOLD CLUSTER LABELS AND RELATED TECHNOLOGIES IN MOLECULAR MORPHOLOGY.
Energy Technology Data Exchange (ETDEWEB)
HAINFELD,J.F.; POWELL,R.D.
2004-02-04
Although intensely colored, even the largest colloidal gold particles are not, on their own, sufficiently colored for routine use as a light microscopy stain: only with very abundant antigens or with specialized illumination methods can bound gold be seen. Colloidal gold probes were developed primarily as markers for electron microscopy, for which their very high electron density and selectivity for narrow size distributions when prepared in different ways rendered them highly suited. The widespread use of gold labeling for light microscopy was made possible by the introduction of autometallographic enhancement methods. In these processes, the bound gold particles are exposed to a solution containing metal ions and a reducing agent; they catalyze the reduction of the ions, resulting in the deposition of additional metal selectively onto the particles. On the molecular level, the gold particles are enlarged up to 30-100 nm in diameter; on the macroscale level, this results in the formation of a dark stain in regions containing bound gold particles, greatly increasing visibility and contrast. The applications of colloidal gold have been described elsewhere in this chapter, we will focus on the use of covalently linked cluster complexes of gold and other metals. A gold cluster complex is a discrete molecular coordination compound comprising a central core, or ''cluster'' of electron-dense metal atoms, ligated by a shell of small organic molecules (ligands), which are linked to the metal atoms on the surface of the core. This structure gives clusters several important advantages as labels. The capping of the metal surface by ligands prevents non-specific binding to cell and tissue components, which can occur with colloidal gold. Cluster compounds are more stable and may be used under a wider range of conditions. Unlike colloidal gold, clusters do not require additional macromolecules such as bovine serum albumin or polyethylene glycol for
Evaluated 182,183,184,186W Neutron Cross Sections and Covariances in the Resolved Resonance Region
International Nuclear Information System (INIS)
Pigni, Marco T; Leal, Luiz C
2015-01-01
Oak Ridge National Laboratory (ORNL) has recently completed the resonance parameter evaluation of four tungsten isotopes, i.e., 182,183,184,186 W, in the neutron energy range of thermal up to several keV. This nuclear data work was performed with support from the US Nuclear Criticality Safety Program (NCSP) in an effort to provide improved tungsten cross section and covariance data for criticality safety analyses. The evaluation methodology uses the Reich-Moore approximation of the R-matrix formalism of the code SAMMY to fit high-resolution measurements performed in 2010 and 2012 at the Geel linear accelerator facility (GELINA), as well as other experimental data sets on natural tungsten available in the EXFOR library. In the analyzed energy range, this work nearly doubles the resolved resonance region (RRR) present in the latest US nuclear data library ENDF/B-VII.1. In view of the interest in tungsten for distinct types of nuclear applications and the relatively homogeneous distribution of the isotopic tungsten - namely, 182 W(26.5%), 183 W(14.31%), 184 W(30.64%), and 186 W(28.43%) - the completion of these four evaluations represents a significant contribution to the improvement of the ENDF library. This paper presents an overview of the evaluated resonance parameters and related covariances for total and capture cross sections on the four tungsten isotopes.
Gold deposits of the southern Piedmont
Pardee, J.T.; Park, C.F.
1948-01-01
This report deals chiefly with the gold mines in the Southern Appalachian gold belt whose workings were accessible at the time of examination, but it also · summarizes available information concerning many mines that were not accessible. Most of the mines lie within a belt, 10 to 100 miles wide, that extends
Characterisation of gold from Fiji
Naden, Jon; Henney, P.J.
1995-01-01
This is a study of the variation in chemistry and inclusion mineralogy of bedrock and placer gold from Fiji. It forms part of a large project, undertaking gold characterisation from a wide range of geological environments in Ecuador, Zimbabwe, Malaysia and Fiji. The work was carried out under the Overseas Development AdministratiodBritish Geological Survey Technology Development and Research programme (Project R5549) as part of the British Government’s provision of technical...
Chemically functionalized gold nanoparticles: Synthesis, characterization, and applications
Daniel, Weston Lewis
This thesis focuses on the development and application of gold nanoparticle based detection systems and biomimetic structures. Each class of modified nanoparticle has properties that are defined by its chemical moieties that interface with solution and the gold nanoparticle core. In Chapter 2, a comparison of the biomolecular composition and binding properties of various preparations of antibody oligonucleotide gold nanoparticle conjugates is presented. These constructs differed significantly in terms of their structure and binding properties. Chapter 3 reports the use of electroless gold deposition as a light scattering signal enhancer in a multiplexed, microarray-based scanometric immunoassay using the gold nanoparticle probes evaluated in Chapter 2. The use of gold development results in greater signal enhancement than the typical silver development, and multiple rounds of metal development were found to increase the resulting signal compared to one development. Chapter 4 describes an amplified scanometric detection method for human telomerase activity. Gold nanoparticles functionalized with specific oligonucleotide sequences can efficiently capture telomerase enzymes and subsequently be elongated. Both the elongated and unmodified oligonucleotide sequences are simultaneously measured. At low telomerase concentrations, elongated strands cannot be detected, but the unmodified sequences, which come from the same probe particles, can be detected because their concentration is higher, providing a novel form of amplification. Chapter 5 reports the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes. The assay works on the concept of a kinetic end point and can be triggered at the EPA
Refractory concentrate gold leaching: Cyanide vs. bromine
Dadgar, Ahmad
1989-12-01
Gold extraction, recovery and economics for two refractory concentrates were investigated using cyanide and bromine reagents. Gold extractions for cyanide leaching (24-48 hours) and bromine leaching (six hours) were the same and ranged from 94 to 96%. Gold recoveries from bromine pregnant solutions using carbon adsorption, ion exchange, solvent extraction, and zinc and aluminum precipitation methods were better than 99.9%. A preliminary economic analysis indicates that chemical costs for cyanidation and bromine process are 11.70 and 11.60 respectively, per tonne of calcine processed.
Gold's monetary roll will be strengthened - Plumbridge
International Nuclear Information System (INIS)
Anon.
1977-01-01
Delivering his Presidential address at the Chamber's annual general meeting, Mr Plumbridge said the gold market would enter a new phase and listed seven reasons why gold's monetary role would be strengthened. There was a dramatic increase in the demand for gold jewellery. He also forecasted that South African uranium production would again attain its former peak annual production of about 6000t. There is an essential need for a sustained growth in nuclear power and the prospects for uranium mining industry remain encouraging
Gold nanoparticles extraction from dielectric scattering background
Hong, Xin; Wang, Jingxin
2014-11-01
The unique advantages such as brightness, non-photobleaching, good bio-compatibility make gold nanoparticles desirable labels and play important roles in biotech and related research and applications. Distinguishing gold nanoparticles from other dielectric scattering particles is of more importance, especially in bio-tracing and imaging. The enhancement image results from the localized surface plasmon resonance associated with gold nanopartilces makes themselves distinguishable from other dielectric particles, based on which, we propose a dual-wavelength detection method by employing a high sensitive cross-polarization microscopy.
Booster gold beam injection efficiency and beam loss
International Nuclear Information System (INIS)
Zhang, S.Y.; Ahrens, L.A.
1998-01-01
The Relativistic Heavy Ion Collider (RHIC) at the BNL requires the AGS to provide Gold beam with the intensity of 10 9 ions per bunch. Over the years, the Tandem Van de Graaff has provided steadily increasing intensity of gold ion beams to the AGS Booster. However, the gold beam injection efficiency at the Booster has been found to decrease with the rising intensity of injected beams. As the result, for Tandem beams of the highest intensity, the Booster late intensity is lower than with slightly lower intensity Tandem beam. In this article, the authors present two experiments associated with the Booster injection efficiency and beam intensity. One experiment looks at the Booster injection efficiency by adjusting the Tandem beam intensity, and another looks at the beam life time while scraping the beam in the Booster. The studies suggest that the gold beam injection efficiency at the AGS Booster is related to the beam loss in the ring, rather than the intensity of injected beam or circulating beam. A close look at the effect of the lost gold ion at the Booster injection leads to the prediction that the lost gold ion creates large number of positive ions, and even larger number of electrons. The lost gold beam is also expected to create large numbers of neutral particles. In 1998 heavy ion run, the production of positive ions and electrons due to the lost gold beam has been observed. Also the high vacuum pressure due to the beam loss, presumably because of the neutral particles it created, has been measured. These results will be reported elsewhere
Use of Soybean Lecithin in Shape Controlled Synthesis of Gold Nanoparticles
Ayres, Benjamin Robert
The work presented in this dissertation is a composite of experiments in the growth of gold nanoparticles with specific optical properties of interest. The goal is to synthesize these gold nanoparticles using soybean extract for not only shape control, but for propensity as a biocompatible delivery system. The optical properties of these nanoparticles has found great application in coloring glass during the Roman empire and, over the centuries, has grown into its own research field in applications of nanoparticulate materials. Many of the current functions include use in biological systems as biosensors and therapeutic applications, thus making biocompatibility a necessity. Current use of cetyltrimethylammonium bromide leads to rod-shaped gold nanoparticles, however, the stability of these gold nanoparticles does not endure for extended periods of time in aqueous media. In my research, two important components were found to be necessary for stable, anisotropic growth of gold nanoparticles. In the first experiments, it was found that bromide played a key role in shape control. Bromide exchange on the gold atoms led to specific packing of the growing crystals, allowing for two-dimensional growth of gold nanoparticles. It was also discerned that soybean lecithin contained ligands that blocked specific gold facets leading to prismatic gold nanoparticle growth. These gold nanoprisms give a near infrared plasmon absorption similar to that of rod-shaped gold nanoparticles. These gold nanoprisms are discovered to be extremely stable in aqueous media and remain soluble for extended periods of time, far longer than that of gold nanoparticles grown using cetyltrimethylammonium bromide. Since soy lecithin has a plethora of compounds present, it became necessary to discover which compound was responsible for the shape control of the gold nanoprisms in order to optimize the synthesis and allow for a maximum yield of the gold nanoprisms. Many of these components were identified
Size control synthesis of starch capped-gold nanoparticles
International Nuclear Information System (INIS)
Tajammul Hussain, S.; Iqbal, M.; Mazhar, M.
2009-01-01
Metallic gold nanoparticles have been synthesized by the reduction of chloroaurate anions [AuCl 4 ] - solution with hydrazine in the aqueous starch and ethylene glycol solution at room temperature and at atmospheric pressure. The characterization of synthesized gold nanoparticles by UV-vis spectroscopy, high resolution transmission electron microscopy (HRTEM), electron diffraction analysis, X-ray diffraction (XRD), and X-rays photoelectron spectroscopy (XPS) indicate that average size of pure gold nanoparticles is 3.5 nm, they are spherical in shape and are pure metallic gold. The concentration effects of [AuCl 4 ] - anions, starch, ethylene glycol, and hydrazine, on particle size, were investigated, and the stabilization mechanism of Au nanoparticles by starch polymer molecules was also studied by FT-IR and thermogravimetric analysis (TGA). FT-IR and TGA analysis shows that hydroxyl groups of starch are responsible of capping and stabilizing gold nanoparticles. The UV-vis spectrum of these samples shows that there is blue shift in surface plasmon resonance peak with decrease in particle size due to the quantum confinement effect, a supporting evidence of formation of gold nanoparticles and this shift remains stable even after 3 months.
Antibacterial properties and mechanisms of gold-silver nanocages
Wang, Yulan; Wan, Jiangshan; Miron, Richard J.; Zhao, Yanbin; Zhang, Yufeng
2016-05-01
Despite the number of antibiotics used in routine clinical practice, bacterial infections continue to be one of the most important challenges faced in humans. The main concerns arise from the continuing emergence of antibiotic-resistant bacteria and the difficulties faced with the pharmaceutical development of new antibiotics. Thus, advancements in the avenue of novel antibacterial agents are essential. In this study, gold (Au) was combined with silver (Ag), a well-known antibacterial material, to form silver nanoparticles producing a gold-silver alloy structure with hollow interiors and porous walls (gold-silver nanocage). This novel material was promising in antibacterial applications due to its better biocompatibility than Ag nanoparticles, potential in photothermal effects and drug delivery ability. The gold-silver nanocage was then tested for its antibacterial properties and the mechanism involved leading to its antibacterial properties. This study confirms that this novel gold-silver nanocage has broad-spectrum antibacterial properties exerting its effects through the destruction of the cell membrane, production of reactive oxygen species (ROS) and induction of cell apoptosis. Therefore, we introduce a novel gold-silver nanocage that serves as a potential nanocarrier for the future delivery of antibiotics.
Time series analysis of gold production in Malaysia
Muda, Nora; Hoon, Lee Yuen
2012-05-01
Gold is a soft, malleable, bright yellow metallic element and unaffected by air or most reagents. It is highly valued as an asset or investment commodity and is extensively used in jewellery, industrial application, dentistry and medical applications. In Malaysia, gold mining is limited in several areas such as Pahang, Kelantan, Terengganu, Johor and Sarawak. The main purpose of this case study is to obtain a suitable model for the production of gold in Malaysia. The model can also be used to predict the data of Malaysia's gold production in the future. Box-Jenkins time series method was used to perform time series analysis with the following steps: identification, estimation, diagnostic checking and forecasting. In addition, the accuracy of prediction is tested using mean absolute percentage error (MAPE). From the analysis, the ARIMA (3,1,1) model was found to be the best fitted model with MAPE equals to 3.704%, indicating the prediction is very accurate. Hence, this model can be used for forecasting. This study is expected to help the private and public sectors to understand the gold production scenario and later plan the gold mining activities in Malaysia.
Gold and not so real gold in Medieval treatises
Directory of Open Access Journals (Sweden)
Srebrenka Bogovic-Zeskoski
2015-01-01
Full Text Available The aim of this study is to evidence diverse materials and processes used by artisans (and alchemists required to synthesize a visually viable replacement for gold. The emphasis of the research is upon the production of mosaic gold or porporina, a pigment that has survived into modern times, which was used as ink and as paint. Base metals, mostly tin, but also alloys were used both into foils coated with glazes and varnishes and as pigment. The research focuses upon recipes documented in treatises dating from Antiquity to the late Medieval period (ca. 1500 and an attempt is made to answer two questions. In the first place, why was there a need for a surrogate? Secondly, why are there so few tangible examples detected on surviving artifacts? In conclusion, an argument is offered pointing out that, although much can be learned by scientific examination of artifacts, textual analysis is equally important and necessary to unravel mysteries of ancient technologies
Preparation of gold ethanol colloid by the arc discharge method
International Nuclear Information System (INIS)
Tseng, K.-H.; Huang, J.-C.; Liao, C.-Y.; Tien, D.-C.; Tsung, T.-T.
2009-01-01
A new method using the arc discharge method (ADM) to synthesize gold nanoparticles in an anhydrous ethanol was studied. Fabricated gold nanoparticles were characterized by different techniques. Unlike conventional methods for metal nanoparticles synthesis, the ADM method does not require application of chemical surfactants and stabilizers. The microstructure of ADM-produced gold nanoparticles was examined by transmission electron microscope (TEM) and scanning electron microscope (SEM). The particle size was found in the range of 2-40 nm. The chemical composition of gold nanoparticles has been confirmed by the energy dispersive X-ray analysis (EDX). The crystal structure of the nanoscale gold particles was studied using the X-ray diffraction (XRD) method. Images of the gold nanoparticles, Zeta potential, size distribution, and ultraviolet-visible (UV-vis) absorbance were investigated. This innovative approach for gold nanoparticles preparation has been successfully established. The experimental results showed that the ADM technique is easy, cheap and clean method which can be used to manufacture gold nanoparticles suspended in ethanol solution without any surfactant
International Nuclear Information System (INIS)
Vulcu, Adriana; Grosan, Camelia; Muresan, Liana Maria; Pruneanu, Stela; Olenic, Liliana
2013-01-01
The present paper describes the preparation of new modified surfaces for electrodes based on guanine/thiocytosine and gold nanoparticles. The gold nanoparticles were analyzed by UV–vis spectroscopy and transmission electron microscopy (TEM) and it was found that they have diameters between 30 and 40 nm. The layers were characterized by specular reflectance infrared spectroscopy (FTIR-RAS) and by atomic force microscopy (AFM). The thickness of layers was found to be approximately 30 nm for TC layers and 300 nm for GU layers. Every layer was characterized as electrochemical sensor (by cyclic voltammetry) both for uric acid and ascorbic acid determinations, separately and in their mixture. The modified sensors have good calibration functions with good sensitivity (between 1.145 and 1.406 mA cm −2 /decade), reproducibility ( t hiocytosine (Au T C) and gold g uanine (Au G U) layers
International Nuclear Information System (INIS)
Shen Maogen; Yao Liying.
1989-01-01
The gold determination method is described by cold leaching gold in dilute aqua regia and collection on activated charcoal and presents the results obtained in determining gold of uranium deposits and soil samples
Some developments in the extraction of gold from Witwatersrand ores
International Nuclear Information System (INIS)
Laxen, P.A.
1975-01-01
The extraction of gold from most ores of the Witwatersrand has been consistently high - approximately 95 per cent - for many years. The present high price of gold has stimulated research and development into potential improvements of the standard procedures. The occurrence of the gold and its association with other minerals is described briefly. The Witwatersrand reefs also contain uranium and pyrite, and some of the improvements to the standard gold-extraction process are associated with the recovery or concentration of one or both of these valuable constituents. For instance, the 'reverse-leach' process, in which acid treatment for the extraction of uranium precedes cyanidation, results in improved gold extraction. Some concentration techniques used on the present residues from cyanidation offer promise in improving the overall gold recoveries. Thucholite is an important carrier of residual gold, and its recovery from some residues by flotation appears to be economically justifiable. Wet high-intensity magnetic separation has given promising results, in the laboratory and on the pilot plant, for the recovery of both uranium and gold from a number of cyanide tailings. The benefits of gravity concentration and of the application of empirical modelling to the gold-extraction process have been demonstrated by a mining group. Some developments in instrumentation for control during cyanidation are discussed briefly [af
Lime in gold and uranium mining
International Nuclear Information System (INIS)
Van Staden, C.M.
1979-01-01
In this article the author discusses the role of lime in gold and uranium extraction and looks more closely at the industry's efforts to improve the environment by vegetation of sand dumps and slimes dams. He then comes to the conclusion that lime has been and still is the most effective, practical and cheapest chemical that can be used in the South African gold and uranium mining industry to settle pulps, protect cyanide solutions, aid the vegetation of dumps and neutralise acidic waters and residues. The gold and uranium industry is very pollution concious, and in South Africa the importance of the role that lime plays in combating air and water pollution cannot be over emphasised
Erdman, J.A.; Cookro, T.M.; O'Leary, R. M.; Harms, T.F.
1988-01-01
Big sagebrush - a cold-desert species that dominates the terrain over large parts of western United States - was sampled along several traverses that crossed thermally metamorphosed limestone, phyllitic shale, and schist of the Middle and Upper Cambrian Preble Formation that host skarn-, disseminated gold and silver-, and hot springs gold-type mineral occurrences. Patterns of detectable levels of gold (8 to 28 ppb or ng g-1) in ash of new growth were consistent with areas affected by known or suspected gold mineralization. Soils collected along one of the traverses where a selenium-indicator plant was common contained no gold above background levels of 2ppb, but were consistently high in As, Sb, and Zn, and several samples were unusually high in Se (maximum 11 ppm or ??g g-1). Sagebrush along this traverse contained Li at levels above norms for this species. We also found a puzzling geochemical anomaly at a site basinward from active hot springs along a range-front fault scarp. Sagebrush at this site contained a trace of gold and an unusually high concentration of Cd (13 ppm) and the soil had anomalous concentrations of Cd and Bi (3.2 and 6 ppm, respectively). The source of this anomaly could be either metal-rich waters from an irrigation ditch or leakage along a buried fault. Despite the limited nature of the study, we conclude that gold in sagebrush could be a cost-effective guide to drilling locations in areas where the geology seems favorable for disseminated and vein precious metals. ?? 1988.
Using mineralogy to optimize gold recovery by direct cyanidation
Venter, D.; Chryssoulis, S. L.; Mulpeter, T.
2004-08-01
The complete and accurate gold deportments of direct cyanide leach residues provide a clear picture of the occurrence of unrecovered gold and identify causes for poor extraction. Based on the independent measurement of each form and carrier of unleached gold, opportunities for recovery optimization can be assessed more accurately by providing meaningful targets and can help identify the means to achieve such targets. In ten of 14 leach plants surveyed, 23% of the unrecovered gold could be extracted without finer grinding.
Recovering gold from thiosulfate leach pulps via ion exchange
Nicol, Michael J.; O'Malley, Glen
2002-10-01
Increasing environmental and occupational safety concerns about the use of cyanide in gold processing has increased interest in more acceptable alternative lixiviants, the most promising of which is thiosulfate. However, the thiosulfate process lacks a proven inpulp method of recovering the dissolved gold because activated carbon is not effective for the absorption of the gold-thiosulfate complex. This paper describes work aimed at evaluating the effectiveness of commercially available anion exchange resins for the recovery of gold from thiosulfate leach liquors and pulps.
Breaking gold nano-junctions simulation and analysis
DEFF Research Database (Denmark)
Lauritzen, Kasper Primdal
, to predict the structure of a gold junction just as it breaks. This method is based on artificial neural networks and can be used on experimental data, even when it is trained purely on simulated data. The method is extended to other types of experimental traces, where it is trained without the use......Simulating the movements of individual atoms allows us to look at and investigate the physical processes that happen in an experiment. In this thesis I use simulations to support and improve experimental studies of breaking gold nano-junctions. By using molecular dynamics to study gold nanowires, I...... can investigate their breaking forces under varying conditions, like stretching rate or temperature. This resolves a confusion in the literature, where the breaking forces of two different breaking structures happen to coincide. The correlations between the rupture and reformation of a gold junction...
Nuclear analyses of the Pietroasa gold hoard
International Nuclear Information System (INIS)
Cojocaru, V.; Besliu, C.
1999-01-01
By means of nuclear analyses the concentrations of Au, Ag, Cu, Ir, Os, Pt, Co and Hg were measured in the 12 artifacts of the gold hoard discovered in 1837 at Pietroasa, Buzau country in Romania. The concentrations of the first four elements were used to compare different stylistic groups assumed by historians. Comparisons with gold nuggets from the old Dacian territory and gold Roman imperial coins were also made. A good agreement was found with the oldest hypothesis which considers that the hoard is represented by three styles appropriated mainly by the Goths. (author)
Ligations of Gold Atoms with Iron Porphyrin
DEFF Research Database (Denmark)
Zhang, Ling; Kepp, Kasper Planeta; Ulstrup, Jens
Gold is an exotic material with d-electrons deciding electronic mappings andconfigurations of adsorbed molecules. The specific interaction of Au atoms and S-, Ncappedmolecules make gold nanoparticles widely applied in the medicine transport andimmunoassay. Density functional theory demonstrates t...
Corrosion of gold alloys and titanium in artificial saliva
International Nuclear Information System (INIS)
Brune, D.; Evje, D.
1982-01-01
Two types of gold alloys and one type of pure titanium have been submitted to corrosion in artificial saliva for periods of up to about 2 months. The release of copper, gold and silver from the gold alloys as well as titanium from the titanium matrix was measured with nuclear tracer technique. The physical/chemical state of the corrosion products of gold alloys referring to the ionic state or presence in particulate form has been examined retaining the particulate matter on a glass filter. Copper was observed to be mainly present in the ionic state. Considerable amounts of gold were observed to be retained on the glass filter explained by the presence of gold in particulate form or as a compentent of a dispersed collloidal phase. The estimation of the release of titanium was registered by the tracer nuclide 46 Sc assuming particulate matter to be deteriorated from the titanium surface. (author)
Gold nanoparticles stabilized by chitosan
International Nuclear Information System (INIS)
Geraldes, Adriana N.; Oliveira, Maria Jose A.; Silva, Andressa A. da; Leal, Jessica; Batista, Jorge G.S.; Lugao, Ademar B.
2015-01-01
In our laboratory has been growing the interest in studying gold nanoparticles and for this reason, the aim of this work is report the first results of the effect of chitosan as stabilizer in gold nanoparticle formulation. AuNPs were synthesized by reducing hydrogen tetrachloroaurate (HAuCl 4 ) using NaBH 4 or gamma irradiation (25kGy) as reduction agent. The chitosan (3 mol L -1 ) was added at 0.5; 1.0 and 1.5 mL. The gold nanoparticles were characterized by UV-Vis absorption spectroscopy, X-ray diffraction (XRD) and Transmission electron microscopy (TEM). Their physical stability was determined using a UV-Vis spectrophotometer over one week during storage at room temperature. Absorption measurements indicated that the plasmon resonance wavelength appears at a wavelength around 530 nm. Has been observed that Chitosan in such quantities were not effective in stabilizing the AuNPs. (author)
Gold Nanoparticle Labels Amplify Ellipsometric Signals
Venkatasubbarao, Srivatsa
2008-01-01
The ellipsometric method reported in the immediately preceding article was developed in conjunction with a method of using gold nanoparticles as labels on biomolecules that one seeks to detect. The purpose of the labeling is to exploit the optical properties of the gold nanoparticles in order to amplify the measurable ellipsometric effects and thereby to enable ultrasensitive detection of the labeled biomolecules without need to develop more-complex ellipsometric instrumentation. The colorimetric, polarization, light-scattering, and other optical properties of nanoparticles depend on their sizes and shapes. In the present method, these size-and-shape-dependent properties are used to magnify the polarization of scattered light and the diattenuation and retardance of signals derived from ellipsometry. The size-and-shape-dependent optical properties of the nanoparticles make it possible to interrogate the nanoparticles by use of light of various wavelengths, as appropriate, to optimally detect particles of a specific type at high sensitivity. Hence, by incorporating gold nanoparticles bound to biomolecules as primary or secondary labels, the performance of ellipsometry as a means of detecting the biomolecules can be improved. The use of gold nanoparticles as labels in ellipsometry has been found to afford sensitivity that equals or exceeds the sensitivity achieved by use of fluorescence-based methods. Potential applications for ellipsometric detection of gold nanoparticle-labeled biomolecules include monitoring molecules of interest in biological samples, in-vitro diagnostics, process monitoring, general environmental monitoring, and detection of biohazards.
Gold recovery from printed wiring board using bioleaching
Energy Technology Data Exchange (ETDEWEB)
Kita, Y. [Faculty of Engineering, Osaka Univ. (Japan); Nishikawa, H. [Center for Advanced Science and Innovation, Osaka Univ. (Japan); Takemoto, T. [Joining and Welding Research Inst., Osaka Univ. (Japan)
2004-07-01
In the electronic assembly, gold is frequently used as surface plating and a bonding wire. To recover gold from waste electronics, the dissolution process using cyan is a popular method, however, the solution is highly toxic. Accordingly, the environmentally conscious substitute process is preferable. In this study the possibility of Au dissolution from printed wiring boards using bioleaching has been investigated. Chromobacterium violaceum having ability of cyanide formation was used to dissolve Au. The printed wiring boards with gold plating of 0.07nm in thickness were immersed in synthetic medium with C. violaceum. After immersion test for 480h, the gold plating was completely dissolved. The increase in cyanide concentration gave little effect on the enhancement of dissolution of gold, however, the dissolution rate of Au was increased with increasing of dissolved oxygen in the medium. Chromobacterium violaceum produced 0.8mmol/l cyanide but it also decomposed about 60% of cyanide generated, therefore, this dissolution process could be used as an environmentally conscious method. (orig.)
Crystal growth, structure and phase studies on gold halides
Janssen, Eugenius Maria Wilhelmus Janssen
1977-01-01
Only very corrosive substances attack gold, the most noble metal. In this study the reactivity and the phase diagrams of gold with the halogens chlorine, bromine and iodine have been investigated. owing to the noble behaviour of gold, its halides are sensitive to heat; on heating they decompose into
Chow, Philippe K.; Yang, Wenjie; Hudspeth, Quentin; Lim, Shao Qi; Williams, Jim S.; Warrender, Jeffrey M.
2018-04-01
We demonstrate that pulsed laser melting (PLM) of thin 1, 5, and 10 nm-thick vapor-deposited gold layers on silicon enhances its room-temperature sub-band gap infrared absorption, as in the case of ion-implanted and PLM-treated silicon. The former approach offers reduced fabrication complexity and avoids implantation-induced lattice damage compared to ion implantation and pulsed laser melting, while exhibiting comparable optical absorptance. We additionally observed strong broadband absorptance enhancement in PLM samples made using 5- and 10-nm-thick gold layers. Raman spectroscopy and Rutherford backscattering analysis indicate that such an enhancement could be explained by absorption by a metastable, disordered and gold-rich surface layer. The sheet resistance and the diode electrical characteristics further elucidate the role of gold-supersaturation in silicon, revealing the promise for future silicon-based infrared device applications.
South African gold and uranium ore mining in 1976
International Nuclear Information System (INIS)
Hentrich, W.
1977-01-01
1976 was a difficult year for the South African gold and uranium ore mining industry, the region of Witwatersrand (Transvaal province) producing some 75% of all the gold mined in the western world besides being an important producer of uranium oxide. Despite the gold production, declining since 1971, not showing a downward tendency anymore as far as the quantity was concerned, the economic result, however, deteriorated as a consequence of continuously falling gold prices, but also on account of the inflationary rise in wages and the prices for energy and materials. Much higher prices for uranium oxide, which some mines produce as interim products from the 'degolded' slurries of their gold ore leaching plants, improved the economic overall result only to a small degree. (orig.) [de
Synthesis of PEGylated gold nanostars and bipyramids for intracellular uptake
International Nuclear Information System (INIS)
Navarro, Julien R G; Lerouge, Frédéric; Chaput, Frédéric; Micouin, Guillaume; Gabudean, Ana-Maria; Baldeck, Patrice L; Kamada, Kenji; Parola, Stephane; Manchon, Delphine; Mosset, Alexis; Cottancin, Emmanuel; Blanchard, Nicholas P; Marotte, Sophie; Leverrier, Yann; Marvel, Jacqueline
2012-01-01
A great number of works have focused their research on the synthesis, design and optical properties of gold nanoparticles for potential biological applications (bioimaging, biosensing). For this kind of application, sharp gold nanostructures appear to exhibit the more interesting features since their surface plasmon bands are very sensitive to the surrounding medium. In this paper, a complete study of PEGylated gold nanostars and PEGylated bipyramidal-like nanostructures is presented. The nanoparticles are prepared in high yield and their surfaces are covered with a biocompatible polymer. The photophysical properties of gold bipyramids and nanostars, in suspension, are correlated with the optical response of single and isolated objects. The resulting spectra of isolated gold nanoparticles are subsequently correlated to their geometrical structure by transmission electron microscopy. Finally, the PEGylated gold nanoparticles were incubated with melanoma B16-F10 cells. Dark-field microscopy showed that the biocompatible gold nanoparticles were easily internalized and most of them localized within the cells. (paper)
Yigit, O.; Hofstra, A.H.
2003-01-01
The Gold Bar district contains five Carlin-type gold deposits and four resources for a combined gold endowment of 1.6 M oz [50 t]. The gold deposits are hosted in Devonian carbonate rocks below parautochthonous and allochthonous Paleozoic siliciclastic rocks emplaced during the Early Mississippian Antler orogeny. The district is in the Battle Mountain-Eureka trend, a long-lived structural feature that localized intrusions and ore deposits of different types and ages. The whole-rock geochemistry of four different mineralized and unmineralized Devonian carbonate rock units (two favorable and two unfavorable) were determined and interpreted in the context of the regional geology. A combination of basic statistics, R-mode factor analysis, isocon plots, and alteration diagrams were utilized to (1) identify favorable geochemical attributes of the host rocks, (2) characterize alteration and associated element enrichments and depletions, and (3) identify the mechanism of gold precipitation. This approach also led to the recognition of other types of alteration and mineralization in host rocks previously thought to be solely affected by Carlin-type mineralization. Unit 2 of the Upper Member of the Denay Formation, with the highest Al2O3, Fe2O3 and SiO2 contents and the lowest CaO content, is the most favorable host rock. Based on the high regression coefficients of data arrays on X-Y plots that project toward the origin, Al2O3 and TiO2 were immobile and K2O and Fe2O3 were relatively immobile during alteration and mineralization. Specific element associations identified by factor analysis are also prominent on isocon diagrams that compare the composition of fresh and altered equivalents of the same rock units. The most prominent associations are: Au, As, Sb, SiO2, TI, -CaO and -LOI, the main gold mineralizing event and related silicification and decalcification; Cd, Zn, Ag, P, Ni and Tl, an early base metal event; and MgO, early dolomitization. Alteration diagrams
Method for aqueous gold thiosulfate extraction using copper-cyanide pretreated carbon adsorption
Young, Courtney; Melashvili, Mariam; Gow, Nicholas V
2013-08-06
A gold thiosulfate leaching process uses carbon to remove gold from the leach liquor. The activated carbon is pretreated with copper cyanide. A copper (on the carbon) to gold (in solution) ratio of at least 1.5 optimizes gold recovery from solution. To recover the gold from the carbon, conventional elution technology works but is dependent on the copper to gold ratio on the carbon.
Gold particle formation via photoenhanced deposition on lithium niobate
Energy Technology Data Exchange (ETDEWEB)
Zaniewski, A.M., E-mail: azaniews@asu.edu; Meeks, V.; Nemanich, R.J.
2017-05-31
Highlights: • Gold chloride is reduced into solid gold nanoparticles at the surface of a polarized semiconductor. • Reduction processes are driven by ultraviolet light. • Gold nanoparticle and silver nanoparticle deposition patterns are compared. - Abstract: In this work, we report on a technique to reduce gold chloride into sub-micron particles and nanoparticles. We use photoelectron transfer from periodically polarized lithium niobate (PPLN) illuminated with above band gap light to drive the surface reactions required for the reduction and particle formation. The particle sizes and distributions on the PPLN surface are sensitive to the solution concentration, with inhibited nucleation and large particles (>150 nm) for both low (2E−8M to 9E−7M) and high (1E−5M to 1E−3M) concentrations of gold chloride. At midrange values of the concentration, nucleation is more frequent, resulting in smaller sized particles (<150 nm). We compare the deposition process to that for silver, which has been previously studied. We find that the reduction of gold chloride into nanoparticles is inhibited compared to silver ion reduction, due to the multi-step reaction required for gold particle formation. This also has consequences for the resulting deposition patterns: while silver deposits into nanowires along boundaries between areas with opposite signed polarizations, such patterning of the deposition is not observed for gold, for a wide range of concentrations studied (2E−8 to 1E−3M).
International Nuclear Information System (INIS)
1988-01-01
The Jabiluka gold-uranium deposit, 230km east of Darwin in the Alligator Rivers Region of the Northern Territory, was discovered by Pancontinental Mining Limited in 1971. Jabiluka, with reserves in excess of 200,000 tonnes of contained U 3 O 8 in two deposits 500 metres apart, is the world's largest high grade uranium deposit and also contains nearly 12 tonnes of gold. It is proposed that only the larger deposit, Jabiluka II will be mined - by underground extraction methods, and that 275,000 tonnes of ore per year will be mined and processed to produce 1,500 tonnes of U 3 O 8 and up to 30,000 oz of gold. The revenue from the uranium sales is estimated to be of the order of A$100 million per year at A$30/lb. By the end of 1982 all necessary mining and environmental approvals had been obtained and significant marketing progress made. With the Australian Labor Party winning Commonwealth Government in the 1983 election, Pancontinental's permission to seek sales contracts was withdrawn and development of the Jabiluka deposit ceased. Jabiluka remains undeveloped - awaiting a change in Australian Government policy on uranium. figs., maps
Gold Nanoparticle Conjugation Enhances the Antiacanthamoebic Effects of Chlorhexidine
Aqeel, Yousuf; Siddiqui, Ruqaiyyah; Anwar, Ayaz; Shah, Muhammad Raza
2015-01-01
Acanthamoeba keratitis is a serious infection with blinding consequences and often associated with contact lens wear. Early diagnosis, followed by aggressive topical application of drugs, is a prerequisite in successful treatment, but even then prognosis remains poor. Several drugs have shown promise, including chlorhexidine gluconate; however, host cell toxicity at physiologically relevant concentrations remains a challenge. Nanoparticles, subcolloidal structures ranging in size from 10 to 100 nm, are effective drug carriers for enhancing drug potency. The overall aim of the present study was to determine whether conjugation with gold nanoparticles enhances the antiacanthamoebic potential of chlorhexidine. Gold-conjugated chlorhexidine nanoparticles were synthesized. Briefly, gold solution was mixed with chlorhexidine and reduced by adding sodium borohydride, resulting in an intense deep red color, indicative of colloidal gold-conjugated chlorhexidine nanoparticles. The synthesis was confirmed using UV-visible spectrophotometry that shows a plasmon resonance peak of 500 to 550 nm, indicative of gold nanoparticles. Further characterization using matrix-assisted laser desorption ionization-mass spectrometry showed a gold-conjugated chlorhexidine complex at m/z 699 ranging in size from 20 to 100 nm, as determined using atomic force microscopy. To determine the amoebicidal and amoebistatic effects, amoebae were incubated with gold-conjugated chlorhexidine nanoparticles. For controls, amoebae also were incubated with gold and silver nanoparticles alone, chlorhexidine alone, neomycin-conjugated nanoparticles, and neomycin alone. The findings showed that gold-conjugated chlorhexidine nanoparticles exhibited significant amoebicidal and amoebistatic effects at 5 μM. Amoebicidal effects were observed by parasite viability testing using a Trypan blue exclusion assay and flow-cytometric analysis using propidium iodide, while amoebistatic effects were observed using growth
Plasmonic Horizon in Gold Nanosponges.
Vidal, Cynthia; Sivun, Dmitry; Ziegler, Johannes; Wang, Dong; Schaaf, Peter; Hrelescu, Calin; Klar, Thomas A
2018-02-14
An electromagnetic wave impinging on a gold nanosponge coherently excites many electromagnetic hot-spots inside the nanosponge, yielding a polarization-dependent scattering spectrum. In contrast, a hole, recombining with an electron, can locally excite plasmonic hot-spots only within a horizon given by the lifetime of localized plasmons and the speed carrying the information that a plasmon has been created. This horizon is about 57 nm, decreasing with increasing size of the nanosponge. Consequently, photoluminescence from large gold nanosponges appears unpolarized.
Gold nanoparticle-pentacene memory-transistors
Novembre , Christophe; Guerin , David; Lmimouni , Kamal; Gamrat , Christian; Vuillaume , Dominique
2008-01-01
We demonstrate an organic memory-transistor device based on a pentacene-gold nanoparticles active layer. Gold (Au) nanoparticles are immobilized on the gate dielectric (silicon dioxide) of a pentacene transistor by an amino-terminated self-assembled monolayer. Under the application of writing and erasing pulses on the gate, large threshold voltage shift (22 V) and on/off drain current ratio of ~3E4 are obtained. The hole field-effect mobility of the transistor is similar in the on and off sta...
78 FR 72139 - Nevada Gold Corp.; Order of Suspension of Trading
2013-12-02
... current and accurate information concerning the securities of Nevada Gold Corp. (``Nevada Gold'') because of questions regarding the accuracy of assertions by Nevada Gold, and by others, to investors in..., and financial condition. Nevada Gold is a Delaware corporation based in Del Mar, California. The...
Enhanced performance of VOx-based bolometer using patterned gold black absorber
Smith, Evan M.; Panjwani, Deep; Ginn, James; Warren, Andrew; Long, Christopher; Figuieredo, Pedro; Smith, Christian; Perlstein, Joshua; Walter, Nick; Hirschmugl, Carol; Peale, Robert E.; Shelton, David J.
2015-06-01
Patterned highly absorbing gold black film has been selectively deposited on the active surfaces of a vanadium-oxide-based infrared bolometer array. Patterning by metal lift-off relies on protection of the fragile gold black with an evaporated oxide, which preserves gold black's near unity absorption. This patterned gold black also survives the dry-etch removal of the sacrificial polyimide used to fabricate the air-bridge bolometers. Infrared responsivity is substantially improved by the gold black coating without significantly increasing noise. The increase in the time constant caused by the additional mass of gold black is a modest 14%.
Multifunctional gold nanoparticles for diagnosis and therapy of disease
Mieszawska, Aneta J.; Mulder, Willem J. M.; Fayad, Zahi A.
2013-01-01
Gold nanoparticles (AuNPs) have a number of physical properties that make them appealing for medical applications. For example, the attenuation of X-rays by gold nanoparticles has led to their use in computed tomography imaging and as adjuvants for radiotherapy. AuNPs have numerous other applications in imaging, therapy and diagnostic systems. The advanced state of synthetic chemistry of gold nanoparticles offers precise control over physicochemical and optical properties. Furthermore gold cores are inert and are considered to be biocompatible and non-toxic. The surface of gold nanoparticles can easily be modified for a specific application and ligands for targeting, drugs or biocompatible coatings can be introduced. AuNPs can be incorporated into larger structures such as polymeric nanoparticles or liposomes that deliver large payloads for enhanced diagnostic applications, efficiently encapsulate drugs for concurrent therapy or add additional imaging labels. This array of features has led to the afore-mentioned applications in biomedical fields, but more recently in approaches where multifunctional gold nanoparticles are used for multiple methods, such as concurrent diagnosis and therapy, so called theranostics. The following review covers basic principles and recent findings in gold nanoparticle applications for imaging, therapy and diagnostics, with a focus on reports of multifunctional AuNPs. PMID:23360440
Preg-robbing of Gold by Carbonaceous Materials Encountered in ...
African Journals Online (AJOL)
Processing of gold from refractory ores containing carbonaceous materials (CM) poses challenges due to the ability of the CM to preg-rob dissolved gold. Depending on the type and maturity of CM encountered, preg-robbing of aurocyanide ion can lead to reduction in gold recovery ranging from a few percentages to more ...
Thiosulphate leaching of gold-, silver-, copper flotation concentrates
International Nuclear Information System (INIS)
Samikhov, Sh.R.; Zinchenko, Z.A.
2015-01-01
Present article is devoted to thiosulphate leaching of gold-, silver-, copper flotation concentrates. For the purpose to improve the process of thiosulphate leaching the ore samples were calcined at temperature 600 ℃ during two hours. During the calcination process of gold-sulphide ores and concentrates the minerals pyrite and arsenopyrite oxidize which lead to opening of gold contains in them. It was defined that thiosulphate leaching can be recommended as an alternative to cyanic process.
International Nuclear Information System (INIS)
Bacso, J.; Uzonyi, I.; Dezsoe, B.
1986-08-01
Human autopsy tissues from five patients with rheumatoid arthritis treated earlier with aqueous solution of gold and those from untreated control with the same disease were analyzed by x-ray fluorescence spectrometry using a conventional Si(Li) detection system. The gold and zinc concentrations of tissues were determined and compared with literature data. Correlation was found between Zn and Au concentrations in heart, lung, kidney and liver tissues. (author)
Energy Technology Data Exchange (ETDEWEB)
Stahlmecke, Burkhard
2008-01-15
Electromigration is the current induced mass transport in metallic wires. It is the main reason for electrical breakdown in integrated circuits and has been studied for more than 50 years. In this thesis, the electromigration behavior in polycrystalline gold as well as in self-organized single crystalline silver wires are studied. To study the electromigration behavior in detail, in-situ investigations of the wires are performed in a scanning electron microscope, for which a new test rig was successfully installed. During electromigration, the development of voids on the cathode and hillocks on the anode side of the wire are observed. This behavior is studied in detail in this thesis. Electrical breakdown in the gold wires takes place due to the presence of slit-like voids perpendicular to the current direction. The void area grows linearly during the course of the experiments, and the electrical breakdown takes place when the total void area reaches a value of 2 % to 4 % of the total wire area. The influence of single voids on the electrical resistance during high current stressing is determined. The dependence of the electromigration behavior on the width and height as well as on the crystallinity and temperature of the gold wires is studied in detail. For high resolution imaging of the wires during the experiments, a special layout with arbitrary kinks is used. The dependence of electromigration effects on current density and on the influence of the measurement setup itself are also discussed in this thesis. When reversing the current direction, a reversible electromigration behavior is observed. Also, the lifetime of the wires grows considerably. According to the resistance data, a remarkable stabilization of the polycrystalline wires is observed during this experiments. Furthermore, it is possible to define an alternative sheet length according to the position of voids and hillocks in the wires. This leads also to the determination of the critical product for
White, Shane A; Landry, Guillaume; Fonseca, Gabriel Paiva; Holt, Randy; Rusch, Thomas; Beaulieu, Luc; Verhaegen, Frank; Reniers, Brigitte
2014-06-01
The recently updated guidelines for dosimetry in brachytherapy in TG-186 have recommended the use of model-based dosimetry calculations as a replacement for TG-43. TG-186 highlights shortcomings in the water-based approach in TG-43, particularly for low energy brachytherapy sources. The Xoft Axxent is a low energy (S700, was created and validated against experimental data. CT scans of the patients were used to create realistic multi-tissue/heterogeneous models with breast tissue segmented using a published technique. Alternative water models were used to isolate the influence of tissue heterogeneity and backscatter on the dose distribution. Dose calculations were performed using Geant4 according to the original treatment parameters. The effect of the Axxent balloon applicator used in APBI which could not be modeled in the CT-based model, was modeled using a novel technique that utilizes CAD-based geometries. These techniques were validated experimentally. Results were calculated using two dose reporting methods, dose to water (Dw,m) and dose to medium (Dm,m), for the heterogeneous simulations. All results were compared against TG-43-based dose distributions and evaluated using dose ratio maps and DVH metrics. Changes in skin and PTV dose were highlighted. All simulated heterogeneous models showed a reduced dose to the DVH metrics that is dependent on the method of dose reporting and patient geometry. Based on a prescription dose of 34 Gy, the average D90 to PTV was reduced by between ~4% and ~40%, depending on the scoring method, compared to the TG-43 result. Peak skin dose is also reduced by 10%-15% due to the absence of backscatter not accounted for in TG-43. The balloon applicator also contributed to the reduced dose. Other ROIs showed a difference depending on the method of dose reporting. TG-186-based calculations produce results that are different from TG-43 for the Axxent source. The differences depend strongly on the method of dose reporting. This study
Determination of thorium in native gold by radiochemical neutron activation analysis
International Nuclear Information System (INIS)
Liu, Y.; Kraehenbuehl, U.
1995-01-01
Thorium concentrations in 11 native gold samples from different sources, e.g. placer gold, vein and lode gold were determined. Thorium was determined by radiochemical separation and measurement of protactinium from irradiated native gold samples. The chemical yield of the separation procedures is 90%. Other elements were measured by gamma-ray spectroscopy. The radiochemical separation procedures described in this work make accurate determination of Th concentrations in native gold at picogram concentrations possible. (orig.)
Pseudo-template synthesis of gold nanoparticles based on polyhydrosilanes
International Nuclear Information System (INIS)
Sacarescu, Liviu; Simionescu, Mihaela; Sacarescu, Gabriela
2011-01-01
Highly stable colloidal gold nanoparticles are obtained in a pseudo-template system using a specific polyhydrosilane copolymeric structure. This process takes place in situ by microwaves activation of the polymer solution in a non-polar solvent followed by stirring with solid HAuCl 4 in natural light. The experimental procedure is very simple and the resulted colloidal gold solution is indefinitely stable. The specific surface plasmon resonance absorption band of the gold nanoparticles is strongly red shifted and is strictly related to their size. AFM correlated with DLS analysis showed flattened round shaped colloidal polymer-gold nanoparticles with large diameters. SEM-EDX combined analysis reveals that the polysilane-gold nanoparticles show a natural tendency to auto-assemble in close packed structures which form large areas over the polymer film surface.
Nondestructive analysis of the gold quarter liras
International Nuclear Information System (INIS)
Cakir, C.; Guerol, A.; Demir, L.; Sahin, Y.
2009-01-01
In this study, we have prepared seven Au-Cu standards in the concentration range of 18-24 (as carat) for nondestructive control of gold quarter liras. Some calibration curves for quantitative analysis of Au in the gold quarter liras that commercially present in Turkey have been plotted using these standard samples. The characteristic X-rays of Au and Cu emitted from these standard samples and the test sample with known composition are recorded by using a Ge(Li) detector. These calibration curves provide a nondestructive analysis of gold quarter liras with the uncertainties about 1.18%. (author)
Effective Opacity for Gold-Doped Foam Plasmas
International Nuclear Information System (INIS)
Huang Cheng-Wu; Song Tian-Ming; Zhao Yang; Zhu Tuo; Shang Wan-Li; Xiong Gang; Zhang Ji-Yan; Yang Jia-Min; Jiang Shao-En
2012-01-01
Radiation flow through gold-doped hydrocarbon foam is investigated and a model is presented to calculate effective opacity for an inhomogeneous, pressure-equilibrated gold/foam mixture based on the Levermore—Pomraning method for binary stochastic media. The effective opacity dependance on the size of the gold particles and the foam temperature are studied. The results suggest that when the mixture temperature is lower than 250 eV, the opacity difference between the 5 μm particle mix case and the atomic mix case is large enough to induce a significant discrepancy in radiation transport, which is confirmed by the hydrodynamic simulation
Nuclear-technical applications in gold extraction metallurgy
International Nuclear Information System (INIS)
Smith, S.W.; De Jesus, A.S.M.
1986-01-01
Radioisotopes have been used for a number of years by the South African gold mining industry in a variety of measuring techniques, not only in conventional on-line process instrumentation, but also to investigate problem areas in extraction processes. These include, inter alia, tracer investigations on recirculating underground water, measurement of air ventilation rates in a mine, residence time measurements in milling and leaching circuits, and gold purity determinations. Applications of both sealed sources and radioactive tracer techniques are reviewed by means of examples of work done in South Africa, with pertinent reference to the benefits accruing to the gold mining industry
Biosynthesis of Gold Nanoparticles Using Pseudomonas Aeruginosa
International Nuclear Information System (INIS)
Abd El-Aziz, M.; Badr, Y.; Mahmoud, M. A.
2007-01-01
Pseudomonas aeruginosa were used for extracellular biosynthesis of gold nanoparticles (Au NPs). Consequently, Au NPs were formed due to reduction of gold ion by bacterial cell supernatant of P. aeruginos ATCC 90271, P. aeruginos (2) and P. aeruginos (1). The UV-Vis. and fluorescence spectra of the bacterial as well as chemical prepared Au NPs were recorded. Transmission electron microscopy (TEM) micrograph showed the formation of well-dispersed gold nanoparticles in the range of 15-30 nm. The process of reduction being extracellular and may lead to the development of an easy bioprocess for synthesis of Au NPs
Gold, oil, and stocks: Dynamic correlations
Czech Academy of Sciences Publication Activity Database
Baruník, Jozef; Kočenda, Evžen; Vácha, Lukáš
2016-01-01
Roč. 42, č. 1 (2016), s. 186-201 ISSN 1059-0560 R&D Projects: GA ČR GA14-24129S Institutional support: RVO:67985556 Keywords : Financial markets * Time-frequency dynamics * High-frequency data * Dynamic correlation * Financial crisis * Wavelets Subject RIV: AH - Economics Impact factor: 1.261, year: 2016 http://library.utia.cas.cz/separaty/2015/E/barunik-0449082.pdf
Substoichiometric neutron activation determination of gold
International Nuclear Information System (INIS)
Mitchell, J.W.; Riley, J.E. Jr.; Payne, V.
1978-01-01
A highly precise and selective method is described for the determination of traces of gold by substoichiometric extraction from hydrochloric acid with tri-n-octylphosphine sulfide in cyclohexane following thermal neutron activation. Fundamental aspects of the extraction system are discussed and results are reported for the determination of gold in an effluent from a recovery process containing a complexed species of gold and unknown amounts of cyanide, citrate, phosphate, potassium and sodium. Other constituents of the effluent stream include traces of the transition elements Co, Ni, Fe, Cu, Zn, Pb and Sn at concentrations less than 50 ppm. One hour was allowed for the Au 3+ carrier and the 198 Au complexed species in samples and standards to oxidize, exchange, and reach chemical equilibrium. Samples were then equilibrated by shaking with the organic phase for thirty min. The percentage extractions (%E) for the substoichiometric separation of gold from the effluent and from the corresponding comparison standards were monitored. The mean percentage extractions for the substoichiometric separations of carrier from the effluent, and its corresponding standard were 75.3 and 59.3, respectively. These data are estimated to be accurate within +-2.0%. (T.G.)
Grafting of gold nanoparticles on polyethyleneterephthalate using dithiol interlayer
International Nuclear Information System (INIS)
Reznickova, A.; Kolska, Z.; Zaruba, K.; Svorcik, V.
2014-01-01
Two different procedures of grafting of polyethyleneterephthalate (PET), modified by plasma treatment, with gold nanoparticles (nanospheres) are studied. In the first procedure the PET foil was grafted with biphenyl-4,4′-dithiol and subsequently with gold nanoparticles. In the second one the PET foil was grafted with gold nanoparticles previously coated by the same dithiol. X-ray photoelectron spectroscopy, Fourier transform infrared spectroscopy and electrokinetic analysis were used for characterization of the polymer surface at different modification steps. Gold nanoparticles were characterized by ultraviolet–visible spectroscopy. The first procedure was found to be more effective. It was proved that the dithiol was chemically bonded to the surface of the plasma activated PET and it mediates subsequent grafting of the gold nanoparticles. - Highlights: • Two different techniques were used for coating of PET with gold nanoparticles. • Grafted GNPs were characterized by XPS, FTIR, UV–vis, zeta potential, AFM. • More effective coating is achieved by deposition of GNPs earlier grafted with thiol. • The studied structures may have potential application in electronics or biomedicine
Gold in Accessory Zircon (the Kozhim Massif, Subpolar Urals)
Denisova, Yuliya; Pystin, Aleksandr
2017-12-01
The crystals of zircon due to their resistance to external impact of various processes can reveal information about the environment of their formation and the inclusions observed of them. Zircon contains different mineral inclusions: biotite, plagioclase, quartz, apatite, etc. However, there is no information about gold inclusions in the zircons from granites of the Sudpolar Urals. The study results of the inclusions of gold in accessory zircon of the Kozhim granitic massif are presented in this paper. The studied mineral is a dark-brown translucent short-prismatic crystal containing the inclusion of gold and the allocations of quartz. According to studies, the inclusion of gold formed during the growth of zircon and it is the gold covered with a thin film of oxide gold. It was confirmed that the crystallization of the studied zircon occurred at a temperature of 800°C and above on the stage of formation of granites of Kozhim massif. The assumption is made about the additional temperature in the course of which was caused by decreasing of temperature up to 700° C and below during postmagmatic stage.
Study on gold concentrate leaching by iodine-iodide
Wang, Hai-xia; Sun, Chun-bao; Li, Shao-ying; Fu, Ping-feng; Song, Yu-guo; Li, Liang; Xie, Wen-qing
2013-04-01
Gold extraction by iodine-iodide solution is an effective and environment-friendly method. In this study, the method using iodine-iodide for gold leaching is proved feasible through thermodynamic calculation. At the same time, experiments on flotation gold concentrates were carried out and encouraging results were obtained. Through optimizing the technological conditions, the attained high gold leaching rate is more than 85%. The optimum process conditions at 25°C are shown as follows: the initial iodine concentration is 1.0%, the iodine-to-iodide mole ratio is 1:8, the solution pH value is 7, the liquid-to-solid mass ratio is 4:1, the leaching time is 4 h, the stirring intensity is 200 r/mim, and the hydrogen peroxide consumption is 1%.
Mechanism of the Transmetalation of Organosilanes to Gold
Falivene, Laura
2015-09-01
Density functional theory (DFT) calculations were carried out to study the reaction mechanism of the first transmetalation of organosilanes to gold as a cheap fluoride-free process. The versatile gold(I) complex [Au(OH)(IPr)] permits very straightforward access to a series of aryl-, vinyl-, and alkylgold silanolates by reaction with the appropriate silane reagent. These silanolate compounds are key intermediates in a fluoride-free process that results in the net transmetalation of organosilanes to gold, rather than the classic activation of silanes as silicates using external fluoride sources. However, here we propose that the gold silanolate is not the active species (as proposed during experimental studies) but is, in fact, a resting state during the transmetalation process, as a concerted step is preferred.
Mechanism of the Transmetalation of Organosilanes to Gold
Falivene, Laura; Nelson, David J.; Dupuy, Sté phanie; Nolan, Steven P.; Poater, Albert; Cavallo, Luigi
2015-01-01
Density functional theory (DFT) calculations were carried out to study the reaction mechanism of the first transmetalation of organosilanes to gold as a cheap fluoride-free process. The versatile gold(I) complex [Au(OH)(IPr)] permits very straightforward access to a series of aryl-, vinyl-, and alkylgold silanolates by reaction with the appropriate silane reagent. These silanolate compounds are key intermediates in a fluoride-free process that results in the net transmetalation of organosilanes to gold, rather than the classic activation of silanes as silicates using external fluoride sources. However, here we propose that the gold silanolate is not the active species (as proposed during experimental studies) but is, in fact, a resting state during the transmetalation process, as a concerted step is preferred.
Nonlinear optical studies of single gold nanoparticles
Dijk, Meindert Alexander van
2007-01-01
Gold nanoparticles are spherical clusters of gold atoms, with diameters typically between 1 and 100 nanometers. The applications of these particles are rather diverse, from optical labels for biological experiments to data carrier for optical data storage. The goal of my project was to develop new
CSIR Research Space (South Africa)
Manzi, MSD
2013-11-01
Full Text Available The gold-bearing Upper Elsburg Reef clastic wedge (UER) in the South Deep gold mine in the Witwatersrand basin (South Africa) hosts the highly auriferous basal conglomerate known as the Elsburg Conglomerate (EC) reef. The reef is less than 20 m...
M.R.S. Boland (Melinde); A. Tsiachristas (Apostolos); A.L. Kruis (Annemarije); N.H. Chavannes (Nicolas); M.P.M.H. Rutten-van Mölken (Maureen)
2014-01-01
markdownabstract__Abstract__ Aims: To investigate the association of the GOLD ABCD groups classification with costs and health-related quality of life (HR-QoL) and to compare this with the GOLD 1234 grades classification that was primarily based on lung function only. Methods: In a
Silk fibroin/gold nanocrystals: a new example of biopolymer-based nanocomposites
Noinville, S.; Garnier, A.; Courty, A.
2017-05-01
The dispersion of nanoparticles in ordered polymer nanostructures can provide control over particle location and orientation, and pave the way for tailored nanomaterials that have enhanced mechanical, electrical, or optical properties. Here we used silk fibroin, a natural biopolymer, to embed gold nanocrystals (NCs), so as to obtain well-ordered structures such as nanowires and self-assembled triangular nanocomposites. Monodisperse gold NCs synthesized in organic media are mixed to silk fibroin and the obtained nanocomposites are characterized by UV-visible spectroscopy, transmission electron microscopy (TEM), scanning electron microscopy (FE-SEM), atomic force microscopy (AFM) and Infrared spectroscopy. The optical properties study of gold NCs and silk-gold nanocomposites shows that the Surface Plasmon band is blue shifted compared to gold NCs. The size and shape of NCs gold superlattices can be well controlled by the presence of silk fibroin giving nanowires and also self-assembled triangular nanocomposites as characterized by TEM, FE-SEM and AFM. The strong interaction between gold NCs and silk fibroin is also revealed by the conformation change of silk protein in presence of gold NCs, as shown by FTIR analysis. The formation of such ordered nanocomposites (gold NCs/silk fibroin) will provide new nanoplasmonic devices.
Eggshell membrane-templated porous gold membranes using nanoparticles as building blocks
International Nuclear Information System (INIS)
Ashraf, S.; Khalid, Z. M.; Hussain, I.
2013-01-01
Highly porous gold membrane-like structures are formed using eggshell membrane, as such and heat denatured, as a template and gold nanoparticles as building blocks. Gold nanoparticles were produced in-situ on the eggshell membranes without using additional reducing agents. The morphology and loading of gold nanoparticles can easily be controlled by adjusting the pH and thus the redox potential of eggshell membranes. Lower pH favored the formation of irregularly-shaped but dense gold macro/ nanocrystals whereas higher pH(8-9) favored the formation of fairly uniform but less dense gold nanoparticles onto the eggshell membranes. Heat treatment of eggshell membrane-gold nanoparticle composites formed at pH 8-9 led to the formation of highly porous membrane like gold while mimicking the original structure of eggshell membrane. All these materials have been thoroughly characterized using field emission scanning electron microscopy (FESEM), energy dispersive X-ray spectroscopy (EDX), and inductively coupled plasma - atomic emission spectroscopy (ISP-AES). These highly porous membrane-like gold materials may have potential applications in catalysis, biosensors, electrode materials, optically selective coatings, heat dissipation and biofiltration. (author)
Directing self-assembly of gold nanoparticles in diblock copolymer scaffold
Li, Qifang; He, Jinbo; Glogowski, Elizabeth; Emrick, Todd; Russell, Thomas
2007-03-01
A versatile hierarchical approach for directing self -assembly of gold nanostructures with size 2-3nm in diblock copolymer scaffolds is found. Diblock copolymer polystyrene-b-poly(2-vinylpyridine) (PS-b-P2VP) is used to form a regular scaffold of highly anisotropic, stripe-like domains, and controlled differential wetting by dichloromethane and thermal annealing guides gold nanoparticles with half hydrophilic ligand to aggregate selectively along the scaffold, producing highly organized metal nanostructures. In as-cast block-copolymer and gold nanoparticles thin films, micelle structure and gold nanoparticles random distribution on scaffold are typically observed. However, samples annealed in dichloromethane exhibit well-defined short-range ordered nanostructure with gold nanoparticles located at the interface of PS and P2VP nanoscale domain. After annealing at 170 C, the gold nanoparticles at interface migrated into the middle of P2VP phase and exhibited long-range ordered hierarchical structures. Synergistic interactions between the gold nanoparticles and the PS-b-P2VP caused an orientation of the microdomains normal to the film surface.
Gold-Based Medicine: A Paradigm Shift in Anti-Cancer Therapy?
Yeo, Chien Ing; Ooi, Kah Kooi; Tiekink, Edward R T
2018-06-11
A new era of metal-based drugs started in the 1960s, heralded by the discovery of potent platinum-based complexes, commencing with cisplatin [(H₃N)₂PtCl₂], which are effective anti-cancer chemotherapeutic drugs. While clinical applications of gold-based drugs largely relate to the treatment of rheumatoid arthritis, attention has turned to the investigation of the efficacy of gold(I) and gold(III) compounds for anti-cancer applications. This review article provides an account of the latest research conducted during the last decade or so on the development of gold compounds and their potential activities against several cancers as well as a summary of possible mechanisms of action/biological targets. The promising activities and increasing knowledge of gold-based drug metabolism ensures that continued efforts will be made to develop gold-based anti-cancer agents.
Large, R.R.; Danyushevsky, L.; Hollit, C.; Maslennikov, V.; Meffre, S.; Gilbert, S.; Bull, S.; Scott, R.; Emsbo, P.; Thomas, H.; Singh, B.; Foster, J.
2009-01-01
Laser ablation ICP-MS imaging of gold and other trace elements in pyrite from four different sediment- hosted gold-arsenic deposits has revealed two distinct episodes of gold enrichment in each deposit: an early synsedimentary stage where invisible gold is concentrated in arsenian diagenetic pyrite along with other trace elements, in particular, As, Ni, Pb, Zn, Ag, Mo, Te, V, and Se; and a later hydrothermal stage where gold forms as either free gold grains in cracks in overgrowth metamorphic and/or hydrothermal pyrite or as narrow gold- arsenic rims on the outermost parts of the overgrowth hydrothermal pyrite. Compared to the diagenetic pyrites, the hydrothermal pyrites are commonly depleted in Ni, V, Zn, Pb, and Ag with cyclic zones of Co, Ni, and As concentration. The outermost hydrothermal pyrite rims are either As-Au rich, as in moderate- to high- grade deposits such as Carlin and Bendigo, or Co-Ni rich and As-Au poor as in moderate- to low-grade deposits such as Sukhoi Log and Spanish Mountain. The early enrichment of gold in arsenic-bearing syngenetic to diagenetic pyrite, within black shale facies of sedimentary basins, is proposed as a critical requirement for the later development of Carlin-style and orogenic gold deposits in sedimentary environments. The best grade sediment-hosted deposits appear to have the gold climax event, toward the final stages of deformation-related hydrothermal pyrite growth and fluid flow. ?? 2009 Society of Economic Geologists, Inc.
Recovery of gold from arsenopyrite concentrates by cyanidation-carbon adsorption
Energy Technology Data Exchange (ETDEWEB)
Heinen, H.J.; McClelland, G.E., Lindstrom, R.E.
1980-01-01
The Bureau of Mines, investigated a cyanidation-carbon adsorption technique for extracting gold from arsenopyrite concentrates. Agitation leach experiments were conducted on 85%-minus-35-mesh gravity concentrates containing 21.8 oz gold and 6.4 oz silver per ton. Results obtained in leaching the concentrates showed that 96.9% gold and 90.7% silver extraction could be achieved in 96 hours of agitation. Gold and silver were recovered from the resulting pregnant solution by exposure to granular activated carbon in a countercurrent system. Carbon loadings of 2556 oz of gold and 502 oz of silver per ton were achieved. These loadings are significantly higher than heretofore thought practical.
Spontaneous formation of gold nanostructures in aqueous microdroplets.
Lee, Jae Kyoo; Samanta, Devleena; Nam, Hong Gil; Zare, Richard N
2018-04-19
The synthesis of gold nanostructures has received widespread attention owing to many important applications. We report the accelerated synthesis of gold nanoparticles (AuNPs), as well as the reducing-agent-free and template-free synthesis of gold nanoparticles and nanowires in aerosol microdroplets. At first, the AuNP synthesis are carried out by fusing two aqueous microdroplet streams containing chloroauric acid and sodium borohydride. The AuNPs (~7 nm in diameter) are produced within 60 µs at the rate of 0.24 nm µs -1 . Compared to bulk solution, microdroplets enhance the size and the growth rate of AuNPs by factors of about 2.1 and 1.2 × 10 5 , respectively. Later, we find that gold nanoparticles and nanowires (~7 nm wide and >2000 nm long) are also formed in microdroplets in the absence of any added reducing agent, template, or externally applied charge. Thus, water microdroplets not only accelerate the synthesis of AuNPs by orders of magnitude, but they also cause spontaneous formation of gold nanostructures.
Extraction of gold and silver from geothermal fluid
Energy Technology Data Exchange (ETDEWEB)
Brown, K.L.; Roberts, P.J. (Geothermal Research Center, Wairakei (New Zealand); Spectrum Resources Ltd., Auckland (New Zealand))
1988-11-10
This paper describes the results of five experiments of the extraction of gold and silver from hydrothermal fluids with a experimental vessel settled up at KA35 well at the Kawerau geothermal field in New Zealand. The experimental vessel was designed to absorb the fluids from orifice plate controlled to be low pressure and had a chamber having within many collecting plates. The first experiment is a fundamental one in which a mild steel was used as metal collector plate. The rates of deposition of gold and silver on the plate were estimated. The second experiment showed that the rate on deposition of gold on the mild steel plate was controlled by the flux rate of hydrothermal fluid. The third experiment showed that a mild steel seemed to be better for the collection plate of gold and silver than copper and aluminium. The fourth experiment clarified that the activated charcoal was not suitable for the collector plate for gold and silver. The fifth experiment showed that a mild steel was better for metal collector than activated charcoal. 1 ref., 4 figs.
Flower-shaped gold nanoparticles: Preparation, characterization, and electro
Directory of Open Access Journals (Sweden)
Islam M. Al-Akraa
2017-09-01
Full Text Available The modification of a glassy carbon electrode with gold nanoparticles was pursued, characterized, and examined for electrocatalytic applications. The fabrication process of this electrode involved assembling the gold nanoparticles atop of amino group grafted glassy carbon electrode. The scanning electron microscopy indicated the deposition of gold nanoparticles in flower-shaped nanostructures with an average particle size of ca. 150 nm. Interestingly, the electrode exhibited outstanding enhancement in the electrocatalytic activity toward the oxygen evolution reaction, which reflected from the large negative shift (ca. 0.8 V in its onset potential, in comparison with that observed at the bulk unmodified glassy carbon and gold electrodes. Alternatively, the Tafel plot of the modified electrode revealed a significant increase (∼one order of magnitude in the apparent exchange current density of the oxygen evolution reaction upon the modification, which infers a faster charge transfer. Kinetically, gold nanoparticles are believed to facilitate a favorable adsorption of OH− (fundamental step in oxygen evolution reaction, which allows the charge transfer at reasonably lower anodic polarizations.
SU-F-T-22: Clinical Implications When Using TG-186 (ACE) Heterogeneity Software
Energy Technology Data Exchange (ETDEWEB)
Likhacheva, A; Grade, E; Sadeghi, A; Sokolowski, T [Arizona Cancer Specialists, Mesa, AZ (United States)
2016-06-15
Purpose: The purpose of this study is to compare dosimetric calculations using traditional TG-43 formalism and Oncentra Brachy Advanced Collapsed cone Engine (ACE) TG-186 calculation algorithm in clinical setting. Methods: We analyzed dosimetry of four patients treated with accelerated partial breast irradiation using a multi-channel intracavitary device (SAVI). All patients were treated to 34 Gy in 10 fractions using a high-dose-rate (192) Ir source. The plans were designed and treated using the TG-43 model. ACE was used to assess the effect heterogeneity correction on various dosimetric parameters. Mass density was estimated using Hounsfield units. Results: Compared to TG-43 formalism, ACE estimated lower doses to targets and organs at risk. The mean difference was 19.8% (range 15.3–24.1%) for PTV-eval V200, 12.0% (range 9.7–17.7%) for PTV-eval V150, 4.3% (range 3.3–6.5%) for PTV-eval D95, 3.3% (range 1.4–5.4%) for PTV-eval D90, 5.4% (range 2.9–9.9%) for maximum rib dose, and 5.7% (2.4–7.4%) for maximum skin dose. There was no correlation between the magnitude of the difference and the PTV-eval volume, air volume, or tissue-applicator conformance. Conclusion: Based on our preliminary study, the TG-43 algorithm appears to overestimate the dose to targets and organs at risk when compared to the ACE TG-186 software. We hypothesize that air adjacent to the SAVI struts contributes to lack of scatter thereby contributing a significant difference in dose calculation when using ACE. We believe that ACE calculation provides a more realistic isodose distribution than TG-43. We plan to further investigate the impact of heterogeneity correction on brachytherapy planning for a wide variety of clinical scenarios, include skin, cervix/uterus, prostate, and lung.
National Ignition Facility subsystem design requirements target area auxiliary subsystem SSDR 1.8.6
International Nuclear Information System (INIS)
Reitz, T.
1996-01-01
This Subsystem Design Requirement (SSDR) establishes the performance, design, development, and test requirements for the Target Area Auxiliary Subsystems (WBS 1.8.6), which is part of the NIF Target Experimental System (WBS 1.8). This document responds directly to the requirements detailed in NIF Target Experimental System SDR 003 document. Key elements of the Target Area Auxiliary Subsystems include: WBS 1.8.6.1 Local Utility Services; WBS 1.8.6.2 Cable Trays; WBS 1.8.6.3 Personnel, Safety, and Occupational Access; WBS 1.8.6.4 Assembly, Installation, and Maintenance Equipment; WBS 1.8.6.4.1 Target Chamber Service System; WBS 1.8.6.4.2 Target Bay Service Systems
Mukherjee, R.; Venkatesh, A. S.; Fareeduddin, F.
2016-12-01
Bhukia is a unique gold prospect in terms of its host lithologies such as albitite and carbonates with respect to greenstone hosted Archean gold deposits from India. Tourmaline occurs along with apatite, magnetite, graphite, chalcopyrite and gold-sulfide association in Bhukia gold prospect preserve geochemical record of changing physico-chemical conditions during its growth. Tourmalinization is one of the distinct hydrothermal alterations present in the study area. Chemical composition of two varieties of tourmalines presents as significant amounts within albitite and carbonate rocks from Bhukia gold prospect. EPMA analysis of two varieties of tourmalines viz. 1) rounded to sub-rounded, euhedral, green colored tourmalines and 2) elongated, zoned, brown colored tourmalines unlocks their chemical compositions as well as variations from core to rim. In some albitite litho-units, tourmaline occurs as major constituents (>15%), present as layers, termed as tourmalinites. Al-Fe-Mg and Na/ (Na+Ca) vs Fe/ (Fe+Mg) suggests that tourmalines from the Bhukia gold prospect are Mg-rich dravite to Fe-rich schrol in composition. Tourmalines present within the albitite rocks show variations in iron and sodium content from core to rim whereas similarity exist from core to rim in case of carbonate rocks. Presence of albite confirms the role of Na-rich fluids during the formation of tourmalines. Tourmalines present in Bhukia gold prospect is mainly influenced by boron influx and the source may be boron bearing hydrothermal fluid or boron bearing minerals. Dewatering of original un-metamorphosed rock during progressive metamorphism may remove boron from the metasedimentary rocks. Due to the mobile nature of boron, it dispersed and mixed with hydrothermal fluids and alumina that is required for the formation of the tourmaline might have been leached from metasedimentary rocks present in Bhukia gold prospect. Presence of hydrothermal alterations such as tourmalinization and albitization
International Nuclear Information System (INIS)
Liang Liang; Zhong Zhiyun.
1988-01-01
Principal types of Precambrian uranium-gold deposits are follows: paleo-conglomerate uranium-deposit, stratified or strata-bound uranium-gold deposit, unconformity-related uranium deposit (no or seldem gold) and greenstone gold deposit. The main types of gold deposits in China is greenstone one which is characterized by later age, high grade metamorphism and a large time difference between diagenesis of host rocks and gold metallogenesis. Gold deposits are spatially distributed in the uplift area, whereas uranium deposits are distributed in the downfaulted belt. Furthermore, both uranium and gold deposits are controlled by regional fractures
Gold and arsenic concentrations in plants as an indication of gold mineralisation
International Nuclear Information System (INIS)
Girling, C.A.; Peterson, P.J.; Minski, M.J.
1978-01-01
A range of plant species growing on derelict gold mines and a lead-silver mine (background site) in Merionethshire, Wales, United Kingdom, was analysed simultaneously for Au and As by neutron activation analysis. The γ-emitting 198 Au and 76 As isotopes were determined in dried compact plant material following irradiation. Many plant species collected from the gold mines contained Au concentrations significantly above background values, but the extent of Au accumulation varied between and within species. Grasses, and herbs associated with the equatic environment contained the most Au, the highest value recorded was 95 ppb (dry weight) in the leaves of the grass Festuca rubra L. Species which contained high concentrations of Au also contained high concentrations of As. (Auth.)
Recovery of gold from electronic scrap by hydrometallurgical processes
Energy Technology Data Exchange (ETDEWEB)
Lee, Churl Kyoung; Rhee, Kang-In [Korea Institute of Geology Mining and Materials, Taejon (Korea, Republic of); Sohn, Hun Joon [Seoul National University, Seoul (Korea, Republic of)
1997-09-30
A series of processes has been developed to recover the gold from electronic scrap containing about 200{approx}600 ppm Au. First, mechanical beneficiation including shredding, crushing and screening was employed. Results showed that 99 percent of gold component leaves in the fraction of under 1 mm of crushed scrap and its concentration was enriched to about 800 ppm without incineration. The crushed scrap was leached in 50% aqua regia solution and gold was completely dissolved at 60 deg. C within 2 hours. Other valuable metals such as silver, copper, nickel and iron were also dissolved. The resulting solution was boiled to remove nitrous compounds in the leachate. Finally, a newly designed electrolyzer was tested to recover the gold metal. More than 99% of gold and silver were recovered within an hour by electrowinning process. (author). 10 refs., 5 tabs., 6 figs.
Emerging advances in nanomedicine with engineered gold nanostructures.
Webb, Joseph A; Bardhan, Rizia
2014-03-07
Gold nanostructures possess unique characteristics that enable their use as contrast agents, as therapeutic entities, and as scaffolds to adhere functional molecules, therapeutic cargo, and targeting ligands. Due to their ease of synthesis, straightforward surface functionalization, and non-toxicity, gold nanostructures have emerged as powerful nanoagents for cancer detection and treatment. This comprehensive review summarizes the progress made in nanomedicine with gold nanostructures (1) as probes for various bioimaging techniques including dark-field, one-photon and two-photon fluorescence, photothermal optical coherence tomography, photoacoustic tomography, positron emission tomography, and surface-enhanced Raman scattering based imaging, (2) as therapeutic components for photothermal therapy, gene and drug delivery, and radiofrequency ablation, and (3) as a theranostic platform to simultaneously achieve both cancer detection and treatment. Distinct from other published reviews, this article also discusses the recent advances of gold nanostructures as contrast agents and therapeutic actuators for inflammatory diseases including atherosclerotic plaque and arthritis. For each of the topics discussed above, the fundamental principles and progress made in the past five years are discussed. The review concludes with a detailed future outlook discussing the challenges in using gold nanostructures, cellular trafficking, and translational considerations that are imperative for rapid clinical viability of plasmonic nanostructures, as well as the significance of emerging technologies such as Fano resonant gold nanostructures in nanomedicine.
Goudafzettingen in Suriname (Gold deposits in Surinam)
Brinck, J.W.
1956-01-01
THE GOLD DEPOSITS IN SURINAM AND THE DISTRIBUTION OF CONCESSIONS THROUGH THE COUNTRY The fieldwork on the occurrence of primary and secondary gold deposits in Surinam on which this thesis is based was carried out by order of the Welfare Fund Surinam (Welvaarts Fonds Suriname) during the periods
Characterization and treatment of artisanal gold mine tailings
International Nuclear Information System (INIS)
Andrade Lima, L.R.P. de; Bernardez, L.A.; Barbosa, L.A.D.
2008-01-01
The solid waste generated by artisanal gold mining, with high mercury and gold contents, can be found in several areas in the South America. The present study focused on the tailings of an artisanal gold mine area located in the Brazilian northeastern. Samples of the mine tailings were taken and used to perform a physical and chemical characterization study using X-ray diffraction, scanning electron microscopy, neutron activation, X-ray fluorescence, induced coupled plasma-mass spectrometry, among others analytical methods. The results indicate that the material is composed mainly by quartz and goethite, the characteristic size of the particles (d 50 ) is about 150 μm, and the density is close of that of quartz. The main constituents are silicon, iron, and aluminum. The tailings gold content is of about 1.8 mg/kg and the mercury content is of about 10 mg/kg. A remarkable feature of this solid waste is that the gold and mercury are both concentrated in both the fine and the coarse particles, but not in particles of intermediary size. Leaching studies indicated that the tailings are stable in weak organic acids, but soluble in alkaline and aired cyanide solutions, in which 89% of gold and 100% of mercury are extracted in 24 h. Electroleaching experiments, performed using sodium chloride as electrolyte, indicated that mercury and gold are extracted simultaneously and the recovery of both metals can be as high as 70% in 4 h. In addition, chromium, nickel, and lead are found in relatively large amounts in the solution, which indicate an effectively action of the electroleaching method to clean up solid wastes contaminated with metals
DEFF Research Database (Denmark)
Jensen, Louise Helene Søgaard; Skjolding, Lars Michael; Thit, Amalie
2017-01-01
techniques are used to investigate internalization of 10 nm gold nanoparticles in Daphnia magna gut lumen and gut epithelial cells upon 24h exposure and outline potential artefacts, i.e. high contract precipitates from sample preparation related to these techniques. Light sheet microscopy confirmed...... accumulation of gold nanoparticles in the gut lumen. Scanning transmission electron microscopy and elemental analysis revealed gold nanoparticles attached to the microvilli of gut cells. Interestingly, the peritrophic membrane appeared to act as a semipermeable barrier between the lumen and the gut epithelium...
Directory of Open Access Journals (Sweden)
Elnaz Shaabani
2017-04-01
Full Text Available Objective(s: Biological applications of gold nanoparticles have limitations because of the toxic chemicals used in their synthesis. Curcumin can be used as reducing as well as capping agent in synthesis of GNPs to eliminate the cytotoxicity. Conjugation of curcumin to gold also helps in increasing its solubility and bioavailability. Materials and Methods: Here we report synthesis of gold nanoparticles coated with citrate and curcumin and of two different sizes via chemical routes. UV-Vis absorbance spectroscopy, Dynamic Light Scattering and Transmission Electron Microscopy were applied to study the average particle size, size stability of the samples and zeta potential. Fourier transform infrared, Raman Spectroscopy and Fluorescence Spectroscopy were applied for detection of curcumin on the surface of GNPs. The antioxidant activity was evaluated using DPPH assay and Cytotoxicity was evaluated by MTT assay.Results: Particles were synthesized of 6 and 16 nm size. The average particle size was found to be 21.7 ± 5.7 by TEM. The zeta potential on the surface of Cur-GNPs was negative and larger than 25 mV which is a sign of their high stability. The stability of these particles (with different coatings but with similar sizes at different time intervals (up to 3 months and also in different media like cell culture medium, different buffers, glucose and at different pH conditions have been investigated thoroughly. Appearance of functional groups assigned to curcumin in FTIR and SERS spectra are sign of presence of curcumin in the sample. The quenching of the fluorescence in the presence of GNPs reveals the clear indication of the capping and binding of curcumin with GNPs. Cur-GNP1 (16 nm were found to exhibit highest antioxidant activity than other gold nanoparticles. Cytotoxicity evaluation using MTT assay on L929 cell line proved curcumin coated gold nanoparticles were non-toxic up to 40 ppm.Conclusion: The results revealed that larger curcumin
International Nuclear Information System (INIS)
Viewing, K.
1983-01-01
Sulphur-isotope studies had been applied by Dr. I. Lambert to a number of deposits in Western Australia and also to certain samples from Vubachickwe and other deposits in Zimbabwe. A study of the sulphur isotopes at the Dickenson Mine, revealed a wide spread of values in the mineralised zones. Metamorphic processes were likely to be significant in the concentration of gold. The iron formations at the Old Jardine Mine had been unfolded by Dr. W.S. Hallager and the pattern of sedimentation was unraveled. A gold-rich zone was separated by a barren gap from the other part of the mineralised zone. Research was also done on the effects of the metamorphic processes, and the ages of mineralisation
De Greef, Yves; Dekker, Lukas; Boersma, Lucas; Murray, Stephen; Wieczorek, Marcus; Spitzer, Stefan G; Davidson, Neil; Furniss, Steve; Hocini, Mélèze; Geller, J Christoph; Csanádi, Zoltan
2016-05-01
This prospective, multicentre study (PRECISION GOLD) evaluated the incidence of asymptomatic cerebral embolism (ACE) after pulmonary vein isolation (PVI) using a new gold multi-electrode radiofrequency (RF) ablation catheter, pulmonary vein ablation catheter (PVAC) GOLD. Also, procedural efficiency of PVAC GOLD was compared with ERACE. The ERACE study demonstrated that a low incidence of ACE can be achieved with a platinum multi-electrode RF catheter (PVAC) combined with procedural manoeuvres to reduce emboli. A total of 51 patients with paroxysmal atrial fibrillation (AF) (age 57 ± 9 years, CHA2DS2-VASc score 1.4 ± 1.4) underwent AF ablation with PVAC GOLD. Continuous oral anticoagulation using vitamin K antagonists, submerged catheter introduction, and heparinization (ACT ≥ 350 s prior to ablation) were applied. Cerebral magnetic resonance imaging (MRI) scans were performed within 48 h before and 16-72 h post-ablation. Cognitive function assessed by the Mini-Mental State Exam at baseline and 30 days post-ablation. New post-procedural ACE occurred in only 1 of 48 patients (2.1%) and was not detectable on MRI after 30 days. The average number of RF applications per patient to achieve PVI was lower in PRECISION GOLD (20.3 ± 10.0) than in ERACE (28.8 ± 16.1; P = 0.001). Further, PVAC GOLD ablations resulted in significantly fewer low-power (GOLD in combination with established embolic lowering manoeuvres results in a low incidence of ACE. Pulmonary vein ablation catheter GOLD demonstrates improved biophysical efficiency compared with platinum PVAC. ClinicalTrials.gov NCT01767558. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Cardiology.
Synthesis of gold nanoparticles with graphene oxide.
Wang, Wenshuo; He, Dawei; Zhang, Xiqing; Duan, Jiahua; Wu, Hongpeng; Xu, Haiteng; Wang, Yongsheng
2014-05-01
Single sheets of functionalized graphene oxide are derived through chemical exfoliation of natural flake graphite. We present an effective synthetic method of graphene-gold nanoparticles hybrid nanocomposites. AFM (Atomic Force Microscope) was used to measure the thickness of the individual GO nanosheet. FTIR (Fourier transform infrared) spectroscopy was used to verify the attachment of oxygen functionalities on the surface of graphene oxide. TEM (Transmission Electron Microscope) data revealed the average diameters of the gold colloids and characterized the composite particles situation. Absorption spectroscopy showed that before and after synthesis the gold particle size did not change. Our studies indicate that the hybrid is potential substrates for catalysts and biosensors.
Microbial deposition of gold nanoparticles by the metal-reducing bacterium Shewanella algae
International Nuclear Information System (INIS)
Konishi, Y.; Tsukiyama, T.; Tachimi, T.; Saitoh, N.; Nomura, T.; Nagamine, S.
2007-01-01
Microbial reduction and deposition of gold nanoparticles was achieved at 25 deg. C over the pH range 2.0-7.0 using the mesophilic bacterium Shewanella algae in the presence of H 2 as the electron donor. The reductive deposition of gold by the resting cells of S. algae was a fast process: 1 mM AuCl 4 - ions were completely reduced to elemental gold within 30 min. At a solution pH of 7, gold nanoparticles 10-20 nm in size were deposited in the periplasmic space of S. algae cells. At pH 2.8, gold nanoparticles 15-200 nm in size were deposited on the bacterial cells, and the biogenic nanoparticles exhibited a variety of shapes that included nanotriangles: in particular, single crystalline gold nanotriangles 100-200 nm in size were microbially deposited. At a solution pH of 2.0, gold nanoparticles about 20 nm in size were deposited intracellularly, and larger gold particles approximately 350 nm in size were deposited extracellularly. The solution pH was an important factor in controlling the morphology of the biogenic gold particles and the location of gold deposition. Microbial deposition of gold nanoparticles is potentially attractive as an environmentally friendly alternative to conventional methods
Directory of Open Access Journals (Sweden)
Ali Kamiar
2013-08-01
Full Text Available Purpose: The aim of the present study was preparation, physicochemical characterization and performance evaluation of gold nanoparticles (GNPs in radiotherapy. Another objective was the investigation of anti-bacterial efficacy of gold nanoparticle against E. coli clinical strains. Methods: Gold nanoparticles prepared by controlled reduction of an aqueous HAuCl4 solution using Tri sodium citrate. Particle size analysis and Transmission electron microscopy were used for physicochemical characterization. Polymer gel dosimetry was used for evaluation of the enhancement of absorbed dose. Diffusion method in agar media was used for investigation of anti-bacterial effect. Results: Gold nanoparticles synthesized in size range from 57 nm to 346 nm by planning different formulation. Gold nanoparticle in 57 nm size increased radiation dose effectiveness with the magnitude of about 21 %. At the concentration of 400 ppm, Nano gold exhibited significant anti-bacterial effect against E. coli clinical strains. Conclusion: It is concluded that gold nanoparticles can be applied as dose enhancer in radiotherapy. The Investigation of anti-bacterial efficacy showed that gold nanoparticle had significant effect against E. coli clinical strains.
Ernawati, Rika; Idrus, Arifudin; TBMP, Himawan
2017-06-01
Lamuntet is one of gold ore mining area carried out by the Artisanal Small scale Gold Mining (ASGM) located in West Sumbawa, Indonesia. Most of the miners at this area are not the local miners but also those from other regions. Mineralization of this area is strong identified as low sulfidation epithermal system. There are two blocks of this mining location, namely, Ngelampar block with an area of 0.164 km2 and Song block with an area of 0.067 km2. This study was focused on Ngelampar block. The characteristic of epithermal system is the existence of quartz vein with comb, vuggy, and sugary texture. The aim of this research was to analyze the gold grade and other metals, such as Cu, Ag, Pb, As, Zn, and Hg. The research methods included literature study from previous researches, field work, laboratory work, and interpretation. The literature study was performed on previous researches with similar study area. The field work comprised of direct observation and sampling. Fieldwork was done for a week to obtain gold ore/vein. Sixteen samples were analyzed to obtain the grade of ore/metal. The Hg laboratory analysis was then performed on the six samples with the highest gold grade. Laboratory works were conducted at Intertek Jakarta by using Fire Assay (FA) for gold grade and Atomic Absorption Spectrophotometry (AAS) for Cu, Ag, Pb, As, Zn, and Hg. Results of the analysis showed the range of Au was grade (0.1 ppm - 27.8 ppm), Cu was 26 ppm -1740 ppm, Pb was 101 ppm- >4000 ppm, Zn of 73 ppm- >10,000 ppm, Ag of 3 ppm -185 ppm, As was 150 ppm-6530 ppm, and Hg of 0.08 ppm - 1.89 ppm. L1 and L15 had high grade for all values (Au, Ag, Zn, Cu, As, and Hg). Gold mineralization was formed as electrum because of Ag content is higher than 20%. Associated minerals of the samples in the study area were galena, sphalerite, arsenopyrite, and chalcopyrite which showed the characteristic of rich base metal of Pb, Zn, and Cu at LS epithermal.
Extraction of gold (Au) particles from sea water by Delftia Acidovorans microbes
Yusoff, A. H. M.; Nading, M. E.; Salimi, M. N.
2017-10-01
Gold-mining activities have been an issue, especially when it involves in contamination of chemicals, for example arsenic and mercury. However, despite of these hazards, gold-mining activities are still being conducted. This is because the gold is worth, regardless of the problems. Gold-mining, as known needs a very large area of land, or site plant. Vast amount of labor force, mechanical force and fund are a must in order for the mining process to be continued. High demand of gold, made gold-mining industries as ones of the most profitable industries in the world. Thus, this has encouraged another alternative way to extract gold. At the mining site, researchers found that biomineralization of gold by Delftia acidovorans can be conducted. How it is done still cannot be understood. It is said that the bacteria secretes secondary metabolites, Delftibactin as a defensive mechanism against the toxicity of the soluble gold. Researchers try to find another source of elemental gold besides of the earth’s core. The options are either lava of a volcano or ocean. Here, the focus is seawater. The problem of seawater is that its composition still not yet to be proved. Dissolve gold existed as gold chloride in seawater, but in a very small amount. So, the gold separation should be focused, in order to make this process to be a successful one. Factors such as depth, climate, region, temperature need to be considered. If this difference affecting the separating process, standardized seawater composition have to be proposed.
Ion induced segregation in gold nanostructured thin films on silicon
International Nuclear Information System (INIS)
Ghatak, J.; Satyam, P.V.
2008-01-01
We report a direct observation of segregation of gold atoms to the near surface regime due to 1.5 MeV Au 2+ ion impact on isolated gold nanostructures deposited on silicon. Irradiation at fluences of 6 x 10 13 , 1 x 10 14 and 5 x 10 14 ions cm -2 at a high beam flux of 6.3 x 10 12 ions cm -2 s -1 show a maximum transported distance of gold atoms into the silicon substrate to be 60, 45 and 23 nm, respectively. At a lower fluence (6 x 10 13 ions cm -2 ) transport has been found to be associated with the formation of gold silicide (Au 5 Si 2 ). At a high fluence value of 5 x 10 14 ions cm -2 , disassociation of gold silicide and out-diffusion lead to the segregation of gold to defect - rich surface and interface regions.
Strain study of gold nanomaterials as HR-TEM calibration standard.
Peng, X Y; Zhou, L Q; Li, X; Tao, X F; Ren, L L; Cao, W H; Xu, G F
2015-12-01
This work presents the use of high resolution electron microscopy (HREM) and geometric phase analysis (GPA) to measure the interplanar spacing and strain distribution of three gold nanomaterials, respectively. The results showed that the {111} strain was smaller than the {002} strain for any kind of gold materials at the condition of same measuring method. The 0.65% of {111} strain in gold film measured by HREM (0.26% measured by GPA) was smaller than the {111} strains in two gold particles. The presence of lattice strain was interpreted according to the growth mechanism of metallic thin film. It is deduced that the {111} interplanar spacing of the gold thin film is suitable for high magnification calibration of transmission electron microscopy (TEM) and the gold film is potential to be a new calibration standard of TEM. Copyright © 2015 Elsevier Ltd. All rights reserved.
An application of gold diffusion for defect investigation in silicon
International Nuclear Information System (INIS)
Feklisova, O.V.; Yakimov, E.B.
2009-01-01
The application of gold diffusion for defect investigation in Si is illustrated by the diffusion experiments carried out on crystals containing grown-in or specially introduced defects. The efficiency of gold diffusion experiments for monitoring the concentration and spatial distribution of these defects is shown. The effect of vacancy type defects on gold diffusion is illustrated by investigations of nitrogen-doped FZ Si and of Cz Si after rapid thermal annealing. In both these cases the gold depth profile is distinctive for trap limited diffusion. The effect of sinks for self-interstitials on gold diffusion is illustrated by the results obtained on the plastically deformed Si. It is shown that in silicon deformed at relatively low temperatures the gold diffusion is to a great extent determined by the defects in the dislocation trails while in high temperature deformed Si the sinks for self-interstitials are associated with dislocations themselves.
Uranium extraction from gold-uranium ores
Energy Technology Data Exchange (ETDEWEB)
Laskorin, B.N.; Golynko, Z.Sh.
1981-01-01
The process of uranium extraction from gold-uranium ores in the South Africa is considered. Flowsheets of reprocessing gold-uranium conglomerates, pile processing and uranium extraction from the ores are presented. Continuous counter flow ion-exchange process of uranium extraction using strong-active or weak-active resins is noted to be the most perspective and economical one. The ion-exchange uranium separation with the succeeding extraction is also the perspective one.
Takei, Koji; Takahashi, Fumihiro; Liu, Shawn; Tsuda, Kikumi; Palumbo, Joseph
2017-10-01
Post-hoc analyses of the ALS Functional Rating Scale-Revised (ALSFRS-R) score data, the primary endpoint in the 24-week double-blind placebo-controlled study of edaravone (MCI186-19, NCT01492686), were performed to confirm statistical robustness of the result. The previously reported original analysis had used a last observation carried forward (LOCF) method and also excluded patients with fewer than three completed treatment cycles. The post-hoc sensitivity analyses used different statistical methods as follows: 1) including all patients regardless of treatment cycles received (ALL LOCF); 2) a mixed model for repeated measurements (MMRM) analysis; and 3) the Combined Assessment of Function and Survival (CAFS) endpoint. Findings were consistent with the original primary analysis in showing superiority of edaravone over placebo. We also investigated the distribution of change in ALSFRS-R total score across all patients in the study as well as which ALSFRS-R items and domains may have contributed to the overall efficacy findings. The distribution of changes in ALSFRS-R total score from baseline to the end of cycle 6 (ALL LOCF) shifted in favour of edaravone compared to placebo. Edaravone was descriptively favoured for each ALSFRS-R item and each of the four ALSFRS-R domains at the end of cycle 6 (ALL LOCF), suggesting a generalised effect of edaravone in slowing functional decline across all anatomical regions. The effect of edaravone appeared to be similar in patients with bulbar onset and limb onset. Together, these observations would be consistent with its putative neuroprotective effects against the development of oxidative damage unspecific to anatomical regions.
Biological and Geochemical Development of Placer Gold Deposits at Rich Hill, Arizona, USA
Directory of Open Access Journals (Sweden)
Erik B. Melchiorre
2018-02-01
Full Text Available Placer gold from the Devils Nest deposits at Rich Hill, Arizona, USA, was studied using a range of micro-analytical and microbiological techniques to assess if differences in (paleo-environmental conditions of three stratigraphically-adjacent placer units are recorded by the gold particles themselves. High-angle basin and range faulting at 5–17 Ma produced a shallow basin that preserved three placer units. The stratigraphically-oldest unit is thin gold-rich gravel within bedrock gravity traps, hosting elongated and flattened placer gold particles coated with manganese-, iron-, barium- (Mn-Fe-Ba oxide crusts. These crusts host abundant nano-particulate and microcrystalline secondary gold, as well as thick biomats. Gold surfaces display unusual plumate-dendritic structures of putative secondary gold. A new micro-aerophilic Betaproteobacterium, identified as a strain of Comamonas testosteroni, was isolated from these biomats. Significantly, this ‘black’ placer gold is the radiogenically youngest of the gold from the three placer units. The middle unit has well-rounded gold nuggets with deep chemical weathering rims, which likely recorded chemical weathering during a wetter period in Arizona’s history. Biomats, nano-particulate gold and secondary gold growths were not observed here. The uppermost unit is a pulse placer deposited by debris flows during a recent drier period. Deep cracks and pits in the rough and angular gold from this unit host biomats and nano-particulate gold. During this late arid period, and continuing to the present, microbial communities established within the wet, oxygen-poor bedrock traps of the lowermost placer unit, which resulted in biological modification of placer gold chemistry, and production of Mn-Fe-Ba oxide biomats, which have coated and cemented both gold and sediments. Similarly, deep cracks and pits in gold from the uppermost unit provided a moist and sheltered micro-environment for additional gold
pH induced protein-scaffold biosynthesis of tunable shape gold nanoparticles
International Nuclear Information System (INIS)
Zhang Xiaorong; He Xiaoxiao; Wang Kemin; Ren Fang; Qin Zhihe
2011-01-01
In this paper, a pH-inductive protein-scaffold biosynthesis of shape-tunable crystalline gold nanoparticles at room temperature has been developed. By simple manipulation of the reaction solution's pH, anisotropic gold nanoparticles including spheres, triangles and cubes could be produced by incubating an aqueous solution of sodium tetrachloroaurate with Dolichomitriopsis diversiformis biomasses after immersion in ultrapure Millipore water overnight. A moss protein with molecular weight of about 71 kDa and pI of 4.9 was the primary biomolecule involved in the biosynthesis of gold nanoparticles. The secondary configuration of the proteins by CD spectrum implied that the moss protein could display different secondary configurations including random coil, α-helix and intermediate conformations between random coil and α-helix for the experimental pH solution. The growth process of gold nanoparticles further showed that the moss protein with different configurations provided the template scaffold for the shape-controlled biosynthesis of gold nanoparticles. The constrained shape of the gold nanoparticles, however, disappeared in boiled moss extract. The gold nanoparticles with designed morphology were successfully reconstructed using the moss protein purified from the gold nanoparticles. Structural characterizations by SEM, TEM and SAED showed that the triangular and cubic gold nanoparticles were single crystalline.
Radiation-enhanced thermal processes during implantation of gold into copper
Energy Technology Data Exchange (ETDEWEB)
Perret, N.E.; King, B.V.; Dastoor, P.C. [Newcastle Univ., NSW (Australia). Dept. of Physics
1996-12-31
A copper (100) single crystal has been implanted with gold ions at temperatures ranging from 133 K to 673 K. Rutherford Backscattering Spectroscopy (RBS) has been used to observe the changes in the gold implant distribution that occur as a function of the sample temperature during implantation. Two distinct effects have been observed. Firstly the gold implant distribution, as a function of depth, broadens with sample temperature. This broadening of the gold depth profile is most marked at temperatures above 473 K. Secondly, the gold is implanted deeper into the copper crystal as the sample temperature is increased. These results are discussed in terms of radiation enhanced diffusion and radiation-induced segregation processes. 10 refs., 3 figs.
Radiation-enhanced thermal processes during implantation of gold into copper
Energy Technology Data Exchange (ETDEWEB)
Perret, N E; King, B V; Dastoor, P C [Newcastle Univ., NSW (Australia). Dept. of Physics
1997-12-31
A copper (100) single crystal has been implanted with gold ions at temperatures ranging from 133 K to 673 K. Rutherford Backscattering Spectroscopy (RBS) has been used to observe the changes in the gold implant distribution that occur as a function of the sample temperature during implantation. Two distinct effects have been observed. Firstly the gold implant distribution, as a function of depth, broadens with sample temperature. This broadening of the gold depth profile is most marked at temperatures above 473 K. Secondly, the gold is implanted deeper into the copper crystal as the sample temperature is increased. These results are discussed in terms of radiation enhanced diffusion and radiation-induced segregation processes. 10 refs., 3 figs.
Radiation-enhanced thermal processes during implantation of gold into copper
International Nuclear Information System (INIS)
Perret, N.E.; King, B.V.; Dastoor, P.C.
1996-01-01
A copper (100) single crystal has been implanted with gold ions at temperatures ranging from 133 K to 673 K. Rutherford Backscattering Spectroscopy (RBS) has been used to observe the changes in the gold implant distribution that occur as a function of the sample temperature during implantation. Two distinct effects have been observed. Firstly the gold implant distribution, as a function of depth, broadens with sample temperature. This broadening of the gold depth profile is most marked at temperatures above 473 K. Secondly, the gold is implanted deeper into the copper crystal as the sample temperature is increased. These results are discussed in terms of radiation enhanced diffusion and radiation-induced segregation processes. 10 refs., 3 figs
Authentication of gold products by nuclear methods
International Nuclear Information System (INIS)
De Jesus, A.S.M.
1985-01-01
The falsification of valuable gold items is a threat to the authenticity of gold products. To solve this, there is a continuous search for reliable, practicle and cost-effective means of identifying forgeries. Because nuclear techniques as applied to elemental analysis have a high degree of specificity, are non-destructive and permit the availability of results within a relatively short time, a few of these techniques were investigated and reviewed in the article. Work on some promising methods in the author's laboratory is also discussed. Constraints such as those imposed by the time taken by the measurement, negligible residual activity within a relatively short time were also considered. The techniques that were investigated include: the transmission of electromagnetic radiation through a medium; scattering of electromagnetic radiation; x-ray fluorescence analysis; neutron activation analysis; activation by the inelastic scattering of gamma radiation; activation by the inelastic scattering of fast neutrons; absorption and scattering of fast neutrons; self-attenuation of gamma radiation. The shape of the object being investigated, should also be considered. It is concluded that a system based on the inelastic scattering of neutrons emitted by a 241 Am/Be source (halflife = 433 years) is practical and capable of authenticating gold and gold alloy coins such as Krugerrands. The feasibility study on the assaying of gold jewelry by means of nuclear methods also showed it to be impractical
Growth of pentacene on clean and modified gold surfaces
International Nuclear Information System (INIS)
Kaefer, Daniel; Ruppel, Lars; Witte, Gregor
2007-01-01
The growth and evolution of pentacene films on gold substrates have been studied. By combining complementary techniques including scanning tunneling microscopy, atomic force microscopy, scanning electron microscopy, near-edge x-ray-absorption fine structure, and x-ray diffraction, the molecular orientation, crystalline structure, and morphology of the organic films were characterized as a function of film thickness and growth parameters (temperature and rate) for different gold substrates ranging from Au(111) single crystals to polycrystalline gold. Moreover, the influence of precoating the various gold substrates with self-assembled monolayers (SAM's) of organothiols with different chemical terminations has been studied. On bare gold the growth of pentacene films is characterized by a pronounced dewetting while the molecular orientation within the resulting crystalline three-dimensional islands depends distinctly on the roughness and cleanliness of the substrate surface. After completion of the first wetting layer where molecules adopt a planar orientation parallel to the surface the molecules continue to grow in a tilted fashion: on Au(111) the long molecular axis is oriented parallel to the surface while on polycrystalline gold it is upstanding oriented and thus parallels the crystalline orientation of pentacene films grown on SiO 2 . On SAM pretreated gold substrates the formation of a wetting layer is effectively suppressed and pentacene grows in a quasi-layer-by-layer fashion with an upstanding orientation leading to rather smooth films. The latter growth mode is observed independently of the chemical termination of the SAM's and the roughness of the gold substrate. Possible reasons for the different growth mechanism as well as consequences for the assignment of spectroscopic data of thin pentacene film are discussed
Adsorption of gold (III) from aqueous solutions on bagasse ash
International Nuclear Information System (INIS)
Hussain, G.; Khan, M.A.
2011-01-01
To assess the potential of cheap biomass materials for the recovery of gold from industrial, and electroplating waste water effluents, adsorption of gold (III) from dilute solutions of hydrochloric acid on bagasse ash has been studied under various experimental conditions by using batch technique. Percentage extraction of gold (III) on bagasse ash was determined from its distribution coefficients as a function of contact time, pH, adsorbent, adsorbate concentrations, and temperature. The uptake of gold (III) by bagasse ash is time, pH, metal concentration, amount of adsorbate, and temperature dependent. Adsorption data have been interpreted in terms of Langmuir, and the Freundlich equations. Thermodynamic parameters for the adsorption of gold (III) on bagasse ash have been determined at three different temperatures. The positive value of heat of adsorption; delta H 44.52 kJ/mol shows that the adsorption of gold (III) on bagasse ash is endothermic where as the negative value of delta G = -0.5303 kJ/mol at 318 K shows the spontaneity of the process. Delta G becomes more negative with increase in temperature which shows that the adsorption is more favorable at higher temperatures. Under the optimal adsorption conditions the adsorption capacity of gold is 0.70 mg /g of the adsorbent out of which 0.65 mg of gold gets desorbed with 0.1 % thiourea solution. (author)
Catalase coupled gold nanoparticles: Comparison between carbodiimide and biotin-streptavidin methods
Chirra, Hariharasudhan D.; Sexton, Travis; Biswal, Dipti; Hersh, Louis B.; Hilt, J. Zach
2011-01-01
The use of proteins for therapeutic applications requires the protein to maintain sufficient activity for the period of in vivo treatment. Many proteins exhibit a short half-life in vivo and, thus, require delivery systems for them to be applied as therapeutics. The relative biocompatibility and the ability to form functionalized bioconjugates via simple chemistry make gold nanoparticles excellent candidates as protein delivery systems. Herein, two protocols for coupling proteins to gold nanoparticles were compared. In the first, the strong biomolecular binding between biotin and streptavidin was used to couple catalase to the surface of gold nanoparticles. In the second protocol, the formation of an amide bond between carboxylic acid coated gold nanoparticles and free surface amines of catalase using carbodiimide chemistry was performed. The stability and kinetics of the different steps involved in these protocols were studied using UV-Visible spectroscopy, dynamic light scattering, and transmission electron microscopy. The addition of mercaptoundecanoic acid in conjugation with (N-(6-(biotinamido)hexyl)-3′-(2′-pyridyldithio)-propionamide increased the stability of biotinylated gold nanoparticles. Although the carbodiimide chemistry based bioconjugation approach exhibited a decrease in catalase activity, the carbodiimide chemistry based bioconjugation approach resulted in more active catalase per gold nanoparticle compared to that of mercaptoundecanoic acid stabilized biotinylated gold nanoparticles. Both coupling protocols resulted in gold nanoparticles loaded with active catalase. Thus, these gold nanoparticle systems and coupling protocols represent promising methods for the application of gold nanoparticles for protein delivery. PMID:21232642
One-step synthesis of gold bimetallic nanoparticles with various metal-compositions
International Nuclear Information System (INIS)
Bratescu, Maria Antoaneta; Takai, Osamu; Saito, Nagahiro
2013-01-01
Highlights: ► Synthesis of bimetallic nanoparticles in an aqueous solution discharge. ► Alloying gold with divalent sp metals, trivalent sp metals, 3d or 4d metals. ► Formation mechanism of bimetallic nanoparticles by metal reduction and gold erosion. ► Blue and red shift of surface plasmon resonance. -- Abstract: A rapid, one-step process for the synthesis of bimetallic nanoparticles by simultaneous metal reduction and gold erosion in an aqueous solution discharge was investigated. Gold bimetallic nanoparticles were obtained by alloying gold with various types of metals belonging to one of the following categories: divalent sp metals, trivalent sp metals, 3d or 4d metals. The composition of the various gold bimetallic nanoparticles obtained depends on electrochemical factors, charge transfer between gold and other metal, and initial concentration of metal in solution. Transmission electron microscopy and energy dispersive spectroscopy show that the gold bimetallic nanoparticles were of mixed pattern, with sizes of between 5 and 20 nm. A red-shift of the surface plasmon resonance band in the case of the bimetallic nanoparticles Au–Fe, Au–Ga, and Au–In, and a blue-shift of the plasmon band of the Au–Ag nanoparticles was observed. In addition, the interaction of gold bimetallic nanoparticles with unpaired electrons, provided by a stable free radical molecule, was highest for those NPs obtained by alloying gold with a 3d metal
Diverse Near-Infrared Resonant Gold Nanostructures for Biomedical Applications
Huang, Jianfeng
2015-12-08
The ability of near-infrared (NIR) light to penetrate tissues deeply and to target malignant sites with high specificity via precise temporal and spatial control of light illumination makes it useful for diagnosing and treating diseases. Owing to their unique biocompatibility, surface chemistry and optical properties, gold nanostructures offer advantages as in vivo NIR photosensitizers. This chapter describes the recent progress in the varied use of NIR-resonant gold nanostructures for NIR-light-mediated diagnostic and therapeutic applications. We begin by describing the unique biological, chemical and physical properties of gold nanostructures that make them excellent candidates for biomedical applications. From here, we make an account of the basic principles involved in the diagnostic and therapeutic applications where gold nanostructures have set foot. Finally, we review recent developments in the fabrication and use of diverse NIR-resonant gold nanostructures for cancer imaging and cancer therapy.
Plasmonic properties of gold-coated nanoporous anodic alumina ...
Indian Academy of Sciences (India)
gold-coated NAA is strongly quenched due to the strong plasmonic coupling. Keywords. Plasmon ... When coated by a thin film of gold, these templates can support surface plasmon resonance. ... 2.2 Equipment for characterization. Surface ...
Directory of Open Access Journals (Sweden)
Linhai Biao
2018-01-01
Full Text Available Green synthesis of gold nanoparticles using plant extracts is one of the more promising approaches for obtaining environmentally friendly nanomaterials for biological applications and environmental remediation. In this study, proanthocyanidins-functionalized gold nanoparticles were synthesized via a hydrothermal method. The obtained gold nanoparticles were characterized by ultraviolet and visible spectrophotometry (UV-Vis, Fourier transform infrared spectroscopy (FTIR, transmission electron microscopy (TEM and X-ray diffraction (XRD measurements. UV-Vis and FTIR results indicated that the obtained products were mainly spherical in shape, and that the phenolic hydroxyl of proanthocyanidins had strong interactions with the gold surface. TEM and XRD determination revealed that the synthesized gold nanoparticles had a highly crystalline structure and good monodispersity. The application of proanthocyanidins-functionalized gold nanoparticles for the removal of dyes and heavy metal ions Ni2+, Cu2+, Cd2+ and Pb2+ in an aqueous solution was investigated. The primary results indicate that proanthocyanidins-functionalized gold nanoparticles had high removal rates for the heavy metal ions and dye, which implies that they have potential applications as a new kind of adsorbent for the removal of contaminants in aqueous solution.
Gold deposits in the western sector of the Central Spanish System
International Nuclear Information System (INIS)
Barrios, S.; Florido, P.; Reguilon, R.
2010-01-01
The gold deposits in the western sector of the Central Spanish System can be grouped in: (1) gold quartz veins type (El Chivote, La Pedrera), (2) paleoplacers: gold nuggets in tertiary alluvial deposits (Las Cavenes, Sierro de Coria), (3) quaternary placers (Rio Erjas), (4) gold nuggets in a regolith developed on the Schist and Graywacke Complex (CEG) (Casillas de Coria). The morphological study of gold nuggets will provide physical, chemical, bacteriological and climatic characteristics. Mining works are located on these deposits from roman time to the present day. (Author)
When gold can do what iodine cannot do: A critical comparison
Directory of Open Access Journals (Sweden)
Stefan F. Kirsch
2011-06-01
Full Text Available Gold catalysis has emerged as one of the most dynamic fields in organic synthesis. Only recently, more and more domino processes, for which gold pre-catalysts were found to be outstandingly effective, were paralleled by employing iodine electrophiles in place of gold compounds. This review highlights how, in certain cases, iodonium activation can match gold-catalyzed reactions to construct identical product scaffolds. Likewise, processes are discussed where mostly identical starting materials are transformed into diverse frameworks depending on whether gold or iodonium activation was used to trigger the reaction.
Bacterial leaching of pyritic gold ores
International Nuclear Information System (INIS)
Gagliardi, F.M.; Cashion, J.D.; Brown, J.; Jay, W.H.
1998-01-01
Full text: Pyritic ores (pyrite and arsenopyrite) containing gold concentrations in excess of 50g Au/t can be processed to recover the gold by the removal of the sulphur from the ore. This may be achieved by roasting (producing sulphur dioxide emissions), pressure oxidation (expensive and suitable for large high grade deposits), pressure leaching (still currently being developed) or bacterial oxidation. The bacterial oxidation process is a well known process in nature but has only recently come under investigation as a economically viable and relatively clean method of gold recovery from deep low grade sulphidic ores. Samples were obtained from the Wiluna Gold Mine in Western Australia consisting of the original ore, six successive bacterial reactors and the final products. Moessbauer experiments have been performed at room temperature, liquid nitrogen and liquid helium temperatures, and in applied magnetic fields. The main components of the iron phases which were present during the bacterial treatment were pyrite and arsenopyrite which were readily oxidised by the bacteria. Ferric sulfates and ferric arsenates were identified as by-products of the process with a small amount of the oxyhydroxide goethite. These results are in contrast to the similar study of the Fairview Mine in South Africa where principally Fe(II) species were observed
Absorption Spectra of Gold Nanoparticle Suspensions
Anan'eva, M. V.; Nurmukhametov, D. R.; Zverev, A. S.; Nelyubina, N. V.; Zvekov, A. A.; Russakov, D. M.; Kalenskii, A. V.; Eremenko, A. N.
2018-02-01
Three gold nanoparticle suspensions are obtained, and mean radii in distributions - (6.1 ± 0.2), (11.9 ± 0.3), and (17.3 ± 0.7) nm - are determined by the transmission electron microscopy method. The optical absorption spectra of suspensions are obtained and studied. Calculation of spectral dependences of the absorption index of suspensions at values of the gold complex refractive index taken from the literature showed a significant deviation of experimental and calculated data in the region of 450-800 nm. Spectral dependences of the absorption of suspensions are simulated within the framework of the Mie-Drude theory taking into account the interband absorption in the form of an additional term in the imaginary part of the dielectric permittivity of the Gaussian type. It is shown that to quantify the spectral dependences in the region of the plasmon absorption band of nanoparticles, correction of the parameters of the interband absorption is necessary in addition to the increase of the relaxation parameter of the Drude theory. Spectral dependences of the dielectric permittivity of gold in nanodimensional state are refined from the solution of the inverse problem. The results of the present work are important for predicting the special features of operation of photonic devices and optical detonators based on gold nanoparticles.
Determination of Commercial Karats on Gold Alloys for Jewellery
International Nuclear Information System (INIS)
Morales, S.E.A.
1986-12-01
An XRF method for the gold content determination in gold alloys was proposed and tested. Gold coins and ingot samples were analyzed. Monoelemental standards and two pint regression curves calculated with the NBSGSC program, Cd-109 annular source, Si-Li detector, 4096 channels analyzer and AXIL deconvolution software were employed. Good precision better than 1.5% and accuracy better than 2% were obtained. (author)
Synthesis of porous gold nanoshells by controlled transmetallation reaction
Energy Technology Data Exchange (ETDEWEB)
Pattabi, Manjunatha, E-mail: manjupattabi@yahoo.com; M, Krishnaprabha [Department of Materials Science, Mangalore University, Mangalagangothri-574199 (India)
2015-06-24
Aqueous synthesis of porous gold nanoshells in one step is carried out through controlled transmetallation (TM) reaction using a naturally available egg shell membrane (ESM) as a barrier between the sacrificial silver particles (AgNPs) and the gold precursor solution (HAuCl{sub 4}). The formation of porous gold nanoshells via TM reaction is inferred from UV-Vis spectroscopy and the scanning electron microscopic (SEM) studies.
Hydrothermal Gold Mineralization and Structural Controls near May ...
African Journals Online (AJOL)
Mickiale
controlled gold mineralized zones of gold near Workamba. .... consists of rounded to sub-rounded clasts of blue quartz eyes and varies in size from ... Based on the field observation, petrographic study and their cross cutting relationships; four.
Synthesis, characterization and self-assembly with gold nanoparticles
Indian Academy of Sciences (India)
Administrator
characterization and self-assembly with gold nanoparticles. JUN-BO LI. 1, ... gold surface lead to the enhancement of device prop- erties. 36,37 ... Reactions were monitored by thin-layer ..... plasmon (SP) absorption band (figure 5) of TOAB-.
Mercury adsorption to gold nanoparticle and thin film surfaces
Morris, Todd Ashley
Mercury adsorption to gold nanoparticle and thin film surfaces was monitored by spectroscopic techniques. Adsorption of elemental mercury to colloidal gold nanoparticles causes a color change from wine-red to orange that was quantified by UV-Vis absorption spectroscopy. The wavelength of the surface plasmon mode of 5, 12, and 31 nm gold particles blue-shifts 17, 14, and 7.5 nm, respectively, after a saturation exposure of mercury vapor. Colorimetric detection of inorganic mercury was demonstrated by employing 2.5 nm gold nanoparticles. The addition of low microgram quantities of Hg 2+ to these nanoparticles induces a color change from yellow to peach or blue. It is postulated that Hg2+ is reduced to elemental mercury by SCN- before and/or during adsorption to the nanoparticle surface. It has been demonstrated that surface plasmon resonance spectroscopy (SPRS) is sensitive to mercury adsorption to gold and silver surfaces. By monitoring the maximum change in reflectivity as a function of amount of mercury adsorbed to the surface, 50 nm Ag films were shown to be 2--3 times more sensitive than 50 nm Au films and bimetallic 15 nm Au/35 nm Ag films. In addition, a surface coverage of ˜40 ng Hg/cm2 on the gold surface results in a 0.03° decrease in the SPR angle of minimum reflectivity. SPRS was employed to follow Hg exposure to self-assembled monolayers (SAMs) on Au. The data indicate that the hydrophilic or hydrophobic character of the SAM has a significant effect on the efficiency of Hg penetration. Water adsorbed to carboxylic acid end group of the hydrophilic SAMs is believed to slow the penetration of Hg compared to methyl terminated SAMs. Finally, two protocols were followed to remove mercury from gold films: immersion in concentrated nitric acid and thermal annealing up to 200°C. The latter protocol is preferred because it removes all of the adsorbed mercury from the gold surface and does not affect the morphology of the gold surface.