WorldWideScience

Sample records for goiabeira serrana acca

  1. Determinação de danos do gorgulho, Conotrachelus Psidii Marshall e captura de mosca-das-frutas, Anastrepha fFaterculus Wiedemann, com óleo de andiroba, Carapa Guianensis em goiabeira serrana Acca Sellowiana

    OpenAIRE

    Rosa, Joatan Machado da

    2011-01-01

    A goiabeira-serrana (Acca sellowiana (Berg) Burret) pertencente a família Myrtaceae, é uma espécie nativa com ampla dispersão nos planaltos meridionais do sul do Brasil. Além de espécie nativa e produzir frutos de odor e sabor diferenciado, razão pela qual seu cultivo comercial é incentivado pelo Departamento de Conservação da Biodiversidade do Ministério do Meio Ambiente. A goiabeira serrana tem sido cultivada sob os sistemas orgânico, convencional, ou ainda, os frutos coletad...

  2. Determinação de danos do gorgulho, Conotrachelus psidii Marshall e captura de mosca-das-frutas, Anastrepha fraterculus Wiedemann, com óleo de andiroba, Carapa guianensis em goiabeira serrana Acca sellowiana. Lages-SC 2011

    OpenAIRE

    Rosa, Joatan Machado da

    2011-01-01

    A goiabeira-serrana (Acca sellowiana (Berg) Burret) pertencente a família Myrtaceae, é uma espécie nativa com ampla dispersão nos planaltos meridionais do sul do Brasil. Além de espécie nativa e produzir frutos de odor e sabor diferenciado, razão pela qual seu cultivo comercial é incentivado pelo Departamento de Conservação da Biodiversidade do Ministério do Meio Ambiente. A goiabeira serrana tem sido cultivada sob os sistemas orgânico, convencional, ou ainda, os frutos coletad...

  3. Teste de tetrazólio para avaliação da qualidade fisiológica em sementes de Goiabeira-serrana (Acca sellowiana O. Berg Burret

    Directory of Open Access Journals (Sweden)

    Marcelo Benevenga Sarmento

    2013-03-01

    Full Text Available A goiabeira-serrana, espécie frutífera nativa do Sul do Brasil, vem mostrando- se promissora em termos ecológicos e comerciais. O trabalho objetivou avaliar a qualidade fisiológica de dois lotes de sementes de goiabeira-serrana por meio do teste de tetrazólio. O experimento foi dividido em duas etapas. Na primeira, os lotes foram submetidos aos testes de germinação, índice de velocidade de germinação, tempo médio de germinação, emergência em casa de vegetação, índice de velocidade de emergência de plântulas em casa de vegetação, tempo médio de emergência e comprimento de parte aérea. Na segunda, foi realizado o teste de tetrazólio nas concentrações de 0,5 e 1,0, e tempos de embebição (2 h e 4 h. O tratamento 0,5 TZ 4h obteve 73% de sementes viáveis (lote 2007. Para o lote 2008, não houve diferenças entre os tratamentos. O teste de germinação apresentou correlação positiva para os tratamentos 0,5 TZ 2 h e 1 TZ 2 h. Para a emergência de plântulas em casa de vegetação, houve correlação positiva para o tratamento 0,5 TZ 2 h. O teste de tetrazólio permitiu a classificação dos lotes em quatro níveis de viabilidade, confirmando a eficiência do teste na avaliação da viabilidade de sementes de goiabeira-serrana.

  4. Protocolo de micropropagação da goiabeira serrana (Acca sellowiana (Berg Burret Feijoa (Acca sellowiana (Berg Burret micropropagation protocol

    Directory of Open Access Journals (Sweden)

    Ana Carla Oltramari

    2000-03-01

    Full Text Available Visando ao desenvolvimento de um novo protocolo para a micropropagação da goiabeira serrana (Acca sellowiana (Berg Burret foram estabelecidos experimentos com segmentos nodais e microestacas. As citocininas 6-Benzilaminopurina (BAP, Cinetina (Kin e 2-Isopenteniladenina (2-iP foram adicionadas ao meio de cultura Woody Plant Midium-WPM, visando à proliferação de brotações múltiplas dos genótipos 53B-7, 101, 529 e 152-12 x 458. As microestacas obtidas in vitro foram submetidas a diferentes períodos de indução, em 20 miM de ácido indolbutírico (AIB e, posteriormente, transferidas para meio de cultura isento desse fitorregulador para a indução de raízes ou, alternativamente, submetidas a diferentes concentrações e tempos de exposição em AIB e transferidas para substrato. As citocininas empregadas não promoveram aumento na taxa de proliferação de brotos em relação à testemunha. O meio de cultura basal WPM, adicionado de Kin (5 miM, proporcionou maior altura média dos brotos. Segmentos nodais do acesso 101 cultivados em meio de cultura WPM, isento de fitorreguladores, apresentaram maiores taxas médias de proliferação. Pulsos de seis dias com AIB (20 miM induziram uma maior taxa de enraizamento (68,9%, um maior número médio de raízes (1,3 raízes e raízes com maior comprimento médio (5,6miM. Microestacas enraizadas ex vitro, pela imersão em AIB (100 miM por 60 minutos, resultaram em maior altura das plantas (45,3mm, número de raízes secundárias (11,3 raízes, massa fresca (1069mg e seca das raízes (282mg.The objective of this study was to establish a micropropagation protocol for Acca sellowiana (Berg Burret. Nodal segments of in vitro cultivated plantlets of the genotypes 53B-7, 101, 529 and 152-12 x 458 were inoculated in test tubes containing 15ml of Woody Plant Medium-WPM solid medium supplemented with the cytokinins BAP, Kin, and 2-iP. For rooting purpose the microcuttings were submitted to different

  5. Efeito de anos e determinação do coeficiente de repetibilidade de características de frutos de goiabeira-serrana

    Directory of Open Access Journals (Sweden)

    Degenhardt Juliana

    2002-01-01

    Full Text Available A variância ambiental costuma ser bastante significativa em características de produção e de frutos, a maioria de herança quantitativa. Este estudo teve por objetivo avaliar o efeito de anos e determinar o número de anos necessários para avaliação precisa do peso do fruto, peso de casca, comprimento, diâmetro, relação comprimento/diâmetro, rendimento de polpa e sólidos solúveis totais dos frutos de goiabeira-serrana (Acca sellowiana, em três anos de avaliação. Com exceção de sólidos solúveis totais, o efeito de anos representou grande parte da variância total. A partir do coeficiente de repetibilidade, determinou-se que seriam necessários no mínimo de quatro a seis anos de avaliação para seleção das plantas, com precisão de 80%.

  6. Teste de tetrazólio para avaliação da qualidade fisiológica em sementes de Goiabeira-serrana (Acca sellowiana O. Berg Burret Tetrazolium test to evaluate physiological quality of Brazilian Guava seeds (Acca sellowiana O. Berg Burret

    Directory of Open Access Journals (Sweden)

    Marcelo Benevenga Sarmento

    2013-03-01

    Full Text Available A goiabeira-serrana, espécie frutífera nativa do Sul do Brasil, vem mostrando- se promissora em termos ecológicos e comerciais. O trabalho objetivou avaliar a qualidade fisiológica de dois lotes de sementes de goiabeira-serrana por meio do teste de tetrazólio. O experimento foi dividido em duas etapas. Na primeira, os lotes foram submetidos aos testes de germinação, índice de velocidade de germinação, tempo médio de germinação, emergência em casa de vegetação, índice de velocidade de emergência de plântulas em casa de vegetação, tempo médio de emergência e comprimento de parte aérea. Na segunda, foi realizado o teste de tetrazólio nas concentrações de 0,5 e 1,0, e tempos de embebição (2 h e 4 h. O tratamento 0,5 TZ 4h obteve 73% de sementes viáveis (lote 2007. Para o lote 2008, não houve diferenças entre os tratamentos. O teste de germinação apresentou correlação positiva para os tratamentos 0,5 TZ 2 h e 1 TZ 2 h. Para a emergência de plântulas em casa de vegetação, houve correlação positiva para o tratamento 0,5 TZ 2 h. O teste de tetrazólio permitiu a classificação dos lotes em quatro níveis de viabilidade, confirmando a eficiência do teste na avaliação da viabilidade de sementes de goiabeira-serrana.Brazilian guava, native fruit tree from Southern Brazil, has become relevant due to its potencial use as ecological and comercial. This article aims evaluate the physiological quality of Brazilian guava seeds by tetrazolium test. The work was divided in two parts. In the first, both lots were submitted to the germination test, index of speed germination, mean time of germination, emergency of seedlings in greenhouse, mean time of emergency and shoot length of seedlings. In the second part it was performed the tetrazolium test. Two concentrations of tetrazolium were used (0,5 e 1,0 and two times of imbibition (2 h e 4 h. To the lot 2007, the treatment 0,5 TZ 4 h obtained 73% of viable seeds

  7. Caracterização genética de populações naturais de goiabeira serrana (Acca sellowiana com marcadores microssatélites heterólogos

    Directory of Open Access Journals (Sweden)

    Karine Louise dos Santos

    2011-08-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2011v24n4p75 A goiabeira serra Acca sellowiana é uma espécie nativa do sul do Brasil e nordestete do Uruguai e devido ao sabor único de seus frutos apresenta-se como alternativa de renda para pequenos agricultores. O conhecimento da diversidade genética se constitui em uma importante ferramenta para o melhoramento genético e conservação. Com intuito de ampliar o conhecimento a respeito da diversidade genética da espécie, foi caracterizada a diversidade genética de cinco populações naturais de A. sellowiana, com o uso de iniciadores microssatélites desenvolvidos para o complexo Eucalyptus grandis W. Hill ex Maiden x E. urophylla S.T. Blake. Com a utilização de 10 pares de iniciadores selecionados, 122 plantas foram caracterizadas. Os valores médios para heterozigosidade esperada e observada foram de 0,42 e 0,47, respectivamente. Os valores estimados para  não diferiram de zero para quatro das cinco populações avaliadas, sugerindo baixo efeito de endogamia. Adicionalmente, foi observada incidência de alelos raros e divergência genética, sugerindo que estratégias de conservação considerem a manutenção de diferentes populações com objetivo de conservar a espécie.

  8. Variação fenotípica em plantas de duas famílias de meios-irmãos de goiabeira-serrana (Acca sellowiana Berg. em um pomar comercial em São Joaquim-SC Plant phenotypic variation of two half sib families of feijoa (Acca sellowiana Berg. from an orchard in São Joaquim, SC

    Directory of Open Access Journals (Sweden)

    Juliana Degenhardt

    2005-12-01

    Full Text Available A goiabeira-serrana (Acca sellowiana Berg. é uma mirtácea nativa do planalto meridional brasileiro, com dispersão secundária no Uruguai, e produz um fruto de sabor único. Plantas de um pomar comercial composto por duas famílias de meios-irmãos (FMI1 e FMI2 foram avaliadas, com o objetivo principal de analisar a variabilidade fenotípica de várias características. As médias (± desvio-padrão obtidas para as características avaliadas, no ano de 2000, foram: produtividade (29,2±35,0 e 55,1±53,4 frutos por planta; altura (2,2±0,7 m e 2,7±0,8 m; diâmetro de copa (1,9±0,7 m e 2,1±0,7 m; número de ramificações a 20 cm do solo (2,4±1,5 e 1,6±1,2 e distância entre o estigma e as anteras na flor (0,5±0,2 cm e 0,2±0,2 cm, para as plantas da FMI1 e da FMI2, respectivamente. As avaliações revelaram diferenças estatisticamente significativas entre as duas famílias para as características avaliadas, com exceção de diâmetro de copa. As correlações entre características vegetativas não foram estatisticamente significativas, com exceção da correlação entre a altura e a distância entre estigma e anteras (r=-0,53 para a FMI1, no ano de 2000. As regressões não foram significativas, com exceção da regressão entre altura e produtividade na FMI1, em 1998, e entre a produtividade e a distância entre estigma e anteras na FMI2, em 2000. Porém, todas apresentaram coeficientes de determinação inferiores a 0,15.Feijoa (Acca sellowiana Berg. is a native Myrtaceae of the Brazilian Southern plateau with secondary dispersion in Uruguay and its fruit has a unique flavor. Plants of a commercial orchard of this species originated by two half-sib families (FMI1 and FMI2 were evaluated, with the objective to characterize the phenotypic variation of several traits. The means (±standard deviation of the evaluated traits, obtained in 2000 were: productivity (29.2±35.0 and 55.1±53.4 fruits per plant; height (2.2±0.7 m and 2.7±0

  9. Transference of microsatellite markers from Eucalyptus spp to Acca sellowiana and the successful use of this technique in genetic characterization

    Directory of Open Access Journals (Sweden)

    Karine Louise dos Santos

    2007-01-01

    Full Text Available The pineapple guava (Acca sellowiana, known in portuguese as the goiabeira-serrana or "Feijoa", is a native fruit tree from southern Brazil and northern Uruguay that has commercial potential due to the quality and unique flavor of its fruits. Knowledge of genetic variability is an important tool in various steps of a breeding program, which can be facilitated by the use of molecular markers. The conservation of repeated sequences among related species permits the transferability of microsatellite markers from Eucalyptus spp. to A. sellowiana for testing. We used primers developed for Eucalyptus to characterize A. sellowiana accessions. Out of 404 primers tested, 180 amplified visible products and 38 were polymorphic. A total of 48 alleles were detected with ten Eucalyptus primer pairs against DNA from 119 A. sellowiana accessions. The mean expected heterozygosity among accessions was 0.64 and the mean observed heterozygosity 0.55. A high level of genetic diversity was also observed in the dendrogram, where the degree of genetic dissimilarity ranged from 0 to 65% among the 119 genotypes tested. This study demonstrates the possibility of transferring microsatellite markers between species of different genera in addition to evaluating the extent of genetic variability among plant accessions.

  10. Qualidade e potencial de conservação pós-colheita dos frutos em cultivares brasileiras de goiabeira-serrana

    Directory of Open Access Journals (Sweden)

    Cassandro Vidal Talamini do Amarante

    2013-12-01

    Full Text Available Foi avaliada a manutenção da qualidade pós-colheita dos frutos em cultivares brasileiras de goiabeira-serrana. Frutos das cultivares Alcântara, Helena, Mattos e Nonante foram colhidos na maturação comercial, no município de São Joaquim-SC, e armazenados a 4±1 ºC (90±5% UR, durante 21 dias, seguido de 8 e 48 h a 23±1 ºC (75±5% UR. Foram avaliadas a composição mineral (N, K, Mg e Ca na colheita e a qualidade dos frutos na colheita e após o armazenamento. Frutos da cultivar Nonante apresentaram na colheita maiores valores de acidez titulável (AT pH e de atributos de textura, e menores valores de pH e da relação sólidos solúveis/acidez titulável (SS/AT, sendo que, após o armazenamento refrigerado, este comportamento foi reduzido, com menores diferenças em relação às demais cultivares. Frutos de 'Nonante' apresentaram também maiores teores de K na casca e polpa, e menores teores de N na polpa e, após o armazenamento refrigerado, cor verde menos intensa na casca e menor escurecimento de polpa. Em relação aos dados de colheita, após o armazenamento refrigerado, houve maior redução na AT (41% do que no teor de SS (8,6%, o que ocasionou acentuado aumento na relação SS/AT (52,5%, considerando valores médios das quatro cultivares. Isto evidencia que, em goiaba-serrana, os ácidos orgânicos representam o principal substrato respiratório durante o armazenamento, o que compromete a qualidade sensorial pelo aumento na relação SS/AT. Frutos de 'Alcântara' foram também avaliados quanto aos efeitos do dano mecânico na colheita e do retardo no armazenamento refrigerado, na qualidade após o armazenamento. O dano mecânico na colheita (dano por queda, a uma altura de 50 cm, sobre uma superfície rígida ocasionou mínimo comprometimento da qualidade após o armazenamento refrigerado. Frutos desta cultivar apresentaram redução na AT (31%, textura da periderme (33% e força para a compressão (13%, e aumento no pH (20% e

  11. O ARMAZENAMENTO REFRIGERADO PROLONGA A VIABILIDADE DE SEMENTES DE GOIABEIRA-SERRANA

    Directory of Open Access Journals (Sweden)

    JOEL DONAZZOLO

    2015-09-01

    Full Text Available RESUMO Este trabalho teve como objetivo avaliar a viabilidade e o vigor das sementes de dois genótipos de Acca sellowiana sob diferentes condições e tempos de armazenamento. As sementes foram obtidas a partir de duas plantas (G1 e G2 localizadas em quintais da área urbana de Vacaria-RS. O experimento foi realizado em esquema trifatorial (2 x 3 x 2, sendo duas condições de armazenamento (temperatura ambiente: 20-25ºC; e refrigerado: 4-8ºC, três períodos de armazenamento (zero, um e dois anos, e dois genótipos (G1 e G2, conduzidos em blocos casualizados, com quatro repetições de 50 sementes. As sementes foram postas para germinar sobre papel absorvente umedecido em caixas tipo “gerbox”, mantidas em câmara de crescimento com temperatura de 25 ± 2 °C e fotoperíodo de 16 h. Avaliaram-se o índice de velocidade de germinação, a porcentagem de germinação e o tempo médio de germinação, por meio da contagem de sementes germinadas a cada dois dias, por 44 dias após o início da germinação. Os genótipos apresentaram desempenhos significativamente diferentes na taxa germinativa e no vigor das sementes. Quando armazenadas em temperatura ambiente, as sementes perderam o poder germinativo drasticamente no primeiro ano e completamente no segundo ano. Conclui-se que é possível manter 80% de poder germinativo das sementes de Acca sellowiana por dois anos em armazenamento refrigerado (4 a 8 ºC.

  12. Efecto del nitrato de potasio, fosfato de potasio y ethephon en la inducción floral de la feijoa o goiabeira serrana (Acca sellowiana [O. Berg] Burret Effect of potassium nitrate, potassium phosphate and ethephon in floral induction of pineapple guava (Acca sellowiana [O. Berg] Burret

    Directory of Open Access Journals (Sweden)

    Oskar Javier Garcia

    2008-09-01

    Full Text Available El ensayo se llevó a cabo en la finca El Cortijo (La Vega, Cundinamarca, Colombia [04°55'N y 74°18'W], 2350 m altitud, 17°C temperatura media, 1423 mm precipitación anual, 85% humedad relativa, 1377 horas brillo solar/año. Se utilizaron árboles de feijoa o goiabeira serrana de seis años, Clon 41 ('Quimba', evaluando fertilizantes foliares KNO3 (Nitrato de Potasio 13-0-46® 1%, 1,5% y 2% y KH2PO4 (fosfato de potasio; Cosmofoliar 0-32-43®; 0,5%, 0,75% y 1,0% y la fitohormona ethephon (Ethrel® 48 SL; 100, 150 y 200 mg L-1. Se determinaron el número de botones florales inducidos, flores formadas, además, el porcentaje de flores formadas y nivel de eficacia de los productos inductores. El KH2PO4 al 0,5% obtuvo resultados favorables en cada una de las variables evaluadas, comparado con el 0,75% y 1% del mismo producto y, sin embargo hubo un alto número de flores inducidas y formadas, no se presentaron diferencias significativas con el testigo. Ethephon a 150 mg L-1 en la inducción de botones florales y a 100 mg L-1 en la de formación de flores mostró resultados favorables, pero tampoco pudo superar el testigo por falta de significancia. La respuesta generada por KNO3 mostró una baja inducción de botones florales, y una eficacia negativa en la proporción de flores formadas; asimismo fitotoxicidad, cuando se emplearon concentraciones al 2% de este producto.The experiment was carried out in El Cortijo farm (La Vega, Cundinamarca, Colombia [ 04° 55' N and 74° 18' W ], 2350 m above sea level, 17° C average temperature, 1423 mm of annual precipitation, 85% of relative humidity, and 1.377 of sunshine hours/year. In the study, evaluation of foliar fertilizers KNO3 (potassium nitrate 13-0-46® 1%, 1.5%, and 2%, KH2PO4 (potassium phosphate; Cosmofoliar 0-32-43®; 0.5%, 0.75%, and 1.0%, and ethephon phytohormone (Ethrel® 48 SL; 100, 150, and 200 mg L-1 was done on six year old pineapple guava trees of Clone 41 ('Quimba'. The number of

  13. Efeito do fósforo no desenvolvimento inicial de mudas de goiabeira serrana Effect of phosphorus on the initial development of feijoa seedlings

    Directory of Open Access Journals (Sweden)

    J.C. Nachtigal

    1994-08-01

    Full Text Available Foi estudado o efeito da adubação fosfatada no desenvolvimento inicial de mudas de goiabeira serrana (Feijoa sellowiana Berg. num experimento em vasos, com solo Podzólico Vermelho Amarelo, apresentando 4 ppm de P extraível pelo método de Mehlich. Os níveis de fósforo utilizados foram 0, 50, 100 e 150 ppm de P, aplicados antes da instalação do experimento, juntamente com 150 ppm de K. Em cobertura, foram aplicados 150 ppm de N, em três parcelas iguais aos 7, 27 e 47 dias após a repicagem das mudas. Plântulas oriundas de sementes de plantas nativas, com aproximadamente 30 dias, foram transplantadas para os vasos e cultivadas durante 89 dias. Houve efeito significativo do P sobre todas as variáveis analisadas. A altura das plantas mostrou um comportamento similar à curva clássica do crescimento, mas os incrementos obtidos a cada avaliação aumentaram com os níveis de P. A matéria seca das raízes e da parte aérea, bem como as quantidades extraídas de N, P e K aumentaram linearmente com os níveis de P. O teor de P no tecido aumentou até o nível de 50 ppm de P aplicado, permanecendo estável nos níveis maiores, enquanto os de N e K diminuiram nos níveis acima de 50 ppm de P. Os resultados obtidos permitem verificar a elevada exigência de fósforo desta espécie no período inicial de crescimento.The effect of phosphate fertilization on the initial development of feijoa (Feyoa sellowiana Berg. seedlings was studied in a pot experiment with a Red Yellow Podzolk soil having 4 ppm of extractable phosporous by the Mehlich method. Levels of phosphorous of 0, 50, 100 and 150 ppm together with 150 ppm of K were applied as a basal dressing. In three equal portions 150 ppm of N were applied at 7, 27 and 42 days after the transplant of the seedlings. Seedlings of native plants, with 30 days approximately, were transplanted to pots and cultivated during 89 days. There was a significant effect of phosphorous on all analised variables

  14. Detecção de Fungos em Sementes de Acca sellowiana (Berg Burret

    Directory of Open Access Journals (Sweden)

    Vinícius Spolaor Fantinel

    2017-08-01

    Full Text Available RESUMO Acca sellowiana é uma espécie frutífera nativa da Região Sul do Brasil que está despertando grande interesse econômico devido ao alto potencial organoléptico de seus frutos. A principal forma de propagação da espécie é via sexuada. Objetivando determinar a qualidade sanitária das sementes, foram comparadas três formas de detecção de fungos, com ou sem a assepsia superficial, em sementes oriundas de quatro municípios do Estado do Rio Grande do Sul e de três municípios do Estado de Santa Catarina. Foram testados os meios de cultura Batata-Dextrose-Ágar (BDA, V8 (suco de tomate e o método Blotter Test. Foram identificados os seguintes fungos: Aspergillus niger, Aspergillus flavus, Penicillium sp., Colletotrichum gloeosporioides, Fusarium sp., Curvularia sp., Alternaria sp., Trichoderma sp., Epicoccum sp. e Phomopsis sp. Os meios agarizados são mais sensíveis na detecção de fungos em sementes de goiaba serrana. A assepsia das sementes reduz a incidência de fungos infestantes.

  15. ACCA College English Teaching Mode

    Science.gov (United States)

    Ding, Renlun

    2008-01-01

    This paper elucidates a new college English teaching mode--"ACCA" (Autonomous Cooperative Class-teaching All-round College English Teaching Mode). Integrated theories such as autonomous learning and cooperative learning into one teaching mode, "ACCA", which is being developed and advanced in practice as well, is the achievement…

  16. Abnormal centromere-chromatid apposition (ACCA) and Peters' anomaly.

    Science.gov (United States)

    Wertelecki, W; Dev, V G; Superneau, D W

    1985-08-01

    Abnormal centromere-chromatid apposition (ACCA) was noted in a patient with Peters' anomaly. Previous reports of ACCA emphasized its association with tetraphocomelia and other congenital malformations (Roberts, SC Phocomelia, Pseudothalidomide Syndromes). This report expands the array of congenital malformations associated with ACCA and emphasizes the diagnostic importance of ocular defects for the ascertainment of additional cases of ACCA and its possible relationship with abnormal cell division.

  17. PersPectives du Programme acca

    International Development Research Centre (IDRC) Digital Library (Canada)

    à acca@crdi.ca. À propos du programme ACCA. Lancé en 2006, le programme Adaptation aux changements ... Nous pourrions y ajouter, par soucis d'équilibre, les « connus inconnus », c'est- à-dire les connaissances que nous ne ...... marocain m'a déjà dit ceci : « Je comprends vos préoccupations, mais mes questions ...

  18. Marcha de absorção dos micronutrientes para mudas de goiabeiras cultivares Paluma e Século XXI

    OpenAIRE

    Franco,Claudenir Facincani; Prado,Renato de Mello; Braghirolli,Luiz Fernando; Rozane,Danilo Eduardo

    2008-01-01

    O conhecimento da marcha de absorção dos micronutrientes em mudas de goiabeira garante melhor eficiência da adubação. O objetivo do trabalho foi determinar a marcha de absorção de micronutrientes em mudas de duas cultivares de goiabeira. O delineamento experimental utilizado foi em parcelas subdivididas com três repetições. Assim, foram utilizadas como tratamentos principais duas cultivares de goiabeira (Paluma e Século XXI) obtidas por estacas herbáceas e como subparcelas, sete coletas de pl...

  19. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  20. ACCA phosphopeptide recognition by the BRCT repeats of BRCA1.

    Science.gov (United States)

    Ray, Hind; Moreau, Karen; Dizin, Eva; Callebaut, Isabelle; Venezia, Nicole Dalla

    2006-06-16

    The tumour suppressor gene BRCA1 encodes a 220 kDa protein that participates in multiple cellular processes. The BRCA1 protein contains a tandem of two BRCT repeats at its carboxy-terminal region. The majority of disease-associated BRCA1 mutations affect this region and provide to the BRCT repeats a central role in the BRCA1 tumour suppressor function. The BRCT repeats have been shown to mediate phospho-dependant protein-protein interactions. They recognize phosphorylated peptides using a recognition groove that spans both BRCT repeats. We previously identified an interaction between the tandem of BRCA1 BRCT repeats and ACCA, which was disrupted by germ line BRCA1 mutations that affect the BRCT repeats. We recently showed that BRCA1 modulates ACCA activity through its phospho-dependent binding to ACCA. To delineate the region of ACCA that is crucial for the regulation of its activity by BRCA1, we searched for potential phosphorylation sites in the ACCA sequence that might be recognized by the BRCA1 BRCT repeats. Using sequence analysis and structure modelling, we proposed the Ser1263 residue as the most favourable candidate among six residues, for recognition by the BRCA1 BRCT repeats. Using experimental approaches, such as GST pull-down assay with Bosc cells, we clearly showed that phosphorylation of only Ser1263 was essential for the interaction of ACCA with the BRCT repeats. We finally demonstrated by immunoprecipitation of ACCA in cells, that the whole BRCA1 protein interacts with ACCA when phosphorylated on Ser1263.

  1. A Estratégia em Relacionamentos Coopetitivos: um estudo do arranjo produtivo de Nova SerranaStrategy and Coopetitive Relationships: the case of Nova Serrana clusterLa Estrategia en las Relaciones Coopetitivas: el caso del cluster de Nova Serrana

    Directory of Open Access Journals (Sweden)

    LEITE, Ramon Silva

    2009-03-01

    Full Text Available RESUMOTradicionalmente, a literatura gerencial aborda os efeitos de relacionamentos competitivos ou colaborativos na estratégia organizacional. Entretanto, recentemente, verifica-se o crescimento de uma terceira abordagem, na qual um mesmo relacionamento pode integrar rivalidade e parceria entre concorrentes. Este estudo tem por finalidade fornecer subsídios para essa discussão. Para isso, foi adotado um delineamento qualitativo de pesquisa, no qual foram entrevistados os empresários do arranjo produtivo calçadista de Nova Serrana. Com isso, foram identificados os aspectos que levam as empresas da cidade a adotarem uma postura colaborativa ou competitiva em seus relacionamentos.ABSTRACTTraditionally, the management literature discusses the effects of competitive or collaborative relationships in organizational strategy. However, recently a third approach has emerged, in which a single relationship is seem as a variable that can integrate collaboration and rivalry between competitors. This study aims to provide subsidies for this discussion. For this, a qualitative design was adopted; in which businessmen of the city of Nova Serrana were interviewed. The results indicate that the decision of collaborate or compete is dependent on a set of factors.RESUMENTradicionalmente, la literatura de gestión la analiza los efectos de la competencia o de relaciones de colaboración en las estrategias de la organización. Sin embargo, recientemente, un tercer enfoque ha surgido, en el que una sola relación se parece como una variable que puede integrar la colaboración y la rivalidad entre competidores. Este estudio tiene como objetivo proporcionar subsidios para este debate. Por ello, se adoptó un diseño cualitativo en el que los hombres de negocios de la ciudad de Nova Serrana fueron entrevistados. Los resultados indican que la decisión de colaborar o competir depende de una serie de factores.

  2. Moscas frugívoras e seus parasitoides nos municípios de Pelotas e Capão do Leão, Rio Grande do Sul, Brasil Frugivorous flies and their parasitoids in the cities of Pelotas and Capão do Leão, Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes

    2012-01-01

    Full Text Available As moscas frugívoras (Tephritoidea são as principais pragas da fruticultura de clima temperado no Brasil. O objetivo do presente trabalho foi avaliar a infestação desses dípteros e a ocorrência de seus parasitoides em frutíferas nos municípios de Pelotas e Capão do Leão, localizados na região Sul, nas safras agrícolas de 2007/08 e 2008/09. Foram coletados frutos de araçazeiro-amarelo e vermelho (Psidium cattleianum Sabine, 1821, butiazeiro [Butia capitata (Mart. Becc., 1916], caquizeiro (Diospyros kaki Linnaeus, 1753, cerejeira-do-mato (Eugenia involucrata DC., 1828, goiabeira [Psidium guajava (Linnaeus, 1753], goiabeira-serrana [Acca sellowiana (Berg. Burret, 1941], nespereira [Eriobotrya japonica (Thunb. Lindley, 1822], pessegueiro [Prunus persicae (L. Batsch, 1801], pitangueira (Eugenia uniflora Linnaeus,1753 e uvalheira (Eugenia pyriformis Cambessèdes, 1832. Os frutos foram coletados e transportados para o laboratório, onde foram individualizados e determinados os seguintes parâmetros: índice de infestação das moscas, índice de parasitismo e frequência de indivíduos por espécie de parasitoide. Foram constatadas duas espécies de Tephritidae, Anastrepha fraterculus (Wiedemann, 1830 (90,5% e Ceratitis capitata (Wiedemann, 1824 (9,5% e duas de Lonchaeidae, Neosilba zadolicha McAlpine & Steyskal, 1982 (87,8% e uma espécie ainda não descrita, referida como Neosilba n. sp. 3 (12,2%. Anastrepha fraterculus é a espécie mais abundante nos dois municípios, sendo constatada na maioria das frutíferas coletadas. Caquizeiro e goiabeira foram os hospedeiros que apresentaram o maior índice de infestação por C. capitata. Quanto às espécies de Neosilba, a maior infestação ocorreu em frutos de goiabeira-serrana. Dos parasitoides emergidos, foram identificadas três espécies, sendo duas de Braconidae, Doryctobracon areolatus (Szépligeti, 1911 (52,6% e Opius bellus (Gahan, 1930 (27,5% e uma espécie de Figitidae, Aganaspis

  3. Resposta de mudas de goiabeira à aplicação de zinco

    Directory of Open Access Journals (Sweden)

    Natale William

    2002-01-01

    Full Text Available O subsolo, normalmente utilizado para produção de mudas de frutíferas, apresenta baixa concentração de zinco e, assim, existe grande probabilidade de resposta à aplicação deste micronutriente. Considerando a falta de informações sobre o assunto, procurou-se avaliar o efeito da aplicação de zinco ao substrato de produção das mudas de goiabeira e acompanhar os efeitos no desenvolvimento, na produção de matéria seca e no estado nutricional das plantas. O delineamento experimental foi em blocos ao acaso, com cinco tratamentos e cinco repetições. As doses de zinco, na forma de sulfato de zinco, foram: 0; 2; 4; 6 e 8 mg dm-3 de Zn. No plantio, as mudas receberam doses de N, P, K e B de 300; 100; 150 e 0,5 mg dm-3, respectivamente. O experimento foi conduzido em viveiro telado, em vasos com 2,8 dm³ de substrato de um Argissolo Vermelho-Amarelo. Após 135 dias do plantio, avaliaram-se: a altura, a área foliar e a matéria seca da parte aérea e das raízes, bem como os teores de macronutrientes e de Zn. As mudas de goiabeira responderam positivamente à aplicação de zinco. O maior desenvolvimento das mudas esteve associado à dose de 2 mg dm-3 de Zn. Doses iguais ou superiores a 4 mg dm-3 causaram redução significativa no desenvolvimento e no acúmulo de macronutrientes nas mudas de goiabeira.

  4. Diagnosis and evaluation of the environmental interference in the nascent and streams due to the passing of the Bolivia-Mato Grosso pipeline in the Serrana Province; Diagnostico e avaliacao das interferencias ambientais nas nascentes e corregos da Provincia Serrana, decorrentes da passagem do gasoduto Bolivia-Mato Grosso

    Energy Technology Data Exchange (ETDEWEB)

    Durao, Alaide M. [Universidade Estadual de Mato Grosso, Cuiaba, MT (Brazil); Durao, Claudia V.M. [Bio-Geo Consultoria Ambiental, Belo Horizonte, MG (Brazil)

    2003-07-01

    The investigated area involves the Pipeline Row of Bolivia Mato-Grosso, inserted in the South-center of The Serrana Province (Almeida, 1964). The south-center section of Serrana Province is a water divisor from those that leaks west directly to Paraguay River from the waters that leaks on the east side to Pantanal. This work has as main subject, to diagnose and to value the environmental impacts that occurred and can occur in the future on the brooks and springs where there were Pipeline Bolivia Mato-Grosso interference on its crossing at the Serrana area, in Caceres municipality. The springs monitor were done during 18 months (march, 2001 to September, 2001), during and after the ending of the works, including different climates and hydrologic conditions, making it possible to diagnose and to value the draining behavior on the drought and on the overflow epoch. So, we believe that the knowledge about the interferences, risks and alterations that reflects on the fluvial duct of the sub-basin that drains the Serrana Province and leaks to Paraguay River may be contributing indirectly or directly to the Pantanal conservation. (author)

  5. A indústria de calçados de Nova Serrana (MG

    Directory of Open Access Journals (Sweden)

    Wilson Suzigan

    2005-12-01

    Full Text Available On the basis of previous statistical work with data and information from RAIS - Relação Anual de Informações Sociais, characterizing the Nova Serrana shoe industry as a local production system, and the results of a field research work with visits and interviews in local firms and institutions, this paper studies the Nova Serrana local production system as a whole as well as its firms and supporting institutions. The objective is to bring empirical evidence to guide public policy and private actions with a view to upgrade the local system in two spheres: (1 productive and technological, and (2 institutional and organizational. With this purpose in mind, this paper first characterizes and describes the local system in terms of location, adjoining influenced areas, logistics, population and number of jobs, history and evolution, production structure, supporting institutions, and social, cultural and political contexts. Next, the paper characterizes local firms in terms of size, product development, trading system, cooperation between rival firms, interactions with suppliers, sources of information for product development and on market trends and production technologies, practices and policies with regard to quality, financing, and other aspects. Finally, the paper summarizes the most relevant issues for policy measures and private actions by local firms and institutions.

  6. Abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Li; Wang, Feng-Ping; Jiang, Hong-Chen; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Li, Wen-Jun

    2013-09-01

    It has been suggested that archaea carrying the accA gene, encoding the alpha subunit of the acetyl CoA carboxylase, autotrophically fix CO2 using the 3-hydroxypropionate/4-hydroxybutyrate pathway in low-temperature environments (e.g., soils, oceans). However, little new information has come to light regarding the occurrence of archaeal accA genes in high-temperature ecosystems. In this study, we investigated the abundance and diversity of archaeal accA gene in hot springs in Yunnan Province, China, using DNA- and RNA-based phylogenetic analyses and quantitative polymerase chain reaction. The results showed that archaeal accA genes were present and expressed in the investigated Yunnan hot springs with a wide range of temperatures (66-96 °C) and pH (4.3-9.0). The majority of the amplified archaeal accA gene sequences were affiliated with the ThAOA/HWCG III [thermophilic ammonia-oxidizing archaea (AOA)/hot water crenarchaeotic group III]. The archaeal accA gene abundance was very close to that of AOA amoA gene, encoding the alpha subunit of ammonia monooxygenase. These data suggest that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  7. An Automated Cropland Classification Algorithm (ACCA) for Tajikistan by combining Landsat, MODIS, and secondary data

    Science.gov (United States)

    Thenkabail, Prasad S.; Wu, Zhuoting

    2012-01-01

    The overarching goal of this research was to develop and demonstrate an automated Cropland Classification Algorithm (ACCA) that will rapidly, routinely, and accurately classify agricultural cropland extent, areas, and characteristics (e.g., irrigated vs. rainfed) over large areas such as a country or a region through combination of multi-sensor remote sensing and secondary data. In this research, a rule-based ACCA was conceptualized, developed, and demonstrated for the country of Tajikistan using mega file data cubes (MFDCs) involving data from Landsat Global Land Survey (GLS), Landsat Enhanced Thematic Mapper Plus (ETM+) 30 m, Moderate Resolution Imaging Spectroradiometer (MODIS) 250 m time-series, a suite of secondary data (e.g., elevation, slope, precipitation, temperature), and in situ data. First, the process involved producing an accurate reference (or truth) cropland layer (TCL), consisting of cropland extent, areas, and irrigated vs. rainfed cropland areas, for the entire country of Tajikistan based on MFDC of year 2005 (MFDC2005). The methods involved in producing TCL included using ISOCLASS clustering, Tasseled Cap bi-spectral plots, spectro-temporal characteristics from MODIS 250 m monthly normalized difference vegetation index (NDVI) maximum value composites (MVC) time-series, and textural characteristics of higher resolution imagery. The TCL statistics accurately matched with the national statistics of Tajikistan for irrigated and rainfed croplands, where about 70% of croplands were irrigated and the rest rainfed. Second, a rule-based ACCA was developed to replicate the TCL accurately (~80% producer’s and user’s accuracies or within 20% quantity disagreement involving about 10 million Landsat 30 m sized cropland pixels of Tajikistan). Development of ACCA was an iterative process involving series of rules that are coded, refined, tweaked, and re-coded till ACCA derived croplands (ACLs) match accurately with TCLs. Third, the ACCA derived cropland

  8. An Automated Cropland Classification Algorithm (ACCA for Tajikistan by Combining Landsat, MODIS, and Secondary Data

    Directory of Open Access Journals (Sweden)

    Prasad S. Thenkabail

    2012-09-01

    Full Text Available The overarching goal of this research was to develop and demonstrate an automated Cropland Classification Algorithm (ACCA that will rapidly, routinely, and accurately classify agricultural cropland extent, areas, and characteristics (e.g., irrigated vs. rainfed over large areas such as a country or a region through combination of multi-sensor remote sensing and secondary data. In this research, a rule-based ACCA was conceptualized, developed, and demonstrated for the country of Tajikistan using mega file data cubes (MFDCs involving data from Landsat Global Land Survey (GLS, Landsat Enhanced Thematic Mapper Plus (ETM+ 30 m, Moderate Resolution Imaging Spectroradiometer (MODIS 250 m time-series, a suite of secondary data (e.g., elevation, slope, precipitation, temperature, and in situ data. First, the process involved producing an accurate reference (or truth cropland layer (TCL, consisting of cropland extent, areas, and irrigated vs. rainfed cropland areas, for the entire country of Tajikistan based on MFDC of year 2005 (MFDC2005. The methods involved in producing TCL included using ISOCLASS clustering, Tasseled Cap bi-spectral plots, spectro-temporal characteristics from MODIS 250 m monthly normalized difference vegetation index (NDVI maximum value composites (MVC time-series, and textural characteristics of higher resolution imagery. The TCL statistics accurately matched with the national statistics of Tajikistan for irrigated and rainfed croplands, where about 70% of croplands were irrigated and the rest rainfed. Second, a rule-based ACCA was developed to replicate the TCL accurately (~80% producer’s and user’s accuracies or within 20% quantity disagreement involving about 10 million Landsat 30 m sized cropland pixels of Tajikistan. Development of ACCA was an iterative process involving series of rules that are coded, refined, tweaked, and re-coded till ACCA derived croplands (ACLs match accurately with TCLs. Third, the ACCA derived

  9. Tratamiento con progestágenos y ECG tras el parto en cabras de la raza Serrana – ecótipo Transmontano

    OpenAIRE

    Valentim, Ramiro; Azevedo, Jorge Manuel Teixeira de; Correia, Teresa Montenegro; Almeida, José Carlos; Fontes, Paulo J.; Galvão, Lurdes; Maurício, Raimundo; Coelho, Alípio

    2003-01-01

    El principal objetivo de este trabajo fue estudiar la eficacia de la utilización del tratamiento – FGA + eCG – en la retoma de la actividad ovárica postparto en cabras de la raza portuguesa Serrana, ecótipo Transmontano, paridas a final de la estación reproductiva. Para el efecto, en la ciudad de Bragança (latitud 41° 49' N, longitud 6° 40' W y altitud 720 metros), 30 cabras (2-6 años) de la raza portuguesa Serrana, ecótipo Transmontano, apareadas por monta natural y que parieron sin ningún p...

  10. Biocatalytic Asymmetric Synthesis of (1R, 2S)-N-Boc-vinyl-ACCA Ethyl Ester with a Newly Isolated Sphingomonas aquatilis.

    Science.gov (United States)

    Zhu, Shaozhou; Shi, Ying; Zhang, Xinyu; Zheng, Guojun

    2018-02-01

    1-amino cyclopropane-1-carboxylic acid (ACCA) and its derivatives are essential pharmacophoric unit that widely used in drug research and development. Specifically, (1R, 2S)-N-Boc-vinyl-ACCA ethyl ester (vinyl-ACCA) is a key chiral intermediate in the synthesis of highly potent hepatitis C virus (HCV) NS3/4A protease inhibitors such as asunaprevir and simeprevir. Developing strategies for the asymmetric synthesis of vinyl-ACCA is thus extremely high demand. In this study, 378 bacterial strains were isolated from soil samples using N-Boc-vinyl-ACCA ethyl ester as the sole carbon source and were screened for esterase activity. Fourteen of which worked effectively for the asymmetric synthesis of (1R, 2S)-N-Boc-1-vinyl ACCA ethyl ester. The strain CY-2, identified as Sphingomonas aquatilis, which showed the highest stability and enantioselectivity was selected as whole cell biocatalyst for further study. A systematic study of all factors influencing the enzymatic hydrolysis was performed. Under optimized conditions, resolution of rac-vinyl-ACCA to (1R, 2S)-N-Boc-1-vinyl ACCA ethyl ester with 88.2% ee and 62.4% conversion (E = 9) was achieved. Besides, S. aquatilis was also used to transform other 10 different substrates. Notably, it was found that 7 of them could be stereoselectively hydrolyzed, especially for (1R,2S)-1-amino-vinyl-ACCA ethyl ester hydrochloride (99.6% ee, E>200). Our investigations provide a new efficient whole cell biocatalyst for resolution of ACCA and might be developed for industry application.

  11. Antibody class capture assay (ACCA) for rubella-specific IgM antibody.

    Science.gov (United States)

    Isaac, M; Payne, R A

    1982-01-01

    Enzyme-linked immunosorbent assays for IgM antirubella were carried out on 1,546 sera, using an IgM capture method with a F (ab')2 conjugate (ACCA). Under the conditions described, sera containing IgM antirubella bound up to 15 times as much enzyme activity as negative specimens. Paired serum specimens from 27 patients, serial serum specimens from 6 patients, and single serum specimens from 15 patients who had had recent rubella were examined by the haemagglutination inhibition test (HAI) in the presence and absence of 2-mercaptoethanol following sucrose density gradient centrifugation (SDGC). ACCA confirmed all the results found with HAI following SDGC. Specimens were examined from ten patients with congenital rubella; ACCA confirmed the results found with both immunofluorescence following SDGC and radioimmunoassay. Pre- and post-vaccination specimens from 123 patients who had been vaccinated against rubella were examined. An IgM response could only be demonstrated in the 57 cases when IgG was absent in the first specimen. The specificity of the assay was confirmed by testing 31 serum specimens from rubella immune patients that also contained rheumatoid factor, 163 serum specimens from patients with acute infections other than rubella, and 12 serum specimens from infants with miscellaneous neonatal abnormalities other than congenital rubella. The ACCA proved a simple, sensitive, and specific test for IgM antirubella and the results compared favourably with those obtained by the SDGC technique.

  12. [Cloning, expression and transcriptional analysis of biotin carboxyl carrier protein gene (accA) from Amycolatopsis mediterranei U32 ].

    Science.gov (United States)

    Lu, Jie; Yao, Yufeng; Jiang, Weihong; Jiao, Ruishen

    2003-02-01

    Acetyl CoA carboxylase (EC 6.4.1.2, ACC) catalyzes the ATP-dependent carboxylation of acetyl CoA to yield malonyl CoA, which is the first committed step in fatty acid synthesis. A pair of degenerate PCR primers were designed according to the conserved amino acid sequence of AccA from M. tuberculosis and S. coelicolor. The product of the PCR amplification, a DNA fragment of 250bp was used as a probe for screening the U32 genomic cosmid library and its gene, accA, coding the biotinylated protein subunit of acetyl CoA carboxylase, was successfully cloned from U32. The accA ORF encodes a 598-amino-acid protein with the calculated molecular mass of 63.7kD, with 70.1% of G + C content. A typical Streptomyces RBS sequence, AGGAGG, was found at the - 6 position upstream of the start codon GTG. Analysis of the deduced amino acid sequence showed the presence of biotin-binding site and putative ATP-bicarbonate interaction region, which suggested the U32 AccA may act as a biotin carboxylase as well as a biotin carrier protein. Gene accA was then cloned into the pET28 (b) vector and expressed solubly in E. coli BL21 (DE3) by 0.1 mmol/L IPTG induction. Western blot confirmed the covalent binding of biotin with AccA. Northern blot analyzed transcriptional regulation of accA by 5 different nitrogen sources.

  13. Propuesta de descriptores para Acca sellowiana (Berg. Burret

    Directory of Open Access Journals (Sweden)

    María Puppo

    2014-12-01

    Full Text Available Guayabo del país o goiaba serrana [Acca sellowiana (Berg. Burret] es uno de los recursos fitogenéticos subutilizados más valiosos de Uruguay y Brasil. Este árbol de fruto comestible, es endémico de una estrecha región sudamericana que abarca el noreste uruguayo y sur de Brasil, donde su cultivo se limita al uso doméstico o a pequeños huertos comerciales. El uso de los materiales de la especie se ve limitado por el desconocimiento de la diversidad presente tanto en poblaciones naturales como en materiales cultivados. El objetivo de este trabajo fue la elaboración de una lista de descriptores que permita la caracterización y evaluación de los materiales para la conservación, uso sostenible e incorporación de diversidad en los programas de mejoramiento genético. Se elaboró una lista preliminar de 41 descriptores morfo-fenológicos de hoja, flor y fruto, que se aplicó in situ a 204 individuos pertenecientes a cuatro poblaciones silvestres del noreste del Uruguay. Con el método de Máxima Verosimilitud Restringida se estimaron los componentes de la varianza entre poblaciones (s²P, entre individuos dentro de poblaciones (s²I(P, entre muestras dentro de individuo (s²M(IP y sus intervalos de confianza utilizando un Modelo Lineal Mixto. Para la determinación del poder discriminante de las variables cuantitativas se adoptó como criterio estadístico la comparación de IC (límite inferior ICs²I(P>límite superior ICs²M(IP y se calculó la razón entre s²I(P/s²M(IP. Para las variables cualitativas se calculó el estadístico F para la determinación de las diferencias significativas entre individuos con el objetivo de identificar descriptores discriminantes de individuos. También se determinaron las variables que discriminan poblaciones. Se validaron siete descriptores cualitativos (forma de fruto, posición de los sépalos, color de pulpa, color interno de la cáscara, dureza de cáscara, clases de distancia estigma-estambres y

  14. Mutations that alter a repeated ACCA element located at the 5' end of the Potato virus X genome affect RNA accumulation.

    Science.gov (United States)

    Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung

    2008-08-15

    The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.

  15. Curva de crescimento e marcha de absorção de macronutrientes em mudas de goiabeira Growth and macronutrient uptake curves in guava seedling

    Directory of Open Access Journals (Sweden)

    Claudenir Facincani Franco

    2007-12-01

    Full Text Available A utilização de mudas de goiabeira com adequado estado nutricional determina o sucesso da implantação de um pomar. O objetivo deste trabalho foi determinar crescimento e acúmulo de macronutrientes em mudas de duas cultivares de goiabeira obtidas por estaquia herbácea. O delineamento utilizado foi o inteiramente casualizado, com parcelas subdivididas, com três repetições. Assim, foram utilizadas como parcelas duas cultivares de goiabeira (Paluma e Século XXI e, como subparcelas, sete coletas de plantas ao longo do período experimental (120 dias, em solução nutritiva. As plantas foram avaliadas quinzenalmente quanto a: altura, número de folhas, diâmetro do caule, área foliar e massa de matéria seca (folhas, caule e raízes. Nos diferentes órgãos das mudas, determinou-se o acúmulo de macronutrientes. Houve acúmulo quadrático de matéria seca das mudas de goiabeira com o tempo de cultivo. A muda de goiabeira da cultivar Século XXI tem maior exigência de macronutrientes que a da cultivar Paluma, e o período de maior exigência é a partir dos 75 e 45 dias, para ambas as cultivares. O acúmulo de macronutrientes pelas mudas de goiabeira das cultivares Paluma e Século XXI foi de: K (726 e 696, N (552 e 585, Ca (293 e 302, S (73 e 66, P (64 e 66 e Mg (39 e 41 mg por planta, respectivamente.The use of guava seedlings with adequate nutritional status determines the success of an orchard installation. This study was conducted to determine plant growth and macronutrient accumulation in herbaceous seedlings of two guava cultivars. The experiment was arranged in a completely randomized design in split-plots with three replications. Plots consisted of the two guava cultivars (Paluma and Século XXI in nutrient solution and the sub-plots were the seven sampling dates in a 120 day period. Plant height, number of leaves, stem diameter, leaf area and dry mass (leaves, stem and roots were determined biweekly. The accumulation of

  16. Uso de soluções nutritivas no desenvolvimento e no estado nutricional de mudas de goiabeira: macronutrientes =

    Directory of Open Access Journals (Sweden)

    Claudenir Facincani Franco

    2006-04-01

    Full Text Available O objetivo do trabalho foi estudar o efeito de diferentes soluções nutritivas sobre o desenvolvimento e o estado nutricional de mudas de goiabeira. Foram avaliadas 2 cultivares, Paluma e Século XXI, e 4 soluções nutritivas, em esquema fatorial (2x4 com 3 repetições. A cultivar Paluma apresentou maior eficiência nutricional, maiordesenvolvimento e maior produção de massa seca que a cultivar Século XXI. As mudas de goiabeira apresentam desenvolvimento e eficiência nutricional semelhantes nas diferentes soluções nutritivas estudadas. As soluções nutritivas promovem maior alteração no teor de nutrientes nas folhas comparando ao caule e às raízes, entretanto não é suficiente para alterar o desenvolvimento e a produção de massa seca das mudas de goiabeira.The objective of this study was to evaluate the effect of different nutritional solutions on development and concentration of nutrients in guava cuttings. Two cv., Paluma and Século XXI, and four nutritional solutions were evaluated, in factorial scheme (2x4 with three replications. The cv. Paluma was bigger nutritional efficient, development and production of dry matter than Século XXI. The concentration of Zn is great in cv. Século XXI. The guava cuttings have development and nutritional efficient similar in the different nutritional solutions. The nutritional solutions promoted greater alteration in the concentration of nutrients in leaves than in stem and roots. However, it is not enough to modify the development and the production of dry matter of the guava cuttings. The biggest concentration of micronutrients occurs in roots of guava cuttings.

  17. Body size, carcass and meat quality of three commercial beef categories of 'Serrana de Teruel' breed

    Energy Technology Data Exchange (ETDEWEB)

    Ripoll, G.; Albertí, P.; Alvarez-Rodríguez, J.; Blasco, I.; Sanz, A.

    2016-11-01

    The aim of this study was to analyse three commercial beef categories of the 'Serrana de Teruel breed' to define the appropriate commercial option. Twenty 'Serrana de Teruel' male calves at 9 months were assigned to the commercial beef categories (young bulls, bulls and steers), slaughtered at 12, 22 and 22 months of age, respectively. The in vivo ultrasound backfat thickness was greater than the dorsal fat thickness, and the young bulls and steers had a similar fat thickness, that was greater than the bulls in both areas. The slaughter weight and cold carcass weight were significantly different between the commercial categories. However, the differences were not sufficient to modify the dressing percentage, carcass conformation and fatness degree between the young bulls and bulls. The maximum stress of the muscle at 7 d of ageing was lower in the steers than in the young bulls and bulls. In general, the lightness of the meat in the bulls was lower than that in the young bulls and steers. The subcutaneous fat of the bull carcasses had a vivid colour and stored more carotenoids than that of the young bulls and steers. Hence, bulls produced heavier and better conformed carcasses with more edible meat and less fat than the other categories. However, steers are recommended to produce large carcasses with more trim and cover fat than the other categories. Finally, it seems that bulls are the most suitable commercial category to 'Serrana de Teruel' breed. (Author)

  18. Propagação de araçazeiro e goiabeira via miniestaquia de material juvenil

    Directory of Open Access Journals (Sweden)

    Jalille Amim Altoé

    2011-01-01

    Full Text Available Este trabalho foi realizado com o objetivo de avaliar a viabilidade da técnica de miniestaquia no enraizamento de material juvenil de araçazeiro (Psidium guineense e Psidium cattleyanum e goiabeira (Psidium guajava, e no crescimento das mudas após a repicagem e na produtividade das minicepas em sucessivas coletas. Foram instalados três experimentos em delineamento de blocos casualizados utilizando-se três espécies diferentes e quatro repetições. Sessenta e dois dias após o estaqueamento, verificou-se que em P. guineense, P. cattleyanum e P. guajava houve enraizamento de 96%; 92% e 100% respectivamente. Em P. guajava o diâmetro mínimo do caule era de oito milímetros aos 110 dias após a repicagem e em P. guineense e P. cattleyanum, o diâmetro do caule estava próximo a sete milímetros aos 140 dias após a repicagem. Foi verificado aumento do potencial de produção de miniestacas ao longo das sucessivas coletas de brotações. Com base nesses resultados, conclui-se que a técnica da miniestaquia é viável para multiplicação do araçazeiro e da goiabeira.

  19. Bioatividade de indutores de resistência no manejo da antracnose da goiabeira (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Rommel dos Santos Siqueira Gomes

    2016-06-01

    Full Text Available RESUMO A cultura da goiaba apresenta perdas em torno de 40 a 60% na pós-colheita relacionadas a problemas fitossanitários, como a antracnose causada pelo fungo Colletotrichum gloeosporioides. Pesquisas com métodos alternativos utilizando indutores de resistência têm sido bastante promissoras na busca de produtos com alto potencial no controle de patógenos em pós-colheita. Assim, o presente trabalho teve como objetivo avaliar os indutores de resistência no controle da antracnose e seus efeitos na qualidade físico-química em frutos de goiabeira ‘Paluma’. Os tratamentos utilizados foram: Agro-mós®, Ecolife®, Fosfitonova K®, Cuprogarb 500®, Rocksil® e testemunha (água destilada esterilizada. Realizou-se o teste in vitro, com discos de colônia de C. gloeosporioides (0,45 cm de diâmetro com sete dias de cultivo e, postos em meio de cultura BDA acrescidos com os indutores. Foi determinada a porcentagem de inibição do crescimento micelial de C. gloeosporioides. O ensaio in vivo foi realizado com frutos de goiabeira variedade Paluma, desinfestados e tratados com indutores. Em seguida, discos de colônia do C. gloeosporioides foram inoculados e do primeiro ao oitavo dia após a inoculação, foram feitas avaliações do diâmetro das lesões nos frutos. As análises pós-colheita foram realizadas, avaliando a perda de massa fresca, sólidos solúveis totais (SST, acidez titulável (AT, razão SST/AT e potencial hidrogeniônico (pH. Foi utilizado o delineamento inteiramente casualizado, em esquema de parcela subdivididas 6x8 (tratamentos x período de avaliação e as médias comparadas pelo teste de Tukey a 5% de probabilidade. Os indutores Agro-mos®, Ecolife®, Fosfitonova K®, Cuprogarb 500® e Rocksil® inibiram o crescimento micelial do C. gloeosporioides in vitro, reduziram o diâmetro das lesões e mantiveram a qualidade pós-colheita em frutos de goiabeira ‘Paluma’.

  20. An Automated Cropland Classification Algorithm (ACCA) for Tajikistan by Combining Landsat, MODIS, and Secondary Data

    OpenAIRE

    Thenkabail, Prasad S.; Wu, Zhuoting

    2012-01-01

    The overarching goal of this research was to develop and demonstrate an automated Cropland Classification Algorithm (ACCA) that will rapidly, routinely, and accurately classify agricultural cropland extent, areas, and characteristics (e.g., irrigated vs. rainfed) over large areas such as a country or a region through combination of multi-sensor remote sensing and secondary data. In this research, a rule-based ACCA was conceptualized, developed, and demonstrated for the country of Tajikistan u...

  1. Programme ACCA : Rapport annuel 2009-2010 | CRDI - Centre de ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    À la lumière d'études de cas locales et ciblées consacrées à l'adaptation en Afrique, le présent rapport montre en quoi la participation des décideurs au processus de recherche les aide à mieux cerner ce processus et contribue à les mobiliser. Le programme ACCA est financé conjointement par le Centre de recherches ...

  2. Estimating carrying capacity in a newly colonized sand fly Lutzomyia serrana (Diptera: Psychodidae).

    Science.gov (United States)

    Santamaría, Erika; Munstermann, Leonard E; Ferro, Cristina

    2002-02-01

    The phlebotomine sand fly Lutzomyia serrana (Damasceno & Arouck) was mass-reared tinder conditions of varying densities in an effort to improve colony production efficiency. To do this, the experimental carrying capacity of a standard rearing chamber was determined, i.e., the optimum population size in relation to density (individuals per unit of space). Rearing chambers of 100 cm3 were populated with 1-50 L. serrana engorged females and an equal number of males. Laboratory conditions were maintained at 23-26 degrees C and 85-95% RH. The following parameters were recorded for each experimental chamber (three replicates): (1) female mortality without oviposition, (2) number of eggs oviposited and (3) number of adults emerging from the egg cohort. Female mortality began to increase substantially in the 26-female chamber, from 5.7% to 15% and finally reaching 60.2% in the 46-50 female chambers. In the chambers containing 1-20 females, egg number and realized adult progeny increased linearly to reach an asymptote. In the 20-50 female chambers, the number of eggs ranged from 420 to 699, and adult production from 306 to 432. The optimum carrying capacity for the 100-cm3 chambers was 22 +/- 2 females. Beyond this number, auto-regulation was initiated, i.e., female mortality without oviposition increased as the number of females per chamber increased. Total number of eggs and adult production was similar in all chambers containing 20-50 females. In conclusion, for optimizing production of mass reared sand flies, determination of the carrying capacity is essential to optimize use of insectary resources, to avoid loss of valuable potentially ovipositing females, and to increase overall production efficiency.

  3. Average correlation clustering algorithm (ACCA) for grouping of co-regulated genes with similar pattern of variation in their expression values.

    Science.gov (United States)

    Bhattacharya, Anindya; De, Rajat K

    2010-08-01

    Distance based clustering algorithms can group genes that show similar expression values under multiple experimental conditions. They are unable to identify a group of genes that have similar pattern of variation in their expression values. Previously we developed an algorithm called divisive correlation clustering algorithm (DCCA) to tackle this situation, which is based on the concept of correlation clustering. But this algorithm may also fail for certain cases. In order to overcome these situations, we propose a new clustering algorithm, called average correlation clustering algorithm (ACCA), which is able to produce better clustering solution than that produced by some others. ACCA is able to find groups of genes having more common transcription factors and similar pattern of variation in their expression values. Moreover, ACCA is more efficient than DCCA with respect to the time of execution. Like DCCA, we use the concept of correlation clustering concept introduced by Bansal et al. ACCA uses the correlation matrix in such a way that all genes in a cluster have the highest average correlation values with the genes in that cluster. We have applied ACCA and some well-known conventional methods including DCCA to two artificial and nine gene expression datasets, and compared the performance of the algorithms. The clustering results of ACCA are found to be more significantly relevant to the biological annotations than those of the other methods. Analysis of the results show the superiority of ACCA over some others in determining a group of genes having more common transcription factors and with similar pattern of variation in their expression profiles. Availability of the software: The software has been developed using C and Visual Basic languages, and can be executed on the Microsoft Windows platforms. The software may be downloaded as a zip file from http://www.isical.ac.in/~rajat. Then it needs to be installed. Two word files (included in the zip file) need to

  4. Incidência e controle químico da ferrugem da goiabeira em diferentes épocas de poda na região norte do Espírito Santo

    Directory of Open Access Journals (Sweden)

    Marlon Vagner Valentim Martins

    2012-04-01

    Full Text Available No norte do Estado do Espírito Santo, vem sendo observada a ocorrência crescente da ferrugem (Puccinia psidii G. Winter nos pomares de goiabeira, ocasionando a queda de frutos novos e o declínio na produção. Este trabalho teve como objetivo avaliar tratamentos com fungicidas no controle da ferrugem em goiabeiras 'Paluma' podadas em diferentes épocas do ano. Foram realizados três experimentos, em delineamento em blocos ao acaso, com diferentes épocas de poda de frutificação (janeiro; maio e outubro e quatro tratamentos fungicidas (I- testemunha - aplicação de água, II- oxicloreto de cobre, III- tebuconazole e IV- tebuconazole + oxicloreto de cobre. Observou-se que, quando a poda foi realizada em janeiro, houve as maiores incidências máxima e final da doença, acarretando menor número de frutos por planta. Dentre os fungicidas testados, tebuconazole isolado ou em mistura com oxicloreto de cobre foram os mais eficientes em controlar a doença nas três épocas de poda, inclusive na época de maior incidência da doença. Quatro pulverizações com tebuconazole, isolado ou em mistura com o oxicloreto de cobre, foram suficientes para minimizar os danos causados pela ferrugem da goiabeira.

  5. Marcha de absorção dos micronutrientes para mudas de goiabeiras cultivares Paluma e Século XXI Micronutrient uptake in ‘Paluma’ and ‘Século XXI’ guava cuttings

    Directory of Open Access Journals (Sweden)

    Claudenir Facincani Franco

    2008-01-01

    Full Text Available O conhecimento da marcha de absorção dos micronutrientes em mudas de goiabeira garante melhor eficiência da adubação. O objetivo do trabalho foi determinar a marcha de absorção de micronutrientes em mudas de duas cultivares de goiabeira. O delineamento experimental utilizado foi em parcelas subdivididas com três repetições. Assim, foram utilizadas como tratamentos principais duas cultivares de goiabeira (Paluma e Século XXI obtidas por estacas herbáceas e como subparcelas, sete coletas de plantas, ao longo do período experimental (120 dias. Nos diferentes órgãos das mudas (folhas, caule e raízes, avaliou-se o acúmulo de micronutrientes, a cada quinze dias. A muda de goiabeira da cultivar Século XXI é mais exigente em micronutrientes do que as mudas da cultivar Paluma. O acúmulo médio de micronutrientes pelas mudas de goiabeira obedeceu à seguinte seqüência: Fe>Mn>Zn>B>Cu, sendo maior nas folhas para B, Cu, Mn e Zn, e nas raízes para Fe. O acúmulo de micronutrientes para as cultivares Paluma e Século XXI em µg por planta foi de: B (632 e 783, Cu (134 e 158, Fe (8103 e 5534, Mn (3052 e 3709 e Zn (760 e 997 respectivamente.Understanding micronutrient uptake in guava cuttings guarantees efficient fertilization. This research was undertaken to measure micronutrient uptake in cuttings from two guava cultivars. The experimental design was arranged in split-plots with three replications. Plots were represented by herbaceous cuttings from the guava cultivars 'Paluma' and 'Século XXI', while split-plots were the seven sampling dates during a 120-day period in nutritive solution. Accumulation of micronutrients was determined in the different plant organs every two weeks. The guava cultivar 'Século XXI' has higher micronutrient requirements than 'Paluma'. The mean micronutrient accumulation followed the order: Fe>Mn>Zn>B>Cu. The accumulation of B, Cu, Mn and Zn was higher in leaves, while Fe was more accumulated in roots

  6. Acúmulo de massa seca e marcha de absorção de nutrientes em mudas de goiabeira 'Pedro Sato' Dry matter storage and absorption route of nutrients in guava seedlings "Pedro Sato"

    Directory of Open Access Journals (Sweden)

    Leonardo Mariano Dias Augostinho

    2008-01-01

    Full Text Available Objetivou-se determinar a curva de acúmulo da matéria seca de mudas e a marcha de absorção de macro e micronutrientes de goiabeira cultivar 'Pedro Sato'. O delineamento experimental foi o inteiramente casualizado, com três repetições. Foram utilizadas sete coletas de plantas de goiabeira 'Pedro Sato', em cultivo hidropônico, em casa de vegetação da Unesp, Campus de Jaboticabal. Nas coletas, avaliaram-se o crescimento das plantas e o acúmulo de nutrientes, a cada 15 dias, durante 120 dias após o transplantio. As mudas de goiabeira proporcionaram maior acúmulo de biomassa no órgão folha em relação ao caule e à raiz. Observou-se alta absorção dos nutrientes, no período de 60 a 90 dias após o transplantio, nas mudas de goiabeira. O acúmulo de nutrientes das mudas de goiabeira (planta inteira foi de 340, 44, 380, 173, 33 e 40 mg planta-1, respectivamente para N, P, K, Ca, Mg, S, e de 743, 118, 5.114, 2.151, 566 mg planta-1, respectivamente, para B, Cu, Fe, Mn e Zn.This work aimed to determine the dry matter storage curve of seedlings and the absorptions of macro and micro nutrients of guava tree cultivar 'Pedro Sato'. It was used randomized design with three repetitions. Seven samples of guava plants cultivar 'Pedro Sato' were used in hydroponic growth in the greenhouse located at UNESP- Jaboticabal Campus, São Paulo State, Brazil. It was evaluated the samples of plants growing and the nutrients storage every 15 days, during 120 days after the transplanting. The seedlings of guava priorized the dry matter storage of leaves in relation of the stem and leaves. The guava seedlings presented high absorption of nutrients in the period of 60 and 90 days after the transplanting. The nutrients storage of the guava seedlings (whole plant were of : 340; 44; 380; 173; 33; and 40 mg plant-1, respectively, for N, P, K, Ca, Mg, S and 743; 118; 5114; 2151; 566µg plant-1, respectively for B, Cu, Fe, Mn, and Zn.

  7. Vztah profesní organizace a vysoké školy na příkladu ACCA/ICAEW a VŠE

    OpenAIRE

    Váňová, Adéla

    2015-01-01

    The thesis aims to explore the relationship of international professional organization ACCA, respectively ICAEW and Faculty of Finance and Accounting (VŠE), and the knowledge to confront each other. The introduction emphasized the importance of professional organizations in connection with the voluntary and compulsory established organizations. The main part of this thesis is focused on the organization ACCA, which deals with her qualifications. The final part closer describes the cooperation...

  8. Avaliação da morfologia interna de sementes de Acca sellowiana O. Berg por meio de análise de imagens

    Directory of Open Access Journals (Sweden)

    Vanessa Neumann Silva

    2013-12-01

    Full Text Available Acca sellowiana O. (Berg Burret é uma fruteira nativa da região Sul do Brasil e do Uruguai, que apresenta grande potencial de uso na recuperação de áreas degradadas. O objetivo deste trabalho foi avaliar a morfologia interna de sementes de Acca sellowiana O. Berg por meio da análise de imagens de raios X e relacionar os resultados com a germinação das sementes. Sementes de Acca sellowiana O. Berg, representadas por três lotes, foram analisadas pelo teste de raios X e, posteriormente, conduzidas ao teste de germinação, com avaliação aos 44 dias após a semeadura. As imagens de raios X foram analisadas com o software ImageJ. A análise das imagens radiográficas de sementes de Acca sellowiana permite a mensuração das áreas internas livres, assim como a determinação da relação entre estas e a germinação. Danos internos detectados por meio de raios X afetam a germinação das sementes.

  9. Micropropagation systems of Feijoa (Acca sellowiana (O. Berg) Burret).

    Science.gov (United States)

    Guerra, Miguel Pedro; Cangahuala-Inocente, Gabriela Claudia; Vesco, Lirio Luiz Dal; Pescador, Rosete; Caprestano, Clarissa Alves

    2013-01-01

    Acca sellowiana (O. Berg) Burret sin. Feijoa sellowiana (Myrtaceae) is a semiwoody fruit species native to South Brazil, Uruguay, and Argentina; edible fruits are tasty. The naturally occurring populations in Santa Catarina State show high variability in fruit size, color, and other features. A breeding program launched in 1990 resulted in the release of four Brazilian commercial varieties. The conventional clonal propagation methods of this species, such as cutting and grafting, have shown low efficiency. Therefore, tissue culture techniques were developed for mass propagation. This chapter describes several protocols based on organogenesis and somatic embryogenesis. Additional techniques including synthetic seed technology and temporary immersion system are also described.

  10. Influência da temperatura de armazenamento na qualidade pós-colheita de goiabas serranas

    Directory of Open Access Journals (Sweden)

    Aline Cristina Velho

    2011-03-01

    Full Text Available O presente estudo teve por objetivo avaliar o potencial de armazenagem de goiabas serranas em temperaturas de 23 ºC e 4 ºC. Os frutos foram colhidos em pomar comercial, localizado no município de São Joaquim-SC, e armazenados nas temperaturas de 23 ± 1 ºC (75±5% UR, durante quinze dias e 4 ± 1 ºC (90±5% UR, durante quatro semanas. Durante o armazenamento, foram feitas avaliações de respiração, produção de etileno, teor de sólidos solúveis (SS, acidez titulável (AT, cor da epiderme (ângulo hue; hº e ocorrência de escurecimento da polpa, manchas escuras na epiderme e podridões. Durante o armazenamento a 23 ºC, os frutos exibiram um padrão climatérico, com pico respiratório entre o 4º e o 5º dia. Nos frutos armazenados a 4 ºC, houve redução na respiração e na produção de etileno. Em frutos a 23 ºC, foi mais acentuada a redução nos valores de SS, AT e h° da epiderme, e aumento na incidência de manchas escuras na epiderme e de podridões, em relação aos frutos armazenados a 4 ºC. O armazenamento a 4 ºC mostrou-se eficiente na redução do metabolismo respiratório e de produção de etileno, na preservação dos atributos de qualidade (SS, AT e hº da epiderme e na diminuição da severidade das manchas na epiderme e podridões sem, contudo, evitar o desenvolvimento de escurecimento da polpa. O potencial de armazenagem de goiabas serranas a 23 ºC é inferior a uma semana e limitado principalmente pelo desenvolvimento de distúrbios de escurecimento da polpa, manchas na epiderme, bem como podridões.

  11. Influência do sexo do animal e do sistema de produção nas características de carcaça de caprinos da raça Blanca Serrana Andaluza Influence of animal gender and production system on the carcass characteristics of goats of the Blanca Serrana Andaluza breed

    Directory of Open Access Journals (Sweden)

    Roberto Germano Costa

    2010-02-01

    Full Text Available Objetivou-se avaliar a influência do sexo e do sistema de produção nas características de carcaça de caprinos da raça Blanca Serrana Andaluza. Foram utilizados 31 animais, 12 machos e 19 fêmeas, distribuídos nos sistemas de produção intensivo (15 animais e extensivo (16 animais. Não foi observada diferença no desempenho, no peso de carcaça e no escore corporal entre os sexos nem entre os sistemas de produção, contudo, os rendimentos de carcaça quente e fria foram maiores nos animais terminados em confinamento. As medidas de carcaça não diferiram entre os sistemas de produção, exceto o comprimento interno, que foi maior nos animais criados no sistema intensivo. O percentual dos não-constituintes da carcaça sofreu pouca variação em relação ao sexo e aos sistemas de criação avaliados. As maiores proporções de gordura perirrenal foram encontradas nas fêmeas e nos animais produzidos em confinamento. Pouca variação foi observada para os cortes paleta, pescoço e serrote, embora o percentual de perna tenha sido maior nos animais produzidos a pasto. O sistema extensivo, predominantemente usado por criadores da raça Blanca Serrana Andaluza na Espanha, permite obter carcaças com características similares às dos animais criados em confinamento e, em virtude da significativa redução dos custos com alimentação, obtida com os animais exclusivamente a pasto, pressupõe-se que esse sistema seja mais economicamente viável.The objective of this study was to evaluate the influence of gender and production system on the carcass characteristics of Blanca Serrana Andaluza goats. Thirty-one animals were used, 12 males and 19 females, distributed in intensive (15 animals and extensive (16 animals production systems. No difference was observed in performance, carcass weight and body score between the gender or production system but the hot and cold carcass yields were greater for the animals finished in a feedlot. The carcass

  12. Evaluación de diferentes tratamientos hormonales para la sincronización del estro en cabras criollas serranas durante el verano

    OpenAIRE

    Ruiz, Rodrigo; Fernández, Jorge L; de la Vega, Adolfo C; Rabasa, Alicia E

    2002-01-01

    El objetivo de este trabajo fue evaluar la eficiencia de dos tratamientos hormonales en la sincronización de celos en cabras Criollas Serranas durante el verano. El mismo se realizó con 79 hembras, con un diseño completamente aleatorizado, con los siguientes tratamientos: T1, Prostaglandina F2µ (n = 27): dos aplicaciones de 325 mg/cabra (sc) de cloprostenol, espaciadas 12 días una de otra; T2, Progestágeno (n =26): esponja intravaginal con 60 mg de acetato de medroxiprogesterona, durante 12 d...

  13. Fungos filamentosos isolados da rizosfera de plantas nativas da caatinga e de cultivos de goiabeiras (Psidium guajava L.) sadias e infestadas por nematóides

    OpenAIRE

    SILVÉRIO, Michelline Lins

    2007-01-01

    Os fungos podem ser encontrados nos mais diversos habitats, incluindo a rizosfera, que é caracterizada pela intensa atividade microbiana. Na região do Vale do Submédio São Francisco (Petrolina, Pernambuco, Brasil) a goiabeira representa a terceira fruteira mais cultivada; entretanto, a cultura vem diminuindo drasticamente em produtividade e área plantada devido ao ataque das raízes por fitonematóides. Este trabalho teve como objetivo identificar espécies de fungos filamentosos ...

  14. Análise da produção e comercialização de produtos DOP da Cabra Serrana Transmontana

    OpenAIRE

    Cabo, Paula; Matos, Alda; Fernandes, António; Ribeiro, Maria Isabel

    2015-01-01

    No Nordeste Transmontano, a caprinicultura baseada na raça Serrana, ecótipo Transmontano, assume, desde há séculos, uma relevância significativa para a economia da região. O sistema de exploração segue, ainda, o modelo tradicional de exploração de pastoreio extensivo, que proporciona aos animais uma alimentação que permite a obtenção de produtos de elevada qualidade. Contudo, a reduzida escala das explorações condiciona as opções estratégicas disponíveis e dita a aposta em produtos de qualida...

  15. Influência do cultivar, do tipo de folha e do tempo de cultivo na medida indireta da clorofila (spad em mudas de goiabeira Influence of cultivars, type of leaf, and cultivation time in the indirect measurement of chlorophyll (SPAD in guava (psidium guajava l. seedlings

    Directory of Open Access Journals (Sweden)

    Danilo Eduardo Rozane

    2009-12-01

    Full Text Available A análise foliar de nitrogênio, comumente empregada em laboratórios de rotina, é destrutiva e nem sempre rápida, obstante para a tomada de decisão. Objetivou-se com a pesquisa estudar as medidas SPAD, em mudas de goiabeira (Psidium guajava L. cultivada em solução nutritiva completa, observando-se as diferenças entre cultivares, épocas de amostragem e tipos de folhas avaliadas. O delineamento foi inteiramente casualizado, com quatro repetições, em parcelas sub-subdivididas. Assim, foi utilizada como parcela as duas cultivares de goiabeira (Paluma e Século XXI, como subparcelas os tipos de folhas (+1, +2 e +3 e, cinco épocas de amostragem ao longo do período experimental (60, 75, 90, 105 e 120 dias, após o transplantio de mudas Concluiu-se que a leitura SPAD em mudas de goiabeira é influenciada pela cultivar, tipo de folha e época de amostragem. O terceiro par de folhas mostrou-se mais adequado para avaliar o estado nutricional do nitrogênio nas mudas de goiabeira a partir da leitura SPAD. As cultivares de goiabeira apresentaram diferença na leitura SPAD apenas aos 60 e 90 dias após o transplantio, independentemente do tipo de folha.Foliar nitrogen analysis, also used in routine laboratories, is destructive and not always fast enough for decision making. The objective of this research was to study SPAD measurements, in guava seedlings (Psidium guajava L. cultivated in a complete nutritive solution, observing the differences between cultivation, times of sampling, and types of evaluated leaves. The experimental design was a completely randomized scheme, with four repetitions, in split lots. The lots consisted of two guava cultivars (Paluma and Século XXI, as sub-lots, the types of leaves (+1, +2 ,and +3, and five sampling times throughout the experimental period (60, 75, 90, 105, and 120 days. It was concluded that the SPAD measurements in guava seedlings are influenced by cultivation, type of leaf, and time of sampling. The

  16. Analisis geométrico y legal de la traza de "La Trochita" patrimonio histórico y cultural de la Comarca Serrana

    Directory of Open Access Journals (Sweden)

    Alicia M. Campo

    2011-06-01

    Full Text Available La recuperación de la traza original del ramal ferroviario "La Trochita", es un trabajo realizado en colaboración con el municipio de Tornquist. Este tren de trocha angosta unía a lo largo de 18 km, la actual estación de Sierra de la Ventana con el Club Hotel de la Ventana. El hotel, de renombre internacional, fue construido a principios del siglo XX. En la actualidad sólo quedan sus ruinas, que junto con los puentes, alcantarillas, terraplenes y desmontes, construidos sobre la traza del tren, conforman parte de la historia local de la Comarca Serrana. Esta denominación se utiliza para identificar en el Sur de la provincia de Buenos Aires a una pujante área turística en el Sistema de Ventania entre los 38° 4´ y 38° 8´ latitud Sur y los 61°47´ y 61°56´ longitud Oeste, en la cual se encuentran comprendidas las localidades de Sierra de la Ventana y Villa Ventana pertenecientes al partido de Tornquist. El objetivo general del trabajo fue la recuperación de la traza original con el objeto de realizar un paseo temático. Para ello se realizó la búsqueda y análisis de antecedentes gráficos y analíticos, se efectuaron relevamientos y replanteos en campaña. El objetivo específico es el estudio del dominio de las tierras afectadas por la traza. Este proyecto contribuye a la toma de conciencia, de gran parte de la comunidad serrana, sobre el valor de su propio patrimonio y la necesidad de su preservación, para instaurar nuevas fuentes de turismo en la región.The recovering of "La Trochita" original railway trail is a joint project with the City Hall of Tornquist. The current train station of Sierra de la Ventana and Club Hotel de la Ventana were communicated through the 18 km narrow railway trail. The Club Hotel de la Ventana, a former world-wide known hotel, was built in the early XX century. Today the ruins of the hotel are part of the local history of the Comarca Serrana, along with the bridges, sewer systems, embankments - all

  17. Século XXI: nova cultivar de goiabeira de dupla finalidade XXI Century: new cultivar of guava tree to double purpose

    Directory of Open Access Journals (Sweden)

    Fernando Mendes Pereira

    2003-12-01

    Full Text Available A goiabeira (Psidium guajava L. é uma espécie que vem se tornando de grande importância em diversas regiões do Brasil, principalmente no Estado de São Paulo, maior produtor nacional. Desde 1985, a UNESP/FCAV, Câmpus de Jaboticabal, vem desenvolvendo um programa de melhoramento genético da goiabeira, com o objetivo de obter plantas com boas características agronômicas e com frutos que possam ser destinados tanto à industrialização quanto ao consumo na forma de fruta fresca. Partindo-se de 219 plantas, oriundas de diversos cruzamentos, e após dez anos de avaliação, chegou-se à cultivar Século XXI, cujas principais características são: planta muito produtiva com ciclo precoce (130 dias da floração à colheita, frutos grandes, com polpa espessa, róseo-avermelhada, ótimo sabor e com poucas e pequenas sementes.The guava tree (Psidium guajava, L. is a species that is coming into being of great importance in several areas of Brazil, mainly in State of São Paulo, its biggest national producer. Since 1985, the UNESP/FCAV, Jaboticabal Campus comes developing a program of breeding of guava tree, with the objective of obtaining plants with good agronomic characteristics and fruits that can be destined for industrialization and consumption as fresh fruit. From 219 plants originating from several crossing, and after ten years of evaluation, it has been obtained the XXI Century cultivar, which main characteristics are: a very productive plant with precocious cycle (130 days from the blossom to the harvest, big fruits with thick pulp, rosy-red, great flavor and with little and small seeds.

  18. Fungos associados às sementes de Acca sellowiana: efeitos na qualidade fisiológica das sementes e transmissão

    Directory of Open Access Journals (Sweden)

    Vinícius Spolaor Fantinel

    2017-12-01

    Full Text Available Objetivou-se analisar o efeito de fungos na qualidade fisiológica de sementes de goiaba-serrana, e determinar os possíveis prejuízos no desenvolvimento inicial de mudas dessa espécie. Para análise fisiológica das sementes, foi realizado teste de germinação, a 25 ºC e fotoperíodo de 12 h, por 30 dias; sendo avaliadas a porcentagem e a velocidade de germinação. Inicialmente, as sementes foram subdivididas, sendo uma parte submetida à assepsia superficial com álcool 70%, hipoclorito de sódio 1% com posterior lavagem em água destilada e outra não. Para a avaliação das plântulas foi realizado teste de emergência de plântulas em viveiro, por 60 dias. Foram avaliadas a porcentagem de emergência, a massa verde e a massa seca de plântulas, e identificados os fungos. Os fungos interferiram na porcentagem de plântulas normais. Aspergillus sp., Colletotrichum gloeosporioides, Fusarium sp., Penicillium sp. e Phomopsis sp. associam-se com sementes não germinadas de goiaba-serrana, sendo prejudiciais à sua qualidade fisiológica. C. gloeosporioides e Fusarium sp. são transmitidos de sementes para plântulas, causando lesões necróticas nos cotilédones e má formação de raízes respectivamente.

  19. Characterization of 10 new nuclear microsatellite markers in Acca sellowiana (Myrtaceae).

    Science.gov (United States)

    Klabunde, Gustavo H F; Olkoski, Denise; Vilperte, Vinicius; Zucchi, Maria I; Nodari, Rubens O

    2014-06-01

    Microsatellite primers were identified and characterized in Acca sellowiana in order to expand the limited number of pre-existing polymorphic markers for use in population genetic studies for conservation, phylogeography, breeding, and domestication. • A total of 10 polymorphic microsatellite primers were designed from clones obtained from a simple sequence repeat (SSR)-enriched genomic library. The primers amplified di- and trinucleotide repeats with four to 27 alleles per locus. In all tested populations, the observed heterozygosity ranged from 0.269 to 1.0. • These new polymorphic SSR markers will allow future genetic studies to be denser, either for genetic structure characterization of natural populations or for studies involving genetic breeding and domestication process in A. sellowiana.

  20. Calagem na nutrição de cálcio e no desenvolvimento do sistema radicular da goiabeira Effect of the liming on the nutrition and the development of the guava root system

    Directory of Open Access Journals (Sweden)

    Renato de Mello Prado

    2004-10-01

    Full Text Available A aplicação de calcário em solos ácidos promove maior desenvolvimento do sistema radicular das plantas e consequentemente, melhora a absorção de água e nutrientes. O objetivo deste trabalho foi avaliar os efeitos da aplicação de calcário no solo, no desenvolvimento do sistema radicular e na nutrição de cálcio de goiabeiras cultivadas em um Latossolo Vermelho distrófico ácido. Analisaram-se amostras de solo coletadas em quatro pontos eqüidistantes, a 75 cm do tronco, nas camadas de 0-20 e 20-40 cm de profundidade, de parcelas que receberam 0, 3,7 e 7,4 t ha-1 de calcário. O calcário foi aplicado em pré-plantio, incorporado com arado de aivecas e grade aradora, na camada de 0-30 cm de profundidade. Durante o segundo e o terceiro ano de cultivo da goiabeira, avaliaram-se os efeitos da calagem nas propriedades químicas do solo. Aos 42 meses após a incorporação do calcário (terceiro ano de cultivo da goiabeira, realizou-se a amostragem das raízes com trado cilíndrico serrilhado para a avaliação da matéria seca e do teor de cálcio radicular e e também realizou-se a amostragem de folhas. A calagem promoveu a correção da acidez do solo, aumentando a saturação por bases, com conseqüente incremento da disponibilidade e absorção de cálcio pela planta, proporcionando maior desenvolvimento do sistema radicular da goiabeira. Concentrações de cálcio próximas de 30 mmol c dm-3 no solo e teor desse nutriente de 7,5 g kg-1 nas raízes, estiveram associados ao maior crescimento radicular da goiabeira.The application of lime in acid soils improves the plant root system and, consequently, enhances water and nutrients absorption by the plants. The objective of this work was to evaluate the effects of lime application on the development of root system and calcium nutrition of guava plants cultivated in an acid distrofic Red Latosol (Typic Hapludox. Soil samples were collected in four equidistant points, at 75 cm of the trunk

  1. Structural interpretation of the area around the Cays - Quitasueno and Serrana, in the Caribbean, coast away from Colombia

    International Nuclear Information System (INIS)

    Munar, F

    2000-01-01

    The Caribbean basin has been poorly explored and poses a wide array of geological questions, due to its uncertain stratigraphic relations, its structural frame and the nature of its basement related to the islands. By interpreting 1.700 km seismic lines, from the Ecopetrol Caribbean surveys, Cayos 77 and Cayos 82, and by tightening two wells, Miskito 1 and Miskito 2, in the area of Cays (lower Nicaragua rise), north of the Colombia Basin, we determined the stratigraphic position of the basement B and found out two trends NE-SW and NW-SE for the Quitasueno and Serrana Cays, in a horst and Graben style. In addition to that, the facies for the basement are for the most part igneous and from an exploration point of view, it gives the opportunity for a good seal

  2. Patterns of protein and carbohydrate accumulation during somatic embryogenesis of Acca sellowiana Padrões de acúmulo de proteínas e carboidratos durante a embriogênese somática de Acca sellowiana

    Directory of Open Access Journals (Sweden)

    Gabriela Claudia Cangahuala-Inocente

    2009-03-01

    Full Text Available The aim of this work was to quantify the protein, starch and total sugars levels during histodifferentiation and development of somatic embryos of Acca sellowiana Berg. For histological observations, the samples were dehydrated in a battery of ethanol, embedded in historesin and stained with toluidine blue (morphology, coomassie blue (protein bodies and periodic acid-Schiff (starch. Proteins were extracted using a buffer solution, precipitated using ethanol and quantified using the Bradford reagent. Total sugars were extracted using a methanol-chloroform-water (12:5:3 solution and quantified by a reaction with anthrone at 0.2%. Starch was extracted using a 30% perchloric acid solution and quantified by a reaction with anthrone at 0.2%. During the somatic embryogenesis' in vitro morphogenesis and differentiation processes, the total protein levels decreased and the soluble sugars levels increased during the first 30 days in culture and remained stable until the 120th day. On the other hand, total protein levels increased according to the progression in the developmental stages of the somatic embryos. The levels of total sugars and starch increased in the heart and cotyledonary stages, and decreased in the torpedo and pre-cotyledonary stages. These compounds play a central role in the development of somatic embryos of Acca sellowiana.O objetivo deste trabalho foi quantificar os teores de proteína, amido e açúcares totais durante a histodiferenciação e desenvolvimento dos embriões somáticos em Acca sellowiana Berg. Para as observações histológicas, as amostras foram desidratadas em uma bateria de etanol, emblocadas em historesina e coradas com azul de toluidina (morfologia, azul de coomassie (corpos proteicos e reativo ácido periódico de Schiff (amido. As proteínas foram extraídas usando uma solução tampão, precipitadas usando etanol e quantificadas por meio do reativo de Bradford. Os açúcares totais foram extraídos usando uma

  3. Characterization of 10 New Nuclear Microsatellite Markers in Acca sellowiana (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Gustavo H. F. Klabunde

    2014-06-01

    Full Text Available Premise of the study: Microsatellite primers were identified and characterized in Acca sellowiana in order to expand the limited number of pre-existing polymorphic markers for use in population genetic studies for conservation, phylogeography, breeding, and domestication. Methods and Results: A total of 10 polymorphic microsatellite primers were designed from clones obtained from a simple sequence repeat (SSR–enriched genomic library. The primers amplified di- and trinucleotide repeats with four to 27 alleles per locus. In all tested populations, the observed heterozygosity ranged from 0.269 to 1.0. Conclusions: These new polymorphic SSR markers will allow future genetic studies to be denser, either for genetic structure characterization of natural populations or for studies involving genetic breeding and domestication process in A. sellowiana.

  4. Isolation and characterization of microsatellite markers in Acca sellowiana (Berg) Burret.

    Science.gov (United States)

    Santos, K L; Santos, M O; Laborda, P R; Souza, A P; Peroni, N; Nodari, R O

    2008-11-01

    Acca sellowiana has commercial potential because of the quality and the unique flavor of its fruit. Conservation of natural populations and management of breeding programmes would benefit from the availability of molecular markers that could be used to characterize levels and distribution of genetic variability. Thus, 13 microsatellite markers were developed from an enriched genomic library of A. sellowiana. They were characterized using 40 samples. The expected and observed heterozygosities ranged from 0.513 to 0.913 and from 0.200 to 0.889, respectively. These are the first microsatellite loci characterized from A. sellowiana that will contribute to improve researches on the genetic conservation, characterization and breeding. Journal compilation © 2008 Blackwell Publishing Ltd. No claim to original US government works.

  5. Efeito da adubação nitrogenada na formação de mudas de goiabeira irrigadas com águas salinizadas

    Directory of Open Access Journals (Sweden)

    E. M. Silva

    2015-10-01

    Full Text Available Além de favorecer o desenvolvimento e a produção das culturas, a adubação tem sido considerada uma técnica capaz de reduzir o efeito da salinidade nas plantas. Neste sentido, desenvolveu-se o trabalho para avaliar a influência de doses de nitrogênio na formação de mudas de goiabeira cv. Paluma irrigadas com águas de diferentes salinidades. O experimento foi desenvolvido em casa de vegetação do Centro de Ciências e Tecnologia Agroalimetar da UFCG, Pombal, PB com delineamento experimental em blocos casualizados, em esquema fatorial 5 x 4, sendo os tratamentos correspondentes aos níveis de condutividade elétrica da água (CEa de 0,3; 1,1; 1,9; 2,7 e 3,5 dS m-1 associados a 70, 100, 130 e 160% da dose recomendada de nitrogênio (N para mudas de goiabeira cv. Paluma, com quatro repetições, e cinco plantas por unidade experimental. Aos 180 dias após a emergência, a adubação nitrogenada na dose de 773 mg de N dm-3 reduz o efeito da salinidade da água de irrigação sobre o diâmetro do caule das mudas. As plantas adubadas com as doses variando de 541 a 618,4 mg de N dm-3 atingem maior crescimento em altura de planta, número de folhas e área foliar. A área foliar e a massa seca total de mudas de goiabeira atingem maiores valores no nível de CEa de 1,3 dS m-1.Effect of nitrogen fertilization in the formation of guava seedlings irrigated with salted waterAbstract: In addition to favoring the development and production of crops, the fertilizer has been considered a technique capable to reduce the effect of salinity on plants. The experiment was conducted in a greenhouse of the ‘Centro de Ciências e Tecnologia Agroalimentar’ of UFCG, Pombal, PB in a randomized block design a 5 x 4 factorial, with the treatments corresponding to the electrical conductivity of irrigation water (ECw 0.3; 1.1; 1.9; 2.7 and 3.5 dS m-1 associated with doses of 70, 100, 130 and 160% of recommended nitrogen (N for guava seedlings Paluma,  with four

  6. Resposta de mudas de goiabeira à aplicação de escória de siderurgia como corretivo de acidez do solo Response of guava plants to basic slag application as corrective of soil acidity

    Directory of Open Access Journals (Sweden)

    Renato de Mello Prado

    2003-04-01

    Full Text Available A escória de siderurgia pode constituir-se em uma fonte alternativa de Ca e Mg, bem como corretivo de acidez do solo, melhorando o estado nutricional de mudas de goiabeira, podendo contribuir para o sucesso da implantação de um pomar. O presente trabalho objetivou avaliar os efeitos da escória de siderurgia nas alterações dos atributos químicos do solo, na nutrição das plantas e no crescimento de mudas de goiabeira. Para tanto, instalou-se um experimento em Taquaritinga-SP, em condições de vasos, com doses crescentes de escória de siderurgia: zero; metade; uma vez; uma vez e meia; duas vezes e duas vezes e meia a dose para elevar a saturação por bases para 70%. Após 90 dias da incubação da escória no solo, procedeu-se o plantio das mudas de goiabeira (cv. Paluma, propagadas vegetativamente por estaquia, em substrato de um Argissolo Vermelho-Amarelo ácido (vaso com 2,8 dm³, cultivando-as por 105 dias. A aplicação de escória de siderurgia elevou os valores de pH, SB, V%, e as concentrações de Ca, Mg e P, diminuindo H+Al do solo. Nas mudas de goiabeira, houve aumento significativo na altura, no número de folhas, na área foliar, nas concentrações de Ca, Mg e P da parte aérea e das raízes das plantas e, conseqüentemente, na matéria seca da parte aérea e das raízes. Portanto, a escória de siderurgia mostrou-se viável na produção de mudas de goiabeira como corretivo de acidez do solo e fonte de nutrientes (Ca e Mg .The basic slag can consist in alternative source of Ca and Mg, as well as conecting soil acidity improving the nutricional state of guava plants, and determining the success of the implantation of an orchard. The present work was carried out to evaluate the basic slag in chemical attributes in soil in the nutrition of plants and the production of guava plants. By the way, an experiment was conducted in Taquaritinga-SP, in pot conditions, with increasing doses of basic slag: zero; half; once, once and

  7. ADUBAÇÃO NITROGENADA E POTÁSSICA EM GOIABEIRAS ‘PALUMA’: I. EFEITO NA PRODUTIVIDADE E NA QUALIDADE Dos FRUTOS PARA INDUSTRIALIZAÇÃO

    Directory of Open Access Journals (Sweden)

    DANIEL ANGELUCCI DE AMORIM

    2015-03-01

    Full Text Available RESUMO A nutrição dos pomares é fator preponderante à produtividade, sendo necessário conhecer as doses adequadas de fertilizantes e sua influência nos atributos qualitativos dos frutos para industrialização. O trabalho objetivou avaliar os efeitos de diferentes doses de nitrogênio e potássio sobre a produtividade de goiabeiras e sobre os valores de pH, conteúdo de sólidos solúveis (SS e de acidez titulável (AT , além da relação polpa/miolo das goiabas. O experimento foi conduzido em Vista Alegre do Alto-SP, em pomar de goiabeiras ‘Paluma’, com sete anos deidade, irrigado, manejado com podas, durante três ciclos consecutivos de produção. O solo do pomar é o Argissolo Vermelho-Amarelo distrófico. O delineamento experimental foi em blocos ao acaso, em esquema fatorial, com quatro doses de nitrogênio (0; 0,5; 1 e 2 kg planta-1 de N e quatro de potássio (0; 0,55; 1,1 e 2,2 kg planta-1 de K2O, com três repetições. A adubação nitrogenada aumentou a produtividade e o pH dos frutos, sendo explicados por modelos quadráticos de regressão polinomial; diminuiu linearmente a relação polpa/miolo e não influenciou os teores de SS e de AT. Por outro lado, a adubação potássica e a interação N x K não apresentaram efeitos significativos sobre a produtividade, bem como sobre as demais características avaliadas.

  8. New species of Temnocephala Blanchard (Platyhelminthes, Temnocephalida ectosymbiont on Aegla serrana Buckup & Rossi (Crustacea, Anomura from southern Brazil

    Directory of Open Access Journals (Sweden)

    José Felipe Ribeiro Amato

    2003-09-01

    Full Text Available A new species of the genus Temnocephala Blanchard, 1849 is described from southern Brazil, ectosymbiont on Aegla serrana Buckup & Rossi, 1977, an anomuran crustacean, collected in a creek and a reservoir of the highlands in the State of Rio Grande do Sul. All crustaceans examined were positive for this species of Temnocephala and carried eggs in different regions of the ventral side: perioral area, pleural strips, esternal plates, pereiopods and chelipods; to a lesser extent in the dorsal side of the cephalothorax and dorsal side of the uropods; as well as adult and young specimens. The most distinctive characters of the new species are: 1 cyanophilous glands forming an irregular-shaped, grape-like, bunch of approximately 10-15 cells, deeply staining with hematoxylin; 2 shape and size of the cirrus and its introvert section; 3 number, size and distribution of the rhabdite glands and 4 shape and position of the post tentacular, 'excretory' syncytial plates, with the off-centered nephridiopore.

  9. Characterization of 10 new nuclear microsatellite markers in Acca sellowiana (Myrtaceae)1

    Science.gov (United States)

    Klabunde, Gustavo H. F.; Olkoski, Denise; Vilperte, Vinicius; Zucchi, Maria I.; Nodari, Rubens O.

    2014-01-01

    • Premise of the study: Microsatellite primers were identified and characterized in Acca sellowiana in order to expand the limited number of pre-existing polymorphic markers for use in population genetic studies for conservation, phylogeography, breeding, and domestication. • Methods and Results: A total of 10 polymorphic microsatellite primers were designed from clones obtained from a simple sequence repeat (SSR)–enriched genomic library. The primers amplified di- and trinucleotide repeats with four to 27 alleles per locus. In all tested populations, the observed heterozygosity ranged from 0.269 to 1.0. • Conclusions: These new polymorphic SSR markers will allow future genetic studies to be denser, either for genetic structure characterization of natural populations or for studies involving genetic breeding and domestication process in A. sellowiana. PMID:25202632

  10. Qualidade de goiaba-serrana em resposta à temperatura de armazenamento e ao tratamento com 1-metilciclopropeno Fruit quality of feijoas in response to storage temperature and treatment with 1-methylcyclopropene

    Directory of Open Access Journals (Sweden)

    Cassandro Vidal Talamini do Amarante

    2008-12-01

    Full Text Available Os objetivos deste trabalho foram caracterizar a fisiologia e avaliar os efeitos da temperatura e da aplicação de 1-metilciclopropeno (1-MCP na qualidade pós-colheita de frutos de goiaba-serrana (Acca selowiana, em acessos do banco ativo de germoplasma da Empresa de Pesquisa Agropecuária e Extensão Rural de Santa Catarina. Os frutos foram colhidos na maturação comercial. Os genótipos Brasil (acesso 387 e Uruguai (acesso 454 foram avaliados quanto ao comportamento respiratório e de produção de etileno a 20ºC, e taxas respiratórias e alterações na cor da casca a 0, 5, 10, 20 e 30ºC. O genótipo Brasil (acesso 242 foi avaliado quanto ao amadurecimento a 4ºC, após tratamento com 1-MCP (0, 500 e 1.500 ppb. Os genótipos Brasil (acesso 387 e Uruguai (acesso 454 apresentaram comportamento climatérico, com picos de produção de etileno e de taxa respiratória aos 8 e 12 dias de armazenamento a 20ºC, respectivamente. Não houve diferença significativa entre as taxas respiratórias e de produção de etileno entre os genótipos, nessa temperatura. Houve aumento substancial na taxa respiratória em ambos os genótipos, com o aumento de 0 para 30ºC, com coeficiente metabólico de 3,5 aproximadamente. Com o aumento na temperatura, houve maior alteração na cor verde da epiderme, em frutos do tipo Brasil, e maior escurecimento da epiderme, em frutos do tipo Uruguai. Frutos do genótipo Brasil (acesso 242, tratados com 1-MCP e armazenados a 4ºC, apresentaram retardamento no amadurecimento.The objectives of this work were to characterize the postharvest physiology and to evaluate the effects of temperature and treatment with 1-methylcyclopropene (1-MCP on the postharvest quality of fruits of feijoa (Acca selowiana accessions from the germplasm bank of Empresa de Pesquisa Agropecuária e Extensão Rural de Santa Catarina. Fruits were harvested at commercial maturity. The genotypes Brasil (accession no. 387 and Uruguai (accession no. 454

  11. Spectral matching techniques (SMTs) and automated cropland classification algorithms (ACCAs) for mapping croplands of Australia using MODIS 250-m time-series (2000–2015) data

    Science.gov (United States)

    Teluguntla, Pardhasaradhi G.; Thenkabail, Prasad S.; Xiong, Jun N.; Gumma, Murali Krishna; Congalton, Russell G.; Oliphant, Adam; Poehnelt, Justin; Yadav, Kamini; Rao, Mahesh N.; Massey, Richard

    2017-01-01

    Mapping croplands, including fallow areas, are an important measure to determine the quantity of food that is produced, where they are produced, and when they are produced (e.g. seasonality). Furthermore, croplands are known as water guzzlers by consuming anywhere between 70% and 90% of all human water use globally. Given these facts and the increase in global population to nearly 10 billion by the year 2050, the need for routine, rapid, and automated cropland mapping year-after-year and/or season-after-season is of great importance. The overarching goal of this study was to generate standard and routine cropland products, year-after-year, over very large areas through the use of two novel methods: (a) quantitative spectral matching techniques (QSMTs) applied at continental level and (b) rule-based Automated Cropland Classification Algorithm (ACCA) with the ability to hind-cast, now-cast, and future-cast. Australia was chosen for the study given its extensive croplands, rich history of agriculture, and yet nonexistent routine yearly generated cropland products using multi-temporal remote sensing. This research produced three distinct cropland products using Moderate Resolution Imaging Spectroradiometer (MODIS) 250-m normalized difference vegetation index 16-day composite time-series data for 16 years: 2000 through 2015. The products consisted of: (1) cropland extent/areas versus cropland fallow areas, (2) irrigated versus rainfed croplands, and (3) cropping intensities: single, double, and continuous cropping. An accurate reference cropland product (RCP) for the year 2014 (RCP2014) produced using QSMT was used as a knowledge base to train and develop the ACCA algorithm that was then applied to the MODIS time-series data for the years 2000–2015. A comparison between the ACCA-derived cropland products (ACPs) for the year 2014 (ACP2014) versus RCP2014 provided an overall agreement of 89.4% (kappa = 0.814) with six classes: (a) producer’s accuracies varying

  12. Synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid vinyl-ACCA) derivatives: key intermediates for the preparation of inhibitors of the hepatitis C virus NS3 protease.

    Science.gov (United States)

    Beaulieu, Pierre L; Gillard, James; Bailey, Murray D; Boucher, Colette; Duceppe, Jean-Simon; Simoneau, Bruno; Wang, Xiao-Jun; Zhang, Li; Grozinger, Karl; Houpis, Ioannis; Farina, Vittorio; Heimroth, Heidi; Krueger, Thomas; Schnaubelt, Jürgen

    2005-07-22

    (1R,2S)-1-Amino-2-vinylcyclopropanecarboxylic acid (vinyl-ACCA) is a key building block in the synthesis of potent inhibitors of the hepatitis C virus NS3 protease such as BILN 2061, which was recently shown to dramatically reduce viral load after administration to patients infected with HCV genotype 1. We have developed a scalable process that delivers derivatives of this unusual amino acid in >99% ee. The strategy was based on the dialkylation of a glycine Schiff base using trans-1,4-dibromo-2-butene as an electrophile to produce racemic vinyl-ACCA, which was subsequently resolved using a readily available, inexpensive esterase enzyme (Alcalase 2.4L). Factors that affect diastereoselection in the initial dialkylation steps were examined and the conditions optimized to deliver the desired diastereomer selectively. Product inhibition, which was encountered during the enzymatic resolution step, initially resulted in prolonged cycle times. Enrichment of racemic vinyl-ACCA through a chemical resolution via diastereomeric salt formation or the use of forcing conditions in the enzymatic reaction both led to improvements in throughput and the development of a viable process. The chemistry described herein was scaled up to produce multikilogram quantities of this building block.

  13. Épocas e intensidades de poda de frutificação na goiabeira ' Paluma' , em Pinheiros-ES Effect of pruning time and intensity on ' Paluma' guava trees, in Pinheiros, ES, Brazil

    Directory of Open Access Journals (Sweden)

    Luiz Augusto Lopes Serrano

    2008-12-01

    Full Text Available Este trabalho teve como objetivo avaliar os efeitos de diferentes intensidades de poda de frutificação realizadas em diferentes épocas do ano sobre a fenologia e a produção da goiabeira 'Paluma', em Pinheiros-ES. As plantas foram submetidas a três intensidades de poda de frutificação (curta, média e longa, em quatro diferentes épocas (25-11-2005, 21-12-2005, 27-01-2006 e 23-02-2006. O ciclo da goiabeira 'Paluma', entre a poda até o início da colheita dos frutos, variou de 189 dias (podas em novembro e dezembro a 203 dias (poda em fevereiro. Independentemente da época de poda, as plantas submetidas à poda longa apresentaram maior emissão de brotos novos e maior número de ramos estabelecidos. As plantas submetidas à poda curta apresentaram menores números de brotos emitidos e de ramos estabelecidos, bem como menor índice de pegamento de frutos, menor número de frutos por planta e, conseqüentemente, menor produção; entretanto produziram frutos de maior peso médio em relação às plantas submetidas à poda longa. A maior produção e o maior número de frutos colhidos por planta ocorreram nas plantas podadas em fevereiro. A época e a intensidade da poda de frutificação afetam a brotação e a produção da goiabeira 'Paluma'.The objective of this work was to evaluate the effects of different pruning times and intensities on the phenology and yield of 'Paluma' guava trees, in Pinheiros, Espírito Santo State, Brazil. The plants were submitted to three pruning intensities (heavy, medium and light, in four dates (November 25, 2005; December 21, 2005; January 27, 2006 and February 23, 2006. The period between pruning and the beginning of fruit ripening varied from 189 (pruning in November and December to 203 days (pruning in February. Regardless of pruning time, the larger numbers of buds and established branches occurred in plants submitted to light pruning. Plants submitted to heavy pruning produced the smallest numbers of

  14. CARACTERIZAÇÃO MORFOLÓGICA DE PLÂNTULAS DURANTE A GERMINAÇÃO DE SEMENTES DE Psidium cattleianum E Acca sellowiana (MYRTACEAE

    Directory of Open Access Journals (Sweden)

    Juliano Pereira Gomes

    2015-01-01

    Full Text Available This study describes the morphological characterization during seedling development of Psidium cattleianum Sabine e Acca sellowiana (O. Berg Burret. To describe germination and seedling morphology, 100 seeds were allowed to germinate on germitest paper as substrate at a temperature of 25 °C. Were analyzed: type, shape and color of the root, hairiness, shape and coloration of hypocotyl and epicotyl, consistency, texture, shape, venation, color, type of board, apex and base of the cotyledons and protophilus. The germination is epigeous phanerocotyledonal for both species, forming seedlings with an axial root system, long pivoting main root with paracotyledons and simple eophylls, opposites. Glands and secreting cells were observed in all organs except in the root system for both species. The germination of the Psidium cattleianum seed begins approximately 10 days after sowing, when the operculum opens followed immediately by the root protrusion. Acca sellowiana shows a long, cylindrical, erect, brownish- red and glabrous hypocotyl after 28 days. When the paracotyledons are totally exposed, they immediately show an intense green color, demonstrating the photosynthetic potential of the seedling growth. The germination process description alongside the morphology of seedlings constitutes an important element for recognition of species.

  15. EFEITO DA ADUBAÇÃO N, P E K NO TEOR DE SÓLIDOS SOLÚVEIS TOTAIS DE FRUTOS DE GOIABEIRA (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    William NATALE

    2009-07-01

    Full Text Available

    RESUMO: Com o objetivo de estudar os efeitos da adubação nitrogenada, fosfatada e potássica sobre o teor de sólidos solúveis totais de frutos de goiabeira, foram realizados seis ensaios de campo, utilizando-se plantas das cultivares rica e paluma, em duas regiões produtoras do Estado de São Paulo, durante três anos. Os resultados mostraram que o grau Brix dos frutos não foi significativamente afetado pelas doses de N, P ou K, durante todo o ensaio. Os frutos da cv. Rica apresentaram valores de sólidos solúveis totais entre 8,0 e 10,8, enquanto a cv. Paluma apresentou teores entre 8,4 e 9,65. PALAVRAS – CHAVE: Goiaba; nutrição; Brix; fertilizante N, P e K.

  16. ITS-rDNA phylogeny of Colletotrichum spp. causal agent of apple Glomerella leaf spot Filogenia por ITS-rDNA de Colletotrichum spp., agente causal da mancha foliar da Gala em macieira

    Directory of Open Access Journals (Sweden)

    Diorvania Ribeiro Giaretta

    2010-04-01

    Full Text Available Several diseases have affected apple production, among them there is Glomerella leaf spot (GLS caused by Colletotrichum spp. The first report of this disease in apple was in plants nearby citrus orchards in São Paulo State, Brazil. The origin of this disease is still not clear, and studies based on the molecular phylogeny could relate the organisms evolutionarily and characterize possible mechanisms of divergent evolution. The amplification of 5.8S-ITS (Internal Transcribed Spacer of rDNA of 51 pathogenic Colletotrichum spp. isolates from apples, pineapple guava and citrus produced one fragment of approximately 600 bases pairs (bp for all the isolates analyzed. The amplified fragments were cleaved with restriction enzymes, and fragments from 90 to 500bp were obtained. The sequencing of this region allowed the generation of a phylogenetic tree, regardless of their hosts, and 5 isolated groups were obtained. From the "in silico" comparison, it was possible to verify a variation from 93 to 100% of similarity between the sequences studied and the Genbank data base. The causal agent of GLS is nearly related (clustered to isolates of pineapple guava and to the citrus isolates used as control.A produção de maçã vem sendo comprometida pela ocorrência de muitas doenças, entre as quais se destaca a Mancha Foliar de Glomerella (MFG, causada por Colletotrichum spp. O primeiro relato dessa doença em maçã foi registrado em plantas próximas a pomares de citrus no Estado de São Paulo, Brasil. A origem da MFG ainda não está bem clara, e estudos baseados na filogenia permitirão relacionar o organismo evolutivamente, possibilitando caracterizar possíveis mecanismos divergentes de evolução. A amplificação da região 5.8S-ITS (espaçador interno transcrito do rDNA de 51 isolados de Colletotrichum patogênicos em de maçã, goiabeira serrana e citrus produziu um fragmento de aproximadamente 600 pares de bases (pb para todos os isolados analisados

  17. 5-Azacytidine combined with 2,4-D improves somatic embryogenesis of Acca sellowiana (O. Berg) Burret by means of changes in global DNA methylation levels.

    Science.gov (United States)

    Fraga, Hugo P F; Vieira, Leila N; Caprestano, Clarissa A; Steinmacher, Douglas A; Micke, Gustavo A; Spudeit, Daniel A; Pescador, Rosete; Guerra, Miguel P

    2012-12-01

    DNA methylation is an epigenetic regulatory mechanism of gene expression which can be associated with developmental phases and in vitro morphogenetic competence in plants. The present work evaluated the effects of 5-azacytidine (AzaC) and 2,4-dichlorophenoxyacetic acid (2,4-D) on Acca sellowiana somatic embryogenesis (SE) and global DNA methylation levels by high-performance liquid chromatography mass spectrometry (HPLC/MS/MS). 2,4-D-free treatments revealed no somatic embryo formation in both accessions tested. Treatments supplemented with 2,4-D pulse plus AzaC in the culture medium resulted in increased embryo formation. In AzaC-free treatment, HPLC/MS/MS analysis showed a gradual increase in methylation levels in cultures of both accessions tested during SE induction. Treatment with AzaC and 2,4-D-free resulted in a marked decrease in methylation for both accessions, ranging from 37.6 to 20.8 %. In treatment with 2,4-D and AzaC combined, the 85 accession showed increasing global methylation levels. Otherwise, the 101X458 accession, in the same treatment, showed a decrease between 10 and 20 days, followed by an increase after 30 days (39.5, 36.2 and 41.6 %). These results indicate that 2,4-D pulse combined with AzaC improves SE induction. However, the conversion phase showed that although positively influencing SE induction, AzaC had a dysregulatory effect on the stage of autotrophic plant formation, resulting in significantly lower conversion rates. The results suggest that DNA methylation dramatically influences SE in Acca sellowiana, and global DNA methylation dynamics are related to morphogenetic response. 5-Azacytidine combined with 2,4-D increases the number of Acca sellowiana somatic embryos. Global DNA methylation is directly affected by these compounds.

  18. [Abundances of ammonia-oxidizing archaeal accA and amoA genes in response to NO2 - and NO3 - of hot springs in Yunnan province].

    Science.gov (United States)

    Song, Zhaoqi; Wang, Li; Zhou, Enmin; Wang, Fengping; Xiao, Xiang; Zhang, Chuanlun; Li, Wenjun

    2014-12-04

    Yunnan hot springs have highly diverseammonia-oxidizing archaea (AOA), which are autotrophic and can fix CO2 using the 3-hydroxypropionate/ 4-hydroxybutyrate (HP/HD) pathway. In this study, we investigated the abundances of prokaryotic 16S rRNA gene and archaeal accA and amoA genes in the sediments of hot springs of Yunnan Province, and analysed the correlations between the above gene abundances and environmental factors. We selected the sediments of twenty representative hot springs, and detected the gene abundances by quantitative polymerase chain reaction (qPCR). The principal component analysis (PCA) and the Mantel test in the R software package were performed for the correlations of gene abundance and environmental variables. The bacterial and archaeal 16S rRNA gene abundances were from 6.6 x 10(7) to 4.19 x 10(11) and from 1.27 x 10(6) to 1.51 x 10(11) copies/g sediment, respectively; Archaeal accA and amoA genes were from 8.89 x 10(3) to 6.49 x 10(5) and from 7.64 x 10(3) to 4.36 x 10(5) copies/g sediment, respectively. The results of mantel test showed that accA gene was significantly (R = 0.98, P < 0.001) correlated with amoA gene; Both of them also were correlated significantly with NO2- and NO3 -, but not with pH. The abundances of bacterial and archaeal 16S rRNA genes and the ratio between them varied significantly among Yunnan hot springs. The archaealaccA and amoA genes showed significant correlation with each other, validating our previous finding that AOA in terrestrial hot springs might acquire energy from ammonia oxidation coupled with CO2 fixation using the 3-hydroxypropionate/4-hydroxybutyrate pathway.

  19. Estudo anatômico do crescimento do fruto em Acca sellowiana Berg. Anatomic study of Acca sellowiana Berg. fruit growth

    Directory of Open Access Journals (Sweden)

    Karin Esemann-Quadros

    2008-06-01

    Full Text Available A Acca sellowiana Berg. (Myrtaceae é uma frutífera nativa dos planaltos meridionais do Sul do Brasil e que se encontra em processo de domesticação. Seus frutos são doce-acidulados e podem ser consumidos in natura ou empregados para a produção de sucos e doces. Assim, informações sobre o desenvolvimento, morfologia e anatomia de seus frutos são de grande interesse e foram objetos do presente trabalho. O fruto (ovário mais hipanto, no tempo zero (plena floração, tem, em média, 0,6 cm de altura e 0,4 cm de diâmetro, sendo cerca de dez vezes menor que o fruto maduro. Longitudinalmente, identificam-se três regiões distintas: locular, sublocular e prolongamento. Transversalmente, na região mediana, estão delimitadas três regiões: 1 epiderme (casca: com tricomas unicelulares e simples; 2 região parenquimática: rica em braquiesclereídes, isoladas ou em pequenos grupos (2-3 células, com oito feixes vasculares concêntricos perifloemáticos distribuídos radialmente e muitas glândulas esféricas subepidérmicas; 3 região interna (polpa: com células pequenas, cúbicas, nitidamente dispostas em 3-4 camadas ao redor dos lóculos, várias contendo drusa. Quatro lóculos são separados pelos septos e vários óvulos nascem de placentas axiais, com duas fileiras por lóculo. Não ocorrem nectários. À medida que o fruto se desenvolve, surgem, na região intermediária, grupos de células de paredes finas, que crescem muito e diferenciam-se em braquiesclereídes. As placentas crescem, ocupando todo o espaço interior dos lóculos à medida que estes aumentam de tamanho e as sementes se desenvolvem. Assim, o fruto maduro apresenta uma região periférica de consistência firme e gosto adstringente, e uma região central macia e adocicada.Acca sellowiana Berg. (Myrtaceae is a fruit-bearing treelet or shrub native from the highlands of South Brazil. The plant is currently in the domestication process. Its fruit is sweet-acidified and

  20. THERMAL TIME FOR REPRODUCTIVE PHENOLOGICAL STAGES OF PINEAPPLE GUAVA (Acca sellowiana (O. Berg Burret

    Directory of Open Access Journals (Sweden)

    Alfonso PARRA-CORONADO

    2015-01-01

    Full Text Available Crop development of feijoa (Acca sellowiana (O. Berg Burret is mainly stimulated by temperature, but is also affected by other climatic factors. The determination of the development in terms of thermal time or growing degree days (GDD is more precise than calendar days. The aim of this study was to propose a phenological model for feijoa cv. Quimba, in which the base temperature (Tb for four different phenological stages and its duration in terms of GDD is estimated to predict the timing of anthesis, fruit setting and harvesting. During the years 2012 to 2014, in two localities of the department of Cundinamarca, Colombia, twenty trees per farm were labeled, dates of occurrence of phenological stages, starting from floral button were recorded. Tb was estimated using the method of minimum coefficient of variation, as well as duration of the four reproductive phenological stages in terms of GDD. The results showed that Tb and GDD vary depending on the stage of development of the crop; in general, an average of 2651 GDD and 189 days is required to reach the flower bud to the fruit harvest. The parameters of the regression analysis showed that the model successfully predicted phenological stages when estimated Tb for each of them was used, with high determination coefficient. Cross-validation showed good statistical fit between predicted and observed values; intercept was not significantly different from zero (p <0.05 and the slope was statistically equal to one TIEMPO TÉRMICO PARA ESTADOS FENOLÓGICOS REPRODUCTIVOS DE LA FEIJOA (Acca sellowiana (O. Berg Burret El desarrollo del cultivo de feijoa (Acca sellowiana (O. Berg Burret es principalmente estimulado por la temperatura, pero también es afectado por otros factores climáticos. La determinación del desarrollo en términos de tiempo térmico o grados día de crecimiento (GDC es más precisa que en días calendario. El objetivo de este estudio fue proponer un modelo fenológico para la feijoa

  1. Crescimento de porta-enxerto de goiabeira sob águas salinizadas e doses de nitrogênio

    Directory of Open Access Journals (Sweden)

    Leandro de Pádua Souza

    2015-09-01

    Full Text Available A salinidade da água de irrigação pode afetar a exploração de cultivos principalmente nas regiões áridas e semiáridas, entretanto, algumas alternativas podem favorecer a exploração agrícola nestas condições. Desse modo, objetivou-se com este trabalho, avaliar a interação entre adubação nitrogenada e a salinidade da água de irrigação sob o crescimento de porta-enxerto de goiabeira ‘Crioula’ em condição de semiárido do nordeste do Brasil. O experimento foi conduzido em tubetes sob condições de ambiente protegido no CCTA/UFCG. Utilizou-se o delineamento experimental em blocos casualizados, com os tratamentos dispostos em esquema fatorial 5 x 4, correspondentes a  cinco níveis de condutividade elétrica da água – CEa (0,3; 1,1; 1,9; 2,7 e 3,5 dS m-1 e quatro doses de nitrogênio (70, 100, 130 e 160% de N da dose recomendada para a cultura, com 4 repetições e 5 plantas por parcela. A dose de 70% de N (541,1 mg de N dm-1 de solo proporciona maior diâmetro de caule de porta-enxerto de goiabeira crioula aos 70 e 145 dias após a emergência (DAE, sobre a área foliar e altura de planta aos 145 DAE e na taxa de crescimento absoluto diâmetro do caule dos 25 a 145 DAE. A irrigação com água cuja salinidade era acima de 0,3 dS m-1 afeta positivamente a razão de área foliar e de forma negativa, o número de folhas, a área foliar e o diâmetro do caule. Houve interação significativa entre os fatores adubação nitrogenada e salinidade da água de irrigação apenas para a variável número de folhas aos 145 DAE.Guava rootstocks growth in salted water and nitrogen levelsAbstract: Salt stress suffered by plants due to concentration of irrigation water salts reduces the ability of exploitation of cultures especially in arid and semiarid regions. Thus, the aim of this study was to evaluate the effect of salinity of irrigation water on the growth of rootstock of guava 'Crioula' associated with increasing doses of

  2. SUBSTRATOS E TEMPERATURAS PARA TESTE DE GERMINAÇÃO EM SEMENTES DE MYRTACEAE

    Directory of Open Access Journals (Sweden)

    Juliano Pereira Gomes

    2016-01-01

    Full Text Available The Brazilian species of the Myrtaceae comprises several arborescent and shrubby plants that are used to produce fruit for fresh consumption or industrialization. Information about the seed quality evaluations for these species are scarce in the literature, mainly related to the adequacy of the germination tests. This study tests different substrates and temperatures to test the germination of Acca sellowiana (O. Berg Burret. (goiaba-serrana, Campomanesia xanthocarpa O. Berg (guabiroba, Eugenia involucrata DC. (cereja-do- mato and Eugenia pyriformis Camb. (uvaia seeds. Two seed lots were collected at different locations, one for each species, according to the requirements of the selection matrices. Sand and germitest paper towel rolls substrates were used, moistened with distilled water, and submitted to temperatures of 15 °C, 25 °C, 30 °C, 35 °C and 20-30 °C under constant light, on P.D.A. germinators. The experimental delineation was entirely randomized with four repetitions of 25 seeds/treatment/lot/specie, and treatment means were compared using the Tukey test (P < 0.01. The germination tests can be conducted at 25 °C using paper roll substrate for Eugenia pyriformis and E. involucrate . Both substrates can be used to Acca sellowiana germination test at 25 °C. The temperature of 25 °C and alternating 20-30 °C are indicated for Campomanesia xanthocarpa , as well as sand and paper roll substrates.

  3. Normas preliminares dris e faixas de suficiência para goiabeira 'Paluma' Preliminary dris norms and sufficiency range for 'Paluma' guava tree

    Directory of Open Access Journals (Sweden)

    Henrique Antunes de Souza

    2013-03-01

    Full Text Available O diagnóstico nutricional a partir da análise do tecido foliar é um instrumento eficiente para detectar desequilíbrios e auxiliar no processo de recomendação de adubação. Assim, objetivou-se avaliar a relação entre os índices DRIS e os teores foliares de nutrientes, estabelecer teores foliares adequados de nutrientes com o DRIS e validar normas DRIS para a goiabeira 'Paluma'. Avaliou-se um pomar comercial nas condições de cultivo do Estado de São Paulo, durante seis safras de produção de frutos, provenientes de ensaios de adubação orgânica e mineral, totalizando 168 amostras. A ordem dos nutrientes limitantes por falta em ordem decrescente foram: Fe>K>Mn>Ca>B>N>P>Cu>S>Mg>Zn, e limitantes por excesso em ordem decrescente foram: Cu>Fe>P>Mn=Mg>Zn>Ca>B>K>S>N. As faixas adequadas, provenientes dos índices DRIS, são: 18-21; 1,5-1,7; 15-17; 8-11; 1,8-2,5 e 2,5-2,9 (g kg-1 para os macronutrientes N, P, K, Ca, Mg e S, respectivamente, e 26-38; 5-57; 54-112; 53-101 e 13-126 (mg kg-1 para os micronutrientes B, Cu, Fe, Mn e Zn, respectivamente. A produtividade das goiabeiras esteve associada ao estado nutricional.The nutritional diagnosis based on the analysis of leaf tissue is an efficient tool for detecting imbalances and help the process of fertilization recommendation. Thus, it was evaluated to establish preliminary DRIS norms, and to derive critical levels and sufficiency ranges of nutrients in the leaf tissue to Paluma guava cultivar in commercial orchards growing conditions in the State of São Paulo. It was evaluated six harvests of fruit production, from organic and mineral fertilizer, totaling 168 samples. The order of limiting nutrients for failure in descending order were: Fe> K> Mn> Ca> B> N> P> Cu> S> Mg> Zn, and limiting excess in descending order were: Cu> Fe> P> Mn = Mg> Zn> Ca> B> K> S> N. The tracks from the appropriate DRIS indices are: 18-21, 1.5 to 1.7, 15-17, 8-11, 1.8 to 2.5 and 2.5 to 2.9 (g kg-1 for the

  4. Avaliação da sensibilidade da goiabeira 'Pedro Sato' ao ozônio

    Directory of Open Access Journals (Sweden)

    Regina Maria de Moraes

    2011-09-01

    Full Text Available O objetivo deste trabalho foi avaliar a sensibilidade da goiabeira 'Pedro Sato' ao ozônio (O3, em comparação à cultivar Paluma, descrita como sensível. Oito plantas de cada cultivar foram submetidas separadamente a ar filtrado e a ar filtrado + O3, cinco horas por dia, durante quatro dias. Foram avaliadas fotossíntese (Asat, injúrias foliares visíveis e concentração de antocianinas e taninos. Plantas das duas cultivares também foram expostas, durante três meses, a condições ambientais em local contaminado por O3, tendo-se avaliado fotossíntese, injúrias foliares e crescimento. Plantas fumigadas com O3 apresentaram redução de Asat e da atividade fotoquímica, além de manifestação de injúrias foliares. 'Paluma' apresentou maior redução de Asat, injúrias foliares mais severas e redução de taninos. Quando exposta ao ambiente contaminado, 'Paluma' apresentou trocas gasosas mais altas, mas apresentou redução de Asat 30 dias antes que 'Pedro Sato'. O crescimento não foi afetado em 'Pedro Sato', cujas injúrias foliares tiveram menor incidência, severidade e precocidade do que em 'Paluma'. A menor taxa de crescimento de 'Paluma' indica maior sensibilidade ao O3. Apesar de responder com menor intensidade ao estresse induzido pelo O3, a cultivar Pedro Sato não pode ser considerada tolerante, pois apresenta danos fotoquímicos, injúrias foliares e alterações nos conteúdos de metabólitos secundários quando exposta a esse poluente.

  5. Estimativa do consumo hídrico da goiabeira, utilizando estações agrometeorológicas automática e convencional

    Directory of Open Access Journals (Sweden)

    Teixeira Antônio Heriberto de Castro

    2003-01-01

    Full Text Available A evapotranspiração (ETc e o coeficiente de cultura (Kc da goiabeira (Psidium guajava L. cv. Paluma, aos dois anos e três meses após o plantio e irrigada por microaspersão, foram determinados durante um ciclo de produção, em Petrolina-PE, Brasil. O método da razão de Bowen foi utilizado para a estimativa da evapotranspiração da cultura (ETc, enquanto o de Penmam-Monteith foi empregado para a estimativa da evapotranspiração de referência (ETo, com a utilização de duas estações agrometeorológicas, uma automática e outra convencional. A ETc acumulada entre a poda (junho de 2001 e a colheita (dezembro de 2001 foi de 906 mm em 200 dias, correspondendo a um valor médio de 4,53 ± 0,68 mm.dia-1. O Kc apresentou valores entre 0,75 a 0,93 e de 0,61 a 0,84, quando foram usadas as estações convencional e automática, respectivamente.

  6. Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

    Science.gov (United States)

    Mouw, M; Pintel, D J

    1998-11-10

    GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

  7. Heterologous co-expression of accA, fabD, and thioesterase genes for improving long-chain fatty acid production in Pseudomonas aeruginosa and Escherichia coli.

    Science.gov (United States)

    Lee, Sunhee; Jeon, Eunyoung; Jung, Yeontae; Lee, Jinwon

    2012-05-01

    The goal of the present study was to increase the content of intracellular long-chain fatty acids in two bacterial strains, Pseudomonas aeruginosa PA14 and Escherichia coli K-12 MG1655, by co-overexpressing essential enzymes that are involved in the fatty acid synthesis metabolic pathway. Recently, microbial fatty acids and their derivatives have been receiving increasing attention as an alternative source of fuel. By introducing two genes (accA and fabD) of P. aeruginosa into the two bacterial strains and by co-expressing with them the fatty acyl-acyl carrier protein thioesterase gene of Streptococcus pyogenes (strain MGAS10270), we have engineered recombinant strains that are efficient producers of long-chain fatty acids (C16 and C18). The recombinant strains exhibit a 1.3-1.7-fold increase in the production of long-chain fatty acids over the wild-type strains. To enhance the production of total long-chain fatty acids, we researched the carbon sources for optimized culture conditions and results were used for post-culture incubation period. E. coli SGJS17 (containing the accA, fabD, and thioesterase genes) produced the highest content of intracellular total fatty acids; in particular, the unsaturated fatty acid content was about 20-fold higher than that in the wild-type E. coli.

  8. Influência do alumínio no crescimento e na acumulação de nutrientes em mudas de goiabeira

    Directory of Open Access Journals (Sweden)

    J. O. Salvador

    2000-12-01

    Full Text Available Durante 110 dias, realizou-se um experimento em solução nutritiva, para avaliar os efeitos do alumínio nas concentrações de 0, 5, 10, 15, 20 e 25 mg L-1, em pH 4,0, sobre o crescimento de mudas de goiabeira, absorção e acumulação de macronutrientes e de Cu, Fe, Mn, Zn e Al. Os sintomas visuais de fitotoxidez, associados às doses 20 e 25 mg L-1 de Al, foram caracterizados pela menor altura das plantas, ausência de ramificação, menor diâmetro do caule e raízes mais escuras; as folhas apresentaram dimensões menores e pecíolos avermelhados. Em doses relativamente baixas, o alumínio promoveu resposta positiva de crescimento, porém, em doses altas, os teores de macronutrientes e de Fe, Mn e Zn nas folhas de diagnose (3º e 4º pares a partir do ápice, bem como o conteúdo mineral nas diversas partes da planta, foram influenciados pelas doses de alumínio. A fitotoxidez afetou, mais acentuadamente, os teores de P, Ca, Mg, Mn e Zn. Cerca de 95% do Al absorvido concentrou-se nas raízes.

  9. Concentração de elementos traços em serpentes do litoral e da região serrana do Espírito Santo

    Directory of Open Access Journals (Sweden)

    Alexandra Frossard

    Full Text Available RESUMO: Os elementos químicos, em sua maioria, encontram-se em ciclos bioquímicos e geoquímicos fechados e em concentrações que não causam efeitos nocivos aos organismos. Contudo, ações antrópicas aceleradas promovem alterações ambientais, como o aumento no aporte de contaminantes. Com essas informações, o presente trabalho buscou caracterizar a presença aos elementos traços em duas espécies de serpentes comuns na região sudeste, Boa constrictor e Bothrops jararaca. Os exemplares de B. constrictor (n=18 foram provenientes de atropelamentos ocorridos no trecho da Rodovia ES-060 do Km 0 ao Km 67,5. Os exemplares de B. jararaca (n=18 foram capturados por fazendeiros na zona rural da região serrana do Espírito Santo. Foram analisados 1 grama de fragmento de rim, de espécimes necropsiados. Os rins coletados foram digeridos com mistura ácida (HNO3;HCl; 1:1 a 300oC, 40min e a quantificação de microelementos (Cd, Co, Cr, Cu, Fe, Mn, Ni, Pb e Zn foi realizada por espectrometria de emissão óptica com plasma indutivamente acoplado (ICP OES. Não foram observadas diferenças significativas entre machos e fêmeas, exceto para Cromo nas B. constrictor (p=0,03, com média de 1,6595 nas concentrações de Cr nas fêmeas e 0,2896 em machos. Contudo, quando foram comparadas as diferentes espécies de serpentes, diferentes concentrações foram encontradas, para todos os elementos determinados, com destaque para o Ferro com uma concentração de 106,2mg/g em B. constrictor e 120,3mg/g em B. jararaca, provavelmente por esses animais virem de áreas próximas à portos de minério de ferro. A concentração de Zinco em B. constrictor foi de 1261,8mg/g e em B. jararaca foi de 28,4mg/g. O presente estudo indica que as serpentes analisadas, que habitam as regiões da Grande Vitória e serrana do Espírito Santo apresentam elevadas concentrações dos microelementos Zn e Fe.

  10. Structural aspects of the zygotic embryogenesis of Acca sellowiana (O. Berg Burret (Myrtaceae Aspectos estruturais da embriogênese zigótica em Acca sellowiana (O. Berg Burret (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Rosete Pescador

    2009-03-01

    Full Text Available Acca sellowiana has anatropous, bitegmic and crassinucellate ovules. The outer and inner integuments are double-layered except in the micropyle, where they are composed of more layers; the micropyle is zig-zag shaped. The egg apparatus lies at the micropylar pole, and the zynergids present a conspicuous filiform apparatus. The antipodal cells are present in the chalazal region, persisting before the occurrence of double fertilization. The zygote is visible 21 days after pollination; nuclear endosperm is already present. The first mitotic division of the zygote occurs at 24th day. The globular, cordiform and torpedo embryo stages can be seen at 30, 45 and 60 days after pollination, respectively. The mature embryo characterized by the presence of a well-developed hypocotyl-radicular axis with two fleshy and folded cotyledons was observed 120 days after pollination. Endosperm is absent in the seeds, and the embryo has spiral form, characteristic of Myrtinae. The zygotic embryology studies of A. sellowiana indicate that this species has embryological characteristics which are in agreement with those reported for Myrtaceae (Myrteae, Myrtinae, and also broaden the knowledge about the sexual reproduction of this native species, whose commercial cultivation has been growing.Acca sellowiana apresenta óvulos anátropos, bitegumentados e crassinucelados. Os tegumentos externo e interno são constituídos por duas camadas de células, exceto na região da micrópila em que têm maior número de camadas; a micrópila apresenta-se em ziguezague. O aparelho oosférico ocupa a região micropilar com sinérgides apresentando aparato fibrilar conspícuo. Na região calazal, as três antípodas estão presentes antes da ocorrência da dupla fecundação. O zigoto é formado 21 dias após a polinização controlada, e o endosperma do tipo nuclear já está presente. O zigoto sofre a primeira divisão mitótica no 24º dia. Embriões nas fases globular, cordiforme

  11. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    Science.gov (United States)

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  12. Genetic characterization of natural populations of pineapple guava (Acca sellowiana, with heterologous microsatellites markers

    Directory of Open Access Journals (Sweden)

    Karine Louise dos Santos

    2011-12-01

    Full Text Available Pineapple guava (Acca sellowiana is a native species from south Brazil and northeast Uruguay, and due to the unique flavor of its fruits, it is an income-generating alternative to small farmers. Knowledge on genetic diversity is an important tool for genetic improvement and conservation. Aiming to increase the knowledge with regarde to the species genetic diversity, fi ve natural populations of A. sellowiana were analyzed through microsatellites markers developed from Eucalyptus grandis W. Hill ex Maiden x E. urophylla S.T. Blake complex. Using 10 pairs of selected markers, 122 plants were characterized. The mean values for expected and observed heterozigosity were 0.42 and 0.47, respectively. The fˆ estimates did not differ from zero to four out of the five populations evaluated, suggesting a small inbreeding effect. In addition, private alleles and high genetic divergence was observed. the average genetic divergence among the populations was st Fˆ = 0,13 e st Rˆ = 0,14, mostly due to the incidenceof rare or exclusive alleles among some populations.

  13. Crescimento inicial de mudas de pinheira e goiabeira em solo salino-sódico com corretivos

    Directory of Open Access Journals (Sweden)

    Jordânia Xavier de Medeiros

    2014-06-01

    Full Text Available Objetivou-se avaliar o efeito do gesso agrícola sobre os atributos químicos de um solo salino-sódico e o crescimento de mudas de goiabeira e pinheira. O trabalho foi realizado em casa de vegetação da UFCG/CSTR em Patos, PB. Amostras de um solo salino-sódico foram obtidas do Perímetro Irrigado de São Gonçalo. O experimento constitui-se de um tipo de solo, duas espécies, três doses de gesso agrícola (00, 100 e 200% da NG e 4 repetições. As parcelas foram distribuídas em DIC. As sementes de pinha e goiaba foram semeadas em tubetes e após 30, as mudas foram transplantadas segundo padronização do diâmetro do coleto, número de folhas, altura e transferidas para os solos salinizados, observando o crescimento através de medições semanais da altura das plantas por um período de 104 dias. Houve redução significativa nos teores de sódio no solo com o aumento do nível de gesso aplicado, o mesmo ocorrendo para o pH e melhoria nas propriedades químicas do solo. As mudas apresentaram redução na altura, número de folhas, na massa seca da parte aérea e da raiz com a aplicação do corretivo. A aplicação de gesso em solos salino-sódico para cultivo de goiaba e pinha não apresentou resultados satisfatórios.

  14. Evidência da atuação do sistema de auto-incompatibilidade tardia em Acca Sellowiana (berg burret. (Myrtaceae Evidence of the late-acting self-incompatibility system in Acca Sellowiana (berg burret. (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Karine Louise dos Santos

    2007-04-01

    Full Text Available Acca sellowiana (Myrtaceae é uma frutífera nativa da região Sul do Brasil e nordeste do Uruguai, que vem despertando grande interesse devido ao alto potencial organoléptico de seus frutos. Neste trabalho, teve-se como objetivo a caracterização do tipo de sistema de incompatibilidade atuante em A. sellowiana, através da avaliação do desenvolvimento dos tubos polínicos. Utilizaram-se dois acessos: 458, sendo autocompatível, e 101, auto-incompatível. A maior porcentagem de germinação de grãos de pólen foi observada no acesso 101, com 68,8% de grãos de pólen germinados. Não foram observadas diferenças no crescimento dos tubos polínicos em pistilos autopolinizados ou de polinização cruzada, em ambos os acessos. O crescimento completo do tubo polínico até o ovário ocorreu em pistilos coletados 96 horas após a polinização, independentemente do tratamento aplicado. Sugere-se a ocorrência de auto-esterilidade ou auto-incompatibilidade tardia ou pós-zigótica, considerando que o abortamento dos frutos de A. sellowiana é uniforme e ocorre num prazo curto, por volta de 20 a 30 dias após a fertilização das flores.Acca sellowiana (Myrtaceae is a native fruit species from the South Brazil and northeast Uruguay which is attracting great interest due to the high organoleptic potential of its fruits. In this study we aimed to characterize the type of incompatibility system which occurs in A. sellowiana, through the evaluation of the polinic tube development. Two accesses were used: being 458 self-compatible and 101 self- incompatible. The highest percentage of pollen grains germination, 68,8%, was observed in the access 101. It was not observed differences in the growth of the polinic tubes between self-pollinated pistils and cross-pollinated ones in both accesses. The complete growth of the polinic tube until reaching the ovary occurred only in pistils collected 96 hours after the polinization, independent of the treatment. The

  15. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian Sea

    Science.gov (United States)

    Yakimov, Michail M.; Cono, Violetta La; Denaro, Renata

    2009-05-01

    The autotrophic and ammonia-oxidizing crenarchaeal assemblage at offshore site located in the deep Mediterranean (Tyrrhenian Sea, depth 3000 m) water was studied by PCR amplification of the key functional genes involved in energy (ammonia mono-oxygenase alpha subunit, amoA) and central metabolism (acetyl-CoA carboxylase alpha subunit, accA). Using two recently annotated genomes of marine crenarchaeons, an initial set of primers targeting archaeal accA-like genes was designed. Approximately 300 clones were analyzed, of which 100% of amoA library and almost 70% of accA library were unambiguously related to the corresponding genes from marine Crenarchaeota. Even though the acetyl-CoA carboxylase is phylogenetically not well conserved and the remaining clones were affiliated to various bacterial acetyl-CoA/propionyl-CoA carboxylase genes, the pool of archaeal sequences was applied for development of quantitative PCR analysis of accA-like distribution using TaqMan ® methodolgy. The archaeal accA gene fragments, together with alignable gene fragments from the Sargasso Sea and North Pacific Subtropical Gyre (ALOHA Station) metagenome databases, were analyzed by multiple sequence alignment. Two accA-like sequences, found in ALOHA Station at the depth of 4000 m, formed a deeply branched clade with 64% of all archaeal Tyrrhenian clones. No close relatives for residual 36% of clones, except of those recovered from Eastern Mediterranean, was found, suggesting the existence of a specific lineage of the crenarchaeal accA genes in deep Mediterranean water. Alignment of Mediterranean amoA sequences defined four cosmopolitan phylotypes of Crenarchaeota putative ammonia mono-oxygenase subunit A gene occurring in the water sample from the 3000 m depth. Without exception all phylotypes fell into Deep Marine Group I cluster that contain the vast majority of known sequences recovered from global deep-sea environment. Remarkably, three phylotypes accounted for 91% of all Mediterranean

  16. Atividade antifúngica do extrato de Psidium guajava Linn. (goiabeira sobre leveduras do gênero Candida da cavidade oral: uma avaliação in vitro

    Directory of Open Access Journals (Sweden)

    Pollianna M. Alves

    Full Text Available O presente estudo teve como objetivo avaliar a atividade antifúngica do extrato da folha de Psidium guajava Linn. sobre leveduras do gênero Candida, isoladas da cavidade oral, incluindo Candida albicans, C. tropicalis, C. stelatoidea e C. krusei, em análise comparativa com o gluconato de clorexidina à 0,12%. Os ensaios antifúngicos foram realizados pelas técnicas de difusão em meio sólido para a determinação da Concentração Inibitória Mínima (CIM. A CIM do extrato de Psidium guajava sobre C. albicans e C. tropicalis foi de 1:32, C. stelatoidea e C. krusei de 1:2, formando, em média, halos de inibição entre 11 e 22 mm. Diante dos resultados, concluí-se que o extrato da folha de Psidium guajava (goiabeira apresenta a capacidade de inibir o crescimento de leveduras do gênero Candida da cavidade oral, o que sugere a possibilidade de utilização deste extrato como meio alternativo no tratamento das candidose orais.

  17. Moda rápida na indústria calçadista: intervenção setorial no arranjo produtivo de Nova Serrana

    Directory of Open Access Journals (Sweden)

    Giancarlo Medeiros Pereira

    2014-09-01

    Full Text Available Em 2008, fabricantes de calçados da região de Nova Serrana juntamente com seus fornecedores de insumos articularam uma intervenção setorial destinada a aumentar a diversidade da oferta na cadeia de suprimentos, acelerar o desenvolvimento de novos produtos e reduzir os custos dos insumos. A despeito do interesse das partes, a intervenção não produziu os resultados desejados. Este artigo busca entender os motivos que bloquearam tais objetivos. Foram estudados quinze fabricantes de calçados e quinze fornecedores de insumos. O método de pesquisa foi o estudo de caso múltiplo. Em sessões de grupos focados com os empresários, foi construída uma estrutura de construtos e variáveis que desvelou a inter-relação entre a flexibilidade de suprimento e o desenvolvimento de produtos. Os achados sugerem que a demanda por exclusividade de insumos, imposta pelos grandes fabricantes de calçados, a possibilidade de conflito com os representantes dos grandes e médios fornecedores de insumos, o receio de cópia das criações, a desatenção a demandas locais e o desempenho insatisfatório em entregas causaram o insucesso da intervenção.

  18. ADUBAÇÃO NITROGENADA E POTÁSSICA EM GOIABEIRAS ‘PALUMA’:II. EFEITO NO ESTADO NUTRICIONAL DAS PLANTAS

    Directory of Open Access Journals (Sweden)

    DANIEL ANGELUCCI DE AMORIM

    2015-03-01

    Full Text Available RESUMO A adequada adubação mineral de pomares de goiabeira, sob manejo intensivo, é fator preponderante na produtividade, e o acompanhamento do estado nutricional das plantas contribui para a eficiência desta prática agronômica.Objetivou-se pesquisar o efeito de diferentes doses de nitrogênio e potássio sobre o estado nutricional de goiabeiras‘Paluma’. O experimento foi conduzido em Vista Alegre do Alto-SP, em pomar irrigado, com sete anos deidade, manejado com podas de frutificação, durante quatro ciclos de produção consecutivos. O solo é o Argissolo Vermelho-Amarelo distrófico. O delineamento experimental foi em blocos ao acaso, com trêsrepetições, em esquema fatorial com quatro doses de nitrogênio (0; 0,5; 1,0 e 2,0 kg planta-1 de N e quatro depotássio (0;0,55; 1,1 e 2,2 kg planta-1 de K2O. A adubação nitrogenada promoveu aumento nos teores foliares de N e Mn e decréscimo nos teores de P e B, observados do segundo ao quarto ciclo produtivo. A adubaçãonitrogenada elevou os teores de Ca e Mg, respectivamente, no segundo e terceiro ciclos. Com exceção doprimeiro ciclo produtivo, os teores foliares de K e Mn aumentaram em função da adubação potássica, enquanto os teores de Mg, no segundo e quarto ciclos, diminuíram em função dessa adubação.

  19. Efeito do composto de resíduo sólido urbano no teor de metais pesados em solo e goiabeira Effect of the urban solid waste compost in the heavy content of metals in soil and guava orchard (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Leonardo Santos Collier

    2004-12-01

    Full Text Available O trabalho foi realizado no município de Cachoeiras de Macacu (RJ com o objetivo de avaliar as várias formas dos metais Cu, Cr, Mn, Ni, Pb e Zn em solo Gleissolo pouco húmico tratado com composto de resíduos urbanos, e as concentrações desses metais nas folhas e nos frutos de goiabeira (Psidium guajava L.. Foram utilizadas três áreas com históricos distintos: área que recebeu doses de 40 t.ha¹ de composto de resíduo sólido urbano (CRSU na superfície por onze anos consecutivos; área com uma única aplicação de CRSU na cova; e área-controle que não utilizou CRSU e sem goiabeiras. As amostras de solo foram tomadas dentro de cada área, nas camadas de 05; 515 e 1530 cm. A extração seqüencial dos metais contidos nas amostras (05 cm de terra demonstrou uma tendência de redução das formas móveis ou mais biodisponíveis de metais pesados no solo com uso do CRSU. Houve aumento nos teores de metais pesados em folhas e frutos de goiabeira cultivadas em áreas que receberam CRSU; porém os teores obtidos estavam dentro da faixa considerada normal. Há necessidade de monitoramento dos teores totais de metais no solo e nas plantas, devido ao incremento dos teores de metais pesados em solos tratados com CRSU.The work was performed in the municipal district of Cachoeiras de Macacu, Rio de Janeiro State and had as objective to obtain information on the contents of chemical forms of Cu, Cr, Mn, Ni, Pb and Zn in soil Gleissolo pouco húmico treated with composted urban residues, and the concentrations in the leaves and fruits of guava (Psidium guajava L.. Three areas with different land use history were used: area that received doses of 40 t.ha¹ of composted of urban solid residue (CRSU in the surface for eleven consecutive years; area with only one application of CRSU in the hole; and control area, with no guava and no CRSU. The soil samples were taken from each area, in the layers of 05, 515 and 15-30 cm. The sequential extraction of

  20. Efeitos da calagem na fertilidade do solo e na nutrição e produtividade da goiabeira Effects of liming on soil fertility, plant nutrition and guava yield

    Directory of Open Access Journals (Sweden)

    William Natale

    2007-12-01

    Full Text Available A acidez do solo é um dos mais importantes fatores que limitam a produção em regiões tropicais. Assim, o objetivo deste trabalho foi avaliar os efeitos da calagem na fertilidade do solo e na nutrição e produtividade da goiabeira (Psidium guajava L.. O experimento foi realizado na Estação Experimental de Citricultura de Bebedouro, São Paulo, em um Latossolo Vermelho distrófico (V = 26 % na camada de 0-20 cm, no período de agosto/1999 a julho/2006. As doses de calcário empregadas foram: 0; 1,85; 3,71; 5,56 e 7,41 t ha-1. Durante 78 meses após aplicação do corretivo foram realizadas análises químicas de solo. Foi feita avaliação do estado nutricional e da produtividade durante cinco safras agrícolas. A calagem promoveu alteração nos atributos químicos do solo ligados à acidez, elevando o pH, Ca, Mg, soma de bases (SB e saturação por bases (V e diminuindo H + Al, até 60 cm. Os teores foliares de Ca e Mg aumentaram com as doses de calcário. As maiores produções acumuladas de frutos estiveram associadas a um valor de V de 50 % na linha e 65 % na entrelinha das goiabeiras.Soil acidity is one of the most important constraints to agricultural production in the tropics. For this reason, the objective of this research was to evaluate the effects of soil liming on the performance of guava (Psidium guajava L. trees. The experiment took place at the Citrus Experimental Station in Bebedouro, state of São Paulo, Brazil. The soil was a Typic Haplustox (V = 26 % in the 0 to 20 cm layer between August 1999 and July 2006. The following doses of limestone were employed: 0, 1.85, 3.71, 5.56, and 7.41 t ha-1. During the 78 months after starting the experiment, soil chemical attributes were periodically examined. Over a period of five years, the guava tree leaves were analyzed for micro-and macronutrients and the fruit yield was determined. Liming improved the evaluated soil chemical attributes: pH, calcium (Ca, magnesium (Mg, BS, V, and

  1. In Vitro Inhibitory Activity of Acca sellowiana Fruit Extract on End Products of Advanced Glycation.

    Science.gov (United States)

    Muñiz, Alethia; Garcia, Abraham H; Pérez, Rosa M; García, Efren V; González, Daphne E

    2018-02-01

    Hyperglycemia plays an important role in the pathogenesis of diabetic complications, as it increases protein glycation, as well as the progressive accumulation of advanced glycation end products (AGEs), which are complex structures that produce fluorescence. The glycation reaction raises the levels of protein carbonyl, N ε -(carboxymethyl)lysine (CML), and fructosamine and decreases the level of thiol groups. In the present study, the antiglycation activity was determined by fluorescence intensity using the bovine serum albumin (BSA)/glucose, CML method, and the level of fructosamine. The oxidation of proteins was determined by the carbonyl protein content and thiol groups. The results show that the hexane extract of Acca sellowiana (FOH) at different concentrations (0.30-5 mg/ml) significantly inhibited the formation of AGEs in the BSA/glucose model during the 4 weeks of the study. FOH reduced the levels of fructosamine and CML. Our results showed a significant effect of FOH in the prevention of oxidative damage of proteins, as well as an effect on the oxidation of thiol groups and carbonyl proteins. The present study indicates that FOH is effective in inhibiting the glycation of proteins in vitro, so it can prevent or ameliorate the chronic conditions of diabetes associated with the formation of AGEs.

  2. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    Science.gov (United States)

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-03-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

  3. Quality and safety of artisan cheese produced in the serrana region of Santa Catarina

    Directory of Open Access Journals (Sweden)

    Giane Helenita Pontarolo

    2017-05-01

    Full Text Available The serrano artisan cheese produced from raw milk of dairy cattle is a typical product of high-altitude farms in the states of Santa Catarina and Rio Grande do Sul. However, marketing of the cheeses occurs illegally because they lack the minimum maturation period required for cheese produced from raw milk. The production of artisan cheeses is required to follow strict hygiene standards. This study aimed to test the quality and safety of cheeses that were produced in 31 farms of the Serrana region in Santa Catarina after 14 and 28 days of maturation. Coliform count was measured at 35 °C, and presence of other microorganisms such as Escherichia coli, Staphylococcus, Listeria spp., and Salmonella spp. were also tested. Fat and protein percentages, acidity, salt content, and humidity were also evaluated. Data were subjected to statistical analyses using the SAS® software. After 14 and 28 days of maturation, 74.19% (23/31 and 64.52% (20/31 of samples, respectively, showed higher numbers of coliforms at 35 °C than those permissible by law. Higher than permissible numbers of E. coli were observed in 45.16% (14/31 and 48.39% (15/31 of the samples analyzed after 14 and 28 days of maturation, respectively. Coagulase-positive staphylococci values above 103 CFU/g were observed in 54.84% (17/31 and 51.61% (16/31 of cheese samples after 14 and 28 days of maturation, respectively. Contamination with Salmonella spp. was not detected. However, Listeria monocytogenes serovar 4b was isolated in 3.23% (1/31 and 6.45% (2/31 of samples after 14 and 28 days of maturation, respectively. The results of humidity tests classified the cheese samples into three categories: low, medium, and high humidity. Semi fat cheeses were predominant in both maturation periods, although the samples were classified in thin, semi fat, and fat cheeses. The main variations in the compositions of analyzed samples occurred for salt and acidity levels. The maturation process has not proven

  4. Marcadores moleculares RAPD e descritores morfológicos na avaliação da diversidade genética de goiabeiras (Psidium guajava L. = RAPD molecular markers and morphological descriptors in the evaluation of genetic diversity of guava (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Aroldo Gomes Filho

    2010-10-01

    Full Text Available O conhecimento da variabilidade genética e fenotípica entre diferentes acessos de goiabeiras é importante para se apoiar programas de melhoramento dessa espécie na região Norte Fluminense que carece de novas culturas capazes de gerar renda aos produtores locais. O objetivo deste trabalho foi avaliar a divergência genética entre seis cultivares e 19 acessos de goiabeiras, por meio de marcadores moleculares RAPD e características morfoagronômicas. Foram obtidas 117 marcas polimórficas, utilizando-se 28 iniciadores. Os resultados mostraram uma concordância parcial entre os métodos de agrupamentos estudados, com a formação de 12 grupos. O acesso Vita 3 e o acesso 6 foram os mais divergentes, apresentando distância genética de 0,663. A análise comparativa dos agrupamentos revelou que os marcadores RAPD e os descritores morfológicos foram eficientes para discriminação dos acessos e que houve variabilidade genética potencial para uso em Programa de Melhoramento Genético.The knowledge of the genetic and phenotypic variability among different accessions of guava is important for supporting improvement programs of this specie in northern Rio de Janeiro state, which needs new cultivars able to generate income for local farmers. This work aimed to evaluate the genetic divergence among six cultivars and 19 accessions of guava via RAPD molecular markers and morphologicalcharacteristics. One hundred and seventeen polymorphic markers were obtained from 28 primers. The results showed a partial agreement between the methods of studied groupings, with the formation of 12 groups. The accessions ‘Vita 3’and ‘6’ were the most divergent, showing genetic distance of 0.663. The comparative analysis of groupings showed that RAPD markers and morphological descriptors were effective in discriminating the accessions and to show potentialgenetic variability useful in genetic improvement programs.

  5. Description of Lutzomyia (Pifanomyia robusta n. sp. (Diptera, Psychodidae, Phlebotominae from Peruvian Equadorean interandean areas

    Directory of Open Access Journals (Sweden)

    Eunice A. Bianchi Galati

    1995-04-01

    Full Text Available Description of Lutzomyia robusta, n. sp. (Diptera, Psychodidae, Phlebotominae from interandean areas of Peru and Equador. Lutzomyia robusta, n. sp., probable vector of human bartonellosis and cutaneous leishmaniasis, is described and illustrated. This species presents strong affinity with L. serrana (Damasceno & Arouck, 1949 but they can be distinguished by variance analysis of four male characteristics and only one female characteristic. In the variance analysis, populations of L. serrana, of Amazonian areas of Brazil, Peru and Bolivia, the coast of Equador and other areas of Brazil were studied. The synonymy of Lutzomyia guayasi (Rodriguez and L. serrana was corroborated.Descreve-se Lutzomyia (Pifanomyia robusta, sp.n., provável vetora de bartonelose e leishmaniose tegumentar, de ocorrência em vales interandinos no Peru e Equador e que apresenta estreita afinidade com L. serrana (Damasceno e Arouck. A separação de ambas foi possível, por meio de análise de variância de alguns caracteres do macho e apenas um da fêmea. Na análise de variância, foram estudadas populações de L. serrana da região amazônica do Brasil, Peru e Bolívia; costa do Equador; região atlântica e outras áreas do Brasil. Corrobora-se a sinonímia de Phlebotomus guayasi Rodríguez com L. serrana.

  6. Caracterização fenológica da goiabeira 'Pedro Sato' sob diferentes épocas de poda 'Pedro Sato' guava tree phenological characterization in different pruning times

    Directory of Open Access Journals (Sweden)

    Ronaldo Hissayuki Hojo

    2007-04-01

    Full Text Available O cultivo da goiabeira na região de Lavras-MG, vem tendo grande importância, porém não há uma oferta freqüente durante o ano, concentrando muitas vezes a produção em um único período. A prática de podas escalonadas é fundamental para auxiliar o produtor a colher frutos em praticamente todos os meses do ano. Visando a esse escalonamento, objetivou-se a caracterização fenológica da goiabeira 'Pedro Sato', em quatro épocas de poda (setembro, e dezembro de 2003, março e junho de 2004. Foram utilizadas dez plantas, com quatro anos de idade, para cada época de poda. O delineamento foi de blocos casualizados, onde em cada planta foram marcados doze ramos, avaliando-se semanalmente os dados sobre os estádios fenológicos. Com as mensurações, foi possível estabelecer a indicação das diferentes fenofases da cultura, sendo a duração entre a poda e o início da brotação de 30,8 a 39,2 dias; poda ao florescimento de 68,6 a 133 dias; da abertura da flor (floração plena à maturação do fruto de 118,3 a 148,4 dias; e o ciclo poda à colheita foi em média de 214,2, 211,4, 247,8 e 237,3 dias para as podas realizadas em setembro, dezembro, março e junho.Although the guava tree cultivation in the area of Lavras, MG, has had great importance, there is not a frequent offer during the year, concentrating the production in an only period. The practice of staggered prunings is fundamental to aid the producer to pick fruits in practically every month of the year. Seeking that stagger, it was aimed the 'Pedro Sato' guava tree phenological characterization in four pruning times (September and December of 2003, March and June of 2004. Ten four-year-old plants were used for each pruning time in randomized block design, where, in each plant, twelve branches were marked and the data were evaluated weekly on the phenological stages. It was possible to establish the indication of the different phenophases of the culture with the measuring, being

  7. Seca dos ponteiros da goiabeira causada por Erwinia psidii: níveis de incidência e aspectos epidemiológicos Guava bacterial blight due to Erwinia psidii: incidence levels and epidemiological aspects

    Directory of Open Access Journals (Sweden)

    Abi Soares Anjos Marques

    2007-01-01

    Full Text Available Um dos fatores limitantes ao cultivo da goiabeira no Brasil é a 'seca dos ponteiros', causada por Erwinia psidii, presente nas regiões Sudeste e Centro-Oeste, onde se concentram grandes áreas produtoras. Considerando a pequena disponibilidade de informações sobre a epidemiologia e níveis de incidência dessa bacteriose, este estudo teve como objetivos: confirmar a distribuição e verificar a dispersão da seca dos ponteiros da goiabeira no Distrito Federal; investigar o efeito da temperatura sobre a multiplicação in vitro de E. psidii; desenvolver um teste de patogenicidade prático e eficiente e avaliar a sobrevivência in vitro da bactéria em diferentes substratos. A doença foi identificada em 56% das propriedades produtoras avaliadas no DF, com 81,9% de correlação entre a presença de sintomas e o diagnóstico laboratorial. A melhor faixa de temperatura para multiplicação de E. psidii foi de 24 a 33 ºC, e a bactéria permaneceu viável por até 120 dias em suspensão em água. A inoculação da bactéria em folhas ou hastes destacadas levou ao aparecimento de sintomas a partir do sétimo dia e mostrou-se eficiente como um teste rápido para se avaliar a patogenicidade de isolados.A major disease that affects guava is 'bacterial blight', caused by Erwinia psidii, which has been reported in Southeastern and Central Regions of Brazil where the major producing areas are located. Considering the lack of information on epidemiology and incidence levels of this disease, the objectives of this study were to confirm the presence and to verify the spread of the disease in Distrito Federal (DF; to determine optimal temperature for in vitro multiplication of E. psidii; to develop a simple and effective method for pathogenicity testing and to evaluate in vitro bacterial survival on different substrates. The disease was detected in 56% of producing orchards evaluated in DF, with a correlation of 81, 9% between presence of symptoms and

  8. Fertilization with nitrogen and potassium in guava seedlings in a commercial nurseryAdubação com nitrogênio e potássio em mudas de goiabeira em viveiro comercial

    Directory of Open Access Journals (Sweden)

    Maria Jacqueline Thomazini Dias

    2012-12-01

    Full Text Available The fertilization takes key role at the production of fruit seedlings in order to ensure a good development and early production. The aim of this study was to evaluate the effects of nitrogen and potassium on the growth of guava seedlings. Herbaceous stakes of guava, “Paluma” cultivar, were rooted in a mist room, in polyethylene bags containing substrate. The experiment was conducted in a commercial nursery, in randomized blocks and a factorial scheme 4x4, with four doses of nitrogen (0, 552, 828 and 1104 mg dm-3 and four doses of potassium (0, 726, 1,089 and 1,452 mg dm-3 in three replications and three plants for parcel. During the filling of the bags (1,5 dm-3, were added 100 mg dm-3 of superphosphate, while fertilizers containing nitrogen and potassium were split into three times. After 120 days, the seedlings were evaluated. There was a significant effect of nitrogen in the variables height, stem diameter, number of leaves, SPAD index, dry weight of leaves, stems, total, Dickson quality index, and nitrogen accumulation. The fertilization with potassium did not influence the biometric parameters, SPAD index and Dickson quality index A adubação assume papel fundamental na fase de produção de mudas de frutíferas, a fim de garantir bom desenvolvimento e precocidade de produção. Objetivou-se avaliar os efeitos de doses de nitrogênio e potássio no crescimento de mudas de goiabeira. Estacas herbáceas de goiabeiras, cultivar “Paluma”, foram enraizadas em câmara de nebulização, em sacos de polietileno contendo substrato. O experimento foi conduzido em viveiro comercial, em blocos casualizados, em esquema fatorial 4 x 4, sendo quatro doses de nitrogênio (0, 552, 828 e 1.104 mg dm-3 e quatro doses de potássio (0, 726, 1.089 e 1.452 mg dm-3, com três repetições e três plantas por parcela. No enchimento dos sacos (1,5 dm-3, foram adicionados 100 mg dm-3 de P, enquanto os adubos contendo nitrogênio e potássio foram parcelados

  9. Induction of somatic embryogenesis in immature seeds of guavatree cv. Paluma Indução de embriogênese somática em sementes imaturas de goiabeira cv. Paluma

    Directory of Open Access Journals (Sweden)

    Elisa Ferreira Moura

    2009-06-01

    Full Text Available The biotechnological techniques may help solve many problems of guava culture, such as the high perishability of fruits. Somatic embryogenesis can generate highly multiplicative cell cultures and with high regenerative potential, serving as basis for genetic transformation. The aim of this work was to obtain somatic embryogenesis of guava (Psidium guajava L. cv. Paluma. Immature seeds were used, and they were inoculated in MS environment containing 400 mg L-1 of L-glutamine, 100 mg L-1 myo-inositol, 60 g L-1 sucrose, 100 mg L-1 ascorbic acid and supplemented with different types and concentrations of growth regulators. Embryogenic callus appeared after 37 days of culture in an environment containing 1.0 mg L-1 2.4-D + 2.0 mg L-1 2-ip, in 7% of the explants. After 65 days of culture, the treatment containing 0.5 mg L-1 CPA showed 20% of explants with direct embryos, while the treatment with 1 mg L-1 had 14% of explants with direct embryos and 7% of explants with embryogenic callus. In 66.6% of embryos regenerated with 0.5 mg L¹ CPA there was the formation of secondary embryos. The use of IASP and BAP, aiming embryogenesis proliferation, led to an increase in the cellular proliferation, but calli apparently lost their embryogenic potential.As técnicas biotecnológicas podem ajudar a solucionar alguns problemas do cultivo da goiabeira, como o alto perecimento dos frutos. A embriogênese somática pode gerar culturas de células altamente multiplicativas e com alto poder regenerativo, sendo base para processos de transformação genética. O objetivo deste trabalho foi obter embriogênese somática de goiabeira (Psidium guajava L. cv. Paluma. Foram utilizadas sementes imaturas, que foram inoculadas em meio MS contendo 400 mg L-1 de L-glutamina, 100 mg L-1 de mioinositol, 60 g L-1 de sacarose, 100 mg L-1 de ácido ascórbico, suplementado com diferentes tipos e concentrações de reguladores de crescimento. Calo embriogênico surgiu após 37 dias

  10. Influência da temperatura de armazenamento na qualidade pós-colheita de goiabas serranas Influence of storage temperature on postharvest quality of feijoas

    Directory of Open Access Journals (Sweden)

    Aline Cristina Velho

    2011-03-01

    Full Text Available O presente estudo teve por objetivo avaliar o potencial de armazenagem de goiabas serranas em temperaturas de 23 ºC e 4 ºC. Os frutos foram colhidos em pomar comercial, localizado no município de São Joaquim-SC, e armazenados nas temperaturas de 23 ± 1 ºC (75±5% UR, durante quinze dias e 4 ± 1 ºC (90±5% UR, durante quatro semanas. Durante o armazenamento, foram feitas avaliações de respiração, produção de etileno, teor de sólidos solúveis (SS, acidez titulável (AT, cor da epiderme (ângulo hue; hº e ocorrência de escurecimento da polpa, manchas escuras na epiderme e podridões. Durante o armazenamento a 23 ºC, os frutos exibiram um padrão climatérico, com pico respiratório entre o 4º e o 5º dia. Nos frutos armazenados a 4 ºC, houve redução na respiração e na produção de etileno. Em frutos a 23 ºC, foi mais acentuada a redução nos valores de SS, AT e h° da epiderme, e aumento na incidência de manchas escuras na epiderme e de podridões, em relação aos frutos armazenados a 4 ºC. O armazenamento a 4 ºC mostrou-se eficiente na redução do metabolismo respiratório e de produção de etileno, na preservação dos atributos de qualidade (SS, AT e hº da epiderme e na diminuição da severidade das manchas na epiderme e podridões sem, contudo, evitar o desenvolvimento de escurecimento da polpa. O potencial de armazenagem de goiabas serranas a 23 ºC é inferior a uma semana e limitado principalmente pelo desenvolvimento de distúrbios de escurecimento da polpa, manchas na epiderme, bem como podridões.This study was carried out to evaluate the storage potential of feijoas at temperatures of 23 ºC and 4 ºC. Fruit were harvested in a commercial orchard in São Joaquim, SC, and stored at 23 ± 1 ºC (75±5% RH, for 15 days and 4 ± 1 ºC (90±5% RH, for 4 weeks. Fruit were assessed during storage in terms of respiration and ethylene production rates, soluble solids content (SSC, titratable acidity (TA, skin

  11. Phylogenomic relationship of feijoa (Acca sellowiana (O.Berg) Burret) with other Myrtaceae based on complete chloroplast genome sequences.

    Science.gov (United States)

    Machado, Lilian de Oliveira; Vieira, Leila do Nascimento; Stefenon, Valdir Marcos; Oliveira Pedrosa, Fábio de; Souza, Emanuel Maltempi de; Guerra, Miguel Pedro; Nodari, Rubens Onofre

    2017-04-01

    Given their distribution, importance, and richness, Myrtaceae species comprise a model system for studying the evolution of tropical plant diversity. In addition, chloroplast (cp) genome sequencing is an efficient tool for phylogenetic relationship studies. Feijoa [Acca sellowiana (O. Berg) Burret; CN: pineapple-guava] is a Myrtaceae species that occurs naturally in southern Brazil and northern Uruguay. Feijoa is known for its exquisite perfume and flavorful fruits, pharmacological properties, ornamental value and increasing economic relevance. In the present work, we reported the complete cp genome of feijoa. The feijoa cp genome is a circular molecule of 159,370 bp with a quadripartite structure containing two single copy regions, a Large Single Copy region (LSC 88,028 bp) and a Small Single Copy region (SSC 18,598 bp) separated by Inverted Repeat regions (IRs 26,372 bp). The genome structure, gene order, GC content and codon usage are similar to those of typical angiosperm cp genomes. When compared to other cp genome sequences of Myrtaceae, feijoa showed closest relationship with pitanga (Eugenia uniflora L.). Furthermore, a comparison of pitanga synonymous (Ks) and nonsynonymous (Ka) substitution rates revealed extremely low values. Maximum Likelihood and Bayesian Inference analyses produced phylogenomic trees identical in topology. These trees supported monophyly of three Myrtoideae clades.

  12. Efeito de fungicidas cúpricos, aplicados isoladamente ou em combinação com mancozeb, na expressão de sintomas de fitotoxicidade e controle da ferrugem causada por Puccinia psidii em goiabeira Effect of copper fungicides, sprayed alone or in combination with mancozeb, in expression of phytotoxicity symptoms and rust control caused by Puccinia psidii in guava

    Directory of Open Access Journals (Sweden)

    Antonio de Goes

    2004-08-01

    Full Text Available Dois experimentos foram conduzidos em pomares de goiabeira 'Paluma', nos municípios de Monte Alto e Vista Alegre do Alto-SP. No primeiro experimento, avaliou-se o efeito de formulações de fungicidas cúpricos, aplicados isoladamente e em mistura com mancozeb, quanto ao efeito fitotóxico em botões florais e em frutos de goiabeira, em três estádios de desenvolvimento. No segundo experimento, foram avaliados os mesmos fungicidas usados no primeiro experimento, sendo, porém, acrescido do tratamento constituído por tebuconazole, cujo alvo foi sua eficiência no controle da ferrugem. No primeiro experimento, verificou-se que nenhum dos fungicidas testados causou abortamento de flores ou outros tipos de sintomas de fitotoxicidade em frutos de tamanho inferior a 15 mm de diâmetro. Contrariamente, estes fungicidas, quando aplicados isoladamente, em frutos entre 25 a 35 mm de diâmetro, causaram sintomas severos de fitotoxicidade. Em frutos de tamanho superior a 40 mm de diâmetro, estes fungicidas causaram sintomas de fitotoxicidade de níveis leves a moderados. A combinação de fungicidas cúpricos com mancozeb causou sintomas de fitotoxicidade em níveis leves, enquanto com mancozeb isoladamente não foram verificados sintomas de fitotoxicidade. No segundo experimento, verificou-se que os fungicidas cúpricos, aplicados isoladamente, foram eficientes no controle da ferrugem da goiabeira, apresentando eficiência comparável ao tratamento-padrão representado por tebuconazole. Esta eficiência foi também observada mediante o emprego da combinação mancozeb e óxido cuproso ou hidróxido de cobre.Two experiments were carried out in guava orchards cv. 'Paluma' at Monte Alto and Vista Alegre do Alto/SP. In Experiment 1 it was used copper fungicides applied alone and in combination with mancozeb to evaluate the effect of phytotoxicity on floral buds and guava fruits in three developmental stages. In Experiment 2 it was used the same fungicides

  13. Produção de mudas de goiabeira (Psidium guajava L., inoculadas com o fungo micorrízico arbuscular Glomus clarum, em substrato agro-industrial Production of guava ( Psidium guajava L. plants inoculated with arbuscular mycorrhizal fungi Glomus clarum, in agro-industrial substrate

    Directory of Open Access Journals (Sweden)

    JOLIMAR ANTONIO SCHIAVO

    2002-08-01

    Full Text Available Conduziu-se um experimento em casa de vegetação, com o objetivo de avaliar o crescimento de mudas de goiabeira (Psidium guajava L., produzidas em blocos prensados, confeccionados com resíduos agro-industriais, e inoculadas com o fungo micorrízico arbuscular (FMA Glomus clarum Nicolson & Schenck. O delineamento experimental utilizado foi o inteiramente casualizado, em esquema fatorial 2 x 2, sendo 2 tratamentos microbiológicos: controle e FMA; e 2 sistemas de produção de mudas: blocos prensados (nova metodologia e tubetes plásticos (tradicional, com 5 repetições. O substrato utilizado para a confecção dos blocos prensados e enchimento dos tubetes foi constituído por uma mistura de bagaço de cana-de-açúcar e torta de filtro (3:1 v/v. O FMA proporcionou aumentos significativos na produção de matéria seca, conteúdo de N e P da parte aérea da goiabeira, apenas no sistema de produção das mudas em blocos prensados. Mudas produzidas e inoculadas em blocos prensados mostraram um aumento de 88% na matéria seca da parte aérea, 82% e 89% para os conteúdos de nitrogênio e fósforo da parte aérea, respectivamente, em relação ao tratamento-controle.A greenhouse experiment was carried out to evaluate the growth of guava plant seedlings, inoculated with arbuscular mycorrhizal fungi (AMF, Glomus clarum Nicolson & Schenck, produced in pressed blocks made with agro-industrial residues. The experimental design utilized was a completely randomized in factorial 2x2, having two microbiological treatments: control and inoculated; two systems of production: pressed blocks (new methodology and plastic tubes (traditional, with 5 repetitions. The substrate utilized to make the pressed blocks and to fill the plastic tubes was constituted by a mixture of sugarcane bagasse and filter cake (3:1 v/v. The AMF inoculation led to a significant increase in dry matter yield and nutrients content of shoot plants, only in pressed blocks. Plants produced in

  14. Reversal of fluconazole resistance induced by a synergistic effect with Acca sellowiana in Candida glabrata strains.

    Science.gov (United States)

    R M Machado, Gabriella da; Pippi, Bruna; Dalla Lana, Daiane Flores; Amaral, Ana Paula S; Teixeira, Mário Lettieri; Souza, Kellen C B de; Fuentefria, Alexandre M

    2016-11-01

    The increased incidence of non-albicans Candida (NAC) resistant to fluconazole (FLZ) makes it necessary to use new therapeutic alternatives. Acca sellowiana (O.berg) Burret (Myrtaceae) is a guava with several proven biological activities. The interaction with fluconazole can be a feasible alternative to overcome this resistance. This study evaluates the in vitro antifungal activity of fractions obtained from the lyophilized aqueous extract of the leaves of A. sellowiana against resistant strains of NAC. The antifungal activity of the fractions was evaluated at 500 μg/mL by microdilution method. Checkerboard assay was performed to determine the effect of the combination of the F2 fraction and antifungal at concentrations: MIC/4, MIC/2, MIC, MIC × 2 and MIC × 4. Candida glabrata showed the lowest MIC values (500-3.90 μg/mL) and the F2 active fraction was the most effective. The association of F2 with FLZ showed a strong synergistic effect (FICI ≤ 0.5) against 100% of C. glabrata resistant isolates. Moreover, the F2 active fraction has demonstrated that probably acts in the cell wall of these yeasts. There was no observed acute dermal toxicity of lyophilized aqueous extract of leaves of A. sellowiana on pig ear skin cells. The interaction between substances present in the F2 active fraction is possibly responsible for the antifungal activity presented by this fraction. This study is unprecedented and suggests that the combination of F2 active fraction and FLZ might be used as an alternative treatment for mucocutaneus infections caused by C. glabrata resistant.

  15. Fenologia da goiabeira 'Paluma' sob diferentes sistemas de cultivos, épocas e intensidades de poda de frutificação Phenology of 'Paluma' guava trees under different cultivation systems, times and intensities of fruit pruning

    Directory of Open Access Journals (Sweden)

    Luiz Augusto Lopes Serrano

    2008-01-01

    Full Text Available O trabalho teve como objetivo avaliar os efeitos de diferentes épocas e intensidades de poda de frutificação sobre a fenologia da goiabeira 'Paluma', em dois sistemas de cultivo, em Pedro Canário (ES. O delineamento experimental foi o de blocos ao acaso, em esquema de parcelas sub-subdivididas. As parcelas foram os sistemas de cultivo irrigado e sequeiro; as subparcelas foram as épocas de poda (10/11/2005, 9/12/2005, 13/1/2006 e 10/2/2006; e as sub-subparcelas foram as intensidades de poda (curta, média e longa. O ciclo da goiabeira 'Paluma', entre a poda até o início da colheita dos frutos, variou de 182 (poda em novembro e dezembro a 203 dias (poda em fevereiro. A queda fisiológica dos frutos ocorreu até os 56 dias após o final do florescimento. A irrigação e a poda longa proporcionaram maior brotação e estabelecimento dos ramos. As plantas submetidas à poda longa em fevereiro produziram maior número de frutos por ramo. Independentemente da época de poda, as plantas submetidas à poda curta apresentaram menor número de frutos por ramo e menor índice de pegamento de frutos. A irrigação e as podas realizadas em dezembro e janeiro favoreceram a produção de frutos maiores.The objective of this work was to evaluate the effects of different fruit pruning times and intensities on the phenology of 'Paluma' guava trees in two cultivation systems, in Pedro Canário, Espírito Santo State, Brazil. The experimental design was a randomized complete block in a split split plots scheme. The main plots were the cultivation systems (with and without irrigation, the split plots were the pruning times (November 10, 2005; December 9, 2005; January 13, 2006 and February 10, 2006, and the split split plots were the pruning intensities (heavy, medium and light. The period between pruning and the beginning of fruit ripening was between 182 (pruning in November and December to 203 days (pruning in February. Fruit physiologic fall continued for

  16. Avaliação fenotípica de características de frutos em duas famílias de meios-irmãos de goiabeira-serrana (Acca sellowiana Berg. de um pomar comercial em São Joaquim, SC Phenotypic evaluation of fruit traits of two half sib families of feijoa (Acca sellowiana Berg. from an orchard in São Joaquim, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Juliana Degenhardt

    2003-12-01

    Full Text Available Frutos de um pomar comercial composto por progênies de duas plantas matrizes foram avaliados, com o objetivo de caracterizar a variabilidade fenotípica. As características peso de fruto, diâmetro e sólidos solúveis totais apresentaram diferenças estatísticas significativas entre as médias de famílias em pelo menos dois dos anos avaliados, enquanto para comprimento e rendimento de polpa a diferença não foi significativa. Houve diferença significativa entre médias de anos, dentro de cada família, para todas as características, com exceção das médias de peso de fruto entre 1998 e 1999 nas duas famílias e as médias de sólidos solúveis totais entre 1998 e 1999 em uma família e entre 1999 e 2000 na outra família. As correlações e regressões entre características produtivas mais relevantes foram obtidas entre peso de fruto e peso de casca, peso de fruto e comprimento, peso de fruto e diâmetro, peso de casca e comprimento, peso de casca e diâmetro e comprimento e diâmetro.Fruits of a commercial orchard originated by seedlings from two plants were evaluated, with the objective to characterize the phenotypic variation. Statistical differences were found among family means in at least two years for fruit diameter and solids soluble contents, but not for fruit length and pulp revenue. There were statistically significant differences in means among year means, within each family, for all the fruits traits, except for fruit weight between 1998 and 1999 in both families, and for soluble solids contents between 1998 and 1999 for family 1 and between 1999 and 2000 for the other family. The most important correlations and regressions among productive traits were obtained among fruit weight and peel weight, fruit weight and length, fruit weight and diameter, peel weight and length, peel weight and diameter and length and diameter.

  17. EFEITO DA OMISSÃO COMBINADA DE N, P, K E S NOS TEORES FOLIARES DE MACRONUTRIENTES EM MUDAS DE GOIABEIRA EFFECT OF COMBINED OMISSION OF N, P, K AND S ON FOLIAR MACRONUTRIENT CONTENT OF GUAVA SEEDLINGS

    Directory of Open Access Journals (Sweden)

    João Odemir Salvador

    1999-01-01

    Full Text Available O objetivo deste trabalho foi avaliar os efeitos da omissão simples e combinada de dois nutrientes, estabelecida entre os macronutrientes N, P, K e S, sobre a composição de macronutrientes no terceiro par de folhas de mudas de goiabeira. Avaliou-se, ainda, a tendência de acúmulo de macro e micronutrientes (B, Cu, Fe, Mn e Zn nas folhas, caules + ramos e raízes, de plantas mantidas em solução nutritiva completa durante 70 dias. A ausência de um nutriente promoveu a redução de sua concentração nas folhas, porém, não produziu grandes alterações na composição dos demais macronutrientes, exceto para K e Ca no tratamento com omissão de N. As folhas foram o principal órgão armazenador de macronutrientes. Dos micronutrientes, cerca de 57% do conteúdo de B e 65% do de Fe foram alocados nas folhas e o restante dividido em proporções equivalentes entre caules + ramos e raízes. Somente 23% do total do Cu extraído foi armazenado nas folhas, enquanto que 45% permaneceu nas raízes. Para o desenvolvimento inicial da goiabeira, a necessidade de macronutrientes obedeceu a ordem decrescente: N, K, Ca, S, Mg e P e a exigência de micronutrientes, por sua vez, obedeceu a seguinte ordem decrescente: Mn, Fe, Zn, B e Cu.This work had the objective of evaluating the effects of N, P, K and S deficiencies, when omitted in single or in pairs, on the macronutrient composition of the third leaf from the tip of young guava plants. The content of macro and micronutrients (B, Cu, Fe, Mn e Zn in leaves, stem + branches and roots of plants grown in a complete nutrient solution for 70 days, was also evaluated. It was shown that the lack of a given element caused a decrease in its leaf concentration, but did not cause significant changes on the level of the other macronutrients in the leaves, except for K and Ca when N was omitted. The leaves were the major storage organ for macronutrients (above 50% from each one. About 57% of the B and 65% of Fe were

  18. PHENOTYPIC VARIABILITY IN FEIJOA FRUITS [Acca sellowiana (O. Berg. Burret] ON INDIGENOUS LANDS,QUILOMBOLAS COMMUNITIES AND PROTECTED AREAS IN THE SOUTH OF BRAZIL

    Directory of Open Access Journals (Sweden)

    LIDO JOSÉ BORSUK

    Full Text Available ABSTRACT Phenotypic studies with native fruits are important sources of information for understanding the status of conservation of plant species, especially populations in protected areas (PAs. Fruits of 18 populations of feijoa [Acca sellowiana (O. Berg. Burret] present in three kind of PAs, Quilombolas Communities (QLs, Indigenous Lands (ILs and Conservation Units (CUs were evaluated with the aim to characterize the phenotypic variability. Fruits were harvested at maturity and eight morphological descriptors were measured: diameter, length, total weight, pericarp weight, pulp weight, pericarp thickness, pulp yield and solid soluble contents (°Brix. The results revealed the existence of large morphological variability for all traits, with significant differences among all populations and among those populations grouped in QLs, TIs and UCs, particularly to the total weight and peel thickness. There was a clear formation of five major clusters of genetic dissimilarity. In addition, two Uruguayan type populations and 16 Brazilian type populations showed contrast means for most of the evaluated traits. The lower variability on fruit characters found in plants collected in areas of traditional people but not in CUs suggests the existence of selection processes of feijoa genotypes on those areas.

  19. Rearing of Thyrinteina arnobia (Lepidoptera: Geometridae on guava and Eucalyptus in laboratory

    Directory of Open Access Journals (Sweden)

    Harley Nonato de Oliveira

    2005-09-01

    Full Text Available Thyrinteina arnobia, is one of the most important defoliating caterpillars of Eucalyptus in Brazil The objective of this work was to evaluate the development and the reproduction of feeding on leaves of guava (Psidium guajava or Eucalyptus grandis in the 15th generation, after rearing this species for 14 genrations on guava leaves. T. arnobia showed shorter larval period, better viability of caterpillars and pupae, heavier pupae, higher number of eggs per female, better egg viability and shorter longevity of females in guava leaves than in Eucalyptus leaves. The better development and reproduction with P. guajava showed that this insect could be reared in laboratory with guava leaves.Thyrinteina arnobia, é umas das mais importantes lagartas desfolhadoras de eucalipto no Brasil. O objetivo desse trabalho foi avaliar o desenvolvimento e a reprodução desse lepidóptero em folhas de goiabeira (Psidium guajava e Eucalyptus grandis, na 15º geração, após criar essa espécie por 14 gerações em folhas de goiabeira. T. arnobia apresentou menor período larval, maior viabilidade de lagartas e de pupas, maior peso pupal, maior número de ovos totais por fêmea e viabilidade de ovos e menor longevidade de fêmeas com folhas de goiabeira. Além disso, teve melhor desempenho e reprodução com P. guajava, do que com folhas de E. grandis, mostrando que esse inseto pode ser criado com folhas de goiabeira em laboratório.

  20. Liberação de micronutrientes de uma escória aplicada em um Argissolo Vermelho-Amarelo cultivado com mudas de goiabeira (Psidium guajava L. Micronutrients released from one basic slag applied a ultisol cultivated with guava plants (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    RENATO DE MELLO PRADO

    2002-08-01

    Full Text Available Os micronutrientes são importantes na nutrição das plantas, especialmente em solos tropicais com baixa concentração devido ao intemperismo. Como fonte alternativa de micronutrientes, tem-se a escória, resíduo da indústria de produção de ferro-gusa e aço. Assim, objetivou-se avaliar a escória como fonte de micronutrientes para mudas de goiabeira. O delineamento experimental foi em blocos ao acaso, com cinco repetições. As doses de escória foram aplicadas objetivando elevar em meia, uma vez, uma vez e meia, duas vezes e duas vezes e meia a saturação por bases do solo igual a 70%, correspondendo a 1,68; 3,36; 5,04; 6,72 e 8,40 g por vaso, além da testemunha sem aplicação. Após 90 dias de incubação da escória com o Argissolo Vermelho-Amarelo, cultivaram-se mudas de goiabeira (cv. Paluma por 110 dias em vasos com 2,8 dm-3 de substrato, em viveiro telado, em Taquaritinga-SP, no período de outubro de 2000 a abril de 2001. A escória promoveu um efeito favorável na reação do solo e na disponibilidades de Zn, Cu, Mn e B do solo. Houve efeitos quadráticos nas concentrações de Zn, Cu e Mn do solo, que, por sua vez, estiveram associadas às doses de escória superiores a 5,8; 6,3 e 7,5 g por vaso, respectivamente, enquanto, para o B, esse efeito foi linear. A saturação por bases do solo, entre 51 e 55%, resultou em maior disponibilidade dos micronutrientes Zn, Cu e Mn no solo, ao passo que, para o B, esse valor foi de 65%. Da mesma forma que ocorreu no solo, a aplicação da escória apresentou efeitos quadráticos nos teores de Zn, Cu e Mn da parte aérea e das raízes das mudas de goiabeira, enquanto, para o B, esse efeito foi linear. Concluiu-se, portanto, que a escória se comportou como material corretivo da acidez e como fonte de micronutrientes.The micronutrients are important in the nutrition of the plants, especially in tropical ground with low concentration of these nutrients. As alternative source of

  1. Caracterização dos frutos de goiabeira e seleção de cultivares na Região do Submédio São Francisco

    Directory of Open Access Journals (Sweden)

    LIMA MARIA AUXILIADORA COÊLHO DE

    2002-01-01

    Full Text Available O estudo visou a caracterizar frutos de goiabeira e selecionar cultivares produzidas na Região do Submédio São Francisco. Os frutos, colhidos na maturidade fisiológica, foram provenientes da Estação Experimental de Bebedouro, pertencente à Embrapa Semi-Árido e avaliados em delineamento experimental inteiramente casualizado com quatro repetições. Os tratamentos compreenderam genótipos de polpa branca (Alabama Safed, Lucknow 49, Banahas, White Selection of Florida e Seleção IPA B 38.1 e vermelha (Paluma, Patillo 2.1, Surubim, Red Selection of Florida e Seleção IPA B 14.3. Avaliaram-se: massa, diâmetro longitudinal (DL, diâmetro transversal (DT, relação DL/DT, espessura da casca, espessura da polpa, sólidos solúveis totais (SST, acidez total titulável (ATT, relação SST/ATT, pH, açúcares solúveis totais (AST e vitamina C. Os genótipos de polpa branca, exceto Seleção IPA B 38.1, tiveram maiores massas (acima de 145,0 g. As menores relações DL/DT foram observadas em Banahas (0,98 e Lucknow 49 (1,00, caracterizando frutos redondos. Estas cultivares tiveram também maior espessura da polpa. Os maiores valores de SST foram observados em Paluma (10,4 ºBrix e Lucknow 49 (10,9 ºBrix. A ATT foi baixa na maioria dos genótipos, exceto Surubim e Seleção IPA B 14.3, e o pH variou de 3,72 a 4,22. Em geral, os genótipos de polpa branca tiveram os maiores teores de AST (5 a 7 % e vitamina C, atingindo 200 mg de ácido ascórbico/100 g.

  2. Investigation of the relationship between venticular fibrillation duration and cardiac/neurological damage in a rabbit model of electrically induced arrhythmia.

    Science.gov (United States)

    Hu, Chun-Lin; Wei, Hong-Yan; Liu, Zi-You; Li, Xing; Liao, Xiao-Xing; Li, Yu-Jie; Zhan, Hong; Jing, Xiao-Li; Xiong, Yan; Liu, Yan-Yan; Wu, Gui-Fu

    2010-12-01

    To establish a simple, economic, and reliable alternating current (AC)-induced cardiac arrest (ACCA) model in rabbits for cardiopulmonary cerebral resuscitation research. Ventricular fibrillation was induced in 27 New Zealand rabbits by external transthoracic AC, which were randomly divided into three groups according to the duration of untreated ACCA (ACCA-3 minutes, ACCA-5 minutes, and ACCA-8 minutes). After ACCA, all animals received cardiopulmonary resuscitation for 2 minutes and subsequent defibrillation until return of spontaneous circulation (ROSC). The troponin I levels were measured at 4 hours after ROSC. Animals died spontaneously or were killed at 72 hours after ROSC. The hippocampus were removed and fixed in 3% formalin. TdT-mediated dUTP-biotin nick end labeling and Nissl stainings were performed in 10-μm thickness coronal sections. Furthermore, two rabbits (without induction of ventricular fibrillation, cardiopulmonary resuscitation, and defibrillation) served as normal control group. Mean survival times after ROSC were 48.57 hours ± 24.70 hours, 18.0 hours ± 15.13 hours, and 3.88 hours ± 2.39 hours for groups ACCA-3 minutes, ACCA-5 minutes, and ACCA-8 minutes, respectively. Survival was significantly different between ACCA-3 minutes and other two groups (p = 0.002 and p = 0.01). Neuronal necrosis and apoptosis were found in the hippocampus CA1, CA2, and CA3 areas of group ACCA-3 minutes. In contrast, neuronal necrosis and TdT-mediated dUTP-biotin nick end labeling positive cells were fewer in control animals. The rabbits in group ACCA-3 minutes had significant neuronal damage with apoptosis in hippocampus CA1, CA2, and CA3 areas at 72 hours after ROSC and survived longer than those in other groups. The model we describe may be a simple, economic, and reliable model for experimental investigation on cardiopulmonary cerebral resuscitation.

  3. Propagação da goiabeira serrana Feijoa sellowiana Berg, através da mergulhia de cepa Vegetative propagation of Feijoa sellowiana Berg through stool layring

    Directory of Open Access Journals (Sweden)

    J.C. Fachinello

    1992-01-01

    Full Text Available Este trabalho teve como objetivo verificar a influência de três tipos de mergulhia de cepa na obtenção de novas plantas de Feijoa sellowiana Berg. Para isso, foi conduzido experimento na EMBRAPA-CNPFT, Pelotas-RS, durante o período de agosto de 90 a julho de 91. Foram utilizados como tratamentos: T1 -corte total da planta a l0cm do nível do solo, seguido de amontoa; T2 - Sem corte da planta, seguido de amontoa a 20 cm de altura e T3 - corte total da planta a 10 cm do nível do solo e amontoa com terra a 20 cm de altura, 2 meses depois do corte. Os parâmetros avaliados foram: número de brotos emitidos por planta; número de brotos enraizados por plantas; número de raízes por broto e vigor dos brotos, representado pelas medidas do comprimento total e diâmetro da base. De acordo com o resultados obtidos o tratamento T3 foi o que proporcionou um maior número de brotos emitidos e enraizados. Para as demais variáveis não houve diferença significativa entre os tratamentos.An experiment to evaluate the effect of stool layring of feijoa was carried out in EMBR APA/CNPFT, Pelotas-RS, from August 90 to July 91. Three treatments of layring propagation were used: T1 - plant cutting 10 cm above the ground and covered with soil; T2 - No plant cutting and covered with soil up to 10 cm above the ground; and T3 - Plant cutting 10 cm above the ground and covered with soil two months later. The results obtained showed that the number of shoots and rooted shoots were more significant in T3. There was no diference between number of roots, diameter and length of shoots among treatments.

  4. Cell cycle regulation of the BRCA1/acetyl-CoA-carboxylase complex.

    Science.gov (United States)

    Ray, H; Suau, F; Vincent, A; Dalla Venezia, N

    2009-01-16

    Germ-line alterations in BRCA1 are associated with an increased susceptibility to breast and ovarian cancer. The BRCA1 protein has been implicated in multiple cellular functions. We have recently demonstrated that BRCA1 reduces acetyl-CoA-carboxylase alpha (ACCA) activity through its phospho-dependent binding to ACCA, and further established that the phosphorylation of the Ser1263 of ACCA is required for this interaction. Here, to gain more insight into the cellular conditions that trigger the BRCA1/ACCA interaction, we designed an anti-pSer1263 antibody and demonstrated that the Ser1263 of ACCA is phosphorylated in vivo, in a cell cycle-dependent manner. We further showed that the interaction between BRCA1 and ACCA is regulated during cell cycle progression. Taken together, our findings reveal a novel mechanism of regulation of ACCA distinct from the previously described phosphorylation of Ser79, and provide new insights into the control of lipogenesis through the cell cycle.

  5. Comparative proteomic analysis of off-type and normal phenotype somatic plantlets derived from somatic embryos of Feijoa (Acca sellowiana (O. Berg) Burret).

    Science.gov (United States)

    Fraga, Hugo Pacheco de Freitas; Agapito-Tenfen, Sarah Zanon; Caprestano, Clarissa Alves; Nodari, Rubens Onofre; Guerra, Miguel Pedro

    2013-09-01

    Morphological disorders in a relevant portion of emerged somatic embryos have been a limiting factor in the true-to-type plantlet formation in Acca sellowiana. In this sense, the present study undertook a comparison between normal phenotype and off-type somatic plantlets protein profiles by means of the 2-D DIGE proteomics approach. Off-type and normal phenotype somatic plantlets obtained at 10 and 20 days conversion were evaluated. Results indicated 12 exclusive spots between normal and off-type plantlets at 10 days conversion, and 17 exclusive spots at 20 days conversion. Also at 20 days conversion, 4 spots were differentially expressed, up- or down-regulated. Two proteins related to carbohydrate metabolism were only expressed in off-types at 10 days conversion, suggesting a more active respiratory pathway. A vicilin-like storage protein was only found in off-types at 20 days conversion, indicating that plantlets may present an abnormality in the mobilization of storage compounds, causing reduced vigor in the development of derived plantlets. The presence of heat shock proteins were only observed during formation of normal phenotype somatic plantlets, indicating that these proteins may be involved in normal morphogenesis of plantlets formed. These new findings shed light on possible genetic or epigenetic mechanisms governing A. sellowiana morphogenesis. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Efeito de diferentes substratos e épocas de coleta no enraizamento de estacas herbáceas de goiabeira, cvs. paluma e século XXI Effect of different substrates and collection seasons on the herbaceous cuttings rooting of guava, cvs. paluma and século XXI

    Directory of Open Access Journals (Sweden)

    Corina Zietemann

    2007-04-01

    Full Text Available Este trabalho objetivou avaliar o enraizamento de estacas herbáceas das goiabeiras 'Paluma' e 'Século XXI' em diferentes substratos, coletadas na primavera e no verão. As estacas foram obtidas de ramos jovens não-lignificados de árvores de quatro anos, com um par de folhas no nó superior e 10 cm de comprimento. Para cada época testada, as estacas foram tratadas por imersão rápida, com cinco doses de AIB (0; 500; 1.000; 1.500 e 2.000 mg/L e dispostas em bandejas plásticas perfuradas com dois substratos (casca de arroz carbonizada e vermiculita em câmara de nebulização. Após 70 dias da estaquia, foram avaliadas as seguintes variáveis: porcentagem de enraizamento; massas seca e fresca das raízes; número de raízes por estaca; comprimento das raízes; sobrevivência; retenção foliar e porcentagem de estacas com calo. Concluiu-se que houve maior enraizamento das estacas coletadas no verão e que as doses de 1.500 e 2.000 mg/L de AIB são as mais adequadas para promover as melhores características de enraizamento das estacas para as cvs. Paluma e Século XXI, respectivamente. Os dois substratos utilizados são indicados para a estaquia das goiabeiras estudadas.The objective of this research was to evaluate the influence of different substrates and collection season on the herbaceous cutting rooting of 'Paluma' and 'Século XXI' guava plants (Psidium guajava L.. The herbaceous cuttings were obtained on spring and summer seasons, consisted of 10cm of length, two nodes and a pair of leaves in the superior node, and treated with five doses of IBA (0, 500, 1,500 and 2,000 mg/L for each season studied, and disposed into plastic boxes containing hull rice coal and vermiculita as substrates. After 70 days, the rooting percentage, roots length, number of roots, fresh and dry matter of roots, survival percentage, foliar retention and percentage of cuttings with callus were evaluated. The results showed that the better rooting percentage

  7. Alpha cyano-4-hydroxy-3-methoxycinnamic acid inhibits proliferation and induces apoptosis in human breast cancer cells.

    Science.gov (United States)

    Hamdan, Lamia; Arrar, Zoheir; Al Muataz, Yacoub; Suleiman, Lutfi; Négrier, Claude; Mulengi, Joseph Kajima; Boukerche, Habib

    2013-01-01

    This study investigated the underlying mechanism of 4-hydroxy-3-methoxycinnamic acid (ACCA), on the growth of breast cancer cells and normal immortal epithelial cells, and compared their cytotoxic effects responses. Treatment of breast cancer cells (MCF-7, T47D, and MDA-231) with ACCA resulted in dose- and time-dependent decrease of cell proliferation, viability in colony formation assay, and programmed cell death (apoptosis) with minimal effects on non-tumoral cells. The ability of ACCA to suppress growth in cancer cells not expressing or containing defects in p53 gene indicates a lack of involvement of this critical tumor suppressor element in mediating ACCA-induced growth inhibition. Induction of apoptosis correlated with an increase in Bax protein, an established inducer of programmed cell death, and the ratio of Bax to Bcl-2, an established inhibitor of apoptosis. We also documented the ability of ACCA to inhibit the migration and invasion of MDA-231 cells with ACCA in vitro. Additionally, tumor growth of MDA-231 breast cancer cells in vivo was dramatically affected with ACCA. On the basis of its selective anticancer inhibitory activity on tumor cells, ACCA may represent a promising therapeutic drug that should be further evaluated as a chemotherapeutic agent for human breast cancer.

  8. Alpha cyano-4-hydroxy-3-methoxycinnamic acid inhibits proliferation and induces apoptosis in human breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Lamia Hamdan

    Full Text Available This study investigated the underlying mechanism of 4-hydroxy-3-methoxycinnamic acid (ACCA, on the growth of breast cancer cells and normal immortal epithelial cells, and compared their cytotoxic effects responses. Treatment of breast cancer cells (MCF-7, T47D, and MDA-231 with ACCA resulted in dose- and time-dependent decrease of cell proliferation, viability in colony formation assay, and programmed cell death (apoptosis with minimal effects on non-tumoral cells. The ability of ACCA to suppress growth in cancer cells not expressing or containing defects in p53 gene indicates a lack of involvement of this critical tumor suppressor element in mediating ACCA-induced growth inhibition. Induction of apoptosis correlated with an increase in Bax protein, an established inducer of programmed cell death, and the ratio of Bax to Bcl-2, an established inhibitor of apoptosis. We also documented the ability of ACCA to inhibit the migration and invasion of MDA-231 cells with ACCA in vitro. Additionally, tumor growth of MDA-231 breast cancer cells in vivo was dramatically affected with ACCA. On the basis of its selective anticancer inhibitory activity on tumor cells, ACCA may represent a promising therapeutic drug that should be further evaluated as a chemotherapeutic agent for human breast cancer.

  9. Antilaminaribioside and antichitobioside antibodies in inflammatory bowel disease.

    Science.gov (United States)

    Rejchrt, S; Drahosová, M; Kopácová, M; Cyrany, J; Douda, T; Pintér, M; Bures, J

    2008-01-01

    Testing antilaminaribioside (ALCA) and antichitobioside (ACCA) antibodies in 89 Crohn's disease (CD), 31 ulcerative colitis (UC) and 50 controls, mean values were 38.6 and 53.0 ELISA units for CD, 34.0 and 32.6 for UC, 34.5 and 36.4 for controls, respectively. There was no significant difference of ALCA values between CD and UC (p = 0.401), CD and control subjects (p = 0.698) or UC and controls (p = 0.898). ACCA were significantly higher in CD compared with UC (p = 0.011) but not with the controls (p = 0.095). No significant difference of ACCA values between UC and controls (p = 0.107) was found. ALCA and ACCA values significantly correlated in CD (r = 0.548, p ACCA), the negative ones (to exclude CD) 25 (ALCA) and 86 % (ACCA). Small and/or large bowel involvement or disease type (i.e. stenosing, perforating or inflammatory) of CD did not differ in the two values. The idea that ALCA and ACCA may be useful either to differentiate between CD, UC and healthy subjects or to stratify CD was not confirmed.

  10. MORFOLOGIA FLORAL DA GOIABEIRA SERRANA (Feijoa sellowiana E SUAS IMPLICAÇÕES NA POLINIZAÇÃO FLOWER MORPHOLOGY OF FEIJOA (Feijoa sellowiana AND IT'S IMPLICATIONS ON POLLINATION

    Directory of Open Access Journals (Sweden)

    JULIANA DEGENHARDT

    2001-12-01

    Full Text Available Esse estudo teve por objetivo caracterizar variações na arquitetura floral da Feijoa sellowiana e determinar sua influência sobre a polinização. Foram avaliados o comprimento do pistilo, a distância entre estigma e estames, o diâmetro de abertura e a distribuição dos estames na flor, com base em 7 flores de 15 acessos do Banco de Germoplasma da espécie. Distinguiram-se 3 classes de distâncias médias entre estigma e estames: 0,2 (C1, 0,7 (C2 e 1,2 cm (C3, e duas classes de distribuição de estames na flor (radial e aleatória. Sorteou-se uma planta por classe de distância entre estigma e estames, a qual teve 50 flores marcadas para cada um dos seguintes tratamentos: T1-polinização aberta; T2-tela contra pássaros e T3-tela contra pássaros e insetos. A frutificação foi de 47% em T1 para C2 e de 22% para C3, diferença que pode ser devida ao genótipo e/ou alternância de produção. No T2, a frutificação foi 31% em C2, 15,4% em C1 e 3% em C3. A superioridade de T1 sobre T2 pode ser devida à polinização por pássaros. Essa superioridade foi mais expressiva em C3 do que em C2, o que sugere que C3 é mais dependente de pássaros. A frutificação em T2 pode ainda evidenciar a polinização por insetos e foi menor para C3, o que pode estar sendo causado pelo maior afastamento do estigma. A frutificação em T3 para C1 (7% e C2 (15% sugere que o vento ou a autopolinização também possam efetuar a polinização.The objective of our research was to evaluate distance between the stigma and the stamens, opening diameter and stamens distribution on the flower. We evaluated these variables on 7 flowers of each one of the 15 plant accessions from the Germplasm Bank. The flowers were classified according to distance between the stigma and the stamens into three classes: 0.2 (C1, 0.7 (C2 and 1,2 (C3 cm, in which 2, 9, and 4 accessions were included, respectively. The radial and random stamens distributions were verified in 6 and 9 accessions, respectively. These two variables behaved independently. Thereafter one plant were randomly taken from each class and marked 150 flowers, being 50 for each of the following treatments: T1 -- natural pollination; T2 -- screen which excluded only the birds from reaching the flowers; and T3 -- screen which excluded both birds and insects. It was evaluated the fruit set in all three treatments. We verified 47% of fruit set in T1 of C2 and 22% in T1 of C3. This difference can be due to genotypic differences and/or alternation of yield. In T2, fruit set was 31% in C2, 15.4% in C1, and 3% in C3. The superiority in fruit set of T1 over T2 can be credited to bird pollination. The fruit set in T1 was 7 times larger in C3 and 2 times larger in C2, than in T2. This suggests that C3 is more dependent on birds for pollination. The observed fruit set in T2 can be partially credited to insect pollination and was smaller in C3, as expected due to the larger pistils. Even in T3 we observed fruit set in C1 (7% and in C2 (15%, which suggests that either wind plays a role in the pollination or that selfing may occur. Since there was no fruit set in T3 on C3, presence of autoincompatibility cannot be discarded.

  11. BRCA1 affects lipid synthesis through its interaction with acetyl-CoA carboxylase.

    Science.gov (United States)

    Moreau, Karen; Dizin, Eva; Ray, Hind; Luquain, Céline; Lefai, Etienne; Foufelle, Fabienne; Billaud, Marc; Lenoir, Gilbert M; Venezia, Nicole Dalla

    2006-02-10

    Germ line alterations in BRCA1 (breast cancer susceptibility gene 1) are associated with an increased susceptibility to breast and ovarian cancer. BRCA1 acts as a scaffold protein implicated in multiple cellular functions, such as transcription, DNA repair, and ubiquitination. However, the molecular mechanisms responsible for tumorigenesis are not yet fully understood. We have recently demonstrated that BRCA1 interacts in vivo with acetyl coenzyme A carboxylase alpha (ACCA) through its tandem of BRCA1 C terminus (BRCT) domains. To understand the biological function of the BRCA1.ACCA complex, we sought to determine whether BRCA1 is a regulator of lipogenesis through its interaction with ACCA. We showed here that RNA inhibition-mediated down-regulation of BRCA1 expression induced a marked increase in the fatty acid synthesis. We then delineated the biochemical characteristics of the complex and found that BRCA1 interacts solely with the phosphorylated and inactive form of ACCA (P-ACCA). Finally, we demonstrated that BRCA1 affects lipid synthesis by preventing P-ACCA dephosphorylation. These results suggest that BRCA1 affects lipogenesis through binding to P-ACCA, providing a new mechanism by which BRCA1 may exert a tumor suppressor function.

  12. Secagem e classificação de Sementes de Acca sellowiana (O. Berg Burret - Myrtaceae quanto à tolerância à dessecação e ao armazenamento

    Directory of Open Access Journals (Sweden)

    Juliano Pereira Gomes

    Full Text Available Objetivou-se, neste estudo, verificar a influência de diferentes métodos de secagem na qualidade de sementes de Acca sellowiana e realizar a classificação fisiológica destas sementes quanto à tolerância à dessecação e ao armazenamento. Para testar o comportamento das sementes em relação a diferentes métodos de secagem, foram utilizados três tratamentos - Controle, Secagem Lenta e Secagem Rápida. Nestes tratamentos, para ambas as secagens, o teor de água foi de 20% de base úmida. Para a classificação fisiológica, sementes de A. sellowiana foram submetidas à secagem até 12% e 5% de teor de água, e ao armazenamento durante 90 dias, em refrigerador a 8 ºC. Para sementes recém-colhidas e armazenadas por 30 e 90 dias, o tipo de secagem não influenciou na qualidade de sementes de A. sellowiana. Em sementes armazenadas por 60 dias, o tratamento controle apresentou germinação superior aos demais. Sementes de A. sellowiana podem ser fisiologicamente classificadas como intermediárias.

  13. BRCA1 and acetyl-CoA carboxylase: the metabolic syndrome of breast cancer.

    Science.gov (United States)

    Brunet, Joan; Vazquez-Martin, Alejandro; Colomer, Ramon; Graña-Suarez, Begoña; Martin-Castillo, Begoña; Menendez, Javier A

    2008-02-01

    Breast cancer-associated mutations affecting the highly-conserved C-terminal BRCT domains of the tumor suppressor gene breast cancer susceptibility gene 1 (BRCA1) fully disrupt the ability of BRCA1 to interact with acetyl coenzyme A carboxylase alpha (ACCA), the rate-limiting enzyme catalyzing de novo fatty acid biogenesis. Specifically, BRCA1 interacts solely with the phosphorylated (inactive) form of ACCA (P-ACCA), and the formation of the BRCA1/P-ACCA complex interferes with ACCA activity by preventing P-ACCA dephosphorylation. One of the hallmarks of aggressive cancer cells is a high rate of energy-consuming anabolic processes driving the synthesis of lipids, proteins, and DNA (all of which are regulated by the energy status of the cell). The ability of BRCA1 to stabilize the phosphorylated/inactive form of ACCA strongly suggests that the tumor suppressive function of BRCA1 closely depends on its ability to mimic a cellular-low-energy status, which is known to block tumor cell anabolism and suppress the malignant phenotype. Interestingly, physical exercise and lack of obesity in adolescence have been associated with significantly delayed breast cancer onset for Ashkenazi Jewish women carrying BRCA1 gene mutations. Further clinical work may explore a chemopreventative role of "low-energy-mimickers" deactivating the ACCA-driven "lipogenic phenotype" in women with inherited mutations in BRCA1. This goal might be obtained with current therapeutic approaches useful in treating the metabolic syndrome and associated disorders in humans (e.g., type 2 diabetes and obesity), including metformin, thiazolidinediones (TZDs), calorie deprivation, and exercise. Alternatively, new forthcoming ACCA inhibitors may be relevant in the management of BRCA1-dependent breast cancer susceptibility and development. (c) 2007 Wiley-Liss, Inc.

  14. Conservação pós-colheita de frutos de goiabeira, variedade Paluma Post-harvest conservation of fruit of guava, var. Paluma

    Directory of Open Access Journals (Sweden)

    Luiz Gonzaga Neto

    1999-01-01

    Full Text Available Objetivando aumentar a vida útil de frutos da goiabeira (Psidium guajava L., variedade Paluma, nos primeiros dezesseis dias pós-colheita, foi realizado, no município de Petrolina, PE, região do Vale do São Francisco, um estudo para determinar o efeito da concentração de cálcio (Ca, do ambiente de armazenamento e do tipo de embalagem, na vida útil da goiaba. Foram estudados dois ambientes de armazenamento (condições naturais e ambiente refrigerado, três concentrações de Ca (0,5, 1,0 e 1,5% e dois tipos de embalagem do fruto (saco de polietileno transparente e saco de papel- manteiga. Doze tratamentos foram testados no delineamento de blocos ao acaso, com três repetições, num arranjo fatorial 3x2x2. Foram determinados os parâmetros: perda de peso e da cor verde da casca do fruto, e o teor de sólidos solúveis totais. Verificou-se que frutos da variedade Paluma colhidos "de vez" (frutos completamente desenvolvidos, mas com a casca verde mantiveram suas características comerciais por até dezesseis dias de armazenamento quando foram embalados em saco de polietileno transparente e sem furo, e armazenado em ambiente refrigerado a 10ºC, e 90% de umidade relativa.The study was undertaken to increase the shelf life of fruits of guava (Psidium guajava L. var. Paluma in the post-harvest period in the São Francisco River Valley (Petrolina, PE, Brazil. Effects of calcium (Ca concentration, storing condition and fruit wrapping material in the shelf life of fruit of guava were studied. Twelve treatments were tested in a randomized complete block design, in a 2 x 3 x2 factorial arrangement, comprising the following variables: two storing conditions (natural temperature and refrigerated, three Ca concentrations (0.5, 1.0 and 1.5% and two fruit wrapping materials (transparent poliethylene bag and impervious paper bag. The following guava parameters were evaluated: weight and peel green color losses and total soluble solids. It was observed

  15. Usefulness of two clinical chorioamnionitis definitions in predicting neonatal infectious outcomes: a systematic review.

    Science.gov (United States)

    Avila, Cecilia; Willins, Jennifer L; Jackson, Matthew; Mathai, Jacob; Jabsky, Marina; Kong, Alex; Callaghan, Fiona; Ishkin, Selda; Shroyer, A Laurie W

    2015-09-01

    To assess the usefulness of two definitions of acute clinical chorioamnionitis (ACCA) in predicting risk of neonatal infectious outcomes (NIO) and mortality, the first definition requiring maternal fever alone (Fever), and the second requiring ≥ 1 Gibbs criterion besides fever (Fever + 1). PubMed, Web of Science, and the Cochrane Database of Systematic Reviews were searched from January 1, 1979 to April 9, 2013. Twelve studies were reviewed (of 316 articles identified): three studies with term patients, four with preterm premature rupture of membranes (PPROM) patients, and five mixed studies with mixed gestational ages and/or membrane status (intact and/or ruptured). Both definitions demonstrated an increased NIO risk for ACCA versus non-ACCA patients, with an odds ratio increase for the Fever + 1 definition that was about twofold larger than the Fever definition. As the Fever definition demonstrated increased NIO risk for ACCA versus non-ACCA patients, the Fever alone ACCA definition should be used to trigger future clinical treatment in many clinical situations. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  16. Competição de genótipos de goiabeira (Psidium guajava L. na região do submédio São Francisco Evaluation of guava genotypes in the submiddle of San Francisco Valley

    Directory of Open Access Journals (Sweden)

    Luiz Gonzaga Neto

    2003-12-01

    Full Text Available Com objetivo de avaliar e selecionar genótipos de goiabeira que possam incrementar o sistema de produção da cultura na região do Submédio São Francisco foi desenvolvido na Estação Experimental de Bebedouro, base física da Embrapa Semi-Árido, em Petrolina-PE, um experimento em blocos ao acaso com cinco tratamentos (Paluma, Red Fleshed, Surubim, Red Selection of Florida e Ruby Supreme e cinco repetições. Considerando os resultados obtidos relativos a primeira e segunda poda de frutificação e análise conjunta dos dois anos de produção, observou-se que a variedade Surubim apresentou tendência de maior produção e maior número de frutos, entre os genótipos estudados.The objective of this study was to discriminate and select guava genotypes to improve the crop production system in the Submiddle of San Francisco Valley. An experiment was carried out at the Bebedouro Experimental Sation that belongs to Embrapa Semiarid in Petrolina, State of Pernambuco, with five genotypes of guava: Paluma, Red Fleshed, Surubim, Red Selection of Florida and Ruby Supreme. A randomized block design was used as statistical model with five treataments, and five repetitions. The results, related to the first and the second fruit set prunings and two year of combined analyses for fruit yield, indicated that Surubim variety tended to higher yield and greater number of fruits among the five genotypes tested.

  17. Tolerancia de plantas de feijoa (Acca sellowiana [Berg] Burret a la salinidad por NaCl

    Directory of Open Access Journals (Sweden)

    Casierra-Posada Fánor Ernesto

    2006-12-01

    Full Text Available

    Los efectos de la salinidad por NaCl sobre la producción y la distribución de la biomasa, la toma de agua y el área foliar total fueron investigados en plantas de feijoa (Acca sellowiana [Berg] Burret cultivadas en materas con suelo bajo condiciones de invernadero, durante ocho meses. Los tratamientos con la sal comenzaron 60 d después del transplante. El NaCl fue agregado en diferentes concentraciones: 0, 20, 40, 60, 80 mM de NaCl en el suelo. Estas concentraciones correspondieron a conductividades eléctricas de 2,8; 4,6; 6,1; 8,4 y 11,1 dS· m-1, respectivamente. Para evitar el choque osmótico, el tratamiento salino fue impuesto progresivamente, aumentando la concentración de sal cada semana hasta alcanzar la

  18. Report on Sensor Technology for Battlefield and Physical Security Applications.

    Science.gov (United States)

    1977-07-01

    Identification, measurable while others must be estimated. The access authorization and auditing may be satis- number of users, terminals and computers...by the Alarm Classification and Command Assembly ( ACCA ). The ACCA is comprised of visual classification and command status indicators dnd a command... ACCA . All of the subassemblies in the monitoring location are physically configured into a console as depicted in Figure 2. CENTRAL MASTER CONTROL (CMC

  19. Antibacterial activity of GUAVA, Psidium guajava Linnaeus, leaf extracts on diarrhea-causing enteric bacteria isolated from Seabob shrimp, Xiphopenaeus kroyeri (Heller Avaliação da atividade antibacteriana de extrato de folhas de goiabeira, Psidium guajava Linnaeus, sobre bactérias entéricas diarreiogênicas, isoladas de camarão sete-barbas, Xiphopenaeus kroyeri (Heller

    Directory of Open Access Journals (Sweden)

    Flávia A. Gonçalves

    2008-02-01

    Full Text Available Guava leaf tea of Psidium guajava Linnaeus is commonly used as a medicine against gastroenteritis and child diarrhea by those who cannot afford or do not have access to antibiotics. This study screened the antimicrobial effect of essential oils and methanol, hexane, ethyl acetate extracts from guava leaves. The extracts were tested against diarrhea-causing bacteria: Staphylococcus aureus, Salmonella spp. and Escherichia coli. Strains that were screened included isolates from seabob shrimp, Xiphopenaeus kroyeri (Heller and laboratory-type strains. Of the bacteria tested, Staphylococcus aureus strains were most inhibited by the extracts. The methanol extract showed greatest bacterial inhibition. No statistically significant differences were observed between the tested extract concentrations and their effect. The essential oil extract showed inhibitory activity against S. aureus and Salmonella spp. The strains isolated from the shrimp showed some resistance to commercially available antibiotics. These data support the use of guava leaf-made medicines in diarrhea cases where access to commercial antibiotics is restricted. In conclusion, guava leaf extracts and essential oil are very active against S. aureus, thus making up important potential sources of new antimicrobial compounds.O chá de folhas de goiaba Psidium guajava Linnaeus é comumente usado como remédio nas gastrenterites e diarréias infantis por aqueles que não têm acesso a antibióticos. Esta pesquisa estudou o efeito antibacteriano sobre bactérias causadoras de diarréias, do óleo essencial e do extrato de folhas de goiabeira usando como diluente: metanol, hexano e acetato de etila. Os extratos foram testados sobre Staphylococcus aureus, Salmonella spp. e Escherichia coli. As bactérias testadas foram isoladas de camarão sete-barbas Xiphopenaeus kroyeri (Heller usando-se como controle cepas padrão, de cada espécie. Das bactérias testadas, o melhor efeito inibitório foi

  20. Caracterização química do óleo essencial de folhas de goiabeira (Psidium guajava L. e seus efeitos no comportamento da lagarta-do-cartucho do milho Spodoptera frugiperda (J. E. Smith, 1797 (Lepidoptera: Noctuidae Essential oil chemical composition from leaves of guava (Psidium guajava L. and its effects on the fall armyworm Spodoptera frugiperda (J. E. Smith, 1797. (Lepidoptera: Noctuidae behavior

    Directory of Open Access Journals (Sweden)

    Rafaela Karin Lima

    2009-01-01

    Full Text Available Nesta pesquisa, objetivou-se a obtenção e caracterização do óleo essencial de folhas da goiabeira Psidium guajava cv. Pedro Sato, e seus possíveis efeitos no comportamento da lagarta-do-cartucho do milho Spodoptera frugiperda. O óleo essencial foi obtido pela técnica "arraste a vapor d'água", utilizando-se de um aparelho de Clevenger modificado e submetido, posteriormente, à análise por cromatografia gasosa acoplada a um espectrômetro de massas CG-EM, a fim de investigar sua composição. Para a avaliação dos efeitos do óleo essencial no comportamento das lagartas de 1º ínstar foram testados quatro tratamentos, dois com o óleo essencial na concentração de 0,01% e 0,001%, diluídos em etanol/água 1:1, e duas testemunhas, uma com água e outra com etanol/água 1:1. Os resultados obtidos mostraram que o óleo essencial de folhas de goiabeira apresenta na sua constituição o α-terpineol (0,9%, 1,8-cineol (7,0%, β-cariofileno (7,2% e o óxido de cariofileno (13,8%. Constatou-se, também, que o óleo essencial demonstrou efeito repelente para a lagarta-do-cartucho na concentração de 0,01%.The aim of this research was to obtain and characterize essential oil from leaves of Psidium guajava cv. Pedro Sato, and its possible effects on fall armyworm Spodoptera frugiperda behavior. The essential oil was obtained through steam distillation, by using a modified Clevenger apparatus, and the chemical composition was later analyzed by gas chromatography coupled to mass spectroscopy GC-MS. In order to evaluate the essential oil effect on the armyworm of 1st instars behavior, four treatments were tested; two with oil at 0.01 and 0.001 % in ethanol/water 1:1 concentration; two controls with water and the other with ethanol/water 1:1. The results showed that the above analyzed essential oil constituted of á-terpineole (0.9%, 1,8-cineole (7.0%, â-caryophyllene (7.2% and the caryophyllene oxide (13.8%. It was also found that the essential

  1. Maduración poscosecha de la feijoa (Acca sellowiana Berg tratada con CaCl2 en tres temperaturas de almacenamiento

    Directory of Open Access Journals (Sweden)

    Ramírez Juan Manuel

    2005-06-01

    Full Text Available

    Con la finalidad de comprobar los efectos retardantes del calcio en la maduración de los frutos de feijoa (Acca sellowiana Berg, cultivar Quimba, se realizó un estudio sobre la aplicación poscosecha, mediante inmersiones de tres soluciones distintas de cloruro de calcio (5%, 10% y 15% y un testigo. La aplicación de CaCl2 prolongó la vida de almacenamiento de los fru­tos, ya que los tratamientos permitieron a los frutos so­portar las condiciones de almacenamiento. Se observó un efecto importante en la disminución de las pérdidas de peso; los frutos tratados con el porcentaje de calcio más alto (15% presentaron las menores pérdidas de peso en cada temperatura. En las fejioas almacenadas a temperatura ambiente (18° C, se observó que la in­cidencia de enfermedades fue más pequeña en los fru­tos tratados con CaCl2. La velocidad de pérdida de la firmeza de los frutos también se vio fortalecida por la adición de calcio. Con relación a las propiedades quí­micas de los frutos, no se presentaron diferencias sig­nificativas entre los tratamientos con cloruro de calcio para cada temperatura de almacenamiento; las feijoas tratadas con CaCl presentaron niveles superiores de sólidos solubles totales, a pesar de no ser significativos estadísticamente.

  2. Propagação vegetativa de camu-camu por meio de enxertia intergenérica na família Myrtaceae

    Directory of Open Access Journals (Sweden)

    Suguino Eduardo

    2003-01-01

    Full Text Available O camu-camu [Myrciaria dubia (Humb., Bonpl. & Kunth McVaugh], da família Myrtaceae, é encontrado em áreas inundáveis da Região Amazônica e utilizado como conservante em antioxidantes por seu alto teor de ácido ascórbico. O objetivo deste trabalho foi avaliar porta-enxertos desta família, adaptados a terra firme, visando à propagação vegetativa de camu-camu. Selecionaram-se duzentas e quarenta mudas de camu-camu, goiabeira (Psidium guajava L. e pitangueira (Eugenia uniflora L., que receberam quatro tipos de enxertia, originando doze tratamentos de sessenta plantas, com cinco repetições. Apenas o porta-enxerto de camu-camu se mostrou compatível. A incompatibilidade entre camu-camu e os porta-enxertos de goiabeira e pitangueira foi demonstrada por análises anatômicas.

  3. Uso fertilizante do subproduto da agroindústria processadora de goiabas II: estado nutricional e produção de goiabas

    Directory of Open Access Journals (Sweden)

    Henrique Antunes de Souza

    2014-09-01

    Full Text Available O conhecimento sobre a dinâmica dos nutrientes provenientes da aplicação de resíduos orgânicos faz-se necessário, principalmente visando sua a reciclagem, considerando que a quantidade desses materiais tem aumentado rapidamente com o tempo. Assim, objetivou-se avaliar o estado nutricional e a produção de frutos de um pomar de goiabeiras, em função da aplicação do subproduto da indústria processadora de goiabas. O delineamento empregado foi o de blocos casualizados, com cinco tratamentos e quatro repetições, sendo as doses do subproduto (moído iguais a zero; 9;18; 27 e 36 t ha-1 (peso do material seco. Foram feitas cinco aplicações do subproduto em 2006, 2007, 2008, 2009 e 2010. Avaliou-se o estado nutricional das goiabeiras, via diagnose foliar (macro e micronutrientes, bem como a produção de frutos por seis safras consecutivas. A aplicação do subproduto da indústria processadora de goiabas promoveu alterações no estado nutricional e na produção de frutos. As doses do subproduto incrementaram os teores foliares de N, Mg e Mn da goiabeira. A produção de goiabas cresceu de forma linear em função das doses do subproduto. Os efeitos da aplicação do subproduto foram verificados primeiramente no solo, posteriormente nos teores foliares e, finalmente, na produção de frutos, ao longo das safras.

  4. The ecological footprint of Acca sellowiana domestication maintains the residual vertebrate diversity in threatened highlands of Atlantic Forest.

    Science.gov (United States)

    Bogoni, Juliano André; Graipel, Maurício Eduardo; Peroni, Nivaldo

    2018-01-01

    Past and contemporary human actions are causing numerous changes in patterns and processes at various ecosystem scales and trophic levels, including unintended downstream changes, such as species interactions. In its native range Acca sellowiana (Feijoa) combines some characteristics of human interactions: incipient domestication, restricted to subtropical Atlantic Forest highlands, associated with the threatened conifer Araucaria angustifolia (Araucaria), within a domesticated landscape with anthropogenic forest patches, and provides fruit at a time of resource shortage (Araucaria seeds-pinhão). We quantify the trophic relationships between Feijoa and vertebrates, and evaluate the influences on interactions caused by environmental variations, Feijoa domestication evidences, spatial distance and fruit availability. In four sites within protected areas, we selected 28 focal individuals of Feijoa (seven/site) and collected three temporal replicas between 2015 and 2016, when we measured productivity and frugivory via 45-second videos taken with camera traps. Using ecological network, rarefaction curves and variation partitioning analyses, we evaluate the frugivory network topology, the spatiotemporal structure of communities in relation to fruit availability and the influence of predictive variables on frugivory. We found a large spatiotemporal variation in productivity of Feijoa and that 20 species consumed Feijoa fruits, with a species degree of 2.8 (±5.7) and average Feijoa degree of 14.4 (±10.1), in a modular network with intermediary connectance. Rarefaction curves showed that richness and the independent records are congruent with the fruit amount. Variation partitioning showed that, for the focal individuals, canopy area, green coverage, patch size and distance to water influenced frugivory, and the Feijoa domestication influenced significantly the mammalian frugivory. Feijoa is an important resource that provides food during the time of year when Pinhão is

  5. The ecological footprint of Acca sellowiana domestication maintains the residual vertebrate diversity in threatened highlands of Atlantic Forest

    Science.gov (United States)

    2018-01-01

    Past and contemporary human actions are causing numerous changes in patterns and processes at various ecosystem scales and trophic levels, including unintended downstream changes, such as species interactions. In its native range Acca sellowiana (Feijoa) combines some characteristics of human interactions: incipient domestication, restricted to subtropical Atlantic Forest highlands, associated with the threatened conifer Araucaria angustifolia (Araucaria), within a domesticated landscape with anthropogenic forest patches, and provides fruit at a time of resource shortage (Araucaria seeds—pinhão). We quantify the trophic relationships between Feijoa and vertebrates, and evaluate the influences on interactions caused by environmental variations, Feijoa domestication evidences, spatial distance and fruit availability. In four sites within protected areas, we selected 28 focal individuals of Feijoa (seven/site) and collected three temporal replicas between 2015 and 2016, when we measured productivity and frugivory via 45-second videos taken with camera traps. Using ecological network, rarefaction curves and variation partitioning analyses, we evaluate the frugivory network topology, the spatiotemporal structure of communities in relation to fruit availability and the influence of predictive variables on frugivory. We found a large spatiotemporal variation in productivity of Feijoa and that 20 species consumed Feijoa fruits, with a species degree of 2.8 (±5.7) and average Feijoa degree of 14.4 (±10.1), in a modular network with intermediary connectance. Rarefaction curves showed that richness and the independent records are congruent with the fruit amount. Variation partitioning showed that, for the focal individuals, canopy area, green coverage, patch size and distance to water influenced frugivory, and the Feijoa domestication influenced significantly the mammalian frugivory. Feijoa is an important resource that provides food during the time of year when Pinh

  6. Effect of Pulse Polarity on Thresholds and on Non-monotonic Loudness Growth in Cochlear Implant Users.

    Science.gov (United States)

    Macherey, Olivier; Carlyon, Robert P; Chatron, Jacques; Roman, Stéphane

    2017-06-01

    Most cochlear implants (CIs) activate their electrodes non-simultaneously in order to eliminate electrical field interactions. However, the membrane of auditory nerve fibers needs time to return to its resting state, causing the probability of firing to a pulse to be affected by previous pulses. Here, we provide new evidence on the effect of pulse polarity and current level on these interactions. In experiment 1, detection thresholds and most comfortable levels (MCLs) were measured in CI users for 100-Hz pulse trains consisting of two consecutive biphasic pulses of the same or of opposite polarity. All combinations of polarities were studied: anodic-cathodic-anodic-cathodic (ACAC), CACA, ACCA, and CAAC. Thresholds were lower when the adjacent phases of the two pulses had the same polarity (ACCA and CAAC) than when they were different (ACAC and CACA). Some subjects showed a lower threshold for ACCA than for CAAC while others showed the opposite trend demonstrating that polarity sensitivity at threshold is genuine and subject- or electrode-dependent. In contrast, anodic (CAAC) pulses always showed a lower MCL than cathodic (ACCA) pulses, confirming previous reports. In experiments 2 and 3, the subjects compared the loudness of several pulse trains differing in current level separately for ACCA and CAAC. For 40 % of the electrodes tested, loudness grew non-monotonically as a function of current level for ACCA but never for CAAC. This finding may relate to a conduction block of the action potentials along the fibers induced by a strong hyperpolarization of their central processes. Further analysis showed that the electrodes showing a lower threshold for ACCA than for CAAC were more likely to yield a non-monotonic loudness growth. It is proposed that polarity sensitivity at threshold reflects the local neural health and that anodic asymmetric pulses should preferably be used to convey sound information while avoiding abnormal loudness percepts.

  7. Straightforward rapid spectrophotometric quantification of total cyanogenic glycosides in fresh and processed cassava products.

    Science.gov (United States)

    Tivana, Lucas Daniel; Da Cruz Francisco, Jose; Zelder, Felix; Bergenståhl, Bjorn; Dejmek, Petr

    2014-09-01

    In this study, we extend pioneering studies and demonstrate straightforward applicability of the corrin-based chemosensor, aquacyanocobyrinic acid (ACCA), for the instantaneous detection and rapid quantification of endogenous cyanide in fresh and processed cassava roots. Hydrolytically liberated endogenous cyanide from cyanogenic glycosides (CNp) reacts with ACCA to form dicyanocobyrinic acid (DCCA), accompanied by a change of colour from orange to violet. The method was successfully tested on various cassava samples containing between 6 and 200 mg equiv. HCN/kg as verified with isonicotinate/1,3-dimethylbarbiturate as an independent method. The affinity of ACCA sensor to cyanide is high, coordination occurs fast and the colorimetric response can therefore be instantaneously monitored with spectrophotometric methods. Direct applications of the sensor without need of extensive and laborious extraction processes are demonstrated in water-extracted samples, in acid-extracted samples, and directly on juice drops. ACCA showed high precision with a standard deviation (STDV) between 0.03 and 0.06 and high accuracy (93-96%). Overall, the ACCA procedure is straightforward, safe and easily performed. In a proof-of-concept study, rapid screening of ten samples within 20 min has been tested. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Molecular Cloning and Characterization of Two Genes for the Biotin Carboxylase and Carboxyltransferase Subunits of Acetyl Coenzyme A Carboxylase in Myxococcus xanthus

    OpenAIRE

    Kimura, Yoshio; Miyake, Rina; Tokumasu, Yushi; Sato, Masayuki

    2000-01-01

    We have cloned a DNA fragment from a genomic library of Myxococcus xanthus using an oligonucleotide probe representing conserved regions of biotin carboxylase subunits of acetyl coenzyme A (acetyl-CoA) carboxylases. The fragment contained two open reading frames (ORF1 and ORF2), designated the accB and accA genes, capable of encoding a 538-amino-acid protein of 58.1 kDa and a 573-amino-acid protein of 61.5 kDa, respectively. The protein (AccA) encoded by the accA gene was strikingly similar t...

  9. Occupational Health Screenings of U.S. Air Force Remotely Piloted Aircraft (Drone) Operators

    Science.gov (United States)

    2014-04-01

    Worsened by Their Unit Assignment and Occupational Stress, Proportion Comparisons Medical Condition ACCa ANGb AFSOCc % ACC/ANG p...Proportion Comparisons Self-Reported Reasons (per coded category) ACCa ANGb AFSOCc % ACC/ANG p % AFSOC/ANG p % AFSOC/ACC p n % n % n

  10. Efecto de la práctica de embolsado sobre la calidad del fruto en feijoa (Acca sellowiana Berg tander

    Directory of Open Access Journals (Sweden)

    Fánor Casierra-Posada

    2011-11-01

    Full Text Available El  cultivo de  feijoa  (Acca  sellowiana Berg.  se ha  extendido  durante  los últimos  años  en  el territorio colombiano, debido a que  la  fruta es muy apetecida en el mercado por las excelentes propiedades  organolépticas.  Sin  embargo,  la cal idad  y  sanidad  exigidas  para  la comercialización  se  ven  afectadas  por  varios factores,  entre  los  que  se  encuentra  el  daño causado  por  la mosca de  la  fruta  (Anastrepha spp..  Por  tanto,  la  evaluación  del  efecto  de embolsado sobre la calidad de la fruta de feijoa es un tema de gran interés. Además, esta técnica es comúnmente usada en guayaba que pertenecea la misma familia que la feijoa (Mirtáceae. Para el estudio, se embolsaron flores en el momento de  la caída de pétalos, y cada semana después hasta  cuat ro  semanas.   Los  frutos  que  se embolsaron a la caída de pétalos detuvieron su crecimiento; aquellos embolsados una, dos y tres semanas  después  de  la  caída  de  pétalos  no reportaron diferencias significativas en cuanto los parámetros  evaluados  (peso  fresco,  peso  seco, diámetro transversal y  longitudinal, intensidad de infestación,  sólidos  solubles  totales  y  acidez titulable Los frutos embolsados cuatro semanas después de la caída de pétalos fueron de mayor peso,  tamaño y más dulces con  respecto a  los demás. La efectividad en el control de mosca de la  fruta  fue evidente. El embolsado, además de mejorar la sanidad del fruto,  influyó en su calidad y permitió obtener un producto con características adecuadas para el mercado.

  11. Efeitos do ácido indolbutírico e da época de coleta no enraizamento de estacas de goiabeira (Psidium guajava L. Effects of indolebutiric acid and of collection date on the rooting of guava cuttings (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    M. S. W. Tavares

    1995-08-01

    Full Text Available Este trabalho foi desenvolvido com o objetivo de verificar o efeito de concentrações de ácido indolbutírico (AIB e da época de coleta sobre o enraizamento de estacas de goiabeira (Psidium guajava L., oriundas de plantas produtoras de frutos de polpa vermelha e de polpa branca, em estufa com nebulizacão intermitente. Utilizou-se estacas apicais com um par de folhas e estacas medianas com dois pares de folhas, ambas cortadas pela metade. Após serem padronizadas em aproximadamente 15 cm de comprimento, procedeu-se ao tratamento introduzindo em torno de 1 cm da base da estaca em AIB na forma de pó, nas concentrações de zero, 4000, 5000, 6000 e 7000 ppm. Em seguida, colocou-se o material em sacos de polietileno perfurado, contendo cinza de casca de arroz como substrato. As épocas de estaquila corresponderam aos meses de fevereiro, abril, julho e outubro de 1993. O delineamento experimental adotado foi o de blocos ao acaso, com 3 repetições de 12 estacas por tratamento. Após 60 dias de permanência dentro da estufa, avaliou-se a percentagem de estacas enraizadas, com calo, brotadas e peso de matéria seca das raízes. Nas condições em que o trabalho foi realizado e de acordo com os resultados obtidos, verificou-se que a época de estaquia, influencia significativamente todas as variáveis estudadas. A maior média de estacas enraizadas ocorreu em fevereiro, com a estaca apical, onde obteve-se 51,52% de enraizamento. A brotação das estacas não causou indução na formação de raízes. Os tratamentos com o ácido indolbutírico (AIB, incrementaram o enraizamento e o peso de matéria seca de raízes das estacas de goiabeira. Para as variáveis brotação e percentagem de estacas enraizadas, a variedade de polpa branca foi superior somente na quarta época, correspondente ao mês de outubro.The purpose or this research work was to evaluate the effects of cutting collection date and of different concentrations of indolebutiric acid (IBA

  12. Going for Gold: A Path Toward Petroleum-Independence in the 2030 Air Force

    Science.gov (United States)

    2011-02-16

    the X- 55A/Advanced Composite Cargo Aircraft ( ACCA ) and Initial Flight Test Results‖ (paper presented at 54 th SETP Symposium & Banquet, Anaheim, CA... ACCA ) and Initial Flight Test Results.‖ Paper presented at 54 th SETP Symposium & Banquet. Anaheim, CA, September 2010. Sloan, Jeff. ―Skinning

  13. First record of Ceratitis capitata (Wiedemann (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Adaime

    2017-12-01

    Resumo. Registra-se pela primeira vez a presença de Ceratitis capitata (Wiedemann (Diptera: Tephritidae no estado do Acre, Brasil, a partir de frutos de goiabeira (Psidium guajava L. e de caramboleira (Averrhoacarambola L., aumentando o conhecimento dos registros geográficos dessa mosca na Amazônia brasileira.

  14. Influência do ethephon e do ácido indolbutírico no enraizamento de estacas de ramos de goiabeira (Psidium guajava L. Influence of ethephon and indole butyric on the rooting of stem cuttings of guava (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Cláudia Araújo Marco

    1998-06-01

    Full Text Available Este trabalho teve o objetivo de avaliar a influência do ethephon, do ácido indolbutírico (AIB e do substrato no enraizamento de estacas obtidas de ramos de goiabeira. As plantas de um pomar com cinco anos de idade foram pulverizadas com ethephon nas concentrações de zero, 50 e 100ppm, sendo que após sete dias, foram feitas estacas de ramos do último lançamento, com três nós por estaca e um par de folhas. Estas foram tratadas com as concentrações de zero, 1000, 2000, 3000 e 4000ppm de AIB na forma liquida, por imersão de dois cm da base da estaca durante cinco segundos. Os substratos utilizados como meio de enraizamento foram vermiculita e cinza de casca de arroz. Os resultados mostram que com a utilização de vermiculita obteve-se maior percentagem de estacas enraizadas (21,48 %. Os reguladores Ethephon e AIB afetaram a percentagem de estacas enraizadas assim como o número de raízes.The objective of this work was to evaluate the influence of ethephon, indole butyric acid (IBA and substrate on root formation of guava stem cuttings. Orchard plants withfive years old were sprayed with ethephon in concentrations of zero, 50 and 100ppm. However, after seven days, stem cuttings were made, of the last lauching with three knots by cutting including one pair of leaves. Cuttings were treated with concentrations of zero, 1000, 2000. 3000 and 4000ppm of liquid IBA by immersion of two centimeter of the basis of cutting for five minutes. Vermiculite and ash rice were used as substrato. Results showed that the use of vermiculite produced greater percentage of cuttings rooted (21.48%. A greater cutting rooted and number of roots were obtained using ethephon and IBA.

  15. Germination and initial growth of guava plants irrigated with saline water Germinação de sementes e crescimento inicial da goiabeira irrigada com água salina

    Directory of Open Access Journals (Sweden)

    Lourival F. Cavalcante

    2005-12-01

    Full Text Available The present study was carried in order to evaluate the effect of saline water irrigation with electrical conductivity (ECw of 0.5; 1.5; 3.0; 4.5 and 6.0 dS m-1, on germination and some growth variables during the seedling formation process of four guava cultivars (Psidium guajava L.: Pentecoste, Paluma, Surubim and IPA B-38. Water salinity inhibited the germination process, plant height, stem diameter, leaf area and dry matter production of roots, stems and leaves, independently of cultivar. After germination, the seedlings did not survive due to saline water effects of ECw 4.5 and 6.0 dS m-1. After 180 days of sowing, the seedlings irrigated with ECw more than 1.5 dS m-1 did not present agronomic quality for planting. Dry matter production sequence of different parts of plants was as follows: leaves > roots > stems, without significant differences among cultivars especially when irrigated with saline water of ECw > 3.0 dS m-1.Avaliou-se o efeito da salinidade da água de irrigação, através dos níveis de condutividade elétrica (CEa de 0,5; 1,5; 3,0; 4,5 e 6,0 dS m-1, sobre a germinação de sementes e algumas variáveis de crescimento, durante a formação de mudas de quatro cultivares de goiabeira (Psidium guajava L. Pentecoste, Paluma, Surubim e IPA B-38. A salinidade da água inibiu a germinação, o crescimento em altura, diâmetro do caule, área foliar e fitomassa das raízes, caules e folhas das plantas, independente da cultivar. Após a germinação, as plântulas não sobreviveram aos efeitos salinos das águas de condutividade elétrica CEa 4,5 e 6,0 dS m-1. Ao final do ensaio, 180 dias após a semeadura, não se obtiveram mudas com qualidade agronômica nos tratamentos irrigados com água de salinidade superior a 1,5 dS m-1. A ordem de produção de matéria seca pelos distintos órgãos das plantas, foi: folhas > raízes > caules, mas sem diferir entre cultivares, principalmente quando irrigadas com água de maior salinidade > 3

  16. Avaliação do gerenciamento dos resíduos de medicamentos e demais resíduos de serviços de saúde na Região Serrana de Santa Catarina

    Directory of Open Access Journals (Sweden)

    Juliana Aparecida Souza Amarante

    2016-10-01

    Full Text Available RESUMO A gestão de resíduos dos serviços de saúde (RSS constitui um grande desafio para o poder público, pois, apesar do avanço nos aspectos legislativos, ainda há grandes deficiências, especialmente relacionadas aos resíduos de medicamentos descartados inadequadamente. Este estudo teve como objetivo caracterizar o processo de descarte de drogas e resíduos dos serviços de saúde humana e veterinária em uma cidade de médio porte da Região Serrana de Santa Catarina. Foram realizadas visitas às unidades participantes, selecionadas por critérios de conveniência, contemplando unidades de saúde municipais, pet shops , clínicas veterinárias, hospital de atendimento humano, hospital de atendimento veterinário e empresas coletoras, totalizando 15 unidades participantes. A coleta de dados ocorreu de março a maio de 2014, com aplicação de questionários e roteiro de observação de campo. Os resultados evidenciaram deficiências no gerenciamento dos resíduos de medicamentos, assim como dos demais resíduos, nas etapas de segregação e armazenamento em instituições de atendimento humano e veterinário, com poucas exceções. As maiores dificuldades foram observadas nos estabelecimentos de atendimento veterinário, especialmente quanto à segregação e ao armazenamento dos resíduos contaminados, à falta de cuidado com material perfurocortante e às normas de biossegurança. A inexistência do Plano de Gerenciamento de Resíduos de Serviços de Saúde nas unidades de saúde e no hospital veterinário, assim como a falta de capacitações aos profissionais, a dissimilaridade no descarte de medicamentos entre os estabelecimentos e a falta de fiscalização por parte dos órgãos competentes foram os principais responsáveis pelo atual cenário de descarte inadequado dos resíduos na região.

  17. A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

    Science.gov (United States)

    Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

    2015-09-01

    Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

  18. POLA REPRODUKSI PADA SALAK BALI (SA/ACCA ZA/ACCA VAR. AMBOINENSIS (BECC. MOGEA

    Directory of Open Access Journals (Sweden)

    ENIEK KRISWIYANTI

    2008-12-01

    Full Text Available Research on reproduction patterns of Balinese snake skin fruits (Salak Bali has been conducted by identifying the availability of pollens on anthers of male and hermaphrodite flowers, the viability of pollens in the pistillum and the present of embryo(s in the ovulum. Flower samples were collected from Sibetan and Muncan Villages, Karangasem regency. Sample preparations and identifications were conducted in "Stuktur dan Perkembangan Tumbuhan Laboratory" Department of Bilogy, FMIPA Udayana University. The results showed that the pollen has a single apperture, unisulcus, minuta, oblat sferoidal type. The length of polar axis was 15-24 jam (P and equatorial diameter of 16-24 |im (E. Therefore, the P/E index was 0.99-1.0. The pollen viability before and after anthesis of hermaphrodite flowers was low (71.4% and 50.6% respectively, with very low pollen tube germinations (0.08% of before and 0.48% after anthesis. Similarly, on the anthers of male flowers, the viability of pollens before anthesis was low (75.7% with pollen germination of 0.18%, and event lower in after anthesis flowers (28.8% with 0.29% pollen tube germination. Squashed stigma before and after anthesis and 2 days after flowers were opened showed that there was no germination occurred. Therefore, there was no germination in the pistillum, but the embryo developed before flower anthesis, indicates that the reproduction pattern of Salak Bali occurred without fertilizations (agamospermy.

  19. Advanced Composite Air Frame Life Cycle Cost Estimating

    Science.gov (United States)

    2014-06-19

    the ACCA based on the cost . This cost analysis takes into account the increased performance parameters of the new airframe structure. This research...20 Advanced Composite Cargo Aircraft ( ACCA ) ..........................................................23 viii Cost Estimation...establishing the procurement strategies and life cycle cost (LCC) model cost estimations. The current LCC models do not take into account the potential cost

  20. Muslim Prison Ministry: Hindering the Spread of the Radical, Militant, Violent and Irreconcilable Wing of Islam

    Science.gov (United States)

    2006-05-25

    radical, militant, violent and irreconcilable wing of Islam Approved by: __________________________________ Monograph Director Timothy L . Challans, Ph.D...Honorable Harley Lapin (BOP), Dr. Michael Waller (Institute of World Politics), Mr. Paul Rogers (ACCA), and Mr. A. J. Sabree (ACCA). 78 Ibid., 12...London, United Kingdom: Verso books, 2005. Patai, Raphael. The Arab Mind, Long Island City, NY: Hatherleigh Press, 2002. Pederson , Dick. Defeating

  1. Adsorption of Pb{sup 2+} and Cd{sup 2+} onto a novel activated carbon-chitosan complex

    Energy Technology Data Exchange (ETDEWEB)

    Ge, H.; Fan, X. [College of Chemistry and Chemical Engineering, South China University of Technology, Guangzhou 510640 (China)

    2011-10-15

    A novel activated carbon-chitosan complex adsorbent (ACCA) was prepared via the crosslinking of glutaraldehyde and activated carbon-(NH{sub 2}-protected) chitosan complex under microwave irradiation. The surface morphology of this adsorbent was characterized. The adsorption of ACCA for Pb{sup 2+} and Cd{sup 2+} was investigated. The results demonstrate that ACCA has higher adsorption capacity than chitosan. The adsorption follows pseudo first-order kinetics. The isotherm adsorption equilibria are better described by Freundlich and Dubinin-Radushkevich isotherms than by the Langmuir isotherm. The adsorbent can be recycled. These results have important implications for the design of low-cost and effective adsorbents in the removal of heavy metal ions from wastewaters. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  2. Acetyl-CoA carboxylase-a as a novel target for cancer therapy.

    Science.gov (United States)

    Wang, Chun; Rajput, Sandeep; Watabe, Kounosuke; Liao, Duan-Fang; Cao, Deliang

    2010-01-01

    Acetyl-CoA carboxylases (ACC) are rate-limiting enzymes in de novo fatty acid synthesis, catalyzing ATP-dependent carboxylation of acetyl-CoA to form malonyl-CoA. Malonyl-CoA is a critical bi-functional molecule, i.e., a substrate of fatty acid synthase (FAS) for acyl chain elongation (fatty acid synthesis) and an inhibitor of carnitine palmitoyltransferase I (CPT-I) for fatty acid beta-oxidation. Two ACC isoforms have been identified in mammals, i.e. ACC-alpha (ACCA, also termed ACC1) and ACC-beta (ACCB, also designated ACC2). ACC has long been used as a target for the management of metabolic diseases, such as obesity and metabolic syndrome, and various inhibitors have been developed in clinical trials. Recently, ACCA up-regulation has been recognized in multiple human cancers, promoting lipogenesis to meet the need of cancer cells for rapid growth and proliferation. Therefore, ACCA might be effective as a potent target for cancer intervention, and the inhibitors developed for the treatment of metabolic diseases would be potential therapeutic agents for cancer therapy. This review summarizes our recent findings and updates the current understanding of the ACCA with focus on cancer research.

  3. Cloning and expression analysis of carboxyltransferase of acetyl-coA carboxylase from Jatropha curcas.

    Science.gov (United States)

    Xie, Wu-Wei; Gao, Shun; Wang, Sheng-Hua; Zhu, Jin-Qiu; Xu, Ying; Tang, Lin; Chen, Fang

    2010-01-01

    A full-length cDNA of the carboxyltransferase (accA) gene of acetyl-coenzym A (acetyl-CoA) carboxylase from Jatropha curcas was cloned and sequenced. The gene with an open reading frame (ORF) of 1149 bp encodes a polypeptide of 383 amino acids, with a molecular mass of 41.9 kDa. Utilizing fluorogenic real-time polymerase chain reaction (RT-PCR), the expression levels of the accA gene in leaves and fruits at early, middle and late stages under pH 7.0/8.0 and light/darkness stress were investigated. The expression levels of the accA gene in leaves at early, middle and late stages increased significantly under pH 8.0 stress compared to pH 7.0. Similarly, the expression levels in fruits showed a significant increase under darkness condition compared to the control. Under light stress, the expression levels in the fruits at early, middle and late stages showed the largest fluctuations compared to those of the control. These findings suggested that the expression levels of the accA gene are closely related to the growth conditions and developmental stages in the leaves and fruits of Jatropha curcas.

  4. [Determination of residual solvents in 7-amino-3-chloro cephalosporanic acid by gas chromatography].

    Science.gov (United States)

    Ma, Li; Yao, Tong-wei

    2011-01-01

    To develop a gas chromatography method for determination of residual solvents in 7-amino-3-chloro cephalosporanic acid (7-ACCA). The residual levels of acetone, methanol, dichloromethane, ethyl acetate, isobutanol, pyridine and toluene in 7-ACCA were measured by gas chromatography using Agilent INNOWAX capillary column (30 m × 0.32 mm,0.5 μm). The initial column temperature was 70° maintained for 6 min and then raised (10°C/min) to 160°C for 1 min. Nitrogen gas was used as carrier and FID as detector. The flow of carrier was 1.0 ml/min, the temperature of injection port and detector was 200°C and 250°C, respectively. The limits of detection for acetone, methanol, dichloromethane, ethyl acetate, isobutanol, pyridine, toluene in 7-ACCA were 2.5 μg/ml, 1.5 μg/ml, 15 μg/ml, 2.5 μg/ml, 2.5 μg/ml, 2.5 μg/ml and 11 μg/ml, respectively. Only acetone was detected in the sample, and was less than the limits of Ch.P. The method can effectively detect the residual solvents in 7-ACCA.

  5. TOFA (5-tetradecyl-oxy-2-furoic acid) reduces fatty acid synthesis, inhibits expression of AR, neuropilin-1 and Mcl-1 and kills prostate cancer cells independent of p53 status.

    Science.gov (United States)

    Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B

    2011-07-01

    A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.

  6. Análise de distância genética entre acessos do gênero Psidium via marcadores ISSR

    Directory of Open Access Journals (Sweden)

    Názila Nayara Silva de Oliveira

    2014-12-01

    Full Text Available O objetivo deste trabalho foi avaliar a distância genética entre 37 acessos da espécie cultivada Psidium guajava, L. (goiaba e de araçás do gênero Psidium do banco de germoplasma da Universidade Estadual do Norte Fluminense (UENF, via marcadores moleculares ISSR. Nos 17 marcadores selecionados, foram obtidas 216 bandas polimórficas. Pelo método de agrupamento UPGMA, houve a formação de cinco principais grupos. Os acessos de araçá da espécie P. cattleyanum Sabine , ficaram alocados nos grupos I e II. No grupo II, foi observada, dentro da espécie P cattleyanum, maior proximidade com a goiabeira. No grupo III, ficou alocado o acesso da espécie P. guineense Sw (araçá-do-campo e dentre os araçás, foi o que ficou mais próximo da goiaba. Os genótipos de goiabeira ficaram alocados do grupo IV e V, confirmando sua alta divergência. Os marcadores moleculares foram eficientes em estimar a distância genética intra e interespecífica.

  7. Dynamics of autotrophic marine planktonic thaumarchaeota in the East China Sea.

    Directory of Open Access Journals (Sweden)

    Anyi Hu

    Full Text Available The ubiquitous and abundant distribution of ammonia-oxidizing Thaumarchaeota in marine environments is now well documented, and their crucial role in the global nitrogen cycle has been highlighted. However, the potential contribution of Thaumarchaeota in the carbon cycle remains poorly understood. Here we present for the first time a seasonal investigation on the shelf region (bathymetry≤200 m of the East China Sea (ECS involving analysis of both thaumarchaeal 16S rRNA and autotrophy-related genes (acetyl-CoA carboxylase gene, accA. Quantitative PCR results clearly showed a higher abundance of thaumarchaeal 16S and accA genes in late-autumn (November than summer (August, whereas the diversity and community structure of autotrophic Thaumarchaeota showed no statistically significant difference between different seasons as revealed by thaumarchaeal accA gene clone libraries. Phylogenetic analysis indicated that shallow ecotypes dominated the autotrophic Thaumarchaeota in the ECS shelf (86.3% of total sequences, while a novel non-marine thaumarchaeal accA lineage was identified in the Changjiang estuary in summer (when freshwater plumes become larger but not in autumn, implying that Changjiang freshwater discharge played a certain role in transporting terrestrial microorganisms to the ECS. Multivariate statistical analysis indicated that the biogeography of the autotrophic Thaumarchaeota in the shelf water of the ECS was influenced by complex hydrographic conditions. However, an in silico comparative analysis suggested that the diversity and abundance of the autotrophic Thaumarchaeota might be biased by the 'universal' thaumarchaeal accA gene primers Cren529F/Cren981R since this primer set is likely to miss some members within particular phylogenetic groups. Collectively, this study improved our understanding of the biogeographic patterns of the autotrophic Thaumarchaeota in temperate coastal waters, and suggested that new accA primers with

  8. Dynamics of autotrophic marine planktonic thaumarchaeota in the East China Sea.

    Science.gov (United States)

    Hu, Anyi; Yang, Zao; Yu, Chang-Ping; Jiao, Nianzhi

    2013-01-01

    The ubiquitous and abundant distribution of ammonia-oxidizing Thaumarchaeota in marine environments is now well documented, and their crucial role in the global nitrogen cycle has been highlighted. However, the potential contribution of Thaumarchaeota in the carbon cycle remains poorly understood. Here we present for the first time a seasonal investigation on the shelf region (bathymetry≤200 m) of the East China Sea (ECS) involving analysis of both thaumarchaeal 16S rRNA and autotrophy-related genes (acetyl-CoA carboxylase gene, accA). Quantitative PCR results clearly showed a higher abundance of thaumarchaeal 16S and accA genes in late-autumn (November) than summer (August), whereas the diversity and community structure of autotrophic Thaumarchaeota showed no statistically significant difference between different seasons as revealed by thaumarchaeal accA gene clone libraries. Phylogenetic analysis indicated that shallow ecotypes dominated the autotrophic Thaumarchaeota in the ECS shelf (86.3% of total sequences), while a novel non-marine thaumarchaeal accA lineage was identified in the Changjiang estuary in summer (when freshwater plumes become larger) but not in autumn, implying that Changjiang freshwater discharge played a certain role in transporting terrestrial microorganisms to the ECS. Multivariate statistical analysis indicated that the biogeography of the autotrophic Thaumarchaeota in the shelf water of the ECS was influenced by complex hydrographic conditions. However, an in silico comparative analysis suggested that the diversity and abundance of the autotrophic Thaumarchaeota might be biased by the 'universal' thaumarchaeal accA gene primers Cren529F/Cren981R since this primer set is likely to miss some members within particular phylogenetic groups. Collectively, this study improved our understanding of the biogeographic patterns of the autotrophic Thaumarchaeota in temperate coastal waters, and suggested that new accA primers with improved coverage

  9. Microbicidal effect of medicinal plant extracts (Psidium guajava Linn. and Carica papaya Linn. upon bacteria isolated from fish muscle and known to induce diarrhea in children Uso de extrato de plantas medicinais (Psidium guajava Linn. e Carica papaya Linn. frente a bactérias isoladas de pescado, causadoras de diarréias infantis

    Directory of Open Access Journals (Sweden)

    Regine Helena Silva dos Fernandes VIEIRA

    2001-06-01

    Full Text Available Out of the twenty-four samples of shrimp and fish muscle used for this study, twelve were collected near a large marine sewer for waste disposal, 3 km off the coast of Fortaleza (Brazil and used for the isolation of E. coli. Other twelve were collected at the Mucuripe fresh fish market (Fortaleza, Brazil and used for the isolation of Staphylococcus aureus. Ethanol, water and acetone-diluted extracts of guava and papaya leaf sprouts were tested on the bacteria in order to verify their microbicidal potential. The E. coli strains used in the trials were rated LT positive. The papaya leaf extracts (Carica papaya Linn showed no microbicidal activity while the guava sprout extracts (Psidium guajava Linn displayed halos exceeding 13 mm for both species, an effect considered to be inhibitory by the method employed. Guava sprout extracts by 50% diluted ethanol most effectively inhibited E. coli (EPEC, while those in 50% acetone were less effective. It may be concluded that guava sprout extracts constitute a feasible treatment option for diarrhea caused by E. coli or by S. aureus-produced toxins, due to their quick curative action, easy availability in tropical countries and low cost to the consumer.Foram coletadas doze amostras de camarão e peixes nas imediações do interceptor oceânico, em Fortaleza e igual número na Feira de pescado do Mucuripe, Fortaleza, para isolamento de E. coli e Staphylococcus aureus, respectivamente. Extratos aquosos, alcoólicos e cetônicos de broto de goiabeira e de folha de mamão foram testados frente às bactérias para se verificar suas ações antibióticas. As cepas de E. coli utilizadas nos ensaios foram as classificadas como LT positivas. Os extratos de folhas de mamão (Carica papaya Linn não revelaram quaisquer atividades antibióticas enquanto que os preparados com broto de goiabeira (Psidium guajava Linn apresentaram halos sempre >13 mm para as duas espécies, considerados como de inibição pelo m

  10. Parasitismo de Meloidogyne enterolobii em espécies de myrtaceae

    Directory of Open Access Journals (Sweden)

    Luiza Suely Semen Martins

    2013-06-01

    Full Text Available A meloidoginose da goiabeira, causada por M. enterolobii (= M. mayaguensis, é hoje considerado o principal problema fitossanitário desta cultura em todo o País, pois sua incidência resulta em acentuada queda de produtividade e, na maioria das vezes, a morte das plantas em médio prazo. Visando a seu controle, objetivou-se neste trabalho identificar fontes de resistência em goiabeira Psidium guajava L e araçazeiro Psidium sp.. Foram avaliados onze genótipos oriundos do Câmpus da Universidade Federal de Lavras (UFLA e de regiões próximas ao município de Lavras (MG. As sementes foram coletadas de frutos fisiologicamente maduros e germinadas em piscinas hidropônicas. Ao atingirem 12 cm de altura, foram transferidas para casa de vegetação, em vasos individuais, e mantidas a temperatura entre 18-38°C. Após quinze dias, foram inoculados individualmente com suspensão de 10.000 ovos e juvenis de segundo estádio (J2 de M. enterolobii e avaliadas após 120 dias. As reações dos hospedeiros foram enquadradas nos parâmetros estabelecidos pelo fator de reprodução FR, estimado pelo quociente Pf/Pi, em que Pf representa a população final e Pi a população inicial. O delineamento utilizado foi o inteiramente casualizado, com 11 genótipos, uma espécie de nematoide e seis repetições, sendo duas plantas em cada genótipo adicionadas como controle. Quatro meses depois, foram avaliados os teores foliares de macro e micronutrientes e o grau de infecção de cada genótipo. A produção média de ovos e J2 de M. enterolobii variou de 200 a 428.146,1, e os fatores de reprodução (FR médios variaram de 0,02(ALU1 a 42,81(A-PASTO. Os genótipos de araçazeiro (Psidium spp. AUFLA1, AUFLA4, AUFLA5 e APASTO e os genótipos de goiabeira (P. guajava G-ROXA e G-AMAR foram considerados suscetíveis. Os genótipos de araçazeiro ALU1, ALU2, ALU3, AROXO-C e AROXO-U mostraram-se resistentes, reforçando a necessidade de trabalhos complementares com

  11. Community structure and function of planktonic Crenarchaeota: changes with depth in the South China Sea.

    Science.gov (United States)

    Hu, Anyi; Jiao, Nianzhi; Zhang, Chuanlun L

    2011-10-01

    Marine Crenarchaeota represent a widespread and abundant microbial group in marine ecosystems. Here, we investigated the abundance, diversity, and distribution of planktonic Crenarchaeota in the epi-, meso-, and bathypelagic zones at three stations in the South China Sea (SCS) by analysis of crenarchaeal 16S rRNA gene, ammonia monooxygenase gene amoA involved in ammonia oxidation, and biotin carboxylase gene accA putatively involved in archaeal CO(2) fixation. Quantitative PCR analyses indicated that crenarchaeal amoA and accA gene abundances varied similarly with archaeal and crenarchaeal 16S rRNA gene abundances at all stations, except that crenarchaeal accA genes were almost absent in the epipelagic zone. Ratios of the crenarchaeal amoA gene to 16S rRNA gene abundances decreased ~2.6 times from the epi- to bathypelagic zones, whereas the ratios of crenarchaeal accA gene to marine group I crenarchaeal 16S rRNA gene or to crenarchaeal amoA gene abundances increased with depth, suggesting that the metabolism of Crenarchaeota may change from the epi- to meso- or bathypelagic zones. Denaturing gradient gel electrophoresis profiling of the 16S rRNA genes revealed depth partitioning in archaeal community structures. Clone libraries of crenarchaeal amoA and accA genes showed two clusters: the "shallow" cluster was exclusively derived from epipelagic water and the "deep" cluster was from meso- and/or bathypelagic waters, suggesting that niche partitioning may take place between the shallow and deep marine Crenarchaeota. Overall, our results show strong depth partitioning of crenarchaeal populations in the SCS and suggest a shift in their community structure and ecological function with increasing depth.

  12. Seasonal cultivated and fallow cropland mapping using MODIS-based automated cropland classification algorithm

    Science.gov (United States)

    Wu, Zhuoting; Thenkabail, Prasad S.; Mueller, Rick; Zakzeski, Audra; Melton, Forrest; Johnson, Lee; Rosevelt, Carolyn; Dwyer, John; Jones, Jeanine; Verdin, James P.

    2014-01-01

    Increasing drought occurrences and growing populations demand accurate, routine, and consistent cultivated and fallow cropland products to enable water and food security analysis. The overarching goal of this research was to develop and test automated cropland classification algorithm (ACCA) that provide accurate, consistent, and repeatable information on seasonal cultivated as well as seasonal fallow cropland extents and areas based on the Moderate Resolution Imaging Spectroradiometer remote sensing data. Seasonal ACCA development process involves writing series of iterative decision tree codes to separate cultivated and fallow croplands from noncroplands, aiming to accurately mirror reliable reference data sources. A pixel-by-pixel accuracy assessment when compared with the U.S. Department of Agriculture (USDA) cropland data showed, on average, a producer's accuracy of 93% and a user's accuracy of 85% across all months. Further, ACCA-derived cropland maps agreed well with the USDA Farm Service Agency crop acreage-reported data for both cultivated and fallow croplands with R-square values over 0.7 and field surveys with an accuracy of ≥95% for cultivated croplands and ≥76% for fallow croplands. Our results demonstrated the ability of ACCA to generate cropland products, such as cultivated and fallow cropland extents and areas, accurately, automatically, and repeatedly throughout the growing season.

  13. Antibodies against glucan, chitin, and Saccharomyces cerevisiae mannan as new biomarkers of Candida albicans infection that complement tests based on C. albicans mannan.

    Science.gov (United States)

    Sendid, B; Dotan, N; Nseir, S; Savaux, C; Vandewalle, P; Standaert, A; Zerimech, F; Guery, B P; Dukler, A; Colombel, J F; Poulain, D

    2008-12-01

    Antibodies against Saccharomyces cerevisiae mannan (ASCA) and antibodies against synthetic disaccharide fragments of glucans (ALCA) and chitin (ACCA) are biomarkers of Crohn's disease (CD). We previously showed that Candida albicans infection generates ASCA. Here, we explored ALCA and ACCA as possible biomarkers of invasive C. albicans infection (ICI). ASCA, ALCA, ACCA, and Candida mannan antigen and antibody detection tests were performed on 69 sera obtained sequentially from 18 patients with ICIs proven by blood culture, 59 sera from CD patients, 47 sera from hospitalized subjects colonized by Candida species (CZ), and 131 sera from healthy controls (HC). ASCA, ALCA, and ACCA levels in CD and ICI patients were significantly different from those in CZ and HC subjects (PACCA, and Platelia Candida tests, 100% of ICIs were detected, with the kinetics of the antibody response depending on the patient during the time course of infection. A large number of sera presented with more than three positive tests. This is the first evidence that the detection of antibodies against chitin and glucans has diagnostic value in fungal infections and that these tests can complement more specific tests. Future trials are necessary to assess the value of these tests in multiparametric analysis, as well as their pathophysiological relevance.

  14. Seasonal cultivated and fallow cropland mapping using MODIS-based automated cropland classification algorithm

    Science.gov (United States)

    Wu, Zhuoting; Thenkabail, Prasad S.; Mueller, Rick; Zakzeski, Audra; Melton, Forrest; Johnson, Lee; Rosevelt, Carolyn; Dwyer, John; Jones, Jeanine; Verdin, James P.

    2014-01-01

    Increasing drought occurrences and growing populations demand accurate, routine, and consistent cultivated and fallow cropland products to enable water and food security analysis. The overarching goal of this research was to develop and test automated cropland classification algorithm (ACCA) that provide accurate, consistent, and repeatable information on seasonal cultivated as well as seasonal fallow cropland extents and areas based on the Moderate Resolution Imaging Spectroradiometer remote sensing data. Seasonal ACCA development process involves writing series of iterative decision tree codes to separate cultivated and fallow croplands from noncroplands, aiming to accurately mirror reliable reference data sources. A pixel-by-pixel accuracy assessment when compared with the U.S. Department of Agriculture (USDA) cropland data showed, on average, a producer’s accuracy of 93% and a user’s accuracy of 85% across all months. Further, ACCA-derived cropland maps agreed well with the USDA Farm Service Agency crop acreage-reported data for both cultivated and fallow croplands with R-square values over 0.7 and field surveys with an accuracy of ≥95% for cultivated croplands and ≥76% for fallow croplands. Our results demonstrated the ability of ACCA to generate cropland products, such as cultivated and fallow cropland extents and areas, accurately, automatically, and repeatedly throughout the growing season.

  15. Acetyl-CoA Carboxylase-α Inhibitor TOFA Induces Human Cancer Cell Apoptosis

    Science.gov (United States)

    Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-fang; Cao, Deliang

    2009-01-01

    Acetyl-CoA carboxylase-α (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC50 at approximately 5.0, 5.0, and 4.5 μg/ml, respectively. TOFA at 1.0–20.0 μg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 μM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis. PMID:19450551

  16. Acetyl-CoA carboxylase-alpha inhibitor TOFA induces human cancer cell apoptosis.

    Science.gov (United States)

    Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-Fang; Cao, Deliang

    2009-07-31

    Acetyl-CoA carboxylase-alpha (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC(50) at approximately 5.0, 5.0, and 4.5 microg/ml, respectively. TOFA at 1.0-20.0 microg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 microM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis.

  17. Accounting for carbon

    OpenAIRE

    Lovell, Heather; Sales de Aguiar, Thereza; Bebbington, Jan; Larrinaga-Gonzalez, Carlos; International Emissions Trading Association

    2010-01-01

    ACCA working in partnership with IETA This report reveals how large emitters in the European Emissions Trading Scheme (EU ETS) are accounting for emission allowances. The diversity of emission-allowance accounting practices being used in Europe shows carbon financial accounting to be in its formative stages - rules and practices are still unsettled. With this report, ACCA, in partnership with IETA, is opening up the debate to a wider international audience. Publisher PDF

  18. Software for Avionics.

    Science.gov (United States)

    1983-01-01

    fonctions gfinbrales et lea uti- litaires fournis en particulier grice 41 UNIX, sont intfigrfs aelon divers points de vue: - par leur accas 41 travers le...Are They Really A Problem? Proceedings, 2nd International Conference On Software Engineering, pp 91-68. Long acCA : IEEE Computer Society. Britton...CD The Hague. Nc KLEINSCIIMIDT, M. Dr Fa. LITEF. Poatfach 774. 7800 Freiburg i. Br., Ge KLEMM, R. Dr FGAN- FFM , D 5 307 Watchberg-Werthhoven. Ge KLENK

  19. Aldo-keto Reductase Family 1 B10 as a Novel Target for Breast Cancer Treatment

    Science.gov (United States)

    2010-08-01

    overexpressed in tested human breast cancer tissues and mediates acetyl-CoA carboxylase-α ( ACCA ) stability, affecting fatty acid de novo synthesis and...9703; Fax. 217-545-3227; E-mail: dcao@siumed.edu Running title: AKR1B10 as a new risk factor for breast cancer Abbreviations used: ACCA , acetyl...The effect of AKR1B10 expression in cancer tissue on patient survival was evaluated with Kaplan - Meier plots, and results showed that AKR1B10

  20. Produção e qualidade dos frutos da goiabeira 'Pedro Sato' submetida a diferentes épocas de poda Production and quality of guava fruits 'Pedro Sato' submitted to different pruning times

    Directory of Open Access Journals (Sweden)

    Ronaldo Hissayuki Hojo

    2007-03-01

    Full Text Available O objetivo deste trabalho foi verificar a possibilidade de produção de goiaba de boa qualidade comercial, em diferentes épocas do ano, de acordo com podas realizadas em setembro e dezembro de 2003, março e junho de 2004. Utilizaram-se goiabeiras, cultivar Pedro Sato, com os ramos podados a 30 cm da base, sem desfolhamento, com quatro anos de idade, em delineamento de blocos ao acaso. Avaliaram-se: número de frutos produzidos, produção por planta, firmeza, sólidos solúveis (SS, acidez titulável (AT, relação SS/AT, pH e açúcares solúveis totais. Observou-se que as épocas de poda afetaram de maneira expressiva as características avaliadas. A produção de frutos por planta variou de 269,8 a 500,8 e foi inversamente proporcional ao peso dos frutos (186,9 a 205,5 g. A produção foi entre 55,5 e 93,6 kg por planta. O período de poda também influenciou as características físico-químicas dos frutos, mas não afetou a firmeza. É possível a produção de frutos de boa qualidade ao longo de nove meses do ano, com o manejo das podas.The objective of this work was to verify the possibility of fruit production at different periods, according to the pruning time (September and December 2003 and March and June 2004. The experimental design was a randomized blocks with guava plants of cultivar Pedro Sato per repetition, with four-years old, no defoliation, and branches prunned with 30 cm length. Evaluations consisted of: number of fruits per plant, plant yield, firmness, soluble solids (SS, titratable acidity (AT, SS/AT ratio, pH and total soluble sugars. It was observed that the pruning periods affected these characteristics. The fruit number per plant varied from 269.8 to 500.8. Fruit weight (186.9 to 205.5 g was inversely proportional to the yield per plant. The total yield weight of fruits varied from 55.5 to 93.6 kg per plant. The pruning period also influenced significantly physio-chemical characteristics of the fruits, but not the

  1. The structural and electro-optical characteristics of AZO/Cr:Cu/AZO transparent conductive film

    International Nuclear Information System (INIS)

    Lin, Tien-Chai; Huang, Wen-Chang; Tsai, Fu-Chun

    2015-01-01

    A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO (ACCA), was presented in the paper. The structural and electro-optical properties of the ACCA film were discussed. The thickness of the middle metal layer was constant and those of the AZO layers were varied. The ACCA film shows an obvious ZnO (002) c-axis preferential growth. No diffraction peaks related to Cr and Cu were observed through x-ray diffraction analysis. The middle Cr:Cu layer showed a thickness of 8.16 nm with a continuous and amorphous structure by the observation of a high-resolution transmission electron microscopy (HR-TEM). For the electro-optical characteristic, a best figure of merit (FOM) value of 3.54 × 10 −3 Ω −1 with a corresponding transmittance of 85% was obtained at the thickness of 116 nm of ACCA film. The high FOM value of the film is due to the improvement of conductivity and small sacrifices of transparency. - Highlights: • A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO is developed. • Chromium is added to copper to reduce the oxidation–reduction reaction. • The film has a FOM of 3.54 × 10 −3 Ω −1 with a corresponding transmittance of 85%. • The Cr:Cu layer shows a continuous and amorphous structure

  2. Secretory carcinoma of the breast and its histopathological mimics: value of markers for differential diagnosis.

    Science.gov (United States)

    Osako, Tomo; Takeuchi, Kengo; Horii, Rie; Iwase, Takuji; Akiyama, Futoshi

    2013-10-01

    Secretory carcinoma (SC) is a rare histological type of breast cancer, and ETV6-NTRK3 gene fusion is highly specific to it. The differential diagnoses of SC include acinic cell carcinoma (ACCA) and cystic hypersecretory carcinoma (CHC), as well as invasive ductal carcinoma (IDC). For patients with these rare but distinctive histological subtypes, SC and its histopathological mimics should be differentiated from each other. However, differential markers have not yet been assessed systematically, and we aimed to identify and evaluate novel and existing markers. We reviewed 19 cases diagnosed initially as SC using integrated diagnostic techniques, including morphology, immunohistochemistry and molecular pathology, and validated promising markers in 445 breast cancers. We reclassified 19 formerly diagnosed 'SCs' into nine SCs, three ACCAs, three CHCs, three IDCs and one microglandular adenosis. We confirmed that ETV6-NTRK3 gene rearrangement and amylase positivity are good diagnostic markers for SC and ACCA, respectively. Vacuolar staining for adipophilin, positivity for α-lactalbumin and negativity for ETV6 rearrangement are diagnostic markers for CHC. In this study, we propose a panel of four markers (ETV6 rearrangement, amylase, α-lactalbumin and adipophilin) for distinguishing SC, ACCA, CHC and IDC. This simple but robust panel will serve pathologists well as a practical guide for reaching an appropriate diagnosis. © 2013 John Wiley & Sons Ltd.

  3. The structural and electro-optical characteristics of AZO/Cr:Cu/AZO transparent conductive film

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Tien-Chai [Department of Electrical Engineering, Kun Shan University, No. 195, Kun-Da Road, Yung-Kang Dist., Tainan 71003, Taiwan, ROC (China); Huang, Wen-Chang, E-mail: wchuang@mail.ksu.edu.tw [Department of Electro-Optical Engineering, Kun Shan University, No. 195, Kun-Da Road, Yung-Kang Dist., Tainan 71003, Taiwan, ROC (China); Tsai, Fu-Chun [Department of Electro-Optical Engineering, Kun Shan University, No. 195, Kun-Da Road, Yung-Kang Dist., Tainan 71003, Taiwan, ROC (China)

    2015-08-31

    A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO (ACCA), was presented in the paper. The structural and electro-optical properties of the ACCA film were discussed. The thickness of the middle metal layer was constant and those of the AZO layers were varied. The ACCA film shows an obvious ZnO (002) c-axis preferential growth. No diffraction peaks related to Cr and Cu were observed through x-ray diffraction analysis. The middle Cr:Cu layer showed a thickness of 8.16 nm with a continuous and amorphous structure by the observation of a high-resolution transmission electron microscopy (HR-TEM). For the electro-optical characteristic, a best figure of merit (FOM) value of 3.54 × 10{sup −3} Ω{sup −1} with a corresponding transmittance of 85% was obtained at the thickness of 116 nm of ACCA film. The high FOM value of the film is due to the improvement of conductivity and small sacrifices of transparency. - Highlights: • A novel triple-layered transparent conductive film, AZO/Cr:Cu/AZO is developed. • Chromium is added to copper to reduce the oxidation–reduction reaction. • The film has a FOM of 3.54 × 10{sup −3} Ω{sup −1} with a corresponding transmittance of 85%. • The Cr:Cu layer shows a continuous and amorphous structure.

  4. Functioning adrenal tumours in children and adolescents: an institutional experience.

    Science.gov (United States)

    Mishra, A; Agarwal, G; Misra, A K; Agarwal, A; Mishra, S K

    2001-02-01

    The purpose of the present paper was to carry out an audit of clinicopathological profile and treatment outcome in 13 children with functioning adrenal tumours. The medical records of 13 children with functioning adrenal tumours who were managed between June 1990 and January 1999 were reviewed. Demographic data, clinical features, biochemical and localization studies, operative details and follow-up records were studied. Children with neuroblastoma were excluded. The mean age was 7.4 +/- 5.3 years. Seven patients had Cushing's syndrome (CS), two patients had virilizing tumours, three patients had phaeochromocytoma (PCC) and one patient had Conn's syndrome. All patients (except one child with CS) were treated surgically. Two children with adrenocortical carcinoma (ACCa) died during the perioperative period. Histopathological diagnosis was adrenal cortical adenoma (ACAd) in four patients, ACCa in five patients and PCC in three patients. Two ACCa patients died of metastases at 12 and 14 months, respectively, while the third is alive and well at 30 months. Children with ACAd are alive and well at 91, 56, 32 and 27 months postoperatively. Children with PCC are free of disease (normal urinary metanephrines) at 63, 18 and 8 months after surgery but require antihypertensive drugs in low doses. The outcome of surgery is good in cases of ACAd and PCC. Although outcome is poor in ACCa, surgery remains the mainstay of treatment and offers good palliation.

  5. Integreret rapportering i praksis

    DEFF Research Database (Denmark)

    Pontoppidan, Caroline Aggestam; Sonnerfeldt, Amanda

    2017-01-01

    Formålet med denne artikel er at bidrage til en dybere forståelse af fænomenet integreret rapporte-ring () og, hvordan IIRC’s begrebsramme afspejles i praksis i virksomheder og af interessen-ter. Artiklen tager udgangspunkt i nyere empiriske forskningsprojekter, som bringer viden omkring......; 1) brugeres (stakeholders) informationsbehov, herunder anvendelsen og nytteværdien af og 2) praktiske udfordringer samt ’best practice’ tendenser inden for (ACCA, 2016; ACCA 2017; AcE, 2017; IFAC 2017)....

  6. sellowiana (Myrtaceae y Casearia lasiophylla (Flacourtiaceae

    Directory of Open Access Journals (Sweden)

    Héctor A. Keller

    2007-01-01

    Full Text Available Se citan por primera vez para la flora argentina las especies Acca sellowiana (Myrtaceae y Casearia lasiophylla (Flacourtiaceae, las cuales se destacan en otros países por sus múltiples usos. El género Acca no había sido citado anteriormente para Argentina. Se detallan los caracteres distintivos de las especies, se las ilustra mediante fotografías y se brinda información acerca de su distribución, nombres vernáculos, usos y observaciones ecológicas.

  7. Proceedings of the Annual Symposium of Frequency Control (43rd) Held in Denver, Colorado on 31 May - 2 June 1989

    Science.gov (United States)

    1989-01-01

    determined by using a mobile earth OW .F’ Mv TJM station and by calculating the Sagnac effect. Td us f ot- Several auditional stations will participate in...a0Mlerad alon theX drecton.SC-cut, four-point mount acca -leratedalong the X direction, along the X direction. FREOUENCY SHIrT IN 1l SC-CUT rOR Txx Taz...removing mapped figure errors. Ailthough PCE is highly acca - gen compensates for the higher evaporation rate ot the hotter rate and repeatable without

  8. Design, Construction, Testing and Evaluation of a Residential Ice Storage Air Conditioning System.

    Science.gov (United States)

    1982-11-01

    handler and chilled water coil from previous research. This was a necessity because of the financial constraints of ] the project. 2. The trailer was...Load lbs ice/12 hr Calculation Btuh req’d @ 8 FLEOB 1. NFPA 501 BM 25,043 1391 2. ACCA Manual J 27,571 1537 using manufacturer’sdata 3. ACCA Manual J...kilowatt hrf - ~0.197 (N da• y The equivalent ice requirement was estimated using the above data and 144 Btu/pound of ice. This does not account for any

  9. Engineering Design Handbook. Helicopter Engineering. Part Two. Detail Design

    Science.gov (United States)

    1976-01-01

    lubrication, the splines and the monoball oc- ge’~ll ar pity -agd stac mt uis brekawy snip v casionzily require lubricationforce. F6 , A~sj, the di~aphiag tc 5v...being stowed ian aminimum volum, so as Hap sad daue co a be Wooatd in accas *.m M~ to isseff-a with the traosport of cor.. wi& MaL4T.5M= so that the men...helicopter to If lubrication is required, fittings must be located placement of modules - limited piece-part replace- where accas is possible using

  10. Advanced asymmetric synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid by alkylation/cyclization of newly designed axially chiral Ni(II) complex of glycine Schiff base.

    Science.gov (United States)

    Kawashima, Aki; Shu, Shuangjie; Takeda, Ryosuke; Kawamura, Akie; Sato, Tatsunori; Moriwaki, Hiroki; Wang, Jiang; Izawa, Kunisuke; Aceña, José Luis; Soloshonok, Vadim A; Liu, Hong

    2016-04-01

    Asymmetric synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid (vinyl-ACCA) is in extremely high demand due to the pharmaceutical importance of this tailor-made, sterically constrained α-amino acid. Here we report the development of an advanced procedure for preparation of the target amino acid via two-step SN2 and SN2' alkylation of novel axially chiral nucleophilic glycine equivalent. Excellent yields and diastereoselectivity coupled with reliable and easy scalability render this method of immediate use for practical synthesis of (1R,2S)-vinyl-ACCA.

  11. Optimization of Selected Remote Sensing Algorithms for Embedded NVIDIA Kepler GPU Architecture

    Science.gov (United States)

    Riha, Lubomir; Le Moigne, Jacqueline; El-Ghazawi, Tarek

    2015-01-01

    This paper evaluates the potential of embedded Graphic Processing Units in the Nvidias Tegra K1 for onboard processing. The performance is compared to a general purpose multi-core CPU and full fledge GPU accelerator. This study uses two algorithms: Wavelet Spectral Dimension Reduction of Hyperspectral Imagery and Automated Cloud-Cover Assessment (ACCA) Algorithm. Tegra K1 achieved 51 for ACCA algorithm and 20 for the dimension reduction algorithm, as compared to the performance of the high-end 8-core server Intel Xeon CPU with 13.5 times higher power consumption.

  12. Fort Drum Preliminary Fiscal Impact Analysis: Technical Appendices,

    Science.gov (United States)

    1986-01-01

    the Capital Expenditure table are those normally included in "equipment and capital outlay" by the New York State Department of Audit and Control...19 . - - C a a * -~- -- - - e a aa - - -- - C a c z - =----- -- a X- - - - Z.-.- -- -- - - a - - - I . Ch ... .aCa aC... - "-a C " fl C ana~ acca ...a - I m a - * Sa a - - S a -* ma m aaamn n * a -- a a a * a a C~0aaa~ aCCa -----------,a a 0~ an a a - - - - ma a a . - a * - aa a a a S a - a

  13. A Pyranose-2-Phosphate Motif Is Responsible for Both Antibiotic Import and Quorum-Sensing Regulation in Agrobacterium tumefaciens.

    Directory of Open Access Journals (Sweden)

    Abbas El Sahili

    2015-08-01

    Full Text Available Periplasmic binding proteins (PBPs in association with ABC transporters select and import a wide variety of ligands into bacterial cytoplasm. They can also take up toxic molecules, as observed in the case of the phytopathogen Agrobacterium tumefaciens strain C58. This organism contains a PBP called AccA that mediates the import of the antibiotic agrocin 84, as well as the opine agrocinopine A that acts as both a nutrient and a signalling molecule for the dissemination of virulence genes through quorum-sensing. Here, we characterized the binding mode of AccA using purified agrocin 84 and synthetic agrocinopine A by X-ray crystallography at very high resolution and performed affinity measurements. Structural and affinity analyses revealed that AccA recognizes an uncommon and specific motif, a pyranose-2-phosphate moiety which is present in both imported molecules via the L-arabinopyranose moiety in agrocinopine A and the D-glucopyranose moiety in agrocin 84. We hypothesized that AccA is a gateway allowing the import of any compound possessing a pyranose-2-phosphate motif at one end. This was structurally and functionally confirmed by experiments using four synthetic compounds: agrocinopine 3'-O-benzoate, L-arabinose-2-isopropylphosphate, L-arabinose-2-phosphate and D-glucose-2-phosphate. By combining affinity measurements and in vivo assays, we demonstrated that both L-arabinose-2-phosphate and D-glucose-2-phosphate, which are the AccF mediated degradation products of agrocinopine A and agrocin 84 respectively, interact with the master transcriptional regulator AccR and activate the quorum-sensing signal synthesis and Ti plasmid transfer in A. tumefaciens C58. Our findings shed light on the role of agrocinopine and antibiotic agrocin 84 on quorum-sensing regulation in A. tumefaciens and reveal how the PBP AccA acts as vehicle for the importation of both molecules by means of a key-recognition motif. It also opens future possibilities for the

  14. A Pyranose-2-Phosphate Motif Is Responsible for Both Antibiotic Import and Quorum-Sensing Regulation in Agrobacterium tumefaciens.

    Science.gov (United States)

    El Sahili, Abbas; Li, Si-Zhe; Lang, Julien; Virus, Cornelia; Planamente, Sara; Ahmar, Mohammed; Guimaraes, Beatriz G; Aumont-Nicaise, Magali; Vigouroux, Armelle; Soulère, Laurent; Reader, John; Queneau, Yves; Faure, Denis; Moréra, Solange

    2015-08-01

    Periplasmic binding proteins (PBPs) in association with ABC transporters select and import a wide variety of ligands into bacterial cytoplasm. They can also take up toxic molecules, as observed in the case of the phytopathogen Agrobacterium tumefaciens strain C58. This organism contains a PBP called AccA that mediates the import of the antibiotic agrocin 84, as well as the opine agrocinopine A that acts as both a nutrient and a signalling molecule for the dissemination of virulence genes through quorum-sensing. Here, we characterized the binding mode of AccA using purified agrocin 84 and synthetic agrocinopine A by X-ray crystallography at very high resolution and performed affinity measurements. Structural and affinity analyses revealed that AccA recognizes an uncommon and specific motif, a pyranose-2-phosphate moiety which is present in both imported molecules via the L-arabinopyranose moiety in agrocinopine A and the D-glucopyranose moiety in agrocin 84. We hypothesized that AccA is a gateway allowing the import of any compound possessing a pyranose-2-phosphate motif at one end. This was structurally and functionally confirmed by experiments using four synthetic compounds: agrocinopine 3'-O-benzoate, L-arabinose-2-isopropylphosphate, L-arabinose-2-phosphate and D-glucose-2-phosphate. By combining affinity measurements and in vivo assays, we demonstrated that both L-arabinose-2-phosphate and D-glucose-2-phosphate, which are the AccF mediated degradation products of agrocinopine A and agrocin 84 respectively, interact with the master transcriptional regulator AccR and activate the quorum-sensing signal synthesis and Ti plasmid transfer in A. tumefaciens C58. Our findings shed light on the role of agrocinopine and antibiotic agrocin 84 on quorum-sensing regulation in A. tumefaciens and reveal how the PBP AccA acts as vehicle for the importation of both molecules by means of a key-recognition motif. It also opens future possibilities for the rational design of

  15. Droplet Size and Liquid Water Characteristics of the USAAEFA (CH-47) Helicopter Spray System and Natural Clouds as Sampled by a JUH-1H Helicopter.

    Science.gov (United States)

    1980-08-01

    o080Atalea Cal lolna 9" C’ lelephone 121 3) 79, .I 9" lee f6 5A2i A S.,&,osa’fr o MC CALIBRAT ION REPORT Date: 1/8/80 Instrument: ASSP-l 00-1 Size Size...c% c l a a 0 -1 a*’ ac e a***cca *a c a am a*ca c acca =aac ca~ac caaa U𔃺 C C C C0 C C C C C C C C Q C C C C C C C> C C C C C C C CD C C C C CD 0 a C...C C atI 0 l C 0 .C C 0 0 QC 0 0 0 c CD C c 0 C C 0 Q 0 CIC C C0 C 0 C C> C go 1 C 0j C C C QC 0 QQO0COQC=C0c 00CC =1C Q0c cC aCCa CSQ --- -V -, -7

  16. Stabilization of Angiotensin-(1-7) by key substitution with a cyclic non-natural amino acid.

    Science.gov (United States)

    Wester, Anita; Devocelle, Marc; Tallant, E Ann; Chappell, Mark C; Gallagher, Patricia E; Paradisi, Francesca

    2017-10-01

    Angiotensin-(1-7) [Ang-(1-7)], a heptapeptide hormone of the renin-angiotensin-aldosterone system, is a promising candidate as a treatment for cancer that reflects its anti-proliferative and anti-angiogenic properties. However, the peptide's therapeutic potential is limited by the short half-life and low bioavailability resulting from rapid enzymatic metabolism by peptidases including angiotensin-converting enzyme (ACE) and dipeptidyl peptidase 3 (DPP 3). We report the facile assembly of three novel Ang-(1-7) analogues by solid-phase peptide synthesis which incorporates the cyclic non-natural δ-amino acid ACCA. The analogues containing the ACCA substitution at the site of ACE cleavage exhibit complete resistance to human ACE, while substitution at the DDP 3 cleavage site provided stability against DPP 3 hydrolysis. Furthermore, the analogues retain the anti-proliferative properties of Ang-(1-7) against the 4T1 and HT-1080 cancer cell lines. These results suggest that ACCA-substituted Ang-(1-7) analogues which show resistance against proteolytic degradation by peptidases known to hydrolyze the native heptapeptide may be novel therapeutics in the treatment of cancer.

  17. Evidence against translational repression by the carboxyltransferase component of Escherichia coli acetyl coenzyme A carboxylase.

    Science.gov (United States)

    Smith, Alexander C; Cronan, John E

    2014-11-01

    In Escherichia coli, synthesis of the malonyl coenzyme A (malonyl-CoA) required for membrane lipid synthesis is catalyzed by acetyl-CoA carboxylase, a large complex composed of four subunits. The subunit proteins are needed in a defined stoichiometry, and it remains unclear how such production is achieved since the proteins are encoded at three different loci. Meades and coworkers (G. Meades, Jr., B. K. Benson, A. Grove, and G. L. Waldrop, Nucleic Acids Res. 38:1217-1227, 2010, doi:http://dx.doi.org/10.1093/nar/gkp1079) reported that coordinated production of the AccA and AccD subunits is due to a translational repression mechanism exerted by the proteins themselves. The AccA and AccD subunits form the carboxyltransferase (CT) heterotetramer that catalyzes the second partial reaction of acetyl-CoA carboxylase. Meades et al. reported that CT tetramers bind the central portions of the accA and accD mRNAs and block their translation in vitro. However, long mRNA molecules (500 to 600 bases) were required for CT binding, but such long mRNA molecules devoid of ribosomes seemed unlikely to exist in vivo. This, plus problematical aspects of the data reported by Meades and coworkers, led us to perform in vivo experiments to test CT tetramer-mediated translational repression of the accA and accD mRNAs. We report that increased levels of CT tetramer have no detectable effect on translation of the CT subunit mRNAs. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  18. EXPOSÉ DE POLITIQUE DU PROGRAMME ACCA

    International Development Research Centre (IDRC) Digital Library (Canada)

    afin qu'elle soit plus accessible aux utilisateurs que les prévisions saisonnières nationales brutes. Ces plateformes ont resserré la communication entre des acteurs de la chaîne de l'information qui n'ont pas l'habitude de travailler ensemble. Ce processus collaboratif sur l'information climatique saisonnière a eu pour effet ...

  19. Estandarización del método propuesto por la Organización Mundial de la Salud para determinar los niveles de susceptibilidad de los vectores de leishmaniasis a insecticidas

    Directory of Open Access Journals (Sweden)

    Erika Santamaría

    2002-06-01

    Full Text Available El objetivo de este estudio fue estandarizar el método OMS para determinar susceptibilidad a insecticidas en algunas especies de Lutzomyia en condiciones de laboratorio y de campo. Los ensayos biológicos se realizaron sin insecticida, únicamente con tratamientos controles para determinar mortalidad por manipulación y otras condiciones desfavorables para cada especie. Se emplearon hembras de tres colonias de laboratorio: dos cepas de Lutzomyia longipalpis y una de Lutzomyia serrana. También se incluyeron en el estudio hembras silvestres de Lutzomyia quasitownsendi. Se emplearon dos tipos de métodos: el método OMS y el método OMSadaptado; este último consistió en reemplazar el tubo OMS para el periodo posexposición por un contenedor plástico con yeso humedecido. Para cada método se ensayaron tres tipos de papeles: papel impregnado con aceite de oliva, papel impregnado con aceite de silicona y papel sin aditivos. La variable por medir fue el porcentaje de mortalidad a las 24 h. El método OMS resultó conveniente para las dos cepas de L. longipalpis con una mortalidad entre 0 y 10%, pero registró una mortalidad elevada en L. serrana (20-80% y L. quasitownsendi silvestres (10-50%. Con el método OMS-modificado, la mortalidad promedio fue inferior a 4% en todas las especies ensayadas. Con respecto al tipo de papel, no se encontraron variaciones importantes. Según los resultados, el recipiente utilizado en el periodo posexposición afecta la supervivencia de los flebótomos y de manera variable para cada especie. Al establecer líneas base de susceptibilidad a insecticidas en especies del género Lutzomyia, se recomienda el uso del método OMS para L. longipalpis y del método OMS-modificado para L. serrana, L. quasitownsendi y especies cercanas.

  20. Relações filogenéticas e diversidade de isolados de Guignardia spp oriundos de diferentes hospedeiros nas regiões ITS1-5,8S-ITS2 Phylogenetic relationships and diversity of Guignardia spp isolated from different hosts on ITS1-5,8S-ITS2 region

    Directory of Open Access Journals (Sweden)

    Ester Wickert

    2009-06-01

    Full Text Available Fungos do gênero Guignardia são frequentemente isolados em diferentes espécies de plantas, sendo muitas vezes caracterizados como fungos endofíticos. Entretanto, algumas espécies deste fungo, a exemplo de G. citricarpa e G. psidii, são causadores de importantes doenças que afetam culturas agrícolas, como a Mancha-Preta dos Citros (MPC e a podridão dos frutos de goiabeira, respectivamente. Também são apontados como causadores de manchas foliares em diferentes espécies de frutíferas e também em outras culturas. Este trabalho teve o objetivo de isolar, identificar e caracterizar a diversidade genética existente entre isolados de Guignardia oriundos de citros, mangueira, goiabeira, eucaliptos, jabuticabeira e pitangueira através da análise da sequência de DNA do cístron ITS1-5,8-S-ITS2. Verificou-se que os isolados obtidos pertencem às espécies G. citricarpa e G. mangiferae. Entretanto, dois grupos encontrados em mangueira não puderam ser identificados em nível de espécie com base em sua sequência de DNA em função da baixa similaridade com as sequências de diferentes espécies de Guignardia já depositadas em banco de dados. Desta forma, goiabeira, eucaliptos, jabuticabeira e pitangueira são hospedeiras de G. mangiferae, enquanto os citros hospedam duas formas, G. citricarpa e G. mangiferae. Já a mangueira é hospedeira de G. mangiferae e de dois outros grupos ainda não identificados. Verificou-se ainda que isolados de Guignardia obtidos de sintomas de podridão de fruto de goiabeira foram identificados como G. mangiferae.Fungi of Guignardia genera are commonly isolated from different plant species and most of the time they are characterized as endophytics. However, some species of this genus, as G. citricarpa and G. psidii are known as causal agents of serious diseases that affect cultures, such as the Citrus Black Spot and the guava fruit rot, respectively. They are also responsible for diseases that cause foliar

  1. AGARD (Advisory Group for Aerospace Research & Development) Index of Publications, 1986-1988

    Science.gov (United States)

    1989-08-01

    paper looks in rather more detail (AGARD-LS.147) Avaii NTIS HC A07’MF A01 at how non inear FFM may Le Replied in support of structral These lecture...p 24H 1160 19923 0 net laInar- -ae.le.. tol 10 stdy Iho tne. OS (RNNE -1loopua In entocl~on le-1. sharing T_ accas -a Iu la.. any din a bepetaton...gudnc 173 Ni89 1706 IcAaAR A-2541 p 14 88828883 radon target doxintangootoosianga ragn of ihot RADAR RESOLUTION QUALITY CONTROL accaes P t3O N87-18744

  2. Cumulative percent energy deposition of photon beam incident on different targets, simulated by Monte Carlo

    International Nuclear Information System (INIS)

    Kandic, A.; Jevremovic, T.; Boreli, F.

    1989-01-01

    Monte Carlo simulation (without secondary radiation) of the standard photon interactions (Compton scattering, photoelectric absorption and pair protection) for the complex slab's geometry is used in numerical code ACCA. A typical ACCA run will yield: (a) transmission of primary photon radiation differential in energy, (b) the spectrum of energy deposited in the target as a function of position and (c) the cumulative percent energy deposition as a function of position. A cumulative percent energy deposition of photon monoenergetic beam incident on simplest and complexity tissue slab and Fe slab are presented in this paper. (author). 5 refs.; 2 figs

  3. Elements of Dynamic Programming,

    Science.gov (United States)

    1981-02-02

    step/pitch lies in the fact that us ia .o eacerprise P, cf means x". to enter.rise P2 - means xan sc L Jsing widely used teraiAo.j, :onrrol U, it is... acca ~acj ,,L ra sauticn of protlem. Is qenertity intuitively it ii cliax thi-t with at. increat-e in the number aoc = 80151502 FAG E of stips/pitches...Ad.aua inccme W*.. 5S on the ,raph/curve Fig. 9.10 bitn ;.A Leut Z, = 0.75.x2 + 0.3 (Z, - xl); it is obtained value w. 4 . .o.& acca ayq.n they are

  4. Influência do boro e do manganês no crescimento e na composição mineral de mudas de goiabeira Boron and manganese influence on growth and mineral composition on young guava plants

    Directory of Open Access Journals (Sweden)

    João Odemir Salvador

    2003-04-01

    Full Text Available Dois experimentos conduzidos em solução nutritiva tiveram como objetivo avaliar os efeitos de doses de boro e de manganês no crescimento e na composição mineral de folhas de mudas de goiabeira (Psidium guajava L.. No experimento com boro, foram testadas sete doses (0, 0,125, 0,25, 0,5, 1,0, 1,5 e 3,0 mg L-1. Pelos resultados, verificou-se que a necrose marginal e as manchas circulares púrpuras e esparsas no limbo foliar foram os principais sintomas de toxidez apresentados, sendo esses associados com a dose máxima e com um teor foliar de 146 mg kg-1. Análises de tecidos foliares sem e com necroses mostraram teores de 92 e 720 mg kg-1, respectivamente. Somente a produção de matéria seca de raízes e o teor foliar de fósforo e enxofre foram afetados significativamente pelas doses de B. Para o manganês, foram usadas sete doses (0, 0,5, 10, 20, 30, 40 e 50 mg L-1. A produção de matéria seca total e os teores foliares de Ca, Mg e Fe foram afetados pelas doses de Mn. Os sintomas foliares de toxidez evidenciaram-se em salpicos adensados de minúsculas pontuações escuras nas folhas velhas; folhas novas de dimensões menores, cloróticas e com reticulado verde das nervuras; formação de pontuações circulares castanhas espalhadas ou fundidas ao longo ou entre as nervuras.Two experiments were carried out in nutrient solution in order to evaluate the effects of boron and manganese on growth and mineral composition of young guava seedling (Psidium guajava L.. The treatments with boron consisted of seven levels: 0, 0.125, 0.25, 0.5, 1.0, 1.5 and 3.0 mg L-1. Tip and marginal necrosis, and purple circular spots on the blade were the main observed symptoms associated with leaf boron concentration of 146 mg kg-1. Analysis of leaf tissues with and without necrosis showed boron content of 92 and 720 mg kg-1, respectively. Boron levels affected only dry matter roots, phosphorus, and sulfur concentration. The experiment with manganese used of

  5. Preliminary characterization of the rare earth ore from the Barra do Itapirapua, Sao Paulo and Parana states, Brazil. Detail 1 area

    International Nuclear Information System (INIS)

    Lorenzi, M.L.B.; Lorenzi, V.E.; Kahn, H.

    1996-01-01

    The main rare earth mineralization on Barra do Itapirapua Alkaline-Carbonatitic Complex is related to the weathering mantle of the Serrana Body carbonatite plug - detail 1 area. The present work describes the preliminary RE ore types established from correlation between geological observations, geochemical weathering profile and mineralogical studies. Mineralogical studies, comprising around 40 thin section analysis, were performed by scanning electron microscopy (SEM) with energy dispersive systems (EDS). (author)

  6. Aspectos biológicos de Thyrinteina arnobia (Lep.: Geometriadae provenientes de lagartas criadas em folhas de Eucalyptus cloeziana ou de Psidium guajava sob condições de campo Biological aspects of Thyrinteina arnobia (Lep.: Geometridae adults originated from caterpillars reared on leaves of Eucalyptus cloeziana or Psidium guajava under field conditions

    Directory of Open Access Journals (Sweden)

    Anderson Mathias Holtz

    2003-12-01

    Full Text Available Os plantios de Eucalyptus no Brasil podem sofrer danos por espécies nativas de insetos de diversas ordens, como Orthoptera, Coleoptera e Lepidoptera. Esses insetos podem alimentar-se tanto de mirtáceas brasileiras como goiabeira, gabirobeira, jabuticabeira, entre outras, como de espécies do gênero Eucalyptus. Entre os desfolhadores, destaca-se Thyrinteina arnobia (Stoll (Lepidoptera: Geometridae como o mais daninho dessa ordem para a eucaliptocultura brasileira. Este trabalho teve por objetivo avaliar aspectos biológicos de adultos de T. arnobia provenientes de lagartas alimentadas com plantas de eucalipto e, ou, goiabeira. Adultos deste inseto criados em folhas de eucalipto e, ou, de goiabeira apresentaram diferenças significativas para a maioria dos aspectos biológicos avaliados, exceto para a duração dos períodos de préoviposição, de oviposição e razão sexual. Assim, insetos herbívoros que vivem em hospedeiros filogeneticamente próximos ao eucalipto são capazes de causar danos consideráveis em reflorestamentos com espécies desse grupo, o que provavelmente ocorre pelo fato de elas estarem ainda em processo de adaptação a essa praga que atacaria o eucalipto, por estar fugindo da pressão exercida por barreiras físicas e químicas existentes nas mirtáceas nativas brasileiras.Eucalyptus plantations in Brazil may be damaged by native insects of many orders including Orthoptera, Coleoptera and Lepidoptera. These insects feed on Brazilian tree species of the family Myrtaceae to which the genus Eucalyptus belongs. The Lepidoptera Thyrinteina arnobia Stoll (Lepidoptera: Geometridae is the most harmful defoliator of Eucalyptus in Brazil. The objective of this work was to evaluate biological aspects of T. arnobia adults originated from caterpillars fed on guava or eucalyptus plants. Adults of T. arnobia originated from caterpillars reared with eucalyptus or guava leaves presented significant differences for most biological

  7. A comparison of performance of automatic cloud coverage assessment algorithm for Formosat-2 image using clustering-based and spatial thresholding methods

    Science.gov (United States)

    Hsu, Kuo-Hsien

    2012-11-01

    Formosat-2 image is a kind of high-spatial-resolution (2 meters GSD) remote sensing satellite data, which includes one panchromatic band and four multispectral bands (Blue, Green, Red, near-infrared). An essential sector in the daily processing of received Formosat-2 image is to estimate the cloud statistic of image using Automatic Cloud Coverage Assessment (ACCA) algorithm. The information of cloud statistic of image is subsequently recorded as an important metadata for image product catalog. In this paper, we propose an ACCA method with two consecutive stages: preprocessing and post-processing analysis. For pre-processing analysis, the un-supervised K-means classification, Sobel's method, thresholding method, non-cloudy pixels reexamination, and cross-band filter method are implemented in sequence for cloud statistic determination. For post-processing analysis, Box-Counting fractal method is implemented. In other words, the cloud statistic is firstly determined via pre-processing analysis, the correctness of cloud statistic of image of different spectral band is eventually cross-examined qualitatively and quantitatively via post-processing analysis. The selection of an appropriate thresholding method is very critical to the result of ACCA method. Therefore, in this work, We firstly conduct a series of experiments of the clustering-based and spatial thresholding methods that include Otsu's, Local Entropy(LE), Joint Entropy(JE), Global Entropy(GE), and Global Relative Entropy(GRE) method, for performance comparison. The result shows that Otsu's and GE methods both perform better than others for Formosat-2 image. Additionally, our proposed ACCA method by selecting Otsu's method as the threshoding method has successfully extracted the cloudy pixels of Formosat-2 image for accurate cloud statistic estimation.

  8. Numerical Study of the Buoyancy-Driven Flow in a Four-Electrode Rectangular Electrochemical Cell

    Science.gov (United States)

    Sun, Zhanyu; Agafonov, Vadim; Rice, Catherine; Bindler, Jacob

    2009-11-01

    Two-dimensional numerical simulation is done on the buoyancy-driven flow in a four-electrode rectangular electrochemical cell. Two kinds of electrode layouts, the anode-cathode-cathode-anode (ACCA) and the cathode-anode-anode-cathode (CAAC) layouts, are studied. In the ACCA layout, the two anodes are placed close to the channel outlets while the two cathodes are located between the two anodes. The CAAC layout can be converted from the ACCA layout by applying higher electric potential on the two middle electrodes. Density gradient was generated by the electrodic reaction I3^-+2e^- =3I^-. When the electrochemical cell is accelerated axially, buoyancy-driven flow occurs. In our model, electro-neutrality is assumed except at the electrodes. The Navier-Stokes equations with the Boussinesq approximation and the Nernst-Planck equations are employed to model the momentum and mass transports, respectively. It is found that under a given axial acceleration, the electrolyte density between the two middle electrodes determines the bulk flow through the electrochemical cell. The cathodic current difference is found to be able to measure the applied acceleration. Other important electro-hydrodynamic characteristics are also discussed.

  9. Development of the Landsat Data Continuity Mission Cloud Cover Assessment Algorithms

    Science.gov (United States)

    Scaramuzza, Pat; Bouchard, M.A.; Dwyer, John L.

    2012-01-01

    The upcoming launch of the Operational Land Imager (OLI) will start the next era of the Landsat program. However, the Automated Cloud-Cover Assessment (CCA) (ACCA) algorithm used on Landsat 7 requires a thermal band and is thus not suited for OLI. There will be a thermal instrument on the Landsat Data Continuity Mission (LDCM)-the Thermal Infrared Sensor-which may not be available during all OLI collections. This illustrates a need for CCA for LDCM in the absence of thermal data. To research possibilities for full-resolution OLI cloud assessment, a global data set of 207 Landsat 7 scenes with manually generated cloud masks was created. It was used to evaluate the ACCA algorithm, showing that the algorithm correctly classified 79.9% of a standard test subset of 3.95 109 pixels. The data set was also used to develop and validate two successor algorithms for use with OLI data-one derived from an off-the-shelf machine learning package and one based on ACCA but enhanced by a simple neural network. These comprehensive CCA algorithms were shown to correctly classify pixels as cloudy or clear 88.5% and 89.7% of the time, respectively.

  10. Coal combustion products: trash or treasure?

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, T.

    2006-07-15

    Coal combustion by-products can be a valuable resource to various industries. The American Coal Ash Association (ACAA) collects data on production and uses of coal combustion products (CCPs). 122.5 million tons of CCPs were produced in 2004. The article discusses the results of the ACCA's 2004 survey. Fly ash is predominantly used as a substitute for Portland cement; bottom ash for structural fill, embankments and paved road cases. Synthetic gypsum from the FGD process is commonly used in wallboard. Plant owners are only likely to have a buyer for a portion of their CCPs. Although sale of hot water (from Antelope Valley Station) from condensers for use in a fish farm to raise tilapia proved unviable, the Great Plains Synfuels Plant which manufactures natural gas from lignite produces a wide range of products including anhydrous ammonia, phenol, krypton, carbon dioxide (for enhanced oil recovery), tar oils and liquid nitrogen. ACCA's goal is to educate people about CCPs and how to make them into useful products, and market them, in order to reduce waste disposal and enhance revenue. The article lists members of the ACCA. 2 photos., 1 tab.

  11. Demonstration of Thermal Stripping of JP-4 and Other VOCs from Soils at Tinker Air Force Base Oklahoma City, Oklahoma

    Science.gov (United States)

    1990-03-01

    alof basedles app dtch. 7 he is tade dew b proosed Vgla ayb Ceontamintant Ionc s tomectses for i bvuto Oefui e fe avda -𔃺Abtelee ae f6 = vsW...cu__teApcue i ee~n be mede acca ~nrd to the provisions to MA4IinS h trave i o AoObtoi esf § 25L for casia-by-case nenkatlovsaf tea of Aie solvents.i Duo...U61a eu,1=4tk’z tn~Jusiing equivulent~ satndsr& Gop nia~ an orýtreplezztfo h prvso itc o T&?O* 1.es POWuVer, acca agtoorized a State M=1 13r .13 &~n

  12. Coexistence of tuberculosis and mammary carcinoma in a goat.

    Science.gov (United States)

    Quintas, H; Alegria, N; Mendonça, A; Botelho, A; Alves, A; Pires, I

    2014-08-01

    Synchronic occurrence of tuberculosis mastitis and mammary cancer is rare in humans and, to the best of our knowledge, not reported in domestic animals. Here, we present a case of a female adult goat of Serrana breed with simultaneous occurrence of a granulomatous mastitis, due to Mycobacterium caprae, and a mammary carcinoma. Both pathological conditions are rare in goats and should be included in differential diagnosis of mammary lesions. © 2014 Blackwell Verlag GmbH.

  13. Coexistence of tuberculosis and mammary carcinoma in a goat

    OpenAIRE

    Quintas, Hélder; Alegria, Nuno; Mendonça, Álvaro; Botelho, A.; Alves, A.; Pires, Isabel

    2014-01-01

    Synchronic occurrence of tuberculosis mastitis and mammary cancer is rare in humans and, to the best of our knowledge, not reported in domestic animals. Here, we present a case of a female adult goat of Serrana breed with simultaneous occurrence of a granulomatous mastitis, due to Mycobacterium caprae, and a mammary carcinoma. Both pathological conditions are rare in goats and should be included in differential diagnosis of mammary lesions. info:eu-repo/semantics/publishedVersion

  14. Preliminary characterization of the rare earth ore from the Barra do Itapirapua, Sao Paulo and Parana states, Brazil. Detail 1 area; Caracterizacao preliminar do minerio de terras raras da Barra do Itapirapua, SP/PR - area de detalhe 1

    Energy Technology Data Exchange (ETDEWEB)

    Lorenzi, M.L.B.; Lorenzi, V.E.; Kahn, H

    1996-12-31

    The main rare earth mineralization on Barra do Itapirapua Alkaline-Carbonatitic Complex is related to the weathering mantle of the Serrana Body carbonatite plug - detail 1 area. The present work describes the preliminary RE ore types established from correlation between geological observations, geochemical weathering profile and mineralogical studies. Mineralogical studies, comprising around 40 thin section analysis, were performed by scanning electron microscopy (SEM) with energy dispersive systems (EDS). (author) 5 refs., 2 figs., 1 tab.

  15. Anticarbohydrate antibodies as markers of inflammatory bowel disease in a Central European cohort.

    Science.gov (United States)

    Malickova, Karin; Lakatos, Peter L; Bortlik, Martin; Komarek, Viktor; Janatkova, Ivana; Lukas, Milan

    2010-02-01

    The study discusses the role of antichitobioside carbohydrate antibody (ACCA), antilaminaribioside carbohydrate antibodies (ALCA), and antimannobioside carbohydrate antibodies (AMCA) in Central European patients with inflammatory bowel disease (IBD). Twohundred and seventy-two serum samples were used - 116 Crohn's disease (CD), 84 ulcerative colitis, and 72 healthy control samples. All samples were evaluated using enzyme-linked immunosorbent assay for the following four anticarbohydrate assays: ACCA, ALCA, AMCA, and anti-Saccharomyces cerevisiae antibodies (gASCA). gASCA antibodies showed the highest sensitivity (67%) for a CD diagnosis, followed by AMCA (31%), ACCA (27%), and ALCA (25%). Positivity of at least one of the four assays increased the overall sensitivity of antibody testing in CD up to 85.5%. Mean serum gASCA levels were significantly higher in CD patients who were younger at diagnosis and had a longer disease duration before blood sampling (PACCA, and ALCA) antibodies and CD location, behavior, age at onset, and disease duration was found; however, that sample size of some of our subgroups was probably too small to make firm conclusions on associations with all CD phenotypes. None of the assessed anticarbohydrate assays was predictive of colonic CD in patients in whom the distinction between CD and ulcerative colitis is not obvious using routine diagnostic methods. There was no relationship between the presence or concentration of anticarbohydrate antibodies and the inflammation measured by C-reactive protein levels. The use of a panel of anticarbohydrate antibodies may provide additional help in distinguishing IBD from non-IBD disease patterns. The addition of AMCA, ALCA, and ACCA assays as IBD serology markers improves the overall sensitivity of immunological examinations in IBD; however, anticarbohydrate assays are not helpful for predicting CD behavior.

  16. Desempenho de cultivares de cebola nos sistemas orgânico e convencional em Minas Gerais Performance of onion cultivars grown in the organic and conventional systems in Minas Gerais State, Brazil

    Directory of Open Access Journals (Sweden)

    Gabriel Belfort Rodrigues

    2006-06-01

    Full Text Available O presente trabalho teve como objetivo avaliar o desempenho de 16 cultivares de cebola nos sistemas orgânico e convencional em Viçosa-MG, de abril a dezembro de 2003. As cultivares avaliadas foram Texas Early Grano, Baia Periforme, Alfa Tropical, Texas Yellow Grano, Jubileu, Crioula do Alto Vale, Encino, Régia, Tropical Valley, Serrana, Bella Crioula, Ipa-6, Bola Precoce e os híbridos Granex, Mercedes e Baia Dura. Foram realizados dois experimentos, um em área de cultivo convencional e outro em área de cultivo orgânico, em blocos ao acaso com quatro repetições e 20 plantas por parcela. Foram avaliadas as seguintes características: produtividade, bulbificação, peso de bulbos, perda de peso e o teor de sólidos solúveis. As cvs. Texas Early Grano, Régia, Mercedes e Encino foram as que apresentaram maior perda de peso. O sistema convencional proporcionou maior instabilidade para as outras características e somente para o teor de sólidos solúveis esteve associado à média alta. No entanto, para todas as características a média das melhores cultivares do sistema convencional foi maior do que as melhores cultivares no sistema orgânico. As cvs. Baia Dura, Bola Precoce e Tropical Valley apresentaram maior produtividade e maior potencial à industrialização devido à maior bulbificação, maior peso de bulbo e maior teor de sólidos solúveis apresentado no sistema convencional.The performance of sixteen onion cultivars grown in the organic and conventional systems was evaluated in Viçosa, Minas Gerais State, Brazil, from April to December 2003. The following onion cultivars were evaluated: 'Texas Early Grano', 'Baia Periforme', 'Alfa Tropical', 'Texas Yellow Grano', 'Jubileu', 'Crioula do Alto Vale', 'Encino', 'Régia', 'Tropical Valley', 'Serrana', 'Bella Crioula', 'Ipa-6', 'Bola Precoce' and the hybrids 'Granex', 'Mercedes' and 'Baia Dura'. Two experiments were carried out, one in an area of conventional cultivation and another

  17. Prime Contractors with Awards Over $25,000 by Name, Location, and Contract Number, Fiscal Year 1992 (Transtainer System-ZZYZK)

    Science.gov (United States)

    1993-01-01

    FFm ...EU a a- a 7- a a) axa ( 0) E acca - aaw wa w w) I ’a a w IH aCC ~~ BC).-) rJ~)D~~ 04r -. raz z n -Ha C 0 al C) aj t0- - I a O a a - a "U-u4 a ~ 0.-- a...z’aC a’a’ a G.’ -L X1a-.a- m m- W a to ~ ~ :D ’-l’ a’ f .- a.,- aCca 0 ( a ’ n -aa. ~ a-aaa-’- - Iwo -. a-a .a--a’t ~ ’a cc - - , a I. a~~J..IJ~t~aa

  18. Windshear Case Study: Denver, Colorado, July 11, 1988

    Science.gov (United States)

    1989-11-01

    04/03/88 JR) GTF 1850 120 SC.T 250 -OVC: 45 032/83/40/n7/973/TC -.W 04COAS NE-E AND SW-NW GTF 1750 200 -SCT 250 -OVC 45 041/81/48/1306/?76/ ACCAS NE...2104/96) P: WND ; 000 /WSHFT 04 ACCAS S+W RS 1848 ----------------- ENROLITE TERMINAL FORECASTS:----------------- OMA FT11 111717 80 SCT 250 -BKN...Llvina TZz:i - 17 2 I / WPOMI 07/11/10 )ffZ=: 22:09:0@ @ ffM : 22: 09: 0 me! up or:p or -0 SA MR a I,92 - - , . va://94 7t2 18i1:S OA~tR 07/1/m w MInqu

  19. Real-Time Implementation of a Speech Digitization Algorithm Combining Time-Domain Harmonic Scaling and Adaptive Residual Coding. Volume 2.

    Science.gov (United States)

    1983-06-01

    V4.0 MODULE PAGE 6 LOC OBJ LINE SOURCE STATEMENT 0 0178 30 275 Sim () 0179 F3 276 DI 277 ; 017A C38700 278 JP PXNXT 279 ; 0000 280 END RSTOO I6 j 6 B.3...003E XOR ACCB,IDB 0089 003F LD! ITR,000H 0090 0040 SPOS: LDI eg,-6 0091 0041 OP NOV @K,A 0092 0042 OP SUB ACCA ,IDD 0092 0042 NOV £NONRO 0092 0042...004B NOv NON,RP / 0102 004C OP XCHG ACCA 1$ STEP BITS .1 0102 004C NOV @RPv 0103 004D OP ADD ACCAIDB 0103 004D NOV @NONtRO ; le ADD CORD *1 0104 004E OP

  20. Turbulence Spectral Widths View Angle Independence as Observed by Doppler Radar

    Science.gov (United States)

    1989-10-01

    t, 1*+ 0 1T t+ ( 10) 2.+ 1I+. 3 3 1 9 Z1 9 1 1 21 S I 10 30 .. 1 11 30 49 3 D. 10 33 !’~3 . 02 2. F6 ’ -36 6 3 6 5 so 6 6 31 If., 68r t+.+ I’. . . .I... ACCA . .. AbA Co. CA•,A~ ... . ... C . .* CC~ CC C .... AC ... C . AC... CC CC . . . .. AAA C A 52CCC.CCCC A C AC. 51. CC 37. A. CACC C Cb...coeCcients b t e. and CCC ’l C. ..... .. o. oCA . .... °AACAA CC * C ... C 12.)0 35. 39. ’.. ’.5. A.. 37. 51 . 18. A• ACCA CCCCCCCCCCCCCCCCCCCCCC

  1. Readressing the role of Toll-like receptor-4 alleles in inflammatory bowel disease: colitis, smoking, and seroreactivity.

    Science.gov (United States)

    Manolakis, Anastassios C; Kapsoritakis, Andreas N; Kapsoritaki, Anastasia; Tiaka, Elisavet K; Oikonomou, Konstantinos A; Lotis, Vassilis; Vamvakopoulou, Dimitra; Davidi, Ioanna; Vamvakopoulos, Nikolaos; Potamianos, Spyros P

    2013-02-01

    Toll-like receptor (TLR) polymorphisms, and especially TLR-4 Asp299Gly and TLR-4 Thr399Ile, have been linked with Crohn's disease (CD) and to a lesser extent with ulcerative colitis (UC), CD behavior, and compromised seroreactivity to microbial antigens. Available data, however, are conflicting. To address these issues, the distribution of TLR-4 polymorphic alleles was assessed in patients with UC, CD, and healthy controls (HC), considering patient and disease characteristics as well as related serological markers. TLR-4 Asp299Gly and TLR-4 Thr399Ile polymorphisms were determined in 187 UC and 163 CD patients and 274 randomly selected HC. C reactive protein, anti-Saccharomyces cerevisiae mannan antibodies, anti-mannobioside carbohydrate antibodies, anti-laminariobioside carbohydrate antibodies IgG, and anti-chitobioside carbohydrate antibodies (ACCA) IgA levels were also assessed. UC and especially pancolitis patients carried the mutant alleles more frequently compared to CD patients and HC or UC patients with different disease extents (P = 0.002 and P ACCA IgA were lower in inflammatory bowel disease (IBD) patients carrying the mutant compared to those with wild-type alleles (0.075 ACCA IgA levels. Smoking reduces the extent of UC, even in the presence of mutant alleles.

  2. Enhanced Enzymatic Synthesis of a Cephalosporin, Cefadroclor, in the Presence of Organic Co-solvents.

    Science.gov (United States)

    Liu, Kun; Li, Sha; Pang, Xiao; Xu, Zheng; Li, Dengchao; Xu, Hong

    2017-05-01

    In this study, we investigated the enzymatic synthesis of a semi-synthetic cephalosporin, cefadroclor, from 7-aminodesacetoxymethyl-3-chlorocephalosporanic acid (7-ACCA) and p-OH-phenylglycine methyl ester (D-HPGM) using immobilized penicillin G acylase (IPA) in organic co-solvents. Ethylene glycol (EG) was employed as a component of the reaction mixture to improve the yield of cefadroclor. EG was found to increase the yield of cefadroclor by 15-45%. An investigation of altered reaction parameters including type and concentration of organic solvents, pH of reaction media, reaction temperature, molar ratio of substrates, enzyme loading, and IPA recycling was carried out in the buffer mixture. The best result was a 76.5% conversion of 7-ACCA, which was obtained from the reaction containing 20% EG (v/v), D-HPGM to 7-ACCA molar ratio of 4:1 and pH 6.2, catalyzed by 16 IU mL -1 IPA at 20 °C for 10 h. Under the optimum conditions, no significant loss of IPA activity was found after seven repeated reaction cycles. In addition, cefadroclor exhibited strong inhibitory activity against yeast, Bacillus subtilis NX-2, and Escherichia coli and weaker activity against Staphylococcus aureus and Pseudomonas aeruginosa. Cefadroclor is a potential antibiotic with activity against common pathogenic microorganisms.

  3. Estandarización del método propuesto por la Organización Mundial de la Salud para determinar los niveles de susceptibilidad de los vectores de leishmaniasis a insecticidas

    OpenAIRE

    Erika Santamaría

    2002-01-01

    El objetivo de este estudio fue estandarizar el método OMS para determinar susceptibilidad a insecticidas en algunas especies de Lutzomyia en condiciones de laboratorio y de campo. Los ensayos biológicos se realizaron sin insecticida, únicamente con tratamientos controles para determinar mortalidad por manipulación y otras condiciones desfavorables para cada especie. Se emplearon hembras de tres colonias de laboratorio: dos cepas de Lutzomyia longipalpis y una de Lutzomyia serrana. También se...

  4. PPARα, PPARγ and SREBP-1 pathways mediated waterborne iron (Fe)-induced reduction in hepatic lipid deposition of javelin goby Synechogobius hasta.

    Science.gov (United States)

    Chen, Guang-Hui; Luo, Zhi; Chen, Feng; Shi, Xi; Song, Yu-Feng; You, Wen-Jing; Liu, Xu

    2017-07-01

    The 42-day experiment was conducted to investigate the effects and mechanism of waterborne Fe exposure influencing hepatic lipid deposition in Synechogobius hasta. For that purpose, S. hasta were exposed to four Fe concentrations (0 (control), 0.36, 0.72 and 1.07μM Fe) for 42days. On days 21 and 42, morphological parameters, hepatic lipid deposition and Fe contents, and activities and mRNA levels of enzymes and genes related to lipid metabolism, including lipogenic enzymes (6PGD, G6PD, ME, ICDH, FAS and ACC) and lipolytic enzymes (CPTI, HSL), were analyzed. With the increase of Fe concentration, hepatic Fe content tended to increase but HSI and lipid content tended to decrease. On day 21, Fe exposure down-regulated the lipogenic activities of 6PGD, G6PD, ICDH and FAS as well as the mRNA levels of G6PD, ACCa, FAS, SREBP-1 and PPARγ, but up-regulated CPT I, HSLa and PPARα mRNA levels. On day 42, Fe exposure down-regulated the lipogenic activities of 6PGD, G6PD, ICDH and FAS as well as the mRNA levels of 6PGD, ACCa, FAS and SREBP-1, but up-regulated CPT I, HSLa, PPARα and PPARγ mRNA levels. Using primary S. hasta hepatocytes, specific pathway inhibitors (GW6471 for PPARα and fatostatin for SREBP-1) and activator (troglitazone for PPARγ) were used to explore the signaling pathways of Fe reducing lipid deposition. The GW6471 attenuated the Fe-induced down-regulation of mRNA levels of 6PGD, G6PD, ME, FAS and ACCa, and attenuated the Fe-induced up-regulation of mRNA levels of CPT I, HSLa and PPARα. Compared with single Fe-incubated group, the mRNA levels of G6PD, ME, FAS, ACCa, ACCb and PPARγ were up-regulated while the CPT I mRNA levels were down-regulated after troglitazone pre-treatment; fatostatin pre-treatment down-regulated the mRNA levels of 6PGD, ME, FAS, ACCa, ACCb and SREBP-1, and increased the CPT I and HSLa mRNA levels. Based on these results above, our study indicated that Fe exposure reduced hepatic lipid deposition by down-regulating lipogenesis

  5. Prevalência de obesidade abdominal e excesso de gordura em escolares de uma cidade serrana no sul do Brasil Prevalence of abdominal obesity and excess fat in students of a city in the mountains of southern Brazil

    Directory of Open Access Journals (Sweden)

    Lahna dos Reis Roth

    2013-05-01

    Full Text Available A obesidade é considerada a mais importante desordem nutricional devido ao aumento acelerado de suas prevalências nos últimos anos. O objetivo do presente estudo foi estimar a prevalência de obesidade abdominal e excesso de gordura em escolares de 11 a 14 anos (meninos e meninas de uma cidade serrana no sul do Brasil, e verificar as possíveis associações com classificação econômica, sexo, idade, hábitos alimentares, hábitos de vida (atividades físicas e atividades sedentárias e insatisfação com a imagem corporal. Foram avaliados 1230 escolares através de um estudo transversal. As variáveis antropométricas estudadas foram circunferência da cintura e as dobras cutâneas do tríceps e da panturrilha. Foi realizada uma análise descritiva e uma bivariada entre as variáveis independentes e o desfecho. As prevalências de obesidade abdominal e excesso de gordura corporal foram 28,7% e 40,1%, respectivamente. Houve associação estatítisca significante com maior número de refeições e insatisfação com a imagem corporal para obesidade abdominal, que também esteve associada com os avaliados do sexo feminino, e para excesso de gordura corporal e. As prevalências de obesidade abdominal e excesso de gordura corporal estão elevadas e justificam a implementação de ações de saúde nas escolas.Obesity is considered the most important nutritional disorder due to a rapid increase in its prevalence in recent years. The scope of this study was to estimate the prevalence of abdominal obesity and excess fat in students aged 11 to 14 (boys and girls from a town in the mountains of southern Brazil, and to verify the possible associations with economic classification, gender, age, eating habits, lifestyle habits (physical activity and sedentary activities and dissatisfaction with body image. A cross-sectional study was conducted with 1230 students. The anthropometric variables studied were the waist circumference and the skin folds of

  6. Qualidade de goiabas ensacadas e manejadas com diferentes produtos fitossanitários, sob manejo orgânico

    OpenAIRE

    Pinheiro, Sarita Socorro Campos

    2006-01-01

    A cultura da goiabeira apresenta sérios problemas fitossanitários, geralmente controlados pelo uso intensivo de agrotóxicos, muitos dos quais não são registrados para este fim. O uso crescente e indiscriminado de agrotóxicos tem colocado em risco a saúde de consumidores e produtores rurais, além de provocar sérios problemas ambientais. Diante destas constatações, os consumidores têm optado por alimentos mais saudáveis, por exemplo, os alimentos orgânicos, produzidos sem a utilização de agrotó...

  7. Technology Transfer From The University of Minas Gerais to a Private Company: Process and Results

    OpenAIRE

    Alves De Oliveira, Maria Do Rosário; Girolleti, Domingos A.; Maccari, Emerson Antonio; Storopoli, José Eduardo

    2016-01-01

    Economic growth and technological development are closely related. In this article, the   process of technology transfer developed by the UFMG (a new sole cushioning system for a footwear industry in Nova Serrana city, in Minas Gerais State) is analyzed, using a case study. The data were collected from UFMG document research and through semi-structured interviews with the principal stakeholders. The process of technology transfer from the university to Crômic was a great learning process for ...

  8. Serology of Patients with Ulcerative Colitis After Pouch Surgery Is More Comparable with that of Patients with Crohn's Disease.

    Science.gov (United States)

    Goren, Idan; Yahav, Lior; Tulchinsky, Hagit; Dotan, Iris

    2015-10-01

    The serologic status of patients with ulcerative colitis (UC) who develop postoperative pouchitis was compared with that of patients with Crohn's disease (CD) and unoperated patients with UC. Pouch patients were stratified into normal pouch, acute/recurrent acute pouchitis, and chronic pouchitis/Crohn's-like disease of the pouch groups. Antibodies against glycans associated with CD (anti-Saccharomyces cerevisiae, anti-laminaribioside, anti-chitobioside, and anti-mannobioside carbohydrate antibodies [ASCA, ALCA, ACCA, and AMCA, respectively]) were detected and correlated with type of inflammatory bowel disease and pouch behavior. A total of 501 patients with inflammatory bowel diseases were recruited: 250 (50%) CD, 124 (24.7%) unoperated UC, and 127 (25.3%) UC-pouch. At least 1 positive antibody was detected in 77.6% CD, 52.0% UC-pouch and 33.1% unoperated UC (P ACCA and AMCA prevalence in CD, UC-pouch and unoperated patients with UC were 33.2%, 24.4%, and 16.9% (P = 0.003 for all) and 35.2%, 26.8%, and 7.3%, respectively (P ACCA and AMCA is significantly increased in UC-pouch patients, suggesting that pouch surgery may trigger differential immune responses to glycans. The finding that the serology of UC-pouch patients shares similarities with that of patients with CD supports the notion that those 2 inflammatory bowel diseases share a common pathogenic pathway.

  9. Implementation on Landsat Data of a Simple Cloud Mask Algorithm Developed for MODIS Land Bands

    Science.gov (United States)

    Oreopoulos, Lazaros; Wilson, Michael J.; Varnai, Tamas

    2010-01-01

    This letter assesses the performance on Landsat-7 images of a modified version of a cloud masking algorithm originally developed for clear-sky compositing of Moderate Resolution Imaging Spectroradiometer (MODIS) images at northern mid-latitudes. While data from recent Landsat missions include measurements at thermal wavelengths, and such measurements are also planned for the next mission, thermal tests are not included in the suggested algorithm in its present form to maintain greater versatility and ease of use. To evaluate the masking algorithm we take advantage of the availability of manual (visual) cloud masks developed at USGS for the collection of Landsat scenes used here. As part of our evaluation we also include the Automated Cloud Cover Assesment (ACCA) algorithm that includes thermal tests and is used operationally by the Landsat-7 mission to provide scene cloud fractions, but no cloud masks. We show that the suggested algorithm can perform about as well as ACCA both in terms of scene cloud fraction and pixel-level cloud identification. Specifically, we find that the algorithm gives an error of 1.3% for the scene cloud fraction of 156 scenes, and a root mean square error of 7.2%, while it agrees with the manual mask for 93% of the pixels, figures very similar to those from ACCA (1.2%, 7.1%, 93.7%).

  10. Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

    Science.gov (United States)

    Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

    2011-04-01

    Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. KARAKTER IDEAL KONSELOR DALAM BUDAYA BUGIS KAJIAN HERMENEUTIK TERHADAP TEKS PAPPASENG

    Directory of Open Access Journals (Sweden)

    Sitti Rahmi

    2017-02-01

    Penelitian ini bertujuan untuk mengkaji empat nilai di dalam teks pappaseng, yakni acca (kecakapan, lempu (kejujuran, warani (keberanian, dan getteng (keteguhan yang dapat diserap menjadi konsep karakter ideal konselors. Penelitian ini menggunakan pendekatan kualitatif dengan data, analisis dan interpretasinya mengikuti kaidah-kaidah hermeneutika Gadamerian. Temuan penelitian menunjukkan (1 nilai acca (kecakapan mengacu pada aspek kecerdasan dan kompetensi yang ditandai dengan ciri sikap penuh pertimbangan, terampil berkomunikasi dan menyelesaikan masalah, berpikir logis, teguh terhadap kejujuran, (2 nilai lempu (kejujuran mengacu pada aspek keterampilan hubungan interpersonal dengan ciri meliputi dapat dipercaya, menghormati hak orang lain, rendah hati, prososial dan taat kepada Tuhan, (3 nilai warani (keberanian mengacu pada aspek kekuatan mental konselor dengan ciri sikap kesiapan diri dan kestabilan emosi, dan (4 nilai getteng (keteguhan mengacu pada komitmen konselor terhadap pengambangan profesi dengan ciri konsisten.

  12. Intensidade de ataque de tripes, de alternaria e da queima-das-pontas em cultivares de cebola

    OpenAIRE

    Leite,Germano L.D.; Santos,Marília Cristina dos; Rocha,Silma L.; Costa,Cândido A. da; Almeida,Chrystian I. Maia e

    2004-01-01

    Avaliou-se a intensidade de ataque de Thrips tabaci Lind., a incidência de Alternaria porri (Ellis) e Botrytis squamosa J.C. Walker em nove cultivares de cebola [Aurora, Primavera, CNPH 6400, Crioula Alto-Vale, Vale-Ouro (IPA 11), Franciscana (IPA-16), Piraouro, Conquista e Serrana], num experimento no delineamento em blocos casualizados com cinco repetições. Foram feitas avaliações semanais, do transplantio até a colheita, em dez plantas/parcela do número de T. tabaci presente na bainha das ...

  13. proximate, caffeine and tannin analyses in some brands of tea

    African Journals Online (AJOL)

    DR. AMINU

    fifteen essential trace and toxic elements in some green tea samples and ... grade, distilled water was used as solvent for solution preparation and all ... weighing the ash and calculation (ACCA, 2002). Ether .... Pharmacologyonline 3: 164-174.

  14. Chemical composition of essential oil from Psidium cattleianum var.

    African Journals Online (AJOL)

    rajuc

    2012-04-24

    Apr 24, 2012 ... accounting for 61% of the essential oil. The major component was ... recently been increased because of great economic costs of deterioration and ..... Identification of isoflavones in Acca sellowiana and two Psidium species ...

  15. Observed Trends in Indices of Daily Precipitation and Temperature Extremes in Rio de Janeiro State (brazil)

    Science.gov (United States)

    Silva, W. L.; Dereczynski, C. P.; Cavalcanti, I. F.

    2013-05-01

    One of the main concerns of contemporary society regarding prevailing climate change is related to possible changes in the frequency and intensity of extreme events. Strong heat and cold waves, droughts, severe floods, and other climatic extremes have been of great interest to researchers because of its huge impact on the environment and population, causing high monetary damages and, in some cases, loss of life. The frequency and intensity of extreme events associated with precipitation and air temperature have been increased in several regions of the planet in recent years. These changes produce serious impacts on human activities such as agriculture, health, urban planning and development and management of water resources. In this paper, we analyze the trends in indices of climatic extremes related to daily precipitation and maximum and minimum temperatures at 22 meteorological stations of the National Institute of Meteorology (INMET) in Rio de Janeiro State (Brazil) in the last 50 years. The present trends are evaluated using the software RClimdex (Canadian Meteorological Service) and are also subjected to statistical tests. Preliminary results indicate that periods of drought are getting longer in Rio de Janeiro State, except in the North/Northwest area. In "Vale do Paraíba", "Região Serrana" and "Região dos Lagos" the increase of consecutive dry days is statistically significant. However, we also detected an increase in the total annual rainfall all over the State (taxes varying from +2 to +8 mm/year), which are statistically significant at "Região Serrana". Moreover, the intensity of heavy rainfall is also growing in most of Rio de Janeiro, except in "Costa Verde". The trends of heavy rainfall indices show significant increase in the "Metropolitan Region" and in "Região Serrana", factor that increases the vulnerability to natural disasters in these areas. With respect to temperature, it is found that the frequency of hot (cold) days and nights is

  16. Aspectos fisiológicos e anatômicos de goiaba Pedro Sato em desenvolvimento

    OpenAIRE

    Cabrini, Elaine Cristina

    2009-01-01

    Frutos de goiabeira Pedro Sato foram acompanhados desde a sua formação até a senescência nas plantas, pelo período de 138 dias. As avaliações de peso, volume, diâmetros transversal e longitudinal indicaram que os frutos apresentaram curvas de crescimento do tipo sigmoidal simples, sendo que a etapa de crescimento rápido compreendeu o período entre o 77º e o 110º dias após a antese. As maiores taxas respiratórias foram observadas no início da formação dos frutos e o pico climatérico de produ...

  17. El miedo a la mujer: las mujeres violentas = Fear of Women: Violent Women

    Directory of Open Access Journals (Sweden)

    José Sánchez Herrero

    2015-06-01

    Full Text Available El trabajo se apoya exclusivamente en documentación literaria que, claramente, afirma la violencia y la homosexualidad femenina. He elegido como texto fundamental el drama de Luis Vélez de Guevara La Serrana de la Vera, escrito en 1613. En el aparecen tres niveles claros de desviación femenina frente a lo tradicional y convencional: 1 el carácter masculino de la protagonista; 2 la protagonista pone siempre en tela de juicio con palabras o con acciones su identidad femenina; y 3 la inclinación amorosa de la protagonista hacia las mujeres. Existe un cuarto nivel que se une al primero: el de la violencia extrema de la protagonista, efecto de la venganza. This study is based exclusively on literary sources that clearly support the claim for feminine violence and lesbianism. I have chosen as a fundamental text, Luis Vélez de Guevara’s La Serrana de la Vera written in 1613. In the text there are three distinct levels of female deviance which contrast with the traditional and conventional: 1 the masculine nature of the protagonist; 2 the protagonist always questions with words or actions her female identity; and 3 the amorous inclination of the protagonist towards women. There is a fourth level that is linked to the first: the extreme violence of the protagonist as a result of vengeance.

  18. Carbon taxation and corporate behaviour

    OpenAIRE

    Association of Chartered Certified Accountants

    2012-01-01

    This report summarises the breakfast briefing held by ACCA on 23 February 2012. The session looked at the role of carbon taxation in mitigating climate change and its value when compared with other market mechanisms. Publisher PDF

  19. Automatic cell cloning assay for determining the clonogenic capacity of cancer and cancer stem-like cells.

    Science.gov (United States)

    Fedr, Radek; Pernicová, Zuzana; Slabáková, Eva; Straková, Nicol; Bouchal, Jan; Grepl, Michal; Kozubík, Alois; Souček, Karel

    2013-05-01

    The clonogenic assay is a well-established in vitro method for testing the survival and proliferative capability of cells. It can be used to determine the cytotoxic effects of various treatments including chemotherapeutics and ionizing radiation. However, this approach can also characterize cells with different phenotypes and biological properties, such as stem cells or cancer stem cells. In this study, we implemented a faster and more precise method for assessing the cloning efficiency of cancer stem-like cells that were characterized and separated using a high-speed cell sorter. Cell plating onto a microplate using an automatic cell deposition unit was performed in a single-cell or dilution rank mode by the fluorescence-activated cell sorting method. We tested the new automatic cell-cloning assay (ACCA) on selected cancer cell lines and compared it with the manual approach. The obtained results were also compared with the results of the limiting dilution assay for different cell lines. We applied the ACCA to analyze the cloning capacity of different subpopulations of prostate and colon cancer cells based on the expression of the characteristic markers of stem (CD44 and CD133) and cancer stem cells (TROP-2, CD49f, and CD44). Our results revealed that the novel ACCA is a straightforward approach for determining the clonogenic capacity of cancer stem-like cells identified in both cell lines and patient samples. Copyright © 2013 International Society for Advancement of Cytometry.

  20. DESEMPENHO AGROECONÔMICO DO CONSÓRCIO ALFACEBETERRABA SOB SISTEMA ORGÂNICO

    OpenAIRE

    De Souza, Jose Paulo; Macedo, Marcelo Alvaro da Silva; De Souza, Camila Guimaraes; Abboud, Antonio Carlos De Souza

    2006-01-01

    Com o objetivo de avaliar o desempenho dos consórcios de olerícolas, cultivados em diferentes densidades populacionais, sob sistema orgânico de produção, foram instalados dois experimentos, no ano 2000, com o consórcio de alface com beterraba. O consorcio de alface com beterraba foi estudado em duas regiões com condições edafoclimáticas diferentes, na Região Médio Serrana e na Baixada Fluminense, ambas no estado do Rio de Janeiro. Para todos os experimentos o delineamento experimental foi de ...

  1. La transformación de los medios forestales en el Norte de Argentina. Implicaciones sociales y ambientales.

    OpenAIRE

    Cuadra, Dante Edin

    2016-01-01

    En el Norte de Argentina se encuentran las mayores extensiones de bosques nativos del país. Se trata de un ámbito subtropical con marcadas variaciones pluviométricas, resultantes de la dinámica atmosférica, los tipos y disposiciones del relieve y la distancia al mar, factores que han posibilitado el desarrollo de formaciones vegetales diferenciadas como las selvas de riberas y mesetas en el Este, los bosques húmedos y xerófilos en el centro y las selvas serranas en el Oeste. Las primeras ...

  2. Study of Worldwide Occurrence of Fog, Thunderstorms, Supercooled Low Clouds and Freezing Temperatures. Change 1

    Science.gov (United States)

    1978-09-01

    a ace ea acca cm eaz aaaa w~asa cau adm cca a (a a- aoMnor t oftfa of M -of zatof saorWo f aco-f ax t ofn la rwo f o To noono -L a~N n i NflatOa t-mN...8217Uc)- - - - - - - - - -- W -, N’p V UN- - - - -V a . It - .1 - a -- - - - - - - - - - c-cfMWý - M;S N ’ ffm .-’ 0Z0 N CT IX a SI a a W af a x S: ’-’K...c t 1 vN P to N OUNU OC9 C n 9~~~~~~ ~ ~ ~ 9(0)999 19 11 !I ý1 -; - : f - - - ýrl C acca aa~ad alz ael C.C da qa.O O 0 00. 000 AOO .OA 0O 000 00,AO O

  3. Assurance Statement Practice in Environmental, Social and Sustainability Reporting: A Critical Evaluation

    NARCIS (Netherlands)

    O'Dwyer, B.; Owen, D.L.

    2005-01-01

    This paper reports on a detailed critical analysis of assurance statements appearing in environmental, social and ‘sustainability’ reports short-listed for the 2002 Association of Chartered Certified Accountants (ACCA) UK and European Sustainability Reporting Awards scheme. Drawing on an evaluative

  4. Association of Anti-glycan Antibodies and Inflammatory Bowel Disease Course.

    Science.gov (United States)

    Paul, S; Boschetti, G; Rinaudo-Gaujous, M; Moreau, A; Del Tedesco, E; Bonneau, J; Presles, E; Mounsef, F; Clavel, L; Genin, C; Flourié, B; Phelip, J-M; Nancey, S; Roblin, X

    2015-06-01

    The usefulness of anti-glycan antibodies alone or combined with anti-Saccharomyces cerevisiae [ASCA] or perinuclear antineutrophil cytoplasmic [pANCA] antibodies for diagnosis of inflammatory bowel disease [IBD], differentiation between Crohn's disease [CD] and ulcerative colitis [UC], disease stratification including IBD phenotype, and also for determination of the course of the disease, remain unclear. A large panel of serological anti-glycan carbohydrate antibodies, including anti-mannobioside IgG antibodies [AMCA], anti-chitobioside IgA [ACCA], anti-laminaribioside IgG antibodies [ALCA], anti-laminarin [anti-L] and anti-chitine [anti-C] were measured in the serum from a cohort of 195 patients with IBD] [107 CD and 88 UC]. The respective accuracy of isolated or combined markers for diagnosis, disease differentiation, stratification disease phenotype, and severity of the disease course, defined by a wide panel of criteria obtained from the past medical history, was assessed. The positivity of at least one anti-glycan antibody was detected in a significant higher proportion of CD and UC compared with healthy controls [p ACCA [> 51U/ml] and anti-laminarin [> 31U/ml] were significantly linked with a higher association with steroid dependency (odds ratio [OR] =2.0 [1.0-4.0], p = 0.03 and OR = 2.4 [1.1-5.2], p = 0.02, respectively]. We further defined the respective performance of anti-glycan antibodies to discriminate between patients with severe or not severe CD and UC course and determined the associated optimal cut-off values: severe CD course was significantly more likely in case of AMCA > 77U/ml [OR = 4.3; p = 0.002], ASCA > 63U/ml [OR = 3.5; p ACCA > 50U/ml [OR = 2.8; p 52U/ml [OR = 3.4; p = 0.04] and ACCA > 25U/ml [OR = 3.0; p < 0.04]. Anti-glycan antibodies are valuable serological markers, especially AMCA antibodies that may help clinicians to promptly classify patients into high risk for severe disease. Copyright © 2015 European Crohn’s and Colitis

  5. Involvement of NFκB in the antirheumatic potential of Chenopodium album L., aerial parts extracts.

    Science.gov (United States)

    Arora, Sumit K; Itankar, Prakash R; Verma, Prashant R; Bharne, Ashish P; Kokare, Dadasaheb M

    2014-08-08

    Chenopodium album L. (C. album) is commonly known as Bathua in Hindi (Family: Chenopodiaceae). Traditionally, the plant is used as a laxative, diuretic, sedative and the infusion of the plant is used for the treatment of rheumatism. However, no scientific validation is available on the antirheumatic potential of the plant. In the present investigation, role of NF kappa B (NFκB) in the antiarthritic potential of extracts of aerial parts of Chenopodium album was explored and evaluated. The defatted aerial parts of Chenopodium album were successively extracted with ethylacetate, acetone, methanol and 50% methanol to study their antioxidant capacity followed by antiarthritic potential using Complete Freund׳s adjuvant (CFA) induced arthritis model in rats. The polyphenol, flavonoid and flavanone contents of different extracts were quantified and correlated with their antioxidant capacity, antiarthritic activity and NFκB inhibition potential. The experimental data indicated that the acetone extract of Chenopodium album (ACCA) has shown significant reduction in rat paw edema (80.13%) at dose level of 200 mg/kg per oral in 21 days of this study. On 22nd day, hematological and biochemical parameters were estimated and it was observed that the altered hematological parameters (Hb, RBC, WBC and ESR), biochemical parameters (Serum creatinine, total proteins and acute phase proteins) and loss in body weight in the arthritic rats were significantly brought back to near normal level by the ACCA extract. ACCA extract significantly decreased the NFκB expression in paraventricular nucleus of hypothalamus and this effect is comparable with standard indomethacine in CFA treated rats. The polyphenolic and flavonoid content of different extracts were in the range of 14.56±0.21-42.00±0.2 mg (gallic acid equivalent/g extract) and 2.20±0.003-7.33±0.5 mg (rutin equivalent/g extract) respectively. The antiarthritic activity possessed by ACCA extract can be correlated directly to its

  6. [A novel gene (Aa-accA ) encoding acetyl-CoA carboxyltransferase alpha-subunit of Alkalimonas amylolytica N10 enhances salt and alkali tolerance of Escherichia coli and tobacco BY-2 cells].

    Science.gov (United States)

    Xian, Mingjie; Zhai, Lei; Zhong, Naiqin; Ma, Yiwei; Xue, Yanfen; Ma, Yanhe

    2013-08-04

    Acetyl-CoA carboxylase (ACC) catalyzes the first step of fatty acid synthesis. In most bacteria, ACC is composed of four subunits encoded by accA, accB, accC, and accD. Of them, accA encodes acetyl-CoA carboxyltransferase alpha-subunit. Our prior work on proteomics of Alkalimonas amylolytica N10 showed that the expression of the Aa-accA has a remarkable response to salt and alkali stress. This research aimed to find out the Aa-accA gene contributing to salt and alkali tolerance. The Aa-accA was amplified by PCR from A. amylolytica N10 and expressed in E. coli K12 host. The effects of Aa-accA expression on the growth of transgenic strains were examined under different NaCl concentration and pH conditions. Transgenic tobacco BY-2 cells harboring Aa-accA were also generated via Agrobacterium-mediated transformation. The viability of BY-2 cells was determined with FDA staining method after salt and alkali shock. The Aa-accA gene product has 318 amino acids and is homologous to the carboxyl transferase domain of acyl-CoA carboxylases. It showed 76% identity with AccA (acetyl-CoA carboxylase carboxyltransferase subunit alpha) from E. coli. Compared to the wild-type strains, transgenic E. coli K12 strain containing Aa-accA showed remarkable growth superiority when grown in increased NaCl concentrations and pH levels. The final cell density of the transgenic strains was 2.6 and 3.5 times higher than that of the control type when they were cultivated in LB medium containing 6% (W/V) NaCl and at pH 9, respectively. Complementary expression of Aa-accA in an accA-depletion E. coli can recover the tolerance of K12 delta accA to salt and alkali stresses to some extent. Similar to the transgenic E. coli, transgenic tobacco BY-2 cells showed higher percentages of viability compared to the wild BY-2 cells under the salt or alkali stress condition. We found that Aa-accA from A. amylolytica N10 overexpression enhances the tolerance of both transgenic E. coli and tobacco BY-2 cells to

  7. The DoD Enterprise Model. Volume 1. Strategic Activity and Data Models

    Science.gov (United States)

    1994-01-01

    materiel items, real estate/facilities, or * Acca services into the inventory (e.g., first destination "* Take Deivery transportation of materiel items...the purposes of their relationships with other specific items makes it possible to develop information, and ultimately through continuous audit and

  8. Theater-Level Stochastic Air-to-Air Engagement Modeling via Event Occurrence Networks Using Piecewise Polynomial Approximation

    Science.gov (United States)

    2001-09-01

    diagnosis natural language understanding circuit fault diagnosis pattern recognition machine vision nancial auditing map learning sensor... ACCA ACCB A ights degree of command and control FCC value is assumed to be the average of all the ACC values of the aircraft in the

  9. Edging towards better accounting

    OpenAIRE

    Schumesch, Patrice

    2014-01-01

    The ACCA's International Public Sector Conference explored the direction of public sector reporting, and rebuilding public trust through improved financial reporting. Other speakers included Carla Moordy of Monitory UK, Zinga Venner of the World Bank, and Professor Michael Parker of Henley Business School.

  10. The Naval Reserve Sea Air Mariner VOTECH (Vocational/Technical) Program: Qualified Civilian Schools for Ramp (Reserve Allied Medical Personnel Program)

    Science.gov (United States)

    1985-09-15

    l= C~tl Ffm R ~ s .8 isnMs?.y91 ed*% i ClassCap 116j 819= ia 2: 1.11.87 4 eed Vd.W1, AC.~aA I -ýS S 3601ŕ - __ =V3 EC=t8 I14 Ce’s Nee0’Rs-1 1987...8050551a 10106%8316- Ca’tilvtV-1-a2g-i- -,:! 2~ ~~ 55Br AV-S 3203 acca - C.-o- V V Klta MD $3Mcc14en R" C-n-VAr-M R’y’~oo M -ey r eca tt w 2 c-r *U. flgrD...A t62O24242100 E. Hcnrkt Rd. T- acca indumm Vocatonnal Technica Rochestr NY 14M2 State Te€]b- Inttt as Mmpbk A,• 4100 Co,ean Rd. 1I6) 424,-5M0 5993

  11. Analysis of metabolic networks of Streptomyces leeuwenhoekii C34 by means of a genome scale model: Prediction of modifications that enhance the production of specialized metabolites.

    Science.gov (United States)

    Razmilic, Valeria; Castro, Jean F; Andrews, Barbara; Asenjo, Juan A

    2018-07-01

    The first genome scale model (GSM) for Streptomyces leeuwenhoekii C34 was developed to study the biosynthesis pathways of specialized metabolites and to find metabolic engineering targets for enhancing their production. The model, iVR1007, consists of 1,722 reactions, 1,463 metabolites, and 1,007 genes, it includes the biosynthesis pathways of chaxamycins, chaxalactins, desferrioxamines, ectoine, and other specialized metabolites. iVR1007 was validated using experimental information of growth on 166 different sources of carbon, nitrogen and phosphorous, showing an 83.7% accuracy. The model was used to predict metabolic engineering targets for enhancing the biosynthesis of chaxamycins and chaxalactins. Gene knockouts, such as sle03600 (L-homoserine O-acetyltransferase), and sle39090 (trehalose-phosphate synthase), that enhance the production of the specialized metabolites by increasing the pool of precursors were identified. Using the algorithm of flux scanning based on enforced objective flux (FSEOF) implemented in python, 35 and 25 over-expression targets for increasing the production of chaxamycin A and chaxalactin A, respectively, that were not directly associated with their biosynthesis routes were identified. Nineteen over-expression targets that were common to the two specialized metabolites studied, like the over-expression of the acetyl carboxylase complex (sle47660 (accA) and any of the following genes: sle44630 (accA_1) or sle39830 (accA_2) or sle27560 (bccA) or sle59710) were identified. The predicted knockouts and over-expression targets will be used to perform metabolic engineering of S. leeuwenhoekii C34 and obtain overproducer strains. © 2018 Wiley Periodicals, Inc.

  12. Metabolic targeting of lactate efflux by malignant glioma inhibits invasiveness and induces necrosis: an in vivo study.

    Science.gov (United States)

    Colen, Chaim B; Shen, Yimin; Ghoddoussi, Farhad; Yu, Pingyang; Francis, Todd B; Koch, Brandon J; Monterey, Michael D; Galloway, Matthew P; Sloan, Andrew E; Mathupala, Saroj P

    2011-07-01

    Glioblastoma multiforme (GBM) are the most malignant among brain tumors. They are frequently refractory to chemotherapy and radiotherapy with mean patient survival of approximately 6 months, despite surgical intervention. The highly glycolytic nature of glioblastomas describes their propensity to metabolize glucose to lactic acid at an elevated rate. To survive, GBMs efflux lactic acid to the tumor microenvironment through transmembrane transporters denoted monocarboxylate transporters (MCTs). We hypothesized that inhibition of MCT function would impair the glycolytic metabolism and affect both glioma invasiveness and survival. We examined the effect on invasiveness with α-cyano-4-hydroxy-cinnamic acid (ACCA, 4CIN, CHCA), a small-molecule inhibitor of lactate transport, through Matrigel-based and organotypic (brain) slice culture invasive assays using U87-MG and U251-MG glioma cells. We then conducted studies in immunodeficient rats by stereotaxic intracranial implantation of the glioma cells followed by programmed orthotopic application of ACCA through osmotic pumps. Effect on the implanted tumor was monitored by small-animal magnetic resonance imaging. Our assays indicated that glioma invasion was markedly impaired when lactate efflux was inhibited. Convection-enhanced delivery of inhibitor to the tumor bed caused tumor necrosis, with 50% of the animals surviving beyond the experimental end points (3 months after inhibitor exhaustion). Most importantly, control animals did not display any adverse neurologic effects during orthotopic administration of ACCA to brain through programmed delivery. These results indicate the clinical potential of targeting lactate efflux in glioma through delivery of small-molecule inhibitors of MCTs either to the tumor bed or to the postsurgical resection cavity.

  13. Metabolic Targeting of Lactate Efflux by Malignant Glioma Inhibits Invasiveness and Induces Necrosis: An In Vivo Study1

    Science.gov (United States)

    Colen, Chaim B; Shen, Yimin; Ghoddoussi, Farhad; Yu, Pingyang; Francis, Todd B; Koch, Brandon J; Monterey, Michael D; Galloway, Matthew P; Sloan, Andrew E; Mathupala, Saroj P

    2011-01-01

    Glioblastoma multiforme (GBM) are the most malignant among brain tumors. They are frequently refractory to chemotherapy and radiotherapy with mean patient survival of approximately 6 months, despite surgical intervention. The highly glycolytic nature of glioblastomas describes their propensity to metabolize glucose to lactic acid at an elevated rate. To survive, GBMs efflux lactic acid to the tumor microenvironment through transmembrane transporters denoted monocarboxylate transporters (MCTs). We hypothesized that inhibition of MCT function would impair the glycolytic metabolism and affect both glioma invasiveness and survival. We examined the effect on invasiveness with α-cyano-4-hydroxy-cinnamic acid (ACCA, 4CIN, CHCA), a small-molecule inhibitor of lactate transport, through Matrigel-based and organotypic (brain) slice culture invasive assays using U87-MG and U251-MG glioma cells. We then conducted studies in immunodeficient rats by stereotaxic intracranial implantation of the glioma cells followed by programmed orthotopic application of ACCA through osmotic pumps. Effect on the implanted tumor was monitored by small-animal magnetic resonance imaging. Our assays indicated that glioma invasion was markedly impaired when lactate efflux was inhibited. Convection-enhanced delivery of inhibitor to the tumor bed caused tumor necrosis, with 50% of the animals surviving beyond the experimental end points (3 months after inhibitor exhaustion). Most importantly, control animals did not display any adverse neurologic effects during orthotopic administration of ACCA to brain through programmed delivery. These results indicate the clinical potential of targeting lactate efflux in glioma through delivery of small-molecule inhibitors of MCTs either to the tumor bed or to the postsurgical resection cavity. PMID:21750656

  14. Computational Fluid Dynamics Analysis of Flexible Duct Junction Box Design

    Energy Technology Data Exchange (ETDEWEB)

    Beach, Robert [IBACOS Inc., Pittsburgh, PA (United States); Prahl, Duncan [IBACOS Inc., Pittsburgh, PA (United States); Lange, Rich [IBACOS Inc., Pittsburgh, PA (United States)

    2013-12-01

    IBACOS explored the relationships between pressure and physical configurations of flexible duct junction boxes by using computational fluid dynamics (CFD) simulations to predict individual box parameters and total system pressure, thereby ensuring improved HVAC performance. Current Air Conditioning Contractors of America (ACCA) guidance (Group 11, Appendix 3, ACCA Manual D, Rutkowski 2009) allows for unconstrained variation in the number of takeoffs, box sizes, and takeoff locations. The only variables currently used in selecting an equivalent length (EL) are velocity of air in the duct and friction rate, given the first takeoff is located at least twice its diameter away from the inlet. This condition does not account for other factors impacting pressure loss across these types of fittings. For each simulation, the IBACOS team converted pressure loss within a box to an EL to compare variation in ACCA Manual D guidance to the simulated variation. IBACOS chose cases to represent flows reasonably correlating to flows typically encountered in the field and analyzed differences in total pressure due to increases in number and location of takeoffs, box dimensions, and velocity of air, and whether an entrance fitting is included. The team also calculated additional balancing losses for all cases due to discrepancies between intended outlet flows and natural flow splits created by the fitting. In certain asymmetrical cases, the balancing losses were significantly higher than symmetrical cases where the natural splits were close to the targets. Thus, IBACOS has shown additional design constraints that can ensure better system performance.

  15. Metabolic Targeting of Lactate Efflux by Malignant Glioma Inhibits Invasiveness and Induces Necrosis: An In Vivo Study

    Directory of Open Access Journals (Sweden)

    Chaim B Colen

    2011-07-01

    Full Text Available Glioblastoma multiforme (GBM are the most malignant among brain tumors. They are frequently refractory to chemotherapy and radiotherapy with mean patient survival of approximately 6 months, despite surgical intervention. The highly glycolytic nature of glioblastomas describes their propensity to metabolize glucose to lactic acid at an elevated rate. To survive, GBMs efflux lactic acid to the tumor microenvironment through transmembrane transporters denoted monocarboxylate transporters (MCTs. We hypothesized that inhibition of MCT function would impair the glycolytic metabolism and affect both glioma invasiveness and survival. We examined the effect on invasiveness with α-cyano-4-hydroxy-cinnamic acid (ACCA, 4CIN, CHCA, a small-molecule inhibitor of lactate transport, through Matrigel-based and organotypic (brain slice culture invasive assays using U87-MG and U251-MG glioma cells. We then conducted studies in immunodeficient rats by stereotaxic intracranial implantation of the glioma cells followed by programmed orthotopic application of ACCA through osmotic pumps. Effect on the implanted tumor was monitored by small-animal magnetic resonance imaging. Our assays indicated that glioma invasion was markedly impaired when lactate efflux was inhibited. Convection-enhanced delivery of inhibitor to the tumor bed caused tumor necrosis, with 50% of the animals surviving beyond the experimental end points (3 months after inhibitor exhaustion. Most importantly, control animals did not display any adverse neurologic effects during orthotopic administration of ACCA to brain through programmed delivery. These results indicate the clinical potential of targeting lactate efflux in glioma through delivery of small-molecule inhibitors of MCTs either to the tumor bed or to the postsurgical resection cavity.

  16. [New findings on the geographic distribution of the verrucarum group (Diptera: Psychodidae) in Colombia].

    Science.gov (United States)

    Bejarano, Eduar Elías; Sierra, Diana; Vélez, Iván Darío

    2003-09-01

    The incrimination of sand flies belonging to verrucarum species group in the leishmaniasis transmission underscores the need for a detailed information on the geographical distribution of these species. The current listing adds 34 new records that extend significantly the knowledge of the geographical distribution of the verrucarum group in Colombia. The most important new records pertain to Lutzomyia spinicrassa in the tropical dry forest of the Atlantic coast, Lutzomyia ovallesi in the Orinoco and Amazon River watersheds regions of Colombia, and the sympatric occurrence of Lutzomyia spinicrassa and Lutzomyia quasitownsendi in the eastern chain of the Andes mountains. Additionally, the municipal and altitudinal distributions are compiled for 19 new species recorded for Colombia. The series townsendi of the verrucarum group generally restricted to premontane and lower montane zones based on distribution data on Lutzomyia longiflocosa, L. quasitownsendi, Lutzomyia sauroida, L. spinicrassa, Lutzomyia torvida, Lutzomyia townsendi and Lutzomyia youngi. The series verrucarum is distributed from the tropical lowland to the montane zones, and includes species with wide geographical range (Lutzomyia evansi, Lutzomyia columbiana, L. ovallesi, Lutzomyia nuneztovari, Lutzomyia nevesi), and species of highly endemic distribution (Lutzomyia andina, Lutzomyia disiuncta, Lutzomyia moralesi, Lutzomyia antioquiensis). Members of the series pia (Lutzomyia pia, Lutzomyia limafalcaoae) and the series serrana (Lutzomyia serrana) occur from the tropical lowlands to the lower montane zones. The altitudinal divergences may be intrinsically tied to speciation process, especially as it relates to the climatic and geologic events that have affected the flora and fauna of the Andean region.

  17. Technical Objective Document for Food and Food Service Systems

    Science.gov (United States)

    1990-10-01

    full ntission posture for exlended duration . 3. POCGRESS AND ACCa -fPLISHMENI’S Natick is responsible for many Research, Development, Test , and...Dr. David L. Kaplan Telephone (508) 651-5525 (Biotechnology) b. Technology Program (1) FY91 Planned Programs Complete Joint Services Front End

  18. Motion Cues in Flight Simulation and Simulator Induced Sickness

    Science.gov (United States)

    1988-06-01

    military F7 .. vehicles, surface excavation equipment, underground mining devices, railway locomotives, .A space vehicles, shiv bridges, and submarines. Of...Evaluatort Rleference to Fukuda is: Fukuda, T. Postural behavior and motion sickness. Acca Otolaryngol. (Stockholm), 1976, B1:37-241.) %kI RTD-5

  19. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia

    Science.gov (United States)

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), ...

  20. A Commentary on "Integrated Reporting: A Review of Developments and Their Implications for the Accounting Curriculum"

    Science.gov (United States)

    Kamp-Roelands, Nancy

    2013-01-01

    In this commentary, Kamp-Roelands states that it was very encouraging to observe that the Association of Chartered Certified Accountants (ACCA) recognises that responding to "Integrated Reporting" initiatives requires an "integrated approach" to accounting education. That change in financial reporting standards put pressure on…

  1. Uso de traçadores fluorescentes para determinar características de transporte e dispersão no Rio Piabanha (RJ) para a modelagem quali-quantitativa pelo HEC-RAS

    OpenAIRE

    Silva, Paulo Vitor Ribeiro Marques da; Pecly, José Otávio Goulart; Azevedo, José Paulo Soares de

    2017-01-01

    RESUMO Um estudo de campo foi realizado em um trecho de aproximadamente 70 km do rio Piabanha, localizado entre Petrópolis e Areal, na região serrana do Estado do Rio de Janeiro, para estimar as características de transporte e dispersão de contaminantes usando técnicas de traçadores fluorescentes. A análise dos resultados de dois trabalhos de campo, realizados no outono de 2012, permitiu determinar os valores de tempo de trânsito, vazão líquida, velocidade média e coeficiente de dispersão lon...

  2. Ações ambientais para o desenvolvimento socioespacial no Rio de Janeiro: estratégias de gestão para as sustentabilidades / Acciones ambientales para el desarrollo socioespacial en Rio de Janeiro: estrategias de gestión para las sostenibilidades

    OpenAIRE

    Augusto César Pinheiro da Silva; Alex Archer Marques Gomes

    2013-01-01

    O artigo expõe estratégias possíveis que podem ser desenvolvidas por agentes econômicos (com apoio político e dos atores sociais) para ações de sustentabilidade em atividades que minimizem os impactos ambientais gerados por práticas humanas cotidianas, no estado do Rio de Janeiro. Nesse sentido, as estratégias identificadas são realizadas pelo poder municipal da Prefeitura de Nova Friburgo (Região Serrana do Rio de Janeiro) em relação à gestão para o reflorestamento, tratamento do lixo e prod...

  3. A Glossary of Terms, Definitions, Acronyms, and Abbreviations Related to the National Airspace System (NAS)

    Science.gov (United States)

    1990-06-01

    System ACAS Airborne Collision Avoidance System ACB Adjacent Center Backup ACC ACCumulator ACC Area Control Center ACCAS Alto Cumulus CAtellanuS ACCC...subsystem) FFC For Further Clearance FFF Form, Fit, and Function FFF Form, Fix, and Function FFLT Familiarize FLighT FFM Far Field Monitor (associated with

  4. A Commentary on "Integrated Reporting: A Review of Developments and Their Implications for the Accounting Curriculum"

    Science.gov (United States)

    Correa Ruiz, Carmen

    2013-01-01

    In this commentary, Correa Ruiz notes that from his analysis, Owen (2013) identified the essential elements to be included in a modern professional accounting curriculum, described how Association of Chartered Certified Accountants (ACCA) has embedded "Integrated Reporting" in its curriculum, and discussed future curriculum development,…

  5. Proceedings of International Conference on the Role of the Polar Regions in Global Change Held in Fairbanks, Alaska on 11-15 June 1990. Volume 2

    Science.gov (United States)

    1992-03-01

    submitted essays (two alizations from faculty observations of student behaviors students audited ). The means and minimum/maximum during the game and the...being directed towards tions has been carried out to evaluate the sensitivity of the analyses of the present Antarctic precipitation and acca - climate to

  6. Report Index for Years 1939-1985

    Science.gov (United States)

    1986-03-01

    u 6) U u u 0 0 93 f3 m I N 0 - - U CU 2 a 3 - U 0 -J 6W W. W 6 2 W W W a a 61 w w w ’A a 1 A U) 41 V, 4A V) IU L V I 61 - 21 j -1 j .- - U - .j a a...ini ’ . W . 2; .c- 2j a a 2r LI or2- - - -a C 3 0-~~c 40 0: I a 2 n m IW Z =. r L j = 02 - I 31 a 0 4A a. 19 acca W- 0I - / 0 - (. I 0 - - 2~ w 6.1 .1...N~ ~ * A -1 A a a a A ’ aa . w w 61 1- 6, 1. 0 za ~ a3 1, .a wi ; CC 0 9- I a oi 10 ) = 11 W 62 a61 - I U w -4 a W aw acca a a u wi U 0 a

  7. Exploring College Counselor Spiritual Competency in Relation to Training and Professional Practice

    Science.gov (United States)

    Conley, Abigail Holland

    2012-01-01

    The purpose of this mixed methods sequential explanatory study was to explore factors contributing to college counselors' spiritual competency by obtaining quantitative results from surveying 199 current members of the American College Counseling Association (ACCA) and then following up with 32 purposefully selected respondents based on high…

  8. Fauna Simalurensis. Lepidoptera Rhopalocera: fam. Satyridae, Morphidae & Nymphalidae

    NARCIS (Netherlands)

    Eecke, van R.

    1913-01-01

    Continuing the enumeration of the Lepidoptera from Simalur and neighbouring islets, collected by Mr. Edw. Jacobson, I have to notice only one new form of Cethosia and of Acca among a number of 16 species of Nymphalidae. The Satyridae were represented by one species and the Morphidae by two.

  9. Plan of Study for the Tidal Power Study, Cobscook Bay, Maine, USA

    Science.gov (United States)

    1978-09-01

    engineering manuals, regula- tions and pamphlets. * Federal Register, Part IV, 29 June 1977, Federal Energy Administration, "Energy Audit Procedures...Impact of gcnoral inflation. Thia ia not valid oconomicaLly; it i merely iinaacial. At a i.n, the field ahould break the reuaona for the incr, acca out

  10. The Development of an Officer Training School Board Score Prediction Method Using a Multi-Board Approach

    Science.gov (United States)

    1991-03-01

    withdrawal$. courseI that e audited , or pa.ail. Lin each college or ut.enitiry separtely. total columns, fbi and (c). them. divide the total of column...CHA AAE FJBFBIBCMDLEMGADAA ED A C A CDHAGNCLGJIJPBJIB AAA A R AAA AFCHHFJEMPHVDRGMKBGACA e B DAAMCNKHKFMHPQIICHEDCAD s AA ACCA FDHQHNEJPPJJZJFKECAA A i

  11. U.S. EPA, Pesticide Product Label, PROKIL PARATHION 4 LB, 01/06/1988

    Science.gov (United States)

    2011-04-21

    ... m:AIl [lmRE l.ARD .. II,.> "Ilirtly III acca,· .Irlll':a with dUllyers. ... f .• ,ricI'!'lIHII r.xlen~inn ;'l'rvIU~ ·(I.,ePII""I. ~:' . lhL· I.Sl::le. BEANS: "'I,hid~i. r;.!oi'f1·lli'.;. ...

  12. Abundance and distribution of archaeal acetyl-CoA/propionyl-CoA carboxylase genes indicative for putatively chemoautotrophic Archaea in the tropical Atlantic's interior.

    Science.gov (United States)

    Bergauer, Kristin; Sintes, Eva; van Bleijswijk, Judith; Witte, Harry; Herndl, Gerhard J

    2013-06-01

    Recently, evidence suggests that dark CO2 fixation in the pelagic realm of the ocean does not only occur in the suboxic and anoxic water bodies but also in the oxygenated meso- and bathypelagic waters of the North Atlantic. To elucidate the significance and phylogeny of the key organisms mediating dark CO2 fixation in the tropical Atlantic, we quantified functional genes indicative for CO2 fixation. We used a Q-PCR-based assay targeting the bifunctional acetyl-CoA/propionyl-CoA carboxylase (accA subunit), a key enzyme powering inter alia the 3-hydroxypropionate/4-hydroxybutyrate cycle (HP/HB) and the archaeal ammonia monooxygenase (amoA). Quantification of accA-like genes revealed a consistent depth profile in the upper mesopelagial with increasing gene abundances from subsurface layers towards the oxygen minimum zone (OMZ), coinciding with an increase in archaeal amoA gene abundance. Gene abundance profiles of metabolic marker genes (accA, amoA) were correlated with thaumarchaeal 16S rRNA gene abundances as well as CO2 fixation rates to link the genetic potential to actual rate measurements. AccA gene abundances correlated with archaeal amoA gene abundance throughout the water column (r(2)  = 0.309, P < 0.0001). Overall, a substantial genetic predisposition of CO2 fixation was present in the dark realm of the tropical Atlantic in both Archaea and Bacteria. Hence, dark ocean CO2 fixation might be more widespread among prokaryotes inhabiting the oxygenated water column of the ocean's interior than hitherto assumed. © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  13. USN/USMC Commander’s Quick Reference Legal Handbook

    Science.gov (United States)

    2015-01-01

    Family Advocacy Program FAR: Family Advocacy Representative FFM : Frequent Flyer Miles FITREP: Fitness Report 141    FJA: Fleet Judge...1107(e) ij theCA is authorized to set aside the findings or sentence or ij the findings or sentence were set aside by ACCA . "Evaluate each piece of

  14. Department of the Navy FY 1990/FY 1991 Biennial Budget Estimates. Military Construction and Family Housing Program FY 1990. Justification Data Submitted to Congress

    Science.gov (United States)

    1989-01-01

    properly configured for optimum space use, are inadequate, overcrowded, and cannot acca -modate all the children who need child care. Comeercial child... F6 -4 l’mestic Leasing Fiscal Year Summary: PY 1988 - The domestic leasing program consists of 1,324 units requiring funding of 09,551.0. runding in

  15. Conference proceedings of Helmet Mounted Displays and Night Vision Goggles (Visuels Montes sur le Casque et Equipments de Vision Nocturne). Held in Pensacola, Florida, on May 2, 1991

    Science.gov (United States)

    1991-12-01

    seinble IAL aussi conduit par Ie VOR. Le plateau observe on exeinple de comporteinent de recherche, associant sacca- entr Ia2Em Ct3 Cne accae d...6quipements, emplacoment dot ycux, forme et dimensions L’informsttion auditive roy~t une importance fondlamontale doeI to tet, emplacement Ct

  16. La mise en spectacle de la mort dans deux pièces du théâtre espagnol du Siècle d’Or

    Directory of Open Access Journals (Sweden)

    Odile Lasserre Dempure

    2012-08-01

    Full Text Available Dans Fuente Ovejuna (1613 de Lope de Vega et La serrana de la Vera (1613 de Luis Vélez de Guevara, la mort est spectacle. Cette mise en spectacle de la mort, qui doit être replacée dans le contexte d’une esthétique macabre caractéristique de la période baroque, s’articule sur de multiples réseaux de sens dont nous tentons de dégager quelques lignes directrices. Une lecture attentive de la façon dont la mort et le cadavre sont mis en scène permet de comprendre que pour l’imaginaire de l’époque, cette mise en spectacle de la mort est surtout mise en spectacle de la vie. La mort, effroyable mais bienfaisante, est une mort génératrice de vie.En Fuente Ovejuna (1613, de Lope de Vega, y en La Serrana de la Vera (1613, de Luis Vélez de Guevara, la muerte es un espectáculo. Esta representación de la muerte, que debe ser situada en el contexto de una estética macabra propia al barroco, adquiere múltiples significados que trataremos de determinar y poner en relieve. Una lectura atenta de la manera cómo la muerte y el cadáver son expuestos, nos permite deducir que para el imaginario de la época esta representación de la muerte es más que nada una representación de la vida. La muerte, espantosa pero benéfica, es una muerte generadora de vida.

  17. Ecology of phlebotomine sand flies (Diptera: Psychodidaein a focus of Leishmania (Viannia brasiliensis in northeastern Colombia

    Directory of Open Access Journals (Sweden)

    Bruce Alexander

    1992-09-01

    Full Text Available The phlebotomine sand fly fauna of two coffee plantations in a Leishmania-endemic area of Norte de Santander, Colombia was studied. Regular insect collections using a variety of methods were made for three and a half years. Information was obtained on diurnal resting sites, host range and seasonal abundance for 17 species, of wich five (Lutzomyia spinicrassa, Lu. serrana,Lu. shannoni, Lu. ovallesi and Lu. gomezi were far more numerous than the others, anthropophilic and present throughout the year. The behaviour of these and the remaining 12 species is discussed in relation to their potential role in transmission of Leishmania (Viannia brasiliensis in the area.

  18. 24 CFR 3285.4 - Incorporation by reference (IBR).

    Science.gov (United States)

    2010-04-01

    ..., Virginia 22206. (1) ACCA Manual J, Residential Load Calculation, 8th Edition, IBR approved for § 3285.503(a)(1)(i)(A). (2) [Reserved] (c) The materials listed below are available for purchase from APA—The...-6600, fax number (253) 565-7265. (1) PS1-95, Construction and Industrial Plywood (with typical APA...

  19. Tangled up in Blue: Boosting Mental Health Services at Community Colleges

    Science.gov (United States)

    Finkel, Ed

    2016-01-01

    In a recent survey of 4,000 community college students, half reported experiencing a mental health condition. American College Counseling Association's (ACCA) fifth annual survey of personal and mental health counseling at community colleges provides some data from 159 professionals at two-year colleges in 41 states and Puerto Rico. Among the…

  20. The Commander’s Handbook on the Law of Naval Operations NWP 9 (REV.A)/ FMFM 1-10. Annotated Supplement

    Science.gov (United States)

    1989-01-01

    Channel ( Luzon Strait) Geographe Channel -Maemei Sudjo Bangka Passage Gibraltar, Strait of 1.4afia-St-a:t Bangki-Strait -Greyhound Strait Ma; acca Strait...if receipt and delivery not simultaneous, two separate msgs shall be sent) F6 AS7-6- 14 FORM 21 REPORT OF SPECIAL PRIZE COMMISSIONER UNITED STATES

  1. U. S. Army Medical Research and Development Technical Report

    Science.gov (United States)

    1978-09-30

    speed, accuracy, and precision cormared to the speed, accuracy, and precision of analysts counting manually was undertaken. If the ACCA prove to be...Fed Pruc 37 f6 ):1300, 1978 78-062 ZOLOCK, D.T., R.L. MORRISSEY, and D.D. BIKLE. 1,25-dihydro- xycholecalciferol (1,25(0112 )-mediated bone mineral

  2. Provision of Personnel and Administrative Support to the Forward Deployed Forces

    Science.gov (United States)

    1975-06-06

    Tor thaaa aystams to onerate reliably during combat. m. Baau.^hU^s^. A. Any cant,n.apay p.aa davalopad fan str^naU, and acca „„ti„s/pars...accounting, control and audit procedures for all replacements in the theater of operations. c. Receipt, processing, housing, feeding, clothing and

  3. 2008-2009 en bref

    International Development Research Centre (IDRC) Digital Library (Canada)

    La recherche-action participative(RAP) rassemble des représentants des groupes ... finance cinq projets pilotes, et le Programme de recherche sur l'eau, la santé et l'adaptation aux changements climatiques en Afrique, dans le cadre duquel le programme ACCA finance désormais six projets. Kezlya Magawa cultive du ...

  4. Diversity and Ecological Functions of Crenarchaeota in Terrestrial Hot Springs of Tengchong, China

    Science.gov (United States)

    Li, W.; Song, Z.; Chen, J.; Jiang, H.; Zhou, E.; Wang, F.; Xiao, X.; Zhang, C.

    2010-12-01

    The diversity and potential ecological functions of Crenarchaeota were investigated in eight terrestrial hot springs (pH: 2.8-7.7; temperature: 43.6-96 C) located in Tengchong, China, using 16S rRNA gene phylogenetic analysis. A total of 826 crenarchaeotal clones were analyzed and a total of 47 Operational taxonomic units (OTUs) were identified. Most (93%) of the identified OTUs were closely related (89-99%) to those retrieved from hot springs and other thermal environments. Our data showed that temperature may predominate over pH in affecting crenarchaeotal diversity in Tengchong hot springs. Crenarchaeotal diversity in moderate-temperature (59 to 77 C) hot springs was the highest, indicating that the moderate-temperature hot springs are more inclusive for Crenarchaeota. To understand what ecological functions these Crenarchaeota may play in Tengchong hot springs, we isolated the environmental RNA and constructed four cDNA clone libraries of the archaeal accA gene that encodes Acetyl CoA carboxylase. The accA gene represents one of the key enzymes responsible for the CO2 fixation in the 3-hydroxypropionate/4-hydroxybutyrate pathway. The results of phylogenetic analysis showed all the transcribed accA gene sequences can be classified into three large clusters, with the first one being affiliated with marine crenarchaeota, the second one with cultured crenarchaeota, and the third one with Chlorobi (Green sulfur bacteria), which have been proved to employ the 3-hydroxypropionate/4-hydroxybutyrate pathway. The long-branch distances of the phylogenetic tree suggest that these sequences represent novel accA-like gene. Our results also showed that sequences of the accA-like gene from the same hot spring belonged to one cluster, which suggests that a single crenarchaeotal group may fix CO2 via 3-hydroxypropionate/4-hydroxybutyrate pathway in the investigated hot springs.

  5. Niche partitioning of marine group I Crenarchaeota in the euphotic and upper mesopelagic zones of the East China Sea.

    Science.gov (United States)

    Hu, Anyi; Jiao, Nianzhi; Zhang, Rui; Yang, Zao

    2011-11-01

    Marine group I Crenarchaeota (MGI) represents a ubiquitous and numerically predominant microbial population in marine environments. An understanding of the spatial dynamics of MGI and its controlling mechanisms is essential for an understanding of the role of MGI in energy and element cycling in the ocean. In the present study, we investigated the diversity and abundance of MGI in the East China Sea (ECS) by analysis of crenarchaeal 16S rRNA gene, the ammonia monooxygenase gene amoA, and the biotin carboxylase gene accA. Quantitative PCR analyses revealed that these genes were higher in abundance in the mesopelagic than in the euphotic zone. In addition, the crenarchaeal amoA gene was positively correlated with the copy number of the MGI 16S rRNA gene, suggesting that most of the MGI in the ECS are nitrifiers. Furthermore, the ratios of crenarchaeal accA to amoA or to MGI 16S rRNA genes increased from the euphotic to the mesopelagic zone, suggesting that the role of MGI in carbon cycling may change from the epipelagic to the mesopelagic zones. Denaturing gradient gel electrophoretic profiling of the 16S rRNA genes revealed depth partitioning in MGI community structures. Clone libraries of the crenarchaeal amoA and accA genes showed both "shallow" and "deep" groups, and their relative abundances varied in the water column. Ecotype simulation analysis revealed that MGI in the upper ocean could diverge into special ecotypes associated with depth to adapt to the light gradient across the water column. Overall, our results showed niche partitioning of the MGI population and suggested a shift in their ecological functions between the euphotic and mesopelagic zones of the ECS.

  6. Serum anti-glycan antibodies in paediatric-onset Crohn's disease: association with disease phenotype and diagnostic accuracy.

    Science.gov (United States)

    Sładek, Małgorzata; Wasilewska, Agata; Swiat, Agnieszka; Cmiel, Adam

    2014-01-01

    Antibodies reacting with various microbial epitopes have been described in inflammatory bowel disease (IBD) and are associated with a specific diagnosis and clinical presentation. To evaluate the profile of new anti-glycan antibodies, their potential association with disease phenotype and diagnostic accuracy in paediatric Crohn's disease (CD). Blood samples from 134 paediatric IBD patients (109 CD, 25 ulcerative colitis (UC)) and 67 controls were blindly analysed for anti-Saccharomyces cerevisiae (ASCA), anti-chitobioside carbohydrate (ACCA), anti-laminaribioside carbohydrate (ALCA), and anti-mannobioside carbohydrate (AMCA) antibodies using commercially available assays. The serological response to glycans was correlated with clinical disease characteristics. At least one of the tested anti-glycan antibodies was present in 75% of CD patients. Despite the high frequency of reactivity to glycan epitopes, a limited overlap of serological markers was observed. In total, 49% of ASCA-negative patients presented with one of the following: ACCA, ALCA, or AMCA. The occurrence of one antibody from the anti-glycan panel was independently associated with complicated disease phenotype and ileocolonic disease location. A higher level of immune response as assessed by the quartile sum scores for ACCA, ALCA, and AMCA was linked with older age at diagnosis (10-17 years) and ileocolonic disease location. The ASCA had the greatest accuracy for diagnosis and differentiation of CD. Qualitative and quantitative serologicalal response to glycan epitopes was associated with distinct clinical presentation in paediatric CD patients. This raises the possibility for the use of these markers to differentiate subgroups of CD patients with more sever clinical presentation. The ASCA was the most accurate serological marker for CD; however, testing for the new anti-glycan antibodies may constitute an adjunctive tool in a specific group of patients to aid in the differentiation of CD with absent

  7. The CARD8 p.C10X mutation associates with a low anti-glycans antibody response in patients with Crohn's disease.

    Science.gov (United States)

    Vasseur, Francis; Sendid, Boualem; Broly, Franck; Gower-Rousseau, Corinne; Sarazin, Aurore; Standaert-Vitse, Annie; Colombel, Jean-Frederic; Poulain, Daniel; Jouault, Thierry

    2013-03-18

    Crohn's disease (CD) is associated with elevated anti-glycans antibody response in 60% of CD patients, and 25% of healthy first-degree relatives (HFDRs), suggesting a genetic influence for this humoral response. In mice, anti-glucan antibody response depends on the NLRP3 inflammasome. Here, we explored the effect of mutated CARD8, a component of the inflammasome, on anti-glycans antibody response in human. The association between p.C10X mutation (rs2043211) of the CARD8 gene and the levels of anti-glycans antibody response was examined in 39 CD families. The family-based QTDT association test was used to test for the genetic association between CARD8 p.C10X mutation and anti-glycan antibodies in the pedigrees. The difference in antibody responses determined by ELISA was tested in a subgroup of CD probands (one per family) and in a subgroup of HFDRs using the Wilcoxon Kruskal Wallis non-parametric test. The QTDT familial transmission tests showed that the p.C10X mutation of CARD8 was significantly associated with lower levels of antibody to mannans and glucans but not chitin (p=0.024, p=0.0028 and p=0.577, for ASCA, ALCA and ACCA, respectively). These associations were independent of NOD2 and NOD1 genetic backgrounds. The p.C10X mutation significantly associated or displayed a trend toward lower ASCA and ALCA levels (p=0.038 and p=0.08, respectively) only in the subgroup of CD probands. Such associations were not significant for ACCA levels in both subgroups of CD probands and of HFDRs. Our results show that ASCA and ALCA but not ACCA levels are under the influence of CARD8 genotype. Alteration of CARD8, a component of inflammasome, is associated with lower levels of antibodies directed to mannans and glucans at least in CD patients.

  8. Role of an Essential Acyl Coenzyme A Carboxylase in the Primary and Secondary Metabolism of Streptomyces coelicolor A3(2)

    Science.gov (United States)

    Rodríguez, E.; Banchio, C.; Diacovich, L.; Bibb, M. J.; Gramajo, H.

    2001-01-01

    Two genes, accB and accE, that form part of the same operon, were cloned from Streptomyces coelicolor A3(2). AccB is homologous to the carboxyl transferase domain of several propionyl coezyme A (CoA) carboxylases and acyl-CoA carboxylases (ACCases) of actinomycete origin, while AccE shows no significant homology to any known protein. Expression of accB and accE in Escherichia coli and subsequent in vitro reconstitution of enzyme activity in the presence of the biotinylated protein AccA1 or AccA2 confirmed that AccB was the carboxyl transferase subunit of an ACCase. The additional presence of AccE considerably enhanced the activity of the enzyme complex, suggesting that this small polypeptide is a functional component of the ACCase. The impossibility of obtaining an accB null mutant and the thiostrepton growth dependency of a tipAp accB conditional mutant confirmed that AccB is essential for S. coelicolor viability. Normal growth phenotype in the absence of the inducer was restored in the conditional mutant by the addition of exogenous long-chain fatty acids in the medium, indicating that the inducer-dependent phenotype was specifically related to a conditional block in fatty acid biosynthesis. Thus, AccB, together with AccA2, which is also an essential protein (E. Rodriguez and H. Gramajo, Microbiology 143:3109–3119, 1999), are the most likely components of an ACCase whose main physiological role is the synthesis of malonyl-CoA, the first committed step of fatty acid synthesis. Although normal growth of the conditional mutant was restored by fatty acids, the cultures did not produce actinorhodin or undecylprodigiosin, suggesting a direct participation of this enzyme complex in the supply of malonyl-CoA for the synthesis of these secondary metabolites. PMID:11526020

  9. Thailand: Background and U.S. Relations

    Science.gov (United States)

    2006-10-02

    Capabilities Will Be Emphasized Instead of Numbers of Troops,” State Department Press Releases and Documents. August 16, 2004. 28 Kaplan , Robert D., “How We...LAOS MALAYSIA Andaman Sea Str ai t of Mal acca INDONESIA Gul f of Thai l and South Chi na Sea Phuket Hat Yai Pattani Yala Narathiwat Nakhon Ratchasima

  10. Radiolocation Techniques (Les Techniques de Radiolocalisation

    Science.gov (United States)

    1992-11-01

    Dr R. Klemm DrD Rother FGAN- FFM SEL/LS/E Neuenahrer Strasse 20 Lorenzstrasse 10 D-5307 Wachtberg 7 D-7000 Stuttgart 40 Germany Germany Prof. G...des solutions. accas I lFionograinme, donc: aui profil. Cat article rapporte tine partie des Etudes mendes an La indthodo proposde s’inspirc de cette

  11. Management Advisory Services by CPA’s. A Survey of Current Expansion of Sole Proprietor Professional Practice Units.

    Science.gov (United States)

    1981-12-01

    national Busintess, 4th ed.. Multiastionals. Sethi & * sW imnuualnd ieansivin and dia. Wilcox (Irwin. 1971). Holim. ( Ffm Press. inmiveat cula...Ch7. 4. (Pretice.HaU, 19733. Specalits, Is.Part I (Oma. 30-37.3 (2) Pvoiysl anJ ecla *u,.ss .w only te Compute, ScwUV Securiy, Accuracy ad,uozed acca

  12. Programme de bourses de recherche sur le changement climatique ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Une faculté d'adaptation limitée est souvent reconnue comme l'un des principaux facteurs de vulnérabilité aux changements climatiques. Le programme Adaptation aux changements climatiques en Afrique (ACCA) du CRDI vise à aider les sociétés africaines à faire face aux changements climatiques. Cette subvention ...

  13. Suppressive Shields Structural Design and Analysis Handbook

    Science.gov (United States)

    1977-11-18

    0.50 Aluminum ..... ......... ... 0.25 3.9 FIREBALL AND THERMAL ENVIRONMENT The fireball and thermal environment resulting from an acca ...289,440 lb The acceleration of the mass is given by F8 - 103,8682 a 0.05759 - 5,025,813 in/sec2 For the next step, the acceleration is assumed to be

  14. Leveraging Executable Architectures in a Joint Environment

    Science.gov (United States)

    2009-01-01

    Support of Type 2/3 Terminal Attack Control Call Wing Operations Center (WOC) to Task On-Call Aircraft Call Air Command and Control Agency ( ACCA ) to...MIDS MIDS MIDS X = Existing capability P1 = Partial - requires voice ack P2 = Partial - only some F/A-18s None P3 = remarks only TARGET LOCATION

  15. Alpha List of Prime Contract Awards. Oct 92-Sep 93. FY93. (Claude Ralph - Day Francis O Co. Inc.)

    Science.gov (United States)

    1994-03-01

    4LLAA ( LU AC x 0 m LA (LA 0 x1 (1A)LALLCA(A( AcCA L A 0 ( tALALA01upIc (00.- U1 C(0 (D0 (0’.CD(0 (D (D (D (DW 00 0 (m (m (0CD(D0(m0w(0(20 (D0w Lo(1(0...COVcII N 44444444444 4444444444 N c04 II 44 4444 N 0041 caoacao acca 0i 0o cn I’ ID6 OOCNY 2 N4NrJNNNNNN0 NNNNNNNNNN C3 cO-4 11 L) U0 0 0 0 0 0c 0 0 0 0...0.4 .. 14൰*o0oo 00 0 0 - .4 N 4j H 4 I0cc WOO 004 INN C 10 10 100N04144443(300 t0 I0.4 ffM MN 14 100 N 0YMIn C 0 0 (1 H ma I (fl>( IIO N N NN N 0 4

  16. Atividade antimicrobiana, antiaderente e antifúngica in vitro de plantas medicinais brasileiras sobre microrganismos do biofilme dental e cepas do gênero Candida In vitro antimicrobial, antiadherent and antifungal activity of Brazilian medicinal plants on oral biofilm microorganisms and strains of the genus Candida

    Directory of Open Access Journals (Sweden)

    Pollianna Muniz Alves

    2009-04-01

    Full Text Available Avaliou-se in vitro a atividade antimicrobiana, antifúngica e antiaderente da aroeira-do-sertão, malva e goiabeira sobre microrganismos do biofilme dental e candidose oral. Os extratos mostraram-se eficazes, inibindo o crescimento das bactérias do biofilme dental e fungos da candidose oral, sugerindo a utilização dessas plantas como meio alternativo na terapêutica odontológica.The antimicrobial, antifungal and antiadherent activity of aroeira-do-sertão, mallow and guava tree on oral biofilm microorganisms and oral candidiasis was evaluated in vitro. The extracts were shown to be effective in inhibiting the growth of bacteria of the oral biofilm and fungi of oral candidiasis, thus suggesting that these extracts can be used as alternative means of dental therapy.

  17. Tight-Binding Approach to Computational Materials Science, Symposium Held December 1-3, 1997, Boston, Massachusetts, USA. Volume 491

    Science.gov (United States)

    1998-01-01

    many-body interactions. Then, hamiltonian (3) is reduced to: H = X PAT + Zfica + Tvc (c* aCca + C*aCva )] (5a) where --V2+V,(F) + V2(r) -^V2 +Vx{r...correction due to charge fluctuations is now represented by the Mulliken charge dependent contribution H^v to the matrix elements ffM „. As in

  18. The Analysis of Design of Robust Nonlinear Estimators and Robust Signal Coding Schemes.

    Science.gov (United States)

    1982-09-16

    b - )’/ 12. between uniform and nonuniform quantizers. For the nonuni- Proof: If b - acca then form quantizer we can expect the mean-square error to...in the window greater than or equal to the value at We define f7 ’(s) as the n-times filtered signal p + 1; consequently, point p + 1 is the median and

  19. A New Procedure for Determination of Electron Temperatures and Electron Concentrations by Thomson Scattering and Analytical Plasmas

    Science.gov (United States)

    1988-10-28

    Spectrochim. Acta 40B, 1211 (1985). 24 30. K. A. MARSHALL and G. M. HIEFTJE, Spectrochim. Acca (submitted, 1987). 31. H. J. KUNZE, Plasma Diagnostics, Ed...13 0,47689017-16 0 .4 F6 S6 7 E.16 26 Table 2. Correction table for Nd/YAG laser. Real (true) Te (top line) and Ne (left column) values and

  20. Surface Observation Climatic Summaries for McChord AFB Washington

    Science.gov (United States)

    1989-07-01

    0 .0 .0 .0 TRCE .0 f6 .6 __ 2_.. .. Q .. . __ .3 TR A n - _5.9 .- Z3, - ) 0 , (N T RA C: .9 .0 .3 .0 .0 .0 .2 .3...t 72-0 ....- 930 . .. . .. 7 .2 _ .. .....-3 .. .. i3 O_..... 1 72.) 1.0 7440 ...................... * aCCA *S& - . - -. & -- MO NLi AP-R iJR&j L

  1. Appendices for Fort George G. Meade Active Sanitary Landfill and Clean Fill Dump Remedial Investigation Report

    Science.gov (United States)

    1992-12-01

    3O VLYqq Time: P7 /0 Well Condition.: Well Diameter (inches): L4 U Odor (describe): Sounding Method: tW L= . . Measurement Reference: ’TOC Pv Stick... acca (f:):~ (=in)-__ --- 13.10 L AP Siium i=; ’are: _______________ Commane n ds Cbserwvuic-n: ______________________ 507 31 ,;IL 3: iL8.15 ’a~~l !o

  2. Nuclear, Chemical and Biological Education and Training: A Review Across the Services and Joint Community

    Science.gov (United States)

    2007-09-01

    13 1. Air Force Inspector General – CBRNE CERFP Program Audit ...14 2. Defense Medical...CBRNE CERFP Program Audit “The AFAA [Air Force Audit Agency] is assessing whether Air National Guard officials properly managed the Chemical...processing personnel through the aircrew contamination control area ( ACCA ). Flight Medicine provides training on agent toxicology and pharmacology. The

  3. Preliminary Public Health, Environmental Risk, and Data Requirements Assessment for the Herbicide Orange Storage Site at Johnston Island

    Science.gov (United States)

    1991-10-01

    included differences in results from field performance audit samples and performance evaluation standards. As stated above, these discrepancies may have...Turtiss arn. also se’nn acca : ,cnly IIhvoughout the lagoon andc chmnnn! arý4nz. 0TiO t-4-t-l. waz c ,!nusnd in April 1986 at" Station P5. Hawia %Ocn" sczls

  4. Fundamental Electronic Properties of Donor-Type Graphite Intercalated Compounds.

    Science.gov (United States)

    1984-08-01

    actulbndsbecauseofthe slight inaccu- of -0.09eOV. Thisis close but too low to give a racy of the fit which was, weighted to more acca - realistic Fermi...2). Further evidence and Dr. N. Wakabayashi and the generosity of of the failure of this model for LtC, is that ( p2 Dr. A. W. Moore of Union

  5. Adapter l'information climatique aux besoins des utilisateurs | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    29 mars 2011 ... Cet exposé politique résume les leçons tirées du forum d'apprentissage du programme ACCA entitulé " Faciliter l'accès aux prévisions météorologiques saisonnières et savoir mieux les exploiter" qui a pris lieux à Nairobi, Kenya en mars 1010.

  6. Novedades en la distribución geográfica del grupo verrucarum (Diptera: Psychodidae en Colombia.

    Directory of Open Access Journals (Sweden)

    Eduar Elías Bejarano

    2003-09-01

    Full Text Available La incriminación de especies de Lutzomyia del grupo verrucarum Theodor, 1965, en la transmisión de leishmaniosis en Colombia ha puesto de manifiesto la necesidad de conocer en detalle su distribución geográfica. Este trabajo pretende contribuir a su conocimiento mediante la incorporación de 34 registros nuevos, entre los que sobresalen el hallazgo de Lutzomyia spinicrassa en un bosque seco tropical de la Costa Atlántica, la presencia de Lutzomyia ovallesi en la Orinoquia y Amazonia y la simpatría de L. spinicrassa y Lutzomyia quasitownsendi en la Cordillera Oriental. Complementariamente, este artículo recopila y sintetiza la distribución municipal y altitudinal de las 19 especies registradas en el país. Los datos compilados muestran que la serie townsendi (L. spinicrassa, Lutzomyia longiflocosa, L. quasitownsendi, Lutzomyia sauroida, Lutzomyia torvida, Lutzomyia townsendi, Lutzomyia youngi está generalmente asociada con los pisos altitudinales premontano y montano bajo, mientras la serie verrucarum hace presencia desde el piso tropical hasta el montano con taxones de extenso ámbito geográfico (Lutzomyia evansi, Lutzomyia columbiana, L. ovallesi, Lutzomyia nuneztovari, Lutzomyia nevesi y taxones de distribución endémica (Lutzomyia andina, Lutzomyia disiuncta, Lutzomyia moralesi, Lutzomyia antioquiensis. De otro lado, los representantes de la serie pia (Lutzomyia pia, Lutzomyia limafalcaoae y de la serie serrana (Lutzomyia serrana aparecen desde el piso tropical hasta el montano bajo. Se postula que las divergencias en los rangos altitudinales podrían estar relacionadas intrínsecamente con el origen de las especies, derivándose de fenómenos climáticos y geológicos que han afectado la flora y fauna de la región andina.

  7. Mary SIDA y otras agresoras fatales en el folclore internáutico: enfermedad, miedo y mito

    Directory of Open Access Journals (Sweden)

    Ángel J. GONZALO TOBAJAS

    2015-04-01

    Full Text Available ABSTRACT: Although the urban legend's versions of «Mary AIDS» and its sequels are mainly transmitted through the new molds for the digital era (blogs, social networks, applications crossplatform messaging as WhatsApp and websites like YouTube, if it deepens in the territories of the oral and written literature, myth, History and the press notes that its content is much more traditional than we might imagine. Between parallels mentioned here, among others, an episode of the Gesta Romanorum, a Breton ballad of the Middle Ages, a popular tale of the Ozarks and a tale by Guy de Maupassant. Furthermore, it's linked here the protagonists of these stories with characters like the serranas of Spanish popular ballads and creatures as lamias, nymphs and succubi of different traditions, cultures and periods of time. RESUMEN: Aunque las versiones de las leyendas urbanas de «Mary SIDA» y sus secuelas se transmitan fundamentalmente a través de los nuevos moldes de la era digital (blogs, redes sociales, aplicaciones de mensajería multiplataforma como WhatsApp y sitios web como YouTube, si se profundiza en los territorios de la literatura oral y escrita, el mito, el cuento, la historia y la prensa se observa que su contenido es mucho más tradicional de lo que a priori se podría imaginar. Entre los paralelos mencionados en este artículo destaca, por ejemplo, un episodio de la Gesta Romanorum, una balada bretona de la Edad Media, un cuento popular de los Ozark y un conocido relato de Guy de Maupassant; asimismo, se vincula aquí a las protagonistas de estas leyendas con personajes como las serranas del Romancero popular y criaturas como las lamias, ninfas y súcubos de distintas tradiciones, culturas y épocas.

  8. Preliminary results relating to gamma irradiations of the pollen in the pineapple (Ananas comosus (L.) Merr)

    International Nuclear Information System (INIS)

    Benaga, R.; Vicedo, L.; Isidron, M.; Arias, E.; Campanioni, L.; Fernandez, J.; Castillo, E.; Romero, M.

    1993-01-01

    As a way to know the radiosensitivity of the pollen of pineapple, in order to get to know haploid plants, the anthers of red Espanola of the type Pinarena and smooth Cayena from the Serrana (Ciego de Avila) were exposed to 60C o gamma radiations in the irradiator at CENSA, with fractional doses ranging from zero to 5KGy. The percentage of germination and length pollinic tube is analysed in vitro; a decrease in the above mentioned parameters is observed, with the main doses in the two cultures although red Espanola showed a slight recovery at doses of 3 and 4KGy as well as the major values of germination of the pollen

  9. Chemical regulation of sex expression in certain olive cultivars

    Directory of Open Access Journals (Sweden)

    E. S. Hegazi

    2013-12-01

    Full Text Available The modifying effect of growth regulators on bud burst, flower bud formation and sex expression in olives varies greatly according to cultivar, concentration and time of application. Cycocel 200, 500 mg/l, ethephon 200 mg/l and SADH 2000 mg/l stimulated bud burst and flower bud formation in the 'Blanquetta' cv. A noticeable increase in the percentage of perfect flowers was obtained by 100 mg/l of kinetin, and 200 mg/l of Cycocel in the cv. 'Picual', Ethephon 200/1, Cycocel 200 mg/l and SADH 2000 mg/l considerably increased the percentage of perfect flowers in the cvs 'Blanquetta', 'Serrana' and 'Picual'. Treatments at green cluster stage were not effective.

  10. Influence of leaf and base lesion of herbaceous cutting in the guava rooting of the selection 8501-9 / Influência de folhas e lesões na base de estacas herbáceas no enraizamento de goiabeira da seleção 8501-9

    Directory of Open Access Journals (Sweden)

    Sérgio Ruffo Roberto

    2010-07-01

    Full Text Available With the objective of evaluate the potential of rooting of the selection of guava tree 8501-9 were using herbaceous cutting with 10-12 cm of length in two make of the prepared (simple cut without lesions and cambium exposition, and three suppression intensity of the leaves (without leaves, with half leaves and intact leaves. The experimental design was completely randomized with five repetitions in factorial arrangement 2 x 3, with ten cutting for parcel. After the preparation with IBA the cutting had been placed to rooting in plastic box (44 x 30 x 7 cm with carbonized rice hulls, in camera of nebulization. After 78 days, evaluated the leaf retention, survive of the cutting, the number of cutting roots and of roots, the length and fresh and dry mass of the roots. The interaction between lesions and presence of leaves was not significant, indicating like this factors act in independent form in relation the study factors. The leaves suppression resulted in cutting death. The cambium exposition not proportion vantage on root cutting herbaceous. For the gotten results it was observed that the interaction between lesion and leaf presence was not significant, indicating that these factors act of independent form in relation to the evaluated parameters. Cutting with base lesion presented addition of only 10% of foliar retention and percentage of roots cutting. Cutting with a pair of leaves had been superior to the parameters of the mass fresh and dry of root in relation to the cutting with half leaves, and the cutting without leaves not presented formation of roots being presence of leaves fundamental to roots promotion.Com o objetivo de avaliar o potencial de enraizamento da seleção 8501-9 de goiabeira utilizou-se estacas herbáceas com 10-12 cm de comprimento em duas formas de preparo (corte simples sem lesão e exposição do câmbio e três intensidades de supressão das folhas (sem folhas, com folhas cortadas ao meio e folhas intactas. O

  11. Advanced Concepts for Avionics/Weapon System Design, Development and Integration: Conference Proceedings of the Avionics Panel Symposium (45th) Held at Ottawa, Canada on 18-22 April 1983.

    Science.gov (United States)

    1983-10-01

    BIT A,, M 115V ACBB N 270V DC RETURN p 115V ACCA R IW DC POWER S INTERLOCK RETURN T STRUCTURE GROUND U FIBER OPTICS BUS V ADDRESS BIT A,, w...Ontario Kl A 0K2 Canada FGAN- FFM , D-5307 Wachtberg-Werthhoven Germany Concordia University, 7141 Sherbrooke St. W. Montreal, QueH4BlRG Canada

  12. The Cloning, Characterization, and Functional Analysis of Murine Pregnancy Specific Glycoproteins

    Science.gov (United States)

    1999-07-23

    wash at 550 C Sense AS Probe CTCCTCTCI I IrCATCTGT TCACTCATTT(AG~CACAGCCAG CTGGTACAAAGGGCTGATTG Cloni"gflllll~"gtltPsg19 5861 (AceS) 5859 ( AccAS ) 8050...12p40, iNOS, orTGF-1J mRNA. In RAW 264.7 cells, LPS upregulated mRNA expression for all cytokines examined, except for TGF- f3 mRNA. However, treatment

  13. 447 157 45 89 %

    International Development Research Centre (IDRC) Digital Library (Canada)

    Selon la prémisse de la recherche-action participative que nous avons financée, toute connaissance utile découle ... auprès des utilisateurs, le programme a financé des efforts supplémentaires de renforcement des capacités et de ... des retombées du programme. AfricaAdapt. Le programme ACCA finance AfricaAdapt afin.

  14. Viterbi Tracking of Randomly Phase-Modulated Data (and Related Topics).

    Science.gov (United States)

    1982-08-10

    odd (#I,, P2 ," • Denote the conditional probability mass 46, ) function of 0k, given Ak, by p(Ok/Ak). For the (4, 4) diagram of Fig. 2(d), i, j even...Professor Electrical Engineering LS:fr I. II Recent (Jutstandinq Acca plisuneil: / - -017(, July 12, 1982 The problem of FM divdulation has a long hi.;try (f

  15. Prime Contractors with Awards Over $25,000 by Name, Location, and Contract Number, Fiscal Year 1992 (Daubert Industries, Inc.-Gaylord Industries, Inc.)

    Science.gov (United States)

    1993-01-01

    a0 m~ ar (0 - a 0 a4 04 H50 4 a 4 C-1 am a C3 L) 0ý an 0 a n c Za4 00 C.ým 4Lo j I N O Nol 0IS)0 cl r- m - anNe t"I ý ý Ll2 an N -z Do~ acca -fN- 0a’J...c to aQ Coo," I "o o) " ’ mC, ,I e nnI to a) ammc)oc Il I I L) o c wo x I Ca u m2 a. U r-7f cc ~ nl.< C0C) -*4~-0na-ao " 0 ELI ao (v acCa ’’ a~al~ nal...Fw IE~ 1. E F1 F4 o F. c4I F 4 F OF. F7 )I - F ~-4 .F 4 F 41) w 10 A F F W)( o4 v7- m ’mo7 l T =444 45 o o .7 c> S . o Lc4 mo - 04 NNr a)0 lo 7 1 7 o

  16. Dollar Summary of Prime Contract Awards by Contractor, State or Country, and Place, FY 85. Part 2 (D & A Construction - H & H Service Corpor).

    Science.gov (United States)

    1985-01-01

    4c4 ’n 8:r--t n0 . I L .I 0 In -4i n 0-1. :8:. 0 If In W I &n U) I I U UNS U g’-u U4 cc) I 040 0e a 6 e1 a. c C46, 4 C 1 00 t" .4 .. a4 4l f6 I. M t Co...1 a a - 0 -- - a44 ’ 0 Om 3"% am" aCCa - -1 aC- a amm m a t- I N N N m mCr- I4 a 21 - 0 I N C) C) c - " C) x C) x r.)mX a C -I c 0 = I= N -4 Noo W...0 aL NA aL N’-4’C 0-a Co -4 N N o 1 4 40- n N ) (DO4a *w w I-I )Ia m - 0Q’ CI "I "ao~ (.) (N 0 Z C-4 m 2lm acca -a: U 0 0 . I.- I.-1 I- nV -0LL J I I

  17. A combined spectral and object-based approach to transparent cloud removal in an operational setting for Landsat ETM+

    Science.gov (United States)

    Watmough, Gary R.; Atkinson, Peter M.; Hutton, Craig W.

    2011-04-01

    The automated cloud cover assessment (ACCA) algorithm has provided automated estimates of cloud cover for the Landsat ETM+ mission since 2001. However, due to the lack of a band around 1.375 μm, cloud edges and transparent clouds such as cirrus cannot be detected. Use of Landsat ETM+ imagery for terrestrial land analysis is further hampered by the relatively long revisit period due to a nadir only viewing sensor. In this study, the ACCA threshold parameters were altered to minimise omission errors in the cloud masks. Object-based analysis was used to reduce the commission errors from the extended cloud filters. The method resulted in the removal of optically thin cirrus cloud and cloud edges which are often missed by other methods in sub-tropical areas. Although not fully automated, the principles of the method developed here provide an opportunity for using otherwise sub-optimal or completely unusable Landsat ETM+ imagery for operational applications. Where specific images are required for particular research goals the method can be used to remove cloud and transparent cloud helping to reduce bias in subsequent land cover classifications.

  18. Quality indicators for acute myocardial infarction: A position paper of the Acute Cardiovascular Care Association.

    Science.gov (United States)

    Schiele, Francois; Gale, Chris P; Bonnefoy, Eric; Capuano, Frederic; Claeys, Marc J; Danchin, Nicolas; Fox, Keith Aa; Huber, Kurt; Iakobishvili, Zaza; Lettino, Maddalena; Quinn, Tom; Rubini Gimenez, Maria; Bøtker, Hans E; Swahn, Eva; Timmis, Adam; Tubaro, Marco; Vrints, Christiaan; Walker, David; Zahger, Doron; Zeymer, Uwe; Bueno, Hector

    2017-02-01

    Evaluation of quality of care is an integral part of modern healthcare, and has become an indispensable tool for health authorities, the public, the press and patients. However, measuring quality of care is difficult, because it is a multifactorial and multidimensional concept that cannot be estimated solely on the basis of patients' clinical outcomes. Thus, measuring the process of care through quality indicators (QIs) has become a widely used practice in this context. Other professional societies have published QIs for the evaluation of quality of care in the context of acute myocardial infarction (AMI), but no such indicators exist in Europe. In this context, the European Society of Cardiology (ESC) Acute Cardiovascular Care Association (ACCA) has reflected on the measurement of quality of care in the context of AMI (ST segment elevation myocardial infarction (STEMI) and non-ST segment elevation myocardial infarction (NSTEMI)) and created a set of QIs, with a view to developing programmes to improve quality of care for the management of AMI across Europe. We present here the list of QIs defined by the ACCA, with explanations of the methodology used, scientific justification and reasons for the choice for each measure.

  19. Dollar Summary of Federal Supply Classification and Service Category by Company. Part 2 (B502-J066)

    Science.gov (United States)

    1990-01-01

    U 0 V ) V ( w~~~~ ae a11 - 4 W 4 0~~~~ a a4 " A 0 1> z~~~~ a. a0 4 0 4 1 4 ,0 4 - 4a%- %. 0 4a4 t4 i acca Lu awHIu 0a 0 0 0 Iw awa In InI I IK t0 n 4...6. 1 4. P7 4 % -. I-J x >- .4.-H %- t- 10 *- C 4 c 6. 01 C 4 .4 &i >, L. *.4 9U 10 0. l4. .- H C 0 3’ 0 c .4 X -4.4 ); Al 31 1. 0. 40V-4 3. Il- I... acca o - z ow zi1- crw z aa 0 0 w w-U 1-00 0 .Z 0 0 <~ ~0 0 : ac 0 ow 0w xD 0 0 1-w 0. < z :I- 0~ OcOZ0 0- H z< U n Z>- ao1 w 0 WI H Z 0 0 0 00-0 al

  20. Réponse équilibrée aux besoins en eau dans le bassin du Saïss au ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ACCA

    par les changements climatiques. Ce projet du programme ACCA met l'accent sur l'agriculture, à l'origine de plus de 82 % de la consommation d'eau dans le bassin. Réponse équilibrée aux besoins en eaudans le bassin du Saïss au Maroc. De petits exploitants agricoles du bassin du Saïss font face aux pénuries d'eau ...

  1. Helicopter Maneuverability and Agility Design Sensitivity and Air Combat Maneuver Data Correlation Study

    Science.gov (United States)

    1991-10-01

    1 1 Hovar Bob-up: Mai ROC (fi/mm) 1400 60 00 6 00 36 00 80 00 27 00 2 Acca * Hovar to 60 kt«: Tima (aac) 10.51...5SA SPECIFIC FILE (Cont’d) ROPMP:t UVRUVRM ja? PSIWFM ItOPM RC.FLO F7 .P -20.0,20.0,2.0 RQFBI ?•« FUSELAGE ROLLING RORENT VI PSIWF •• {RAP

  2. MAGMA: A Liquid Software Approach to Fault Tolerance, Computer Network Security, and Survivable Networking

    Science.gov (United States)

    2001-12-01

    and Lieutenant Namik Kaplan , Turkish Navy. Maj Tiefert’s thesis, “Modeling Control Channel Dynamics of SAAM using NS Network Simulation”, helped lay...DEC99] Deconinck , Dr. ir. Geert, Fault Tolerant Systems, ESAT / Division ACCA , Katholieke Universiteit Leuven, October 1999. [FRE00] Freed...Systems”, Addison-Wesley, 1989. [KAP99] Kaplan , Namik, “Prototyping of an Active and Lightweight Router,” March 1999 [KAT99] Kati, Effraim

  3. Secure DBMS Auditor

    Science.gov (United States)

    1990-07-01

    a be (AUIT ALL) kzldal accas audited , ( AUDIT CHANGES) any changes but no read access andoad, ( AUDIT NONE) or not auditig. Securit au&i monitors the...prcessinglofea queery, (4)n ituio deteapctintecnologyurmay beic an ritultiora ftureseach andlitl (5) the audit system should be examined, in detail, c...10 4 Guidance on Auditing ......................................... 13 4.1 Guidance from the TCSEC Audit Guide . ..................... 13 4.2 The

  4. East Europe Report

    Science.gov (United States)

    1987-02-02

    85 Briefs Defense Ministry PZPR Meeting 86 Defense Ministry PZPR Audit Session 86 POLITICS GERMAN DEMOCRATIC REPUBLIC Peace Conference...indi- SotherTchesf accA T.T^ZX^^^ ^ . Position of sTl^scaleentrepreneur or self-employed person and the status workplace. One of the Hungarian...function of payment transactions is excessive in the Public Auditing Service [SDK]. We know that commercial banks carry out the entirity of payment

  5. Annual Industrial Capabilities Report to Congress

    Science.gov (United States)

    2009-03-01

    Demonstration (UCAS-D), Blackswift, Advanced Composite Cargo Aircraft ( ACCA ), Falcon, Speed Agile, and Vulture—are facing funding constraints that are...tasked the Defense Contract Audit Agency to provide annual IRAD spending reports. The TCG continues to work to gain insight into IRAD expenditures...following short-term TENTNET projects have either been funded or are being pursued: • University of Tennessee – Supply Chain Audit • University of

  6. System Dynamics and Management Science Approaches Toward Increasing Acquisition Process Efficiency

    Science.gov (United States)

    2015-06-26

    1-85908-475-5, The Association of Chartered Certified Accountants ( ACCA ), London, UK, February 2012 Wood 2012 Roy Wood: Schedule-Driven Costs in...especially in the context of so-called public private partnership (PPP). Improper contracts may cause significant delay and additional costs in...improvement of the project contracting process may have a significant contribution to reduce project delays, additional costs and improve outcome of

  7. Design and Analysis of Reconfigurable Analog System

    Science.gov (United States)

    2011-02-01

    34010010" �" �" �" �" �" �" �±" N3 N2 N± P1 P2 P3 * Current sources $RR = 1; *Ramp Rate (slope of the...2008/12/12/31e83bac-500f-4182- acca -4d360295fd9c.pdf, Analog Devices, Analog Dialogue 39-06, June 2005. [15] D. A. Johns, K. Martin "Analog Integrated

  8. Contribuição da pesquisa científica brasileira no desenvolvimento de algumas frutíferas de clima subtropical

    Directory of Open Access Journals (Sweden)

    Fernando Mendes Pereira

    2011-10-01

    Full Text Available Quando se considera aptidão climática, as plantas frutíferas são classificadas em: tropicais, subtropicais e temperadas. Esta tradicional classificação, por muito tempo, mostrou-se bastante efetiva. Os mais atuais conhecimentos dos centros de origens de diferentes espécies, os avanços tecnológicos na condução dos pomares e na conservação dos frutos e especialmente o melhoramento genético criaram condições excepcionais para o cultivo de espécies tropicais e temperadas em clima subtropical. No presente trabalho foram selecionadas as culturas da atemoieira, do caquizeiro, da figueira e da goiabeira com base não apenas na importância nacional e regional, mas também pelas diferentes contribuições que a pesquisa científica ofereceu a estas frutíferas. Atemoieira - dentre as espécies frutíferas exploradas em larga escala, talvez seja a de mais recente introdução de cultivo no Brasil, iniciado em meados da década de 1980. Diversas técnicas de cultivo foram desenvolvidas, como porta-enxertos mais adequados para cada região, podas de formação e produção, polinização artificial, manejo de pragas e doenças, e diversas outras tecnologias que permitiram rápida expansão da cultura em diversas regiões do País. Embora o importante papel das Universidades, Institutos de Pesquisas e Extensão seja inquestionável, foi fundamental a contribuição dos produtores pioneiros que iniciaram a busca de soluções para os problemas surgidos, indicando as necessidades para intervenções da pesquisa. Caquizeiro - a produção brasileira de caqui (IBGE - 2009, de 171.555 t, é obtida em uma área de 8.770 ha e representa um valor de 146,67 milhões de reais. São Estados maiores produtores São Paulo (111.646 t, Rio Grande do Sul, Paraná e Rio de Janeiro. As principais cultivares em produção são: Rama Forte, Giombo e Fuyu, que são comercializados prioritariamente no mercado interno. Figueira - a produção brasileira de figos

  9. Ecologia da paisagem da hantavirose no Estado do Rio Grande do Sul Landscape ecology of hantavirosis in Rio Grande do Sul State

    Directory of Open Access Journals (Sweden)

    Waldir E. Henkes

    2004-12-01

    Full Text Available Esse trabalho tem como objetivo estudar a ecologia da paisagem das hantaviroses no Rio Grande do Sul através do mapeamento da ocorrência de casos e sua sobreposição a mapas de vegetação e relevo. A maior parte dos casos ocorre na primavera em regiões serranas com vegetação secundária e atividade agrícola.The aim of this work was to study the landscape ecology of hantavirosis in Rio Grande do Sul state, Brazil. This was achieved through geocoding the occurrence of cases and overlaying onto vegetation and relief maps. The majority of cases occurred during Spring, in highland areas dominated by secondary vegetation and agricultural activity.

  10. Acciones políticas y proyectos económicos en Guanajuato frente al conflicto de la Sierra Gorda 1847-1852

    Directory of Open Access Journals (Sweden)

    Carlos Armando Preciado de Alba

    2009-07-01

    Full Text Available Las revoluciones europeas de 1848 inquietaron a grandes sectores de la clase política mexicana pues fueron percibidas como un peligro para el orden social. Asimismo, en esos años, conflictos regionales como la Guerra de Castas y la rebelión en la Sierra Gorda amenazaban con trascender al ámbito nacional. Las autoridades guanajuatenses trataron de impulsar acciones políticas y económicas para controlar a la población. El artículo aborda el proyecto para la construcción de un presidio en la población serrana de Atargea, el cual, además de desincentivar potenciales brotes de violencia, buscaría reactivar la industria minera de la región.

  11. Vulnerabilidade socioambiental, redução de riscos de desastres e construção da resiliência: lições do terremoto no Haiti e das chuvas fortes na Região Serrana, Brasil Socio-environmental vulnerability, disaster risk-reduction and resilience-building: lessons from the earthquake in Haiti and torrential rains in the mountain range close to Rio de Janeiro in Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Machado de Freitas

    2012-06-01

    Full Text Available Dados sobre desastres no mundo apontam para uma maior gravidade nos países com menores níveis de desenvolvimento econômico e social. Neste contexto, políticas de redução de riscos de desastres e construção da resiliência constituem prioridades na agenda do desenvolvimento sustentável, estando entre os temas eleitos para a Rio+20. O objetivo deste artigo é, através de uma contribuição de natureza conceitual e dos exemplos de desastres em países com níveis de desenvolvimento diferentes, o terremoto do Haiti e as chuvas fortes na Região Serrana (Rio de Janeiro, Brasil, demonstrar como a vulnerabilidade socioambiental cria condições para os desastres, ao mesmo tempo em que limita as estratégias para prevenção e mitigação. Ao final são apontados alguns dos desafios que a redução de riscos de desastres e a construção da resiliência exigem em contextos de vulnerabilidade socioambiental, o que inclui mudanças nos padrões de desenvolvimento social, econômico e ambiental orientados para a sustentabilidade ecológica e a justiça social como pilares do desenvolvimento sustentável.Data on disasters around the world reveal greater seriousness in countries with lower social and economic development levels. In this context, disaster risk-reduction and resilience-building policies are priorities in the sustainable development agenda, featuring among the topics selected for the Rio+20 Summit. By means of a contribution of a conceptual nature and from examples of disasters in countries with different development levels, namely the Haiti earthquake and the torrential rains in the mountain range close to Rio de Janeiro in Brazil, the scope of this article is to demonstrate how socio-environmental vulnerability creates conditions for disasters, while at the same time limiting strategies for their prevention and mitigation. Lastly, some of the measures that disaster risk reduction and resilience-building demand in a socio

  12. CRESCIMENTO INICIAL DE PORTA-ENXERTOS DE GOIABEIRA IRRIGADOS COM ÁGUAS SALINAS

    Directory of Open Access Journals (Sweden)

    Marcelo Tavares Gurgel

    2007-01-01

    Full Text Available With the purpose of evaluating effects of salinity of irrigation water on initial development of rootstocks of guava (Psidium guajava L, an experiment was conducted in greenhouse at Experimental Station of Pacajus, belonging to Embrapa Tropical Agroindustry in the State of Ceará. The treatments in randomized block design consisted of five levels of electrical conductivity of water (ECw: 0.5; 1.5; 2.5; 3.5 and 4.5 dS m-1 and two cultivars of guava (Rica and Ogawa with four replications. The irrigation waters were prepared maintaining equivalent proportion of 7:2:1 respectively of Na:Ca:Mg. Seedlings were appraised 80 days after emergence, the effects, on number of leaves, plant height, diameter of stem, phytomass of the root and aerial parts, total phytomass, diameter, leaf area and root to aerial part ratio were studied. The increment of water salinity affected growth of cultivar in terms of number of leaves, stem diameter plant height, the Ogawa cultivar was found to be more affected. In highest level of water salinity (4.5 dS m-1 the relative reduction in total dry phytomass in case of cultivar Rica was 63.5% while the decrease in cultivar Ogawa was higher (77.4%; with regard to leaf area the effect was linear with reduction of 17.2% and 18.4%, respectively, for unit increase of water salinity. In cultivar Rica roots and in cultivar Ogawa the aerial parts were most affected negatively by water salinity.

  13. Distribuição da matéria seca e composição química das raízes, caule e folhas de goiabeira submetida a estresse salino Dry matter partitioning and mineral composition of roots, stems and leaves of guava grown under salt stress conditions

    Directory of Open Access Journals (Sweden)

    Raimundo Gonçalves Ferreira

    2001-01-01

    Full Text Available Um experimento em casa de vegetação foi conduzido com o objetivo de estudar a resposta de plantas de goiabeira (Psidium guajavaL. a diferentes concentrações de NaCl. As plantas foram cultivadas em solução nutritiva, com 0, 25, 50, 75, 100, 125 e 150 mM de NaCl, e colhidas com 30 e 50 dias após estresse, num delineamento inteiramente casualizado. Foram determinadas: matéria seca das raízes e parte aérea; e porcentagens de Na, Cl, K, Ca e Mg nas raízes, caule e folhas. O estresse salino reduziu a matéria seca total, e a relação parte aérea/raiz foi reduzida. O estresse causou um aumento nos níveis dos íons Na+ e Cl-, com maior acúmulo nas folhas, seguido das raízes. Os teores de Ca foram estáveis nas raízes, mas decresceram no caule e folhas. Os teores de K foram reduzidos, particularmente nas folhas. Ao contrário, os teores de Mg não foram afetados pela salinidade no caule e nas raízes, havendo, entretanto, redução nas folhas. O teor de Na apresentou relação direta com o de Cl e inversa com o de K nas raízes e folhas. O teor de Ca não variou com o de Na nas folhas, mas apresentou uma relação inversa nas raízes. O teor de Mg não variou com o de Na nas raízes e folhas.A greenhouse experiment was conducted with the objective of studying the response of guava plants (Psidium guajavaL. to increasing levels of NaCl concentrations. Plants were grown in nutrient solutions, with 0, 25, 50, 75, 100, 125 and 150mM of NaCl, and harvested 30 and 50 days after saline stress in a complete randomized design. The following traits were studied: shoot, root and total plant dry matter and the percentage of Na, Cl, K, Ca and Mg in plant dry matter. Dry matter yield decreased when salinity increased. The root/shoot ratio decreased with the saline treatment. Salinity stress caused an increase in the levels of Na+ and Cl-. The highest ion accumulation was found in the leaves followed by the roots. The Ca levels were stable in the roots

  14. Proceedings of NEUROTOX󈨜, Molecular Basis of Drug & Pesticide Action (3rd) Held in Bath, England on 10-15 April 1988: Abstracts

    Science.gov (United States)

    1988-04-15

    cxy e n/ and i nve s iati r. t-’-e cs si~ mechanisms cf :.’.e cx~nac;:4on. RP 60- 2P~ 3- 40 5 /*I on fn A min in mh andr menrmm ma 1.1Lceda,K., Kaplan ,V...Biophys. Acca . 1988, (submitted for publica- tion). 5. Coronado.R. and Latore.R. Biophys. 1. 1983, 43 231-236. 144 POTASSIUM CHANNELS IN CULTURED

  15. Transactions of the Conference of Army Mathematicians (26th) Held at Hanover, New Hampshire on 10 - 12 June 1980.

    Science.gov (United States)

    1981-01-01

    swee r the Mlor-Le ’a ie tayl e to li thin thle acca - rae. i tti h n IIrfleI-ieCaL I dit a . Iceo inl t ii hreJries o. however, the iorteot the( pA1...bifurcations, which surprised us, the perturbed problem has solutions which may be approximated by the scheme proposed in fFM ]. In a way, the asser- tion

  16. Damage Control Technology - A Literature Review

    Science.gov (United States)

    2006-03-01

    The Canadian Navy has identified the reduction of the total operating cost ( TOC ) of new ships as a priority. The major contributors to the TOC of a...Corporation, California, USA AC-CAS Group Co. Ltd., Bangkok, Thailand Apollo Fire Detectors, Hempshire, England, UK Compania Panamena de Sistemas ...National Defence DRDC Defence Research and Development Canada TOC Total Operating Cost BDCS Battle Damage Control System DC-ARM Damage Control

  17. Biological Effects of Laser Radiation. Volume I. Review of the Literature on Biological Effects of Laser Radiation-to 1965.

    Science.gov (United States)

    1978-10-17

    ailsur-der stu-dy. Y’c~zcro-p c e:zuto s- zsne nodules -whi ch Iw r su- sbl : irracdiated revealed sho. -cyes c -,t-,i~lrg nut o-. -- "at ae thzan vale...Ham, W.T., Jr., ec al., Amer. J. Ophchal. 43, 711, 1957. 7. Ham, W.T., Jr., et al., Amer. J. Ophchal. 46, 700, 1958. 8. Ham, W.T., Jr., ec al., Acca

  18. Mobility Performance of Towed and Self-Propelled Artillery and Related Vehicles

    Science.gov (United States)

    1977-01-01

    K A means not applicable. (Sheet 5 of 6) (Set5 f6 Table oi (Concluded) Vehicle Characteristics Dimes- NO. Identification sions MIO9AI M107 MI1OE2...A/I *4W 0.,.ArAO.,fl 0 a,..,ntOC..=C a 04fl0040C.AA/ a anaaoaco,, aCCA % 00000 4................4..... 4--------.4 0r,..0o.atCa 4 NNCCSC0N .nrc.. 0

  19. United States Air Force Statistical Digest, Fiscal Year 1968. Twenty Third Edition

    Science.gov (United States)

    1968-09-30

    FY1968 f6 .Cl."!!!WfflR - m ... 919 5,765 1,039 68 5,758 13 7 508 6 450 SOllrCe: Data Applications ,Division, Dat$.,services Center, Canptroller of the...1.ceroatce S,..e... lIl.ella BJ.eet.-uc e..... . . . u.-t 1JIlc.e t alii Ope~ato~ hallllq Da1ou. • • • • •• ~ • ... ~cnft Acca ."I:J ceUDCe

  20. Calculations of Shipboard Heat Exchangers,

    Science.gov (United States)

    1980-04-18

    40 C. Absolute, either real, pxessuze: Pa F6 ( where P6 - atmospheric, or tarcmetric, pressure, am Hg; p - overpressure (reading mancmeter), ikm Hal. A...21,oA 44 wxv BOX. CT. I *OyllTKU. .2lObin 0.0703 Acca (32) ()I *ynl’/XB. ite0Ms 0.068o 4(?ii. anm I *0yHlt/Ku. itoil. 51 .712 .1A PT. CT. DOC

  1. Pilot of the Modern Army Record-Keeping System (MARKS) at 5th Battalion, 73rd Armored Regiment, 194th Armored Brigade, Fort Knox, Kentucky

    Science.gov (United States)

    1984-08-01

    patents, inventions, taxation , land litigation 7-. . . - - - - - - - - - - -- - - - - - - - - - - - .. . - . - - . . . . . .. - --- ----- Series 4...Jl~ 00 ;0 w 40 ow 03 -4 Ai’ Q3 r.. 41I acca -4 1.4 0.4 0 40 W A 1. 4 a C ’ 0 o-4 >4 u 0.-4 0d 0,U c c4E 0 ~ 0 .~ 4.4 C r-J * . 4 pq 4a *i LI 4) 4 4-44

  2. Justice Department Enforcement of the Neutrality Statutes in the South Florida Area.

    Science.gov (United States)

    1984-04-16

    At that time we will send copies to interested parties and make copies available to others upon request. William J. Anderson Director Accae -ss-ion F...that investigative matters against these activities have been declined for prosecution. As requested by your office, our audit work focused on...practices of U.S. attorneys’ offices. Our work was conducted in accordance with generally accepted government auditing standards. We performed our

  3. An Evaluation of NEPTUNE - A Program for Estimating Life-Cycle Cost of Oily Waste/Waste Oil Collection, Transportation and Treatment Systems.

    Science.gov (United States)

    1981-04-01

    are listed in Appendix B. There was a significant problem with the formal auditing of the NEPTUNE predictions since a complete manual checking effort...WRSE R. Z. ien BROKLY ! ACcA BSTON SATH CROTON SAT VALJLJO OUZ~A 5.3. NW AD AX A’s AMS AOFT AG! AZ AOSS AD "’s A AS& ASI AT! A’S AVM cc C"~ Cv DC OD963

  4. Statement Testimony of Mr. Alan R. Shaffer, Principal Deputy, Defense Research and Engineering Before the United States House of Representatives Committee on Armed Services, Subcommittee on Terrorism, Unconventional Threats and Capabilities

    Science.gov (United States)

    2009-05-20

    Advanced Composite Cargo Aircraft ( ACCA ) platform to assess and validate the structural behavior and cost impact of using large out-of-autoclave...capabilities to fight the current and future wars 3. Improving our acquisition capabilities and accountability . The Department of Defense S&T budget...In fact, the S&T program fared well in comparison to many other discretionary accounts . For instance, the RDT&E budget categories of Advanced

  5. en bref

    International Development Research Centre (IDRC) Digital Library (Canada)

    réseaux qu'il finance et ses partenaires, travaille à ce que les leçons tirées et les résultats obtenus soient diffusés dans toute l'Afrique et ... ACCA finance aussi diverses initiatives de partage du savoir dans le cadre du réseau ... stratégie de recherche-action participative, de renforcement des capacités et de partage du ...

  6. Le transfert de la direction des activités vers des institutions ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    la recherche-action participative (RAP);. • l'éducation et la formation;. • les communications et le ... financé des ateliers de formation en anglais et en français sur les méthodes de RAP, l'évaluation des risques ... En 2010, le programme ACCA a financé une deuxième phase de l'ACCFP qui sera dirigée par l'Institut d' ...

  7. Place à l'adaptAction | IDRC - International Development Research ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    22 févr. 2011 ... Ces brefs profils de projets donnent un aperçu des types de défis auxquels les Africains font face dans le cadre de l'adaptation aux changements climatiques et des stratégies qu'ils mettent à l'essai dans le cadre des travaux de recherche appuyés par le programme ACCA.Les profils sont fondés sur des ...

  8. CONSTRUÇÃO E VALIDAÇÃO DA CURVA DE CALIBRAÇÃO EM NIR ATRAVÉS DE ANÁLISES BROMATOLÓGICAS DA POLPA DE GOIABA

    Directory of Open Access Journals (Sweden)

    Jessika Santos de Oliveira

    2017-01-01

    Full Text Available Resumo: A P guajava L, comumente conhecida como goiaba, ocorre naturalmente em todo território brasileiro, sendo mais explorada na região nordeste e sudeste do país. O mercado brasileiro de goiaba está dividido em dois segmentos: o de goiaba in natura e o de goiaba para indústria. A avaliação da qualidade dos frutos é uma questão importante, porém, as metodologias convencionais utilizadas necessitam de extração prévia dos analitos. A espectroscopia na região do infravermelho é uma ferramenta com alto potencial analítico, pois fornece o perfil completo da composição de uma amostra em poucos segundos, apresenta alta sensibilidade, é de fácil implementação e baixo custo. Palavras-chave: Goiabeiras, Genótipo, Bromatologia, NIR

  9. Determinação da atividade antifúngica de Acca sellowiana

    OpenAIRE

    Gabriella da Rosa Monte Machado

    2015-01-01

    Infecções fúngicas causadas por leveduras oportunistas de Candida não – albicans (CNA) têm aumentado drasticamente nas últimas décadas, podendo estar relacionadas com o elevado número de pacientes imunocomprometidos, mais susceptíveis a essas infecções. CNA possuem maior resistência aos antifúngicos tradicionais como o fluconazol (FLZ), fármaco de escolha para o tratamento de infecções por Candida spp. A resistência antifúngica conduz a falhas na terapia clínica podendo levar ao aumento das t...

  10. activit secondaire* du programme acca la cdp 12, cdp/rdp 2

    International Development Research Centre (IDRC) Digital Library (Canada)

    freelance

    5.3. But et objectifs spécifiques de la stratégie de Partage des Risques ... EEEAO : Echange d'Energie Electrique en Afrique de l'Ouest. FAO: Food and Agriculture ...... 95 000 pour son noyau central) sur les deux rives du Delta du fleuve.

  11. Características de frutos e germinação de sementes de seis espécies de Myrtaceae nativas do Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Cristina Santos Magalhães Ribas dos

    2004-01-01

    Full Text Available Myrtaceae family is well represented in the flora of Rio Grande do Sul, in the Southern region of Brazil. The seed and the fruits from six trees species of this family were examined concerning their size, color, mass and water content. The species were the following: Acca sellowiana (Berg. Burnet; Campomanesia guazumifolia (Camb. Berg.; Campomanesia xanthocarpa Berg.; Eugenia rostrifolia Legr.; Myrcianthes pungens (Berg. Legr and Psidium cattleyanum Sabine. The germinative behavior of the seeds was evaluated and the substratum used was autoclaved, which was placed in gerbox (11 x 11cm, at constant temperatures 15, 20, 25 or 30°C or in alternate ones 15°C/ 30°C, with fourteen hours period, in the highest temperature. The experiments were also carried out in the dark. The seeds of Acca sellowiana, Myrcianthes pungens, Psidium cattleyanum showed positive photoblastic behavior. All species germinated in 90 days except Campomanesia guazumifolia which took around 150 days to germinate. The water content ranged from 9% in Campomanesia guazumifolia to 68% in Myrcianthes pungens and the seeds varied from intermediate to recalcitrant ones. The eugenoid embryos had a cryptocotylar germination, however the myrciod and the pimentoid had a fanerocotylar germination.

  12. ANATOMICAL ASPECTS OF DEVELOPMENT OF PINEAPPLE GUAVA FRUIT [ACCA SELLOWIANA (O.BERG BURRET] ASPECTOS ANATÓMICOS DEL DESARROLLO DEL FRUTO DE FEIJOA [ACCA SELLOWIANA (O.BERG BURRET

    Directory of Open Access Journals (Sweden)

    Mariela Rodríguez

    2010-06-01

    Full Text Available An anatomical study of feijoa fruits was carried out with the purpose to describe the anatomical changes in the fruit starting from floral bud until the physiological maturity. In order to realize the description, fruit samples of different sizes from clones 41 (Quimba and 8-4 were taken and histological techniques were applied. The samples were fixed in FAA, after which it was made the inclusion process, it has stages of dehydration, infiltration and inclusion, finally, was made the cut and assembly of the samples with fast- green and safranin. The observations showed that cells of the exocarp and endocarp presented cellular multiplication until advanced stages of development. The mesocarp had an important increment in volume, mainly due to the cellular multiplication at the first and second stages of development and cellular expansion at the last stage of development. One important conclusion was that feijoa fruit is stable anatomically because the tissues observed in the floral bud maintain its identity until when the fruit reaches the physiologic maturity. From the anatomical point of view, the final size of the fruit depends on the continuous cellular multiplications that suffer these tissues and to the cellular expansion in the stage of fruit filling. By microscopic observations it was concluded that the exocarp of the fruit is composed of the outer epidermis and hypodermis, the mesocarp is composed of many layers of parenchyma, the endocarp is formed by the inner epidermis and three or four layers of subepidermal cells in both clones .Se realizó un estudio anatómico de los frutos de feijoa con el propósito de describir los cambios anatómicos desde capullo floral hasta la madurez fisiológica. Para realizar la descripción, se tomaron muestras de los frutos de diferentes tamaños de los clones 41 (Quimba y 8-4 las cuales se trataron con técnicas histológicas. Las muestras se fijaron en FAA, después de lo cual se realizó el proceso de inclusión que tiene las etapas de deshidratación, infiltración e inclusión, finalmente, se realizó el corte y montaje con safranina fast-green. Las observaciones mostraron que las células del exocarpio y el endocarpio presentaron multiplicación celular hasta avanzadas etapas del desarrollo. El mesocarpio tuvo un incremento importante en el volumen, debido principalmente a la multiplicación celular en la primera y segunda etapa del desarrollo y, a la expansión celular en la última etapa del desarrollo. Se concluyó que el fruto de feijoa es estable anatómicamente porque los tejidos observados en el capullo floral mantienen su identidad hasta cuando el fruto alcanza la madurez fisiológica. Desde el punto de vista anatómico, el tamaño final del fruto depende de las continuas divisiones celulares que sufren estos tejidos y a la expansión celular en la etapa de llenado del fruto. Con las observaciones microscópicas se concluyó que el exocarpio del fruto está conformado por la epidermis externa y la hipodermis; el mesocarpio está constituido por numerosas capas de parénquima; el endocarpio está constituido por la epidermis interna y tres o cuatro capas de células subepidérmicas en ambos clones.

  13. Intensidade de ataque de tripes, de alternaria e da queima-das-pontas em cultivares de cebola Intensity of attacks of thrips, purple blotch and gray mold on onion cultivars

    Directory of Open Access Journals (Sweden)

    Germano L.D. Leite

    2004-03-01

    Full Text Available Avaliou-se a intensidade de ataque de Thrips tabaci Lind., a incidência de Alternaria porri (Ellis e Botrytis squamosa J.C. Walker em nove cultivares de cebola [Aurora, Primavera, CNPH 6400, Crioula Alto-Vale, Vale-Ouro (IPA 11, Franciscana (IPA-16, Piraouro, Conquista e Serrana], num experimento no delineamento em blocos casualizados com cinco repetições. Foram feitas avaliações semanais, do transplantio até a colheita, em dez plantas/parcela do número de T. tabaci presente na bainha das folhas bem como da percentagem de área foliar danificada pelo mesmo a partir da primeira folha expandida e também da presença ou da ausência de lesões causadas por A. porri e B. squamosa. A cv. Franciscana mostrou-se mais resistente em relação às demais ao ataque de T. tabaci. Não houve diferença significativa de plantas afetadas por A. porri e B. squamosa. T. tabaci e A. porri foram ambos afetados positiva e negativamente pela temperatura e pela umidade relativa do ambiente, respectivamente.The intensity of attack of T. tabaci and incidence of Alternaria porri (Ellis Cif and Botrytis squamosa J.C. Walker in nine onion cultivars [Aurora, Primavera, CNPH 6400, Crioula Alto-Vale, Vale-Ouro (IPA 11, Franciscana (IPA-16, Piraouro, Conquista and Serrana] was evaluated, in an experiment in randomized blocks design, with five replications. Weekly evaluations were done from the transplanting until harvesting date, in ten plants/parcel of the number of T. tabaci on the leaves, the percentage of damaged foliar area from the first expanded leaf up and the presence or absence of injuries caused by A. porri and B. squamosa. The cv. Franciscana was more resistant to the attack of T. tabaci in comparison to the other onion cultivars. There was no significant difference between cvs for A. porri and Botrytis squamosa resistance. T. tabaci and A. porri were influenced positively and negatively by temperature and relative humidity, respectively.

  14. Luchas y reivindicaciones de los Yanaconas en las haciendas de la sierra piurana en los años 1934-1945

    Directory of Open Access Journals (Sweden)

    1991-01-01

    Full Text Available LUTTES ET REVENDICATIONS DES YANACONAS DANS LES HACIENDAS DE LA SIERRA DE PIURA DE 1934 A 1945. En 1934 la lutte des yanaconas commence dans la sierra de Piura quand ils exigent une amélioration et une réglementation de leurs conditions de travail dans les haciendas. Des membres du Parti Socialiste du Pérou conseillent les colonos et appuient leurs revendications. Les paysans des haciendas dirigent leurs réclamations à l’Inspection Régionale du Travail pour obtenir une solution aux conflits entre colonos et propriétaire de l’hacienda. Les documents étudiés permettent de connaître le système laboral des haciendas serranas. En el año 1934 se inicia la lucha de los yanaconas de la sierra de Piura exigiendo el mejoramiento y la reglamentación de sus condiciones de trabajo en las haciendas. Miembros del Partido Socialista del Perú apoyan y asesoran a los colonos en sus reivindicaciones. Los campesinos de las haciendas dirigen sus quejas mediante pliegos de reclamos a la Inspección Regional de Trabajo para obtener una solución a los conflictos entre colonos y patrón de hacienda. El material analizado permite conocer el sistema laboral vigente en las haciendas serranas. STRUGGLES AND CLAIMS OF THE YANACONAS IN THE PIURAN HIGHLAND HACIENDAS DURING THE YEARS 1934-1945. During 1934, the yanacona struggle begins within the Piura Highlands, demanding labor improvement and a fair ruling of the working conditions in the haciendas of the area. Members of the peruvian socialist party supported and advised all peasants over their claims. These people address their complaints to the Regional Working Inspectory in order to obtain a final solution to their labor conflicts. The study of such documents let us learn about the working system in the Highland Haciendas at that time.

  15. National Dam Safety Program. Junior Lake Dam, (MO 11526) Missouri - Kansas City Basin, Callaway County, Missouri. Phase I Inspection Report.

    Science.gov (United States)

    1980-10-01

    Lake, Dam Inspection, Private Dams 20 AWTACT (Ce ffm ew - m*1et N naeey ad identfy by block number) This report was prepared under the National Program...cO r " 7 - IM-.r Il: r’ o .rrr4 QM zc PLT DL1 ~OC.4..NW to~.. c pz acca ~ ~ ~ 0 AaO cr~c 0000000000 ca~cc 0 NOCC~C ~ j...a ~ in =o ,0 0 00 O 0~ co

  16. Low-Speed Wind Tunnel Test on Joined Wing and Monoplane Configurations. Volume 1. Analysis of Results.

    Science.gov (United States)

    1982-02-01

    monoplane, with no sign that tis a max-mum. Trirned CLax comparisons are i’:en in g. 2O. 70 o.g- 0.2- 0.0- -o.2- G8WHD v+ 7s- PL’Ns 36 f7 L I I I I I I L... ACca equal to approximately 70% of that given by the vertical tail of configuration BUHDV. This is much more than would be expected from the relative

  17. An Experimental Investigation of Computer Program Development Approaches and Computer Programming Metrics.

    Science.gov (United States)

    1979-12-01

    8217 S A Air Force Office of Scientific Research/NM , Dccec f7 / Bolling AFB, Washington, DC 20332 N’" - E -E . 150 __" 74 MOJ’jT tRING AGENC NAME A...55t -3 O 2 a. tL loco o.uaZ 4 1 0 0 - .. a .CO acca 4 * ao -- c- - .an za-e~a- 2.5 aa34z98ba a- CHAPTER VII coipletely differentiated outcome is

  18. Microcomputer-Assisted Flow-Through ASV System.

    Science.gov (United States)

    1979-09-01

    FXVAL AND LPTNO,LXVAL *RETURN I-TRUE 0-FALSE IN ACCA *T VALUE ON LINE IS LEFT IN Y 0390 FE 0033 D AELINE LDX FPTNO /GET Ti 0393 09 DIX 1ST Y VALUE 0394...64D6 9 DEX 04D7 26 F3 04D4 SNE CLSA1 04D9 39 RTS *SAVE THE INTEGRATION RESULTS IN PROPER BUFFER ***** ** *** k******* 04DA 36 6633 D SAYRES LDAA ELN

  19. Modeling and Simulation of Avionics Systems and Command, Control and Communications Systems

    Science.gov (United States)

    1980-01-01

    CONDITIONS: ALL BEGIN IN THINK STATE _ ~(2) - F6 w 4(3) NTm35 E(RT)98.246 4 (1 -4-0NT a25 E’(RT) 3.415 L0 1OO 200 300 400 500 600 700 800 900 NUMBER OF...vibrations ou acca - llretions, Li En offet. is vol tactique tel qua le pratique l’Armle de Terra Frangalse, consiste A4 valer au plus prls du sal (hauteur

  20. Proceedings of the Technical Forum (3rd) on the F-16 MIL-STD-1750A Microprocessor and the F-16 MIL-STD-1589B Compiler Held at Wright-Patterson AFB, OH on May 5-6, 1982. Volume 1. Papers,

    Science.gov (United States)

    1982-05-06

    BUS MKS Fucioa Diagram ~ALAOAR *RSAU TT E E 0E U D*iQ MKSXQ16 Microinstruction Word 1 ~ ~5 .6 a7 . 6 1 1,I 1,. 151li "" SP*D ACCA CONTROL JASNTJ EX...result CALLSF 4F FA Call with ID in register GETSID 4F F9 Get re-time ID of function Data Forwarding FWD 4F F6 Forward integer DFWD 4F F5 Forward

  1. Regional Employment Growth and Defense Spending.

    Science.gov (United States)

    1987-12-01

    important part of regional growth. UI ACCA 9o1n For ’NDis i - Dljt s i-: . TABLE OF CONTENTS I. INTRODUCTION .. .. .. .... ..... .... .... .... ..... .. 7...Mideast and Great Lakes, all show spending to taxation ratios of less than one on a per capita basis, yet the Southwest and Rocky Mountain states have...because businesses look beyond the obvious nominal rate and locate according to effective rates of taxation , ie. actual tax liability. In addition, tax

  2. JPRS Report Science & Technology China.

    Science.gov (United States)

    1989-04-18

    revenue preferences for new products will be changed from a uniform exemption from taxation to either tax reduction or exemption. There will be...planning" and coordinating work of departments of S&T, finance, banking, and taxation to arrange for the input and matching of funds. This is the way...0081] of the Department of Virology, Xi’an Medical University] [Text] An ACCA -ELISA (IgA complex capture assay) method was established to detect

  3. Analysis of Central Design Agency Alternatives for Navy Industrial Fund Accounting Systems: A Proposed Methodology.

    Science.gov (United States)

    1980-03-01

    Postgraduate School ANA01611I NM61"fa Monterey, California 93940 1 CON TROLLING OFFICE NAMC &NO Accaes ii uOmvo*a Naval Postgraduate School March 1980...judge alternative 3, it is further recomended that the Naval Audit Service, private contractor or other independent agent be comissioned to perform an in...Government Accounting, Government Accounting, Auditing , and Financial Reporting, Chicago, Municipal Finance Officer’s Association, 1968, p. 3-4. 4

  4. Installation Restoration Program. Phase 1. Records Search, Lackland AFB, Texas

    Science.gov (United States)

    1985-02-01

    governmental environ- mental projects. Environmental Engineering Department Head (1973-1976). Supervised staff involved in auditing environmental practices...V. -4 a a ; to- w w M, 4-. c* a a M - ~ a -- ~= a a a a a aa as-au ’- aC aCca - ~~~ - aa:0 a 0 24 X4 JU 2 a -- a. -~a - .wZ 2kD.4 4 ob0 m C C w 4a

  5. Sensorimotor Interactions in the Haptic Perception of Virtual Objects

    Science.gov (United States)

    1997-01-01

    the human user. 2 Compared to our understanding of vision and audition , our knowledge of the human haptic perception is very limited. Many basic...modalities such as vision and audition on haptic perception of viscosity or mass, for example. 116 Some preliminary work has already been done in this...string[3]; *posx="x" *forf="f’ *velv="v" * acca ="a" trial[64]; resp[64]; /* random number */ /* trial number */ /* index */ /* array holding stim

  6. The Expert Infantryman Squad and Platoon Evaluation (EISPE) I Concept: Evaluations and Observations

    Science.gov (United States)

    1977-12-01

    specific perforanc•a test imetditelv following the roa’ &.:-rch requires the Infantryman to show he r n still function AccA .-’a\\;ifter the stress of...weighed against thn cost of devoting an hour or two of valuable testing time to this activity. Similarly, it is debatable whether tre coordinated...the objective effective? (9) Was withdrawal free the objective rapid and organized? (10) Was everyone accounted for at the oojective raily point? (11

  7. A Proposed RTN Officer Performance Evaluation System

    Science.gov (United States)

    1989-12-01

    Taa& No. WokI Unlit Acca ~def 11¶. TITLE (biclde Securiy ClassifiCation) A PROPOSED ROYAL THAI NAVY OFIICER PERFORM NCE EVALUATION SYSTEM 12. PERSONAL...all aspects of performance into account , the commanding officer uses his opinion to decide who is "the best." There are no standard guidelines for...ftequently used in orgunsadozn as a bais for adminiardstive decisions such as employee promotion., tuufer, and allocation of financial reward; employee

  8. The future of financial reporting 2013 : still grappling with major problems.

    OpenAIRE

    Jones, M.; Slack, R.E.

    2013-01-01

    A discussion paper based on the British Accounting Association Financial Accounting and Reporting Special Interest Group (FARSIG) Colloquium, 11 January 2013. ACCA was pleased to host again the FARSIG annual discussion of the future of financial reporting. The meeting continues to provide a valuable discussion between interested parties – principally academics studying financial reporting and those involved with its practical application in way or another. The line of speakers this year re...

  9. Detecção de Meloidogyne enterolobii em mudas de amoreira (Morus nigra L.

    Directory of Open Access Journals (Sweden)

    Vanessa dos Santos Paes-Takahashi

    2015-05-01

    Full Text Available O comércio de mudas sem certificação contribui para disseminação de pragas e doenças, que podem causar sérios danos às plantas cultivadas. Na região de Itapetininga (SP, foram apreendidas, pela equipe da Defesa Agropecuária, mudas de aceroleira, goiabeira e amoreira, comercializadas em caminhões, que apresentavam galhas nas raízes, sintoma típico causado por Meloidogyne spp. A identificação da espécie foi feita através da morfologia da configuração perineal de fêmeas e região labial de machos, bem como através da caracterização do fenótipo enzimático de esterase. Foi constatada a presença de M. enterolobii nas amostras analisadas. Trata-se do primeiro relato do parasitismo de M. enterolobii em mudas de amoreira no mundo.

  10. Technical Papers Presented at the Defense Nuclear Agency Global Effects Review. Held at Moffett Field, California on 25-27 February 1986. Volume 1.

    Science.gov (United States)

    1986-05-15

    0.4 -4 -4.4 >1 -1 1% ~~~ 404EDCE doa- -4 -4 -45 ti ahEEED U.,~ U2. 44d 0 00.) ) 41 to0 4 V AJJV a09 00 go W Ac AC ACca .04J0.0 .0WhO >J413W...SCIENCES CORP ATTN MAJ GEN HJCOATES ATTN: M KAPLAN ATTN P PROSSER TECHNOLOGY INTERNATIONAL CORP BRITISH DEFENCE STAFF ""ATTN. W BOQUIST ATTN C FENWICK

  11. Reliability-Based Performance Assessment of Damaged Ships

    Science.gov (United States)

    2006-10-01

    37OR.A 2 AceI 2 oce 3 3C7R Main Deck Plan View at 9.906 metre STAA T~SIc ACCa IC 111 tI RO MAO ’ 2 0004 M 3O m 3 STORES) me 3 1 002~s STOR1 PfIS PlnVIS...Vol. 15, pp.7 4 -9 3 . Kaplan , M. Benatar, M., Bentson, J., Achtarides, T.A. (1984). "Analysis and assessment of major uncertainties associated with

  12. Final Evaluation Report on Fort Ord Project VOLAR

    Science.gov (United States)

    1978-04-04

    I%.p 4 .; .* . . . . .. .¾ 1. ...i ....j ... -4- tlVt ’,J~f ’..~ flt~UUf~jitf F7 ____ I -U- I- F ?. ;.’ 1777 I. I t:t:.. ’*1** I’ . It: 9...GENER4AL i POST ENV!RONMET fT .4 , h ,,. f avn an 31 :-12 4 two $000 tort Cd la󈨢 1.0-01 acca -O 2 :-g::2: 5~:4: BIih, Post’s Progress ri 1npuun 32 1

  13. Role of the Neddylation Enzyme Uba3, A New Estrogen Receptor Corepressor, in Breast Cancer

    Science.gov (United States)

    2005-05-01

    University School of Medicine, 302 Jordan Hall, 1001 East activates SCF( f3 (TrCP))-dependent ubiquitination of Third Street, Bloomington, Indiana...is essential for SCF( f3 -TrCP)-mediated ubiquitination ety Research Grant TBE-104125 (to K.P.N.), the Walther Can- and processing of the NF-K B...Nawaz Z, Lonard DM, Dennis AP, Smith CL, O’Malley BW position 3997, within the intron); reverse primer, 5’- ACCA - 1999 Proteasome-dependent degradation of

  14. Technical Considerations for Improvement of USAF Operational Training, Testing and Evaluation (OTT and E)

    Science.gov (United States)

    1975-06-30

    L LJ C9 - aCCa C= co =mp XE 0 a aLa C~= =b & -JA 0’-𔃺 z - -Lai’ = WE w.. _A oMac G = cm - cc0j -0, e 125 The total instrument error is a combination...C77 C/) V-C) r:C 7:C-) 0.. C:) f3 . C-) cC./) C) F-I = LU LUJ CAC: peripheral firmware devices. Any well defined process can and should be done by a

  15. Radiation by Sources on Perfectly Conducting Convex Cylinders with an Impedance Surface Patch.

    Science.gov (United States)

    1980-01-01

    U -- = - (a to0 . 0 0 m 4- 0 4- 04 0-0 1 - .0 4’ U-- ~4- 4 0 n4- -- C_ to S~0- 4J C >1 cu S)-0’ (0 C 0)~ 00 =3 .r aCCA 50 It is observed from these...by such a source has only a z-component and it will be denoted by H . H satisfies the reduced, inhomo- geneous wave equation, and the f6 1llowing

  16. Carbon reduction in the NHS : a role for finance

    OpenAIRE

    Brown, Steve

    2009-01-01

    HFMA briefing sponsored by ACCA NHS bodies’ performance on carbon reduction is increasingly having an impact on annual audit assessments, and a new energy efficiency scheme, involving the purchase and trading of carbon emissions allowances, will provide real financial consequences for under or over consumption of carbon. But perhaps the biggest driver for the finance community is the fact that carbon reduction should in fact help them meet their key challenge – the need for efficienc...

  17. General Urban Warfare Amphibious Logistics Applications. Volume 2. Operations Plan.

    Science.gov (United States)

    1983-06-23

    accordance with Joint Uniform Military Pay System procedures. (3) Control of Financial Institutions. See Force 0 7200.1. (4) Inspection and Audit . Conducted...1CA -- z; a ex r-- - C.’ on~ oCa a 10. 6 Z OZOOOOO 0 0.CCi- ~~flflfl1 Ce aA~ aC0i0SCCS- do.C. m ca f Cit U - CaS.Li CCL*n 0LLaJ ACCA CU ZC CS. . C CA

  18. The Human-Electronic Crew: Can We Trust The Team?

    Science.gov (United States)

    1995-12-19

    prevent false trust being engendered in imperfect adaptive aiding. Audit data of teamwork quality are presented based on a model of teamwork goals...ability to auccmssfallycomp~let k thsks; Acca ¢ry - Accracy of own perform•nce on thw tasks with 1wc aidthen fully automated (Co-op 1). In a second co...to validate the model was conductedI by Taylor & Selcon (5), who used a TEAM RESOURCES teamwork audit technique requiring subjective estimates on 20

  19. A Further Look Into The Integration of Strategic Business Sustainability and the Communication of Business Sustainability Beyond Reporting

    OpenAIRE

    Lew, Stephen Joo Wei

    2015-01-01

    There has been continuous growth in the area of sustainability reporting globally, and in the ASEAN region, Malaysia has been found to have the distinction of being the country with the highest number of sustainability reports produced. This growth is in part due to firms attempting to address the ever evolving relationship between businesses and its stakeholders over the decade which has given rise to a variety of ethical, economic, social, and even environmental challenges (ACCA, 2010; Carr...

  20. Automatic cloud coverage assessment of Formosat-2 image

    Science.gov (United States)

    Hsu, Kuo-Hsien

    2011-11-01

    Formosat-2 satellite equips with the high-spatial-resolution (2m ground sampling distance) remote sensing instrument. It has been being operated on the daily-revisiting mission orbit by National Space organization (NSPO) of Taiwan since May 21 2004. NSPO has also serving as one of the ground receiving stations for daily processing the received Formosat- 2 images. The current cloud coverage assessment of Formosat-2 image for NSPO Image Processing System generally consists of two major steps. Firstly, an un-supervised K-means method is used for automatically estimating the cloud statistic of Formosat-2 image. Secondly, manual estimation of cloud coverage from Formosat-2 image is processed by manual examination. Apparently, a more accurate Automatic Cloud Coverage Assessment (ACCA) method certainly increases the efficiency of processing step 2 with a good prediction of cloud statistic. In this paper, mainly based on the research results from Chang et al, Irish, and Gotoh, we propose a modified Formosat-2 ACCA method which considered pre-processing and post-processing analysis. For pre-processing analysis, cloud statistic is determined by using un-supervised K-means classification, Sobel's method, Otsu's method, non-cloudy pixels reexamination, and cross-band filter method. Box-Counting fractal method is considered as a post-processing tool to double check the results of pre-processing analysis for increasing the efficiency of manual examination.

  1. Unidades de conservação, Legislação ambiental e a APA Petrópolis

    Directory of Open Access Journals (Sweden)

    Julieta Laudelina de Paiva

    2010-12-01

    Full Text Available As unidades de conservação são criadas com o objetivo de manter a diversidade biológica, proteger espécies ameaçadas de extinção, preservar e restaurar ecossistemas naturais. A Área de Proteção Ambiental da Região Serrana de Petrópolis – APA PETRÓPOLIS, primeira APA federal, foi criada por apresentar rica biodiversidade além de ter seus atributos naturais relativamente bem conservados. A população residente na APA Petrópolis está submetida ao cumprimento de várias determinações legais nos três níveis administrativos.

  2. THE STRATEGIST THOUGHT: GRANTED FACTORS IN THE STRATEGIC DECISION MAKING OF THE SMALL AND MEDIUM ENTERPRISES DOI: 10.5585/riae.v8i2.1641

    Directory of Open Access Journals (Sweden)

    Werner Duarte Dalla

    2009-12-01

    Full Text Available The organizational behavior is linked to the strategic decision-making, carried through its main decision-makers, called "strategists". This behavior, in organizational daily actions or planning, shifts its performance to consider market and tangible and intangible resources. The present study aimed to contribute in the understanding of how these actors formulate their strategies, build their heuristics, to manage their firms to improve organizational performance. The RepGrid - Repertory Grid (Kelly, 1955 was chosen as the method, which was undertaken with the Small and Medium Enterprises (SMEs owners of the footwear area of a relevant cluster production of Nova Serrana-MG - Brazil. The results appointed agent factors of attention, which centralize the decision in the managers or owners, base on financial results, asses actual internal factors so that external sales, and lead to a emergent and less formalized process.

  3. Germinación in vitro de polen de feijoa (Acca sellowiana Berg

    Directory of Open Access Journals (Sweden)

    Mavel Hernández

    2011-02-01

    Full Text Available Actualmente no existen estudios de viabilidad y caracterización del grano de polen de Feijoa, ante lo cual la cantidad y calidad del polen producidos por una flor, son aspectos importantes en estudios evolutivos y de adaptación de genotipos. Así, se determinó la solución germinativa adecuada para realizar pruebas de germinación in vitro, mediante pruebas de las siguientes soluciones:agua, agar, agua + sacarosa 5%, agua + sacarosa 10%, agar +sacarosa 5% ý agar + sacarosa 10%, ante lo cual, en la solución germinativa compuesta por agar y sacarosa al 5% se registró el mayor porcentaje de germinación de granos de polen en el tiempo. Se efectuó la prueba de fertilidad del polen para los dos clones por medio del método de tinción con azul de lactofenol en tres estados de apertura floral E1 (pétalos visibles, E2 (sépalos desplegados y E3 (pétalos maduros, presentando 100% de tinción del total de granos observados por estado de apertura floral. Se realizaron pruebas de germinación para los dos clones en los tres estados de apertura floral y se observó germinación en el clon 8-4 a las 10 horas después de la siembra para el estado E3, alcanzando un alto porcentaje de germinación (80%, mientras que los otros dos estados no germinaron en el tiempo de medición establecido. En el clon 41, la germinación inició a las 10 horas después de la siembra para el estado E2 ý a las 12 horas para el E3, mientras que el E1 no germinó. Los estados E2 y E3 alcanzaron 80% de germinación aproximada 16 horas después de siembra.

  4. Warsaw Pact: The Question of Cohesion. Phase II, Volume 2. Poland, German Democratic Republic and Romania,

    Science.gov (United States)

    1984-11-01

    integrated with the other members of the system. AccA ~zsiorj For -TAB -. f tion Ile r Cods mt/ori 2// ,a ft1 ___"-.- i ’ ,:,, un:ocl [] R9SUM9 Le...4. 100 Eugeniusz Walczuk, "Oficerowie, Polityka, 29 April 1972, pp. 1, 4-8. 101 Hinterhoft, "Armia Rokossowskiego." 102 Karel Kaplan , Rada vzajemne...and L.S. Kaplan , eds., The Warsaw Pact: Political Purpose and Military Means (Wilmington, Del.: Scholarly Resources, Inc., 1982), p. 149. 4 The

  5. Observations of Near-Bottom Flow in a Wave-Dominated Nearshore Environment.

    Science.gov (United States)

    1994-02-01

    E 0 0 0 ~- X : (- 1.. pI m~ ffm ~o .pcr onf> ..... X • -- E X/• x,. "£ "*.. . .. . 0o 0 0 a c c ,(s0wO) (S/PH w) (SlUwo) . 7109 I 3 I Mean of LDV...1 I 8250 ASM X,ANDA #&HBF :REM 0000 OXXX ACCA 8260 ASM X,ANDB #&HBF :REM 0000 1XXX ACCB 8270 ASM X,STAB &H17 :REM /CS=0 3 8280 ASM X,STAA &H17 :REM

  6. Proceedings of the Conference on Viscous Effects in Turbomachines Held at Copenhagen, Denmark on 1-3 June 1983.

    Science.gov (United States)

    1983-09-01

    fluide-parfait via A vis de petites perturba- tions des conditions eux limitey. Catte approximation donne accas aux coefficients d’am- plification de...cascade (Reference 3). The current invisaid-viacous method is unable to predict the lead- ing edge f7 . in sufficient detail to set up the correct...Crtrquel Pwvl inftivwe Perem~tr deifp r at coefficiet do frottenent m’w. 20 1.4 mob iwgt-Ieu Flo. F7 - Interaction dane un oanal dkwyn* -. PeOW mtlawa

  7. Role of Hunk and Punc in Breast Cancer and Mammary Development

    Science.gov (United States)

    2001-08-01

    develop- (C/T)(C/T)-3’) and PTKIIa (5’-CCCGGGGAATTCCA(A/T)AGG- ment, suggesting that these molecules may be important ACCA (G/C)AC(G/A)TC-3’), have...actin in order to correct for these As an initial control, Northern blots were hybridized dilutional effects. with probes for the genes encoding f3 ...scale increases in milk protein gene expression during late pregnancy and lactation. Expression levels normalized to f3 -actin are shown relative to

  8. National Dam Safety Program. Lake Wanda Dam (NJ00510), Hudson River Basin, Tributary to Wawayanda Creek, Sussex County, New Jersey. Phase 1 Inspection Report.

    Science.gov (United States)

    1980-03-01

    8217 7rA’Al’A𔄀 /O’ 3 4 5 $-eS 7W# 55 Af1--7;72 6 10 12 - . . . . . ... . . . . . .’ . . .. 13 l 14 15 £ F6 3I f’f . 16 A6 18 19 200 _.._. . . . .. . . . 21’ 22...191, ~ C! . .. .. C.C C C L. C . C W .C . . . .C .C . . . .C .C . . . . .C . C . C C. . C . C 4 4 . . . a CC aa acca a aa aa C C

  9. Atmospheric Triatomic Molecular Studies.

    Science.gov (United States)

    1980-11-17

    ADORE.SS(Jf dlII.,.nt tra 05), tivl 15, SECURITY CLA’.SS. (of this rwpofl) __ 1 P7 jl / 15&. DECLASSJFI CAT DJGft*114I1 -J SCmEDULE If- DiSTRIBUT ION...work in Table I are given in Appendix I. I (3) 41 S. - I + t/n LU ) *C14~ & c .) a)Z. W i 0 0 uL a) NCDNN N 0 4-3 0) cl b -4 cu a x of acca Lm %- a

  10. The Training and Employment of Area Specialists in the Military

    Science.gov (United States)

    1989-06-01

    Unit Acca =o N I1. Title (Include Security Classification) The Training and Employment of Area Specialists in the Military 12 Personal Author(s) Randy P...informally allows FAOs at DLI/FLC to audit courses if they so desire yet there is no obvious effort underway to reverse the Army’s earlier deci- sion...NPS profes- sors. Others cannot even find the time to audit any classes and often turn to magazines at DLI/FLC and/or NPS for their information. Given

  11. Department of Defense In-House RDT and E Activities

    Science.gov (United States)

    1972-10-30

    be WW". w 1.-- wW"A.44444U .5. W0W O4 .we 0.-.e𔄃.-4 j00 W.~ 400 0 4C 04 zI- z z U . 4A 444 LL) ACCA w " 6 0491. > 0 .W.-W 4 0 K W u x4 " W- h 6l.0~s...AND APPLIED RESEARCH IN jUBMARINE AND DIVINU MEDICINE, CLOSED ENVIRONMENTS INi AREAS OF PHYSIOL. MEDICAL PSYCHOL.VISION AUDITION HUMAN FAC.ENG

  12. Local Irritation Toxicity Study of Hypertonic Saline/Dextran 70 (Trade Name) and Constituents in New Zealand White Rabbits

    Science.gov (United States)

    1988-12-01

    34 Toxicology Series 244, was audited on 21 November 1988. CAROLYN M. LEWIS, MS Diplomate, American Board of Toxicology Chief, Quality Assurance vi TABLE OF...a aa O l-4 i)’ a a a Lia _ at . acca - ).a *a a a a ...j a0 ~ mal- a a 4 0. 4 a a a a I Da~ a a a o _a a a 0.a ~ a a a a ja a a a U a aa EA- a aa a- 0

  13. A Guide for the Perspective Navy Contractor

    Science.gov (United States)

    1991-01-01

    11. FAR 52.214-26, Audit -Sealed Bidding (APR 1985) (Applicable if award exceeds $100,000) 12. FAR 52.214-27, Price Reduction for Defective Cost or...services in acca . -ce itih theter_ s and conditions. (3) For progress payzents, Goer-ent arowa! shall be deenedd to have occurred on the 5the working day...the event that an audit or other review of a specific financing request is required to ensure compliance with the terms and conditions of the contract

  14. Better Oversight Needed for Safety and Health Activities at DOE’s Nuclear Facilities.

    Science.gov (United States)

    1981-08-04

    States Acca !3ion Tor Kl. ; BRA&I DTIC TAi \\ • inounced Jusl Lfii I "• ’ DiStril on/ r\\ D i Avai3 i - ’•ity Coi a j...m*d——I—^1 I —* Even DOE’s audit report tracking system failed to adequately document corrective actions taken or planned. This system was...designed by DOE to ensure that corrective actions on audit report recommendations are responsive, timely and complete. Audit re- ports, such as ours

  15. Fourteen-Day Subacute Intravenous Toxicity Study of Hypertonic Saline/ Dextran 70 (Trade name) and its Constituents in New Zealand White Rabbits

    Science.gov (United States)

    1989-11-01

    of Hypertonic Saline/Dextran 70C and its Constituents in New Zealand White Rabbits," Toxicology Series 248, was audited on 20 October 1989. CAROLYNM...at tA "e a .6 L C C o L a L Lm .. .. a. a4 1 . . ao 3.&ow2 aCCa .0 00 c -C a- 4;. *; a 0O .. t x.T 2Cu u . u uu0 0 Uc L 01 2.:4A.1 4xa&C -I - -N .CA -e

  16. Organization of an Oceanographic Data Bank for the Peruvian Navy.

    Science.gov (United States)

    1981-09-01

    pfrhedactsan for the ayfihte and orn potential users are presented.," Accas o n Tr IQOPY AI in-IIS P .. .. . .. . .. ... .a- iz- -- H DD Forr% 1473 2...been collected at high cost and1. effort for so many years is not centrali7ed and is, therefore, not readily available to potential users in Peru or...northward current that affected the route of the ships sailing between Panama and Callao. An excerpt fZarate, 15553, from the " Account of the Country

  17. Genetic diversity of tropical-adapted onion germplasm assessed by RAPD markers Diversidade genética em germoplasma tropical de cebola estimada via marcadores RAPD

    Directory of Open Access Journals (Sweden)

    Maria do Desterro M dos Santos

    2012-03-01

    Full Text Available Onion is a crop of significant socioeconomic importance to Brazil. Onion germplasm with adaptation to tropical and sub-tropical conditions has played an important role in the development of this crop in the country. In this context, we studied the genetic diversity in a germplasm collection potentially useful for the development of cultivars for tropical and subtropical regions. The genetic variability of 21 accessions/cultivars that have been used as germplasm and/or were developed by onion breeding programs in Brazil was evaluated via RAPD markers. The following accessions were included in the study :'Red Creole', 'Roxa IPA-3', 'Valenciana 14', 'Beta Cristal', 'Diamante', 'Composto IPA-6', 'Aurora', 'Bojuda Rio Grande', 'Alfa Tropical', 'Pêra IPA-4', 'Primavera', 'Belém IPA-9', 'Crioula Alto Vale', 'Conquista', 'Pira-Ouro', 'Vale-Ouro IPA-11', 'Franciscana IPA-10', 'Serrana', 'CNPH 6400', 'Petroline', and 'Baia Periforme'. From the 520 primers used in the initial screening only 38 displayed stable polymorphisms. They produced 624 amplicons, of which 522 (83.7% were monomorphic and 102 (16.3% were polymorphic. An average similarity coefficient of 0.72 was calculated among accessions based upon this subgroup of polymorphic amplicons. This allowed the discrimination of this germplasm collection into six groups with only one of them comprising more than one accession. The main group was formed by 16 accessions ('Diamante', 'Composto IPA-6', 'Aurora', 'Bojuda Rio Grande', 'Conquista', 'Pira-Ouro', 'Serrana', 'Vale-Ouro IPA-11', 'Baia Periforme', 'Primavera', 'Franciscana IPA-10', 'Belém IPA-9', 'Crioula Alto Vale', 'Petroline', 'Pêra IPA-4' and 'Alfa Tropical', for which the genetic origin (with few exceptions can be traced back to the variety 'Baia Periforme'. The populations 'Red Creole', 'Roxa IPA-3', 'Beta Cristal', 'CNPH 6400', and 'Valenciana 14' comprised a set of five isolated groups, showing genetic divergence among them and in

  18. Produção de bulbinhos de cebola em bandejas de isopor Production of onion bulb sets in styrofoam trays

    Directory of Open Access Journals (Sweden)

    Antonio Ismael Inácio Cardoso

    1999-10-01

    Full Text Available Com o objetivo de estudar a viabilidade de produção de bulbinhos de cebola sob ambiente protegido em diferentes tipos de bandejas de poliestireno expandido foram instalados dois experimentos. No primeiro, trabalhando com a cultivar Serrana, foram avaliadas três tipos de bandejas com diferentes números de plantas por célula: uma planta/célula na bandeja de 288 células, três a cinco plantas/célula na de 128 e cinco a nove plantas/célula na de 72 células. No outro experimento, testaram-se nove cultivares, semeadas somente em bandejas de 128 células com três plantas por célula. Utilizou-se o delineamento em blocos ao acaso com quatro repetições no primeiro ensaio e cinco no segundo, sendo cada parcela constituída por uma bandeja. Observou-se que quanto maior a densidade de plantio menor o tamanho do bulbinho (diâmetro e peso. O manejo adequado de adubações em cobertura pode viabilizar, tecnicamente, a produção de cinco bulbinhos com 1,3 cm de diâmetro (2 g por célula, na bandeja de 128 células. Quanto ao ensaio de cultivares, ‘Crioula’ da Agroflora, ‘Crioula’ da Granja Lotário e ‘Houston’ apresentaram 83%, 67% e 81% de plantas bulbificadas, enquanto que nas demais (‘Aurora’, ‘Baia Periforme’, ‘Brownsville’, ‘Petroline’, ‘Pira Ouro’, ‘Pirana’ e ‘Serrana’ obteve-se 100% de bulbificação. As principais vantagens na produção de bulbinhos em bandeja foram: uniformidade, ausência de plantas daninhas e de patógenos. É um sistema que pode ser útil aos viveiristas que tem entressafra de mudas nos meses de agosto a novembro, período de produção dos bulbinhos. Poderá, também, ser uma alternativa na produção de bulbinhos para conserva, no controle de qualidade de lotes de sementes e em programas de melhoramento de cebola.One objective was to study the production of onion Allium cepa L.. bulb sets in a protected environment in a seedling system with trays with different number of

  19. Cloning Sequencing and Structural Manipulation of the Enterotoxin D and E Genes from Staphylococcus aureus

    Science.gov (United States)

    1990-07-01

    Iandolo, J.J. and R.K. Tweten. 1988. Purification of staphylococcal enterotoxin. In. Methods of Enzymology, (N.O. Kaplan , S. Harshman, Eds.) volume 165...N C V 9 L G 0 K 1 S P A K I C T S N 0 149 "T7AACTGG&&C&hICG&clhht:7caflCATGTAATAa~aI ACca CAACaCAA 942 L K D G D K L Z L I G T P r D H K V N 0 H L..L

  20. Lightweight Towed Howitzer Demonstrator. Phase 1 and Partial Phase 2. Volume D1. Part 1. Structural Analysis (Less Cradle and System).

    Science.gov (United States)

    1987-04-01

    X4Cro 7WAW,"G9 N k Y,1i ACCA . 2 JVM ly y,- L OA.0 v roo*Ler t-OAD. FA’ A /"Fi./A/a. (" -A,E’ CNAiv*6:CP A/ ’r/O’,L C4A$4P&4R.* -1MAGC.T?D0 VI.3 Moon...M- S 3D = .. = ==-=== Version 1.1 02/01/85 LTHD muzzle brate thermal load - steel Load Case 1: Loads Node F x FFM - My

  1. Conference Proceedings on Ionospheric Modification and Its Potential to Enhance or Degrade the Performance of Military Systems Held in Bergen, Norway on 28-31 May 1990 (La Modification de l’Ionosphere et son Potentiel d’Amelioration ou de Degradation des Performances des Systemes Militaires)

    Science.gov (United States)

    1990-05-31

    20 kv)l SITr-OEOREIE CNIMED BEAMS f7 .S750 P.10OKW T- 0 pIeee - (3o km) (ref. VNHARMV, et Ai 1984) -F tgiur 2. Crossed-beam microwave laboratory chamber...Ta*l esoeici ht~tin the conditions dt.scussed in this paper, jccy a.% densities of 10-10 ca-. This affect prevents accaes tc densities of 10 -10 cam...Observed variations in the potential of the DMSP F7 satellite (lower curve) and the background plasma density (upper curve) (17) LABORATORY SIMULATION OF

  2. Effect of the Ionosphere on Space Systems and Communications Based on the 1975 Ionosphere Effects Symposium Held in Crystal City, Arlington, Va. January 20-22, 1975

    Science.gov (United States)

    1975-01-01

    proportionate graphic and magnetic equator is needed to ratio method,. the results from both techniques achieve a diurnally stable acca "racy. Such a are combined...of a component array in the summations of the 02 contribufion would add a small (9a), (9b), and (12) are the auto- component of k6 or f6 . This...and about a 10% component of f6 fre- electronically small scatterers and far quency dependence may be present. field conditions sin2 (k/2)/(R2/2

  3. Andrea Caracausi e Antonio Conzato (a cura di) (2013). Formazione alla politica, politica della formazione a Venezia in Età moderna

    OpenAIRE

    Giani, Marco

    2015-01-01

    Il volume raccoglie gli Atti del Convegno svoltosi nel maggio 2011 presso l’Università di Padova, avente come tema «La formazione dei ceti dirigenti, o comunque eminenti, della Serenissima in Età moderna» (p. 7). Dopo una breve introduzione a cura di Giuseppe Gullino, apre le danze un frizzante intervento di Gino Benzoni («Le accademie e il tabù della politica»), il quale miscela il discorso storico propriamente detto sulle accademie in territorio veneto con i propri ricordi personali di acca...

  4. Digital Avionics Information System (DAIS): Development and Demonstration.

    Science.gov (United States)

    1981-09-01

    V) - >1 (a 4) cU C - 0 Va ’(1 ) 0 0A*4 (A4-. 4-) C (C (U~ LI) <: kn C V H 3 ) ACCA C 4-) eo V)C CC clO ca cy a: m2 cc co C )co 4) I--V( 0. 4- A a...Polling P 2 BCI Undefined Mode Coitriands P P 3 UCI MTU Shutdown Mode Lo"ands F 4 ULI Mude Commands With interrupts F(Note I) p 5 P7 Undefined Mode

  5. Foreign Military Sales between Thailand and U.S.

    Science.gov (United States)

    1982-06-01

    appointed by the President with the advice and consent of Senate for a term of 15 years. The audit authority of the GAO extends to all departments and...i»i<Mariu rui*i cutiv Cl»l» Prior To OaUwrf QB|Min<l«ala tn^rCAiiing X2X,XXX CU.UX TX-4 A# N/A M/A 2 ACcA i2M AMOVUvr 0« "Mfiav 9«𔃺«4r t XAX.ZXX

  6. Air Force Contract Management Division Aircrew Standardization and Evaluation: A Handbook for Government Flight Representatives.

    Science.gov (United States)

    1985-04-01

    and all boldface procedures. In addition, include questions from AFR 60-16 and AFR 51-37. Document all such testing on memos to provide an audit trail...your contractor to use simi 1 ar forms. They will provide a clear audit trail for both you and the STAN/EVAL Inspection Team. 22 Supervisory Evaluations...OS m(Mal-j Bedil, 8 72- 3930) 190~e~br1 BJFCTFor-%at of AFForms 8 Acca -mplished by SAC Exaxiners T:AF PRO/F0 (Dot 47) 1. Certificate:- of .%ircrew

  7. Final Environmental Impact Statement. Disposal and Reuse of Norton Air Force Base, California

    Science.gov (United States)

    1993-06-01

    auditory threshold shift of an individual’s hearing in an ear. Auditr -v threshold refers to the minimum acoustic signal that evokes an auditory sk...U I 1: 7 z c I I - ’ r b ACCA 04 W CO# II 00 0 0 00 I ~~3 1 - 7 K-7 \\ ~ ! I I U 0 IC a i| &l i lia U l - •I 00 a i°(AIM K -8 o b E,cg *’’S I I K-8 I

  8. Ten Propositions Regarding Space Power: The Dawn of a Space Force

    Science.gov (United States)

    2006-01-01

    perspective, space contributions z 97will account for an estimated $209 billion in 1947- 1950-T 1960-T 1970- 1980- 1990- the 2006 global economy. 2 4 50 60...Assessmu~t o ational awareiess, rhe transportation industry, A{,OaO{ dampaigns in 2010 and financial markers. 7TN PWOPSOI()S ] JWARII ’G SPA(E POWER 71...red, manner thot pmvteets one vital secnty intei blue, anI gray forces. The goal is rapid, acca - ests. We wil deter theati to our intrets, anid rate

  9. Proceedings of the 1980 Tri-Service Conference on Corrosion, 5-7 November 1980, US Air Force Academy, Colorado. Volume 1

    Science.gov (United States)

    1980-11-01

    10 RECENT rAILURE OF A FORCED DRAFT BLOWE.R METAL- LILED BEARING AcCA DURING A kUUTIN" SHOP BALANCING OF THE ROTATING ASSEMbLYP NAVSLASYSCCl...34 1.74 U14 D 1.2 E p H 0 . F8 A 0.6" T A 0.4’ C K T -I 0.8 0.01 0.05 0.2 38 DAYS S0 DAYS SULFIDE., m I 120 DAYS 148 Il t e AFWAL-TR-81 -4019 * Kj A a 4v

  10. A Numerical Model for the Computation of Radiance Distributions in Natural Waters with Wind-Roughened Surfaces, Part 2: User’s Guide and Code Listing

    Science.gov (United States)

    1988-07-01

    8217) END IF C..... SOLUTION STEP 9 C COMPUTE THE AMPLITUDE A(A.’) C CALL AMPAP c WERKY1) NOW COtJ1AINS ACCA ,’). THE kF.,ELTED DIRECT BEAM C C END OF...FUNCTID IN IS USED;’//, SIGMA(V.COS(PSI)) = )’Y)I(44PI) wHERE/fl 2’ IV V S(V) ALPHA(Y) S,/ALPH-A!) 102 FORMAT ( H 14, F8 .IF8 .3,FI10.3, FlI1.3 END 95 §5

  11. Analysis of the Air Force Logistics Enterprise. Evaluation of Global Repair Network Options for Supporting the F-16 and KC-135

    Science.gov (United States)

    2009-01-01

    Redford, NGB/A4R, Col Dave Whipple , ANG Advisor to AF/A4M, Col Tom Murgatroyd, ANG Advisor to AMC/ A4, and Col Chuck Melton, ANG Advisor to ACC/A4...necessary to support home-station operations. For more details on this calcula- tion procedure , see Appendix E. Based on our extension of these AMC KC-135... procedure discussed in this appendix. RAND’s source for UMD manpower authorizations data is the end-of-month MPES data extract, which we obtain from

  12. An Analytical Assessment of Assurance Practices in Social Environmental and Sustainable Reporting in the United Kingdom and North America

    Directory of Open Access Journals (Sweden)

    Annisa Melissa Manurung

    2010-01-01

    Full Text Available The objective of this study is to continue and extend previous studies in evaluating the extent to which current assurance practices promote transparency and accountability to stakeholders. This is carried out by conducting an empirical analysis of the content of assurance statements accompanying a sample of non-financial reports short-listed for the Association of Chartered Certified Accountants (ACCA U.K. Sustainability Reporting Award and the CERES-ACCA Sustainability Reporting Award from 2006 to 2008. The findings of this study show that several new trends in social, environmental and sustainability assurance can be observed. Firstly, accountants tend to limit their intended readership to management only and state a disclaimer for other potential readers. This diminishes the transparency and stakeholder accountability of the reporting. Secondly, there is even stronger evidence that management has the control over the scope of the assurance engagement and over what information gets publicly disclosed. The evidence is shown in the fact that in many assurance statements prepared by accountants, only selected parts of the reports are being assured, with no indication that it is not management who selects these parts. Finally, the recent practices of assurance engagements represented by the sample in this study have not improved the transparency and stakeholder accountability of social, environmental and sustainable reporting. Similar to the two previous studies, we assert that a generally accepted standard is needed to promote assurance statements that add meaningful values to the reliability of social, environmental and sustainability reporting.

  13. CARACTERÍSTICAS DE FRUTOS E GERMINAÇÃO DE SEMENTES DE SEIS ESPÉCIES DE MYRTACEAE NATIVAS DO RIO GRANDE DO SUL

    Directory of Open Access Journals (Sweden)

    Maria Estefânia Alves Áquila

    2004-09-01

    Full Text Available A família Myrtaceae é muito bem representada na flora do estado do Rio Grande do Sul, região sul do Brasil. Frutos e sementes de seis espécies foram examinados quanto ao tamanho, cor, massa, teor de água. As espécies são: Acca sellowiana (Berg. Burnet; Campomanesia guazumifolia (Camb. Berg.; Campomanesia xanthocarpa Berg.; Eugenia rostrifolia Legr.; Myrcianthes pungens (Berg. Legr. e Psidium cattleyanum Sabine. Avaliou-se o comportamento germinativo das sementes, tendo sido usada como substrato areia de rio autoclavada umedecida com água destilada, colocada em caixas gerbox (11 x 11cm nas temperaturas constantes de 15, 20, 25 ou 30°C ou na alternada de 15°C - 30°C, com 14 horas na temperatura mais alta. Os experimentos foram efetuados na presença e ausência de luz. Acca sellowiana, Myrcianthes pungens, Psidium cattleyanum mostraram sementes fotoblásticas positivas. Todas as espécies germinaram em noventa dias, exceto Campomanesia guazumifolia, que levou cerca de cento e cinqüenta dias. O conteúdo de água das sementes variou de 9% em Campomanesia guazumifolia até 68% em Myrcianthes pungens, ocorrendo sementes de intermediárias a recalcitrantes em relação à dessecação. Os embriões tipo eugenoide mostraram germinação criptocotiledonar, enquanto os embriões tipo mircióide e pimentóide apresentaram comportamento fanerocotiledonar.

  14. Características de frutos e germinação de sementes de seis espécies de Myrtaceae nativas do Rio Grande do Sul.

    Directory of Open Access Journals (Sweden)

    Cristina Magalhães Ribas dos Santos

    2010-08-01

    Full Text Available A família Myrtaceae é muito bem representada na flora do estado do Rio Grande do Sul, região sul do Brasil. Frutos e sementes de seis espécies foram examinados quanto ao tamanho, cor, massa, teor de água. As espécies são: Acca sellowiana (Berg. Burnet; Campomanesia guazumifolia (Camb. Berg.; Campomanesia xanthocarpa Berg.; Eugenia rostrifolia Legr.; Myrcianthes pungens (Berg. Legr. e Psidium cattleyanum Sabine. Avaliou-se o comportamento germinativo das sementes, tendo sido usada como substrato areia de rio autoclavada umedecida com água destilada, colocada em caixas gerbox (11 x 11cm nas temperaturas constantes de 15, 20, 25 ou 30°C ou na alternada de 15°C - 30°C, com 14 horas na temperatura mais alta. Os experimentos foram efetuados na presença e ausência de luz. Acca sellowiana, Myrcianthes pungens, Psidium cattleyanum mostraram sementes fotoblásticas positivas. Todas as espécies germinaram em noventa dias, exceto Campomanesia guazumifolia, que levou cerca de cento e cinqüenta dias. O conteúdo de água das sementes variou de 9% em Campomanesia guazumifolia até 68% em Myrcianthes pungens, ocorrendo sementes de intermediárias a recalcitrantes em relação à dessecação. Os embriões tipo eugenoide mostraram germinação criptocotiledonar, enquanto os embriões tipo mircióide e pimentóide apresentaram comportamento fanerocotiledonar.

  15. Proceedings of the AMEDD Clinical Psychology Short Course (1987): Military Applications of Neuropsychology and Health Psychology Held in San Francisco, California on 9-13 March 1987. Volume 2.

    Science.gov (United States)

    1987-07-01

    If. I. Kaplan , & B. J. Sadock (Eds), Comprehensive textbook ofpsychiatry (Vol. 2, 2nd ed ). Baltimore, Md.: Williams & Wilkins, 1975. Lipowski, Z. J...ratat ion was t hef vr t aormod. arcma~r>.a -Xtr lct-d whicn acca "Inted f ai b3 -a t.vranc- a" ’fa is t (:a01.’aa0 -a nt v",’,Sc Ca:11) isa a:, ta n...Professional Psychology: Research and Practice, 17, 514-518. -- __ Hare-Must in, R. T., Marecek, J., Kaplan , G., & Liss-Levinson, N. (1979). Rights of

  16. Listing of Army Fuel-Consuming Nonautomotive Ground Support Equipment.

    Science.gov (United States)

    1981-08-01

    W Z(55I(00W(.J...J0((55(5 X55(S NNN. .6uu m xv~ 00d0. . -z 00 0 0a0 e~ W 0 0 1fl 0 40.28 QUf0=Q lS59uuIIIII 4 a a acca N0QgI %q c a It, 4t 0 0 0 - !3...ATDO-S FORT MONROE VA 23651 DIR US ARMY MATERIALS & MECHANICS CDR RSCH CTR US ARMY NATICK RES & DEV CMD ATTN: DRXMR-E 1 ATTN: DRDNA-YEP ( DR KAPLAN

  17. Bibliography on Cold Regions Science and Technology, Volume 46, Part 2, 1992

    Science.gov (United States)

    1992-01-01

    8217 acca malatirrri ahlatiorn moridel (ASAAh1) espenm \\a(t1I-120. systems at temrperatares helow 213 K stadied hy 11991. p 187-19b. eng1 46-102, encc itt...38694488 Ka~rpurin, A.M. Kaustinen, P.M. Kaplan . L.G. Metallogenic aspects of cryolithogenesis (1 9 90 . p.427-429 K Flow of hailstorm processes in an...in an atmosphere with wind Heard Island Viscous-insiscid interactiirn due to the freezing i-f a liquidshear Kaplan . G.0 et cilo, [1990. p, 9 2-98, run1

  18. Molecular Basis of Ion Channels and Receptors Involved in Nerve Excitation, Synaptic Transmission and Muscle Contraction

    Science.gov (United States)

    1993-12-20

    R\\I) (CHARLES A SANDE[RS. Past Chairman {I IElNE 1. KAPLAN . General ,unsel (c-\\ itimol RODNEY W NI(HOI.S. Chief Fiveut,,, Officer [k.x fliui...MUSCARINIC ACETYLCHOLINE RECEPTOR 221 𔃼 -7 acca cr Y. x a ý . a; > -, -~ 2x 1 Ft. 4• ,1; S4" វ - ɜ:4+ 222 ANNALS NEW YORK ACADEMY OF SCIENCES with other...Physiol. 263: C267-C286. 22. KAPLAN , J, H. 1993. Molecular biology of carrier proteins. Cell 72: 13-18. 23. SOEJIMA, M. & A. NOMA. 1984. Mode of

  19. KC-135 Crew System Criteria.

    Science.gov (United States)

    1981-03-01

    isav overlhead cu e!t cc n s o 1 e o f adequate F7 ’e Cs r -.r ra isplays Present xmon leF o or-t ion of, tne pi lot ’: ’centor b)oom operator ’:,- i...c z L ;~i’)n 1 -T r A ofCV Arevy dat :or ontr- o a;- t C oiycitne conter 15 f tn crw member to aa acca - +3 1: i I.~ .. ~~r~c wi-z --nic LTIA’ i-iz

  20. AIRTOURS: Application of an Interactive Computer Model to Analyze the Manpower Requirements and Operational Tour Opportunities of the Aviation Warfare Community.

    Science.gov (United States)

    1980-12-01

    COUT.) ?RCOP .MFQ SUBCCMMMi~ITY M(JLaER S! DZSCE~ f7 PROPANPO OPERAZONAL HUZETS BY’ ORGANrZAZON??PT 12-. eOAA’iIZArfOM A 0 el C2 f 91 12 01 62/3 0sa/5...En Za Ca It’ ma ra a Caa -4 C ’Ca Ca. a cc Ad. ft a z a ., a Ca ca ’m a~ ca 06-- &n - - -K w C3 ft -. aC Ca !a Ca- Ca C aCCa a Ca wa " w Cj 0 ca aaa

  1. Methods of Evaluating Tank Platoon Battle Run Performance

    Science.gov (United States)

    1980-05-01

    a a OCZ 410041 aCCa a4..𔃾 a ... 41.041 41 ~.- . - 0 C41. 0 41 C a 41 0 41 -l 41 4 - 10 C ’V - .4 11 a a .4 41 ’a a 41 0 " a.󈧭 41 30 - ~41 0 0 a...who are required to arrive at a consensual judgment as in the Delphi technique (Dalkey & Helmer, 1963; Girshick, Kaplan , & Skogstad, 1950; Gordon...Flanagan, J. C. Use of comprehensive rationales. Educational and Psycho- logical Measurement, 1951, 11, 151-155. Girshick, M., Kaplan , A., & Skogstad, A

  2. United States Navy and United States Naval Reserve. Fiscal Year 1989. Military Equal Opportunity Assessment

    Science.gov (United States)

    1990-03-06

    ft. ft ft --- -f ftL ft V)... .- - - f ft ft f ft t ft ft t ft ft f ’Cx ft~0 ft f t ft f3 ,t ft- ft -t -t ft ft...a0 aZ a a a a m a a~ ~~ ~~ al a4 = a . 0- a ~ ~ ~ ~ ~ ~ -a O n - - - - . a~c accA - a 03- a a ~ .a atal Jm’C 0-~0 a) -C a a Ir az a * a a~ a m OA- 0~W a

  3. Needs Assessment to Define the Training Requirements for a Basic Skills Education Program (BSEP) Curriculum Development. Revision.

    Science.gov (United States)

    1984-04-01

    MW1 zm~woo 0 /4 ==W a.. w Z 3 OU. 3 C M p. i 40..U - w W -- l2 L ccU= 1 0.-- r U)_.O I- ~ I-1 ZI 4 C :x U z WX-L U ZZ 4 0Z LL - ac z3 _ uj.- 0 ~ f3 LU D...opeC/cdswoeap e to the TPA-2 form and remort,-a:c 70- :o -e 7P,-3 and Knowledge Analysis formns and reports. To acca -%-- Ce :ns cn’-r’ge, task anal’,s

  4. The Evaluation of Small Arms Effectiveness Criteria. Volume 2: Appendixes

    Science.gov (United States)

    1975-05-01

    v ,f 4C v C 0 0 O C a O OzC,0 C0Oo o~ cc 10 acca =n c- 1 00 00 a lZI -l 4r a - 𔃻 0 000 A 100 P.000,0 -10 .A O00 -2 Cen 7 I fV Aaafn aa In Naco aa oc...f-M n r-- (%., \\ JN N (\\ 5’ _P I..- pI- P_ Of N- rN- I - V NNNC~N J N f5 - ’V4 ’V’- --------------------------------------------- E-81 ~a uNANNN NNINNN

  5. Speech Optimization at 9600 Bits/Second. Volume 2. Real-Time Software and Hardware.

    Science.gov (United States)

    1980-09-30

    resumed as follows: q s A r c ACCA -- S rUP > When resumed, the task closes the MAP and exits. If a complete, two MAP system is desired, the process...A r - C 2 #1 L. II V. It 1, x It -- C C cr t9-tr it 2 - 9C--99 .I. 11 1 16 f6 .~ 4 2t V V t6 M W C It It 22~ ~~ .20 2 r2-~. z-. C22 z C Z ~ 2 O s~ 9

  6. The Allocation of Runway Slots by Auction. Volume II. The Airline Management Game and Slot Auction Testing.

    Science.gov (United States)

    1980-04-15

    fg-49 43IOAA OAAA C Wh. ~ ~A~Pq#~ftC.~I-uwqwC - IC ACAOW A -W9Wftfit-ACAA An -3- ACCA AW CAA ~AA 󈨤’ 2 6A4 0-A I A &U4UU a .~U.d9 AM £U4Cu 0 ~ 6 64...04 3 a-god ~ 3 -5 400 5- a . .. . . 95 %:, P7 OV: im S b z ;Iwos Sues- .’ a U * ~ ~ ~ : ; 060!4 S-~ . :~: a w 60 4b6 66 U1 16603044 OOOOO amo BUSfn~m

  7. Cruise Missile Engine Program Contract Data Requirements List Sequence Number 95. Qualification Test Report. Volume XXXIX. Vibration and Mission Simulation Testing on Engine 828. XF-107-WR-400 Cruise Missile Engine,

    Science.gov (United States)

    1981-06-01

    Illinois Page 7 REV. E ACC"T iJ’ , T.-T AUDIT 4 tii~~fs~actor ~ L~~ 4~4’~NDate S "n M. I. M EC RORDRE -MARK 1 95 oh -- Pum Capacity iA 11994 12054 0...2 S.Z 14-. -l_ S. Z.11500 0 60(60-1851 500 515 5.3. At. el 170’f 8061-056 OnY) 1438 1-448 1; 45a ~~:1 462____ 5.4 Acca ? -6S5F 5.4.116400 40 .4595

  8. United States Air Force Statistical Digest, Jan 1949-Jun 1950, Fifth Edition

    Science.gov (United States)

    1951-04-25

    94.7437 0 • 51 (Face p. 10) PERSONNEL - MILITARY AND CIVILIAN The data presented in this part of the ~USAF Statistical DigesP are bll.$ed on audited ...Quarter ~rtor ~""r ~""r II’ORUlll’IDB ’TOrage Personnel Strength 159,757 16>,996 626,871 168,101 154,643 150,574 152,953 Acca "ioM _ ToW • ~ ~ ~ ~ UU l...Strategic Intelligence Army Language School Accountin& and Auditing AJ’lllJ’ Security Agency Officer, General Automatic Telephone syst8m 1l.aintenance Basic

  9. Management and cost accounting

    CERN Document Server

    Drury, Colin

    1992-01-01

    This third edition of a textbook on management and cost accounting features coverage of activity-based costing (ABC), advance manufacturing technologies (AMTs), JIT, MRP, target costing, life-cycle costing, strategic management accounting, total quality management and customer profitability analysis. Also included are revised and new end-of-chapter problems taken from past examination papers of CIMA, ACCA and ICAEW. There is increased reference to management accounting in practice, including many of the results of the author's CIMA sponsored survey, and greater emphasis on operational control and performance measurement.

  10. Low Temperature Pulsed Plasma Deposition. Part 2. The Production of Novel Amorphous Compounds of Germanium in Thin Film

    Science.gov (United States)

    1988-08-12

    been suggested to occur in amorphous GeS thin films [13]. A change in bond energy and band gap could also account for the measured decrease in optical...the financial support of the US Naval Weapons Center, China Lake and US SDI/IST through the Office of Naval Research. We also acknowledge the...forward power, 210 sTorr chamber pressure, gas flows GeH4/PH3/H2S in acca as given in table, together with 500 sccm Ar. DC bias potential approx. 2kV

  11. All Prime Contract Awards by State or Country, Place, and Contractor. Part 10 (Croom, Maryland-Mendon, Mass)

    Science.gov (United States)

    1990-01-01

    A -IfCJ A ACI 11 LO n (O ? )-t ((D In ((D D-0- n InW ItJ0- W MJWW W .1 ..I<(-4 it I I 1-UCI 41) 0 (04 >1 :: o c" C c14 A CA ACCA C (,j AOCANAN" C CA C...7 )0470 C )) )4))M )( DD000 )0 )0 M0) 0) M0( F8 -00 0 0 8-481I8IM(0.4 it " 0) () r-000000000000000000000000000000000 00 0 ) ) -w I(0-4 it 1A

  12. Irondequoit Creek Watershed New York, Final Feasibility Report and Environmental Impact Statement.

    Science.gov (United States)

    1982-03-01

    would be far raore in-&De~th. To acca !22Ii3h thMs, "m.pllna- ?rzrts ditional Saia stAtions, moAS1 cr-Ailrativu to scm.?llng anelysis, and eveijtia1 effc...8217:iior l’otj-1A R O F8 2 0 p er m it. 1hi; st t mnl e a i e h C o u n ty .W a rh in g to n . T h e m a in n itv ivstio n it StJ~’AAR OFNOTIE: ’i: , Pu

  13. Best Value Acquisition Symposium and Continuous Acquisition and Life Cycle Support (CALS) Update Held in Eatontown, New Jersey on November 17-18, 1993

    Science.gov (United States)

    1993-11-18

    Satellite Commications/Milstar AMSEL- ACCA -A-AE Fort Mcimicth, New Jersey 07703 (908) 532-5486 MR. ROGER S. BERGE HQ, US Amy Ccauunicaticns-Electranics...o 0 0m IL W 0 0 2o Z 0 x0 0~LI 0i- 1 0 F8 20 (A ZI-m 0. WO 0 L 0>11 Z 0 0 A ’o m0J X I-z 4wE 0z. z 0OOL~( WZZ c Wx1>- MiAi Oz OMOXzO ILCl) 0>M CO)( 0

  14. Growth, mineral composition, fruit yield, and mycorrhizal colonization of feijoa in response to lime and phosphorus application

    OpenAIRE

    Nava, Gilberto; Santos, Karine Louise dos; Costa, Murilo Dalla; Ciotta, Marlise Nara

    2016-01-01

    Abstract: The objective of this work was to investigate the effect of liming and phosphorus fertilization on the growth, mineral composition of the leaves, fruit yield, and mycorrhizal colonization of young feijoa (Acca sellowiana) plants. Treatments consisted of four liming levels - 0, 25, 50, and 100% of the dose required to raise the soil pH to 6.5 - and of five levels of P - 0, 60, 120, 180, and 240 kg ha-1 P2O5 -, placed in a randomized complete block design, in a split-plot arrangement,...

  15. Estudo fitoquímico de goiaba (Psidium guajava L. com potencial antioxidante para o desenvolvimento de formulação fitocosmética

    Directory of Open Access Journals (Sweden)

    Silvia M. Iha

    Full Text Available Considerando-se a qualidade dos fitoterápicos, é importante salientar que a preocupação com esta questão inclui rigoroso acompanhamento das diferentes etapas do desenvolvimento e produção destes produtos, desde a coleta do vegetal até a disponibilidade do produto final. Neste trabalho, foram realizados o controle da qualidade, o potencial antioxidante como também ensaios biológicos in vitro do fruto da goiabeira (Psidium guajava L., para o desenvolvimento de uma formulação fitocosmética. Os resultados obtidos mostraram que o fruto apresenta taninos e flavonóides, bem como atividades antioxidante e antimicrobiana. A análise microbiológica não apresentou crescimento de patógenos na formulação desenvolvida entre os outros testes realizados. Destaca-se a importância do estabelecimento do controle da qualidade para as plantas, a fim de que sejam utilizadas para o desenvolvimento de uma formulação fitocosmética segura, eficaz e com qualidade.

  16. Influence of farming system and production purpose on the morpho structure of Spanish goat breeds

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Martinez, A.; Herrera, M.; Luque, M.; Rodero, E.

    2014-06-01

    The aim of this study was to examine the possible influence of farming systems, based on the morpho structure of 1,571 female goats drawn from 40 flocks containing seven Spanish breeds (Blanca Andaluza, Blanca Celtiberica, Negra Serrana, Pirenaica, Payoya, Murciano-Granadina and Malaguena) raised under four different farming systems. Analysis of morphometric variables showed that the morphostructure of native Spanish goat breeds was linked to the farming system used and thus to the production purpose. The morphostructure of grazing breeds may be more influenced by natural selection within the physical environment and less by human selection. That of stall-fed breeds, by contrast, reflects intense artificial selection aimed at achieving a highly-productive dairy type. For this reason, morphological evaluation systems used in breeding programmes for meat or dual-purpose goat breeds farmed extensively or semiextensively should be specific, and should reflect the influence of the environment in which these goats are farmed. (Author)

  17. Dating of pre hispanic ceramics from the archaeological zone of Zoque by thermoluminescence method

    International Nuclear Information System (INIS)

    Valdes, J.V.; Gonzalez, P.R.; Mendoza, D.; Tenorio, D.; Terreros, E.; Ramirez, A.

    2007-01-01

    Full text: The dating of pre hispanic ceramics resides permitting us to located them in a certain period of the history; allows us to verify it origin. The thermoluminescence is a technique that permits us to estimate the absolute age of the archaeological samples. The present work is directed in determining the age by the method of thermoluminescence of archaeological samples of the grotto of Concubac, located in the Serrana Region of Tabasco. To determine the mineralogical composition of the samples, analysis of diffraction of X rays and Energy Dispersive X-ray Spectroscopy (EDS) have been conducted. The radiation emitted by the ground where the samples were buried and the contribution of the cosmic radiation was measured with thermoluminescent dosimeters of LiF:Mg,Cu,P+PTFE. The feasibility of dating of the studied samples is broadly disputed in function of the contents of minerals, as well as the procedure and management of the sample. (Author)

  18. Influence of farming system and production purpose on the morphostructure of Spanish goat breeds

    Directory of Open Access Journals (Sweden)

    Ana Gonzalez-Martinez

    2014-02-01

    Full Text Available The aim of this study was to examine the possible influence of farming systems, based on the morphostructure of 1,571 female goats drawn from 40 flocks containing seven Spanish breeds (Blanca Andaluza, Blanca Celtiberica, Negra Serrana, Pirenaica, Payoya, Murciano-Granadina and Malagueña raised under four different farming systems. Analysis of morphometric variables showed that the morphostructure of native Spanish goat breeds was linked to the farming system used and thus to the production purpose. The morphostructure of grazing breeds may be more influenced by natural selection within the physical environment and less by human selection. That of stall-fed breeds, by contrast, reflects intense artificial selection aimed at achieving a highly-productive dairy type. For this reason, morphological evaluation systems used in breeding programmes for meat or dual-purpose goat breeds farmed extensively or semi-extensively should be specific, and should reflect the influence of the environment in which these goats are farmed.

  19. Efeitos das estratégias de ensino-aprendizagem: um ensaio sobre as respostas do corpo que aprende no cenário tutorial Effects of teaching strategies-learning: an essay on the responses of body learning as scenario tutorial

    Directory of Open Access Journals (Sweden)

    Paulo Sergio da Silva

    2016-07-01

    Full Text Available Objetivo: Descrever as estratégias de ensino utilizadas pelos docentes no cenário tutorial. Método: Trata-se de um estudo qualitativo realizado em um Centro Universitário Particular localizado na região serrana do estado do Rio de Janeiro. Os sujeitos-objeto deste estudo foram dezesseis estudantes regularmente matriculados no primeiro semestre de 2012 e a análise foi realizada mediante a disposição dos conteúdos. Resultados: Definimos a seguinte categoria: Os efeitos das estratégias de ensinar no corpo que aprende. Trata dos efeitos nos corpos dos estudantes a partir de estratégias pedagógicas utilizadas nos cenário tutorial. Conclusão: No plano das formas de ensinar, os estudantes trazem como fundamental as características de saber fazer, que estiveram atreladas as experiências e vivências do professor, descoberta de singularidades, potencialidades e deficiências deles, além do uso de desenhos.

  20. Dating of pre hispanic ceramics from the archaeological zone of Zoque by thermoluminescence method; Datacion de ceramica prehispanica de la zona arqueologica Zoque por el metodo de termoluminiscencia (TL)

    Energy Technology Data Exchange (ETDEWEB)

    Valdes, J.V. [UAEM, Facultad de Quimica, 50120 Toluca, Estado de Mexico (Mexico); Gonzalez, P.R.; Mendoza, D.; Tenorio, D. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Terreros, E. [Museo Templo Mayor, INAH, Seminario No. 8, Col. Centro, 06060 Mexico D.F. (Mexico); Ramirez, A. [Instituto de Geofisica, UNAM, 04510 Mexico D.F. (Mexico)

    2007-07-01

    Full text: The dating of pre hispanic ceramics resides permitting us to located them in a certain period of the history; allows us to verify it origin. The thermoluminescence is a technique that permits us to estimate the absolute age of the archaeological samples. The present work is directed in determining the age by the method of thermoluminescence of archaeological samples of the grotto of Concubac, located in the Serrana Region of Tabasco. To determine the mineralogical composition of the samples, analysis of diffraction of X rays and Energy Dispersive X-ray Spectroscopy (EDS) have been conducted. The radiation emitted by the ground where the samples were buried and the contribution of the cosmic radiation was measured with thermoluminescent dosimeters of LiF:Mg,Cu,P+PTFE. The feasibility of dating of the studied samples is broadly disputed in function of the contents of minerals, as well as the procedure and management of the sample. (Author)

  1. Irrigation management and phosphorus addition alter the abundance of carbon dioxide-fixing autotrophs in phosphorus-limited paddy soil.

    Science.gov (United States)

    Wu, Xiaohong; Ge, Tida; Yan, Wende; Zhou, Juan; Wei, Xiaomeng; Chen, Liang; Chen, Xiangbi; Nannipieri, Paolo; Wu, Jinshui

    2017-12-01

    In this study, we assessed the interactive effects of phosphorus (P) application and irrigation methods on the abundances of marker genes (cbbL, cbbM, accA and aclB) of CO2-fixing autotrophs. We conducted rice-microcosm experiments using a P-limited paddy soil, with and without the addition of P fertiliser (P-treated-pot (P) versus control pot (CK)), and using two irrigation methods, namely alternate wetting and drying (AWD) and continuous flooding (CF). The abundances of bacterial 16S rRNA, archaeal 16S rRNA, cbbL, cbbM, accA and aclB genes in the rhizosphere soil (RS) and bulk soil (BS) were quantified. The application of P significantly altered the soil properties and stimulated the abundances of Bacteria, Archaea and CO2-fixation genes under CF treatment, but negatively influenced the abundances of Bacteria and marker genes of CO2-fixing autotrophs in BS soils under AWD treatment. The response of CO2-fixing autotrophs to P fertiliser depended on the irrigation management method. The redundancy analysis revealed that 54% of the variation in the functional marker gene abundances could be explained by the irrigation method, P fertiliser and the Olsen-P content; however, the rhizosphere effect did not have any significant influence. P fertiliser application under CF was more beneficial in improving the abundance of CO2-fixing autotrophs compared to the AWD treatment; thus, it is an ideal irrigation management method to increase soil carbon fixation. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Monte Carlo Analysis of Energy Deposition in Solid State Materials by 400 and 200 MEV Electrons

    Science.gov (United States)

    1992-06-01

    acca ~pel2=ruvzW ucopty= 125-WOZ.13,S3ZO.25,0.141 roi3.im = (1.1 u.04,3.2e-04,8.5s-04,2.Os-03,2.5u-031 acce ~peiS = roi W accopt0= L4.Ou-04,2.9s...Ewpoipts) p’bftwmat=’(Emtw Ons NOgt dW Wb i ma b 8 114 P"U bpp rull.z= [10.35,10.40,20.90,31.60,42.30,53.10J Fill .aM = [8.72,48.02.56.74,95.46,74.l

  3. F-16 Pilot Media Selection

    Science.gov (United States)

    1981-03-01

    sweep wLS1vaTI GrJAVA-M*- .~--- ’- - - -t------ 7EOA FFM 𔃼t ee.W?mv ~.L: 1.7.5.4/2n C.AMM~AT!: L’sftle MIMI I-- itlm . z4 ~~~as~e;.~~ i c’.1~te1...ac~e I C-s.met~ I £’A.F- ivsa ~ta I ~ acca az~Y I I tc~ ~t I tca± - e~aec N .x-c, ; cnar. ~ ;zar~a I ~i~; EC~I~ a c2r..1C:%ttI I ~t7!fl - -- rr..r

  4. Automatic Threshold Design for a Bound Document Scanner.

    Science.gov (United States)

    1982-12-01

    CCC6G i CcCS aCCa 3C67 311E? Ell CZA JE ~z:: 006! 1069------------------------- LT CAN1~. C3I 007C OC07 35 0071 OUTS 5 0072 a 000! 2040 0073 BEGIN L...00 76 01 7C 00 76 nOCS -01 F3 00 48 01 Fh 00 3E 906FO - 01 70 00 81 01 7 00 77 MOO1 -01 F5 0 40 Ol F 00 3F O6 - 01 7F 00 70 01 80 00 78 MOOS0 01 F7 00

  5. 9th Asian Conference on Computer-Aided Surgery

    CERN Document Server

    2016-01-01

    This book presents the latest research advances in the theory, design, control, and application of robot systems intended for a variety of purposes such as manipulation, manufacturing, automation, surgery, locomotion, and biomechanics. Several chapters deal with fundamental kinematics in nature, including synthesis, calibration, redundancy, force control, dexterity, inverse and forward kinematics, kinematic singularities, and over-constrained systems. This book is a compilation of the extended versions of the very best papers selected from the many that were presented at the Asian Conference on Computer-Aided Surgery held September 16–18, 2013, in Tokyo, Japan (ACCAS 2013).

  6. Benchmark for the ASALT Program; Assessment of Survivability against Laser Threats.

    Science.gov (United States)

    1981-09-01

    3 U 3 J3 . ... 0 - 2 .... 2... U3UA 0 f3 (..UU .. ( 3~(U . - ~ ~ ~ ~ ~ c .2< .2 e. e% In.., on D.2 4 2 .0 D..0 2 440. . .2L 4.. 2...Abrb1 -UU5 0 . , n n4 a’ ,’ La , 1 a . . . . . W,4 𔃾 3i acca , r )4 twi a4I n v 2I -o V Dd I4C ; 4AI )1 o0 Vta ; r ,’ .4 Man4 L .41 S" - u o a l 1- 4, -f

  7. Job Language Performance Requirements for MOS-62J, General Construction Equipment Operator, Reference Soldier’s Manual Dated 28 September 1979.

    Science.gov (United States)

    1979-09-28

    DAAosrt O14.NE VRO1 H__IH_1_________1_______1 1~~hN EIl 1___________ dsknind.o ~~~importance aCCA .Is %1* NU%3E OF REODE D RATA OBTAINED FROM...9~44r £LM2 ae1s ~ Am 424~~del 4e A ~-~. f3 N w ~ Ail 2~ZV41/- t-.. c4 fz d/1,C4t let e -~4Z tz 4L~ fl~4k*1 Wed 4 4-’V 4~bf6144a- 6d>zi.i Z a~ r

  8. CCITT Study Group XVIII Work Program 1981-1984; (Integrated Services Digital Network)

    Science.gov (United States)

    1981-06-01

    ecitintwrste!D teaN he1B - 72 - COM VIII-No. 1-E The points lised below require particular attention in the studies, whereby acca -t should be taken of all...l I\\ I path> muldex f, fc c f3 fre’ue’o Z. -- frequency f F=ure 2 - ttput r a line .at.. a .a = ex Section (22) -79- COMl XVI-!O -E IA dB lie at...muldex fc f3 f, cf frequency -~frequency - Figure 3 -Jitter-transfer function of a line path and a muldex section Figure I4 shows the amplitude of

  9. Santa Ana River Design Memorandum Number 1. Phase 2. GDM on the Santa Ana River Mainstem Including Santiago Creek. Volume 1. Seven Oaks Dam. Appendix A

    Science.gov (United States)

    1988-08-01

    su0.0001,4 from full depth of west0 wall of 23.656 lb. somple f5 , maso o~s ora atsow below exc Of test pit of teot pit. IL 4+ __ -H.~gv MASS GRADATION MASS...s * -W I * a am9 a a a 0 6 a a a a a a a a a a a Sa ~ ~ ~ o a’ a.1aa a a a a a a a a J . . a a a a acca aO a1 1 1 1 a aa a 1- a a 1 as- Is a1 a a a a

  10. Baseline Noise Measurements at Vandenberg AFB, California.

    Science.gov (United States)

    1988-01-01

    CCCMCC0ACC. 4 4;; l;1;9 4CPI* ACCA . 9 ; 4 1 4 #mr nvvr.&%0naof w# ed .4 in l-4P" a a .4 mIAPl~ PlC C4 toi v rm--0ow.in .4 m t a A Cr l %n .Cl w o m a m ww...cooo, O 999944444992144.4449999 9. 49999999994444444449944944 in- Is f5 If 4n % r, A : O IV .0 :, :,o t g Xw g V ;o oe a w I fft w q on f" 4 f 4 ’ i w

  11. Conference Proceedings on Guidance and Control Techniques for Advanced Space Vehicles (37th) Held at Florence, Italy on 27-30 September 1983.

    Science.gov (United States)

    1984-01-01

    aspects du produit final et ceci moyennant des accas faciles aux diversea informationsa ce aouhait l~gitime n’est pas encore compl~tement satisfait...d’origine, is systLame peut constituer des liates de r~ f6 - r encesa croisgies, de flux de donnges. des arbres exprimant lea structures de contr8le...Satellite Launch Date Life (months) FI 12 Sept. 76 36 F2 4 June 77 32 - F3 1 May 78 65 F4 6 June 79 14 F5 15 July 80 0 F6 20 Dec. 82 9+ The current

  12. Prime Contract Awards Alphabetically by Contractor, by State or Country, and Place, Fiscal Year 1985. Part 10 (Hi Plains Supply - International Cnslt Eng Inc).

    Science.gov (United States)

    1985-01-01

    cccC’-4.4 J-4-4 0,30----44.4f. w I(0 .41 -0)0000000 (00000 0)0 0)0)00000000 0ɘ (0(0c, f6 (0 .4ICCCCC ACC 1 ococo w w Wc co 0 000 000 n o00000 0 o...W00O00000000 woo0 INNC 1(0 .41200000000 200000 zoo 200000000000 2000 2WW F.- Im "W ww ww 11C(UCAAAA -4U)nCh cnAA(A 0-4IACA C ACCA ACCWj IC(nC (n -4<< o󈧎

  13. Rotorcraft Flight Simulation, Computer Program C81. Volume 2. User’s Manual

    Science.gov (United States)

    1979-10-01

    o . 7 𔄂 7 2 0 .0 0 1 1 - 2 · 2t > 1 9 1 9 3 .0 - 2 2 .9 2 3 0 .6 1 7 2 2 4 .4 0 o .e :J f6 o .o o l7 -2 o 2 1 ro 9 l 1 4 6...FT/SEC**2 2231 RT:4 2.8L0 S*STA Is CHORD ACC. FT/SEC**2 2232 RTq 29BL0 6.@STA 1o CHORD ACCa FT/SEC**2 2233 RTR ?9.OL0 7.STA 1. CHORD ACC. FT/SEC**2

  14. Installation Restoration Program (IRP) Stage 7, Remedial Investigation/ Feasibility Study Comprehensive CERCLA Work PLan for McClellan AFB/EM, McClellan AFB, California

    Science.gov (United States)

    1991-07-01

    Systems Audits ; Preventive Maintenance; Data Assessment Procedures; Corrective Action; Quality Assurance Reports; and Site Management. General Data Quality...for verification and quality control audits . A copy of the QAPP will be in the possession of field sampling teams for all sampling efforts...L cc- acca C wi w-C P-3-- C I- usu 2; - at C4~~2 Q (( c ccc c-c C- 0L U -C 3- au S - - C3 . - acu tr - -a CL.43 C LU -C2 -C ul 0it S w- -C u Ocw - z i

  15. Loves Park Creek, Loves Park, Illinois Local Flood Protection. General Design Memorandum with Environmental Assessment. Revision

    Science.gov (United States)

    1990-06-01

    accelssCo, ~~e 61:6 ififectrica/ ca ndul’ -Aaq Accas hatch tSelf _____,?q ’EL /4s0 ~~~~~~~c ~ ~ ~ ~ s c) Q a~ri ty 5 iate I i q’ ,mfi AI r IIAcce ss shai...Goverment Audit F-il Article XIII - Federal and State Laws F-il Article XIV - Relationship of Parties F-il Article XV - Officials not to Benefit F-l1...shall not exceed the actual audited , allowable costs of Pebble Creek Dam that are allocable to the Project, nor shall the credits exceed the value of the

  16. Defense Finance and Accounting Service Fiscal Year 1995 Budget Estimates.

    Science.gov (United States)

    1994-02-01

    respect to financial reporting requirements and auditable financial statements through the designation of interim migration systems along DFAS center...ma ma a * a -- a a ccac-.c-aa acca -ca-a-ca-ca-cacc a. * et L a a a a a a a a a a a a a a * * S a CL a a a a a a a a a a a a a p. a.3aa a a a a a a a...incorporate technological changes, systems modifications and payroll adjustments in a timely, efficient manner; and improve audit capability to prevent

  17. Defense Science Board 1986 Summer Study: Use of Commercial Components in Military Equipment

    Science.gov (United States)

    1987-01-01

    I 0 LU 0L c/) LU C- 0.. < o 0. Ui LU C FL/ zD 5 aZz z o C.0 0 cc U ~ ’ 4 i i 0 U-4 ZZ .J •-• go--’ E c : L -- 4 L- u z V 0 acca )0 V f.z ?A 4. CV...Guidebook Certify and Audit IC Suppliers Yes-Who? and Processes Use Industrial Plastic Encap- Partial sulated ICs in Selected Application Remove MIL...removal of precedence between IC selections. The first question concerns certification/ audit , specifically, who performs this function -- the

  18. Application of the System Identification Technique to Goal-Directed Saccades.

    Science.gov (United States)

    1984-07-30

    incorrectly derived result. (4) BAG - KST BAG / KSEand ’ BANT - KST BAN /"SE Substituting these values into the expressions for 8, P0 Pip P2 and P3...found in Appendix Al, yields 47 8 - 5.0938109 x 107 -.’ ’ o . - . -.. .... * . * . s - - * ** . - -. .. . . 63 P3 W 1.548 x 10 P = 3.4455 x 10 P2 P1...absolute value of displacement for subject 2.I Fig.S. he tme nteral romthe tar of he accae t th the ime t pak vlocty v abslut vale o • - " " "-’. di

  19. Further Studies in Filmwise Condensation of Steam on Horizontal Finned Tubes

    Science.gov (United States)

    1992-03-01

    8217; OUITPUT 7(0C. ’AD AFE02 ALSZ ’,IS !IZ7 ,’hiTPiT ’ 7 097 AcCA . ~2 1 ENiTER 709;Etp !’S OU~TPUtT 70 ’AC S -2’ 1 NPUIT "CONlNE’C~T tifOl A.C L.PjC l...Ptczit1Pvap1 GAUGEc 2077 Ptezt2P-v~ p2 ITRANSDUCER 2080’ CORECION FOR AIR CONTAMNATION 20SI P~pPvp2*1 .E-3 ITRANSDUCER IN P 20Z P-~~1 -3 ISAT. PRESSU’RE IN P

  20. National Dam Safety Program. Kehr’s Mill Trail Lower Dam (MO 11277), Missouri - Kansas City Basin, St. Louis County, Missouri. Phase I Inspection Report.

    Science.gov (United States)

    1980-11-01

    j a aja-a, *a-’a .4 - .4 VS a a - a fl WV’ *-rI0&a. a.~ a-c.,.., a a a *a-,~ .~ ... a a. NO a- a.C5𔃺 a 004 a a la-n aCCa -) 0 2. 0 * a3O0 * aQ *a3 0...N C ’N** KU N - NNN.V(4t4 N, C, 3.5 .1 0 . - N4 4 N-NW * U ( 4MW Nt OOOCOOOOOC...NNVUACION.NNCNNV,1’ N’CC’VNVA V.. I NNNN AAAtNCA P2 5.3 3. CI N

  1. Períodos de interferência das plantas daninhas na cultura de cebola (Allium cepa transplantada Periods of weed interference with transplanted onion crop (Allium cepa

    Directory of Open Access Journals (Sweden)

    D.J. Soares

    2003-12-01

    Full Text Available O trabalho foi realizado com o objetivo de estudar os efeitos de períodos de convivência (0, 14, 28, 42, 56, 70, 84 e 98 dias após o transplantio de uma comunidade de plantas daninhas sobre a produtividade de quatro cultivares de cebola (Mercedes, Granex 33, Superex e Serrana, em sistema de transplantio de mudas. O experimento foi instalado em Jaboticabal-SP, de abril a outubro de 2000, utilizando delineamento experimental de blocos ao acaso, quatro repetições, em esquema fatorial 4 x 8. As principais populações de plantas daninhas no final dos períodos de convivência foram de Coronopus didymus, Amaranthus hybridus e Cyperus rotundus. Os cultivares Mercedes (2,90 kgm-2 e Granex 33 (2,64 kgm-2 foram os mais produtivos, independentemente da interferência das plantas daninhas. A convivência com as plantas daninhas durante os primeiros 98 dias reduziu a produtividade da cebola em 95% e o peso médio de bulbos em 91%. O período anterior à interferência (PAI foi de 42 dias, não havendo diferença entre os cultivares de cebola.This research was carried out to evaluate the effects of weed coexistence periods (0, 14, 28, 42, 56, 70, 84 and 98 days after transplanting on the productivity of four onion cultivars (Mercedez, Granex 33, Superex and Serrana. The experiment was installed in Jaboticabal - SP - Brazil, from April to October 2000, arranged in a randomized complete block design, with four replications, in a factorial design 4 x 8. The main weed populations at the end of the coexistence periods were Coronopus didymus, Amaranthus hybridus and Cyperus rotundus. The cultivars Mercedez (2.90 kg m-2 and Granex-33 (2.64 kg m-2 were the most productive, under the conditions of weed interference.Weed interference during the first 98 days reduced production weight around 95% and the average weight of bulbs was reduced by 91%. For all the cultivars, weed coexistence the during the first 42 days after transplanting did not reduce the total

  2. Caracterização Climatológica e Tendências Observadas em Extremos Climáticos no Estado do Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Wanderson Luiz Silva

    2014-07-01

    Full Text Available Neste trabalho elabora-se uma climatologia da temperatura do ar e da precipitação e uma análise das tendências nos extremos climáticos de tais variáveis para o estado do Rio de Janeiro, a partir de dados observacionais entre 1961 e 2012. Os resultados da climatologia mostram temperaturas mínimas médias oscilando entre 9,5 e 11°C (15,5 e 17°C no inverno (verão na região Serrana. Valores mais elevados ocorrem principalmente no litoral, onde as médias de temperatura mínima variam entre 17 e 18,5°C (21,5 e 23°C no inverno (verão. As menores temperaturas máximas médias oscilam entre 21,5 e 23°C (26 e 27,5°C no inverno (verão na região Serrana e os valores mais elevados encontram-se na região Metropolitana e no Norte/Noroeste Fluminense, oscilando entre 26 e 27,5°C (32 e 33,5°C no inverno (verão. A precipitação anual apresenta máximos em áreas elevadas (cerca de 2500 a 2800 mm ao ano e mínimos sobre as regiões de baixada e de costa (entre 700 e 1300 mm ao ano. Para as tendências observadas nos extremos climáticos de temperatura, a região Metropolitana e a região Norte e Noroeste do estado apontam para aumentos estatisticamente significativos da temperatura máxima média (entre +0,01 e +0,08°C/ano. Notam-se também tendências estatisticamente significativas de elevação na porcentagem de noites e de dias quentes em quase todo o estado (entre +0,1 e +0,6 %dias/ano. Quanto à chuva, observa-se que há uma tendência estatisticamente significativa de aumento dos totais pluviométricos anuais nas Baixadas Litorâneas (entre +4,0 e +32,0 mm/ano. Também verifica-se uma elevação significativa dos totais pluviométricos das chuvas mais fortes do ano nas Baixadas Litorâneas e em parte da região Metropolitana, com magnitudes entre +2,0 e +20,0 mm/ano.

  3. Stratigraphy and stable isotope geochemistry of the carbonate sequence from the Paraguay belt

    International Nuclear Information System (INIS)

    Santos, Roberto Ventura.; Alvarenga, Carlos Jose Souza de; Dantas, Elton Luiz

    2001-01-01

    isotope data across 1300 m of carbonates from the northern Paraguay Belt that are stratigraphically placed above glacial sediments. The whole sequence may be divided into three different horizons that shows a general increase in δ 13 C PDB values from the base to the top: 1) a lower horizon in which the δ 13 C PDB values are negative; 2) a intermediate horizon dominated by slightly positive carbon isotope values; and 3) an upper horizon in which the carbon isotope values vary from -1% o to +9.3% o Compared to the carbonate sequences from the Brasilia Belt (Bambui Group), the amount of high δ 13 C PDB values in the Paraguay belt is much less prominent. Rocks from the lower horizon lay directly above the glacial diamictites and present variable δ 18 O PDB values. Besides presenting negative δ 13 C PDB values, they also display a negative carbon isotope peak that may reach values as low as 10% o . The intermediate horizon is best represented in the Provincia Serrana area and is characterized by homogeneous δ 13 C PDB values through out the sequence. This horizon is dominated by dolostones and present δ 18 O PDB values ranging between + 1.9% o and +2.7% o . The upper horizon is dominated by dolostones and present variable δ 13 C PDB and δ 18 O PDB values. The highest δ 13 C PDB values were found on samples from a narrow layer from the Provincia Serrana area. Although the Guia area also has positive values (+3.8% o , they were not as high as those from the Provincia Serrana. At the end of the profile, and just bellow the contact with the upper siliciclastic unit, there is an abrupt decrease in the δ 13 C PDB values down to -2.0% o (au)

  4. Genetic study of Andalusia's ovine and caprine breeds.

    Science.gov (United States)

    Rodero, E; Haba, M R; Rodero, A

    1997-01-12

    differents variables de polymorphism biochimique. Lorsque on fait differences entre troupeau, dedans de races, ou entre elles, on a utilicés differents preuves, á partir des fréquences géniques et génotipiques: l'index de Wright, hétérozygotie moyennes, variances de Whalund, preuve G de raison de probabilité, etc. Aussi le distance de Cavalli-Sforza. Comme conclusion, dans les races Andalusian Black et Grazalema Merino les variances de Whalund obtenues sont cosequences de l'action de la selection, donant different populations avec differentiation spaciale. Les hétérozygoties moyennes de chaque race sont parus, mais lorsque on considérent chaque systéme separé, les differences entre groupes ethniques sont importantes. Les indexes F de Wright demonstrent que, dans le races Andalusian White et Grazalema Merino on peuvent déduire d'heterozygoties génétique entre les populations ou troupeau analicées, dans le race Andalusian Black les differences valeurs de FIS indiquent que, malgré les petites dimensions des populations, on a evité la consanguinitée, due, probablement, á l'entrée d'étalons externes. Il n'y a pas, chez auqune race, d'un signifivative accroissement d'hétérizygosis. Les distances génétiques entre troupeau, dedans des races, en different pas des distances obtenues entre races. RESUMEN: Se ha trabajado con diferentes ganaderias de las razas ovinas andaluzas Merino de Grazalema y Churra Lebrijana, y con las caprinas Blanca Serrana y Negra Serrana, elegidas entre el resto de las razas de Andalucia como prioritarias pra la conservación, por estudio previo (Rodero y col., 1992a). Los sistemas utilizados en este trabajo corresponden tanto a caracteres etnozootécnicos como a diferentes variables de polimorfismos bioquimicos. Cuando se han diferenciado las ganaderias dentrde razas, o las ganaderias entre si, se han utilizado diferentes pruebas, a partir de las frecuencias genéticas y genotipicas: indices de Wright, heterocigosidades media

  5. Regulation and mechanism of leptin on lipid metabolism in ovarian follicle cells from yellow catfish Pelteobagrus fulvidraco.

    Science.gov (United States)

    Zhang, Li-Han; Tan, Xiao-Ying; Wu, Kun; Zhuo, Mei-Qin; Song, Yu-Feng; Chen, Qing-Ling

    2015-10-01

    The present study was conducted to determine the effect of leptin on lipid metabolism in ovarian follicle cells of yellow catfish Pelteobagrus fulvidraco. For that purpose, primary ovarian follicle cells were isolated from yellow catfish, cultured and subjected to different treatments (control, 0.1% DMSO, 500ng/ml leptin, 500ng/ml leptin plus 100μM wortmannin, 500ng/ml leptin plus 50nM AG490, respectively) for 48h. Intracellular triglyceride (TG) content, the activities (CPT I, FAS, G6PD, and 6PGD) and/or expression level of several enzymes (CPT I, FAS, G6PD, 6PGD, ACCa and ACCb), as well as the mRNA expression of transcription factors (PPARα, PPARγ and SREBP-1) involved in lipid metabolism were determined. Recombinant human leptin (rt-hLEP) incubation significantly reduced intracellular TG content, activities and mRNA levels of FAS, G6PD and 6PGD, SREBP-1 and PPARγ, but enhanced activity and mRNA level of CPT I, PPARα and ACCa. Specific inhibitors AG490 and wortmannin of JAK-STAT and IRS-PI3K signaling pathways prevented leptin-induced changes, indicating that JAK-STAT and IRS-PI3K signaling pathways were involved in the process of leptin-induced changes of lipid metabolism. Based on these observations above, for the first time, our study indicated that leptin reduced lipid deposition by activating lipolysis and suppressing lipogenesis in ovarian follicles of yellow catfish, and both JAK-STAT and IRS-PI3K signaling pathways were involved in the changes of leptin-induced lipid metabolism. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. ASTER cloud coverage reassessment using MODIS cloud mask products

    Science.gov (United States)

    Tonooka, Hideyuki; Omagari, Kunjuro; Yamamoto, Hirokazu; Tachikawa, Tetsushi; Fujita, Masaru; Paitaer, Zaoreguli

    2010-10-01

    In the Advanced Spaceborne Thermal Emission and Reflection radiometer (ASTER) Project, two kinds of algorithms are used for cloud assessment in Level-1 processing. The first algorithm based on the LANDSAT-5 TM Automatic Cloud Cover Assessment (ACCA) algorithm is used for a part of daytime scenes observed with only VNIR bands and all nighttime scenes, and the second algorithm based on the LANDSAT-7 ETM+ ACCA algorithm is used for most of daytime scenes observed with all spectral bands. However, the first algorithm does not work well for lack of some spectral bands sensitive to cloud detection, and the two algorithms have been less accurate over snow/ice covered areas since April 2008 when the SWIR subsystem developed troubles. In addition, they perform less well for some combinations of surface type and sun elevation angle. We, therefore, have developed the ASTER cloud coverage reassessment system using MODIS cloud mask (MOD35) products, and have reassessed cloud coverage for all ASTER archived scenes (>1.7 million scenes). All of the new cloud coverage data are included in Image Management System (IMS) databases of the ASTER Ground Data System (GDS) and NASA's Land Process Data Active Archive Center (LP DAAC) and used for ASTER product search by users, and cloud mask images are distributed to users through Internet. Daily upcoming scenes (about 400 scenes per day) are reassessed and inserted into the IMS databases in 5 to 7 days after each scene observation date. Some validation studies for the new cloud coverage data and some mission-related analyses using those data are also demonstrated in the present paper.

  7. Geographic List of Prime Contract Awards. Oct 1992-Sep 1993. FY 1993. (Aiea, Hawaii-Wichita, Kansas). Part 5

    Science.gov (United States)

    1994-03-01

    Z . = ac ac acca H I0o00) , aZ ZZ ZZ Z 2Z ZZ ZZ 2c z z Z a2 ca ci c2 c2 cz 2 r ; H 1 00 0 M U * M 00 M -N tVCOO0 n (D -4 C) r. NNYInCV) .- N -(..-4 0...Ifa1 0.-i K( N (0 (0 I L 0 to 0 (0 K U. I (0wzl0 K 0.-4 0.4.4.-qV4 0 .4 4 OMMMMMMMMMCf(fffff Off CV) - V4 ffm ff) 0 (yf) v E0-Z -4N3ýf(O% NNCYM*VW

  8. Computer Assisted Medical Diagnosis (CAMD) System Version 1.0 Technical Manual.

    Science.gov (United States)

    1992-10-01

    Asaasasa S " "ft Mo Q0r "Ma.. @ ffM ’ 0e= 1aw- 0ý K. O - ^0e’O.t-,ý 4V .4 0;P S&. co *;:c Olt 0-oZo6.06-c v- f ’*-IA S0 . N Ml t* Q.0. L . ii a ,I...M& N.-2 1NNNNa N1ý*m N NN NNNNNN NN-NNNNNNN W.9 co 2 ;:N 2 .0 al .0-w -lI -, a? S -J w a a ( ( acca (a *. (a m. a a *.mo i-W - U - - - - U - 4--’- a-W

  9. Final Environmental Impact Statement for the Kauai Acoustic Thermometry of Ocean Climate Project and its associated Marine Mammal Research Program: Vol 2

    Science.gov (United States)

    1995-05-01

    4436r A43 r-4 01 60-40.6460 4..3 4.36 6 6 --4 2 3.6 a 43 Ca A 333 -4 v. AC4 0 4 -A6 14, 0’ C J4.4C 3 . 0. a , n 0o ,a 󈧈 0 ’ .340 :O 9’ ] acca a 43.’. 4...2140 16000 15940 15920 16000 15940 i’i i] /• / 2 4 𔃼 FIGH FFM f\\aaicra9\\a,\\i -2-4.n 214,1 i TRI0T ON O C j24 0, 1 i Hi I ,/ ] ,’" , ," ’-’ ’,’I LLU

  10. Proposed Revisions to MIL-F-8785C Related to Flight Safety of Augmented Aircraft. Volume 2. Appendices A through F, References

    Science.gov (United States)

    1982-04-01

    matrices described in Section F.l.2, Equation F7 . These were derived from the aerodynamic coefficients, see Section C.4.4. They are in stability-body...actuator and 6 e is the elevator output. The time histories used the state models of Table C-8, corres- ponding to Equation F7 given in Section F.1.2...40 a c o 0Oa - a ~ ~ 4 -9c -C -9mu * 0 #b4 C 000 0 00, 0a-a-- a~~a.c cc * a -ic* . anlalugaus LAOlla umsila 0 4iO ’ an am am om .a -m , M ~ - . acca

  11. Task IV: Groundshock-Induced Hydrogeologic Response: Volume 2. Hydrologic Response of Deep Based Systems to Blast Loading

    Science.gov (United States)

    1994-09-01

    0.46 ’o u. . .6 ’ .4 . - . *a a C6 Si u5 5 555 5 .1 I. . $I v. cc - - -, - - - 0 0- 6 301.000 .04- -3 cc 1.615a P.) a... .a -0a 1 aCCa a *I: A 2 2 I -. A...fLnwfl): 114 I I I INU -4 4.’, tm4 C6 EoC -1-4/WJ mcLJ 115 ~ UlU 94J C4 c4 IA L C CD -U 1r) C F7 i II I I a; (!sd)ainsaij a. o aUo -4 ~1116 C Ln W C1*4

  12. Description of Officers and Enlisted Personnel in the U.S. Armed Forces: A Reference for Military Manpower Analysis.

    Science.gov (United States)

    1982-03-01

    wi 0. 4 a -4 Cu to w1 w 6. 0 ~ Cuo z paa 𔃺 rim 84 z Q z .3 425 OJ -4 C1 -.7 (N L 0 -4cn - 00 Ui - F7 ɘ 1r- ON C4 4 000 ’.O 06700 NLA 1 c’Jr- 1 cn I...0.~ w2 4.- 1-. >1 1 0- 44 4 0H (aw ) ACca E-4 aJm Vu.- 00v- 41 a& r )4VE W- w 1 0 = 4-4 0)fq 04 01 A P. 2 d) >~4 1.- .4 Cu ~ u~, .Cu "A- ~ 4) Cu4 -4

  13. Implementing the Defense Business Operations Fund, The Case of the Naval Air Reserve at Point Mugu

    Science.gov (United States)

    1993-12-13

    maintenance, airfield operations, recruiting, advertising, and management headquarters. These costs are budgeted as the following Activity Groups: F3 ...are issued for each BA within the 3Activity Group F3 , Other Base Operations Support, includes support to the Aircraft Intermediate Maintenance...a l ah aCca a a a a o o. i W; C4 coai ccm< ~~I~ aa I ccH0 ,NUU’ in In U N S 0O U% -. t NU ,- N v ’ D v a .-q a ft 8U U a:mQ " 00 h owl ci R toNN NN N

  14. Prime Contract Awards of $100,000 or More by Federal Supply Classification or Service Category and Purchasing Office, FY 88. Part 5. (S215-Z299).

    Science.gov (United States)

    1988-01-01

    4 N 00 ( AccA % 0 4 00.-.0-..4 V 41 0 -C 0 00 ~I-" . 0( rU 4c 04 w Of0"al-t c - 9-0 0 -C I.-n 0.O .- O (𔃻 30- ----- -------- - 00 N4-4 0 -4 Nj~cU -Io...top- Q -0~ f3 -I 00O.~,3loG00 (n.j -4N4N.4 w-.00 .44. ..- ’J - 0 Wa W .zO . 0S 3-4 40 :I-N so 00 0’ 0 004 PIC 4vollam " 40mnC0(’- mnvmGOmfl0Q0 -4 .1

  15. All Prime Contract Awards by State or Country, Place, and Contractor. Part 9 (Annville, Kentucky-Crofton, Maryland)

    Science.gov (United States)

    1990-01-01

    0 c In 0 0 N4 cc 400C N 0N3 00 U 40 N 0*n 04r 000l -4000000 0000000000000000000000 05M-5 WP.- N00 f5 -00 40c 0N 3 C 40 Nf-N4 MN 404 e 4OiC nC 4N N N NN...4-4 -IQ0 1400 IQ 40 .4n 4 4 I in9-40 4 1 2 L >%>- >013 "- >1 9 >4 % -2 1-^" ’-^ > ACca C2de I in. -40 0 zz ix. .Z L z Lz ZZ Lz LZ Z Z )-* 400 U00 0 4

  16. Tables of Asymptotic Directions and Vertical Cutoff Rigidities for a Five Degree by Fifteen Degree World Grid as Calculated Using the International Geomagnetic Reference Field for Epoch 1975.0

    Science.gov (United States)

    1975-04-03

    b-sos 01 I 𔃺 06 I 99.6991, S N - .b- NS.=O-O.sb- .rN4C..aCNSbM.cC-r 74 NCSCC NClb0.C lb ..-. %flJ I b9 O ncaaOtflbOOtCfCObbSCC. seSro 0 - acca ...ob.1 6.1.? 2 00 1 1 2ACRID~~i9 .1 10.2 750 L29:.0 56 D __r RIe•O -I IPO, 1 5 0¢ *j I b5 • f5 ,$ q,3 15, W O R L D G O O D 𔃻 . 2 0 9 2.0 2 1. 9 1 6

  17. Department of the Navy FY 1994 Budget Estimates. Military Personnel, Navy. Justification of Estimates Submitted to Congress April 1993

    Science.gov (United States)

    1993-04-01

    I ~ t ~ ( 4 I f5 ftf 4wdf .f t tOf ’I - f!t L’z ftCý -0 ft U..f T. ft z1 S 1 o I~t It.ff -a an sf , I aa -b Jft (SIPI C4" a a ft C" ft fm t 40 1 1f...P ac 49 a.a.a.. -a- - - aCCa C . P-- L.~ mna..v. aum-U 4- -. u a a . (’I .. p.in (.(.4 0(..-.a0(.a-O... C, 𔃺 4*. C4I~ 4! aa ?-2 - U.O, 0 *n I C4 -a d

  18. Simulation Models of Search in the Presence of Decoys

    Science.gov (United States)

    1972-04-01

    it. Wl It Ie Ile’ rad i tt.s of’ th acca i1,Nn;’u h mputicciýl cia IpAc’M1nteLI I Ii’ I IaS 11(:11Z I Iv Ihelli toigte vi lice of 200( cmin FoId ret 21...nr IF( T ND. F 0) r-0 ൒ 50 "Ŕ n 3p’c I. CALL XYNOV( TN, DT, V,XL. AS, YLASI, COU 0 C, AL,",I, h, P 303 ’+ X N 0 t, YN0,1 NI D, ANO ,’, I AN’) 00 F5

  19. The Sortie-Generation Model System. Volume VI. Spares Subsystem,

    Science.gov (United States)

    1981-09-01

    1020 F0rPT(I5,2’X,A18,F8.5,I4, F6 ..2,F9.5,I6,F12.2,T21,2F6.2) 3360 WRITE(2)NSNOUT (IOUjT), DEKWJT(IOUT), IQAOT(IOMJ), 3370 & FAPOUT(IOUJT),INITSOIJT(IOUT...tC IOOOCCCCCCO0COCCC rzOOOCzCCzzOc c 0MC =CCaCCr C C aCCa , 3. 3 3 L. U.3a33aL. 3 3i. .3 3 i. 3 3 . ~_K-17~t.. - 0 -0 g . .l C xCCr0 zJ1 wc ck aNC -C

  20. Outpatient Nonavailability Statement Procedures, Health Services Command Catchment Areas, First Quarter, FY 1993 with Comparisons to Fourth Quarter, FY 1992

    Science.gov (United States)

    1993-02-12

    oldg 0 0 0 ’e e -’O0 0IL 40 U I- -; - .. j = .- -C 4, -- -z NN 0 Z’’-XLU wKwc I-" ,, G . w aL . 3I-IA Lul-U I- A w -AA! _j w >" 4 cc I of ’ AccA ZO-CK...34 I" 3-m r. U, 9 x . I. U0 U, bIll - r - IdM lieU ; r-- ee s’ sI aa aila I *E UM UM " I-- ua a M. 1- 05 1f- $-- a F6 - m in onI to lI

  1. Aging and Surveillance Program MINUTEMAN II/III Stage II Program Progress

    Science.gov (United States)

    1986-05-01

    CW C; C;f: C E " 0 o Wo - . acca w. cr. 0: - w- Lu .1 -t 𔃻.1 4 ’S < ’SI--T 0 X I m mu ( m a0 mammm mommu 0 w 04 00 000000 im0LZo0000c 0 000C1000400 0...FRAC IW 2850 K. S-. 85B 0.0 1.0572 0.171 1.040 t389 0.2 1.0692 0.064 0.155 1.012 :’ f6 0.2 0.9936 0.060 0.154 1.027 0 0.3 1.0108 0.061 0.151 1.013 0.5

  2. Advanced Composite Cost Estimating Manual. Volume I

    Science.gov (United States)

    1976-08-01

    0012T)L ( F6 ) MERE: H Standard runtime hour per part T = Thickness of material, in inches 1. =lngth to be sauded, in inches Setup Time = 0.02 Hour 55 4i...hole is beveled to acca -cdate the conical seat of a flat head screw in order to have the head of the screw flush with the s~urface. A carbide tool held...POTBETOOL SANDING 0.02 (O.OO12T)L ( F6 ) MCIESNIG0.25 (0.00046L)P (F7) HOLE OPERATIONS DRILLING 0.05 (0.01693D0 3 0 z +.52 0.0006)Q (F8) COUNTERBORING

  3. Installation Restoration Program. Phase 2. Confirmation/Quantification. Stage 1 for Pease Air Force Base, New Hampshire. Volume 2. Appendices.

    Science.gov (United States)

    1987-08-01

    san Agency Judgment on an amn pces that are more sensitive The .vlaldt’a . acca ~ble" siskieavel. . that those tested. Mortality to early life...METHOD -30 c 7P~4- 1]I07- .ps cC4 Zw /5(,ov 12򒵃 /I04dOSIT/ - RIEP PIIS Bi,0614 L 1 111 16" AL F6 t 7 9 2349, -* ,* I- ~CL */1.CIIIT C-CL).1- LI tNT I...LWpCL MAILSE ORIGINALD (.. .I hla REPRT 7e__ _ __ _ __ _ 1" -L 5.um.Iwf TOr4 c0opy 131210421, ( ^i F6 .,Ol+,3uicj.Imb3 COPYS 2L0 _______COLLCTEDB_____

  4. Geographic List of Prime Contract Awards. Oct 1992-Sep 1993. FY 1993. (Akron, New York-Williston, North Dakota). Part 9

    Science.gov (United States)

    1994-03-01

    4-4 .-4 -4-ý4-4-4 -4-44--4-ý4 4-4--4 - 4 -. 4 4 - --- 444ci 11 0O II 1 000 0 0 00 000000009M0000000000000000133coc co co 11 1lU ON- 11 0cc acca 11 1...C.J 1444 44c w Y 4 2000 e ý 7) l 1 ONj iINcIn Ln n Ln v (0 00a) r) .M-4. O4In0 0-4 -4 n (00-4NNJ ~ L Ucri 0T) I ON 10r ýr-P vIN N P7 % 0y) m Li W(0 j

  5. True Asymptotic Plasma-Sheath Matching with an Asymptotically Correct Collisional Presheath

    Science.gov (United States)

    1989-06-30

    and shifted in velocity according to a generalization sructure amkse acca un redected l.ow, trapped ions, and of the Bohm criterion [51. (61. urice...2,10.2) (IPARAM(I),I-1,5) CLOSE (2) WRITE (*, 109) STOP c 101 FORMAT ( F8 .1/F8.1/F6.3/F6.3/F6.3/F6.3/F7.2/F5.2/F6. 1) 102 FORMAT (I1/I1/I3/I3/I3) 103...150 FRA(X’********************I &JX’****TEC START 151 FORMAT(F8.1/ F8 .i/F6.3/F6.3

  6. Design of Mobile Photovoltaic Power Systems: 0.5-3 kW

    Science.gov (United States)

    1981-10-01

    o o . . .tI "• I’, X I6%, 6% S=’ -% 6% 0 6% -. 6% •60% 60%060 60%, .•v P2 o o• . 6%• 0% 6 0 6% 6%*• • •o 04 0 6% 0 % 6%6. Ix •, 6% 0 ,.6-. -*Z*w...C C C C’ Cc v C a a. e c. (1 -1. a, a C C c c. c 0 c. C’ @. C. C ara . a C CCEa C, 0 C ’ a c a, a. a c * . a a a. co C. a. 0: a. a. 1. 9. a a aCCa

  7. Aspectos ambientais e sócio-econômicos relacionados à incidência de acidentes ofídicos no Estado do Rio de Janeiro de 1990 a 1996: uma análise exploratória

    Directory of Open Access Journals (Sweden)

    Bochner Rosany

    2004-01-01

    Full Text Available Neste trabalho foram analisadas, de forma exploratória, as relações existentes entre algumas variáveis ambientais e sócio-econômicas com a incidência de acidentes ofídicos ocorridos no Estado do Rio de Janeiro, Brasil, no período de 1990 a 1996. Concluiu-se como possíveis fatores de risco as regiões Baía da Ilha Grande, Serrana, Médio Paraíba, Noroeste Fluminense e Centro-Sul Fluminense, a porcentagem de crianças de 10 a 14 anos que trabalham, a carência de alfabetização de jovens, a porcentagem de renda insuficiente, a porcentagem de domicílios rurais, áreas plantadas de feijão, café, banana e cana-de-açúcar, a taxa total de pessoal ocupado em atividades agropecuárias, as lavouras em descanso e produtivas não utilizáveis, as matas naturais e plantadas e o total de suínos.

  8. Description of a new species, Pintomyia dissimilis nov. sp., a phlebotomine fossil from Dominican Republic amber (Diptera: Psychodidae: Phlebotominae

    Directory of Open Access Journals (Sweden)

    Sanguinette Cristiani

    2009-05-01

    Full Text Available Abstract Background Phlebotomine sandflies are the vectors of etiological agents of leishmaniases in several areas of the world. In the Neotropical Region, the biodiversity of these insects is more than other regions, probably due the long evolutionary period of this group. Miocene amber from Dominican Republic, currently, has a record of 14 extinct species of Phlebotomine sandflies. Results This paper describes a new fossil species of phlebotomine sandfly from amber found in Dominican Republic. This new species is based on morphological characters of a male such as 5° palpomere longer than 3° + 4°, three well-developed spines in the gonostyle, lateral lobe longer than gonocoxite and permit inclusion of the new species in the genus Pintomyia, series serrana. The paramere, with a curvature in the ventral margin, of the middle of the structure, separates the new species from the others fossils or extant species. Conclusion The new species described in the present study named Pintomyia dissimilis nov. sp. is well differenciated from all known species in this genus.

  9. Atuação do psicólogo em situações de desastre: reflexões a partir da práxis

    Directory of Open Access Journals (Sweden)

    Ana Cecília Andrade de Moraes Weintraub

    2015-06-01

    Full Text Available A partir de uma série de experiências de trabalho em situações de desastre, notadamente na região serrana do Rio de Janeiro, Brasil, no início de 2011, este artigo pretende contribuir com a reflexão a respeito da atuação do psicólogo em um contexto de desastres. Inicia-se por uma breve retomada histórico-institucional da questão no Brasil, para, então, apresentar algumas reflexões conceituais e práticas da saúde mental a esse respeito; e, por fim, discutir princípios e diretrizes de intervenção em situações de desastre, tendo como pano de fundo o cenário fluminense de janeiro de 2011. Pretende-se, com isso, argumentar que a intervenção do psicólogo num contexto de desastres deve ser articulada com outras instâncias, contextualizada e descolada da noção de traumatismo como principal operador da clínica.

  10. Maturity indexes for 'Kumagai' and 'Paluma' guavas Índices de maturidade para goiabeiras 'Kumagai' e 'Paluma'

    Directory of Open Access Journals (Sweden)

    Flavia Cristina Cavalini

    2006-08-01

    Full Text Available Harvest time is one of the main factors related to guava fruit postharvest losses. It is subjectively determined by fruit size and skin color, without any consensual standardization among the growers. The use of maturity indexes enables growers to know the ideal harvest time according to each market situation. The objective of this work was to determine the maturity indexes to identify the harvest time for guava fruit cv. Kumagai and Paluma. Skin color, fruit firmness, soluble solids, titratable acidity, ratio and ascorbic acid were analyzed. The most adequate maturity indexes for 'Kumagai' guava fruit were skin color and pulp firmness, while for 'Paluma' guava fruit, the best indexes were skin color, pulp firmness, titratable acidity and ratio.O ponto de colheita é um dos principais fatores de perda pós-colheita e, em goiaba, este é determinado de maneira subjetiva através da coloração externa e tamanho do fruto, não havendo uma padronização consensual entre os produtores. A utilização de índices de maturação permite que se conheça o ponto de colheita ideal para cada situação mercadológica. Este trabalho objetivou determinar tais índices que permitam identificar o ponto de colheita em goiabas 'Kumagai' e 'Paluma', em cinco estádios de maturação. Avaliaram-se cor da casca, firmeza, teor de sólidos solúveis, acidez titulável, ratio e teor de ácido ascórbico. Os índices de maturação mais adequados para 'Kumagai' foram cor da casca e firmeza da polpa, e para 'Paluma', foram cor da casca, firmeza da polpa, acidez titulável e relação sólidos solúveis/acidez titulável.

  11. Diversidade de populações de Phyllosticta spp. de goiabeiras e de mangueiras em diferentes ambientes

    OpenAIRE

    Carboni, Roberta Cristina Delphino [UNESP

    2014-01-01

    Phyllosticta corresponds to an important genus of fungi associated with the plant kingdom. Due to the economic importance of damages caused by some species of Phyllosticta and the cosmopolitan behavior of endophytic species, several studies have been conducted in order to identify and reclassify species of this genus. Through the application of sequencing of different gene regions, new species of Phyllosticta were recently reported, and concomitant to the new reports, doubts were raised about...

  12. An Analysis of Thaumarchaeota Populations from the Northern Gulf of Mexico

    Directory of Open Access Journals (Sweden)

    Bradley B. Tolar

    2013-04-01

    Full Text Available We sampled Thaumarchaeota populations in the northern Gulf of Mexico, including shelf waters under the Mississippi River outflow plume that are subject to recurrent hypoxia. Data from this study allowed us to: 1 test the hypothesis that Thaumarchaeota would be abundant in this region; 2 assess phylogenetic composition of these populations for comparison with other regions; 3 compare the efficacy of quantitative PCR (qPCR based on primers for 16S rRNA genes (rrs with primers for genes in the ammonia oxidation (amoA and carbon fixation (accA, hcd pathways; 4 compare distributions obtained by qPCR with the relative abundance of Thaumarchaeota rrs in pyrosequenced libraries; 5 compare Thaumarchaeota distributions with environmental variables to help us elucidate the factors responsible for the distributions; 6 compare the distribution of Thaumarchaeota with Nitrite-Oxidizing Bacteria (NOB to gain insight into the coupling between ammonia and nitrite oxidation. We found up to 108 copies L-1 of Thaumarchaeota rrs in our samples (up to 40% of prokaryotes by qPCR, with maximum abundance in slope waters at 200-800 m. Thaumarchaeota rrs were also abundant in pyrosequenced libraries and their relative abundance correlated well with values determined by qPCR (r2=0.82. Thaumarchaeota populations were strongly stratified by depth. Canonical correspondence analysis using a suite of environmental variables explained 92% of the variance in qPCR-estimated gene abundances. Thaumarchaeota rrs abundance was correlated with salinity and depth, while accA abundance correlated with fluorescence and pH. Correlations of Archaeal amoA abundance with environmental variables were primer-dependent, suggesting differential responses of sub-populations to environmental variables. Bacterial amoA was at the limit of qPCR detection in most samples. NOB and Euryarchaeota rrs were found in the pyrosequenced libraries; NOB distribution was correlated with that of Thaumarchaeota (r2=0.49

  13. Cloud detection method for Chinese moderate high resolution satellite imagery (Conference Presentation)

    Science.gov (United States)

    Zhong, Bo; Chen, Wuhan; Wu, Shanlong; Liu, Qinhuo

    2016-10-01

    Cloud detection of satellite imagery is very important for quantitative remote sensing research and remote sensing applications. However, many satellite sensors don't have enough bands for a quick, accurate, and simple detection of clouds. Particularly, the newly launched moderate to high spatial resolution satellite sensors of China, such as the charge-coupled device on-board the Chinese Huan Jing 1 (HJ-1/CCD) and the wide field of view (WFV) sensor on-board the Gao Fen 1 (GF-1), only have four available bands including blue, green, red, and near infrared bands, which are far from the requirements of most could detection methods. In order to solve this problem, an improved and automated cloud detection method for Chinese satellite sensors called OCM (Object oriented Cloud and cloud-shadow Matching method) is presented in this paper. It firstly modified the Automatic Cloud Cover Assessment (ACCA) method, which was developed for Landsat-7 data, to get an initial cloud map. The modified ACCA method is mainly based on threshold and different threshold setting produces different cloud map. Subsequently, a strict threshold is used to produce a cloud map with high confidence and large amount of cloud omission and a loose threshold is used to produce a cloud map with low confidence and large amount of commission. Secondly, a corresponding cloud-shadow map is also produced using the threshold of near-infrared band. Thirdly, the cloud maps and cloud-shadow map are transferred to cloud objects and cloud-shadow objects. Cloud and cloud-shadow are usually in pairs; consequently, the final cloud and cloud-shadow maps are made based on the relationship between cloud and cloud-shadow objects. OCM method was tested using almost 200 HJ-1/CCD images across China and the overall accuracy of cloud detection is close to 90%.

  14. Ecology of Mabuya agilis (Squamata: Scincidae from a montane atlantic rainforest area in Southeastern Brazil

    Directory of Open Access Journals (Sweden)

    Teixeira, Rogério L.

    2003-05-01

    Full Text Available Alguns aspectos da ecologia (principalmente reprodução e dieta do lagarto scincídeo Mabuya agilis foram estudados com base em amostras mensais realizadas de dezembro de 1997 a abril de 1999 em uma área de floresta tropical serrana no estado do Espírito Santo, sudeste do Brasil. Dos 197 espécimes coletados, 82 eram machos, 110 eram fêmeas, e o resto não pôde ser corretamente sexado. Lagartos variaram em comprimento rostro-coacal de 30 a 96 mm e foram sexualmente dimórficos em tamanho, com fêmeas atingindo maiores tamanhos que machos. A menor fêmea grávida mediu 54.0 mm. O tamanho da ninhada para 49 fêmeas grávidas variou de 2 a 9 (média = 5.7 e esteve positiva e significativamente relacionado ao tamanho dos lagartos. As presas dominantes na dieta de M. agilis foram baratas, ortópteros e aranhas. A população de M. agilis aqui estudada diferiu de outras populações conspecíficas previamente estudadas em hábitats de «restinga» nos estados do Rio de Janeiro e Espírito Santo, sendo que os indivíduos crescem a tamanhos maiores e a fecundidade é mais alta, possivelmente devido a uma maior disponibilidade de alimento no hábitat de floresta tropical serrana Some aspects of the ecology (mainly reproduction and diet of the skink Mabuya agilis were studied based on monthly samples taken from December 1997 to April 1999 at a montane rainforest area in Espírito Santo state, southeastern Brazil. Of 197 collected specimens, 82 were males, 110 were females, and the rest could not be properly sexed. Lizards varied in snout-vent length (SVL from 30 to 96 mm and were sexually dimorphic in size, with females growing larger than males. The smallest gravid female measured 54.0 mm in SVL. Litter size of 49 gravid females varied from 2 to 9 (mean= 5.7 and was positively and significantly related to lizard SVL. The dominant prey items in the diet of M. agilis were cockroaches, orthopterans and spiders. The population of M. agilis here studied

  15. Amblyomma cajennense infestation on horses in two microregions of the state of Rio de Janeiro, Brazil Infestação por Amblyomma cajennense em equinos de duas microrregiões do estado do Rio de Janeiro, Brasil

    Directory of Open Access Journals (Sweden)

    Marcus Sandes Pires

    Full Text Available The objective of this study was to evaluate factors associated with infestation by Amblyomma cajennense on horses in two microregions of the state of Rio de Janeiro. Horses on 62 farms in the municipalities of the Itaguaí and Serrana microregions were evaluated between January and May 2009. The animals were examined to determine the presence of ticks and infestation level. The animals' rearing and management were assessed on each farm property using an epidemiological questionnaire. Out of the 635 horses evaluated, 41.6% were infested with A. cajennense. It was observed that farms in low-altitude regions (OR=3.69; CI: 2.3-5.8, with unsatisfactory zootechnical and sanitary management (OR=5.92; CI: 3.8-9.2 and an extensive rearing system (OR=4.25; CI: 2.1-8.5 were factors associated with tick infestation (p O objetivo deste estudo foi avaliar os fatores associados à infestação por Amblyomma cajennense em equinos em duas microrregiões do estado do Rio de Janeiro. Equinos de 62 fazendas nos municípios das microrregiões de Itaguaí e Serrana foram avaliados entre janeiro e maio de 2009. Os animais foram inspecionados quanto à presença e ao nível de infestação destes carrapatos. As condições de criação e o manejo foram avaliados em cada propriedade, por um questionário epidemiológico. Dos 635 equinos avaliados, 41,6% apresentavam-se infestados por A. cajennense. Observou-se que as criações dos animais em regiões de baixas altitudes (OR=3,69, IC: 2,3-5,8, em propriedades com manejo zootécnico e sanitário insatisfatório (OR=5,92, IC: 3,8-9,2 e em sistema de criação extensivo (OR=4,25, IC: 2,1-8,5 foram fatores associados (p < 0,05 à infestação, sendo também relacionados à intensa infestação nos equinos. O uso de carrapaticida nos equinos também apresentou associação (p < 0,05 à infestação, sendo descritas pelos proprietários, diferentes condutas terapêuticas, em intervalos alternados de tratamento. Baixas

  16. Training Extract AFSC 791X0 Public Affairs.

    Science.gov (United States)

    1985-09-01

    8217 C I 6 8o9 a Is- LI I I ffm cc I C.~ 11 N * 0- Q * .j I .0 L’ ) t.. Cn IC. C~ OU~ *IC - ~ ONcc N.U- 1 0r N a- I A u z a I . A .. I: n] -j 1.’ I I a... Acca r : 𔃺 0 j4 &. a a 40’ 8. x . 09 a n u a i m W Z 15LW4 4 Sn. z 41 0 C. IS L" W. Sn) WL Sn J 0 V. w i Sn - &A ’~S CC 0 Ct 0: Sn w L. -4 04 0 S 4.0- 0

  17. All Prime Contract Awards by State or Country, Place, and Contractor. Part 16 (Albany Oregon-Newport Rhode Isld)

    Science.gov (United States)

    1990-01-01

    0 00 0- 0 -I -I- =0. ZZ1.-M a Inl c) N4 cr-. N ffm -40(a co -40 -4 N4 m0of wwiJ- a o 0 -.4 04000.0 0o -40 Co 0-4 C0 0 Ina W’-4 z 2 2 Z zz z2Z 2 22 z...0 u0 u00 4UU( CAI (A)0 W U n CA I ACCA (AU) C U I(044<I 00 -)4~’ 0 *VM C (0 C) (Y) (D q*CO(00 00-4 t U O(-4N4 MI 0-4 C S NNNNNc C’) 0 (D( to D (0c(0

  18. Prime Contractors with Awards Over $25,000 by Name, Location, and Contract Number, Fiscal Year 1992 (Bituminous Paving, Inc.-Datum Maching Services, Inc.)

    Science.gov (United States)

    1993-01-01

    WOWOLICF IcFO OaF OOI cFCF CODFFt Ft~ ~~~~~~~~ FC,0~FO0OaF~ F7 Fz00 F ,FF F O O 7** 0 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ u .0F F 0 F0’L F 0NN F 0 4 444 F F FO C H...Z z Z ~0424 0 1:, ’o 0C wC C" I C-4 cc 0- a j > 4v Lo.- C) U - u 0 M I- . to a aL a aA acca . ) 0 a- C a T 0 (0 CC cc 4 w w 0124) aa aw0 4 -- I

  19. Alpha List of Prime Contract Awards. Oct 91 - Sep 92. FY 92 (H E P incicn Biomedicals Inc)

    Science.gov (United States)

    1993-01-01

    ea -IL. U-’ 4n0) 0)0) 0) it 4 I CO00>-I If f7 )"’.lNNNjNjNNN -IE m J-J NJCA a < 04 0-v 00 a4’ 40000L)O < 11 0 1M 0 -4 110a(w(0w(0(0(W0W0(D( -44 044 U...4 It MO0M It M) 00 NCO-1-10101000tIn N410441- N" 0 00 (0-410 f.-I to 01 11MI C . - aCCa )0 0 0-40000 000001 Ř 4 0 0 00C 0U to 01 11 i i-N N1 N- NN NN

  20. Automating the Exchange of Military Personnel Data Among Selected Army Organizations. Volume II. Appendices,

    Science.gov (United States)

    1981-06-30

    w OO Id Sa f3 c c c o AJ -0h C CU 0 L -A- V)’ 0~ uiZ~u ’ w ii C 1a. b. % US %0 0 U4 4 ~ c 0C - = 0 IC a.4 0 0. 0~ 0 >00 ~C U a -60 A f 0 C3T...O 0 o’’ " - _0 3.. T5 4c( #j r. 0 < E C, -. .0 cc1 ,-, ;, 0. .- 0 ". a - c- r-. w 0 . .4 -4 f .%d 00 U a W W)w 44 0 ,U " 0 0 C) Z C4 W oa OC > acCA . 0