Multiple shoot regeneration of cotton (Gossypium hirsutum L.) via ...

African Journals Online (AJOL)

user

2011-03-14

Mar 14, 2011 ... Induction of multiple shoots of cotton (Gossypium hirsutum L.) plant in two commercial varieties (Sahel and Varamin) using shoot apex was done. Explants were isolated from 3 - 4 days old seedlings, then they were cultured on a shoot induction media, modified MS nutrient agar with combinations: 1- ...

Polyploidization altered gene functions in cotton (Gossypium spp.).

Science.gov (United States)

Xu, Zhanyou; Yu, John Z; Cho, Jaemin; Yu, Jing; Kohel, Russell J; Percy, Richard G

2010-12-16

Cotton (Gossypium spp.) is an important crop plant that is widely grown to produce both natural textile fibers and cottonseed oil. Cotton fibers, the economically more important product of the cotton plant, are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that large numbers of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across At and Dt subgenomes of tetraploid AD cottons. In the present study, the organization and evolution of the fiber development genes were investigated through the construction of an integrated genetic and physical map of fiber development genes whose functions have been verified and confirmed. A total of 535 cotton fiber development genes, including 103 fiber transcription factors, 259 fiber development genes, and 173 SSR-contained fiber ESTs, were analyzed at the subgenome level. A total of 499 fiber related contigs were selected and assembled. Together these contigs covered about 151 Mb in physical length, or about 6.7% of the tetraploid cotton genome. Among the 499 contigs, 397 were anchored onto individual chromosomes. Results from our studies on the distribution patterns of the fiber development genes and transcription factors between the At and Dt subgenomes showed that more transcription factors were from Dt subgenome than At, whereas more fiber development genes were from At subgenome than Dt. Combining our mapping results with previous reports that more fiber QTLs were mapped in Dt subgenome than At subgenome, the results suggested a new functional hypothesis for tetraploid cotton. After the merging of the two diploid Gossypium genomes, the At subgenome has provided most of the genes for fiber development, because it continues to function similar to its fiber producing diploid A genome ancestor. On the other hand, the Dt subgenome, with its non-fiber producing D genome ancestor

Genetic diversity and structure of elite cotton germplasm (Gossypium hirsutum L.) using genome-wide SNP data.

Science.gov (United States)

Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing

2017-10-01

Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.

Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

Science.gov (United States)

MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

Identification of exotic genetic components and DNA methylation pattern analysis of three cotton introgression lines from Gossypium bickii.

Science.gov (United States)

He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming

2011-01-01

The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.

Genome wide identification of cotton (Gossypium hirsutum)-encoded microRNA targets against Cotton leaf curl Burewala virus.

Science.gov (United States)

Shweta; Akhter, Yusuf; Khan, Jawaid Ahmad

2018-01-05

Cotton leaf curl Burewala virus (CLCuBV, genus Begomovirus) causes devastating cotton leaf curl disease. Among various known virus controlling strategies, RNAi-mediated one has shown potential to protect host crop plants. Micro(mi) RNAs, are the endogenous small RNAs and play a key role in plant development and stress resistance. In the present study we have identified cotton (Gossypium hirsutum)-encoded miRNAs targeting the CLCuBV. Based on threshold free energy and maximum complementarity scores of host miRNA-viral mRNA target pairs, a number of potential miRNAs were annotated. Among them, ghr-miR168 was selected as the most potent candidate, capable of targeting several vital genes namely C1, C3, C4, V1 and V2 of CLCuBV genome. In addition, ghr-miR395a and ghr-miR395d were observed to target the overlapping transcripts of C1 and C4 genes. We have verified the efficacy of these miRNA targets against CLCuBV following suppression of RNAi-mediated virus control through translational inhibition or cleavage of viral mRNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Glyphosate resistance: state of knowledge

Science.gov (United States)

Sammons, Robert Douglas; Gaines, Todd A

2014-01-01

Studies of mechanisms of resistance to glyphosate have increased current understanding of herbicide resistance mechanisms. Thus far, single-codon non-synonymous mutations of EPSPS (5-enolypyruvylshikimate-3-phosphate synthase) have been rare and, relative to other herbicide mode of action target-site mutations, unconventionally weak in magnitude for resistance to glyphosate. However, it is possible that weeds will emerge with non-synonymous mutations of two codons of EPSPS to produce an enzyme endowing greater resistance to glyphosate. Today, target-gene duplication is a common glyphosate resistance mechanism and could become a fundamental process for developing any resistance trait. Based on competition and substrate selectivity studies in several species, rapid vacuole sequestration of glyphosate occurs via a transporter mechanism. Conversely, as the chloroplast requires transporters for uptake of important metabolites, transporters associated with the two plastid membranes may separately, or together, successfully block glyphosate delivery. A model based on finite glyphosate dose and limiting time required for chloroplast loading sets the stage for understanding how uniquely different mechanisms can contribute to overall glyphosate resistance. PMID:25180399

Genetic regulation of salt stress tolerance revealed by RNA-Seq in cotton diploid wild species, Gossypium davidsonii.

Science.gov (United States)

Zhang, Feng; Zhu, Guozhong; Du, Lei; Shang, Xiaoguang; Cheng, Chaoze; Yang, Bing; Hu, Yan; Cai, Caiping; Guo, Wangzhen

2016-02-03

Cotton is an economically important crop throughout the world, and is a pioneer crop in salt stress tolerance research. Investigation of the genetic regulation of salinity tolerance will provide information for salt stress-resistant breeding. Here, we employed next-generation RNA-Seq technology to elucidate the salt-tolerant mechanisms in cotton using the diploid cotton species Gossypium davidsonii which has superior stress tolerance. A total of 4744 and 5337 differentially expressed genes (DEGs) were found to be involved in salt stress tolerance in roots and leaves, respectively. Gene function annotation elucidated salt overly sensitive (SOS) and reactive oxygen species (ROS) signaling pathways. Furthermore, we found that photosynthesis pathways and metabolism play important roles in ion homeostasis and oxidation balance. Moreover, our studies revealed that alternative splicing also contributes to salt-stress responses at the posttranscriptional level, implying its functional role in response to salinity stress. This study not only provides a valuable resource for understanding the genetic control of salt stress in cotton, but also lays a substantial foundation for the genetic improvement of crop resistance to salt stress.

Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres

Science.gov (United States)

Emergent phenotypes are common in polyploids relative to their diploid progenitors, a phenomenon exemplified by spinnable cotton fibers. Following 15-18 fold paleopolyploidy, allopolyploidy 1-2 million years ago reunited divergent Gossypium genomes, imparting new combinatorial complexity that might ...

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

OpenAIRE

Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

2005-01-01

Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

Overview of glyphosate-resistant weeds worldwide.

Science.gov (United States)

Heap, Ian; Duke, Stephen O

2018-05-01

Glyphosate is the most widely used and successful herbicide discovered to date, but its utility is now threatened by the occurrence of several glyphosate-resistant weed species. Glyphosate resistance first appeared in Lolium rigidum in an apple orchard in Australia in 1996, ironically the year that the first glyphosate-resistant crop (soybean) was introduced in the USA. Thirty-eight weed species have now evolved resistance to glyphosate, distributed across 37 countries and in 34 different crops and six non-crop situations. Although glyphosate-resistant weeds have been identified in orchards, vineyards, plantations, cereals, fallow and non-crop situations, it is the glyphosate-resistant weeds in glyphosate-resistant crop systems that dominate the area infested and growing economic impact. Glyphosate-resistant weeds present the greatest threat to sustained weed control in major agronomic crops because this herbicide is used to control weeds with resistance to herbicides with other sites of action, and no new herbicide sites of action have been introduced for over 30 years. Industry has responded by developing herbicide resistance traits in major crops that allow existing herbicides to be used in a new way. However, over reliance on these traits will result in multiple-resistance in weeds. Weed control in major crops is at a precarious point, where we must maintain the utility of the herbicides we have until we can transition to new weed management technologies. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

Directory of Open Access Journals (Sweden)

Liping Ke

Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

Glyphosate-Resistant Goosegrass from Mississippi

Directory of Open Access Journals (Sweden)

Vijay K. Nandula

2013-05-01

Full Text Available A suspected glyphosate-resistant goosegrass [Eleusine indica (L. Gaertn.] population, found in Washington County, Mississippi, was studied to determine the level of resistance and whether the resistance was due to a point mutation, as was previously identified in a Malaysian population. Whole plant dose response assays indicated a two- to four-fold increase in resistance to glyphosate. Leaf disc bioassays based on a glyphosate-dependent increase in shikimate levels indicated a five- to eight-fold increase in resistance. Sequence comparisons of messenger RNA for epsps, the gene encoding the enzyme 5-enolpyruvylshikimate-3-phosphate synthase, from resistant and sensitive goosegrass, revealed a cytosine to thymine nucleotide change at position 319 in the resistant accessions. This single nucleotide polymorphism causes a proline to serine amino acid substitution at position 106 in 5-enolpyruvylshikimate-3-phosphate synthase. A real-time polymerase chain reaction assay using DNA probes specific for the nucleotide change at position 319 was developed to detect this polymorphism. Goosegrass from 42 locations were screened, and the results indicated that glyphosate-resistant goosegrass remained localized to where it was discovered. Pendimethalin, s-metolachlor, clethodim, paraquat and fluazifop controlled resistant goosegrass 93% to 100%, indicating that several control options for glyphosate-resistant goosegrass are available.

Genome-wide cloning, identification, classification and functional analysis of cotton heat shock transcription factors in cotton (Gossypium hirsutum).

Science.gov (United States)

Wang, Jun; Sun, Na; Deng, Ting; Zhang, Lida; Zuo, Kaijing

2014-11-06

Heat shock transcriptional factors (Hsfs) play important roles in the processes of biotic and abiotic stresses as well as in plant development. Cotton (Gossypium hirsutum, 2n=4x=(AD)2=52) is an important crop for natural fiber production. Due to continuous high temperature and intermittent drought, heat stress is becoming a handicap to improve cotton yield and lint quality. Recently, the related wild diploid species Gossypium raimondii genome (2n=2x=(D5)2=26) has been fully sequenced. In order to analyze the functions of different Hsfs at the genome-wide level, detailed characterization and analysis of the Hsf gene family in G. hirsutum is indispensable. EST assembly and genome-wide analyses were applied to clone and identify heat shock transcription factor (Hsf) genes in Upland cotton (GhHsf). Forty GhHsf genes were cloned, identified and classified into three main classes (A, B and C) according to the characteristics of their domains. Analysis of gene duplications showed that GhHsfs have occurred more frequently than reported in plant genomes such as Arabidopsis and Populus. Quantitative real-time PCR (qRT-PCR) showed that all GhHsf transcripts are expressed in most cotton plant tissues including roots, stems, leaves and developing fibers, and abundantly in developing ovules. Three expression patterns were confirmed in GhHsfs when cotton plants were exposed to high temperature for 1 h. GhHsf39 exhibited the most immediate response to heat shock. Comparative analysis of Hsfs expression differences between the wild-type and fiberless mutant suggested that Hsfs are involved in fiber development. Comparative genome analysis showed that Upland cotton D-subgenome contains 40 Hsf members, and that the whole genome of Upland cotton contains more than 80 Hsf genes due to genome duplication. The expression patterns in different tissues in response to heat shock showed that GhHsfs are important for heat stress as well as fiber development. These results provide an improved

GhNAC18 , a novel cotton ( Gossypium hirsutum L.) NAC gene, is ...

African Journals Online (AJOL)

GhNAC18 is a novel NAC gene that was isolated from cotton (Gossypium hirsutum L.). The full-length cDNA was 1511 bp including an open reading frame of 1260 bp in length and encodes a protein of 419 amino acids. With qRT-PCR analysis, GhNAC18 was downregulated during natural and dark-induced senescence, ...

Rapid diversification of the cotton genus (Gossypium: Malvaceae) revealed by analysis of sixteen nuclear and chloroplast genes.

Science.gov (United States)

Richard C. Cronn; Randall L. Small; Tamara Hanselkorn; Jonathan F. Wendel

2002-01-01

Previous molecular phylogenetic studies have failed to resolve the branching order among the major cotton (Gossypium) lineages, and it has been unclear whether this reflects actual history (rapid radiation) or sampling properties of the genes evaluated. In this paper, we reconsider the phylogenetic relationships of diploid cotton genome groups using DNA sequences from...

Evolution of insect pest and disease resistant, high-yielding and improved quality varieties of cotton by use of ionizing radiation. Part of a coordinated programme on the use of induced mutations for disease resistance in crop plants

International Nuclear Information System (INIS)

Vasti, S.M.

1981-06-01

Disease resistant, high yielding and higher quality cotton varieties were developed. 42 interspecific hybrid progenies of earlier crosses between Gossypium barbadense and Gossypium tomentosum or Gossypium barbadense and Gossypium hirsutum were included. Out of these, 22 progenies in F 3 generation were irradiated by gamma radiation doses of 20 and 25 kR. A list is given of interspecific hybrid progenies, as are the lists of boll rot susceptible and resistant plants in the irradiated and non-irradiated populations and/or successful crosses made between 1977 and 1978

Effects of rotation of cotton (Gossypium hirsutum L.) and soybean [Glycine max (L.) Merr.] crops on soil fertility in Elizabeth, Mississippi, USA

OpenAIRE

H.A., Reddy, K. and Pettigrew, W.T.

2018-01-01

The effects of cotton (Gossypium hirsutum L.): soybean [Glycine max (L.) Merr.] rotation on the soil fertility levels are limited. An irrigated soybean: cotton rotation experiment was conducted from 2012 through 2015 near Elizabeth, Mississippi, USA. The crop rotation sequences were included continuous cotton (CCCC), continuous soybean (SSSS), cotton-soybean-cotton-soybean (CSCS), cotton-soybean-soybean-cotton (CSSC), soybean-cotton-cotton-soybean (SCCS), soybean-cotton-soybean-cotton (SCSC)....

Genetics of the ovule fuzzless trait in Gossypium arboreum germplasm line PI 615737

Science.gov (United States)

The diploid cotton species Gossypium arboreum possesses many favorable agronomic traits such as drought tolerance and disease resistance, which can be utilized in the development of improved upland cotton cultivars. The USDA National Plant Germplasm System maintains more than 1,600 G. arboreum acces...

Glyphosate-resistant goosegrass from Mississippi

Science.gov (United States)

A glyphosate resistant population of goosegrass (Eleusine indica (L.) Gaertn.) was documented near Stoneville, Mississippi, USA, in an area which had received multiple applications of glyphosate each year for the previous eleven years. Resistance ratios based on dose response growth reduction assays...

Genotype and planting density effects on rooting traits and yield in cotton (Gossypium hirsutum L.)

NARCIS (Netherlands)

Zhang, L.Z.; Li, B.G.; Yan, G.T.; Werf, van der W.; Spiertz, J.H.J.; Zhang, S.P.

2006-01-01

Root density distribution of plants is a major indicator of competition between plants and determines resource capture from the soil. This experiment was conducted in 2005 at Anyang, located in the Yellow River region, Henan Province, China. Three cotton (Gossypium hirsutum L.) cultivars were

Weeds and ground-dwelling predators' response to two different weed management systems in glyphosate-tolerant cotton: A farm-scale study.

Science.gov (United States)

García-Ruiz, Esteban; Loureiro, Íñigo; Farinós, Gema P; Gómez, Pablo; Gutiérrez, Elena; Sánchez, Francisco Javier; Escorial, María Concepción; Ortego, Félix; Chueca, María Cristina; Castañera, Pedro

2018-01-01

The use of glyphosate, as a post-emergence broad-spectrum herbicide in genetically modified glyphosate-tolerant (GT) cotton, supposes a big change in weed management programs with respect to a conventional regime. Thus, alterations in arable flora and arthropod fauna must be considered when evaluating their potential impacts. A 3-year farm-scale study was conducted in a 2-ha GT cotton crop, in southern Spain, to compare the effects of conventional and glyphosate herbicide regimes on weed abundance and diversity and their consequences for ground-dwelling predators. Surveys reveal that weed density was relatively low within all treatments with a few dominant species, with significantly higher weed densities and modifications of the floristic composition in glyphosate-treated plots that led to an increase in the abundance of Portulaca oleracea and to a reduction in plant diversity. The activity-density of the main predatory arthropod taxa (spiders, ground beetles, rove beetles and earwigs) varied among years, but no significant differences were obtained between conventional and glyphosate herbicide regimes. However, significant differences between treatments were obtained for ground beetles species richness and diversity, being higher under the glyphosate herbicide regime, and a positive correlation with weed density could be established for both parameters. The implications of these findings to weed control in GT cotton are discussed.

Glyphosate resistance in Ambrosia trifida: Part 1. Novel rapid cell death response to glyphosate.

Science.gov (United States)

Van Horn, Christopher R; Moretti, Marcelo L; Robertson, Renae R; Segobye, Kabelo; Weller, Stephen C; Young, Bryan G; Johnson, William G; Schulz, Burkhard; Green, Amanda C; Jeffery, Taylor; Lespérance, Mackenzie A; Tardif, François J; Sikkema, Peter H; Hall, J Christopher; McLean, Michael D; Lawton, Mark B; Sammons, R Douglas; Wang, Dafu; Westra, Philip; Gaines, Todd A

2018-05-01

Glyphosate-resistant (GR) Ambrosia trifida is now present in the midwestern United States and in southwestern Ontario, Canada. Two distinct GR phenotypes are known, including a rapid response (GR RR) phenotype, which exhibits cell death within hours after treatment, and a non-rapid response (GR NRR) phenotype. The mechanisms of resistance in both GR RR and GR NRR remain unknown. Here, we present a description of the RR phenotype and an investigation of target-site mechanisms on multiple A. trifida accessions. Glyphosate resistance was confirmed in several accessions, and whole-plant levels of resistance ranged from 2.3- to 7.5-fold compared with glyphosate-susceptible (GS) accessions. The two GR phenotypes displayed similar levels of resistance, despite having dramatically different phenotypic responses to glyphosate. Glyphosate resistance was not associated with mutations in EPSPS sequence, increased EPSPS copy number, EPSPS quantity, or EPSPS activity. These encompassing results suggest that resistance to glyphosate in these GR RR A. trifida accessions is not conferred by a target-site resistance mechanism. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Simple Sequence Repeat (SSR Genetic Linkage Map of D Genome Diploid Cotton Derived from an Interspecific Cross between Gossypium davidsonii and Gossypium klotzschianum

Directory of Open Access Journals (Sweden)

Joy Nyangasi Kirungu

2018-01-01

Full Text Available The challenge in tetraploid cotton cultivars is the narrow genetic base and therefore, the bottleneck is how to obtain interspecific hybrids and introduce the germplasm directly from wild cotton to elite cultivars. Construction of genetic maps has provided insight into understanding the genome structure, interrelationships between organisms in relation to evolution, and discovery of genes that carry important agronomic traits in plants. In this study, we generated an interspecific hybrid between two wild diploid cottons, Gossypium davidsonii and Gossypium klotzschianum, and genotyped 188 F2:3 populations in order to develop a genetic map. We screened 12,560 SWU Simple Sequence Repeat (SSR primers and obtained 1000 polymorphic markers which accounted for only 8%. A total of 928 polymorphic primers were successfully scored and only 728 were effectively linked across the 13 chromosomes, but with an asymmetrical distribution. The map length was 1480.23 cM, with an average length of 2.182 cM between adjacent markers. A high percentage of the markers on the map developed, and for the physical map of G. raimondii, exhibited highly significant collinearity, with two types of duplication. High level of segregation distortion was observed. A total of 27 key genes were identified with diverse roles in plant hormone signaling, development, and defense reactions. The achievement of developing the F2:3 population and its genetic map constructions may be a landmark in establishing a new tool for the genetic improvement of cultivars from wild plants in cotton. Our map had an increased recombination length compared to other maps developed from other D genome cotton species.

Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

Science.gov (United States)

Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

Weeds and ground-dwelling predators′ response to two different weed management systems in glyphosate-tolerant cotton: A farm-scale study

Science.gov (United States)

Farinós, Gema P.; Gómez, Pablo; Gutiérrez, Elena; Sánchez, Francisco Javier; Escorial, María Concepción; Ortego, Félix; Chueca, María Cristina; Castañera, Pedro

2018-01-01

The use of glyphosate, as a post-emergence broad-spectrum herbicide in genetically modified glyphosate-tolerant (GT) cotton, supposes a big change in weed management programs with respect to a conventional regime. Thus, alterations in arable flora and arthropod fauna must be considered when evaluating their potential impacts. A 3-year farm-scale study was conducted in a 2-ha GT cotton crop, in southern Spain, to compare the effects of conventional and glyphosate herbicide regimes on weed abundance and diversity and their consequences for ground-dwelling predators. Surveys reveal that weed density was relatively low within all treatments with a few dominant species, with significantly higher weed densities and modifications of the floristic composition in glyphosate-treated plots that led to an increase in the abundance of Portulaca oleracea and to a reduction in plant diversity. The activity-density of the main predatory arthropod taxa (spiders, ground beetles, rove beetles and earwigs) varied among years, but no significant differences were obtained between conventional and glyphosate herbicide regimes. However, significant differences between treatments were obtained for ground beetles species richness and diversity, being higher under the glyphosate herbicide regime, and a positive correlation with weed density could be established for both parameters. The implications of these findings to weed control in GT cotton are discussed. PMID:29351549

Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

Science.gov (United States)

Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

2016-09-01

Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

Science.gov (United States)

Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

2013-12-01

Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

Resposta de cultivares de algodoeiro a subdoses de glyphosate Response of cotton cultivars to reduced rates of glyphosate

Directory of Open Access Journals (Sweden)

O.M. Yamashita

2005-12-01

Full Text Available Avaliou-se a resposta de nove cultivares de algodoeiro, de importância econômica no Estado do Mato Grosso, quanto à intoxicação causada por subdoses de glyphosate. Os cultivares de algodoeiro utilizados foram Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal, BRS Facual, Antares e Coodetec 407. As plantas foram cultivadas em tubetes preenchidos com substrato de solo e mantidas em casa telada, tendo recebido a aplicação do glyphosate aos 20 dias após a emergência, época em que apresentavam quatro folhas verdadeiras. As subdoses de glyphosate, simulando deriva, foram de 270 e 540 g ha-1. Também foi utilizada testemunha, sem aplicação do herbicida, para efeito de comparação. Foram realizadas avaliações semanais até 42 dias após a aplicação dos tratamentos (DAA, período em que também foi tomada a altura das plantas. Os sintomas visuais de intoxicação iniciaram-se aos 3 DAA, caracterizados pelo amarelecimento das pontas das folhas mais novas, seguido de murchamento do ápice das plantas. Na dose de 270 g ha-1 esses sintomas foram de baixa intensidade, mas a 540 g ha-1 causaram, na maioria dos casos, toxidez "preocupante" a "muito alta". Os cultivares BRS Facual e FM 986 mostraram-se os mais suscetíveis. A altura das plantas foi mais afetada quando se aplicou a menor dose de glyphosate. Houve recuperação de todos os cultivares tratados com 270 g ha-1 de glyphosate até os 42 DAA. Quando tratados com 540 g ha-1 de glyphosate, os cultivares Fabrika, Coodetec 407, BRS-Facual e ITA-90 foram mais sensíveis, apresentando redução de altura entre 84 e 90% aos 42 DAA. Os cultivares menos sensíveis na dose de 270 g ha-1 de glyphosate não foram os mesmos para a dose de 540 g ha-1.The response of nine cotton cultivars economically important in the state of Mato Grosso was evaluated in relation to the toxicity caused by reduced rates of glyphosate. The cotton cultivars used were Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal

Mechanism of Resistance to Glyphosate in Lolium perenne from Argentina

Directory of Open Access Journals (Sweden)

Marcos Yanniccari

2017-10-01

Full Text Available In Argentina, glyphosate resistance was reported in a Lolium perenne population after 12 years of successful herbicide use. The aim of the current paper was to put in evidence for the mechanism of glyphosate resistance of this weed. Susceptible leaves treated with different doses of glyphosate and incubated in vitro showed an accumulation of shikimic acid of around three to five times the basal level, while no changes were detected in leaves of glyphosate-resistant plants. The resistance mechanism prevents shikimate accumulation in leaves, even under such tissue-isolation conditions. The activity of the glyphosate target enzyme (EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase was quantified at different herbicide concentrations. EPSPS from resistant plants showed no difference in glyphosate-sensitivity compared to EPSPS from susceptible plants, and, accordingly, no amino acid substitution causing mutations associated with resistance were found. While the glyphosate target enzymes were equally sensitive, the basal EPSPS activity in glyphosate resistant plants was approximately 3-fold higher than the EPSPS activity in susceptible plants. This increased EPSPS activity in glyphosate resistant plants was associated with a 15-fold higher expression of EPSPS compared with susceptible plants. Therefore, the over-expression of EPSPS appears to be the main mechanism responsible for resistance to glyphosate. This mechanism has a constitutive character and has important effects on plant fitness, as recently reported.

Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species.

Science.gov (United States)

Ulloa, M; Wang, C; Saha, S; Hutmacher, R B; Stelly, D M; Jenkins, J N; Burke, J; Roberts, P A

2016-04-01

Chromosome substitution (CS) lines in plants are a powerful genetic resource for analyzing the contribution of chromosome segments to phenotypic variance. In this study, a series of interspecific cotton (Gossypium spp.) CS lines were used to identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode or fungal disease resistance traits. The CS lines were developed in the G. hirsutum L. TM-1 background with chromosome or chromosome segment substitutions from G. barbadense L. Pima 3-79 or G. tomentosum. Root-knot nematode (Meloidogyne incognita) and fusarium wilt (Fusarium oxysporum f. sp. vasinfectum) (races 1 and 4) resistance alleles and quantitative trait loci (QTL) previously placed on cotton chromosomes using SSR markers in two interspecific recombinant inbred line populations were chosen for testing. Phenotypic responses of increased resistance or susceptibility in controlled inoculation and infested field assays confirmed the resistance QTLs, based on substitution with the positive or negative allele for resistance. Lines CS-B22Lo, CS-B04, and CS-B18 showed high resistance to nematode root-galling, confirming QTLs on chromosomes 4 and 22 (long arm) with resistance alleles from Pima 3-79. Line CS-B16 had less fusarium race 1-induced vascular root staining and higher percent survival than the TM-1 parent, confirming a major resistance QTL on chromosome 16. Lines CS-B(17-11) and CS-B17 had high fusarium race 4 vascular symptoms and low survival due to susceptible alleles introgressed from Pima 3-79, confirming the localization on chromosome 17 of an identified QTL with resistance alleles from TM1 and other resistant lines. Analyses validated regions on chromosomes 11, 16, and 17 harboring nematode and fusarium wilt resistance genes and demonstrated the value of CS lines as both a germplasm resource for breeding programs and as a powerful genetic analysis tool for determining QTL effects for disease

Response of Cotton (Gossypium Hirsutum L.) to Nitrogen Phosphorous Fertilizers in Western Kenya

International Nuclear Information System (INIS)

Kouko, W.O; Owino, G.

1999-01-01

The requirements for nitrogen and phosphorous fertilizers for growing cotton (Gossypium hirsutum L.) in Kenya are 26-kg N ha - 1 and 27 kg P ha - 1, respectively. Calcium ammonium nitrate (CAN) was recommended at the rate of 100 kg ha - 1 for black cotton soils while double superphosphate (DSP) was recommended at the rate of 150 kg ha - 1 on reddish brown clays. However, experiments conducted on a major soil types on which cotton is grown in Kenya showed that, soil colour is not the best indicator of nutrients supply power of the soil. It was found that Verto-eutric planosols of National Fibre Research Centres-Kibos requires application of 13-kg ha - 1 as CAN for optimal yields. Ferralo-eurtric Acrisols of Alupe Agricultural Research Sub-Centre, Busia needed 26-kg N ha - 1 and 9 kg P ha - 1 to give high yields. At Siaya FTC 9 kg P ha - 1 was adequate in providing the highest yields without nitrogen. Strict observation of recommended agronomic practices for growing cotton and good soil management practices for growing cotton and good soil management practices were observed a prerequisite for high response and efficient utilisation of fertilizers

Exp2 polymorphisms associated with variation for fiber quality properties in cotton (Gossypium spp.

Directory of Open Access Journals (Sweden)

Daohua He

2014-10-01

Full Text Available Plant expansins are a group of extracellular proteins thought to affect the quality of cotton fibers. Previous expression profile analysis revealed that six Expansin A genes are present in cotton, of which two (GhExp1 and GhExp2 produce transcripts that are specific to the developing cotton fiber. To identify the phenotypic function of Exp2, and to determine whether nucleotide variation among alleles of Exp2 affects fiber quality, candidate gene association mapping was conducted. Gene-specific primers were designed to amplify the Exp2 gene. By amplicon sequencing, the nucleotide diversity of Exp2 was investigated across 92 accessions (including 7 Gossypium arboreum, 74 Gossypium hirsutum, and 11 Gossypium barbadense accessions with different fiber qualities. Twenty-six SNPs and seven InDels including 14 from the coding region of Exp2 were detected, forming twelve distinct haplotypes in the cotton collection. Among the 14 SNPs in the coding region, five were missense mutations and nine were synonymous nucleotide changes. The average SNP/InDel per nucleotide ratio was 2.61% (one SNP per 39 bp, with 1.81 and 3.87% occurring in coding and non-coding regions, respectively. Nucleotide and haplotype diversity across the entire Exp2 region was 0.00603 (π and 0.844, respectively, and diversity in non-coding regions was higher than that in coding regions. For linkage disequilibrium (LD, the mean r2 value for all polymorphism loci pairs was 0.48, and LD did not decay over 748 bp. Based on 132 simple sequence repeat (SSR loci evenly covering 26 chromosomes, the population structure was estimated, and the accessions were divided into seven groups that agreed well with their genomic origin and evolutionary history. A general linear model was used to calculate the Exp2-wide diversity–trait associations of 5 fiber quality traits, considering population structure (Q. Four SNPs in Exp2 were associated with at least one of the fiber quality traits, but not with

Pool of resistance mechanisms to glyphosate in Digitaria insularis.

Science.gov (United States)

de Carvalho, Leonardo Bianco; Alves, Pedro Luis da Costa Aguiar; González-Torralva, Fidel; Cruz-Hipolito, Hugo Enrique; Rojano-Delgado, Antonia María; De Prado, Rafael; Gil-Humanes, Javier; Barro, Francisco; de Castro, María Dolores Luque

2012-01-18

Digitaria insularis biotypes resistant to glyphosate have been detected in Brazil. Studies were carried out in controlled conditions to determine the role of absorption, translocation, metabolism, and gene mutation as mechanisms of glyphosate resistance in D. insularis. The susceptible biotype absorbed at least 12% more (14)C-glyphosate up to 48 h after treatment (HAT) than resistant biotypes. High differential (14)C-glyphosate translocation was observed at 12 HAT, so that >70% of the absorbed herbicide remained in the treated leaf in resistant biotypes, whereas 42% remained in the susceptible biotype at 96 HAT. Glyphosate was degraded to aminomethylphosphonic acid (AMPA), glyoxylate, and sarcosine by >90% in resistant biotypes, whereas a small amount of herbicide (up to 11%) was degraded by the susceptible biotype up to 168 HAT. Two amino acid changes were found at positions 182 and 310 in EPSPS, consisting of a proline to threonine and a tyrosine to cysteine substitution, respectively, in resistant biotypes. Therefore, absorption, translocation, metabolism, and gene mutation play an important role in the D. insularis glyphosate resistance.

Influence of Soil Temperature on Meloidogyne incognita Resistant and Susceptible Cotton, Gossypium hirsutum

OpenAIRE

Carter, William W.

1982-01-01

The degree of resistance by a cotton plant to Meloidogyne incognita is affected by soil temperature, particularly in moderately resistant cultivars, The total number of nematodes in the resistant and moderately resistant rools at 35 C was equal to, or greater than, the number in susceptible roots at 20, 25, or 30 C. A shift in numbers to developing and egg-bearing forms of nematodes in the susceptible cultivar as tentperature increased indicates development was affected by temperature rather ...

Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).

Science.gov (United States)

Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F

2006-01-01

Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.

Selectivity and stability of vegetation-applied herbicides in cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

T. Barakova

2016-06-01

Full Text Available Abstract. An experiment was carried out during 2013 – 2015 in the experimental field of the Field Crops Institute, Chirpan, with two cotton cultivars − Helius and Darmi (Gossypium hirsutum L.. Herbicides: Goal 2 E, oxyfluorfen (80 ml/da; Linuron 45 SC, linuron (200 ml/da; Wing-P, pendimethalin + dimethenamid (400 ml/da; Merlin 750 WG, isoxaflutol (5 g/da; Bazagran 480 SL, bentazone (150 ml/da were investigated. They were treated separately or combined with growth regulator Amalgerol (500 ml/da or foliar fertilizer Lactofol O (500 ml/da in the budding stage of the cotton. It was established that selectivity is the lowest in the two cotton cultivars with herbicides Linuron 45 CK and Merlin 750 WG. The purpose of this investigation was to establish the selectivity and stability of some herbicides and their tank mixtures on the cotton by influence of different meteorological conditions. It has been found that the highest phytotoxicity on cotton is given the vegetation-applied herbicides Merlin and Linuron. Foliar fertilizer Laktofol O reduces phytotoxicity of herbicides Goal, Wing, Merlin and Bazagran in two cotton cultivars. Herbicides Wing and Bazagran have excellent selectivity for the two cotton cultivars – Helius and Darmi. The highest yield was obtained by vegetation treatment with herbicide Bazagran, followed by herbicides Wing and Goal. Tank mixtures of Goal, Bazagran and Wing with Laktofol, followed by those with Amalgerol are technologically the most valuable. They combine high yield with high stability over the years. Аlone application of herbicides Linuron and Merlin and their tank mixtures with Amalgerol and Laktofol have low estimate.

Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

KAUST Repository

Idris, Ali

2010-12-01

A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

Effect of ecological management of weed control on economical income, yield and yield components of cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

A. Zare Feizabadi

2016-04-01

Full Text Available In order to compare of ecological management of weed control on economical income, yield and yield components of cotton (Gossypium hirsutum L., a Randomized Complete Block design with 12 treatments and four replications was conducted in Mahvelat of Khorasan Razavi province, Iran. Treatments consisted of weeding, harrowing, burning, two times weeding, weeding + harrowing, weeding + burning, harrowing + harrowing, harrowing + weeding, harrowing + burning, weeding+ harrowing+ burning, weed free and weedy as a check treatment. Investigated traits were plant height, number of boll in plant, 20 boll weight, 20 boll cotton lint weight, cotton lint yield per plant, cotton yield, number and biomass of weeds, outcome, net and gross income. The result showed that treatments had significant effect (p

Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

NARCIS (Netherlands)

Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

2011-01-01

Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).

Science.gov (United States)

He, Qiuling; Zhu, Shuijin; Zhang, Baohong

2014-09-01

MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.

Effects of Different Densities of Cotton (Gossypium Hirsutum and Common Lambsquarter (Chenopodium Album on Some Cotton Growth Characteristics in Birjand Condition

Directory of Open Access Journals (Sweden)

M. Velayati

2011-01-01

Full Text Available Abstract Weeds are problematic plants in agroecosystems as a competitor for crops. In order to evaluate effects of cotton (Gossypium hirsutum and common lambsquarter (Chenopodium album densities on some crop growth indices, a study was conducted during 2006 in Experimental Station of Faculty of Agriculture, The University of Birjand as factorial experiment based on complete randomized block design with four replications. Three densities of cotton (6, 9 and 12 Pl.m-2 and four weed densities (0, 6, 9 and 12 Pl.m-2 were used to provide different weed interference levels. Indeed, three plots in each replication were intended to cultivation of lambsquarter alone at 6, 9 or 12 Pl.m-2. Results showed that crop growth rate (CGR of cotton was influenced by weed density, and its relative growth rate (RGR and net assimilation rate (NAR indicated a declining trend as weed density increased. Dry matter accumulation of cotton also was affected negatively by weed densities, as interference of lambsquarter at 6, 9 and 12 Pl.m-2 resulted to 35, 42 and 48 percent dry matter reduction, respectively, than weed-free treatment. Increasing of cotton density could partly compensate for negative impact of weed attendance on cotton growth. Thus, it seems higher plant densities can be used as a managing tool against weeds in cotton fields to avoid reduction of yield. Keywords: Cotton, Density, Weed, competition, Growth analysis

Interactions of tillage and cover crop on water, sediment, and pre-emergence herbicide loss in glyphosate-resistant cotton: implications for the control of glyphosate-resistant weed biotypes.

Science.gov (United States)

Krutz, L Jason; Locke, Martin A; Steinriede, R Wade

2009-01-01

The need to control glyphosate [N-(phosphonomethyl)glycine]-resistant weed biotypes with tillage and preemergence herbicides in glyphosate-resistant crops (GRCs) is causing a reduction in no-tillage hectarage thereby threatening the advances made in water quality over the past decade. Consequently, if environmental gains afforded by GRCs are to be maintained, then an in-field best management practice (BMP) compatible with tillage is required for hectarage infested with glyphosate-resistant weed biotypes. Thus, 1 d after a preemergent application of fluometuron [N,N-dimethyl-N'-(3-(trifluoromethyl)phenyl)urea] (1.02 kg ha(-1)) and metolachlor [2-chloro-N-(2-ethyl-6-methylphenyl)-N-(2-methoxy-1-methylethyl)acetamide] (1.18 kg ha(-1)) to a Dundee silt loam (fine-silty, mixed, active, thermic Typic Endoaqualf), simulated rainfall (60 mm h(-1)) was applied to 0.0002-ha microplots for approximately 1.25 h to elucidate tillage (no tillage [NT] and reduced tillage [RT])and cover crop (no cover [NC] and rye cover [RC]) effects on water, sediment, and herbicide loss in surface runoff. Regardless of tillage, RC delayed time-to-runoff 1.3-fold, reduced cumulative runoff volume 1.4-fold, and decreased cumulative sediment loss 4.7-fold. Cumulative fluometuron loss was not affected by tillage or cover crop. Conversely, total metolachlor loss was 1.3-fold lower in NT than RT and 1.4-fold lower in RC than NC. These data indicate that RC can be established in hectarage requiring tillage and potentially curtail water, sediment, and preemergence herbicide losses in the spring to levels equivalent to or better than that of NT, thereby protecting environmental gains provided by GRCs.

Selection of Gossypium hirsutum genotypes for interspecific ...

African Journals Online (AJOL)

FORRESTER

ARS), Crop Genetics Research Unit in. Stoneville, Mississippi ... Key words: Cotton, germplasm, immature embryo, tissue culture, wide-hybridization. INTRODUCTION. Tetraploid upland cotton, Gossypium hirsutum L., is comprised of over 90% ...

Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

Science.gov (United States)

Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

2017-03-01

An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

Phylogeny of the New World diploid cottons (Gossypium L., Malvaceae) based on sequences of three low-copy nuclear genes.

Science.gov (United States)

I. Alvarez; R. Cronn; J.F. Wendel

2005-01-01

American diploid cottons (Gossypium L., subgenus Houzingenia Fryxell) form a monophyletic group of 13 species distributed mainly in western Mexico, extending into Arizona, Baja California, and with one disjunct species each in the Galapagos Islands and Peru. Prior phylogenetic analyses based on an alcohol dehydrogenase gene (...

Coupling of MIC-3 overexpression with the chromosome 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton...

Science.gov (United States)

High levels of resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. We had previously determined that MIC-3 expression played a direct role in suppressing RKN egg...

Proteomic profiling of developing cotton fibers from wild and domesticated Gossypium barbadense.

Science.gov (United States)

Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Grupp, Kara; Chen, Sixue; Wendel, Jonathan F

2013-10-01

Pima cotton (Gossypium barbadense) is widely cultivated because of its long, strong seed trichomes ('fibers') used for premium textiles. These agronomically advanced fibers were derived following domestication and thousands of years of human-mediated crop improvement. To gain an insight into fiber development and evolution, we conducted comparative proteomic and transcriptomic profiling of developing fiber from an elite cultivar and a wild accession. Analyses using isobaric tag for relative and absolute quantification (iTRAQ) LC-MS/MS technology identified 1317 proteins in fiber. Of these, 205 were differentially expressed across developmental stages, and 190 showed differential expression between wild and cultivated forms, 14.4% of the proteome sampled. Human selection may have shifted the timing of developmental modules, such that some occur earlier in domesticated than in wild cotton. A novel approach was used to detect possible biased expression of homoeologous copies of proteins. Results indicate a significant partitioning of duplicate gene expression at the protein level, but an approximately equal degree of bias for each of the two constituent genomes of allopolyploid cotton. Our results demonstrate the power of complementary transcriptomic and proteomic approaches for the study of the domestication process. They also provide a rich database for mining for functional analyses of cotton improvement or evolution. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Phosphorus use efficiency in pima cotton (Gossypium barbadense L. genotypes

Directory of Open Access Journals (Sweden)

Elcio Santos

2015-06-01

Full Text Available In the Brazilian Cerrado, P deficiency restricts cotton production, which requires large amounts of phosphate fertilizer. To improve the yield of cotton crops, genotypes with high P use efficiency must be identified and used. The present study evaluated P uptake and use efficiency of different Gossypium barbadense L. genotypes grown in the Cerrado. The experiment was carried out in a greenhouse with a completely randomized design, 15 x 2 factorial treatment structure (15 genotypes x 2 P levels, and four replicates. The genotypes were MT 69, MT 70, MT 87, MT 91, MT 92, MT 94, MT 101, MT 102, MT 103, MT 105, MT 106, MT 110, MT 112, MT 124, and MT 125; P levels were sufficient (1000 mg pot-1, PS treatment or deficient (PD treatment. Dry matter (DM and P levels were determined in cotton plant parts and used to calculate plant P content and use efficiency. In general, DM and P content were higher in the PS than in the PD treatment, with the exception of root DM and total DM in some genotypes. Genotypes also differed in terms of P uptake and use capacity. In the PS treatment, genotypes MT 92 and MT 102 had the highest response to phosphate fertilization. Genotype MT 69 exhibited the most efficient P uptake in the PD treatment. Genotype MT 124 showed the best shoot physiological efficiency, apparent recovery efficiency, and utilization efficiency, whereas MT 110 exhibited the highest root physiological efficiency.

Glyphosate-Resistant and Conventional Canola (Brassica napus L.) Responses to Glyphosate and Aminomethylphosphonic Acid (AMPA) Treatment.

Science.gov (United States)

Corrêa, Elza Alves; Dayan, Franck E; Owens, Daniel K; Rimando, Agnes M; Duke, Stephen O

2016-05-11

Glyphosate-resistant (GR) canola contains two transgenes that impart resistance to the herbicide glyphosate: (1) the microbial glyphosate oxidase gene (gox) encoding the glyphosate oxidase enzyme (GOX) that metabolizes glyphosate to aminomethylphosphonic acid (AMPA) and (2) cp4 that encodes a GR form of the glyphosate target enzyme 5-enolpyruvylshikimic acid-3-phosphate synthase. The objectives of this research were to determine the phytotoxicity of AMPA to canola, the relative metabolism of glyphosate to AMPA in GR and conventional non-GR (NGR) canola, and AMPA pool sizes in glyphosate-treated GR canola. AMPA applied at 1.0 kg ha(-1) was not phytotoxic to GR or NGR. At this AMPA application rate, NGR canola accumulated a higher concentration of AMPA in its tissues than GR canola. At rates of 1 and 3.33 kg ae ha(-1) of glyphosate, GR canola growth was stimulated. This stimulatory effect is similar to that of much lower doses of glyphosate on NGR canola. Both shikimate and AMPA accumulated in tissues of these glyphosate-treated plants. In a separate experiment in which young GR and NGR canola plants were treated with non-phytotoxic levels of [(14)C]-glyphosate, very little glyphosate was metabolized in NGR plants, whereas most of the glyphosate was metabolized to AMPA in GR plants at 7 days after application. Untreated leaves of GR plants accumulated only metabolites (mostly AMPA) of glyphosate, indicating that GOX activity is very high in the youngest leaves. These data indicate that more glyphosate is transformed to AMPA rapidly in GR canola and that the accumulated AMPA is not toxic to the canola plant.

Herbicide-resistant weed management: focus on glyphosate.

Science.gov (United States)

Beckie, Hugh J

2011-09-01

This review focuses on proactive and reactive management of glyphosate-resistant (GR) weeds. Glyphosate resistance in weeds has evolved under recurrent glyphosate usage, with little or no diversity in weed management practices. The main herbicide strategy for proactively or reactively managing GR weeds is to supplement glyphosate with herbicides of alternative modes of action and with soil-residual activity. These herbicides can be applied in sequences or mixtures. Proactive or reactive GR weed management can be aided by crop cultivars with alternative single or stacked herbicide-resistance traits, which will become increasingly available to growers in the future. Many growers with GR weeds continue to use glyphosate because of its economical broad-spectrum weed control. Government farm policies, pesticide regulatory policies and industry actions should encourage growers to adopt a more proactive approach to GR weed management by providing the best information and training on management practices, information on the benefits of proactive management and voluntary incentives, as appropriate. Results from recent surveys in the United States indicate that such a change in grower attitudes may be occurring because of enhanced awareness of the benefits of proactive management and the relative cost of the reactive management of GR weeds. Copyright © 2011 Society of Chemical Industry.

Agricultural impacts of glyphosate-resistant soybean cultivation in South America.

Science.gov (United States)

Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B

2011-06-08

In the 2009/2010 growing season, Brazil was the second largest world soybean producer, followed by Argentina. Glyphosate-resistant soybeans (GRS) are being cultivated in most of the soybean area in South America. Overall, the GRS system is beneficial to the environment when compared to conventional soybean. GRS resulted in a significant shift toward no-tillage practices in Brazil and Argentina, but weed resistance may reduce this trend. Probably the highest agricultural risk in adopting GRS in Brazil and South America is related to weed resistance due to use of glyphosate. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. Five weed species, in order of importance, Conyza bonariensis (L.) Cronquist, Conyza canadensis (L.) Cronquist, Lolium multiflorum Lam., Digitaria insularis (L.) Mez ex Ekman, and Euphorbia heterophylla L., have evolved resistance to glyphosate in GRS in Brazil. Conyza spp. are the most difficult to control. A glyphosate-resistant biotype of Sorghum halepense L. has evolved in GRS in Argentina and one of D. insularis in Paraguay. The following actions are proposed to minimize weed resistance problem: (a) rotation of GRS with conventional soybeans in order to rotate herbicide modes of action; (b) avoidance of lower than recommended glyphosate rates; (c) keeping soil covered with a crop or legume at intercrop intervals; (d) keeping machinery free of weed seeds; and (d) use of a preplant nonselective herbicide plus residuals to eliminate early weed interference with the crop and to minimize escapes from later applications of glyphosate due to natural resistance of older weeds and/or incomplete glyphosate coverage.

Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L. Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

Directory of Open Access Journals (Sweden)

Renesh Bedre

Full Text Available Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L. pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

Manejo de Conyza bonariensis resistente ao herbicida glyphosate Management of Glyphosate-resistant Conyza bonariensis

Directory of Open Access Journals (Sweden)

J.M. Paula

2011-03-01

Full Text Available C. bonariensis (Conyza bonariensis é uma planta daninha da família Asteraceae, amplamente distribuída no Brasil, com presença marcante nos Estados do Rio Grande do Sul e do Paraná. Biótipos de C. bonariensis resistentes ao glyphosate foram identificados nos Estados do Rio Grande do Sul, Paraná e São Paulo. O objetivo deste trabalho foi avaliar o efeito de diferentes manejos de inverno e na pré-semeadura da soja sobre a população de plantas de C. bonariensis resistente ao herbicida glyphosate. Os resultados evidenciaram que a população de C. bonariensis é maior em áreas mantidas sem cultivo (pousio do que naquelas áreas cultivadas com trigo ou aveia-preta durante o inverno. Observou-se que o trigo e a aveia-preta exercem efeito supressor sobre a população de C. bonariensis, proporcionando maior facilidade de controle com herbicida na pré-semeadura da cultura usada em sucessão. O controle de C. bonariensis resistente ao herbicida glyphosate foi satisfatório quando se utilizaram herbicidas pós-emergentes na cultura do trigo e glyphosate + 2,4-D ou glyphosate + diuron + paraquat na pré-semeadura da soja.Horseweed (Conyza bonariensis, which belongs to the Asteraceae family, is a weed species widely spread in Brazil. Horseweed biotypes resistant to glyphosate, the main herbicide used in Roundup Ready soybean fields, were identified in the states of Rio Grande do Sul and Parana. The aim of this study was to evaluate the effect of different winter and pre-sowing management techniques on soybean plant population of C. bonariensis resistant to glyphosate. The results showed that the population of C. bonariensis is larger in areas maintained fallow than in areas planted with wheat or oats during the winter. Wheat and oats were found to exert a suppressive effect on the population of C. bonariensis, providing greater ease of control with herbicide before seeding in the culture used in succession. The control of glyphosate-resistant C

Evolution and Stress Responses of Gossypium hirsutum SWEET Genes.

Science.gov (United States)

Li, Wei; Ren, Zhongying; Wang, Zhenyu; Sun, Kuan; Pei, Xiaoyu; Liu, Yangai; He, Kunlun; Zhang, Fei; Song, Chengxiang; Zhou, Xiaojian; Zhang, Wensheng; Ma, Xiongfeng; Yang, Daigang

2018-03-08

The SWEET (sugars will eventually be exported transporters) proteins are sugar efflux transporters containing the MtN3_saliva domain, which affects plant development as well as responses to biotic and abiotic stresses. These proteins have not been functionally characterized in the tetraploid cotton, Gossypium hirsutum , which is a widely cultivated cotton species. In this study, we comprehensively analyzed the cotton SWEET gene family. A total of 55 putative G. hirsutum SWEET genes were identified. The GhSWEET genes were classified into four clades based on a phylogenetic analysis and on the examination of gene structural features. Moreover, chromosomal localization and an analysis of homologous genes in Gossypium arboreum , Gossypium raimondii , and G. hirsutum suggested that a whole-genome duplication, several tandem duplications, and a polyploidy event contributed to the expansion of the cotton SWEET gene family, especially in Clade III and IV. Analyses of cis -acting regulatory elements in the promoter regions, expression profiles, and artificial selection revealed that the GhSWEET genes were likely involved in cotton developmental processes and responses to diverse stresses. These findings may clarify the evolution of G. hirsutum SWEET gene family and may provide a foundation for future functional studies of SWEET proteins regarding cotton development and responses to abiotic stresses.

Germination test as a fast method to detect glyphosate-resistant sourgrass

Directory of Open Access Journals (Sweden)

Marcos Altomani Neves Dias

2015-01-01

Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

Germination test as a fast method to detect glyphosate-resistant sourgrass

Directory of Open Access Journals (Sweden)

Marcos Altomani Neves Dias

2015-09-01

Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

Identification of glyphosate resistance in Salsola tragus in north-eastern Oregon.

Science.gov (United States)

Barroso, Judit; Gourlie, Jennifer A; Lutcher, Larry K; Liu, Mingyang; Mallory-Smith, Carol A

2018-05-01

Farmers in the low-rainfall region of eastern Oregon rely on repeated applications of non-selective herbicides, predominately glyphosate, to control Salsola tragus in no-till fallow systems. Reports of poor glyphosate effectiveness have increased in recent years. Reduced efficacy is often attributed to dust, water stress, or generally poor growing conditions during application. Inadequate control also may be the result of the evolution of glyphosate resistance. Therefore, studies were undertaken to determine if glyphosate-resistant S. tragus populations occur in Oregon. Results from dose-response studies confirmed glyphosate resistance in three of 10 Oregon Salsola tragus populations. The ratio I 50R /I 50S from dose-response curves was, on average, 3.1 for the relative dry biomass per plant and 3.2 for the % of surviving plants per pot in these three populations. Plant mortality at recommended glyphosate doses for the resistant populations was less than 30% 3 weeks after treatment. Glyphosate resistance in S. tragus highlights the imperative need to diversify weed control strategies to preserve the longevity and sustainability of herbicides in semi-arid cropping systems of the Pacific Northwest. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Elevated CO2, warmer temperatures and soil water deficit affect plant growth, physiology and water use of cotton (Gossypium hirsutum L.)

Science.gov (United States)

Changes in temperature, atmospheric [CO2] and precipitation under the scenarios of projected climate change present a challenge to crop production, and may have significant impacts on the physiology, growth and yield of cotton (Gossypium hirsutum L.). A glasshouse experiment explored the early growt...

Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin

2013-03-28

Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G

Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts.

Science.gov (United States)

Hulse-Kemp, Amanda M; Ashrafi, Hamid; Zheng, Xiuting; Wang, Fei; Hoegenauer, Kevin A; Maeda, Andrea B V; Yang, S Samuel; Stoffel, Kevin; Matvienko, Marta; Clemons, Kimberly; Udall, Joshua A; Van Deynze, Allen; Jones, Don C; Stelly, David M

2014-10-30

Cotton (Gossypium spp.) is the largest producer of natural fibers for textile and is an important crop worldwide. Crop production is comprised primarily of G. hirsutum L., an allotetraploid. However, elite cultivars express very small amounts of variation due to the species monophyletic origin, domestication and further bottlenecks due to selection. Conversely, wild cotton species harbor extensive genetic diversity of prospective utility to improve many beneficial agronomic traits, fiber characteristics, and resistance to disease and drought. Introgression of traits from wild species can provide a natural way to incorporate advantageous traits through breeding to generate higher-producing cotton cultivars and more sustainable production systems. Interspecific introgression efforts by conventional methods are very time-consuming and costly, but can be expedited using marker-assisted selection. Using transcriptome sequencing we have developed the first gene-associated single nucleotide polymorphism (SNP) markers for wild cotton species G. tomentosum, G. mustelinum, G. armourianum and G. longicalyx. Markers were also developed for a secondary cultivated species G. barbadense cv. 3-79. A total of 62,832 non-redundant SNP markers were developed from the five wild species which can be utilized for interspecific germplasm introgression into cultivated G. hirsutum and are directly associated with genes. Over 500 of the G. barbadense markers have been validated by whole-genome radiation hybrid mapping. Overall 1,060 SNPs from the five different species have been screened and shown to produce acceptable genotyping assays. This large set of 62,832 SNPs relative to cultivated G. hirsutum will allow for the first high-density mapping of genes from five wild species that affect traits of interest, including beneficial agronomic and fiber characteristics. Upon mapping, the markers can be utilized for marker-assisted introgression of new germplasm into cultivated cotton and in

Effects of 1,1-Dimethylpiperidinium Chloride on the Pests and Allelochemicals of Cotton and Pecan.

Science.gov (United States)

P. A. Hedin; J. N. Jenkins; J. C. McCarty; J. E. Mulrooney; W. L. Parrott; A. Borazjani; C. H. Graves; T. H. Filer

1984-01-01

The growth regulator, PIX (mepiquat chloride - 1,1-dimethyl-piperdinium chloride), when applied to cotton (Gossypium hirsutum L.) and pecan (Carya illinoensis Koch), caused internode shortening. PIX did not elicit an increase in resistance in cotton to the tobacco budworm (Heliothis virescens (Fab.)], or in pecan...

The history and current status of glyphosate.

Science.gov (United States)

Duke, Stephen O

2018-05-01

Glyphosate is the only herbicide to target the enzyme 5-enolpyruvyl-3-shikimate phosphate synthase (EPSPS). It is a high use rate, non-selective herbicide that translocates primarily to metabolic sinks, killing meristematic tissues away from the application site. Its phloem-mobile properties and slow action in killing weeds allow the herbicide to move throughout the plant to kill all meristems, making it effective for perennial weed control. Since commercialization in 1974, its use has grown to dominate the herbicide market. Much of its use is on transgenic, glyphosate-resistant crops (GRCs), which have been the dominant transgenic crops worldwide. GRCs with glyphosate provided the most effective and inexpensive weed management technology in history for a decade or more. However, as a consequence of the rapid increase in glyphosate-resistant (GR) weeds, the effectiveness of glyphosate use in GRCs is declining. Critics have claimed that glyphosate-treated GRCs have altered mineral nutrition and increased susceptibility to plant pathogens because of glyphosate's ability to chelate divalent metal cations, but the complete resistance of GRCs to glyphosate indicates that chelating metal cations do not contribute to the herbicidal activity or significantly affect mineral nutrition. The rates of increases in yields of maize, soybean, and cotton in the USA have been unchanged after high adoption rates of GRCs. Glyphosate is toxic to some plant pathogens, and thereby can act as a fungicide in GRCs. Ultra-low doses of glyphosate stimulate plant growth in glyphosate-susceptible plants by unknown mechanisms. Despite rapid and widespread increases in GR weeds, glyphosate use has not decreased. However, as GR weeds increase, adoption of alternative technologies will eventually lead to decreased use. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in

Construction of a complete set of alien chromosome addition lines from Gossypium australe in Gossypium hirsutum: morphological, cytological, and genotypic characterization.

Science.gov (United States)

Chen, Yu; Wang, Yingying; Wang, Kai; Zhu, Xiefei; Guo, Wangzhen; Zhang, Tianzhen; Zhou, Baoliang

2014-05-01

We report the first complete set of alien addition lines of G. hirsutum . The characterized lines can be used to introduce valuable traits from G. australe into cultivated cotton. Gossypium australe is a diploid wild cotton species (2n = 26, GG) native to Australia that possesses valuable characteristics unavailable in the cultivated cotton gene pool, such as delayed pigment gland morphogenesis in the seed and resistances to pests and diseases. However, it is very difficult to directly transfer favorable traits into cultivated cotton through conventional gene recombination due to the absence of pairing and crossover between chromosomes of G. australe and Gossypium hirsutum (2n = 52, AADD). To enhance the transfer of favorable genes from wild species into cultivated cotton, we developed a set of hirsutum-australe monosomic alien chromosome addition lines (MAAL) using a combination of morphological survey, microsatellite marker-assisted selection, and molecular cytogenetic analysis. The amphidiploid (2n = 78, AADDGG) of G. australe and G. hirsutum was consecutively backcrossed with upland cotton to develop alien addition lines of individual G. australe chromosomes in G. hirsutum. From these backcross progeny, we generated the first complete set of chromosome addition lines in cotton; 11 of 13 lines are monosomic additions, and chromosomes 7G(a) and 13G(a) are multiple additions. MAALs of 1G(a) and 11G(a) were the first to be isolated. The chromosome addition lines can be employed as bridges for the transfer of desired genes from G. australe into G. hirsutum, as well as for gene assignment, isolation of chromosome-specific probes, flow sorting and microdissection of chromosome, development of chromosome-specific ''paints'' for fluorochrome-labeled DNA fragments, physical mapping, and selective isolation and mapping of cDNAs for a particular G. australe chromosome.

EPSPS gene amplification conferring resistance to glyphosate in windmill grass (Chloris truncata) in Australia.

Science.gov (United States)

Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

2018-05-01

Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Genome-wide functional analysis of cotton (Gossypium hirsutum in response to drought.

Directory of Open Access Journals (Sweden)

Yun Chen

Full Text Available Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6 of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene analysis showed that the normal biophysical profiles of cotton (cultivar J-13 were affected by drought stress, and some cellular metabolic processes (including photosynthesis were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

Directory of Open Access Journals (Sweden)

Raquel Sampaio Oliveira

2016-02-01

Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

Science.gov (United States)

de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

2016-01-01

Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

Science.gov (United States)

de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

2016-01-01

Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

Glyphosate-Resistant Parthenium hysterophorus in the Caribbean Islands: Non Target Site Resistance and Target Site Resistance in Relation to Resistance Levels.

Directory of Open Access Journals (Sweden)

Enzo Bracamonte

2016-12-01

Full Text Available Glyphosate has been the most intensely herbicide used worldwide for decades, and continues to be a single tool for controlling weeds in woody crops. However, the adoption of this herbicide in a wide range of culture systems has led to the emergence of resistant weeds. Glyphosate has been widely used primarily on citrus in the Caribbean area, but a study of resistance in the Caribbean islands of Cuba and the Dominican Republic has never been carried out. Unfortunately, Parthenium hysterophorus has developed glyphosate-resistance in both islands, independently. The resistance level and mechanisms of different P. hysterophorus accessions (three collected in Cuba (Cu-R and four collected in the Dominican Republic (Do-R have been studied under greenhouse and laboratory conditions. In in vivo assays (glyphosate dose causing 50% reduction in above-ground vegetative biomass and survival, the resistance factor levels showed susceptible accessions (Cu-S≥Do-S, low-resistance accessions (Cu-R3Do-R2>Cu-R2>Do-R3>Do-R4>Cu-R3>>Cu-S≥Do-S. Glyphosate was degraded to aminomethylphosphonic acid, glyoxylate and sarcosine by >88% in resistant accessions except in Cu-R3 and Do-R4 resistant accessions (51.12 and 44.21, respectively, whereas a little glyphosate (<9.32% was degraded in both susceptible accessions at 96 h after treatment. There were significant differences between P. hysterophorus accessions in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS activity enzyme with and without different glyphosate rates. The R accessions showed values of between 0.026 and 0.21 µmol µg-1 TSP protein min-1 basal EPSPS activity values with respect to the S (0.024 and 0.025 accessions. The same trend was found in the EPSPS enzyme activity treated with glyphosate, where a higher enzyme activity inhibition (glyphosate µM corresponded to greater resistance levels in P. hysterophorus accessions. One amino acid substitution was found at position 106 in EPSPS, consisting

Glyphosate efficacy on sourgrass biotypes with suspected resistance collected in GR-crop fields

Directory of Open Access Journals (Sweden)

Hellen Martins da Silveira

2017-11-01

Full Text Available In Brazil, infestations of crop areas with glyphosate-resistant (GR sourgrass (Digitaria insularis (L. Fedde biotypes has risen significantly, increasing crop production costs. Glyphosate efficacy on three biotypes (GO, BA and MT of sourgrass with suspected resistance was evaluated. A susceptible biotype (MG was used as the control. The results confirmed that the MG and GO biotypes were susceptible to glyphosate (control > 90%. The MG biotype exhibited growth reduction and mortality by 50% (GR50 and LD50, respectively with mean glyphosate doses of 243.7 and 431.6 g ae ha-1. The resistance index of the biotypes with suspected resistance ranged from 2.8 to 6.1 in relation to GR50 and between 1.4 to 26.7 in relation to LD50. The glyphosate susceptibility ranking of the sourgrass biotypes was MG < GO < MT < BA. The MT and BA biotypes demonstrated high glyphosate resistance levels, and the GO biotype had a high potential to develop resistance. Farmers should avoid the application of glyphosate overdoses to minimize the selection pressure on weeds.

Proteomics profiling of fiber development and domestication in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Hu, Guanjing; Koh, Jin; Yoo, Mi-Jeong; Pathak, Dharminder; Chen, Sixue; Wendel, Jonathan F

2014-12-01

Comparative proteomic analyses were performed to detail the evolutionary consequences of strong directional selection for enhanced fiber traits in modern upland cotton (Gossypium hirsutum L.). Using two complementary proteomic approaches, 2-DE and iTRAQ LC-MS/MS, fiber proteomes were examined for four representative stages of fiber development. Approximately 1,000 protein features were characterized using each strategy, collectively resulting in the identification and functional categorization of 1,223 proteins. Unequal contributions of homoeologous proteins were detected for over a third of the fiber proteome, but overall expression was balanced with respect to the genome-of-origin in the allopolyploid G. hirsutum. About 30% of the proteins were differentially expressed during fiber development within wild and domesticated cotton. Notably, domestication was accompanied by a doubling of protein developmental dynamics for the period between 10 and 20 days following pollination. Expression levels of 240 iTRAQ proteins and 293 2-DE spots were altered by domestication, collectively representing multiple cellular and metabolic processes, including metabolism, energy, protein synthesis and destination, defense and stress response. Analyses of homoeolog-specific expression indicate that duplicated gene products in cotton fibers can be differently regulated in response to selection. These results demonstrate the power of proteomics for the analysis of crop domestication and phenotypic evolution.

Assessing the Economic Impact of inversion tillage, cover crops, and herbicide regimes in palmer amaranth (Amaranthus palmeri) infested cotton

Science.gov (United States)

Cotton (Gossypium hirsutum L.) producers in Alabama and across the Cotton Belt are faced with a rapidly expanding problem that decreases yields and increases production costs: herbicide-resistant weeds. Producers are increasingly relying on production methods that raise production costs, such as add...

Identifying Chloris Species from Cuban Citrus Orchards and Determining Their Glyphosate-Resistance Status

Directory of Open Access Journals (Sweden)

Enzo R. Bracamonte

2017-11-01

Full Text Available The Chloris genus is a C4 photosynthetic species mainly distributed in tropical and subtropical regions. Populations of three Chloris species occurring in citrus orchards from central Cuba, under long history glyphosate-based weed management, were studied for glyphosate-resistant status by characterizing their herbicide resistance/tolerance mechanisms. Morphological and molecular analyses allowed these species to be identified as C. ciliata Sw., Chloris elata Desv., and Chloris barbata Sw. Based on the glyphosate rate that causes 50% mortality of the treated plants, glyphosate resistance (R was confirmed only in C. elata, The R population was 6.1-fold more resistant compared to the susceptible (S population. In addition, R plants of C. elata accumulated 4.6-fold less shikimate after glyphosate application than S plants. Meanwhile, populations of C. barbata and C. ciliata with or without glyphosate application histories showed similar LD50 values and shikimic acid accumulation rates, demonstrating that resistance to glyphosate have not evolved in these species. Plants of R and S populations of C. elata differed in 14C-glyphosate absorption and translocation. The R population exhibited 27.3-fold greater 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS activity than the S population due to a target site mutation corresponding to a Pro-106-Ser substitution found in the EPSPS gene. These reports show the innate tolerance to glyphosate of C. barbata and C. ciliata, and confirm the resistance of C. elata to this herbicide, showing that both non-target site and target-site mechanisms are involved in its resistance to glyphosate. This is the first case of herbicide resistance in Cuba.

Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement.

Science.gov (United States)

Zhang, Tianzhen; Hu, Yan; Jiang, Wenkai; Fang, Lei; Guan, Xueying; Chen, Jiedan; Zhang, Jinbo; Saski, Christopher A; Scheffler, Brian E; Stelly, David M; Hulse-Kemp, Amanda M; Wan, Qun; Liu, Bingliang; Liu, Chunxiao; Wang, Sen; Pan, Mengqiao; Wang, Yangkun; Wang, Dawei; Ye, Wenxue; Chang, Lijing; Zhang, Wenpan; Song, Qingxin; Kirkbride, Ryan C; Chen, Xiaoya; Dennis, Elizabeth; Llewellyn, Danny J; Peterson, Daniel G; Thaxton, Peggy; Jones, Don C; Wang, Qiong; Xu, Xiaoyang; Zhang, Hua; Wu, Huaitong; Zhou, Lei; Mei, Gaofu; Chen, Shuqi; Tian, Yue; Xiang, Dan; Li, Xinghe; Ding, Jian; Zuo, Qiyang; Tao, Linna; Liu, Yunchao; Li, Ji; Lin, Yu; Hui, Yuanyuan; Cao, Zhisheng; Cai, Caiping; Zhu, Xiefei; Jiang, Zhi; Zhou, Baoliang; Guo, Wangzhen; Li, Ruiqiang; Chen, Z Jeffrey

2015-05-01

Upland cotton is a model for polyploid crop domestication and transgenic improvement. Here we sequenced the allotetraploid Gossypium hirsutum L. acc. TM-1 genome by integrating whole-genome shotgun reads, bacterial artificial chromosome (BAC)-end sequences and genotype-by-sequencing genetic maps. We assembled and annotated 32,032 A-subgenome genes and 34,402 D-subgenome genes. Structural rearrangements, gene loss, disrupted genes and sequence divergence were more common in the A subgenome than in the D subgenome, suggesting asymmetric evolution. However, no genome-wide expression dominance was found between the subgenomes. Genomic signatures of selection and domestication are associated with positively selected genes (PSGs) for fiber improvement in the A subgenome and for stress tolerance in the D subgenome. This draft genome sequence provides a resource for engineering superior cotton lines.

Suppression of cotton leaf curl disease symptoms in Gossypium hirsutum through over expression of host-encoded miRNAs.

Science.gov (United States)

Akmal, Mohd; Baig, Mirza S; Khan, Jawaid A

2017-12-10

Cotton leaf curl disease (CLCuD), a major factor resulting in the enormous yield losses in cotton crop, is caused by a distinct monopartite begomovirus in association with Cotton leaf curl Multan betasatellite (CLCuMB). Micro(mi)RNAs are known to regulate gene expression in eukaryotes, including antiviral defense in plants. In a previous study, we had computationally identified a set of cotton miRNAs, which were shown to have potential targets in the genomes of Cotton leaf curl Multan virus (CLCuMuV) and CLCuMB at multiple loci. In the current study, effect of Gossypium arboreum-encoded miRNAs on the genome of CLCuMuV and CLCuMB was investigated in planta. Two computationally predicted cotton-encoded miRNAs (miR398 and miR2950) that showed potential to bind multiple Open Reading Frames (ORFs; C1, C4, V1, and non- coding intergenic region) of CLCuMuV, and (βC1) of CLCuMB were selected. Functional validation of miR398 and miR2950 was done by overexpression approach in G. hirsutum var. HS6. A total of ten in vitro cotton plants were generated from independent events and subjected to biological and molecular analyses. Presence of the respective Precursor (pre)-miRNA was confirmed through PCR and Southern blotting, and their expression level was assessed by semi quantitative RT-PCR, Real Time quantitative PCR and northern hybridization in the PCR-positive lines. Southern hybridization revealed 2-4 copy integration of T-DNA in the genome of the transformed lines. Remarkably, expression of pre-miRNAs was shown up to 5.8-fold higher in the transgenic (T 0 ) lines as revealed by Real Time PCR. The virus resistance was monitored following inoculation of the transgenic cotton lines with viruliferous whitefly (Bemisia tabaci) insect vector. After inoculation, four of the transgenic lines remained apparently symptom free. While a very low titre of viral DNA could be detected by Rolling circle amplification, betasatellite responsible for symptom induction could not be detected

Molecular basis of glyphosate resistance: Different approaches through protein engineering

Science.gov (United States)

Pollegioni, Loredano; Schonbrunn, Ernst; Siehl, Daniel

2011-01-01

Glyphosate (N-phosphonomethyl-glycine) is the most-used herbicide in the world: glyphosate-based formulations exhibit broad-spectrum herbicidal activity with minimal human and environmental toxicity. The extraordinary success of this simple small molecule is mainly due to the high specificity of glyphosate towards the plant enzyme enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway leading to biosynthesis of aromatic amino acids. Starting in 1996, transgenic glyphosate-resistant plants were introduced thus allowing the application of the herbicide to the crop (post-emergence) to remove emerged weeds without crop damage. This review focuses on the evolution of mechanisms of resistance to glyphosate as obtained through natural diversity, the gene shuffling approach to molecular evolution, and a rational, structure-based approach to protein engineering. In addition, we offer rationale for the means by which the modifications made have had their intended effect. PMID:21668647

Genetic diversity of sea-island cotton (Gossypium barbadense) revealed by mapped SSRs.

Science.gov (United States)

Wang, X Q; Feng, C H; Lin, Z X; Zhang, X L

2011-12-08

In order to evaluate the genetic diversity of sea-island cotton (Gossypium barbadense), 237 commonly mapped SSR markers covering the cotton genome were used to genotype 56 sea-island cotton accessions. A total of 218 polymorphic primer pairs (91.98%) amplified 361 loci, with a mean of 1.66 loci. Polymorphism information content values of the SSR primers ranged from 0.035 to 0.862, with a mean of 0.320. The highest mean polymorphism information content value for the SSR motifs was from a compound motif (0.402), and for the chromosomes it was Chr10 (0.589); the highest ratio of polymorphic primers in Xinjiang accessions was from Chr21 (83.33%). Genetic diversity was high in Xinjiang accessions. AMOVA showed that variation was 8 and 92% among populations and within populations, respectively. The 56 sea-island accessions were divided into three groups in the UPGMA dendrogram: Xinhai5 was in the first group; accessions from Xinjiang, except the five main ones, were in the second group, and the other 34 accessions were in the third group. Accessions from the former Soviet Union and Xinjiang main accessions were closely related. Both PCA and UPGMA confirmed that Xinhai5 was distinct from the other accessions, and accessions from Xinjiang were in an independent group. Given the differences between principal components analysis and UPGMA results, it is necessary to combine molecular markers and pedigree information so that genetic diversity can be objectively analyzed.

Inheritance of Evolved Glyphosate Resistance in a North Carolina Palmer Amaranth (Amaranthus palmeri Biotype

Directory of Open Access Journals (Sweden)

Aman Chandi

2012-01-01

Full Text Available Inheritance of glyphosate resistance in a Palmer amaranth biotype from North Carolina was studied. Glyphosate rates for 50% survival of glyphosate-resistant (GR and glyphosate-susceptible (GS biotypes were 1288 and 58 g ha−1, respectively. These values for F1 progenies obtained from reciprocal crosses (GR×GS and GS×GR were 794 and 501 g ha−1, respectively. Dose response of F1 progenies indicated that resistance was not fully dominant over susceptibility. Lack of significant differences between dose responses for reciprocal F1 families suggested that genetic control of glyphosate resistance was governed by nuclear genome. Analysis of F1 backcross (BC1F1 families showed that 10 and 8 BC1F1 families out of 15 fitted monogenic inheritance at 2000 and 3000 g ha−1 glyphosate, respectively. These results indicate that inheritance of glyphosate resistance in this biotype is incompletely dominant, nuclear inherited, and might not be consistent with a single gene mechanism of inheritance. Relative 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS copy number varied from 22 to 63 across 10 individuals from resistant biotype. This suggested that variable EPSPS copy number in the parents might be influential in determining if inheritance of glyphosate resistance is monogenic or polygenic in this biotype.

Cotton (Gossypium hirsutum L.).

Science.gov (United States)

Rathore, Keerti S; Campbell, LeAnne M; Sherwood, Shanna; Nunes, Eugenia

2015-01-01

Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis.

Study on the Mitochondrial Genome of Sea Island Cotton (Gossypium barbadense) by BAC Library Screening

Institute of Scientific and Technical Information of China (English)

SU Ai-guo; LI Shuang-shuang; LIU Guo-zheng; LEI Bin-bin; KANG Ding-ming; LI Zhao-hu; MA Zhi-ying; HUA Jin-ping

2014-01-01

The plant mitochondrial genome displays complex features, particularly in terms of cytoplasmic male sterility (CMS). Therefore, research on the cotton mitochondrial genome may provide important information for analyzing genome evolution and exploring the molecular mechanism of CMS. In this paper, we present a preliminary study on the mitochondrial genome of sea island cotton (Gossypium barbadense) based on positive clones from the bacterial artiifcial chromosome (BAC) library. Thirty-ifve primers designed with the conserved sequences of functional genes and exons of mitochondria were used to screen positive clones in the genome library of the sea island cotton variety called Pima 90-53. Ten BAC clones were obtained and veriifed for further study. A contig was obtained based on six overlapping clones and subsequently laid out primarily on the mitochondrial genome. One BAC clone, clone 6 harbored with the inserter of approximate 115 kb mtDNA sequence, in which more than 10 primers fragments could be ampliifed, was sequenced and assembled using the Solexa strategy. Fifteen mitochondrial functional genes were revealed in clone 6 by gene annotation. The characteristics of the syntenic gene/exon of the sequences and RNA editing were preliminarily predicted.

Genetic variation and heritability for cotton seed, fiber and oil traits in gossypium hirsutum

International Nuclear Information System (INIS)

Khan, N.U.; Farhatullah; Batool, S.; Makhdoom, K.; Marwat, K.B.; Hassan, G.; Ahmad, W.; Khan, H.U.

2010-01-01

The research work pertaining to the study of genetic variability, heritability, genetic gain and correlation for cottonseed, fiber and cottonseed oil % in Gossypium hirsutum cultivars was conducted during 2005 at NWFP Agricultural University Peshawar, Pakistan. Analysis of variance manifested highly significant differences among the genotypes for all the traits except seeds per locule. Genetic potential range of eight cotton cultivars for different parameters was recorded i.e. seeds locule-1 (6.33 to 6.60), seeds boll-1 (26.10 to 28.47), seed index (8.61 to 9.69 g), lint index (5.35 to 6.05 g), lint % (35.17 to 38.13 %), seed cotton yield (1200 to 2450 kg ha/sup -1/) and cottonseed oil % (27.52 to 30.15%). Genetic variances were found almost greater than the environmental variances for all the traits except seeds locule-1 and seed index. High broad sense heritability and selection response were also formulated for seeds boll-1 (0.67, 0.84), seed index (0.77, 0.47 g), lint index (0.96, 0.33 g), lint % (0.96, 1.66 %), seed cotton yield (0.98, 643.16 kg) and cottonseed oil % (0.87, 1.28 %), respectively. Correlation of yield with other traits was found positive for majority of traits except seeds locule-1 and cotton seed oil %. Seed cotton yield is our ultimate goal in growing cotton besides lint %. Highest seed cotton yield was recorded in CIM-499 followed by CIM-473, CIM-496 and CIM-506 and were also found as the second and third top scoring genotypes for seeds per boll, seed index, lint % and cottonseed oil %. Cultivar SLH-279 performed better for lint index, lint % and oil %. This type of correlation is rarely found and ultra desirable by the cotton breeders and a little genetic gain in seed and lint traits, and oil content is a great accomplishment. (author)

(Gossypium barbadense) germplasm resources

Indian Academy of Sciences (India)

Navya

2017-03-28

Mar 28, 2017 ... Running title: Marker-trait associations in sea-island cotton ... In this study, Gossypium barbadense germplasm accessions with ... origins (n = 123) were used to perform association analysis of fiber traits with 120 polymorphic simple ... Because fiber yield and quality traits are complex quantitative traits, ...

Comparative transmission genetics of introgressed chromatin in Gossypium (cotton) polyploids.

Science.gov (United States)

Waghmare, Vijay N; Rong, Junkang; Rogers, Carl J; Bowers, John E; Chee, Peng W; Gannaway, John R; Katageri, Ishwarappa; Paterson, Andrew H

2016-04-01

Introgression is widely acknowledged as a potential source of valuable genetic variation, and growing effort is being invested in analysis of interspecific crosses conferring transgressive variation. Experimental backcross populations provide an opportunity to study transmission genetics following interspecific hybridization, identifying opportunities and constraints to introgressive crop improvement. The evolutionary consequences of introgression have been addressed at the theoretical level, however, issues related to levels and patterns of introgression among (plant) species remain inadequately explored, including such factors as polyploidization, subgenome interaction inhabiting a common nucleus, and the genomic distribution and linkage relationships of introgressant alleles. We analyze introgression into the polyploid Gossypium hirsutum (upland cotton) from its sister G. tomentosum and compare the level and pattern with that of G. barbadense representing a different clade tracing to the same polyploidization. Across the genome, recurrent backcrossing to Gossypium hirsutum yielded only one-third of the expected average frequency of the G. tomentosum allele, although one unusual region showed preferential introgression. Although a similar rate of introgression is found in the two subgenomes of polyploid (AtDt) G. hirsutum, a preponderance of multilocus interactions were largely within the Dt subgenome. Skewed G. tomentosum chromatin transmission is polymorphic among two elite G. hirsutum genotypes, which suggests that genetic background may profoundly affect introgression of particular chromosomal regions. Only limited correspondence is found between G. hirsutum chromosomal regions that are intolerant to introgression from the two species, G. barbadense and G. tomentosum, concentrated near possible inversion polymorphisms. Complex transmission of introgressed chromatin highlights the challenges to utilization of exotic germplasm in crop improvement. © 2016

Cytomorphological studies in X-ray induced glandless haploids in Gossypium hirsutum L. (cotton)

Energy Technology Data Exchange (ETDEWEB)

Mehetre, S.S.; Thombre, M.V. (Mahatma Phule Krishi Vidyapeeth, Rahuri (India))

1981-08-01

Six haploid plants were obtained in M/sub 2/ generation of the 25 kr. X-ray irradiated Gossypium hirsutum L. cotton variety H.G. 108. The cytomorphological studies on these plants indicated highly irregular meiosis, giving on an average six bivalents, the range being 0-9. Unequal separation of chromosomes and chromatids at anaphase-1 and II respectively led to formation of abnormal tetrads and pollens with high size variations leading to high pollen sterility. These plants were characterized by miniature stature, shorter stem and internodes, smaller leaves, flowers and stomata with fewer chloroplasts, male and female sterility and halving of chromosomes. The reduction in morphological characters was nearly in the proportion of 1:2 as compared to their diploid counterparts. 31 refs.; 5 tables; 12 figures.

Diversity in Betasatellites Associated with Cotton Leaf Curl Disease During Source-To-Sink Movement Through a Resistant Host

Directory of Open Access Journals (Sweden)

Iftikhar Ali Khan

2016-02-01

Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.

The benefits of herbicide-resistant crops.

Science.gov (United States)

Green, Jerry M

2012-10-01

Since 1996, genetically modified herbicide-resistant crops, primarily glyphosate-resistant soybean, corn, cotton and canola, have helped to revolutionize weed management and have become an important tool in crop production practices. Glyphosate-resistant crops have enabled the implementation of weed management practices that have improved yield and profitability while better protecting the environment. Growers have recognized their benefits and have made glyphosate-resistant crops the most rapidly adopted technology in the history of agriculture. Weed management systems with glyphosate-resistant crops have often relied on glyphosate alone, have been easy to use and have been effective, economical and more environmentally friendly than the systems they have replaced. Glyphosate has worked extremely well in controlling weeds in glyphosate-resistant crops for more than a decade, but some key weeds have evolved resistance, and using glyphosate alone has proved unsustainable. Now, growers need to renew their weed management practices and use glyphosate with other cultural, mechanical and herbicide options in integrated systems. New multiple-herbicide-resistant crops with resistance to glyphosate and other herbicides will expand the utility of existing herbicide technologies and will be an important component of future weed management systems that help to sustain the current benefits of high-efficiency and high-production agriculture. Copyright © 2012 Society of Chemical Industry.

Extensive and biased intergenomic nonreciprocal DNA exchanges shaped a nascent polyploid genome, Gossypium (cotton).

Science.gov (United States)

Guo, Hui; Wang, Xiyin; Gundlach, Heidrun; Mayer, Klaus F X; Peterson, Daniel G; Scheffler, Brian E; Chee, Peng W; Paterson, Andrew H

2014-08-01

Genome duplication is thought to be central to the evolution of morphological complexity, and some polyploids enjoy a variety of capabilities that transgress those of their diploid progenitors. Comparison of genomic sequences from several tetraploid (AtDt) Gossypium species and genotypes with putative diploid A- and D-genome progenitor species revealed that unidirectional DNA exchanges between homeologous chromosomes were the predominant mechanism responsible for allelic differences between the Gossypium tetraploids and their diploid progenitors. Homeologous gene conversion events (HeGCEs) gradually subsided, declining to rates similar to random mutation during radiation of the polyploid into multiple clades and species. Despite occurring in a common nucleus, preservation of HeGCE is asymmetric in the two tetraploid subgenomes. At-to-Dt conversion is far more abundant than the reciprocal, is enriched in heterochromatin, is highly correlated with GC content and transposon distribution, and may silence abundant A-genome-derived retrotransposons. Dt-to-At conversion is abundant in euchromatin and genes, frequently reversing losses of gene function. The long-standing observation that the nonspinnable-fibered D-genome contributes to the superior yield and quality of tetraploid cotton fibers may be explained by accelerated Dt to At conversion during cotton domestication and improvement, increasing dosage of alleles from the spinnable-fibered A-genome. HeGCE may provide an alternative to (rare) reciprocal DNA exchanges between chromosomes in heterochromatin, where genes have approximately five times greater abundance of Dt-to-At conversion than does adjacent intergenic DNA. Spanning exon-to-gene-sized regions, HeGCE is a natural noninvasive means of gene transfer with the precision of transformation, potentially important in genetic improvement of many crop plants. Copyright © 2014 by the Genetics Society of America.

Phenotyping Root System Architecture of Cotton (Gossypium barbadense L. Grown Under Salinity

Directory of Open Access Journals (Sweden)

Mottaleb Shady A.

2017-12-01

Full Text Available Soil salinity causes an annual deep negative impact to the global agricultural economy. In this study, the effects of salinity on early seedling physiology of two Egyptian cotton (Gossypium barbadense L. cultivars differing in their salinity tolerance were examined. Also the potential use of a low cost mini-rhizotron system to measure variation in root system architecture (RSA traits existing in both cultivars was assessed. Salt tolerant cotton cultivar ‘Giza 90’ produced significantly higher root and shoot biomass, accumulated lower Na+/K+ ratio through a higher Na+ exclusion from both roots and leaves as well as synthesized higher proline contents compared to salt sensitive ‘Giza 45’ cultivar. Measuring RSA in mini-rhizotrons containing solid MS nutrient medium as substrate proved to be more precise and efficient than peat moss/sand mixture. We report superior values of main root growth rate, total root system size, main root length, higher number of lateral roots and average lateral root length in ‘Giza 90’ under salinity. Higher lateral root density and length together with higher root tissue tolerance of Na+ ions in ‘Giza 90’ give it an advantage to be used as donor genotype for desirable root traits to other elite cultivars.

Lack of transgene and glyphosate effects on yield, and mineral and amino acid content of glyphosate-resistant soybean.

Science.gov (United States)

Duke, Stephen O; Rimando, Agnes M; Reddy, Krishna N; Cizdziel, James V; Bellaloui, Nacer; Shaw, David R; Williams, Martin M; Maul, Jude E

2018-05-01

There has been controversy as to whether the glyphosate resistance gene and/or glyphosate applied to glyphosate-resistant (GR) soybean affect the content of cationic minerals (especially Mg, Mn and Fe), yield and amino acid content of GR soybean. A two-year field study (2013 and 2014) examined these questions at sites in Mississippi, USA. There were no effects of glyphosate, the GR transgene or field crop history (for a field with both no history of glyphosate use versus one with a long history of glyphosate use) on grain yield. Furthermore, these factors had no consistent effects on measured mineral (Al, As, Ba, Cd, Ca, Co, Cr, Cs, Cu, Fe, Ga, K, Li, Mg, Mn, Ni, Pb, Rb, Se, Sr, Tl, U, V, Zn) content of leaves or harvested seed. Effects on minerals were small and inconsistent between years, treatments and mineral, and appeared to be random false positives. No notable effects on free or protein amino acids of the seed were measured, although glyphosate and its degradation product, aminomethylphosphonic acid (AMPA), were found in the seed in concentrations consistent with previous studies. Neither glyphosate nor the GR transgene affect the content of the minerals measured in leaves and seed, harvested seed amino acid composition, or yield of GR soybean. Furthermore, soils with a legacy of GR crops have no effects on these parameters in soybean. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli*S⃞

Science.gov (United States)

Funke, Todd; Yang, Yan; Han, Huijong; Healy-Fried, Martha; Olesen, Sanne; Becker, Andreas; Schönbrunn, Ernst

2009-01-01

The shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the target of the broad spectrum herbicide glyphosate. The genetic engineering of EPSPS led to the introduction of glyphosate-resistant crops worldwide. The genetically engineered corn lines NK603 and GA21 carry distinct EPSPS enzymes. CP4 EPSPS, expressed in NK603 corn and transgenic soybean, cotton, and canola, belongs to class II EPSPS, glyphosate-insensitive variants of this enzyme isolated from certain Gram-positive bacteria. GA21 corn, on the other hand, was created by point mutations of class I EPSPS, such as the enzymes from Zea mays or Escherichia coli, which are sensitive to low glyphosate concentrations. The structural basis of the glyphosate resistance resulting from these point mutations has remained obscure. We studied the kinetic and structural effects of the T97I/P101S double mutation, the molecular basis for GA21 corn, using EPSPS from E. coli. The T97I/P101S enzyme is essentially insensitive to glyphosate (Ki = 2.4 mm) but maintains high affinity for the substrate phosphoenolpyruvate (PEP) (Km = 0.1 mm). The crystal structure at 1.7-Å resolution revealed that the dual mutation causes a shift of residue Gly96 toward the glyphosate binding site, impairing efficient binding of glyphosate, while the side chain of Ile97 points away from the substrate binding site, facilitating PEP utilization. The single site T97I mutation renders the enzyme sensitive to glyphosate and causes a substantial decrease in the affinity for PEP. Thus, only the concomitant mutations of Thr97 and Pro101 induce the conformational changes necessary to produce catalytically efficient, glyphosate-resistant class I EPSPS. PMID:19211556

Aldo-keto reductase enzymes detoxify glyphosate and improve herbicide resistance in plants.

Science.gov (United States)

Vemanna, Ramu S; Vennapusa, Amaranatha Reddy; Easwaran, Murugesh; Chandrashekar, Babitha K; Rao, Hanumantha; Ghanti, Kirankumar; Sudhakar, Chinta; Mysore, Kirankumar S; Makarla, Udayakumar

2017-07-01

In recent years, concerns about the use of glyphosate-resistant crops have increased because of glyphosate residual levels in plants and development of herbicide-resistant weeds. In spite of identifying glyphosate-detoxifying genes from microorganisms, the plant mechanism to detoxify glyphosate has not been studied. We characterized an aldo-keto reductase gene from Pseudomonas (PsAKR1) and rice (OsAKR1) and showed, by docking studies, both PsAKR1 and OsAKR1 can efficiently bind to glyphosate. Silencing AKR1 homologues in rice and Nicotiana benthamiana or mutation of AKR1 in yeast and Arabidopsis showed increased sensitivity to glyphosate. External application of AKR proteins rescued glyphosate-mediated cucumber seedling growth inhibition. Regeneration of tobacco transgenic lines expressing PsAKR1 or OsAKRI on glyphosate suggests that AKR can be used as selectable marker to develop transgenic crops. PsAKR1- or OsAKRI-expressing tobacco and rice transgenic plants showed improved tolerance to glyphosate with reduced accumulation of shikimic acid without affecting the normal photosynthetic rates. These results suggested that AKR1 when overexpressed detoxifies glyphosate in planta. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Potassium-phosphorus relationships in cotton (gossypium hirsutum L.) as affected by potassium nutrition

International Nuclear Information System (INIS)

Makhdum, M.I.; Ashraf, M.

2007-01-01

Field studies were undertaken to determine the interrelationship between potassium (K+) concentration in various organs of plant and phosphorus (P) content as influenced by K-nutrition in cotton. The experiment was conducted on Miani soil series silt loam and classified as Calcaric Cambisols, fine silty, mixed Hyperthermic Fluventic Haplocambids. The treatments consisted .of (a) four cotton (Gossypium hirsutum L.) cultivars (CI.M-448, CIM-IIOO, Karishma, S-12); and (b) four potassium fertilizer doses (0, 62.5, 125.0, 250.0 kg K ha-l). The design of experiment was split plot (main: cultivars, sub-plot: K-doses). The plant samples were collected at five stages of growth, i.e., first flower bud., first flower, peak flowering, first boll split and maturity. The various parts of plants were analyzed for phosphorus and potassium concentration at various stages of growth. Phosphorus concentration in leaves, stems, burs, seed and lint decreased with concurrent increase in K-doses. Crop maintained 0.22% phosphorus concentration in leaf tissues at first flower bud and dropped to 0.11% at maturity. Cultivars differed greatly amongst themselves in terms of maintaining P content in their different parts. Averaged across K-doses, cv. CIM-448 maintained the highest P content in all parts than other cultivars. There was a negative and significant correlation co-efficient between K and P concentration in various parts of the plant. The study demonstrated antagonistic interaction between K+ and P in cotton plant under irrigated conditions. (author)

Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

Science.gov (United States)

Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

2017-08-01

Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Effects of glyphosate on the mineral content of glyphosate-resistant soybeans (Glycine max).

Science.gov (United States)

Duke, Stephen O; Reddy, Krishna N; Bu, Kaixuan; Cizdziel, James V

2012-07-11

There are conflicting claims as to whether treatment with glyphosate adversely affects mineral nutrition of glyphosate-resistant (GR) crops. Those who have made claims of adverse effects have argued links between reduced Mn and diseases in these crops. This article describes experiments designed to determine the effects of a recommended rate (0.86 kg ha(-1)) of glyphosate applied once or twice on the mineral content of young and mature leaves, as well as in seeds produced by GR soybeans (Glycine max) in both the greenhouse and field using inductively coupled plasma mass spectrometry (ICP-MS). In the greenhouse, there were no effects of either one application (at 3 weeks after planting, WAP) or two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves sampled at 6, 9, and 12 WAP and in harvested seed. Se concentrations were too low for accurate detection in leaves, but there was also no effect of glyphosate applications on Se in the seeds. In the field study, there were no effects of two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves at either 9 or 12 WAP. There was also no effect on Se in the seeds. There was no difference in yield between control and glyphosate-treated GR soybeans in the field. The results indicate that glyphosate does not influence mineral nutrition of GR soybean at recommended rates for weed management in the field. Furthermore, the field studies confirm the results of greenhouse studies.

Transcriptome analysis of Gossypium hirsutum flower buds infested by cotton boll weevil (Anthonomus grandis) larvae.

Science.gov (United States)

Artico, Sinara; Ribeiro-Alves, Marcelo; Oliveira-Neto, Osmundo Brilhante; de Macedo, Leonardo Lima Pepino; Silveira, Sylvia; Grossi-de-Sa, Maria Fátima; Martinelli, Adriana Pinheiro; Alves-Ferreira, Marcio

2014-10-04

Cotton is a major fibre crop grown worldwide that suffers extensive damage from chewing insects, including the cotton boll weevil larvae (Anthonomus grandis). Transcriptome analysis was performed to understand the molecular interactions between Gossypium hirsutum L. and cotton boll weevil larvae. The Illumina HiSeq 2000 platform was used to sequence the transcriptome of cotton flower buds infested with boll weevil larvae. The analysis generated a total of 327,489,418 sequence reads that were aligned to the G. hirsutum reference transcriptome. The total number of expressed genes was over 21,697 per sample with an average length of 1,063 bp. The DEGseq analysis identified 443 differentially expressed genes (DEG) in cotton flower buds infected with boll weevil larvae. Among them, 402 (90.7%) were up-regulated, 41 (9.3%) were down-regulated and 432 (97.5%) were identified as orthologues of A. thaliana genes using Blastx. Mapman analysis of DEG indicated that many genes were involved in the biotic stress response spanning a range of functions, from a gene encoding a receptor-like kinase to genes involved in triggering defensive responses such as MAPK, transcription factors (WRKY and ERF) and signalling by ethylene (ET) and jasmonic acid (JA) hormones. Furthermore, the spatial expression pattern of 32 of the genes responsive to boll weevil larvae feeding was determined by "in situ" qPCR analysis from RNA isolated from two flower structures, the stamen and the carpel, by laser microdissection (LMD). A large number of cotton transcripts were significantly altered upon infestation by larvae. Among the changes in gene expression, we highlighted the transcription of receptors/sensors that recognise chitin or insect oral secretions; the altered regulation of transcripts encoding enzymes related to kinase cascades, transcription factors, Ca2+ influxes, and reactive oxygen species; and the modulation of transcripts encoding enzymes from phytohormone signalling pathways. These

Target-site mutations conferring resistance to glyphosate in feathertop Rhodes grass (Chloris virgata) populations in Australia.

Science.gov (United States)

Ngo, The D; Krishnan, Mahima; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

2018-05-01

Chloris virgata is a warm-season, C 4 , annual grass weed affecting field crops in northern Australia that has become an emerging weed in southern Australia. Four populations with suspected resistance to glyphosate were collected in South Australia, Queensland and New South Wales, Australia, and compared with one susceptible (S) population to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the rate of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in four populations of C. virgata (V12, V14.2, V14.16 and V15). GR plants were 2-9.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. GR and S plants did not differ in glyphosate absorption and translocation. Target-site EPSPS mutations corresponding to Pro-106-Leu (V14.2) and Pro-106-Ser (V15, V14.16 and V12) substitutions were found in GR populations. The population with Pro-106-Leu substitution was 2.9-4.9-fold more resistant than the three other populations with Pro-106-Ser substitution. This report confirms glyphosate resistance in C. virgata and shows that target-site EPSPS mutations confer resistance to glyphosate in this species. The evolution of glyphosate resistance in C. virgata highlights the need to identify alternative control tactics. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches

Directory of Open Access Journals (Sweden)

Changwei Bi

2016-01-01

Full Text Available Cotton is one of the most important economic crops and the primary source of natural fiber and is an important protein source for animal feed. The complete nuclear and chloroplast (cp genome sequences of G. raimondii are already available but not mitochondria. Here, we assembled the complete mitochondrial (mt DNA sequence of G. raimondii into a circular genome of length of 676,078 bp and performed comparative analyses with other higher plants. The genome contains 39 protein-coding genes, 6 rRNA genes, and 25 tRNA genes. We also identified four larger repeats (63.9 kb, 10.6 kb, 9.1 kb, and 2.5 kb in this mt genome, which may be active in intramolecular recombination in the evolution of cotton. Strikingly, nearly all of the G. raimondii mt genome has been transferred to nucleus on Chr1, and the transfer event must be very recent. Phylogenetic analysis reveals that G. raimondii, as a member of Malvaceae, is much closer to another cotton (G. barbadense than other rosids, and the clade formed by two Gossypium species is sister to Brassicales. The G. raimondii mt genome may provide a crucial foundation for evolutionary analysis, molecular biology, and cytoplasmic male sterility in cotton and other higher plants.

Spatial and temporal variation in fungal endophyte communities isolated from cultivated cotton (Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

María J Ek-Ramos

Full Text Available Studies of fungi in upland cotton (Gossypium hirsutum cultivated in the United States have largely focused on monitoring and controlling plant pathogens. Given increasing interest in asymptomatic fungal endophytes as potential biological control agents, surveys are needed to better characterize their diversity, distribution patterns and possible applications in integrated pest management. We sampled multiple varieties of cotton in Texas, USA and tested for temporal and spatial variation in fungal endophyte diversity and community composition, as well as for differences associated with organic and conventional farming practices. Fungal isolates were identified by morphological and DNA identification methods. We found members of the genera Alternaria, Colletotrichum and Phomopsis, previously isolated as endophytes from other plant species. Other recovered species such as Drechslerella dactyloides (formerly Arthrobotrys dactyloides and Exserohilum rostratum have not, to our knowledge, been previously reported as endophytes in cotton. We also isolated many latent pathogens, but some species such as Alternaria tennuissima, Epicoccum nigrum, Acremonium alternatum, Cladosporium cladosporioides, Chaetomium globosum and Paecilomyces sp., are known to be antagonists against plant pathogens, insects and nematode pests. We found no differences in endophyte species richness or diversity among different cotton varieties, but did detect differences over time and in different plant tissues. No consistent patterns of community similarity associated with variety, region, farming practice, time of the season or tissue type were observed regardless of the ecological community similarity measurements used. Results indicated that local fungal endophyte communities may be affected by both time of the year and plant tissue, but the specific community composition varies across sites. In addition to providing insights into fungal endophyte community structure, our survey

Glyphosate Effects on Plant Mineral Nutrition, Crop Rhizosphere Microbiota, and Plant Disease in Glyphosate-Resistant Crops

Science.gov (United States)

2012-01-01

Claims have been made recently that glyphosate-resistant (GR) crops sometimes have mineral deficiencies and increased plant disease. This review evaluates the literature that is germane to these claims. Our conclusions are: (1) although there is conflicting literature on the effects of glyphosate on mineral nutrition on GR crops, most of the literature indicates that mineral nutrition in GR crops is not affected by either the GR trait or by application of glyphosate; (2) most of the available data support the view that neither the GR transgenes nor glyphosate use in GR crops increases crop disease; and (3) yield data on GR crops do not support the hypotheses that there are substantive mineral nutrition or disease problems that are specific to GR crops. PMID:23013354

The genome sequence of Sea-Island cotton (Gossypium barbadense) provides insights into the allopolyploidization and development of superior spinnable fibres

Science.gov (United States)

Yuan, Daojun; Tang, Zhonghui; Wang, Maojun; Gao, Wenhui; Tu, Lili; Jin, Xin; Chen, Lingling; He, Yonghui; Zhang, Lin; Zhu, Longfu; Li, Yang; Liang, Qiqi; Lin, Zhongxu; Yang, Xiyan; Liu, Nian; Jin, Shuangxia; Lei, Yang; Ding, Yuanhao; Li, Guoliang; Ruan, Xiaoan; Ruan, Yijun; Zhang, Xianlong

2015-01-01

Gossypium hirsutum contributes the most production of cotton fibre, but G. barbadense is valued for its better comprehensive resistance and superior fibre properties. However, the allotetraploid genome of G. barbadense has not been comprehensively analysed. Here we present a high-quality assembly of the 2.57 gigabase genome of G. barbadense, including 80,876 protein-coding genes. The double-sized genome of the A (or At) (1.50 Gb) against D (or Dt) (853 Mb) primarily resulted from the expansion of Gypsy elements, including Peabody and Retrosat2 subclades in the Del clade, and the Athila subclade in the Athila/Tat clade. Substantial gene expansion and contraction were observed and rich homoeologous gene pairs with biased expression patterns were identified, suggesting abundant gene sub-functionalization occurred by allopolyploidization. More specifically, the CesA gene family has adapted differentially temporal expression patterns, suggesting an integrated regulatory mechanism of CesA genes from At and Dt subgenomes for the primary and secondary cellulose biosynthesis of cotton fibre in a “relay race”-like fashion. We anticipate that the G. barbadense genome sequence will advance our understanding the mechanism of genome polyploidization and underpin genome-wide comparison research in this genus. PMID:26634818

Review of potential environmental impacts of transgenic glyphosate-resistant soybean in Brazil.

Science.gov (United States)

Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B; Spadotto, Claudio A

2007-01-01

Transgenic glyphosate-resistant soybeans (GRS) have been commercialized and grown extensively in the Western Hemisphere, including Brazil. Worldwide, several studies have shown that previous and potential effects of glyphosate on contamination of soil, water, and air are minimal, compared to those caused by the herbicides that they replace when GRS are adopted. In the USA and Argentina, the advent of glyphosate-resistant soybeans resulted in a significant shift to reduced- and no-tillage practices, thereby significantly reducing environmental degradation by agriculture. Similar shifts in tillage practiced with GRS might be expected in Brazil. Transgenes encoding glyphosate resistance in soybeans are highly unlikely to be a risk to wild plant species in Brazil. Soybean is almost completely self-pollinated and is a non-native species in Brazil, without wild relatives, making introgression of transgenes from GRS virtually impossible. Probably the highest agricultural risk in adopting GRS in Brazil is related to weed resistance. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. These include Chamaesyce hirta (erva-de-Santa-Luzia), Commelina benghalensis (trapoeraba), Spermacoce latifolia (erva-quente), Richardia brasiliensis (poaia-branca), and Ipomoea spp. (corda-de-viola). Four weed species, Conyza bonariensis, Conyza Canadensis (buva), Lolium multiflorum (azevem), and Euphorbia heterophylla (amendoim bravo), have evolved resistance to glyphosate in GRS in Brazil and have great potential to become problems.

Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

Science.gov (United States)

Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

2015-10-01

Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

Silicon (Si) alleviates cotton (Gossypium hirsutum L.) from zinc (Zn) toxicity stress by limiting Zn uptake and oxidative damage.

Science.gov (United States)

Anwaar, Shad Ali; Ali, Shafaqat; Ali, Skhawat; Ishaque, Wajid; Farid, Mujahid; Farooq, Muhammad Ahsan; Najeeb, Ullah; Abbas, Farhat; Sharif, Muhammad

2015-03-01

Silicon (Si) is as an important fertilizer element, which has been found effective in enhancing plant tolerance to variety of biotic and a-biotic stresses. This study investigates the Si potential to alleviate zinc (Zn) toxicity stress in cotton (Gossypium hirsutum L.). Cotton plants were grown in hydroponics and exposed to different Zn concentration, 0, 25, and 50 μM, alone and/or in combination with 1 mM Si. Incremental Zn concentration in growth media instigated the cellular oxidative damage that was evident from elevated levels of hydrogen peroxide (H2O2), electrolyte leakage, and malondialdehyde (MDA) and consequently inhibited cotton growth, biomass, chlorophyll pigments, and photosynthetic process. Application of Si significantly suppressed Zn accumulation in various plant parts, i.e., roots, stems, and leaves and thus promoted biomass, photosynthetic, growth parameters, and antioxidant enzymes activity of Zn-stressed as well unstressed plants. In addition, Si reduced the MDA and H2O2 production and electrolyte leakage suggesting its role in protecting cotton plants from Zn toxicity-induced oxidative damage. Thus, the study indicated that exogenous Si application could improve growth and development of cotton crop experiencing Zn toxicity stress by limiting Zn bioavailability and oxidative damage.

Biological control of cotton aphid (Aphis gossypii Glover) in cotton (inter)cropping systems in China : a simulation study

NARCIS (Netherlands)

Xia, J.

1997-01-01

Cotton aphid ( Aphis gossypii Glover) is the key insect pest of seedling cotton ( Gossypium hirsutum L. ) in China, particularly in the North China cotton region. The resulting annual losses amount to 10-15% of the attainable yield. Sole reliance on

A New Synthetic Amphiploid (AADDAA) between Gossypium hirsutum and G. arboreum Lays the Foundation for Transferring Resistances to Verticillium and Drought

Science.gov (United States)

Chen, Yu; Wang, Yingying; Zhao, Ting; Yang, Jianwei; Feng, Shouli; Nazeer, Wajad; Zhang, Tianzhen; Zhou, Baoliang

2015-01-01

Gossypium arboreum, a cultivated cotton species (2n = 26, AA) native to Asia, possesses invaluable characteristics unavailable in the tetraploid cultivated cotton gene pool, such as resistance to pests and diseases and tolerance to abiotic stresses. However, it is quite difficult to transfer favorable traits into Upland cotton through conventional methods due to the cross-incompatibility of G. hirsutum (2n = 52, AADD) and G. arboreum. Here, we improved an embryo rescue technique to overcome the cross-incompatibility between these two parents for transferring favorable genes from G. arboreum into G. hirsutum. Our results indicate that MSB2K supplemented with 0.5 mgl-1 kinetin and 250 mg-1 casein hydrolysate is an efficient initial medium for rescuing early (3 d after pollination) hybrid embryos. Eight putative hybrids were successfully obtained, which were further verified and characterized by cytology, molecular markers and morphological analysis. The putative hybrids were subsequently treated with different concentrations of colchicine solution to double their chromosomes. The results demonstrate that four putative hybrid plants were successfully chromosome-doubled by treatment with 0.1% colchicine for 24 h and become amphiploid, which were confirmed by cytological observation, self-fertilization and backcrossing. Preliminary assessments of resistance at seedling stage indicate that the synthetic amphiploid showed highly resistant to Verticillium and drought. The synthetic amphiploid between G. hirsutum × G. arboreum would lay the foundation for developing G. arboreum-introgressed lines with the uniform genetic background of G. hirsutum acc TM-1, which would greatly enhance and simplify the mining, isolation, characterization, cloning and use of G. arboreum-specific desirable genes in future cotton breeding programs. PMID:26061996

A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

Science.gov (United States)

Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

2017-12-01

A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

Error-prone PCR mutation of Ls-EPSPS gene from Liriope spicata conferring to its enhanced glyphosate-resistance.

Science.gov (United States)

Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng

2017-09-01

Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.

The intensity of non-target site mechanisms influences the level of resistance of sourgrass to glyphosate

Directory of Open Access Journals (Sweden)

Flávia Regina da Costa

2014-02-01

Full Text Available Non-target site mechanisms are involved in the resistance of sourgrass (Digitaria insularis to glyphosate. Studies on the 14C-glyphosate absorption and translocation as well as the detection of glyphosate and its metabolites in sourgrass plants were carried out under controlled conditions to investigate if the differential response of resistant sourgrass biotypes (R1 and R2 is derived from the intensity of non-target site mechanisms involved in the resistance to glyphosate. Different pattern of absorption was observed between S (susceptible and R2 from 12 up to 48 hours after treatment with glyphosate (HAT, and between S and R1 just at 12 HAT. The initial difference in glyphosate absorption among the biotypes did not maintained at 96 HAT and afterwards. Smaller amount of herbicide left the treated leaf into the rest of shoot and roots in R2 (25% than in S (58% and R1 (52%. In addition, slight difference in glyphosate translocation was observed between S and R1. We found high percentage (81% of glyphosate in the S biotype up to 168 HAT, while just 44% and 2% of glyphosate was recovered from R1 and R2 plant tissues. In addition, high percentage of glyphosate metabolites was found in R2 (98% and R1 (56% biotypes, while a very low percentage (11% was found in the S biotype. As previous studies indicated resistant factors of 3.5 and 5.6 for R1 and R2, respectively, we conclude that the differential response of sourgrass biotypes is derived from the intensity of the non-target site mechanisms involved in the resistance to glyphosate.

Genome-wide identification of mitogen-activated protein kinase gene family in Gossypium raimondii and the function of their corresponding orthologs in tetraploid cultivated cotton.

Science.gov (United States)

Zhang, Xueying; Wang, Liman; Xu, Xiaoyang; Cai, Caiping; Guo, Wangzhen

2014-12-10

Mitogen-activated protein kinase (MAPK) cascades play a crucial role in plant growth and development as well as biotic and abiotic stress responses. Knowledge about the MAPK gene family in cotton is limited, and systematic investigation of MAPK family proteins has not been reported. By performing a bioinformatics homology search, we identified 28 putative MAPK genes in the Gossypium raimondii genome. These MAPK members were anchored onto 11 chromosomes in G. raimondii, with uneven distribution. Phylogenetic analysis showed that the MAPK candidates could be classified into the four known A, B, C and D groups, with more MAPKs containing the TEY phosphorylation site (18 members) than the TDY motif (10 members). Furthermore, 21 cDNA sequences of MAPKs with complete open reading frames (ORFs) were identified in G. hirsutum via PCR-based approaches, including 13 novel MAPKs and eight with homologs reported previously in tetraploid cotton. The expression patterns of 23 MAPK genes reveal their important roles in diverse functions in cotton, in both various developmental stages of vegetative and reproductive growth and in the stress response. Using a reverse genetics approach based on tobacco rattle virus-induced gene silencing (TRV-VIGS), we further verified that MPK9, MPK13 and MPK25 confer resistance to defoliating isolates of Verticillium dahliae in cotton. Silencing of MPK9, MPK13 and MPK25 can significantly enhance cotton susceptibility to this pathogen. This study presents a comprehensive identification of 28 mitogen-activated protein kinase genes in G. raimondii. Their phylogenetic relationships, transcript expression patterns and responses to various stressors were verified. This study provides the first systematic analysis of MAPKs in cotton, improving our understanding of defense responses in general and laying the foundation for future crop improvement using MAPKs.

Heterologous Expression of the Cotton NBS-LRR Gene GbaNA1 Enhances Verticillium Wilt Resistance in Arabidopsis

Directory of Open Access Journals (Sweden)

Nan-Yang Li

2018-02-01

Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.

Impact of glyphosate resistant corn, glyphosate applications, and tillage on soil nutrient ratios, exoenzyme activities, and nutrient acquisition ratios

Science.gov (United States)

We report results of the last two years of a 7-year (2008-2014) field experiment designed to test the null hypothesis that applications of glyphosate on glyphosate resistant corn (Zea mays L.) as a routine weed control practice under both conventional and reduced tillage practices would have no effe...

Gene expression in response to Cotton Leaf Curl Virus infection in Gossypium hirsutum under variable environmental conditions

Directory of Open Access Journals (Sweden)

Rehman Iqra

2017-01-01

Full Text Available Cotton Leaf Curl Disease (CLCuD is one of the threatening constrains of cotton production in Pakistan for which no adequate remedy is available until now. Local variety of Gossypium hirsutum (FH-142 was grown in field and infected naturally by CLCuV under variable range of temperature and humidity. Plants showed thickening of veins in lower leaf surface at 34°C and 60% relative humidity at 15days post infection (dpi and curling of leaf margins at 33°C with 58% relative humidity at 30dpi. Remarkable leaf darkening was observed with reduced boll formation at 45dpi at 26°C and 41% relative humidity. Enation developed, severe thickening and curling of leaves intensified and plants showed dwarf growth at 60dpi at 24°C with 52% relative humidity. PCR amplification of Rep associated gene confirmed the presence of CLCuD-associated begomovirus in the infected samples. Quantitative RT-PCR confirmed the amplification and differential expression of a number of pathogen stress responsive genes at different levels of temperature and humidity. This observation predicts that Cotton Leaf Curl Virus (CLCuV interacts with several host genes that are upregulated to make plants susceptible or suppress other genes to overcome host defense responses.

Current status of genetic engineering in cotton (Gossypium hirsutum L): an assessment.

Science.gov (United States)

Chakravarthy, Vajhala S K; Reddy, Tummala Papi; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

2014-06-01

Cotton is considered as the foremost commercially important fiber crop and is deemed as the backbone of the textile industry. The productivity of cotton crop, worldwide, is severely hampered by the occurrence of pests, weeds, pathogens apart from various environmental factors. Several beneficial agronomic traits, viz., early maturity, improved fiber quality, heat tolerance, etc. have been successfully incorporated into cotton varieties employing conventional hybridization and mutation breeding. Crop losses, due to biotic factors, are substantial and may be reduced through certain crop protection strategies. In recent years, pioneering success has been achieved through the adoption of modern biotechnological approaches. Genetically engineered cotton varieties, expressing Bacillus thuringiensis cry genes, proved to be highly successful in controlling the bollworm complex. Various other candidate genes responsible for resistance to insect pests and pathogens, tolerance to major abiotic stress factors such as temperature, drought and salinity, have been introduced into cotton via genetic engineering methods to enhance the agronomic performance of cotton cultivars. Furthermore, genes for improving the seed oil quality and fiber characteristics have been identified and introduced into cotton cultivars. This review provides a brief overview of the various advancements made in cotton through genetic engineering approaches.

What do farmers' weed control decisions imply about glyphosate resistance? Evidence from surveys of US corn fields.

Science.gov (United States)

Wechsler, Seth J; McFadden, Jonathan R; Smith, David J

2018-05-01

The first case of glyphosate-resistant weeds in the United States was documented in 1998, 2 years after the commercialization of genetically engineered herbicide-resistant (HR) corn and soybeans. Currently, over 15 glyphosate-resistant weed species affect US crop production areas. These weeds have the potential to reduce yields, increase costs, and lower farm profitability. The objective of our study is to develop a behavioral model of farmers' weed management decisions and use it to analyze weed resistance to glyphosate in US corn farms. On average, we find that weed control increased US corn yields by 3700 kg ha -1 (worth approximately $US 255 ha -1 ) in 2005 and 3500 kg ha -1 (worth approximately $US 575 ha -1 ) in 2010. If glyphosate resistant weeds were absent, glyphosate killed approximately 99% of weeds, on average, when applied at the label rate in HR production systems. Average control was dramatically lower in states where glyphosate resistance was widespread. We find that glyphosate resistance had a significant impact on weed control costs and corn yields of US farmers in 2005 and 2010. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Identification of regulated genes conferring resistance to high concentrations of glyphosate in a new strain of Enterobacter.

Science.gov (United States)

Fei, Yun-Yan; Gai, Jun-Yi; Zhao, Tuan-Jie

2013-12-01

Glyphosate is a widely used herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity. Most plants and microbes are sensitive to glyphosate. However, transgenic-resistant crops that contain a modified epsps obtained from the resistant microbes have been commercially successful and therefore, new resistance genes and their adaptive regulatory mechanisms are of great interest. In this study, a soil-borne, glyphosate-resistant bacterium was selected and identified as Enterobacter. The EPSPS in this strain was found to have been altered to a resistant one. A total of 42 differentially expressed genes (DEGs) in the glyphosate were screened using microarray techniques. Under treatment, argF, sdhA, ivbL, rrfA-H were downregulated, whereas the transcripts of speA, osmY, pflB, ahpC, fusA, deoA, uxaC, rpoD and a few ribosomal protein genes were upregulated. Data were verified by quantitative real-time PCR on selected genes. All transcriptional changes appeared to protect the bacteria from glyphosate and associated osmotic, acidic and oxidative stresses. Many DEGs may have the potential to confer resistance to glyphosate alone, and some may be closely related to the shikimate pathway, reflecting the complex gene interaction network for glyphosate resistance. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Yield of glyphosate-resistant sugar beets and efficiency of weed management systems with glyphosate and conventional herbicides under German and Polish crop production.

Science.gov (United States)

Nichterlein, Henrike; Matzk, Anja; Kordas, Leszek; Kraus, Josef; Stibbe, Carsten

2013-08-01

In sugar beet production, weed control is one of the most important and most expensive practices to ensure yield. Since glyphosate-resistant sugar beets are not yet approved for cultivation in the EU, little commercial experience exists with these sugar beets in Europe. Experimental field trials were conducted at five environments (Germany, Poland, 2010, 2011) to compare the effects of glyphosate with the effects of conventional weed control programs on the development of weeds, weed control efficiency and yield. The results show that the glyphosate weed control programs compared to the conventional methods decreased not only the number of herbicide applications but equally in magnitude decreased the dosage of active ingredients. The results also showed effective weed control with glyphosate when the weed covering was greater and sugar beets had a later growth stage of four true leaves. Glyphosate-resistant sugar beets applied with the glyphosate herbicide two or three times had an increase in white sugar yield from 4 to 18 % in comparison to the high dosage conventional herbicide systems. In summary, under glyphosate management sugar beets can positively contribute to the increasingly demanding requirements regarding efficient sugar beet cultivation and to the demands by society and politics to reduce the use of chemical plant protection products in the environment.

Insecticide use and practices among cotton farmers in northern ...

African Journals Online (AJOL)

Cotton (Gossypium hirsutum L.) is an important cash crop in Uganda. Insecticide application practices among cotton growers in northern Uganda were examined to determine the pests targeted and the compliance of control measures with the standards recommended by the Uganda's Cotton Development Organization ...

EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

Science.gov (United States)

Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

2016-08-12

Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance.

The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis

Directory of Open Access Journals (Sweden)

Muhammad Sajjad Ali

2013-07-01

Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.

iTRAQ-facilitated proteomic profiling of anthers from a photosensitive male sterile mutant and wild-type cotton (Gossypium hirsutum L.).

Science.gov (United States)

Liu, Ji; Pang, Chaoyou; Wei, Hengling; Song, Meizhen; Meng, Yanyan; Ma, Jianhui; Fan, Shuli; Yu, Shuxun

2015-08-03

Male sterility is a common phenomenon in flowering plants, and it has been successfully developed in several crops by taking advantage of heterosis. Cotton (Gossypium hirsutum L.) is an important economic crop, used mainly for the production of textile fiber. Using a space mutation breeding technique, a novel photosensitive genetic male sterile mutant CCRI9106 was isolated from the wild-type upland cotton cultivar CCRI040029. To use CCRI9106 in cotton hybrid breeding, it is of great importance to study the molecular mechanisms of its male sterility. Here, histological and iTRAQ-facilitated proteomic analyses of anthers were performed to explore male sterility mechanisms of the mutant. Scanning and transmission electron microscopy of the anthers showed that the development of pollen wall in CCRI9106 was severely defective with a lack of exine formation. At the protein level, 6121 high-confidence proteins were identified and 325 of them showed differential expression patterns between mutant and wild-type anthers. The proteins up- or down-regulated in MT anthers were mainly involved in exine formation, protein degradation, calcium ion binding,etc. These findings provide valuable information on the proteins involved in anther and pollen development, and contribute to elucidate the mechanism of male sterility in upland cotton. Copyright © 2015. Published by Elsevier B.V.

Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase.

Science.gov (United States)

Baerson, Scott R; Rodriguez, Damian J; Tran, Minhtien; Feng, Yongmei; Biest, Nancy A; Dill, Gerald M

2002-07-01

The spontaneous occurrence of resistance to the herbicide glyphosate in weed species has been an extremely infrequent event, despite over 20 years of extensive use. Recently, a glyphosate-resistant biotype of goosegrass (Eleusine indica) was identified in Malaysia exhibiting an LD(50) value approximately 2- to 4-fold greater than the sensitive biotype collected from the same region. A comparison of the inhibition of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity by glyphosate in extracts prepared from the resistant (R) and sensitive (S) biotypes revealed an approximately 5-fold higher IC(50)(glyphosate) for the (R) biotype. Sequence comparisons of the predicted EPSPS mature protein coding regions from both biotypes revealed four single-nucleotide differences, two of which result in amino acid changes. One of these changes, a proline to serine substitution at position 106 in the (R) biotype, corresponds to a substitution previously identified in a glyphosate-insensitive EPSPS enzyme from Salmonella typhimurium. Kinetic data generated for the recombinant enzymes suggests that the second substitution identified in the (R) EPSPS does not contribute significantly to its reduced glyphosate sensitivity. Escherichia coli aroA- (EPSPS deficient) strains expressing the mature EPSPS enzyme from the (R) biotype exhibited an approximately 3-fold increase in glyphosate tolerance relative to strains expressing the mature EPSPS from the (S) biotype. These results provide the first evidence for an altered EPSPS enzyme as an underlying component of evolved glyphosate resistance in any plant species.

Effects of GhWUS from upland cotton (Gossypium hirsutum L.) on somatic embryogenesis and shoot regeneration.

Science.gov (United States)

Xiao, Yanqing; Chen, Yanli; Ding, Yanpeng; Wu, Jie; Wang, Peng; Yu, Ya; Wei, Xi; Wang, Ye; Zhang, Chaojun; Li, Fuguang; Ge, Xiaoyang

2018-05-01

The WUSCHEL (WUS) gene encodes a plant-specific homeodomain-containing transcriptional regulator, which plays important roles during embryogenesis, as well as in the formation of shoot and flower meristems. Here, we isolated two homologues of Arabidopsis thaliana WUS (AtWUS), GhWUS1a_At and GhWUS1b_At, from upland cotton (Gossypium hirsutum). Domain analysis suggested that the two putative GhWUS proteins contained a highly conserved DNA-binding HOX domain and a WUS-box. Expression profile analysis showed that GhWUSs were predominantly expressed during the embryoid stage. Ectopic expression of GhWUSs in Arabidopsis could induce somatic embryo and shoot formation from seedling root tips. Furthermore, in the absence of exogenous hormone, overexpression of GhWUSs in Arabidopsis could promote shoot regeneration from excised roots, and in the presence of exogenous auxin, excised roots expressing GhWUS could be induced to produce somatic embryo. In addition, expression of the chimeric GhWUS repressor in cotton callus inhibited embryogenic callus formation. Our results show that GhWUS is an important regulator of somatic embryogenesis and shoot regeneration. Copyright © 2018 Elsevier B.V. All rights reserved.

Potassium improves photosynthetic tolerance to and recovery from episodic drought stress in functional leaves of cotton (Gossypium hirsutum L.).

Science.gov (United States)

Zahoor, Rizwan; Zhao, Wenqing; Dong, Haoran; Snider, John L; Abid, Muhammad; Iqbal, Babar; Zhou, Zhiguo

2017-10-01

To investigate whether potassium (K) application enhances the potential of cotton (Gossypium hirsutum L.) plants to maintain physiological functions during drought and recovery, low K-sensitive (Siza 3) and -tolerant (Simian 3) cotton cultivars were exposed to three K rates (0, 150, and 300 K 2 O kg ha -1 ) and either well-watered conditions or severe drought stress followed by a recovery period. Under drought stress, cotton plants showed a substantial decline in leaf water potential, stomatal conductance, photosynthetic rate, and the maximum and actual quantum yield of PSII, resulting in greater non-photochemical quenching and lipid peroxidation as compared to well-watered plants. However, plants under K application not only showed less of a decline in these traits but also displayed greater potential to recover after rewatering as compared to the plants without K application. Plants receiving K application showed lower lipid peroxidation, higher antioxidant enzyme activities, and increased proline accumulation as compared to plants without K application. Significant relationships between rates of photosynthetic recovery and K application were observed. The cultivar Siza 3 exhibited a more positive response to K application than Simian 3. The results suggest that K application enhances the cotton plant's potential to maintain functionality under drought and facilitates recovery after rewatering. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Genome-wide divergence, haplotype distribution and population demographic histories for Gossypium hirsutum and Gossypium barbadense as revealed by genome-anchored SNPs

Science.gov (United States)

Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we exami...

A New Synthetic Allotetraploid (A1A1G2G2) between Gossypium herbaceum and G. australe: Bridging for Simultaneously Transferring Favorable Genes from These Two Diploid Species into Upland Cotton

Science.gov (United States)

Chen, Yu; Wang, Yingying; Chen, Jinjin; Zhang, Tianzhen; Zhou, Baoliang

2015-01-01

Gossypium herbaceum, a cultivated diploid cotton species (2n = 2x = 26, A1A1), has favorable traits such as excellent drought tolerance and resistance to sucking insects and leaf curl virus. G. australe, a wild diploid cotton species (2n = 2x = 26, G2G2), possesses numerous economically valuable characteristics such as delayed pigment gland morphogenesis (which is conducive to the production of seeds with very low levels of gossypol as a potential food source for humans and animals) and resistance to insects, wilt diseases and abiotic stress. Creating synthetic allotetraploid cotton from these two species would lay the foundation for simultaneously transferring favorable genes into cultivated tetraploid cotton. Here, we crossed G. herbaceum (as the maternal parent) with G. australe to produce an F1 interspecific hybrid and doubled its chromosome complement with colchicine, successfully generating a synthetic tetraploid. The obtained tetraploid was confirmed by morphology, cytology and molecular markers and then self-pollinated. The S1 seedlings derived from this tetraploid gradually became flavescent after emergence of the fifth true leaf, but they were rescued by grafting and produced S2 seeds. The rescued S1 plants were partially fertile due to the existence of univalents at Metaphase I of meiosis, leading to the formation of unbalanced, nonviable gametes lacking complete sets of chromosomes. The S2 plants grew well and no flavescence was observed, implying that interspecific incompatibility, to some extent, had been alleviated in the S2 generation. The synthetic allotetraploid will be quite useful for polyploidy evolutionary studies and as a bridge for transferring favorable genes from these two diploid species into Upland cotton through hybridization. PMID:25879660

Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

Evolution of a double amino acid substitution in the 5-enolpyruvylshikimate-3-phosphate synthase in Eleusine indica conferring high-level glyphosate resistance.

Science.gov (United States)

Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R Douglas; Powles, Stephen B

2015-04-01

Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I+P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. © 2015 American Society of Plant Biologists. All Rights Reserved.

Control of glyphosate resistant hairy fleabane (Conyza bonariensis with dicamba and 2,4-D Controle de buva (Conyza bonariensis resistente ao glyphosate com dicamba e 2,4-D

Directory of Open Access Journals (Sweden)

D.J. Soares

2012-06-01

Full Text Available Auxyn type herbicides such as dicamba and 2,4-D are alternative herbicides that can be used to control glyphosate-resistant hairy fleabane. With the forthcoming possibility of releasing dicamba-resistant and 2,4-D-resistant crops, use of these growth regulator herbicides will likely be an alternative that can be applied to the control of glyphosate resistant hairy fleabane (Conyza bonariensis. The objective of this research was to model the efficacy, through dose-response curves, of glyphosate, 2,4-D, isolated dicamba and glyphosatedicamba combinations to control a brazilian hairy fleabane population resistant to glyphosate. The greenhouse dose-response studies were conducted as a completely randomized experimental design, and the rates used for dose response curve construction were 0, 120, 240, 480, 720 and 960 g a.i. ha-1 for 2,4-D, dicamba and the dicamba combination, with glyphosate at 540 g a.e. ha-1. The rates for glyphosate alone were 0, 180, 360, 540, 720 and 960 g a.e. ha-1. Herbicides were applied when the plants were in a vegetative stage with 10 to 12 leaves and height between 12 and 15 cm. Hairy fleabane had low sensitivity to glyphosate, with poor control even at the 960 g a.e. ha-1 rate. Dicamba and 2,4-D were effective in controlling the studied hairy fleabane. Hairy fleabane responds differently to 2,4-D and dicamba. The combination of glyphosate and dicamba was not antagonistic to hairy fleabane control, and glyphosate may cause an additive effect on the control, despite the population resistance.Os herbicidas mimetizadores de auxinas como dicamba e 2,4-D são alternativas para o controle de buva resistente ao glyphosate. Com a possível futura liberação comercial de culturas resistentes ao dicamba e 2,4-D, a aplicação destes herbicidas reguladores de crescimento será uma provável alternativa de controle de buva resistente ao glyphosate. O objetivo desta pesquisa foi modelar por meio de curvas de dose-resposta a efic

Evolution of a Double Amino Acid Substitution in the 5-Enolpyruvylshikimate-3-Phosphate Synthase in Eleusine indica Conferring High-Level Glyphosate Resistance1

Science.gov (United States)

Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.

2015-01-01

Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039

Investigating the mechanisms of glyphosate resistance in goosegrass (Eleusine indica (L.) Gaertn.) by RNA sequencing technology.

Science.gov (United States)

Chen, Jingchao; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Xu; Zhang, Chaoxian

2017-01-01

Glyphosate is an important non-selective herbicide that is in common use worldwide. However, evolved glyphosate-resistant (GR) weeds significantly affect crop yields. Unfortunately, the mechanisms underlying resistance in GR weeds, such as goosegrass (Eleusine indica (L.) Gaertn.), an annual weed found worldwide, have not been fully elucidated. In this study, transcriptome analysis was conducted to further assess the potential mechanisms of glyphosate resistance in goosegrass. The RNA sequencing libraries generated 24 597 462 clean reads. De novo assembly analysis produced 48 852 UniGenes with an average length of 847 bp. All UniGenes were annotated using seven databases. Sixteen candidate differentially expressed genes selected by digital gene expression analysis were validated by quantitative real-time PCR (qRT-PCR). Among these UniGenes, the EPSPS and PFK genes were constitutively up-regulated in resistant (R) individuals and showed a higher copy number than that in susceptible (S) individuals. The expressions of four UniGenes relevant to photosynthesis were inhibited by glyphosate in S individuals, and this toxic response was confirmed by gas exchange analysis. Two UniGenes annotated as glutathione transferase (GST) were constitutively up-regulated in R individuals, and were induced by glyphosate both in R and S. In addition, the GST activities in R individuals were higher than in S. Our research confirmed that two UniGenes (PFK, EPSPS) were strongly associated with target resistance, and two GST-annotated UniGenes may play a role in metabolic glyphosate resistance in goosegrass. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

(Gossypium hirsutum L.) CONTRE LA FUSARIOSE EFFECT ...

African Journals Online (AJOL)

EFFECT OFOLIGOSACCHARIDE FRACTION OF Fusarium oxysporum f. sp. vasinfectum ON COTTON PROTECTION (Gossypium hirsutum L.) AGAINST FUSARIUM WILT. R. A. N'GORAN épse BLA1,2, H. T. KOUAKOU2, F. K. Y. KONAN2, B. CAMARA1,. N. K. KOUASSI3 et D. KONE1. 1Laboratoire de Physiologie Végétale, ...

Screening of cotton (gossypium hirsutum l.) genotypes for heat tolerance

International Nuclear Information System (INIS)

Abro, S.; Khan, M.A.; Sial, M.A.

2015-01-01

Cotton yield is highly affected due to biotic (diseases and pests) and abiotic (heat, dought and salinity) Stresses. Among them, high temperature is the main environmental constraint which adversely reduces cotton yield and quality. High temperature above 36 degree C affects plant growth and development especially during reproductive phase. Present studies were carried out to assess the tolerance of fifty-eight newly evolved cotton genotypes to heat stresses, based on agronomic and physiological characteristics. The genotypes were screened in field conditions under two temperature regimes. The studies were conducted at experimental farm of Nuclear Institute of Agriculture, Tando Jam, Pakistan. The results showed that March sown crop experienced high temperature (i.e. > 44 degree C in May and June), which significantly affected crop growth and productivity. The genotypes were identified as heat-tolerant on the basis of relative cell injury percentage (RCI %), heat susceptibility index (HSI) values, boll retention and seed cotton yield (kg/ha). RCI level in cotton genotypes ranged from 39.0 to 86.0%. Out of 58, seventeen genotypes (viz.NIA-80, NIA-81, NIA-83, NIA-84, NIA-M-30, NIA-M31, NIA-HM-48, NIA-HM-327, NIA-H-32, NIA-HM-2-1, NIA-Bt1, NIA-Bt2, NIA-Perkh, CRIS-342, CRIS-134, NIAB-111 and check variety Sadori indicated high level of heat tolerance at both (heat-stressed and non-stressed) temperature regimes; as shown the lowest relative injury level and relatively heat resistant index (HSI<1) values. Such genotypes could be used as heattolerant genotypes under heat-stressed environments. (author)

Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

Science.gov (United States)

Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

2015-10-01

Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

Recent long-distance transgene flow into wild populations conforms to historical patterns of gene flow in cotton (Gossypium hirsutum) at its centre of origin.

Science.gov (United States)

Wegier, A; Piñeyro-Nelson, A; Alarcón, J; Gálvez-Mariscal, A; Alvarez-Buylla, E R; Piñero, D

2011-10-01

Over 95% of the currently cultivated cotton was domesticated from Gossypium hirsutum, which originated and diversified in Mexico. Demographic and genetic studies of this species at its centre of origin and diversification are lacking, although they are critical for cotton conservation and breeding. We investigated the actual and potential distribution of wild cotton populations, as well as the contribution of historical and recent gene flow in shaping cotton genetic diversity and structure. We evaluated historical gene flow using chloroplast microsatellites and recent gene flow through the assessment of transgene presence in wild cotton populations, exploiting the fact that genetically modified cotton has been planted in the North of Mexico since 1996. Assessment of geographic structure through Bayesian spatial analysis, BAPS and Genetic Algorithm for Rule-set Production (GARP), suggests that G. hirsutum seems to conform to a metapopulation scheme, with eight distinct metapopulations. Despite evidence for long-distance gene flow, genetic variation among the metapopulations of G. hirsutum is high (He = 0.894 ± 0.01). We identified 46 different haplotypes, 78% of which are unique to a particular metapopulation, in contrast to a single haplotype detected in cotton cultivars. Recent gene flow was also detected (m = 66/270 = 0.24), with four out of eight metapopulations having transgenes. We discuss the implications of the data presented here with respect to the conservation and future breeding of cotton populations and genetic diversity at its centre of crop origin. © 2011 Blackwell Publishing Ltd.

Critical osmotic, ionic and physiological indicators of salinity tolerance in cotton (gossypium hirsutum l.) for cultivar selection

International Nuclear Information System (INIS)

Munis, M.F.H.; Tu, L.; Ziaf, K; Tan, J.; Deng, F.; Zhang, X.

2010-01-01

Salinity affects the germination, growth and ultimately the yield of cotton (Gossypium hirsutum L.) which demands reliable traits for the evaluation and selection of salt tolerant cultivars. Here, ten major osmotic, ionic and physiological parameters have been studied to distinguish the effect of salinity in two different cultivars of cotton. Plants were grown in hydroponic system and exposed to different salinity levels of NaCl followed by its recovery under non saline conditions. Data was recorded at three different stages i.e., before stress, after stress and after recovery for comparative study. Recovery assay proved to be very helpful in extracting reliable results. Both cultivars showed significantly different response to Na+ and K+ accumulation and phenotypically salt tolerant cultivar (Coker 312) accumulated less Na+ and more K+ in comparison with susceptible (Simian 3). Decrease in leaf area, seed germination and seedling growth were also conclusive to differentiate these cultivars. We also found other physiological parameters like relative leaf water content (RLWC), plant fresh-weight (PFW), plant dry-weight (PDW), relative growth rate (RGR) and stomatal behavior as good indicators of salinity but could not find their significant role to differentiate two closely relevant cultivars regarding salinity tolerance. Our studies revealed that proline accumulation and chlorophyll concentration are not significant to be used as accurate indicators to characterize the sensitivity of cotton cultivars to salinity. We found post-recovery analysis to be very useful in understanding the role and behavior of different indicators of salinity. (author)

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

Shan Xin

Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Science.gov (United States)

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Regulation of auxin on secondary cell wall cellulose biosynthesis in developing cotton fibers

Science.gov (United States)

Cotton (Gossypium hirsutum L.) fibers are unicellular trichomes that differentiate from epidermal cells of developing cotton ovules. Mature fibers exhibit thickened secondary walls composed of nearly pure cellulose. Cotton fiber development is divided into four overlapping phases, 1) initiation sta...

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

Science.gov (United States)

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

Science.gov (United States)

Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

2014-02-01

Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

Transcriptome Sequencing and Differential Gene Expression Analysis of Delayed Gland Morphogenesis in Gossypium australe during Seed Germination

Science.gov (United States)

Tao, Tao; Zhao, Liang; Lv, Yuanda; Chen, Jiedan; Hu, Yan; Zhang, Tianzhen; Zhou, Baoliang

2013-01-01

The genus Gossypium is a globally important crop that is used to produce textiles, oil and protein. However, gossypol, which is found in cultivated cottonseed, is toxic to humans and non-ruminant animals. Efforts have been made to breed improved cultivated cotton with lower gossypol content. The delayed gland morphogenesis trait possessed by some Australian wild cotton species may enable the widespread, direct usage of cottonseed. However, the mechanisms about the delayed gland morphogenesis are still unknown. Here, we sequenced the first Australian wild cotton species ( Gossypium australe ) and a diploid cotton species ( Gossypium arboreum ) using the Illumina Hiseq 2000 RNA-seq platform to help elucidate the mechanisms underlying gossypol synthesis and gland development. Paired-end Illumina short reads were de novo assembled into 226,184, 213,257 and 275,434 transcripts, clustering into 61,048, 47,908 and 72,985 individual clusters with N50 lengths of 1,710 bp, 1544 BP and 1,743 bp, respectively. The clustered Unigenes were searched against three public protein databases (TrEMBL, SwissProt and RefSeq) and the nucleotide and protein sequences of Gossypium raimondii using BLASTx and BLASTn. A total of 21,987, 17,209 and 25,325 Unigenes were annotated. Of these, 18,766 (85.4%), 14,552 (84.6%) and 21,374 (84.4%) Unigenes could be assigned to GO-term classifications. We identified and analyzed 13,884 differentially expressed Unigenes by clustering and functional enrichment. Terpenoid-related biosynthesis pathways showed differentially regulated expression patterns between the two cotton species. Phylogenetic analysis of the terpene synthases family was also carried out to clarify the classifications of TPSs. RNA-seq data from two distinct cotton species provide comprehensive transcriptome annotation resources and global gene expression profiles during seed germination and gland and gossypol formation. These data may be used to further elucidate various mechanisms and

Investigation of glyphosate resistance levels and target-site based resistance (TSR) mechanisms in Conyza canadensis (L.) from apple orchards around areas of Bohai seas and Loess Plateau in China.

Science.gov (United States)

Mei, Yu; Xu, Yufang; Wang, Shipeng; Qiu, Lihong; Zheng, Mingqi

2018-04-01

The resistance levels to glyphosate and target-site based resistance mechanisms in susceptible (S) and resistant (R) Conyza canadensis (L.) populations, which were collected from apple orchards around areas of Bohai seas and Loess Plateau in China, were investigated. Among forty C. canadensis populations, eighteen populations (45%) were still susceptible; fourteen populations (35%) evolved low resistance levels resistance to glyphosate with resistance index (RI) of 2.02 to 3.90. In contrast, eight populations (20%) evolved medium resistance levels with RI of 4.35 to 8.38. The shikimic acid concentrations in R populations were highly negative relative with the glyphosate resistance levels in C. canadensis, the Pearson correlation coefficient was -0.82 treated by glyphosate at 1.8mg/L. Three 5-enoylpyruvylshikimate 3'-phosphate synthase genes (EPSPS1, EPSPS2 and EPSPS3) were cloned in all S and glyphosate-resistant C. canadensis populations. No amino acid substitution was identified at site of 102 and 106 in three EPSPS genes, which were reported to confer glyphosate resistance in other weed species. The relative expression level of EPSPS mRNA in R populations (SD07, LN05, SHX06 and SD09) was 4.5 to 13.2 times higher than in S biotype. The Pearson correlation coefficient between EPSPS expression levels and RI was 0.79, which indicated the over expression of EPSPS mRNA may cause these R populations evolve higher resistance level to glyphosate. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification of geneticaly modified soybean seeds resistant to glyphosate

Directory of Open Access Journals (Sweden)

Tillmann Maria Ângela André

2004-01-01

Full Text Available Advances in genetic engineering permit the modification of plants to be tolerant to certain herbicides that are usually not selective. For practical and commercial purposes, it is important to be able to detect the presence or absence of these traits in genotypes. The objective of this research was to develop a procedure for identifying genetically modified soybean (Glycine max L. Merr. with resistance to the herbicide glyphosate. Two studies were conducted based on germination test. In the first study, soybean seeds were pre-imbibed in paper towel with the herbicide solutions, then transferred to moist paper towel for the germination test. In the second study, seeds were placed directly in herbicide solutions in plastic cups and tested for germination using the paper towel method. Eight soybean genotypes were compared: four Roundup Ready, that contained the gene resistant to the herbicide (G99-G725, Prichard RR, G99-G6682, and H7242 RR and four non-transgenic parental cultivars (Boggs, Haskell, Benning, and Prichard. In the first study, the seeds were imbibed for 16 hours at 25°C in herbicide concentrations between 0.0 and 1.5% of the glyphosate active ingredient. In the second, seeds were subjected to concentrations between 0.0 and 0.48%, for one hour, at 30°C. The evaluation parameters were: germination, hypocotyl length, root length and total length of the seedlings. Both methods are efficient in identifying glyphosate-resistant soybean genotypes. It is possible to identify the genetically modified soybean genotypes after three days, by imbibing the seed in 0.12% herbicide solution, and after six days if the substrate is pre-imbibed in a 0.6% herbicide solution. The resistance trait was identified in all cultivars, independent of the initial physiological quality of the seed.

Changes in Amino Acid Profile in Roots of Glyphosate Resistant and Susceptible Soybean (Glycine max) Induced by Foliar Glyphosate Application.

Science.gov (United States)

Moldes, Carlos Alberto; Cantarelli, Miguel Angel; Camiña, José Manuel; Tsai, Siu Mui; Azevedo, Ricardo Antunes

2017-10-11

Amino acid profiles are useful to analyze the responses to glyphosate in susceptible and resistant soybean lines. Comparisons of profiles for 10 amino acids (Asp, Asn, Glu, Gln, Ser, His, Gly, Thr, Tyr, Leu) by HPLC in soybean roots were performed in two near isogenic pairs (four varieties). Foliar application of glyphosate was made to soybean plants after 5 weeks of seeding. Roots of four varieties were collected at 0 and 72 h after glyphosate application (AGA) for amino acid analysis by HPLC. Univariate analysis showed a significant increase of several amino acids in susceptible as well as resistant soybean lines; however, amino acids from the major pathways of carbon (C) and nitrogen (N) metabolism, such as Asp, Asn, Glu and Gln, and Ser, increased significantly in susceptible varieties at 72 h AGA. Multivariate analysis using principal component analysis (2D PCA and 3D PCA) allowed different groups to be identified and discriminated based on the soybean genetic origin, showing the amino acid responses on susceptible and resistant varieties. Based on the results, it is possible to infer that the increase of Asn, Asp, Glu, Gln, and Ser in susceptible varieties would be related to the deregulation of C and N metabolism, as well as changes in the growth mechanisms regulated by Ser.

Genotypic variations in photosynthetic and physiological adjustment to potassium deficiency in cotton (Gossypium hirsutum).

Science.gov (United States)

Wang, Ning; Hua, Hanbai; Eneji, A Egrinya; Li, Zhaohu; Duan, Liusheng; Tian, Xiaoli

2012-05-02

A hydroponic culture experiment was conducted to determine genotypic variation in photosynthetic rate and the associated physiological changes in response to potassium (K) deficiency in cotton (Gossypium hirsutum L.) seedlings with contrasting two cotton cultivars in K efficiency. The K-efficient Liaomian18 produced 66.7% more biomass than the K-inefficient NuCOTN99(B) under K deficiency, despite their similar biomass under K sufficiency. Compared with NuCOTN99(B), Liaomian18 showed 19.4% higher net photosynthetic rate (P(n), per unit leaf area) under K deficient solutions and this was associated with higher photochemical efficiency and faster export of soluble sugars from the phloem. The lower net P(n) of NuCOTN99(B) was attributed to higher capacity for nitrate assimilation and lower export of soluble sugars. Furthermore, NuCOTN99(B) showed 38.4% greater ETR/P(n) than Liaomian18 under K deficiency, indicating that more electrons were driven to other sinks. Higher superoxide dismutase (SOD) and lower catalase (CAT) and ascorbate peroxidase (APX) activities resulted in higher levels of reactive oxygen species (ROS; e.g. O(2)(-)and H(2)O(2)) in NuCOTN99(B) relative to Liaomian18. Thus, the K inefficiency of NuCOTN99(B), indicated by lower biomass and net P(n) under K deficiency, was associated with excessively high nitrogen assimilation, lower export of carbon assimilates, and greater ROS accumulation in the leaf. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

Multiple resistance to glyphosate, paraquat and ACCase-inhibiting herbicides in Italian ryegrass populations from California: confirmation and mechanisms of resistance.

Science.gov (United States)

Tehranchian, Parsa; Nandula, Vijay; Jugulam, Mithila; Putta, Karthik; Jasieniuk, Marie

2018-04-01

Glyphosate, paraquat and acetyl CoA carboxylase (ACCase)-inhibiting herbicides are widely used in California annual and perennial cropping systems. Recently, glyphosate, paraquat, and ACCase- and acetolactate synthase (ALS)-inhibitor resistance was confirmed in several Italian ryegrass populations from the Central Valley of California. This research characterized the possible mechanisms of resistance. Multiple-resistant populations (MR1, MR2) are resistant to several herbicides from at least three modes of action. Dose-response experiments revealed that the MR1 population was 45.9-, 122.7- and 20.5-fold, and the MR2 population was 24.8-, 93.9- and 4.0-fold less susceptible to glyphosate, sethoxydim and paraquat, respectively, than the susceptible (Sus) population. Accumulation of shikimate in Sus plants was significantly greater than in MR plants 32 h after light pretreatments. Glyphosate resistance in MR plants was at least partially due to Pro106-to-Ala and Pro106-to-Thr substitutions at site 106 of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). EPSPS gene copy number and expression level were similar in plants from the Sus and MR populations. An Ile1781-to-Leu substitution in ACCase gene of MR plants conferred a high level of resistance to sethoxydim and cross-resistance to other ACCase-inhibitors. Radiolabeled herbicide studies and phosphorimaging indicated that MR plants had restricted translocation of 14 C-paraquat to untreated leaves compared to Sus plants. This study shows that multiple herbicide resistance in Italian ryegrass populations in California, USA, is due to both target-site and non-target-site resistance mechanisms. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Weed flora, yield losses and weed control in cotton crop

OpenAIRE

Jabran, Khawar

2016-01-01

Cotton (Gossypium spp.) is the most important fiber crop of world and provides fiber, oil, and animals meals. Weeds interfere with the growth activities of cotton plants and compete with it for resources. All kinds of weeds (grasses, sedges, and broadleaves) have been noted to infest cotton crop. Weeds can cause more than 30% decrease in cotton productivity. Several methods are available for weed control in cotton. Cultural control carries significance for weed control up to a certain extent....

Simulating the evolution of glyphosate resistance in grains farming in northern Australia.

Science.gov (United States)

Thornby, David F; Walker, Steve R

2009-09-01

The evolution of resistance to herbicides is a substantial problem in contemporary agriculture. Solutions to this problem generally consist of the use of practices to control the resistant population once it evolves, and/or to institute preventative measures before populations become resistant. Herbicide resistance evolves in populations over years or decades, so predicting the effectiveness of preventative strategies in particular relies on computational modelling approaches. While models of herbicide resistance already exist, none deals with the complex regional variability in the northern Australian sub-tropical grains farming region. For this reason, a new computer model was developed. The model consists of an age- and stage-structured population model of weeds, with an existing crop model used to simulate plant growth and competition, and extensions to the crop model added to simulate seed bank ecology and population genetics factors. Using awnless barnyard grass (Echinochloa colona) as a test case, the model was used to investigate the likely rate of evolution under conditions expected to produce high selection pressure. Simulating continuous summer fallows with glyphosate used as the only means of weed control resulted in predicted resistant weed populations after approx. 15 years. Validation of the model against the paddock history for the first real-world glyphosate-resistant awnless barnyard grass population shows that the model predicted resistance evolution to within a few years of the real situation. This validation work shows that empirical validation of herbicide resistance models is problematic. However, the model simulates the complexities of sub-tropical grains farming in Australia well, and can be used to investigate, generate and improve glyphosate resistance prevention strategies.

Gene expression in developing fibres of Upland cotton (Gossypium hirsutum L.) was massively altered by domestication.

Science.gov (United States)

Rapp, Ryan A; Haigler, Candace H; Flagel, Lex; Hovav, Ran H; Udall, Joshua A; Wendel, Jonathan F

2010-11-15

Understanding the evolutionary genetics of modern crop phenotypes has a dual relevance to evolutionary biology and crop improvement. Modern upland cotton (Gossypium hirsutum L.) was developed following thousands of years of artificial selection from a wild form, G. hirsutum var. yucatanense, which bears a shorter, sparser, layer of single-celled, ovular trichomes ('fibre'). In order to gain an insight into the nature of the developmental genetic transformations that accompanied domestication and crop improvement, we studied the transcriptomes of cotton fibres from wild and domesticated accessions over a developmental time course. Fibre cells were harvested between 2 and 25 days post-anthesis and encompassed the primary and secondary wall synthesis stages. Using amplified messenger RNA and a custom microarray platform designed to interrogate expression for 40,430 genes, we determined global patterns of expression during fibre development. The fibre transcriptome of domesticated cotton is far more dynamic than that of wild cotton, with over twice as many genes being differentially expressed during development (12,626 versus 5273). Remarkably, a total of 9465 genes were diagnosed as differentially expressed between wild and domesticated fibres when summed across five key developmental time points. Human selection during the initial domestication and subsequent crop improvement has resulted in a biased upregulation of components of the transcriptional network that are important for agronomically advanced fibre, especially in the early stages of development. About 15% of the differentially expressed genes in wild versus domesticated cotton fibre have no homology to the genes in databases. We show that artificial selection during crop domestication can radically alter the transcriptional developmental network of even a single-celled structure, affecting nearly a quarter of the genes in the genome. Gene expression during fibre development within accessions and expression

Differential expression of genes regulated in response to drought stress in diploid cotton (Gossypium arboreum) (abstract)

International Nuclear Information System (INIS)

Hussain, T.; Majeed, A.; Maqbool, A.; Hussain, S.S.; Ali, T.; Riazuddin, S.

2005-01-01

Negative effects on the Water status of plants is one of the most common and deleterious stresses experienced by wild and cultivated plants throughout the World. Our project is designed to identify, clone and characterize gene sequences regulated in response to Water stress (e.g., drought). We used the differential-display reverse transcriptase polymerase chain reaction (DD-RT- PCA) methodology to accomplish our Objectives. Structural and functional characterization of environmental stress-induced genes has contributed to a better understanding of how plants respond and adapt to different abiotic stresses. Differential display was used to compare overall difference in gene expression between draught stressed and unstressed (control) plants of diploid Cotton (Gossypium arboreum). DDRT-PCR product from stressed and unstressed samples resolved side by side on 6% PAGE to compare qualitative and quantitative difference in mRNA expression. A total of 81 primer combinations were tested. DDRT -PCR enabled us to identify differentially expressed transcripts between water stressed and non-stressed cotton seedlings. PAGE revealed a total of 347 DNA transcripts in stressed samples (New Transcripts) while 110 down regulated and 209 up regulated DNA transcripts were also recorded. Similarly. 22 DNA transcripts were identified based on the comparative study of PAGE and Agarose gel electrophoresis. These sequences showed various degree homology With draught tolerant genes in the gene bank. (author)

Screening of post emergence herbicides for weed control in cotton (GOSSYPIUM HIRSUTUM) and their effect on yield and yield components

International Nuclear Information System (INIS)

Hussain, N.; Khan, M.B.; Khan, M.A.; Hameed, R.A.

2005-01-01

Response of varying herbicides at different levels: round up 490 G/L at the rate of 4.7 L ha/sup -1/ and 1.5 L ha/sup -1/ (Glyphosat) and Gramaxone 20 EC (Paraquat) at the rate of 2.5 L ha/sup -1/ against untreated (control, were investigated to cotton cultivar CIM-473 under field conditions during Kharif 2002 at Agronomic Research Area. Central Cotton Research Institute, Multan. Significant control of weeds and increase in yield and yield contributing factors were observed. It was indicated that maximum yield and weed control were obtained by using Round up (Glyphosate) at the rate of 4.7 L ha/sup -1/ as compared to other treatments including untreated (control). Average boll weight was not significant among treatments but significant against control. Maximum net profit was obtained from Round up 490 G/L when treated at the rate of 4.7 L ha/sup -1/ than all other treatments. (author)

Transformation and evaluation of Cry1Ac+Cry2A and GTGene in Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Agung Nugroho Puspito

2015-11-01

Full Text Available More than 50 countries around the globe cultivate cotton on a large scale. It is a major cash crop of Pakistan and is considered white gold because it is highly important to the economy of Pakistan. In addition to its importance, cotton cultivation faces several problems, such as insect pests, weeds, and viruses. In the past, insects have been controlled by insecticides, but this method caused a severe loss to the economy. However, conventional breeding methods have provided considerable breakthroughs in the improvement of cotton, but it also has several limitations. In comparison with conventional methods, biotechnology has the potential to create genetically modified plants that are environmentally safe and economically viable. In this study, a local cotton variety VH 289 was transformed with two Bt genes (Cry1Ac and Cry2A and a herbicide resistant gene (cp4 EPSPS using the Agrobacterium mediated transformation method. The constitutive CaMV 35S promoter was attached to the genes taken from Bacillus thuringiensis (Bt and to an herbicide resistant gene during cloning, and this promoter was used for the expression of the genes in cotton plants. This construct was used to develop the Glyphosate Tolerance Gene (GTGene for herbicide tolerance and insecticidal gene (Cry1Ac and Cry2A for insect tolerance in the cotton variety VH 289. The transgenic cotton variety performed 85% better compared with the non-transgenic variety. The study results suggest that farmers should use the transgenic cotton variety for general cultivation to improve the production of cotton.

The PIN gene family in cotton (Gossypium hirsutum): genome-wide identification and gene expression analyses during root development and abiotic stress responses.

Science.gov (United States)

He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui

2017-07-03

Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.

Confamiliar transferability of simple sequence repeat (SSR) markers from cotton (Gossypium hirsutum L.) and jute (Corchorus olitorius L.) to twenty two Malvaceous species.

Science.gov (United States)

Satya, Pratik; Paswan, Pramod Kumar; Ghosh, Swagata; Majumdar, Snehalata; Ali, Nasim

2016-06-01

Cross-species transferability is a quick and economic method to enrich SSR database, particularly for minor crops where little genomic information is available. However, transferability of SSR markers varies greatly between species, genera and families of plant species. We assessed confamiliar transferability of SSR markers from cotton (Gossypium hirsutum) and jute (Corchorus olitorius) to 22 species distributed in different taxonomic groups of Malvaceae. All the species selected were potential industrial crop species having little or no genomic resources or SSR database. Of the 14 cotton SSR loci tested, 13 (92.86 %) amplified in G. arboreum and 71.43 % exhibited cross-genera transferability. Nine out of 11 jute SSRs (81.81 %) showed cross-transferability across genera. SSRs from both the species exhibited high polymorphism and resolving power in other species. The correlation between transferability of cotton and jute SSRs were highly significant (r = 0.813). The difference in transferability among species was also significant for both the marker groups. High transferability was observed at genus, tribe and subfamily level. At tribe level, transferability of jute SSRs (41.04 %) was higher than that of cotton SSRs (33.74 %). The tribe Byttnerieae exhibited highest SSR transferability (48.7 %). The high level of cross-genera transferability (>50 %) in ten species of Malvaceae, where no SSR resource is available, calls for large scale transferability testing from the enriched SSR databases of cotton and jute.

Tolerance of Glyphosate-Resistant Maize to Glyphosate Plus MCPA Amine Is Influenced by Dose and Timing

Directory of Open Access Journals (Sweden)

Nader Soltani

2015-01-01

Full Text Available There is little information on tolerance of glyphosate-resistant maize to glyphosate plus MCPA amine as influenced by dose and timing under Ontario environmental conditions. A total of seven field trials were conducted at various locations in Ontario, Canada, in 2011–2013 to evaluate tolerance of field maize to tank mixes of glyphosate (900 g a.e./ha plus MCPA amine (79, 158, 315, 630, 1260, 2520, or 5040 g a.e./ha at either the 4- or 8-leaf stage. The predicted dose of MCPA amine that caused 5, 10, and 20% injury was 339, 751, and 1914 g a.e./ha when applied to 4-leaf maize but only 64, 140, and 344 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% reduction in shoot dry weight of maize was 488, 844, and 1971 g a.e./ha when applied to 4-leaf maize and only 14, 136, and 616 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% yield reduction was 2557, 4247, and >5040 g a.e./ha when applied to 4-leaf maize and 184, 441, and 1245 g a.e./ha when applied to 8-leaf maize, respectively. Based on these results, glyphosate plus MCPA amine applied at the manufacturer’s recommended dose of 630 g a.e./ha applied to 4-leaf maize has potential to cause injury but the injury is transient with no significant reduction in yield. However, when glyphosate plus MCPA amine is applied to 8-leaf maize it has the potential to cause significant injury and yield loss in maize.

Forward selection for multiple resistance across the non-selective glyphosate, glufosinate and oxyfluorfen herbicides in Lolium weed species.

Science.gov (United States)

Fernández, Pablo; Alcántara, Ricardo; Osuna, María D; Vila-Aiub, Martin M; Prado, Rafael De

2017-05-01

In the Mediterranean area, Lolium species have evolved resistance to glyphosate after decades of continual use without other alternative chemicals in perennial crops (olive, citrus and vineyards). In recent years, oxyfluorfen alone or mixed with glyphosate and glufosinate has been introduced as a chemical option to control dicot and grass weeds. Dose-response studies confirmed that three glyphosate-resistant Lolium weed species (L. rigidum, L. perenne, L. multiflorum) collected from perennial crops in the Iberian Peninsula have also evolved resistance to glufosinate and oxyfluorfen herbicides, despite their recent introduction. Based on the LD 50 resistance parameter, the resistance factor was similar among Lolium species and ranged from 14- to 21-fold and from ten- to 12-fold for oxyfluorfen and glufosinate respectively. Similarly, about 14-fold resistance to both oxyfluorfen and glufosinate was estimated on average for the three Lolium species when growth reduction (GR 50 ) was assessed. This study identified oxyfluorfen resistance in a grass species for the first time. A major threat to sustainability of perennial crops in the Iberian Peninsula is evident, as multiple resistance to non-selective glyphosate, glufosinate and oxyfluorfen herbicides has evolved in L. rigidum, L. perenne and L. multiflorum weeds. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Evaluation of glyphosate resistance in Arabidopsis thaliana expressing an altered target site EPSPS.

Science.gov (United States)

Sammons, R Douglas; You, Jinsong; Qi, Youlin; Flasinski, Stanislaw; Kavanaugh, Christina; Washam, Jeannie; Ostrander, Elizabeth; Wang, Dafu; Heck, Greg

2018-05-01

Glyphosate-resistant goosegrass has recently evolved and is homozygous for the double mutant of EPSPS (T 102 I, P 106 S or TIPS). These same mutations combined with EPSPS overexpression, have been used to create transgenic glyphosate-resistant crops. Arabidopsis thaliana (Wt EPSPS K i ∼ 0.5 μM) was engineered to express a variant AtEPSPS-T 102 I, P 106 A (TIPA K i = 150 μM) to determine the resistance magnitude for a more potent variant EPSPS that might evolve in weeds. Transgenic A. thaliana plants, homozygous for one, two or four copies of AtEPSPS-TIPA, had resistance (IC 50 values, R/S) as measured by seed production ranging from 4.3- to 16-fold. Plants treated in reproductive stage were male sterile with a range of R/S from 10.1- to 40.6-fold. A significant hormesis (∼ 63% gain in fresh weight) was observed for all genotypes when treated at the initiation of reproductive stage with 0.013 kg ha -1 . AtEPSPS-TIPA enzyme activity was proportional to copy number and correlated with resistance magnitude. A. thaliana, as a model weed expressing one copy of AtEPSPS-TIPA (300-fold more resistant), had only 4.3-fold resistance to glyphosate for seed production. Resistance behaved as a single dominant allele. Vegetative tissue resistance was 4.7-fold greater than reproductive tissue resistance and was linear with gene copy number. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species

Science.gov (United States)

Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo

2016-01-01

The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

Pro-106-Ser mutation and EPSPS overexpression acting together simultaneously in glyphosate-resistant goosegrass (Eleusine indica).

Science.gov (United States)

Gherekhloo, Javid; Fernández-Moreno, Pablo T; Alcántara-de la Cruz, Ricardo; Sánchez-González, Eduardo; Cruz-Hipolito, Hugo E; Domínguez-Valenzuela, José A; De Prado, Rafael

2017-07-27

Glyphosate has been used for more than 15 years for weed management in citrus groves in the Gulf of Mexico, at up to 3-4 applications per year. Goosegrass (Eleusine indica (L.) Gaertn.) control has sometimes failed. In this research, the mechanisms governing three goosegrass biotypes (Ein-Or from an orange grove, and Ein-Pl1 and Ein-Pl2 from Persian lime groves) with suspected resistance to glyphosate were characterized and compared to a susceptible biotype (Ein-S). Dose-response and shikimate accumulation assays confirmed resistance of the resistant (R) biotypes. There were no differences in glyphosate absorption, but the R biotypes retained up to 62-78% of the herbicide in the treated leaf at 96 h after treatment (HAT), in comparison to the Ein-S biotype (36%). The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity in the Ein-Or and Ein-S biotypes was over 100-fold lower than the Ein-Pl1 and Ein-Pl2 ones. The latter showed a high EPSPS-basal activity, a mutation at Pro-106-Ser position in the EPSPS gene, and EPSPS overexpression. The EPSPS basal and EPSPS overexpression were positively correlated. The R goosegrass biotypes displayed poor glyphosate translocation. Furthermore, this grassweed showed, for the first time, two mechanisms at the target-site level (Pro-106-Ser mutation + EPSPS overexpression) acting together simultaneously against glyphosate.

Usability of Particle Film Technology and Water Holding Materials to Improve Drought Tolerance in Gossypium hirsutum L. Plants

Science.gov (United States)

Roy, K.; Zwieniecki, M.

2017-12-01

Cotton (Gossypium hirsutum L.) is relatively drought resistant and thus is planted widely in many semi-arid and arid parts of the world, many of which are usually deprived of modern water management technologies. Since the productivity of cotton plants depends on water availability, we carried out the present research aiming at testing two different low cost and arid-environment friendly water efficient techniques: application of particle film technology on leaves to reduce the transpiration rate (kaolin dust), and use of organic material to improve the soil water holding capacity (cotton wool). In details, kaolin (3% and 5%; weight:volume) mixed in water was sprayed on the upper surface of the leaves of young plants, and small amounts of cotton wool (0.1%, 0.3% and 0.5%; weight:weight) were mixed into the soils. The study showed that kaolin spray was useful as a transpiration reducing agent only if plants have adequate water in the soil (well irrigated) but not under water stress conditions. In addition, mixing a small amount of cotton wool into the soil can significantly increase the amount of water available to the plants, and extend the benefit of kaolin application on plants.

Herbicidas alternativos para controle de biótipos de Conyza bonariensis e C. canadensis resistentes ao glyphosate Alternative herbicides to control glyphosate-resistant biotypes of Conyza bonariensis and C. canadensis

Directory of Open Access Journals (Sweden)

M.S. Moreira

2010-01-01

Full Text Available Após sucessivos anos, aplicações do herbicida glyphosate em pomares de citros no Estado de São Paulo selecionaram biótipos resistentes de Conyza bonariensis e C. canadensis. Na ocorrência de plantas daninhas resistentes em uma área agrícola, tornam-se necessárias mudanças nas práticas de manejo para obtenção de adequado controle das populações resistentes, bem como para a redução da pressão de seleção sobre outras espécies. Assim, este trabalho foi realizado com o objetivo de identificar herbicidas alternativos para controle de biótipos de Conyza spp. resistentes ao herbicida glyphosate, com aplicações em diferentes estádios fenológicos da planta daninha. Três experimentos foram conduzidos em campo, em pomares de citros em formação, sobre plantas de buva em estádio fenológico de dez folhas e no pré-florescimento. Para plantas no estádio de dez folhas, controle satisfatório foi obtido com aplicações de glyphosate + bromacil + diuron (1.440 + 1.200 + 1.200 g ha-1, glyphosate + atrazina (1.440 + 1.500 g ha-1 e glyphosate + diuron (1.440 + 1.500 g ha-1. Quando em estádio de pré-florescimento de Conyza spp., a aplicação do herbicida amônio-glufosinato, na dose de 400 g ha-1, isolado ou associado a MSMA, bromacil+diuron, metsulfuron, carfentrazone e paraquat, foi a alternativa viável para controle dos biótipos resistentes ao glyphosate.After successive years, glyphosate applications on São Paulo-Brazil citrus orchards selected resistant biotypes of Conyza bonariensis and C. canadensis. The occurrence of herbicide-resistant weed biotypes at some agricultural area makes it necessary to change the management practices to reach effective control of the selected resistant populations, as well as to reduce selection pressure on the other species. Thus, this work aimed to identify the alternative herbicides to control glyphosate-resistant biotypes of Conyza spp., with applications at different weed phenological

Mutantes morfológicos de algodoeiro herbáceo como fonte de resistência ao bicudo Morphological mutants of upland cotton as source of boll weevil resistance

Directory of Open Access Journals (Sweden)

Francisco das Chagas Vidal Neto

2005-02-01

Full Text Available Este trabalho teve como objetivo avaliar os efeitos de três características morfológicas mutantes de linhagens de algodoeiro herbáceo (Gossypium hirsutum L. r. latifolium Hutch., isoladas ou combinadas no mesmo genótipo, como fonte de resistência ao bicudo, Anthonomus grandis Boheman, 1843 (Coleoptera, Curculionidae. O experimento foi conduzido em campo, sob infestação natural, com delineamento de blocos ao acaso e arranjo fatorial 2´3 com um tratamento adicional, com quatro repetições. Em teste com chance de escolha, a característica bráctea frego foi a que apresentou maior redução no dano de oviposição pelo bicudo (34,71%, em relação ao equivalente normal. A folha "okra" reduziu o dano apenas quando associada à bráctea frego (40%. A combinação das três características mutantes na mesma planta proporcionou a menor porcentagem de botões com dano de oviposição (23,13%.This work aimed to evaluate the effects of three morphological mutants of upland cotton lines (Gossypium hirsutm L. r. latifolium Hutch., isolated or in combination in the same cotton genotype, as a source of resistance to boll weevil, Anthonomus grandis Boheman, 1843 (Coleoptera, Curculionidae. The experiment was carried out in the field, under natural infestation, with a completely randomized block design arranged in a factorial 2´3 plus an additional treatment, with four replications. In a multiple choice test, the character mutant frego bract presented the higher reduction on boll weevil oviposition damage (34.71%, in relation to the normal equivalent. The okra leaf reduced the boll weevil damage only when associated with frego bract (40%. The combination of the three mutant characters in the same plant presented the least square percent with oviposition damage (23.13%.

Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

Science.gov (United States)

Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

2015-02-01

WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

Perspectives on transgenic, herbicide-resistant crops in the United States almost 20 years after introduction.

Science.gov (United States)

Duke, Stephen O

2015-05-01

Herbicide-resistant crops have had a profound impact on weed management. Most of the impact has been by glyphosate-resistant maize, cotton, soybean and canola. Significant economic savings, yield increases and more efficacious and simplified weed management have resulted in widespread adoption of the technology. Initially, glyphosate-resistant crops enabled significantly reduced tillage and reduced the environmental impact of weed management. Continuous use of glyphosate with glyphosate-resistant crops over broad areas facilitated the evolution of glyphosate-resistant weeds, which have resulted in increases in the use of tillage and other herbicides with glyphosate, reducing some of the initial environmental benefits of glyphosate-resistant crops. Transgenic crops with resistance to auxinic herbicides, as well as to herbicides that inhibit acetolactate synthase, acetyl-CoA carboxylase and hydroxyphenylpyruvate dioxygenase, stacked with glyphosate and/or glufosinate resistance, will become available in the next few years. These technologies will provide additional weed management options for farmers, but will not have all of the positive effects (reduced cost, simplified weed management, lowered environmental impact and reduced tillage) that glyphosate-resistant crops had initially. In the more distant future, other herbicide-resistant crops (including non-transgenic ones), herbicides with new modes of action and technologies that are currently in their infancy (e.g. bioherbicides, sprayable herbicidal RNAi and/or robotic weeding) may affect the role of transgenic, herbicide-resistant crops in weed management. Published 2014. This article is a U.S. Government work and is in the public domain in the USA. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Environmental and health effects of the herbicide glyphosate.

Science.gov (United States)

Van Bruggen, A H C; He, M M; Shin, K; Mai, V; Jeong, K C; Finckh, M R; Morris, J G

2018-03-01

The herbicide glyphosate, N-(phosphonomethyl) glycine, has been used extensively in the past 40years, under the assumption that side effects were minimal. However, in recent years, concerns have increased worldwide about the potential wide ranging direct and indirect health effects of the large scale use of glyphosate. In 2015, the World Health Organization reclassified glyphosate as probably carcinogenic to humans. A detailed overview is given of the scientific literature on the movement and residues of glyphosate and its breakdown product aminomethyl phosphonic acid (AMPA) in soil and water, their toxicity to macro- and microorganisms, their effects on microbial compositions and potential indirect effects on plant, animal and human health. Although the acute toxic effects of glyphosate and AMPA on mammals are low, there are animal data raising the possibility of health effects associated with chronic, ultra-low doses related to accumulation of these compounds in the environment. Intensive glyphosate use has led to the selection of glyphosate-resistant weeds and microorganisms. Shifts in microbial compositions due to selective pressure by glyphosate may have contributed to the proliferation of plant and animal pathogens. Research on a link between glyphosate and antibiotic resistance is still scarce but we hypothesize that the selection pressure for glyphosate-resistance in bacteria could lead to shifts in microbiome composition and increases in antibiotic resistance to clinically important antimicrobial agents. We recommend interdisciplinary research on the associations between low level chronic glyphosate exposure, distortions in microbial communities, expansion of antibiotic resistance and the emergence of animal, human and plant diseases. Independent research is needed to revisit the tolerance thresholds for glyphosate residues in water, food and animal feed taking all possible health risks into account. Copyright © 2017 Elsevier B.V. All rights reserved.

How glyphosate affects plant disease development: it is more than enhanced susceptibility.

Science.gov (United States)

Hammerschmidt, Ray

2018-05-01

Glyphosate has been shown to affect the development of plant disease in several ways. Plants utilize phenolic and other shikimic acid pathway-derived compounds as part of their defense against pathogens, and glyphosate inhibits the biosynthesis of these compounds via its mode of action. Several studies have shown a correlation between enhanced disease and suppression of phenolic compound production after glyphosate. Glyphosate-resistant crop plants have also been studied for changes in resistance as a result of carrying the glyphosate resistance trait. The evidence indicates that neither the resistance trait nor application of glyphosate to glyphosate-resistant plants increases susceptibility to disease. The only exceptions to this are cases where glyphosate has been shown to reduce rust diseases on glyphosate-resistant crops, supporting a fungicidal role for this chemical. Finally, glyphosate treatment of weeds or volunteer crops can cause a temporary increase in soil-borne pathogens that may result in disease development if crops are planted too soon after glyphosate application. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Effect of mutagens on the quality characters and disease resistant genes of diploid cotton (Gossypium arboreum L.)

International Nuclear Information System (INIS)

Haidar, S.; Khan, I.A.; Mansoor, S.

2002-01-01

In both M1 and M2 plant height decreased with the increase in dose for both the mutagens. The 15 Krad and 0.15M EMS doses increased 122.7 and 128.3 gm seed cotton yield as compared to control respectively while all other doses of both mutagens decreased the yield of seed cotton. The EMS dose 0.10 M drastically decreased 184 gm seed cotton yield as compared to control. There was no larger effect of both mutagens on GOT % whereas staple length was slightly increased and micronaire value decreased as compared to control for all the doses of both mutagens. It was observed in M2 that mutation dose 10 Krad increased 165.6 gm seed cotton yield as compared to control but slight reduction in GOT % was observed. In M2 GOT were increased 3.5 % with 15 Krad and 3.6 % with EMS 0.10 M as compared to control. There were no larger effects for both mutagens in case of staple length, micronaire and uniformity ratio for all the doses as compared to control. respectively. In both M1 and M2 no plant was observed susceptible to cotton leaf curl virus and bacterial blight diseases of cotton

Herbicide-resistant crops: utilities and limitations for herbicide-resistant weed management.

Science.gov (United States)

Green, Jerry M; Owen, Micheal D K

2011-06-08

Since 1996, genetically modified herbicide-resistant (HR) crops, particularly glyphosate-resistant (GR) crops, have transformed the tactics that corn, soybean, and cotton growers use to manage weeds. The use of GR crops continues to grow, but weeds are adapting to the common practice of using only glyphosate to control weeds. Growers using only a single mode of action to manage weeds need to change to a more diverse array of herbicidal, mechanical, and cultural practices to maintain the effectiveness of glyphosate. Unfortunately, the introduction of GR crops and the high initial efficacy of glyphosate often lead to a decline in the use of other herbicide options and less investment by industry to discover new herbicide active ingredients. With some exceptions, most growers can still manage their weed problems with currently available selective and HR crop-enabled herbicides. However, current crop management systems are in jeopardy given the pace at which weed populations are evolving glyphosate resistance. New HR crop technologies will expand the utility of currently available herbicides and enable new interim solutions for growers to manage HR weeds, but will not replace the long-term need to diversify weed management tactics and discover herbicides with new modes of action. This paper reviews the strengths and weaknesses of anticipated weed management options and the best management practices that growers need to implement in HR crops to maximize the long-term benefits of current technologies and reduce weed shifts to difficult-to-control and HR weeds.

Secondary effects of glyphosate on plants

Science.gov (United States)

Glyphosate is a unique herbicide with interesting secondary effects. Unfortunately, some have assumed that the secondary effects that occur in glyphosate-susceptible plants treated with glyphosate, such as altered mineral nutrition, reduced phenolic compound production and pathogen resistance, also ...

Polyploidization altered gene functions in cotton (Gossypium spp.)

Science.gov (United States)

Cotton fibers are seed trichomes derived from individual cells of the epidermal layer of the seed coat. It has been known for a long time that a large set of genes determine the development of cotton fiber, and more recently it has been determined that these genes are distributed across the At and ...

A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

Science.gov (United States)

Sharkhuu, Altanbadralt; Narasimhan, Meena L; Merzaban, Jasmeen S; Bressan, Ray A; Weller, Steve; Gehring, Chris

2014-01-01

Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide. PMID:24654847

A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

KAUST Repository

Sharkhuu, Altanbadralt; Narasimhan, Meena L.; Merzaban, Jasmeen; Bressan, Ray A.; Weller, Steve; Gehring, Christoph A

2014-01-01

Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide.

A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

KAUST Repository

Sharkhuu, Altanbadralt

2014-06-01

Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide.

Salt-induced effects on some key morpho-physiological attributes of cotton (Gossypium hirsutum L. at various growth stages

Directory of Open Access Journals (Sweden)

Huma Lubna Shaheen and Muhammad Shahbaz

2012-11-01

Full Text Available Salinity is a multidimensional stress affecting crop yield and productivity at various levels of plant organization. To assess salt induced adverse effects on cotton (Gossypium hirsutum L., ten cultivars were grown in sand culture supplemented with full strength Hoagland’s nutrients solutions and different salt concentrations (0, 50, 100 and 200 mM NaCl. Salt stress markedly reduced growth attributes, relative water contents, efficiency of photosystem II, net CO2 assimilation rate (A, transpiration rate (E and stomatal conductance in all cultivars. Reduction was maximum at the highest level of salt stress i.e. 200 mM. However, response of cotton cultivars was variable to various levels of salinity and even at various developmental stages. Cultivars RH-510, BH-118 and MNH-770 were ranked as relatively salt tolerant on the basis of their better growth performance and net CO2 assimilation rate whereas cvs. CIM-496, CIM-473 and FH-901 were relatively salt sensitive. Cultivars RH-510, BH-118 and MNH-770 exhibited high shoot fresh and dry weights, photosynthetic rate (A, and Photosystem II (Fv/Fm efficiency at both seedling and maturity growth stages. Results suggest that selection of plants having high photosynthetic rate and biomass at seedling stage may be a good source of high yield at mature stage of growth.

Responses of reniform nematode and browntop millet to tillage, cover crop, and herbicides in cotton

Science.gov (United States)

Cropping practices that reduce competition from reniform nematode (Rotylenchulus reniformis) and browntop millet (Urochlora ramosum) may help minimize losses in cotton (Gossypium hirsutum). The impacts of tillage, rye cover crop, and preemergence and postemergence herbicides on cotton yields, renifo...

Airborne multispectral detection of regrowth cotton fields

Science.gov (United States)

Regrowth of cotton, Gossypium hirsutum L., can provide boll weevils, Anthonomus grandis Boheman, with an extended opportunity to feed and reproduce beyond the production season. Effective methods for timely areawide detection of these potential host plants are critically needed to achieve eradicati...

Fitness Outcomes Related to Glyphosate Resistance in Kochia (Kochia scoparia: What Life History Stage to Examine?

Directory of Open Access Journals (Sweden)

Omobolanle Adewale Osipitan

2017-06-01

Full Text Available A fast-spreading weed, kochia (Kochia scoparia, has developed resistance to the widely-used herbicide, glyphosate. Understanding the relationship between the occurrence of glyphosate resistance caused by multiple EPSPS gene copies and kochia fitness may suggest a more effective way of controlling kochia. A study was conducted to assess fitness cost of glyphosate resistance compared to susceptibility in kochia populations at different life history stages, that is rate of seed germination, increase in plant height, days to flowering, biomass accumulation at maturity, and fecundity. Six kochia populations from Scott, Finney, Thomas, Phillips, Wallace, and Wichita counties in western Kansas were characterized for resistance to field-use rate of glyphosate and with an in vivo shikimate accumulation assay. Seed germination was determined in growth chambers at three constant temperatures (5, 10, and 15 C while vegetative growth and fecundity responses were evaluated in a field study using a target-neighborhood competition design in 2014 and 2015. One target plant from each of the six kochia populations was surrounded by neighboring kochia densities equivalent to 10 (low, 35 (moderate, or 70 (high kochia plants m−2. In 2015, neighboring corn densities equivalent to 10 and 35 plants m−2 were also evaluated. Treatments were arranged in a randomized complete block design with at least 7 replications. Three kochia populations were classified as glyphosate-resistant (GR [Scott (SC-R, Finney (FN-R, and Thomas (TH-R] and three populations were classified as glyphosate-susceptible (GS [Phillips (PH-S, Wallace (WA-S and Wichita (WI-S]. Of the life history stages measured, fitness differences between the GR and GS kochia populations were consistently found in their germination characteristics. The GR kochia showed reduced seed longevity, slower germination rate, and less total germination than the GS kochia. In the field, increases in plant height, biomass

Development of a core set of SSR markers for the characterization of Gossypium germplasm

Science.gov (United States)

Molecular markers such as simple sequence repeats (SSR) are a useful tool for characterizing genetic diversity of Gossypium germplasm collections. Genetic profiles by DNA fingerprinting of cotton accessions can only be compared among different collections if a common set of molecular markers are us...

Integrated Palmer Amaranth Management in Glufosinate-Resistant Cotton: II. Primary, Secondary and Conservation Tillage

Directory of Open Access Journals (Sweden)

Michael G. Patterson

2013-01-01

Full Text Available A three year field experiment was conducted to evaluate the role of soil inversion, cover crops and spring tillage methods for Palmer amaranth between-row (BR and within-row (WR management in glufosinate-resistant cotton. Main plots were two soil inversion treatments: fall inversion tillage (IT and non-inversion tillage (NIT. Subplots were three cover treatments: crimson clover, cereal rye or none (i.e., winter fallow; and the sub subplots were four secondary spring tillage methods: disking followed by (fb cultivator (DCU, disking fb chisel plow (DCH, disking fb disking (DD and no tillage (NT. Averaged over years and soil inversion, the crimson clover produced maximum cover biomass (4390 kg ha−1 fb cereal rye (3698 kg ha−1 and winter fallow (777 kg ha−1. Two weeks after planting (WAP and before the postemergence (POST application, Palmer amaranth WR and BR density were two- and four-times less, respectively, in IT than NIT. Further, Palmer amaranth WR and BR density were reduced two-fold following crimson clover and cereal rye than following winter fallow at 2 WAP. Without IT, early season Palmer amaranth densities were 40% less following DCU, DCH and DD, when compared with IT. Following IT, no spring tillage method improved Palmer amaranth control. The timely application of glufosinate + S-metolachlor POST tank mixture greatly improved Palmer amaranth control in both IT and NIT systems. The highest cotton yields were obtained with DD following cereal rye (2251 kg ha−1, DD following crimson clover (2213 kg ha−1 and DD following winter fallow (2153 kg ha−1. On average, IT cotton yields (2133 kg ha−1 were 21% higher than NIT (1766 kg ha−1. Therefore, from an integrated weed management standpoint, an occasional fall IT could greatly reduce Palmer amaranth emergence on farms highly infested with glyphosate-resistant Palmer amaranth. In addition, a cereal rye or crimson clover cover crop can effectively reduce early season Palmer

Chemical control of different Digitaria insularis populations and management of a glyphosate-resistant population

OpenAIRE

CORREIA,N.M.; ACRA,L.T.; BALIEIRO,G.

2015-01-01

This study aimed to control different populations of Digitaria insularisby glyphosate herbicide, isolated and mixed, besides the combination of methods (chemical and mechanical) to manage resistant adult plants. Three experiments were conducted, one in pots which were maintained under non-controlled conditions and two under field conditions. In the experiment in pots, twelve populations of D. insularis were sprayed with isolated glyphosate (1.44 and 2.16 kg a.e. ha-1) and mixed (1.44 and 2.16...

Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information

Science.gov (United States)

2012-01-01

Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource

SELETIVIDADE DE INSETICIDAS AO COMPLEXO DE INIMIGOS NATURAIS NA CULTURA DO ALGODÃO (Gossypium hirsutum L. SELECTIVITY OF INSECTICIDES ON THE COMPLEX OF NATURAL ENEMIES IN COTTON CROP (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Fábio Shigeo Takatsuka

2007-09-01

="justify">The selectivity of insecticides was evaluated in the complex of natural enemies of the cotton (Gossypium hirsutum L. crop. The cultivar Deltapine was used in a randomized block experimental design, with seven treatments and four replications. The treatments, all in their commercial formulation, were: control; thiamethoxam (300 g.ha^-1; lufenuron (300 mL.ha^-1; betacyflutrin (800 mL.ha^-1; imidacloprid (70g.ha^-1; diflubenzuron (6,0 g.ha^-1; and endosulfan (1500 mL.ha^-1. The insecticides were sprayed at 45 days after germination. Besides the initial evaluation, other evaluations were performed three and seven days after insecticide application. Each plot was sampled by the fabric beating method, with two random beatings per plot. Natural enemies were identified and counted. Three days after application, the insecticides thiamethoxam (300 g.ha^-1, lufenuron (300 mL.ha^-1, and diflubenzuron (60 g.ha^-1 did not showed negative effect on the complex of predators present in the cotton. However, seven days after application, only the lufenuron treatment maintained the selective effect over predator complex.

KEY-WORDS: Insecticide; biological control; Gossypium.

Differential response of two sourgrass populations to glyphosate

Directory of Open Access Journals (Sweden)

São Paulo State University, Jaboticabal, SP, Brazil

2013-02-01

Full Text Available The repetitive use of glyphosate may cause increase on the resistance of sourgrass (Digitaria insularis through mechanisms of natural selection. The aim of this study was to verify the response of two populations of sourgrass (one collected from nonagricultural area and the other one from area suspected of glyphosate resistance to increasing doses of glyphosate. The experimental design was completely randomized with four repetitions. For both populations, glyphosate was sprayed at 10 doses (0D, D/16, D/8, D/4, D/2, D, 2D, 4D, 8D, and 16D; so that D is the dose of 1.08 kg e.a. ha-1. The treatments were sprayed when the plants had shown 3-5 tillers. The population collected in the nonagricultural area was slightly more sensible to the herbicide glyphosate than the population originated from an area where the herbicide application is common, not indicating glyphosate resistance.

Detecting cotton boll rot with an electronic nose

Science.gov (United States)

South Carolina Boll Rot is an emerging disease of cotton, Gossypium hirsutum L., caused by the opportunistic bacteria, Pantoea agglomerans (Ewing and Fife). Unlike typical fungal diseases, bolls infected with P. agglomerans continue to appear normal externally, complicating early and rapid detectio...

Genetic transformation of cry1EC gene into cotton ( Gossypium ...

African Journals Online (AJOL)

Cotton is the chief fibre crop of global importance. It plays a significant role in the national economy. Cotton crop is vulnerable to a number of insect species, especially to the larvae of lepidopteron pests. 60% insecticides sprayed on cotton are meant to control the damage caused by bollworm complex. Transgenic ...

Genomics-enabled analysis of the emergent disease cotton bacterial blight.

Directory of Open Access Journals (Sweden)

Anne Z Phillips

2017-09-01

Full Text Available Cotton bacterial blight (CBB, an important disease of (Gossypium hirsutum in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars.

Induced mutations for improvement of desi cotton

International Nuclear Information System (INIS)

Waghmare, V.N.; Mohan, Punit; Singh, Phundan; Gururajan, K.N.

2000-01-01

Desi cotton varieties of Gossypium arboreum have wide adaptability and are relatively tolerant to biotic (insect pests and diseases) and abiotic (moisture and salt) stresses. Desi varieties have got potential to yield even under adverse and low input situations. Most of them are synchronous in maturity and possess consistent fibre properties. Despite such merits, very little attention has been paid for improvement of desi cotton. The present area under arboreum varieties is 17.0% (15.30 lakh ha.) against 65% (35.75 lakh ha) during 1947-48. Deliberate attempts are required to improve G. arboreum for its economic and quality characters to compete with upland varieties in rainfed cotton ecology

Genetic basis of some yield components in gossypium hirsutum l

International Nuclear Information System (INIS)

Javed, A.; Azhar, F.M.; Khan, I.A.; Rana, S.A.

2014-01-01

A 5 * 5 diallel analysis was conducted to study the inheritance of seed cotton yield, number of bolls and boll weight in Gossypium hirsutum L. using combining ability technique. The analysis of the data revealed that variance due to specific combining ability was significant for all the three traits signifying the importance of non additive gene action. The comparison of the parents showed that NF-801-2-37 was the best general combiner for seed cotton yield, number of bolls and boll weight followed by Acala-63-75. Best hybrid combinations identified were Acala-63-75 * NF-801-2-37 for seed cotton yield and DPL-61 * NF-801-2-37 for number of bolls and boll weight. Higher proportion of dominance variance in all three traits suggested delayed selection or use of heterosis breeding in crop improvement programs. (author)

Identificação de biótipos de azevém (Lolium multiflorum resistentes ao herbicida glyphosate em pomares de maçã Identification of glyphosate-resistant ryegrass (Lolium multiflorum biotypes in apple orchards

Directory of Open Access Journals (Sweden)

L. Vargas

2004-12-01

Full Text Available O glyphosate é um herbicida de amplo espectro utilizado há mais de 15 anos em pomares de maçã na região de Vacaria-RS, para manejo da vegetação nas linhas da cultura. São realizadas, em geral, três a quatro aplicações por ciclo e a dose normalmente utilizada é de 720 a 1.080 g e.a. ha-1 de glyphosate (2 a 3 L ha-1 do produto comercial. O azevém (Lolium multiflorum é uma planta daninha comum em pomares e, tradicionalmente, sensível ao glyphosate. Entretanto, nos últimos anos a ocorrência de plantas de azevém que, após receberem o tratamento com glyphosate, não manifestam sintomas significativos de toxicidade sugere que elas adquiriram resistência ao produto. Assim, com o objetivo de avaliar a resposta de uma população de plantas de azevém ao glyphosate, foram realizados três experimentos: um em campo e dois em casa de vegetação. No experimento em campo os tratamentos avaliados constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880, 5.760 e 11.520 g e.a. ha-1, e os herbicidas paraquat, glufosinate, haloxyfop e diclofop foram empregados como produtos-padrão, aplicados em dois estádios vegetativos do azevém. No experimento em casa de vegetação, os tratamentos constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880 e 5.760 g e.a. ha-1 mais os herbicidas testemunhas, aplicados sobre plantas do biótipo considerado resistente e de um sensível. No segundo experimento realizado em casa de vegetação foram avaliados tratamentos contendo glyphosate (720, 1.440, 2.880, 720 + 720 e 720 + 1.440 g e.a. ha-1, em aplicações únicas e seqüenciais, mais os herbicidas paraquat, glufosinate, haloxyfop, clethodim, sethoxydim, diclofop, fenoxaprop, fluazifop, paraquat + diuron, atrazine + simazine, trifluralin e metolachlor. A toxicidade dos tratamentos herbicidas foi avaliada aos 15, 30 e 45 DAT (dias após tratamento. Os resultados obtidos nos experimentos em campo e em casa de vegetação, de forma

Estimation of best parents parents and superior cross combinations for yield and fiber quality related traits in upland cotton (gossypium hirsutum L.)

International Nuclear Information System (INIS)

Shaukat, S.; Khan, T.M.; Ijaz, S.

2013-01-01

Combining ability was studied for identification of potential cultivars and hybrids in upland cotton (Gossypium hirsutum L.) in a 6x6 set of diallel crosses among six genotypes of cotton, i.e., VH-232, CRS-2007, SB-149, GR-156, FH-207, and MARVI carried out on fiber length, fiber fineness, fiber elongation, fiber strength, ginning out tern (GOT) and seed cotton yield. Analysis of variance revealed highly significant (p < 0.01) differences among the genotypes for all traits. Combining ability studies showed that the mean squares, due to general combining ability (GCA), specific combining ability (SCA) and reciprocal effects were highly significant in F1 generation. Genetic components, due to GCA and SCA, revealed that traits, such as, fiber length, strength and fineness, showed high proportion of additive type of gene action in F1 generation because of greater GCA variances were greater than SCA variance. GR-156 was the best combiner for lint percentage and fiber length. FH-207 was the best combiner for fiber fineness. FH-207, MARVI and SB-149 were the best general combiners for fiber character and were suggested to be used in future breeding programme to improve fiber quality traits. CRS-2007 x GR-156, CRS-2007 x MARVI, SB-149 x MARVI and VH-232 x SB-149 had higher specific combining ability and reciprocal effects and they can be used for future breeding programme to improve fiber quality. (author)

Transgene escape and persistence in an agroecosystem: the case of glyphosate-resistant Brassica rapa L. in central Argentina.

Science.gov (United States)

Pandolfo, Claudio E; Presotto, Alejandro; Carbonell, Francisco Torres; Ureta, Soledad; Poverene, Mónica; Cantamutto, Miguel

2018-03-01

Brassica rapa L. is an annual Brassicaceae species cultivated for oil and food production, whose wild form is a weed of crops worldwide. In temperate regions of South America and especially in the Argentine Pampas region, this species is widely distributed. During 2014, wild B. rapa populations that escaped control with glyphosate applications by farmers were found in this area. These plants were characterized by morphology and seed acidic profile, and all the characters agreed with B. rapa description. The dose-response assays showed that the biotypes were highly resistant to glyphosate. It was also shown that they had multiple resistance to AHAS-inhibiting herbicides. The transgenic origin of the glyphosate resistance in B. rapa biotypes was verified by an immunological test which confirmed the presence of the CP4 EPSPS protein and by an event-specific GT73 molecular marker. The persistence of the transgene in nature was confirmed for at least 4 years, in ruderal and agrestal habitats. This finding suggests that glyphosate resistance might come from GM oilseed rape crops illegally cultivated in the country or as a seed contaminant, and it implies gene flow and introgression between feral populations of GM B. napus and wild B. rapa. The persistence and spread of the resistance in agricultural environments was promoted by the high selection pressure imposed by intensive herbicide usage in the prevalent no-till farming systems.

Correlations and Correlated Responses in Upland Cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Echekwu, CA.

2001-01-01

Full Text Available Plant breeders must be concerned with the total array of economic characters in their efforts to develop a crop variety acceptable to farmers. Their selection endeavours must therefore take into consideration how changes in one trait affect, simultaneously changes in other economic attributes. The importance of correlations and correlated responses is therefore self evident in plant breeding endeavours. In this study F3 progenies from a cross between two cotton lines SAMCOT-9 x Y422 were evaluated for two years and performance data were used to obtain correlations between nine agronomic and fibre quality traits in upland cotton. The results indicated that plant helght was significantly and positively correlated with seed cotton yield, number of sympodial and monopodial branches, seed index, fibre length and micronaire index. Positive and significant correlations were also obtained between : seed cotton yield, tint percent and fibre strength and fibre length. Significant negative correlations were obtained between : plant height and lint percent ; number of monopodial branches, sympodial branches and lint percent ; fibre length, fibre strength and micronaire index. The correlated responses in the other eight traits when selection was practiced for seed cotton yield in the present study shows that it might be more profitable to practice direct selection for seed cotton yield compared to selecting for seed cotton yield through any of the other traits.

The Immature Fiber Mutant Phenotype of Cotton (Gossypium hirsutum Is Linked to a 22-bp Frame-Shift Deletion in a Mitochondria Targeted Pentatricopeptide Repeat Gene

Directory of Open Access Journals (Sweden)

Gregory N. Thyssen

2016-06-01

Full Text Available Cotton seed trichomes are the most important source of natural fibers globally. The major fiber thickness properties influence the price of the raw material, and the quality of the finished product. The recessive immature fiber (im gene reduces the degree of fiber cell wall thickening by a process that was previously shown to involve mitochondrial function in allotetraploid Gossypium hirsutum. Here, we present the fine genetic mapping of the im locus, gene expression analysis of annotated proteins near the locus, and association analysis of the linked markers. Mapping-by-sequencing identified a 22-bp deletion in a pentatricopeptide repeat (PPR gene that is completely linked to the immature fiber phenotype in 2837 F2 plants, and is absent from all 163 cultivated varieties tested, although other closely linked marker polymorphisms are prevalent in the diversity panel. This frame-shift mutation results in a transcript with two long open reading frames: one containing the N-terminal transit peptide that targets mitochondria, the other containing only the RNA-binding PPR domains, suggesting that a functional PPR protein cannot be targeted to mitochondria in the im mutant. Taken together, these results suggest that PPR gene Gh_A03G0489 is involved in the cotton fiber wall thickening process, and is a promising candidate gene at the im locus. Our findings expand our understanding of the molecular mechanisms that modulate cotton fiber fineness and maturity, and may facilitate the development of cotton varieties with superior fiber attributes.

Genotypic interactions with potassium nutrition on fruit production in cotton (gossypium hirsutum l.) under irrigated conditions

International Nuclear Information System (INIS)

Makhdum, M.I.; Pervez, H.; Ashraf, M.

2005-01-01

A field experiment was conducted using four (Gossypium hirsutum l.) cultivars (OM-448, OM-I00, NIAB-Karishma, 5-12) at four rates of potassium (0, 62, 5, 125, 250 kg K ha-1) and with two sources of potassium (K/sub 2/S0/sub 4/, KCI) to determine the effects of potassium (K) fertilizer on fruit production under irrigated conditions. Cultivars differed significantly amongst themselves in production and retention of fruits per unit land area. The cultivars were categorized as OM-448>OM-1100>Karishma>5-12 in order of fruit production. The number of total fruiting positions increased with concurrent levels of K-fertilizer. The shedding of fruit was significantly reduced by application of 250 kg K ha-1 compared to zero K-rate treatment. The addition of K-fertilizer in the form of K/sub 2/S0/sub 4/ showed an edge over KCI in fruit production. A high degree of correlation (r 0.89**,0.91**, -0.8**) was measured between seed cotton yield and number of total fruiting positions, number of intact fruit and fruit shedding percentage respectively. (author)

Using cotton plant residue to produce briquettes

Energy Technology Data Exchange (ETDEWEB)

Coates, W. [University of Arizona, Tucson, AZ (United States). Bioresources Research Facility

2000-07-01

In Arizona, cotton (Gossypium) plant residue left in the field following harvest must be buried to prevent it from serving as an overwintering site for insects such as the pink bollworm. Most tillage operations employed to incorporate the residue into the soil are energy intensive and often degrade soil structure. Trials showed that cotton plant residue could be incorporated with pecan shells to produce commercially acceptable briquettes. Pecan shell briquettes containing cotton residue rather than waste paper were slightly less durable, when made using equivalent weight mixtures and moisture contents. Proximate and ultimate analyses showed the only difference among briquette samples to be a higher ash content in those made using cotton plant residue. Briquettes made with paper demonstrated longer flame out time, and lower ash percentage, compared to those made with cotton plant residue. (author)

Evaluating cotton seed gland initiation by microscopy

Science.gov (United States)

Gossypol is a terpenoid aldehyde found in cotton (Gossypium hirsutum L.) glands and helps protect the seed from pests and pathogens. However, gossypol is toxic to many animals, so the seed is used mainly in cattle feed, as ruminants are tolerant to the effects of gossypol. In order to develop strat...

Evaluation of haemoglobin (erythrogen): for improved somatic embryogenesis and plant regeneration in cotton (Gossypium hirsutum L. cv. SVPR 2).

Science.gov (United States)

Ganesan, M; Jayabalan, N

2004-10-01

Somatic embryogenesis in cotton (Gossypium hirsutum L.) is accelerated when the plant regeneration medium is supplemented with haemoglobin (erythrogen). In cotton SVPR 2 lines, a higher frequency of embryoid formation was observed when the medium contained 400 mg/l haemoglobin. Fresh weight of the callus, rate of embryoid induction, number of embryoids formed and the percentage of plant regeneration from somatic embryos were increased. Among the two different cultivars tested, MCU 11 showed no response to the presence of haemoglobin when compared to SVPR 2, and embryogenic callus formation was completely absent in the former. Medium containing MS salts, 100 mg/l myo-inositol , 0.3 mg/l thiamine-HCL, 0.3 mg/l Picloram (PIC), 0.1 mg/l kinetin and 400 mg/l haemoglobin effected a better response with respect to embryogenic callus induction. After 8 weeks of culture, a high frequency of embryoid induction was observed on medium containing MS basal salts, 100 mg/l myo-inositol, 0.3 mg/l PIC , 0.1 mg/l isopentenyl adenine, 1.0 g/l NH4NO3 and 400 mg/l haemoglobin. Plant regeneration was observed in 75.8% of the mature somatic embryos, and whole plant regeneration was achieved within 6-7 months of culture. The regenerated plantlets were fertile and similar to in vivo-grown, seed-derived plants except that they were phenotypically smaller. A positive influence of haemoglobin was observed at concentrations up to 400 mg/l at all stages of somatic embryogenesis. The increase in the levels of antioxidant enzyme activities, for example superoxide dismutase and peroxidase, indicated the presence of excess oxygen uptake and the stressed condition of the plant tissues that arose from haemoglobin supplementation. This increased oxygen uptake and haemoglobin-mediated stress appeared to accelerate somatic embryogenesis in cotton.

A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

Science.gov (United States)

Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

2015-07-01

Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. © 2014 Scandinavian Plant Physiology Society.

Effect of ionization radiation (γ-rays 60Co) on germination of cotton

International Nuclear Information System (INIS)

Lall, S.B.; Bhute, M.G.

1974-01-01

Effect of ionization radiation (γ-rays 60 Co) on germination of cotton varieties viz. AK 235 and 197/3, also B 147 and B 296-7 belonging to Gossypium arboreum and Gossypium hirsutum respectively under field and laboratory conditions were studied. Materials under study were tried in two radiation doses i.e. 10,000 r and 20,000 r in two (R1 and R2) generations. In laboratory and field condition, both doses (10,000r and 20,000r) depressed the germination percentage in R1 generation of radiation to greater degree in almost all the varieties of cotton. Maximum depression was noted under field condition in both the varieties belonging to Gossypium arboreum species in R1 generation under 20,000 r. In R2 generation, depressing effect on germination capacity of seed is reduced to much extent in field condition in almost of all the varieties. The germination percentage has increased over control in R2 generation in both doses in laboratory conditions in all the varieties used in this experiment. (author)

High Resolution Consensus Mapping of Quantitative Trait Loci for Fiber Strength, Length and Micronaire on Chromosome 25 of the Upland Cotton (Gossypium hirsutum L.).

Science.gov (United States)

Zhang, Zhen; Li, Junwen; Muhammad, Jamshed; Cai, Juan; Jia, Fei; Shi, Yuzhen; Gong, Juwu; Shang, Haihong; Liu, Aiying; Chen, Tingting; Ge, Qun; Palanga, Koffi Kibalou; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Li, Wei; Sun, Linyang; Gong, Wankui; Yuan, Youlu

2015-01-01

Cotton (Gossypium hirsutum L.) is an important agricultural crop that provides renewable natural fiber resources for the global textile industry. Technological developments in the textile industry and improvements in human living standards have increased the requirement for supplies and better quality cotton. Upland cotton 0-153 is an elite cultivar harboring strong fiber strength genes. To conduct quantitative trait locus (QTL) mapping for fiber quality in 0-153, we developed a population of 196 recombinant inbred lines (RILs) from a cross between 0-153 and sGK9708. The fiber quality traits in 11 environments were measured and a genetic linkage map of chromosome 25 comprising 210 loci was constructed using this RIL population, mainly using simple sequence repeat markers and single nucleotide polymorphism markers. QTLs were identified across diverse environments using the composite interval mapping method. A total of 37 QTLs for fiber quality traits were identified on chromosome 25, of which 17 were stably expressed in at least in two environments. A stable fiber strength QTL, qFS-chr25-4, which was detected in seven environments and was located in the marker interval between CRI-SNP120491 and BNL2572, could explain 6.53%-11.83% of the observed phenotypic variations. Meta-analysis also confirmed the above QTLs with previous reports. Application of these QTLs could contribute to improving fiber quality and provide information for marker-assisted selection.

The multi-year effects of repeatedly growing cotton with moderate resistance to Meloidogyne incognita

Science.gov (United States)

Kemerait, Robert C.

2009-01-01

Meloidogyne incognita causes more damage to cotton in the US than any other pathogen. The objective of this study was to document the cumulative effect of moderate resistance on M. incognita population density, root galling, and yield suppression in the southern United States on a moderately resistant cotton genotype grown continuously for three years. Cotton genotypes were Phytogen PH98-3196 (77% suppression of M. incognita), Acala NemX (85% suppression of M. incognita), and Delta and Pine Land DP458 B/R (susceptible standard, 0% suppression). Cotton was grown in fumigated and non-fumigated plots to measure yield loss. Each genotype and nematicide combination was planted in the same place for three years at two sites to document cumulative effects. In 2006, following three years of the different genotypes, all plots at one site were planted with susceptible cotton to document residual effects of planting resistant genotypes. Root galling and nematode population densities in the soil were significantly lower, and percentage yield suppression was numerically lower, when moderately resistant cotton was grown compared to the susceptible standard in both fields in all three years. Differences between susceptible and moderately resistant genotypes are established quickly (after only one season) and then either maintained at similar levels or slightly increased in subsequent years depending on initial nematode levels. However, when susceptible cotton was grown following three years of the moderately resistant genotypes, the nematode suppression provided by moderate resistance was undetectable by the end of the first season. Moderately resistant cotton genotypes are more beneficial than previously reported and should be pursued for nematode management. Rotation of moderately resistant and susceptible cotton could be used along with nematicides to manage root-knot nematodes in a continuous cotton cropping system and reduce selection pressure on the nematodes. PMID:22661787

Review: Genetic diversity and population structure of cotton ...

African Journals Online (AJOL)

Cotton (Gossypium spp.) is the world's leading natural fiber crop and is cultivated in diverse temperate and tropical areas. In this sense, molecular markers are important tools for polymorphism identification in genetic diversity analyses. The objective of this study was to evaluate genetic diversity and population structure in ...

Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

Science.gov (United States)

Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

2018-07-01

The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

Using Winter Annual Cover Crops in a Virginia No-till Cotton Production System

OpenAIRE

Daniel, James B. II

1997-01-01

Cotton (Gossypium hirsutum L.) is a low residue crop, that may not provide sufficient surface residue to reduce erosion and protect the soil. A winter annual cover crop could alleviate erosion between cotton crops. Field experiments were conducted to evaluate selected winter annual cover crops for biomass production, ground cover, and N assimilation. The cover crop treatments were monitored under no-till and conventional tillage systems for the effects on soil moisture, cotton yield and qu...

Sequencing of a Cultivated Diploid Cotton Genome-Gossypium arboreum

Institute of Scientific and Technical Information of China (English)

WILKINS; Thea; A

2008-01-01

Sequencing the genomes of crop species and model systems contributes significantly to our understanding of the organization,structure and function of plant genomes.In a `white paper' published in 2007,the cotton community set forth a strategic plan for sequencing the AD genome of cultivated upland cotton that initially targets less complex diploid genomes.This strategy banks on the high degree

Genome-wide identification and functional analysis of the TIFY gene family in response to drought in cotton.

Science.gov (United States)

Zhao, Ge; Song, Yun; Wang, Caixiang; Butt, Hamama Islam; Wang, Qianhua; Zhang, Chaojun; Yang, Zuoren; Liu, Zhao; Chen, Eryong; Zhang, Xueyan; Li, Fuguang

2016-12-01

Jasmonates control many aspects of plant biological processes. They are important for regulating plant responses to various biotic and abiotic stresses, including drought, which is one of the most serious threats to sustainable agricultural production. However, little is known regarding how jasmonate ZIM-domain (JAZ) proteins mediate jasmonic acid signals to improve stress tolerance in cotton. This represents the first comprehensive comparative study of TIFY transcription factors in both diploid A, D and tetraploid AD cotton species. In this study, we identified 21 TIFY family members in the genome of Gossypium arboretum, 28 members from Gossypium raimondii and 50 TIFY genes in Gossypium hirsutum. The phylogenetic analyses indicated the TIFY gene family could be divided into the following four subfamilies: TIFY, PPD, ZML, and JAZ subfamilies. The cotton TIFY genes have expanded through tandem duplications and segmental duplications compared with other plant species. Gene expression profile revealed temporal and tissue specificities for TIFY genes under simulated drought conditions in Gossypium arboretum. The JAZ subfamily members were the most highly expressed genes, suggesting that they have a vital role in responses to drought stress. Over-expression of GaJAZ5 gene decreased water loss, stomatal openings, and the accumulation of H 2 O 2 in Arabidopsis thaliana. Additionally, the results of drought tolerance assays suggested that this subfamily might be involved in increasing drought tolerance. Our study provides new data regarding the genome-wide analysis of TIFY gene families and their important roles in drought tolerance in cotton species. These data may form the basis of future studies regarding the relationship between drought and jasmonic acid.

Herbicide Glyphosate Impact to Earthworm (E. fetida

Directory of Open Access Journals (Sweden)

Greta Dajoraitė

2016-10-01

Full Text Available Glyphosate is a broad spectrum weed resistant herbicide. Glyphosate may pose negative impact on land ecosystems because of wide broad usage and hydrofilic characteristic. The aim of this study was to investigate negative effects of glyphosate on soil invertebrate organisms (earthworm Eisenia fetida. The duration of experiment was 8 weeks. The range of the test concentrations of glyphosate were: 0,1, 1, 5, 10, 20 mg/kg. To investigate the glyphosate impact on earthworm Eisenia fetida the following endpoints were measured: survival, reproduction and weight. The exposure to 20 mg/kg glyphosate has led to the 100% mortality of earthworms. Glyphosate has led to decreased E. fetida reproduction, the cocoons were observed only in the lowest concentration (0,1 mg/kg. In general: long-term glyphosate toxicity to earthworms (E. fetida may be significant.

Manejo de Conyza bonariensis resistente ao glyphosate: coberturas de inverno e herbicidas em pré-semeadura da soja Management of glyphosate resistant Conyza bonariensis: winter cover crops and herbicides in soybean pre-seeding

Directory of Open Access Journals (Sweden)

F.P. Lamego

2013-06-01

Full Text Available Conyza bonariensis tornou-se a principal planta daninha da cultura da soja no Sul do Brasil, em decorrência da evolução para resistência ao herbicida glyphosate. O objetivo deste trabalho foi avaliar o efeito de diferentes coberturas de inverno e da associação de manejo de dessecação pré-semeadura da soja, visando ao controle de C. bonariensis resistente ao glyphosate. Um experimento foi conduzido em campo, na safra 2010/2011. Os tratamentos foram conduzidos em esquema de parcelas subdivididas, em que as coberturas de inverno foram alocadas nas parcelas principais: aveia-preta, nabo, ervilhaca, azevém, trigo e pousio. Nas subparcelas, foram alocados os tratamentos de manejo de dessecação pré-semeadura da soja: glyphosate (720 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha‑1 e roçada. O nabo foi a espécie de cobertura que produziu o maior volume de massa seca durante o inverno, enquanto a ervilhaca foi a que apresentou maior efeito supressor sobre a germinação e o desenvolvimento inicial de C. bonariensis. Associações de glyphosate com 2,4-D ou chlorimuron-ethyl, seguidas da aplicação sequencial de paraquat + diuron, causaram maior redução na infestação de C. bonariensis.Conyza bonariensis became the main weed in soybean crop in Southern Brazil, as a consequence of the evolution of resistance to the herbicide glyphosate. The objective of this work was to evaluate the effect of different winter cover crops and the association of burn-down herbicides on the control of glyphosate-resistant C. bonariensis. A field experiment was conducted in the 2010/2011 season. The treatments were arranged in a split-plot scheme, with the winter

Sugar alcohols-induced oxidative metabolism in cotton callus culture

African Journals Online (AJOL)

Sugar alcohols (mannitol and sorbitol) may cause oxidative damage in plants if used in higher concentration. Our present experiment was undertaken to study physiological and metabolic responses in cotton (Gossypium hirsutum L.) callus against mannitol and sorbitol higher doses. Both markedly declined mean values of ...

Influence of foliar application of glycine betaine on gas exchange characteristics of cotton (gossypium Hirsutum L.)

International Nuclear Information System (INIS)

Makhdum, M.I.; Din, S.U.

2007-01-01

Water is the most limiting factor in cotton production and numerous efforts are being made to improve crop drought tolerance. A field study was conducted with the objectives to determine the effects of different application rates of glycine betaine in field grown cotton at Central Cotton Research Institute, Multan. Four levels of glycine betaine (0.0, 1.0, 3.0 and 6.0 kg ha-1) were applied at three physiological growth stages i.e. at squaring, first flower and peak flowering. Cotton cultivar CIM-448 was used as test crop. Results showed that crop sprayed with glycine betaine at the rate of 6.0 kg ha-1 maintained 120.0, 62.1, 69.7 and 35.5 percent higher net CO/sub 2/ assimilation rate (PN), transpiration rate (E), stomatal resistance (gs) and water use efficiency (PN/E), respectively over that of untreated crop. Crop spayed with glycine betaine at peak flowering stage maintained higher PN, E, gs and PN/E compared to at other stages of growth. (author)

Characterization of eleven monosomic alien addition lines added from Gossypium anomalum to Gossypium hirsutum using improved GISH and SSR markers.

Science.gov (United States)

Wang, Xiaoxiao; Wang, Yingying; Wang, Chen; Chen, Yu; Chen, Yu; Feng, Shouli; Zhao, Ting; Zhou, Baoliang

2016-10-07

Gossypium anomalum (BB genome) possesses the desirable characteristics of drought tolerance, resistance to diseases and insect pests, and the potential for high quality fibers. However, it is difficult to transfer the genes associated with these desirable traits into cultivated cotton (G. hirsutum, AADD genome). Monosomic alien addition lines (MAALs) can be used as a bridge to transfer desired genes from wild species into G. hirsutum. In cotton, however, the high number and smaller size of the chromosomes has resulted in difficulties in discriminating chromosomes from wild species in cultivated cotton background, the development of cotton MAALs has lagged far behind many other crops. To date, no set of G. hirsutum-G. anomalum MAALs was reported. Here the amphiploid (AADDBB genome) derived from G. hirsutum × G. anomalum was used to generate a set of G. hirsutum-G. anomalum MAALs through a combination of consecutive backcrossing, genomic in situ hybridization (GISH), morphological survey and microsatellite marker identification. We improved the GISH technique used in our previous research by using a mixture of two probes from G. anomalum and G. herbaceum (AA genome). The results indicate that a ratio of 4:3 (G. anomalum : G. herbaceum) is the most suitable for discrimination of chromosomes from G. anomalum and the At-subgenome of G. hirsutum. Using this improved GISH technique, 108 MAAL individuals were isolated. Next, 170 G. hirsutum- and G. anomalum-specific codominant markers were obtained and employed for characterization of these MAAL individuals. Finally, eleven out of 13 MAALs were identified. Unfortunately, we were unable to isolate Chrs. 1B a and 5B a due to their very low incidences in backcrossing generation, as these remained in a condition of multiple additions. The characterized lines can be employed as bridges for the transfer of desired genes from G. anomalum into G. hirsutum, as well as for gene assignment, isolation of chromosome

Spectral discrimination of two pigweeds from cotton with different leaf colors

Science.gov (United States)

To implement strategies to control Palmer amaranth (Amaranthus palmeri S. Wats.) and redroot pigweed (Amaranthus retroflexus L.) infestations in cotton (Gossypium hirsutum L.) production systems, managers need effective techniques to identify the weeds. Leaf light reflectance measurements have shown...

Propriedades físicas e sensoriais da carne de cordeiros Santa Inês terminados em dietas com diferentes níveis de caroço de algodão integral (Gossypium hirsutum Physical and sensorial properties of Santa Ines lamb meat terminated in diets with increasing levels of whole cotton seed (Gossypium hirsutum

Directory of Open Access Journals (Sweden)

Thereza Raquel de Lucena Vieira

2010-06-01

Full Text Available Esta pesquisa teve como objetivo avaliar o efeito de dietas de terminação contendo diferentes níveis (0, 20, 30 e 40% de caroço de algodão integral (Gossypium hirsutum sobre os parâmetros físicos e sensoriais da carne de vinte e quatro cordeiros da raça Santa Inês. Foram avaliados os parâmetros de pH, capacidade de retenção de água (CRA, perda de peso por cocção (PPC, textura e cor, além dos parâmetros sensoriais de sabor, aroma, cor e textura. Apenas o parâmetro cor da carne ovina sofreu influência significativa da adição do caroço de algodão integral, observando-se variações para as coordenadas b* e L* (antes da cocção. Verificou-se também que os tratamentos apresentaram influência (p The objective of this research was to evaluate the effect of termination diets containing increasing levels (0, 20, 30, and 40% of whole cotton seed (Gossypium hirsutum on the physical (pH, water holding capacity, cooking losses, texture, colour and sensory parameters (flavour, odour, colour, texture of the lamb meat of twenty four Santa Ines sheep. Only the b* and L* colour parameters of the lamb meat were significantly affected by the addition of different levels of whole cotton seed to the diet. The inclusion of the whole cotton seed in the diet of the Santa Ines sheep also influenced sensory attributes such as natural colour, odour, and characteristic flavour. Based on these observations, considering the physical and sensory attributes of the lamb meat, the use of whole cotton seed at a 40% level for sheep in termination for short periods, i.e., up to 90 days, is recommended.

Fitness of Bt-resistant cabbage loopers on Bt cotton plants.

Science.gov (United States)

Tetreau, Guillaume; Wang, Ran; Wang, Ping

2017-10-01

Development of resistance to the insecticidal toxins from Bacillus thuringiensis (Bt) in insects is the major threat to the continued success of transgenic Bt crops in agriculture. The fitness of Bt-resistant insects on Bt and non-Bt plants is a key parameter that determines the development of Bt resistance in insect populations. In this study, a comprehensive analysis of the fitness of Bt-resistant Trichoplusia ni strains on Bt cotton leaves was conducted. The Bt-resistant T. ni strains carried two genetically independent mechanisms of resistance to Bt toxins Cry1Ac and Cry2Ab. The effects of the two resistance mechanisms, individually and in combination, on the fitness of the T. ni strains on conventional non-Bt cotton and on transgenic Bt cotton leaves expressing a single-toxin Cry1Ac (Bollgard I) or two Bt toxins Cry1Ac and Cry2Ab (Bollgard II) were examined. The presence of Bt toxins in plants reduced the fitness of resistant insects, indicated by decreased net reproductive rate (R 0 ) and intrinsic rate of increase (r). The reduction in fitness in resistant T. ni on Bollgard II leaves was greater than that on Bollgard I leaves. A 12.4-day asynchrony of adult emergence between the susceptible T. ni grown on non-Bt cotton leaves and the dual-toxin-resistant T. ni on Bollgard II leaves was observed. Therefore, multitoxin Bt plants not only reduce the probability for T. ni to develop resistance but also strongly reduce the fitness of resistant insects feeding on the plants. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Genome-Wide Identification and Expression Analysis of the Biotin Carboxyl Carrier Subunits of Heteromeric Acetyl-CoA Carboxylase in Gossypium

Directory of Open Access Journals (Sweden)

Jinping Hua

2017-05-01

Full Text Available Acetyl-CoA carboxylase is an important enzyme, which catalyzes acetyl-CoA’s carboxylation to produce malonyl-CoA and to serve as a committed step for de novo fatty acid biosynthesis in plastids. In this study, 24 putative cotton BCCP genes were identified based on the lately published genome data in Gossypium. Among them, 4, 4, 8, and 8 BCCP homologs were identified in Gossypium raimondii, G. arboreum, G. hirsutum, and G. barbadense, respectively. These genes were divided into two classes based on a phylogenetic analysis. In each class, these homologs were relatively conserved in gene structure and motifs. The chromosomal distribution pattern revealed that all the BCCP genes were distributed equally on corresponding chromosomes or scaffold in the four cotton species. Segmental duplication was a predominant duplication event in both of G. hirsutum and G. barbadense. The analysis of the expression profile showed that 8 GhBCCP genes expressed in all the tested tissues with changed expression levels, and GhBCCP genes belonging to class II were predominantly expressed in developing ovules. Meanwhile, the expression analysis for the 16 cotton BCCP genes from G. raimondii, G. arboreum and G. hirsutum showed that they were induced or suppressed by cold or salt stress, and their expression patterns varied among different tissues. These findings will help to determine the functional and evolutionary characteristics of the BCCP genes in Gossypium species.

Effect of nitrates on embryo induction efficiency in cotton (Gossypium ...

African Journals Online (AJOL)

Fred

cotton species (Zhang, 1994b). Somatic embryogenesis and plant regeneration systems have been established from cotton tissue, protoplasts and ovules (Zhang and Li,. 1992; Feng and Zhang, 1994; Zhang, 1995). Regeneration procedures have been used to obtain genetically modified plants after Agrobacterium- ...

Reproduction and pathogenicity of endemic populations of Rotylenchulus reniformis on cotton

Science.gov (United States)

The reniform nematode (Rotylenchulus reniformis) is the predominant parasitic nematode of upland cotton (Gossypium hirsutum) in the southern United States. Little is known about variability in geographic isolates of reniform nematode. In order to evaluate the comparative reproduction and pathogenici...

Effect of chitosan on resist printing of cotton fabrics with reactive dyes

African Journals Online (AJOL)

The concentration of chitosan, types of resist agent, curing temperature and curing time were varied to determine their effects on resist-printed cotton fabrics. An optimal chitosan concentration of 1.6% resulted in the greatest resist effect on printed cotton fabrics. For mixtures, a 6:4 ratio of citric acid : chitosan and an 8:2 ...

Asymmetric evolution and domestication in allotetraploid cotton (Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Lei Fang

2017-04-01

Full Text Available Polyploidy plays a major role in genome evolution, which corresponds to environmental changes over millions of years. The mechanisms of genome evolution, particularly during the process of domestication, are of broad interest in the fields of plant science and crop breeding. Upland cotton is derived from the hybridization and polyploidization of its ancient A and D diploid ancestors. As a result, cotton is a model for polyploid genome evolution and crop domestication. To explore the genomic mysteries of allopolyploid cotton, we investigated asymmetric evolution and domestication in the A and D subgenomes. Interestingly, more structural rearrangements have been characterized in the A subgenome than in the D subgenome. Correspondingly, more transposable elements, a greater number of lost and disrupted genes, and faster evolution have been identified in the A subgenome. In contrast, the centromeric retroelement (RT-domain related sequence of tetraploid cotton derived from the D subgenome progenitor was found to have invaded the A subgenome centromeres after allotetrapolyploid formation. Although there is no genome-wide expression bias between the subgenomes, as with expression-level alterations, gene expression bias of homoeologous gene pairs is widespread and varies from tissue to tissue. Further, there are more positively selected genes for fiber yield and quality in the A subgenome and more for stress tolerance in the D subgenome, indicating asymmetric domestication. This review highlights the asymmetric subgenomic evolution and domestication of allotetraploid cotton, providing valuable genomic resources for cotton research and enhancing our understanding of the basis of many other allopolyploids.

Simulating changes in cropping practises in conventional and glyphosate-tolerant maize. I. Effects on weeds.

Science.gov (United States)

Colbach, Nathalie; Fernier, Alice; Le Corre, Valérie; Messéan, Antoine; Darmency, Henri

2017-04-01

Herbicide-tolerant (HT) crops such as those tolerant to glyphosate simplify weed management and make it more efficient, at least at short-term. Overreliance on the same herbicide though leads to the spread of resistant weeds. Here, the objective was to evaluate, with simulations, the impact on the advent of glyphosate resistance in weeds of modifications in agricultural practises resulting from introducing HT maize into cropping systems. First, we included a single-gene herbicide resistance submodel in the existing multispecific FLORSYS model. Then, we (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, (2) compared these systems in terms of glyphosate resistance, (3) identified pertinent cultural practises influencing glyphosate resistance, and (4) investigated correlations between cultural practises and species traits, using RLQ analyses. The simulation study showed that, during the analysed 28 years, (1) glyphosate spraying only results in glyphosate resistance in weeds when combined with other cultural factors favouring weed infestation, particularly no till; (2) pre-sowing glyphosate applications select more for herbicide resistance than post-sowing applications on HT crops; and (3) glyphosate spraying selects more for species traits avoiding exposure to the herbicide (e.g. delayed early growth, small leaf area) or compensating for fitness costs (e.g. high harvest index) than for actual resistance to glyphosate, (4) actual resistance is most frequent in species that do not avoid glyphosate, either via plant size or timing, and/or in less competitive species, (5) in case of efficient weed control measures, actual resistance proliferates best in outcrossing species. An advice table was built, with the quantitative, synthetic ranking of the crop management effects in terms of glyphosate-resistance management, identifying the optimal choices for each management technique.

High Resolution Consensus Mapping of Quantitative Trait Loci for Fiber Strength, Length and Micronaire on Chromosome 25 of the Upland Cotton (Gossypium hirsutum L..

Directory of Open Access Journals (Sweden)

Zhen Zhang

Full Text Available Cotton (Gossypium hirsutum L. is an important agricultural crop that provides renewable natural fiber resources for the global textile industry. Technological developments in the textile industry and improvements in human living standards have increased the requirement for supplies and better quality cotton. Upland cotton 0-153 is an elite cultivar harboring strong fiber strength genes. To conduct quantitative trait locus (QTL mapping for fiber quality in 0-153, we developed a population of 196 recombinant inbred lines (RILs from a cross between 0-153 and sGK9708. The fiber quality traits in 11 environments were measured and a genetic linkage map of chromosome 25 comprising 210 loci was constructed using this RIL population, mainly using simple sequence repeat markers and single nucleotide polymorphism markers. QTLs were identified across diverse environments using the composite interval mapping method. A total of 37 QTLs for fiber quality traits were identified on chromosome 25, of which 17 were stably expressed in at least in two environments. A stable fiber strength QTL, qFS-chr25-4, which was detected in seven environments and was located in the marker interval between CRI-SNP120491 and BNL2572, could explain 6.53%-11.83% of the observed phenotypic variations. Meta-analysis also confirmed the above QTLs with previous reports. Application of these QTLs could contribute to improving fiber quality and provide information for marker-assisted selection.

Analysis of [Gossypium capitis-viridis × (G.hirsutum × G.australe2] Trispecific Hybrid and Selected Characteristics.

Directory of Open Access Journals (Sweden)

Di Chen

Full Text Available Speciation is always a contentious and challenging issue following with the presence of gene flow. In Gossypium, there are many valuable resources and wild diploid cotton especially C and B genome species possess some excellent traits which cultivated cotton always lacks. In order to explore character transferring rule from wild cotton to upland tetraploid cotton, the [G. capitis-viridis × (G. hirsutum × G. australe2] triple hybrid was synthesized by interspecies hybridization and chromosome doubling. Morphology comparisons were measured among this hybrid and its parents. It showed that trispecific hybrid F1 had some intermediate morphological characters like leaf style between its parents and some different characters from its parents, like crawl growth characteristics and two kind flower color. It is highly resistant to insects comparing with other cotton species by four year field investigation. By cytogenetic analysis, triple hybrid was further confirmed by meiosis behavior of pollen mother cells. Comparing with regular meiosis of its three parents, it was distinguished by the occurrence of polyads with various numbers of unbalanced microspores and finally generating various abnormal pollen grains. All this phenomenon results in the sterility of this hybrid. This hybrid was further identified by SSR marker from DNA molecular level. It showed that 98 selected polymorphism primers amplified effective bands in this hybrids and its parents. The genetic proportion of three parents in this hybrid is 47.8% from G. hirsutum, 14.3% from G. australe, 7.0% from G. capitis-viridis, and 30.9% recombination bands respectively. It was testified that wild genetic material has been transferred into cultivated cotton and this new germplasm can be incorporated into cotton breeding program.

Controle químico de biótipos de buva (Conyza canadensis e Conyza bonariensis resistentes ao glyphosate Chemical Control of glyphosate-resistant horseweed (Conyza Canadensis and hairy fleabane (Conyza bonariensis biotypes

Directory of Open Access Journals (Sweden)

Micheli Satomi Yamauti

2010-09-01

Full Text Available Estudos foram conduzidos na Estação Experimental de Citricultura de Bebedouro, SP para avaliar a resposta de biótipos de buva resistentes aos herbicidas glyphosate, bromacil + diuron, diuron e paraquat isolados e em mistura, e o efeito de uma aplicação seqüencial com glyphosate. O delineamento foi o de blocos casualizados com quatro repetições e sete tratamentos.. Os herbicidas foram aplicados com pulverizador costal, à pressão constante (mantido por CO2 comprimido, munido com barra com três bicos do tipo TT110015 com um consumo de calda equivalente a 150 L ha-1. O controle foi avaliado visualmente, através de escala percentual de notas. Para o controle geral das plantas daninhas os melhores resultados foram obtidos com diuron isolado e com glyphosate em mistura com bromacil + diuron, enquanto para o controle da buva não houve diferença entre os tratamentos. Depois da aplicação seqüencial, o melhor tratamento para o controle de buva foi com diuron e bromacil+diuron.Studies were conducted at Estação Experimental de Citricultura de Bebedouro, SP to evaluate the response of glyphosate-resistant horseweed and hairy fleabane biotypes to herbicides glyphosate, bromacil + diuron, diuron e paraquat isolated and in mixture and effect of a sequential application of glyphosate. The experimental design was of complete randomized blocks with four replication and seven treatments. The herbicides were applied with costal sprayer, constant pressure with three nozzles TT110015, the equivalent spray volume was 150 L ha-1. The control was visually evaluated, trough percentile note scale. The best results were obtained to general control of weed with diuron isolated and glyphosate in mixture with bromacil + diuron while to glyphosate-resistant horseweed and hairy fleabane there was no difference between the treatments. After sequential application to Conyza sp control, the best treatment was obtained associated with diuron and bromacil+diuron.

Glyphosate tolerance of soybean mutant gained after boarding on satellite

International Nuclear Information System (INIS)

Jiang Lingxue; Ren Honglei; Zhang Hongyan; Liu Zhangxiong; Jin Longguo; Guo Yong; Qiu Lijuan; Tao Bo

2011-01-01

Glyphosate-tolerant germplasm and genetic variation characteristics of SP 2 and SP 3 soybean varieties boarded on Shijian No.8 satellite were analyzed after treated by herbicide glyphosate in the field. Abundant variations of traits were produced, and the resistance within and among cultivars were different in their offspring of space mutagenesis. Plant height and maturity were used as index to screen glyphosate tolerant materials. Space mutation increased of soybean 661 SP 3 of Zhongpin, and one glyphosate-resistance variant was screened from Zhongpin 661 SP 3 . It showed that glyphosate tolerance was different among offspring of different space mutagenesis soybean materials. It is feasible to systemically screen elite traits soybean by applying space mutation breeding. (authors)

Role of secondary metabolites biosynthesis in resistance to cotton ...

African Journals Online (AJOL)

use

2011-12-12

Dec 12, 2011 ... Disease percentage on six cotton varieties with respect to time for cotton leaf curl virus (CLCuV) was evaluated. In August 2007, the maximum disease was observed in CIM-506, CYTO-89 and BH-118. (susceptible), whereas CIM-443 was resistant with lower disease percentage. It was found that the leaf.

Remote sensing techniques for monitoring the Rio Grande Valley cotton stalk destruction program

Energy Technology Data Exchange (ETDEWEB)

Richardson, A.J.; Gerbermann, A.H.; Summy, K.R.; Anderson, G.L. (Department of Agriculture, Weslaco, TX (United States))

1993-09-01

Post harvest cotton (Gossypium hirsutum L.) stalk destruction is a cultural practice used in the Rio Grande Valley to suppress over wintering populations of boll weevils (Anthonomus grandis Boheman) without using chemicals. Consistent application of this practice could substantially reduce insecticide usage, thereby minimizing environmental hazards and increasing cotton production profits. Satellite imagery registered within a geographic information system was used to monitor the cotton stalk destruction program in the Rio Grande Valley. We found that cotton stalk screening procedures based on standard multispectral classification techniques could not reliably distinguish cotton from sorghum. Greenness screening for cotton plant stalks after the stalk destruction deadline was possible only where ground observations locating cotton fields were available. These findings indicate that a successful cotton stalk destruction monitoring program will require satellite images and earth referenced data bases showing cotton field locations.

The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae as a new menace to cotton in Egypt and its chemical control

Directory of Open Access Journals (Sweden)

El-Zahi El-Zahi Saber

2016-04-01

Full Text Available The cotton mealybug, Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae is a polyphagous sap sucking insect with a wide geographical and host range causing severe losses in economically important crops. This study represents the first record of P. solenopsis as a new insect attacking cotton plants (Gossypium barbadense var. Giza 86 in Kafr El-Sheikh governorate, Egypt. The insect was noticed on cotton plants for the first time during its growing season of 2014. The mealybug specimens were collected from infested cotton plants and identified as P. solenopsis. In an attempt to control this pest, eight toxic materials viz., imidacloprid, thiamethoxam, flonicamid, emamectin-benzoate, chlorpyrifos, methomyl, deltamethrin and mineral oil (KZ-oil, belonging to different chemical groups, were tested for their influence against P. solenopsis on cotton under field conditions. Methomyl, imidacloprid, thiamethoxam and chlorpyrifos showed the highest efficacy against P. solenopsis recording 92.3 to 80.4% reduction of the insect population. Flonicamid, emamectin-benzoate and KZ-oil failed to exhibit sufficient P. solenopsis control.

Identification and characterization of microRNAs in Asiatic cotton (Gossypium arboreum L..

Directory of Open Access Journals (Sweden)

Min Wang

Full Text Available To date, no miRNAs have been identified in the important diploid cotton species although there are several reports on miRNAs in upland cotton. In this study, we identified 73 miRNAs, belonging to 49 families, from Asiatic cotton using a well-developed comparative genome-based homologue search. Several of the predicted miRNAs were validated using quantitative real time PCR (qRT-PCR. The length of miRNAs varied from 18 to 22 nt with an average of 20 nt. The length of miRNA precursors also varied from 46 to 684 nt with an average of 138 ±120 nt. For a majority of Asiatic cotton miRNAs, there is only one member per family; however, multiple members were identified for miRNA 156, 414, 837, 838, 1044, 1533, 2902, 2868, 5021 and 5142 families. Nucleotides A and U were dominant, accounted for 62.95%, in the Asiatic cotton pre-miRNAs. The Asiatic cotton pre-miRNAs had high negative minimal folding free energy (MFE and adjusted MFE (AMFE and high MFE index (MFEI. Many miRNAs identified in Asiatic cotton suggest that miRNAs also play a similar regulatory mechanism in diploid cotton.

APPLICATION OF DRIP IRRIGATION ON COTTON PLANT GROWTH (Gossypium sp.

Directory of Open Access Journals (Sweden)

Syahruni Thamrin

2017-12-01

Full Text Available The condition of cotton planting in South Sulawesi is always constrained in the fulfillment of water. All plant growth stages are not optimal to increase production, so it is necessary to introduce good water management technology, such as through water supply with drip irrigation system. This study aims to analyze the strategy of irrigation management in cotton plants using drip irrigation system. Model of application by designing drip irrigation system and cotton planting on land prepared as demonstration plot. Observations were made in the germination phase and the vegetative phase of the early plants. Based on the result of drip irrigation design, the emitter droplet rate (EDR was 34.266 mm/hour with an operational time of 4.08 min/day. From the observation of cotton growth, it is known that germination time lasted from 6 to 13 days after planting, the average plant height reached 119.66 cm, with the number of leaves averaging 141.93 pieces and the number of bolls averaging 57.16 boll.

Effect of nitrates on embryo induction efficiency in cotton ...

African Journals Online (AJOL)

Cotton (Gossypium hirsutum L.) cv Coker-312 callus culture was assessed in terms of its usefulness as a system for investigating the effect of nitrates from different chemical compounds of nitrogen on embryo induction percentage in calli as the plant growth and cell differentiation mainly based on nitrogen. Both sources and ...

Profitability of cover crops for single and twin row cotton

Science.gov (United States)

With the increased interest in cover crops, the impact of adoption on profitability of cash crops is a common question from producers. The objective of this study was to evaluate the profitability of cover crops for single and twin row cotton (Gossypium hirsutum L.) in Alabama. This experiment inclu...

Population structure and genetic diversity of the boll weevil, Anthonomus grandis (Coleoptera: Curculionidae), on Gossypium in North America

Science.gov (United States)

While the boll weevil, Anthonomus grandis, has been identified as one of the most devastating pests in U.S. history, its origin and activity in Mexico, both on wild and cultivated cotton hosts (genus Gossypium), is poorly understood. Three forms (geographical or host-associated races) of A. grandis ...

Genetic and DNA methylation changes in cotton (Gossypium genotypes and tissues.

Directory of Open Access Journals (Sweden)

Kenji Osabe

Full Text Available In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP assays including a methylation insensitive enzyme (BsiSI, and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC. DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.

Science.gov (United States)

Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W

2014-01-01

In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

Structural analysis of Gossypium hirsutum fibers grown under greenhouse and hydroponic conditions.

Science.gov (United States)

Natalio, Filipe; Tahir, Muhammad Nawaz; Friedrich, Norman; Köck, Margret; Fritz-Popovski, Gerhard; Paris, Oskar; Paschke, Reinhard

2016-06-01

Cotton is the one of the world's most important crops. Like any other crop, cotton growth/development and fiber quality is highly dependent on environmental factors. Increasing global weather instability has been negatively impacting its economy. Cotton is a crop that exerts an intensive pressure over natural resources (land and water) and demands an overuse of pesticides. Thus, the search for alternative cotton culture methods that are pesticide-free (biocotton) and enable customized standard fiber quality should be encouraged. Here we describe a culture of Gossypium hirsutum ("Upland" Cotton) utilizing a greenhouse and hydroponics in which the fibers are morphological similar to conventional cultures and structurally fit into the classical two-phase cellulose I model with 4.19nm crystalline domains surrounded by amorphous regions. These fibers exhibit a single crystalline form of cellulose I-Iß, monoclinic unit cell. Fiber quality bulk analysis shows an improved length, strength, whiteness when compared with soil-based cultures. Finally, we show that our fibers can be spun, used for production of non-woven fabrics and indigo-vat stained demonstrating its potential in industrial and commercial applications. Copyright © 2016 Elsevier Inc. All rights reserved.

Factors affecting the fate and transport of glyphosate and AMPA into surface waters of agricultural watersheds in the United States and Europe

Science.gov (United States)

Coupe, R.; Kalkhoff, S.; Capel, P.; Gregoire, C.

2012-04-01

Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used extensively in almost all agricultural and urban areas of the United States and Europe. Although, glyphosate is used widely throughout the world in the production of many crops, it is predominately used in the United States on soybeans, corn, potatoes, and cotton that have been genetically modified to be tolerant to glyphosate. From 1992 to 2007, the agricultural use of glyphosate has increased from less than 10,000 Mg to more than 80,000 Mg, respectively. The greatest areal use is in the midwestern United States where glyphosate is applied on transgenic corn and soybeans. Because of the difficulty and expense in analyzing for glyphosate and AMPA (aminomethylphosphonic acid, a primary glyphosate degradate) in water, there have been only small scale studies on the fate and transport of glyphosate. The characterization of the transport of glyphosate and AMPA on a watershed scale is lacking. Glyphosate and AMPA were frequently detected in the surface waters of 4 agricultural watersheds in studies conducted by the U.S. Geological Survey in the United States and at the Laboratory of Hydrology and Geochemistry of Strasbourg. Two of these basins were located in the midwestern United States where the major crops are corn and soybean, the third is located the lower Mississippi River Basin where the major crops are soybean, corn, rice, and cotton, and the fourth was located near Strasbourg, France where the use of glyphosate was on a vineyard. The load as a percent of use ranged from 0.009 to 0.86 percent and could be related to 3 factors: source strength, hydrology, and flowpath. Glyphosate use in a watershed results in some occurrence in surface water at the part per billion level; however, those watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff, and a flowpath that does not include transport through the soil.

Induced variants in cotton (Gossypium Hirsutum L.) by in vitro mutagenesis

International Nuclear Information System (INIS)

Muthusamy, A.; Jayabalan, N.

2000-01-01

The shoot tips (3-5mm) of cotton were isolated from five day old in vitro grown seedlings and it contained two small unexpanded leaves approximately 1.0 mm along with cotyledons and the cotyledons were removed before the treatment with mutagens. The shoot tip alone was treated with 1-5 kR doses of gamma rays from 60C o source at Sugarcane Breeding Institute (ICAR), Coimbatore, Tamil Nadu and 1-5 mM of ethyl methane sulphonate (EMS) and sodium azide (SA) for 30 min. at pH 6 and 3 respectively. The treated shoot tips were inoculated on MS medium supplemented with 0.1 mg/l KIN, l-inositol 100 mg/l, thiamine HCI 1.0 mg/l, sucrose 30 g/l and agar 8 g/l. During the development of shoots, a number of leaf mutants with narrow, tubular, bilobed and multilobed leaves was observed. The plants also showed the best performance in number of branches, leaf area and yield characters than control. The morphological variants obtained due to mutagenic treatment in the present investigation showed high frequency with increasing doses of mutagens. Compared with somatic cell culture of cotton, shoot and meristem culture is an easier method to obtain regenerative plants. The in vitro induction of mutations has also potential application in the development of disease-resistant plants through tissue culture. (author)

Genetic analysis of some agronomic traits (gossypium hamster L.) in cotton

International Nuclear Information System (INIS)

Zulqarnain, M.; Khan, I.A.; Shakeel, T.; JAfri, J.S.

1998-01-01

Four varieties of cotton were crossed in a complete diallel fashion to evaluate the mode of inheritance of different agronomic traits. Height of main stem, number of bolls per plant, boll weight and yield of seed cotton per plant appeared to be controlled by additive with partial dominance type of gene action. While number of seeds per boll was controlled by over dominance type of gene action. Variety MNH-93 possessed dominant genes for height of main stem, number of bolls per plant number of seeds per boll and yield of seed cotton per plant. AMSI-38 carried dominant genes for boll weight and recessive for number of bolls per plant, number of seeds per boll and boll weight. Height of main stem and yield of seed cotton were controlled by recessive genes in Variety AMSI-38. (author)

Fate and transport of glyphosate and aminomethylphosphonic acid in surface waters of agricultural basins

Science.gov (United States)

Coupe, R.H.; Kalkhoff, S.J.; Capel, P.D.; Gregoire, C.

2012-01-01

Background: Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used widely throughout the world in the production of many crops and is heavily used on soybeans, corn and cotton. Glyphosate is used in almost all agricultural areas of the United States, and the agricultural use of glyphosate has increased from less than 10 000 Mg in 1992 to more than 80 000 Mg in 2007. The greatest intensity of glyphosate use is in the midwestern United States, where applications are predominantly to genetically modified corn and soybeans. In spite of the increase in usage across the United States, the characterization of the transport of glyphosate and its degradate aminomethylphosphonic acid (AMPA) on a watershed scale is lacking. Results: Glyphosate and AMPA were frequently detected in the surface waters of four agricultural basins. The frequency and magnitude of detections varied across basins, and the load, as a percentage of use, ranged from 0.009 to 0.86% and could be related to three general characteristics: source strength, rainfall runoff and flow route. Conclusions: Glyphosate use in a watershed results in some occurrence in surface water; however, the watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff and a flow route that does not include transport through the soil. ?? 2011 Society of Chemical Industry.

Genome-wide identification and comparative analysis of squamosa-promoter binding proteins (sbp) transcription factor family in gossypium raimondii and arabidopsis thaliana

International Nuclear Information System (INIS)

Ali, M.A.; Alia, K.B.; Atif, R.M.; Rasulj, I.; Nadeem, H.U.; Shahid, A.; Azeem, F

2017-01-01

SQUAMOSA-Promoter Binding Proteins (SBP) are class of transcription factors that play vital role in regulation of plant tissue growth and development. The genes encoding these proteins have not yet been identified in diploid cotton. Thus here, a comprehensive genome wide analysis of SBP genes/proteins was carried out to identify the genes encoding SBP proteins in Gossypium raimondii and Arabidopsis thaliana. We identified 17 SBP genes from Arabidopsis thaliana genome and 30 SBP genes from Gossypium raimondii. Chromosome localization studies revealed the uneven distribution of SBP encoding genes both in the genomes of A. thaliana and G. raimondii. In cotton, five SBP genes were located on chromosome no. 2, while no gene was found on chromosome 9. In A. thaliana, maximum seven SBP genes were identified on chromosome 9, while chromosome 4 did not have any SBP gene. Thus, the SBP gene family might have expanded as a result of segmental as well as tandem duplications in these species. The comparative phylogenetic analysis of Arabidopsis and cotton SBPs revealed the presence of eight groups. The gene structure analysis of SBP encoding genes revealed the presence of one to eleven inrons in both Arabidopsis and G. raimondii. The proteins sharing the same phyletic group mostly demonstrated the similar intron-exon occurrence pattern; and share the common conserved domains. The SBP DNA-binding domain shared 24 absolutely conserved residues in Arabidopsis. The present study can serve as a base for the functional characterization of SBP gene family in Gossypium raimondii. (author)

Molecular and Biochemical Characterization of Cotton Epicuticular Wax in Defense Against Cotton Leaf Curl Disease.

Science.gov (United States)

Khan, Muhammad Azmat Ullah; Shahid, Ahmad Ali; Rao, Abdul Qayyum; Bajwa, Kamran Shehzad; Samiullah, Tahir Rehman; Muzaffar, Adnan; Nasir, Idrees Ahmad; Husnain, Tayyab

2015-12-01

Gossypium arboreumis resistant to Cotton leaf curl Burewala virus and its cognate Cotton leaf curl Multan beta satellite ( CLCuBuV and CLCuMB ). However, the G. arboreum wax deficient mutant (GaWM3) is susceptible to CLCuV . Therefore, epicuticular wax was characterized both quantitatively and qualitatively for its role as physical barrier against whitefly mediated viral transmission and co-related with the titer of each viral component (DNA-A, alphasatellite and betasatellite) in plants. The hypothesis was the CLCuV titer in cotton is dependent on the amount of wax laid down on plant surface and the wax composition. Analysis of the presence of viral genes, namely alphasatellite, betasatellite and DNA-A, via real-time PCR in cotton species indicated that these genes are detectable in G. hirsutum , G. harknessii and GaWM3, whereas no particle was detected in G. arboreum . Quantitative wax analysis revealed that G. arboreum contained 183 μg.cm -2 as compared to GaWM3 with only 95 μg.cm -2 . G. hirsutum and G. harknessii had 130 μg.cm -2 and 146 μg.cm -2 , respectively. The GCMS results depicted that Lanceol, cis was 45% in G. harknessii . Heptadecanoic acid was dominant in G. arboreum with 25.6%. GaWM3 had 18% 1,2,-Benenedicarboxylic acid. G. hirsutum contained 25% diisooctyl ester. The whitefly feeding assay with Nile Blue dye showed no color in whiteflies gut fed on G. arboreum . In contrast, color was observed in the rest of whiteflies. From results, it was concluded that reduced quantity as well as absence of (1) 3-trifluoroacetoxytetradecane, (2) 2-piperidinone,n-|4-bromo-n-butyl|, (3) 4-heptafluorobutyroxypentadecane, (4) Silane, trichlorodocosyl-, (5) 6- Octadecenoic acid, methyl ester, and (6) Heptadecanoicacid,16-methyl-,methyl ester in wax could make plants susceptible to CLCuV , infested by whiteflies.

Characterization of indigenous gossypium arboreum L. genotypes for various fiber quality traits

International Nuclear Information System (INIS)

Iqbal, M. A.; Abbas, A.; Zafar, Y.

2015-01-01

Diploid cotton (Gossypium arboreum L.) being an Old World cultivated cotton species, evolved in Indo-Pak subcontinent, has been known for conferring resistance to biotic and abiotic stresses. To the extent of our knowledge, there is no comprehensive report available on the characterization of G. arboreum germplasm. Hence, the present study was conducted to characterize 26 G. arboreum genotypes by deploying univariate and multivariate analysis in 2010 at NIBGE, Faisalabad. All these genotypes were characterized for boll weight, GOT percentage, micronaire value, staple length, fiber bundle strength and uniformity index. Genotypic variation was significant (p<0.01) for all the analyzed traits except boll weight. Maximum boll weight (2.47g) was observed for genotype 23718. GOT ranged from 18.75% (Haroonabad) to 36.94 percentage (DC-116).The finest fiber was obtained from synthetic (4.37 micro g/inch) and this genotype also exhibited the higher values for staple length (23.81 mm) and fiber bundle strength (27.37 g/tex). Range for uniformity index was observed from 76.19 percentage (Garohill) to 77.98 percentage (212). Principal component analysis (PCA) exhibited that first five components accounted for >63 percentage of the total variability. Cluster analysis identified four groups based on their agronomic properties. Significant relationships among different traits can be useful to select best genotypes having good fiber quality traits. These genotypes may prove a valuable resource to fuel the breeding efforts for not only broadening the genetic base of the newly developed material but can also add synergy to various cotton genomic projects. (author)

Genetic divergence and association among polygenic characters in gossypium hirsutum L

International Nuclear Information System (INIS)

BiBi, M.; Khan, N.U.; Mohammad, F.; Gul, R.

2011-01-01

Development of promising cotton populations with improved agronomic performance is primary objective of the cotton breeders. Genetic potential and variability in 8 X 8 F/sub 1/diallel hybrids versus their parental lines, traits correlation and heritability estimates were studied in Gossypium hirsutum L., during 2008-09 at Khyber Pakhtunkhwa Agricultural University, Peshawar, Pakistan. Highly significant variations were observed among the parental cultivars and their F/sub 1/ hybrids for all traits. Results indicated that F/sub 1/ hybrids CIM-506 X CIM-554, CIM-473 X CIM-554, CIM-446 X CIM-554 and CIM-446 X CIM-496 (its reciprocal) produced significantly higher seed cotton yield, bolls per sympodia, boll weight and seeds per boll. Most of the F/sub 1/ populations involving CIM-554 as maternal plant also revealed early maturity. Yield related traits revealed significant positive correlations with seed cotton yield. Heritability (broad sense) was high in magnitude for all traits. Results revealed that traits with high heritability and wide range of genetic variability in breeding material can work as a base population, and their significant contribution towards high yield can help in early segregating generations. (author)

Cotton Flowers: Pollen and Petal Humidity Sensitivities Determine Reproductive Competitiveness in Diverse Environments

Science.gov (United States)

Genetic diversity in reproductive abiotic stress tolerance has been reported for cotton [Gossypium hirsutum (L.)] based upon the percentage of anther dehiscence of mature pollen in adverse environments. This study investigated the abiotic stress tolerance of mature pollen and identified genetic vari...

Tobacco rattle virus (TRV) based silencing of cotton enoyl-CoA reductase (ECR) gene and the role of very long chain fatty acids in normal leaf development and resistance to wilt disease

Science.gov (United States)

A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...

Glyphosate sustainability in South American cropping systems.

Science.gov (United States)

Christoffoleti, Pedro J; Galli, Antonio J B; Carvalho, Saul J P; Moreira, Murilo S; Nicolai, Marcelo; Foloni, Luiz L; Martins, Bianca A B; Ribeiro, Daniela N

2008-04-01

South America represents about 12% of the global land area, and Brazil roughly corresponds to 47% of that. The major sustainable agricultural system in South America is based on a no-tillage cropping system, which is a worldwide adopted agricultural conservation system. Societal benefits of conservation systems in agriculture include greater use of conservation tillage, which reduces soil erosion and associated loading of pesticides, nutrients and sediments into the environment. However, overreliance on glyphosate and simpler cropping systems has resulted in the selection of tolerant weed species through weed shifts (WSs) and evolution of herbicide-resistant weed (HRW) biotypes to glyphosate. It is a challenge in South America to design herbicide- and non-herbicide-based strategies that effectively delay and/or manage evolution of HRWs and WSs to weeds tolerant to glyphosate in cropping systems based on recurrent glyphosate application, such as those used with glyphosate-resistant soybeans. The objectives of this paper are (i) to provide an overview of some factors that influence WSs and HRWs to glyphosate in South America, especially in Brazil, Argentina and Paraguay soybean cropped areas; (ii) to discuss the viability of using crop rotation and/or cover crops that might be integrated with forage crops in an economically and environmentally sustainable system; and (iii) to summarize the results of a survey of the perceptions of Brazilian farmers to problems with WSs and HRWs to glyphosate, and the level of adoption of good agricultural practices in order to prevent or manage it. Copyright (c) 2008 Society of Chemical Industry.

Response of Pennsylvania native plant species to dicamba and/or glyphosate

Science.gov (United States)

Weeds may become resistant to intensive and extensive use of specific herbicides associated with the growth of herbicide tolerant crops, e.g., the use of glyphosate for weed control with glyphosate tolerant soybeans. To counter this resistance, crops modified to contain genes for...

Genome-wide identification of differentially expressed genes under water deficit stress in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Park, Wonkeun; Scheffler, Brian E; Bauer, Philip J; Campbell, B Todd

2012-06-15

Cotton is the world's primary fiber crop and is a major agricultural commodity in over 30 countries. Like many other global commodities, sustainable cotton production is challenged by restricted natural resources. In response to the anticipated increase of agricultural water demand, a major research direction involves developing crops that use less water or that use water more efficiently. In this study, our objective was to identify differentially expressed genes in response to water deficit stress in cotton. A global expression analysis using cDNA-Amplified Fragment Length Polymorphism was conducted to compare root and leaf gene expression profiles from a putative drought resistant cotton cultivar grown under water deficit stressed and well watered field conditions. We identified a total of 519 differentially expressed transcript derived fragments. Of these, 147 transcript derived fragment sequences were functionally annotated according to their gene ontology. Nearly 70 percent of transcript derived fragments belonged to four major categories: 1) unclassified, 2) stress/defense, 3) metabolism, and 4) gene regulation. We found heat shock protein-related and reactive oxygen species-related transcript derived fragments to be among the major parts of functional pathways induced by water deficit stress. Also, twelve novel transcripts were identified as both water deficit responsive and cotton specific. A subset of differentially expressed transcript derived fragments was verified using reverse transcription-polymerase chain reaction. Differential expression analysis also identified five pairs of duplicated transcript derived fragments in which four pairs responded differentially between each of their two homologues under water deficit stress. In this study, we detected differentially expressed transcript derived fragments from water deficit stressed root and leaf tissues in tetraploid cotton and provided their gene ontology, functional/biological distribution, and

CRISPR/Cas9-mediated targeted mutagenesis in upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Janga, Madhusudhana R; Campbell, LeAnne M; Rathore, Keerti S

2017-07-01

The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated (Cas)9 protein system has emerged as a simple and efficient tool for genome editing in eukaryotic cells. It has been shown to be functional in several crop species, yet there are no reports on the application of this or any other genome editing technologies in the cotton plant. Cotton is an important crop that is grown mainly for its fiber, but its seed also serves as a useful source of edible oil and feed protein. Most of the commercially-grown cotton is tetraploid, thus making it much more difficult to target both sets of homeologous alleles. Therefore, in order to understand the efficacy of the CRISPR/Cas9 system to target a gene within the genome of cotton, we made use of a transgenic cotton line previously generated in our laboratory that had a single copy of the green fluorescent protein (GFP) gene integrated into its genome. We demonstrate, for the first time, the use of this powerful new tool in targeted knockout of a gene residing in the cotton genome. By following the loss of GFP fluorescence, we were able to observe the cells that had undergone targeted mutations as a result of CRISPR/Cas9 activity. In addition, we provide examples of the different types of indels obtained by Cas9-mediated cleavage of the GFP gene, guided by three independent sgRNAs. The results provide useful information that will help us target important native genes in the cotton plant in future.

Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

Science.gov (United States)

Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-08-01

Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Simulating changes in cropping practices in conventional and glyphosate-resistant maize. II. Weed impacts on crop production and biodiversity.

Science.gov (United States)

Colbach, Nathalie; Darmency, Henri; Fernier, Alice; Granger, Sylvie; Le Corre, Valérie; Messéan, Antoine

2017-05-01

Overreliance on the same herbicide mode of action leads to the spread of resistant weeds, which cancels the advantages of herbicide-tolerant (HT) crops. Here, the objective was to quantify, with simulations, the impact of glyphosate-resistant (GR) weeds on crop production and weed-related wild biodiversity in HT maize-based cropping systems differing in terms of management practices. We (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, with the weed dynamics model FLORSYS; (2) quantified how much the presence of GR weeds contributed to weed impacts on crop production and biodiversity; (3) determined the effect of cultural practices on the impact of GR weeds and (4) identified which species traits most influence weed-impact indicators. The simulation study showed that during the analysed 28 years, the advent of glyphosate resistance had little effect on plant biodiversity. Glyphosate-susceptible populations and species were replaced by GR ones. Including GR weeds only affected functional biodiversity (food offer for birds, bees and carabids) and weed harmfulness when weed effect was initially low; when weed effect was initially high, including GR weeds had little effect. The GR effect also depended on cultural practices, e.g. GR weeds were most detrimental for species equitability when maize was sown late. Species traits most harmful for crop production and most beneficial for biodiversity were identified, using RLQ analyses. None of the species presenting these traits belonged to a family for which glyphosate resistance was reported. An advice table was built; the effects of cultural practices on crop production and biodiversity were synthesized, explained, quantified and ranked, and the optimal choices for each management technique were identified.

Genome-wide analysis of the WRKY gene family in cotton.

Science.gov (United States)

Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

2014-12-01

WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

Genetic study of various agronomic traits in cotton (Gossypium hirsutum L.)

International Nuclear Information System (INIS)

Ashraf, F.; Khan, I.A.; Ahmed, S.

2009-01-01

The use of already existing genetic variability in the breeding material, as well as, the creation of new variability along with the genetic understanding of various agronomic traits is of crucial importance, in order to develop potential sources of cotton. For this purpose, 5 X 6 complete diallel cross experiment was conducted during 2003-04, involving 5 strains i.e. VH-55, MNH-516, ACALA-SJ-4, A-8100 and CRIS-420, to evaluate gene-action, general and specific combining ability for number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant, boll weight and yield of seed cotton. Additive type of gene action, with partial dominance for all the traits studied, was observed. Most dominant genes for boll weight, yield of seed-cotton, and number of sympodial branches were observed in CRIS-420, while maximum dominant genes for number of monopodial branches, plant height were observed in ACALA-SJ-4. Variety VH-55 carried maximum dominant genes for number of bolls per plant. Recessive genes for the number of sympodial branches, number of monopodial branches, plant height, number of bolls per plant and yield of seed-cotton, were exhibited by MNH-516. The variety ACAU-SJ-4 showed harmonius combination for bolls per plant and yield of seed-cotton, whereas CRIS- 420 was found a good general combiner for plant height and number of sympodial branches. (author)

Pollen- and seed-mediated transgene flow in commercial cotton seed production fields.

Directory of Open Access Journals (Sweden)

Shannon Heuberger

Full Text Available BACKGROUND: Characterizing the spatial patterns of gene flow from transgenic crops is challenging, making it difficult to design containment strategies for markets that regulate the adventitious presence of transgenes. Insecticidal Bacillus thuringiensis (Bt cotton is planted on millions of hectares annually and is a potential source of transgene flow. METHODOLOGY/PRINCIPAL FINDINGS: Here we monitored 15 non-Bt cotton (Gossypium hirsutum, L. seed production fields (some transgenic for herbicide resistance, some not for gene flow of the Bt cotton cry1Ac transgene. We investigated seed-mediated gene flow, which yields adventitious Bt cotton plants, and pollen-mediated gene flow, which generates outcrossed seeds. A spatially-explicit statistical analysis was used to quantify the effects of nearby Bt and non-Bt cotton fields at various spatial scales, along with the effects of pollinator abundance and adventitious Bt plants in fields, on pollen-mediated gene flow. Adventitious Bt cotton plants, resulting from seed bags and planting error, comprised over 15% of plants sampled from the edges of three seed production fields. In contrast, pollen-mediated gene flow affected less than 1% of the seed sampled from field edges. Variation in outcrossing was better explained by the area of Bt cotton fields within 750 m of the seed production fields than by the area of Bt cotton within larger or smaller spatial scales. Variation in outcrossing was also positively associated with the abundance of honey bees. CONCLUSIONS/SIGNIFICANCE: A comparison of statistical methods showed that our spatially-explicit analysis was more powerful for understanding the effects of surrounding fields than customary models based on distance. Given the low rates of pollen-mediated gene flow observed in this study, we conclude that careful planting and screening of seeds could be more important than field spacing for limiting gene flow.

Alleles conferring improved fiber quality from EMS mutagenesis of elite cotton genotypes

Science.gov (United States)

The elite gene pool of cotton (Gossypium spp.) has less diversity than those of most other major crops, making identification of novel alleles important to ongoing crop improvement. A total of 3,164 M5 lines resulting from ethyl methanesulfonate mutagenesis of two G. hirsutum breeding lines, TAM 94L...

Cover Crop Biomass Harvest Influences Cotton Nitrogen Utilization and Productivity

Directory of Open Access Journals (Sweden)

F. Ducamp

2012-01-01

Full Text Available There is a potential in the southeastern US to harvest winter cover crops from cotton (Gossypium hirsutum L. fields for biofuels or animal feed use, but this could impact yields and nitrogen (N fertilizer response. An experiment was established to examine rye (Secale cereale L. residue management (RM and N rates on cotton productivity. Three RM treatments (no winter cover crop (NC, residue removed (REM and residue retained (RET and four N rates for cotton were studied. Cotton population, leaf and plant N concentration, cotton biomass and N uptake at first square, and cotton biomass production between first square and cutout were higher for RET, followed by REM and NC. However, leaf N concentration at early bloom and N concentration in the cotton biomass between first square and cutout were higher for NC, followed by REM and RET. Seed cotton yield response to N interacted with year and RM, but yields were greater with RET followed by REM both years. These results indicate that a rye cover crop can be beneficial for cotton, especially during hot and dry years. Long-term studies would be required to completely understand the effect of rye residue harvest on cotton production under conservation tillage.

Effect of Gamma Irradiation Doses on Some Chemical Characteristics of Cotton Seed Oil

International Nuclear Information System (INIS)

Saleh, O.I.

2011-01-01

Cotton Seeds c.v. Giza 85 (Gossypium hirsutum L.) were exposed to gamma irradiation doses of 0.5, 1.0 and 1.5 kGy to improve some chemical characteristics of cotton seed oil i.e. saturated and unsaturated fatty acids, gossypol and βsitosterol that were bound oil. The presented study showed that, the saturated fatty acids; lauric, palmitic and stearic increased when the cotton seeds were exposed to gamma irradiation doses of 0.5 up to 1.5 kGy, On the other hand, arachidic acid content decreased in all the irradiated treatments compared with untreated cotton seed. The unsaturated fatty acid oleic was increased in irradiated cotton seed samples compared with untreated one, while linoleic, the major unsaturated fatty acid decreased in irradiated cotton seed oil than untreated seeds. Gossypol and βsitosterol, bound oil, in irradiated cotton seeds increased gradually with gamma irradiated doses compared with untreated control samples

Inheritance of resistance to cotton blue disease Herança da resistência do algodoeiro à doença-azul

Directory of Open Access Journals (Sweden)

Osmério Pupim Junior

2008-05-01

Full Text Available The objective of this work was to determine the inheritance of cotton blue disease resistance by cotton plants. Populations derived from the CD 401 and Delta Opal resistant varieties were evaluated, through a greenhouse test with artificial inoculation by viruliferous aphids. Cotton blue disease resistance is conditioned by one dominant gene, both in CD 401 and Delta Opal varieties.O objetivo deste trabalho foi determinar a herança da resistência do algodoeiro à doença-azul. Populações derivadas das variedades resistentes CD 401 e Delta Opal foram avaliadas em casa de vegetação, por meio da inoculação de pulgões virulíferos. A resistência à doença-azul do algodoeiro é condicionada por um gene dominante, tanto em 'DC 401' quanto em 'Delta Opal'.

Toxicity to cotton boll weevil Anthonomus grandis of a trypsin inhibitor from chickpea seeds.

Science.gov (United States)

de P G Gomes, Angélica; Dias, Simoni C; Bloch, Carlos; Melo, Francislete R; Furtado, José R; Monnerat, Rose G; Grossi-de-Sá, Maria F; Franco, Octávio L

2005-02-01

Cotton (Gossypium hirsutum L.) is an important agricultural commodity, which is attacked by several pests such as the cotton boll weevil Anthonomus grandis. Adult A. grandis feed on fruits and leaf petioles, reducing drastically the crop production. The predominance of boll weevil digestive serine proteinases has motivated inhibitor screenings in order to discover new ones with the capability to reduce the digestion process. The present study describes a novel proteinase inhibitor from chickpea seeds (Cicer arietinum L.) and its effects against A. grandis. This inhibitor, named CaTI, was purified by using affinity Red-Sepharose Cl-6B chromatography, followed by reversed-phase HPLC (Vydac C18-TP). SDS-PAGE and MALDI-TOF analyses, showed a unique monomeric protein with a mass of 12,877 Da. Purified CaTI showed significant inhibitory activity against larval cotton boll weevil serine proteinases (78%) and against bovine pancreatic trypsin (73%), when analyzed by fluorimetric assays. Although the molecular mass of CaTI corresponded to alpha-amylase/trypsin bifunctional inhibitors masses, no inhibitory activity against insect and mammalian alpha-amylases was observed. In order to observe CaTI in vivo effects, an inhibitor rich fraction was added to an artificial diet at different concentrations. At 1.5% (w/w), CaTI caused severe development delay, several deformities and a mortality rate of approximately 45%. These results suggested that CaTI could be useful in the production of transgenic cotton plants with enhanced resistance toward cotton boll weevil.

Elargissement de la base génétique de la principale espèce de cotonnier cultivé Gossypium hirsutum L. par la création et l'exploitation de lignées monosomiques d'addition

Directory of Open Access Journals (Sweden)

Sarr D.

2009-01-01

Full Text Available Genetic broadening of the main cultivated cotton species Gossypium hirsutum L. by creation and exploitation of monosomic alien addition lines. The genus Gossypium is composed of about forty wild diploïd species that constitute an important reservoir of interesting genes for the genetic improvement of Gossypium hirsutum L., the main cultivated cotton species. Creation of monosomic alien addition lines (MAAL, made up of plants having in addition to the chromosome set of the cultivated species one wild species' supernumerary chromosome, is an interesting way to exploit this diversity. Numerous constraints limit the creation of MAAL, among them the most important is doubtless the production of first generation derivatives from pentaploids obtained by backcrossing G. hirsutum with bispecific hexaploid hybrids made of the cultivated species tetraploid genome and the genome of a donor diploid species. Raising this impediment by appropriate techniques allows to develop MAAL offering the possibility to introgress finely traits of interest from diploid species and to better understand genomic relationships between species in the genus Gossypium. Identification and exploitation of these MAAL have been for a long time based on not very reliable morphological characteristics and on the use of classical cytogenetic techniques, very heavy to implement. Nowadays, the exploitation of MAAL benefits from the great advances registered in molecular biology through the development of DNA markers and molecular cytogenetics. These progresses make of MAAL a promising way for the genetic improvement of the main cultivated cotton species.

Influence of bleach activators on the fabric made from cotton (gossypium hamster l.)

International Nuclear Information System (INIS)

Asif, H.M.; Iftikhar, M.; Shahbaz, B.

2013-01-01

Raw cotton contains various type of trash and most of the impurities are removed during the spinning process but still the cotton fabric coming from the weaving or knitting process always contains some impurities. Some time cotton fabric gets the oil, stains and coloured materials which affect the quality of dyed fabric. Bleaching is a process that eliminates unwanted coloured matters from the fibres, yarn and fabrics. A bleaching agent is a material that lightens or whitens a substrate through chemical action. Hydrogen peroxide is by far the most commonly used oxidative bleaching agent for cotton and its blends, accounting for more than 90 percent of all the bleaching agents. The use of activators to enhance the bleaching performance of hydrogen peroxide for cellulosic materials has gained popularity now a day. In this context the main objectives of this paper are to study the influence of different bleaching activators on cotton fabric and to give implications for textile extension.The results indicate that the activators with different concentrations, along with different concentrations of hydrogen peroxide (H/sub 2/O/sub 2) have significant influence on the bleaching performance of cotton fabric. (author)

The effect of herbivory on temporal and spatial dynamics of foliar nectar production in cotton and castor

NARCIS (Netherlands)

Wäckers, F.L.; Zuber, D.; Wunderlin, R.; Keller, F.

2001-01-01

The effects of feeding Spodoptera littoralis(Boisd.) (Lepidoptera: Noctuidae) larvae on the quantity and distribution of extrafloral nectar production by leaves of castor (Ricinus communis) and cotton (Gossypium herbaceum) were investigated. Following larval feeding, the total volume of nectar

Early detection of crop injury from herbicide glyphosate by leaf biochemical parameter inversion

Science.gov (United States)

Early detection of crop injury from glyphosate is of significant importance in crop management. In this paper, we attempt to detect glyphosate-induced crop injury by PROSPECT (leaf optical PROperty SPECTra model) inversion through leaf hyperspectral reflectance measurements for non-Glyphosate-Resist...

Glyphosate and dicamba herbicide tank mixture effects on native plant and non-genetically engineered soybean seedlings

Science.gov (United States)

Weed species are becoming resistant to intensive and extensive use of specific herbicides associated with the production of herbicide resistant crops, e.g., the use of glyphosate for weed management with glyphosate resistant soybeans. To counter this resistance, crops engineered ...

Study of gene flow from GM cotton (Gossypium hirsutum) varieties in El Espinal (Tolima, Colombia)

International Nuclear Information System (INIS)

Rache Cardenal, Leidy Yanira; Mora Oberlaender, Julian; Chaparro Giraldo, Alejandro

2013-01-01

In 2009, 4088 hectares of genetically modified (GM) cotton were planted in Tolima (Colombia), however there is some uncertainty about containment measures needed to prevent the flow of pollen and seed from regulated GM fields into adjacent fields. In this study, the gene flow from GM cotton varieties to conventional or feral cotton plants via seed and pollen was evaluated. ImmunostripTM, PCR and ELISA assays were used to detect gene flow. Fifty six refuges, 27 fields with conventional cotton and four feral individuals of the enterprise Remolinos Inc. located in El Espinal (Tolima) were analyzed in the first half of 2010. The results indicated seed mediated gene flow in 45 refuges (80.4 %) and 26 fields with conventional cotton (96 %), besides pollen mediated gene flow in one field with conventional cotton and nine refuges. All fields cultivated with conventional cotton showed gene flow from GM cotton. Two refuges and two feral individuals did not reveal gene flow from GM cotton.

Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

Directory of Open Access Journals (Sweden)

Waqas Malik

2014-01-01

Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.

Genetic diversity/impurity estimation in sources of natural resistance against cotton leaf curl disease in pakistan

International Nuclear Information System (INIS)

Sarwar, G.

2007-01-01

Cotton accounts for more than 60% of Pakistan's export earnings through the export of both raw cotton and cotton products. An epidemic of cotton leaf curl disease (CLCuD) in Pakistan during the 1990s led to the withdrawal of high yielding cotton cultivars. Due of their susceptibility to the disease. The identification of natural resistance in some genotypes provided a means to manage reduce losses due to the disease. But it has been an adversity that almost all these resistant varieties have ultimately 'lost' their resistance. There are also reports that the original sources of resistance, as well as the varieties developed from them, are now susceptible to the disease when grafted with infected scion. For the present studies. Seed of two resistant varieties (LRA-5166 and (CP-152) was obtained from six different research organizations. Plants raised from these seed were grafted with symptomatic scion and used for morphological comparisons. Our results indicated that the genetic pool of these cultivars is not well maintained and that an unacceptable diversity impurity is present within and among the genetic stock of both these lines. There is thus a requirement for screening of these elite lines at the molecular level to ensure the purity of these varieties for future development. The virus causing CLCuD showed change by recombination making the search for new sources of resistance, as well as the maintenance of established sources, indispensable for the sustainable cotton production in Pakistan. (author)

The effect of herbivory on temporal and spatial dynamics of foliar nectar production in cotton and castor

NARCIS (Netherlands)

Wäckers, F.L.; Zuber, D.; Wunderlin, R.; Keller, F.

2001-01-01

The effects of feeding Spodoptera a littoralis (Boisd.) (Lepidoptera: Noctuidae) larvae on the quantity and distribution of extrafloral nectar production by leaves of castor ((Ricinus communis) and cotton (Gossypium herbaceum) were investigated. Following larval feeding, the total volume of nectar

Radiation and chemical mutagen induced somaclonal variations through in vitro organogenesis of cotton (Gossypium hirsutum L.).

Science.gov (United States)

Muthusamy, Annamalai; Jayabalan, Narayanasamy

2014-12-01

The purpose of the investigation was to induce somaclonal variations by gamma rays (GR), ethylmethane sulphonate (EMS) and sodium azide (SA) during in vitro organogenesis of cotton. The shoot tip explants were irradiated with 5-50 Gray (Gy) GR (Cobalt 60), 0.5-5.0 mM EMS and SA separately, and inoculated on Murashige and Skoog (MS) medium fortified with plant growth regulator (PGR) for organogenesis. The plantlets with well-developed root systems were acclimatized and transferred into the experimental field to screen the somaclonal variations during growth and development. The number of somaclonal variations was observed in growth of irradiated/treated shoot tips, multiplication, plantlet regeneration and growth in vitro and ex vitro. The lower doses/concentrations of mutagenic treatments showed significant enhancement in selected agronomical characters and they showed decreased trends with increasing doses/concentrations of mutagenic agents. The results of the present study revealed the influence of lower doses/concentrations of mutagenic treatments on in vitro and ex vitro growth of cotton plantlets and their significant improvement in agronomical characters which needs further imperative stability analysis. The present observations showed the platform to use lower doses/concentrations of mutagenic agents to induce variability for enhanced agronomical characters, resistant and tolerant cotton varieties.

Characterization of expressed sequence tags from developing fibers of Gossypium barbadense and evaluation of insertion-deletion variation in tetraploid cultivated cotton species.

Science.gov (United States)

Lv, Yuanda; Zhao, Liang; Xu, Xiaoyang; Wang, Lei; Wang, Cheng; Zhang, Tianzhen; Guo, Wangzhen

2013-03-13

Cotton is the leading fiber crop worldwide. Gossypium barbadense is an important species of cotton because of its extra-long staple fibers with superior luster and silkiness. However, a systematic analysis and utilization of cDNA sequences from G. barbadense fiber development remains understudied. A total of 21,079 high quality sequences were generated from two non-normalized cDNA libraries prepared by using a mixture of G. barbadense Hai7124 fibers and ovules. After assembly processing, a set of 8,653 unigenes were obtained. Of those, 7,786 were matched to known proteins and 7,316 were assigned to functional categories. The molecular functions of these unigenes were mostly related to binding and catalytic activity, and carbohydrate, amino acid, and energy metabolisms were major contributors among the subsets of metabolism. Sequences comparison between G. barbadense and G. hirsutum revealed that 8,245 unigenes from G. barbadense were detected the similarity with those released publicly in G. hirsutum, however, the remaining 408 sequences had no hits against G. hirsutum unigenes database. Furthermore, 13,275 putative ESTs InDels loci involved in the orthologous and/or homoeologous differences between/within G. barbadense and G. hirsutum were discovered by in silico analyses, and 2,160 InDel markers were developed by ESTs with more than five insertions or deletions. By gel electrophoresis combined with sequencing verification, 71.11% candidate InDel loci were reconfirmed orthologous and/or homoeologous loci polymorphisms using G. hirsutum acc TM-1 and G. barbadense cv Hai7124. Blastx result showed among 2,160 InDel loci, 81 with significant function similarity with known genes associated with secondary wall synthesis process, indicating the important roles in fiber quality in tetraploid cultivated cotton species. Sequence comparisons and InDel markers development will lay the groundwork for promoting the identification of genes related to superior agronomic traits

Characterization of Eleusine indica with gene mutation or amplification in EPSPS to glyphosate.

Science.gov (United States)

Chen, Jingchao; Jiang, Cuilan; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Huimin; Zhao, Dandan; Zhang, Chaoxian

2017-11-01

The evolution of weed-resistant species threatens the sustainable use of glyphosate, which is the most important herbicide widely used in agriculture worldwide. Moreover, the high glyphosate resistance (>180-fold based on LD 50 ) of Eleusine indica found in Malaysia, which carries a double mutation in its 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), made the control of this species more difficult. By contrast, the same species carrying the same double mutation in EPSPS (T102I+P106S) but found in China only shows a resistance level of not more than 14-fold based on GR 50 . The resistance level of this population is four times higher than that of the population carrying a single mutation (P106L). Although the members of this population survive under a high glyphosate dosage of 10,080gaeha -1 , their growth was significantly inhibited by glyphosate under the recommend dose (840gaeha -1 ), where in the fresh weight was 85.4% of the control. EPSPS expression, relative copy number, and EPSPS activity in this population were similar to those of the susceptible population. In addition, the expression of two glutathione transferase (GST) genes (GST-U8 and GST-23) and the enzyme activity of the GST in this population did not significantly differ from those of the susceptible population. This finding is important in elucidating the resistance of the naturally evolved glyphosate-resistant (GR) weed species carrying a double mutation in EPSPS to glyphosate. Copyright © 2017. Published by Elsevier Inc.

Steam explosion distinctively enhances biomass enzymatic saccharification of cotton stalks by largely reducing cellulose polymerization degree in G. barbadense and G. hirsutum.

Science.gov (United States)

Huang, Yu; Wei, Xiaoyang; Zhou, Shiguang; Liu, Mingyong; Tu, Yuanyuan; Li, Ao; Chen, Peng; Wang, Yanting; Zhang, Xuewen; Tai, Hongzhong; Peng, Liangcai; Xia, Tao

2015-04-01

In this study, steam explosion pretreatment was performed in cotton stalks, leading to 5-6 folds enhancements on biomass enzymatic saccharification distinctive in Gossypium barbadense and Gossypium hirsutum species. Sequential 1% H2SO4 pretreatment could further increase biomass digestibility of the steam-exploded stalks, and also cause the highest sugar-ethanol conversion rates probably by releasing less inhibitor to yeast fermentation. By comparison, extremely high concentration alkali (16% NaOH) pretreatment with raw stalks resulted in the highest hexoses yields, but it had the lowest sugar-ethanol conversion rates. Characterization of wall polymer features indicated that biomass saccharification was enhanced with steam explosion by largely reducing cellulose DP and extracting hemicelluloses. It also showed that cellulose crystallinity and arabinose substitution degree of xylans were the major factors on biomass digestibility in cotton stalks. Hence, this study has provided the insights into cell wall modification and biomass process technology in cotton stalks and beyond. Copyright © 2015 Elsevier Ltd. All rights reserved.

Non-destructive measurements of cottonseed nutritional trait diversity in the US National Cotton Germplasm Collection

Science.gov (United States)

Recent studies have suggested that cottonseed (Gossypium spp.) has the potential to contribute to the effort against world hunger, particularly by providing a high-quality protein source. This report analyzed the diversity in protein content and other seed quality factors in the U.S. National Cotton...

Interference between Redroot Pigweed (Amaranthus retroflexus L.) and Cotton (Gossypium hirsutum L.): Growth Analysis.

Science.gov (United States)

Ma, Xiaoyan; Wu, Hanwen; Jiang, Weili; Ma, Yajie; Ma, Yan

2015-01-01

Redroot pigweed is one of the injurious agricultural weeds on a worldwide basis. Understanding of its interference impact in crop field will provide useful information for weed control programs. The effects of redroot pigweed on cotton at densities of 0, 0.125, 0.25, 0.5, 1, 2, 4, and 8 plants m(-1) of row were evaluated in field experiments conducted in 2013 and 2014 at Institute of Cotton Research, CAAS in China. Redroot pigweed remained taller and thicker than cotton and heavily shaded cotton throughout the growing season. Both cotton height and stem diameter reduced with increasing redroot pigweed density. Moreover, the interference of redroot pigweed resulted in a delay in cotton maturity especially at the densities of 1 to 8 weed plants m(-1) of row, and cotton boll weight and seed numbers per boll were reduced. The relationship between redroot pigweed density and seed cotton yield was described by the hyperbolic decay regression model, which estimated that a density of 0.20-0.33 weed plant m(-1) of row would result in a 50% seed cotton yield loss from the maximum yield. Redroot pigweed seed production per plant or per square meter was indicated by logarithmic response. At a density of 1 plant m(-1) of cotton row, redroot pigweed produced about 626,000 seeds m(-2). Intraspecific competition resulted in density-dependent effects on weed biomass per plant, a range of 430-2,250 g dry weight by harvest. Redroot pigweed biomass ha(-1) tended to increase with increasing weed density as indicated by a logarithmic response. Fiber quality was not significantly influenced by weed density when analyzed over two years; however, the fiber length uniformity and micronaire were adversely affected at density of 1 weed plant m(-1) of row in 2014. The adverse impact of redroot pigweed on cotton growth and development identified in this study has indicated the need of effective redroot pigweed management.

Physiological response of wheat, maize and cotton to gamma irradiation

International Nuclear Information System (INIS)

Sharabash, M.T.M.; Gaweesh, S.S.M.; Orabi, I.O.A.; Hammad, A.H.A.

1988-01-01

Grains of wheat triticum aestivum vulgare cv. Giza 155, maize Zea mays cv. double hybrid strain 17 S and cotton seeds Gossypium barbadence cv. Giza 67 were irradiated with successive doses of gamma rays from 0 to 64 Krad. Irradiating wheat grains with 1 Krad, maize grains with 0.5 Krad and cotton seeds with 4 Krad stimulated their germination and enhanced the growth of seedlings and their chlorophyll content. Also, these doses activated Alpha- and Beta-Amylase in the seeds. Higher doses had suppression effects. Peroxidase value in the seedlings of the three species was accelerated progressively in concomitant with the increase in the dosage

Genetic diversity, virulence, and Meloidogyne incognita interactions of Fusarium oxysporum isolates causing cotton wilt in Georgia

Science.gov (United States)

Locally severe outbreaks of Fusarium wilt of cotton (Gossypium spp.) in South Georgia raised concerns about the genotypes of the causal pathogen, Fusarium oxysporum f. sp. vasinfectum. Vegetative complementation tests and DNA sequence analysis were used to determine genetic diversity among 492 F. ox...

Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

Science.gov (United States)

Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

2017-04-01

Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

Characterization of the damage of Spodoptera eridania (Cramer) and Spodoptera cosmioides (Walker) (Lepidoptera: Noctuidae) to structures of cotton plants

OpenAIRE

Santos, Karen B dos; Meneguim, Ana M; Santos, Walter J dos; Neves, Pedro M O J; Santos, Rachel B dos

2010-01-01

The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud;...

Isolation and characterization of gene sequences expressed in cotton fiber

Directory of Open Access Journals (Sweden)

Taciana de Carvalho Coutinho

2016-06-01

Full Text Available ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L. to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for the subsequent generation of a cDNA library. Seventeen sequences were obtained, of which 14 were already described in the NCBI database (National Centre for Biotechnology Information, such as those encoding the lipid transfer proteins (LTPs and arabinogalactans (AGP. However, other cDNAs such as the B05 clone, which displays homology with the glycosyltransferases, have still not been described for this crop. Nevertheless, results showed that several clones obtained in this study are associated with cell wall proteins, wall-modifying enzymes and lipid transfer proteins directly involved in fiber development.

Manejo de capim pé-de-galinha em lavouras de soja transgênica resistente ao glifosato Management of goose grass on transgenic soybean, resistant to glyphosate

Directory of Open Access Journals (Sweden)

André da Rosa Ulguim

2013-01-01

Full Text Available O objetivo deste trabalho foi avaliar a resistência de capim pé-de-galinha (Eleusine indica ao glifosato, em lavouras de soja transgênica; avaliar o efeito de aplicações de glifosato em diferentes estádios de desenvolvimento; identificar práticas agronômicas associadas à seleção de biótipos resistentes; e avaliar a eficiência dos herbicidas cletodim, fluazifope-P-butílico, clomazona, glufosinato de amônio e glifosato nas plantas resistentes. Plantas escapes ao tratamento com glifosato foram coletadas em 24 propriedades, no Rio Grande do Sul. As plantas foram cultivadas em casa de vegetação, tendo-se avaliado a sua resistência ao glifosato. Os acessos resistentes foram selecionados e avaliados quanto ao efeito da aplicação do glifosato em diferentes estádios de crescimento e quanto à sensibilidade aos herbicidas. Foi aplicado um questionário aos produtores para identificação das práticas agronômicas associadas às falhas no controle. O controle de E. indica pelo glifosato é mais efetivo com a aplicação em estádios iniciais de desenvolvimento. Práticas agronômicas, como uso contínuo de baixas doses do herbicida, aplicação em estádios de desenvolvimento avançados das plantas daninhas (mais de um afilho e a ausência de rotação de culturas foram relacionadas às falhas de controle observadas. Os herbicidas cletodim, fluazifope-P-butílico e glufosinato de amônio são alternativas eficientes para o controle de E. indica.The objective of this work was to evaluate the resistance of goose grass (Eleusine indica to glyphosate application in transgenic soybean crops; evaluate the effect of glyphosate applications in different growth stages; identify the main agronomic practices associated with the selection of resistant biotypes; and evaluate the effect of the herbicides clethodim, fluazifop-p-butyl, clomazone, glufosinate ammonium, and glyphosate on resistant plants. Plants that survived glyphosate application

Comparative genomic analysis of the PKS genes in five species and expression analysis in upland cotton

Directory of Open Access Journals (Sweden)

Xueqiang Su

2017-10-01

Full Text Available Plant type III polyketide synthase (PKS can catalyse the formation of a series of secondary metabolites with different structures and different biological functions; the enzyme plays an important role in plant growth, development and resistance to stress. At present, the PKS gene has been identified and studied in a variety of plants. Here, we identified 11 PKS genes from upland cotton (Gossypium hirsutum and compared them with 41 PKS genes in Populus tremula, Vitis vinifera, Malus domestica and Arabidopsis thaliana. According to the phylogenetic tree, a total of 52 PKS genes can be divided into four subfamilies (I–IV. The analysis of gene structures and conserved motifs revealed that most of the PKS genes were composed of two exons and one intron and there are two characteristic conserved domains (Chal_sti_synt_N and Chal_sti_synt_C of the PKS gene family. In our study of the five species, gene duplication was found in addition to Arabidopsis thaliana and we determined that purifying selection has been of great significance in maintaining the function of PKS gene family. From qRT-PCR analysis and a combination of the role of the accumulation of proanthocyanidins (PAs in brown cotton fibers, we concluded that five PKS genes are candidate genes involved in brown cotton fiber pigment synthesis. These results are important for the further study of brown cotton PKS genes. It not only reveals the relationship between PKS gene family and pigment in brown cotton, but also creates conditions for improving the quality of brown cotton fiber.

Water use, canopy temperature, lint yield, and fiber quality response of six upland cotton cultivars to water stress

Science.gov (United States)

The declining saturated thickness of the Ogallala Aquifer combined with the unpredictability of precipitation during the growing season in the Southern High Plains has resulted in elevated production risks associated with short-term crop water deficits. Cotton (Gossypium spp.) cultivars that can use...

Global gene expression in cotton (Gossypium hirsutum L. leaves to waterlogging stress.

Directory of Open Access Journals (Sweden)

Yanjun Zhang

Full Text Available Cotton is sensitive to waterlogging stress, which usually results in stunted growth and yield loss. To date, the molecular mechanisms underlying the responses to waterlogging in cotton remain elusive. Cotton was grown in a rain-shelter and subjected to 0 (control-, 10-, 15- and 20-d waterlogging at flowering stage. The fourth-leaves on the main-stem from the top were sampled and immediately frozen in liquid nitrogen for physiological measurement. Global gene transcription in the leaves of 15-d waterlogged plants was analyzed by RNA-Seq. Seven hundred and ninety four genes were up-regulated and 1018 genes were down-regulated in waterlogged cotton leaves compared with non-waterlogged control. The differentially expressed genes were mainly related to photosynthesis, nitrogen metabolism, starch and sucrose metabolism, glycolysis and plant hormone signal transduction. KEGG (Kyoto Encyclopedia of Genes and Genomes analysis indicated that most genes related to flavonoid biosynthesis, oxidative phosphorylation, amino acid metabolism and biosynthesis as well as circadian rhythm pathways were differently expressed. Waterlogging increased the expression of anaerobic fermentation related genes, such as alcohol dehydrogenase (ADH, but decreased the leaf chlorophyll concentration and photosynthesis by down-regulating the expression of photosynthesis related genes. Many genes related to plant hormones and transcription factors were differently expressed under waterlogging stress. Most of the ethylene related genes and ethylene-responsive factor-type transcription factors were up-regulated under water-logging stress, suggesting that ethylene may play key roles in the survival of cotton under waterlogging stress.

Stacked -gene hybrids were not found to be superior to glyphosate resistant or Non-GMO corn hybrids

Science.gov (United States)

Seed costs of modern corn hybrids genetically modified with multiple traits for insect and herbicide resistance “stacked-gene” are in excess of $100.00 US per acre. Yields and net returns per acre along with yield component data were determined for ten hybrids, four stacked-gene, four glyphosate re...

Meta-analysis of cotton fiber quality QTLs across diverse environments in a Gossypium hirsutum x G. barbadense RIL population.

Science.gov (United States)

Lacape, Jean-Marc; Llewellyn, Danny; Jacobs, John; Arioli, Tony; Becker, David; Calhoun, Steve; Al-Ghazi, Yves; Liu, Shiming; Palaï, Oumarou; Georges, Sophie; Giband, Marc; de Assunção, Henrique; Barroso, Paulo Augusto Vianna; Claverie, Michel; Gawryziak, Gérard; Jean, Janine; Vialle, Michèle; Viot, Christopher

2010-06-28

Cotton fibers (produced by Gossypium species) are the premier natural fibers for textile production. The two tetraploid species, G. barbadense (Gb) and G. hirsutum (Gh), differ significantly in their fiber properties, the former having much longer, finer and stronger fibers that are highly prized. A better understanding of the genetics and underlying biological causes of these differences will aid further improvement of cotton quality through breeding and biotechnology. We evaluated an inter-specific Gh x Gb recombinant inbred line (RIL) population for fiber characteristics in 11 independent experiments under field and glasshouse conditions. Sites were located on 4 continents and 5 countries and some locations were analyzed over multiple years. The RIL population displayed a large variability for all major fiber traits. QTL analyses were performed on a per-site basis by composite interval mapping. Among the 651 putative QTLs (LOD > 2), 167 had a LOD exceeding permutation based thresholds. Coincidence in QTL location across data sets was assessed for the fiber trait categories strength, elongation, length, length uniformity, fineness/maturity, and color. A meta-analysis of more than a thousand putative QTLs was conducted with MetaQTL software to integrate QTL data from the RIL and 3 backcross populations (from the same parents) and to compare them with the literature. Although the global level of congruence across experiments and populations was generally moderate, the QTL clustering was possible for 30 trait x chromosome combinations (5 traits in 19 different chromosomes) where an effective co-localization of unidirectional (similar sign of additivity) QTLs from at least 5 different data sets was observed. Most consistent meta-clusters were identified for fiber color on chromosomes c6, c8 and c25, fineness on c15, and fiber length on c3. Meta-analysis provided a reliable means of integrating phenotypic and genetic mapping data across multiple populations and

Pleiotropic effects of herbicide-resistance genes on crop yield: a review.

Science.gov (United States)

Darmency, Henri

2013-08-01

The rapid adoption of genetically engineered herbicide-resistant crop varieties (HRCVs)-encompassing 83% of all GM crops and nearly 8% of the worldwide arable area-is due to technical efficiency and higher returns. Other herbicide-resistant varieties obtained from genetic resources and mutagenesis have also been successfully released. Although the benefit for weed control is the main criteria for choosing HRCVs, the pleiotropic costs of genes endowing resistance have rarely been investigated in crops. Here the available data of comparisons between isogenic resistant and susceptible varieties are reviewed. Pleiotropic harmful effects on yield are reported in half of the cases, mostly with resistance mechanisms that originate from genetic resources and mutagenesis (atrazine in oilseed rape and millet, trifluralin in millet, imazamox in cotton) rather than genetic engineering (chlorsulfuron and glufosinate in some oilseed rape varieties, glyphosate in soybean). No effect was found for sethoxydim and bromoxynil resistance. Variable minor effects were found for imazamox, chlorsulfuron, glufosinate and glyphosate resistance. The importance of the breeding plan and the genetic background on the emergence of these effects is pointed out. Breeders' efforts to produce better varieties could compensate for the yield loss, which eliminates any possibility of formulating generic conclusions on pleiotropic effects that can be applied to all resistant crops. © 2013 Society of Chemical Industry.

Advanced Backcross QTL Analysis of Fiber Strength and Fineness in a Cross between Gossypium hirsutum and G. mustelinum

Directory of Open Access Journals (Sweden)

Baohua Wang

2017-10-01

Full Text Available The molecular genetic basis of cotton fiber strength and fineness in crosses between Gossypium mustelinum and Gossypium hirsutum (Upland cotton was dissected using 21 BC3F2 and 12 corresponding BC3F2:3 and BC3F2:4 families. The BC3F2 families were genotyped with simple sequence repeat markers from a G. hirsutum by G. mustelinum linkage map, and the three generations of BC3-derived families were phenotyped for fiber strength (STR and fineness (Micronaire, MIC. A total of 42 quantitative trait loci (QTLs were identified through one-way analysis of variance, including 15 QTLs for STR and 27 for MIC, with the percentage of variance explained by individual loci averaging 13.86 and 14.06%, respectively. Eighteen of the 42 QTLs were detected at least twice near the same markers in different generations/families or near linked markers in the same family, and 28 of the 42 QTLs were identified in both mixed model-based composite interval mapping and one-way variance analyses. Alleles from G. mustelinum increased STR for eight of 15 and reduced MIC for 15 of 27 QTLs. Significant among-family genotypic effects (P < 0.001 were detected in 13 and 10 loci for STR and MIC respectively, and five loci showed significant (P < 0.001 genotype × family interaction for MIC. These results support the hypothesis that fiber quality improvement for Upland cotton could be realized by introgressing G. mustelinum alleles although complexities due to the different effects of genetic background on introgressed chromatin might be faced. Building on prior work with G. barbadense, G. tomentosum, and G. darwinii, QTL mapping involving introgression of G. mustelinum alleles offers new allelic variation to Upland cotton germplasm.

Water quality of surface runoff and lint yield in cotton under furrow irrigation in Northeast Arkansas

Science.gov (United States)

Use of furrow irrigation in row crop production is a common practice through much of the Midsouth US and yet, nutrients can be transported off-site through surface runoff. A field study with cotton (Gossypium hirsutum, L.) was conducted to understand the impact of furrow tillage practices and nitrog...

ADAPTABILIDADE E ESTABILIDADE FENOTÍPICA DE CULTIVARES DE ALGODOEIRO NO ESTADO DO MATO GROSSO, BRASIL PHENOTYPIC ADAPTABILITY AND STABILITY OF COTTON CULTIVARS IN THE MATO GROSSO STATE, BRAZIL

Directory of Open Access Journals (Sweden)

Cristina Schetino Bastos

2007-09-01

Full Text Available

O objetivo deste trabalho foi o de avaliar a adaptabilidade e a estabilidade de cultivares de algodão (Gossypium hirsutum L., utilizando a metodologia proposta por Eberhart & Russell (1966. Para tanto, onze variedades de algodão foram avaliadas em sete locais do Estado do Mato Grosso, Brasil, em dois anos agrícolas (2002/2003 e 2003/2004. O delineamento experimental empregado foi o de blocos casualizados com quatro repetições e as características avaliadas foram a produtividade de algodão em caroço e a porcentagem de fibra. Com relação à produção de algodão em caroço, as cultivares BRS Aroeira, BRS Ipê, BRS Cedro, BRS Jatobá e Delta Opal demonstraram ampla adaptabilidade e estabilidade para as regiões produtoras do Estado. Entretanto, considerando a porcentagem de fibra, não foram encontradas cultivares de algodão com ampla adaptabilidade e estabilidade nos ambientes estudados.

PALAVRAS-CHAVE: Gossypium hirsutum; fibra; estabilidade.

The objective of this work was to evaluate the stability and adaptability of cotton (Gossypium hirsutum L. cultivars using the method of Eberhart & Russell (1966. Eleven varieties of cotton were tested at seven locations in Mato Grosso State, Brazil, in two growing seasons (2002/2003 and 2003/2004. The experimental design was the randomized complete blocks with four replications and the evaluated traits were lint percentage and seed cotton yield. For seed cotton yield, BRS Aroeira, BRS Ipê, BRS Cedro, BRS Jatobá and Delta Opal showed broad adaptability and stability in Mato Grosso State. However, for lint percentage there were not found cotton cultivars with both broad adaptability and stability for the studied environments.

76 FR 60448 - Syngenta Biotechnology, Inc.; Determination of Nonregulated Status for Lepidopteran-Resistant Cotton

Science.gov (United States)

2011-09-29

...] Syngenta Biotechnology, Inc.; Determination of Nonregulated Status for Lepidopteran-Resistant Cotton AGENCY... our determination that a cotton line developed by Syngenta Biotechnology, Inc., designated as event... submitted by Syngenta Biotechnology, Inc., in its petition for a determination of nonregulated status, our...

Field trials to evaluate effects of continuously planted transgenic insect-resistant cottons on soil invertebrates.

Science.gov (United States)

Li, Xiaogang; Liu, Biao; Wang, Xingxiang; Han, Zhengmin; Cui, Jinjie; Luo, Junyu

2012-03-01

Impacts on soil invertebrates are an important aspect of environmental risk assessment and post-release monitoring of transgenic insect-resistant plants. The purpose of this study was to research and survey the effects of transgenic insect-resistant cottons that had been planted over 10 years on the abundance and community structure of soil invertebrates under field conditions. During 3 consecutive years (2006-2008), eight common taxa (orders) of soil invertebrates belonging to the phylum Arthropoda were investigated in two different transgenic cotton fields and one non-transgenic cotton field (control). Each year, soil samples were taken at four different growth stages of cotton (seedling, budding, boll forming and boll opening). Animals were extracted from the samples using the improved Tullgren method, counted and determined to the order level. The diversity of the soil fauna communities in the different fields was compared using the Simpson's, Shannon's diversity indices and evenness index. The results showed a significant sampling time variation in the abundance of soil invertebrates monitored in the different fields. However, no difference in soil invertebrate abundance was found between the transgenic cotton fields and the control field. Both sampling time and cotton treatment had a significant effect on the Simpson's, Shannon's diversity indices and evenness index. They were higher in the transgenic fields than the control field at the growth stages of cotton. Long-term cultivation of transgenic insect-resistant cottons had no significant effect on the abundance of soil invertebrates. Collembola, Acarina and Araneae could act as the indicators of soil invertebrate in this region to monitor the environmental impacts of transgenic plants in the future. This journal is © The Royal Society of Chemistry 2012

Resistance to glufosinate is proportional to phosphinothricin acetyltransferase expression and activity in LibertyLink(®) and WideStrike(®) cotton.

Science.gov (United States)

Carbonari, Caio A; Latorre, Débora O; Gomes, Giovanna L G C; Velini, Edivaldo D; Owens, Daniel K; Pan, Zhiqiang; Dayan, Franck E

2016-04-01

Insertion of the gene encoding phosphinothricin acetyltransferase (PAT) has resulted in cotton plants resistant to the herbicide glufosinate. However, the lower expression and commensurate reduction in PAT activity is a key factor in the low level of injury observed in the WideStrike(®) cotton and relatively high level of resistance observed in LibertyLink(®) cotton. LibertyLink(®) cotton cultivars are engineered for glufosinate resistance by overexpressing the bar gene that encodes phosphinothricin acetyltransferase (PAT), whereas the insect-resistant WideStrike(®) cultivars were obtained using the similar pat gene as a selectable marker. The latter cultivars carry some level of resistance to glufosinate which enticed certain farmers to select this herbicide for weed control with WideStrike(®) cotton. The potency of glufosinate on conventional FM 993, insect-resistant FM 975WS, and glufosinate-resistant IMACD 6001LL cotton cultivars was evaluated and contrasted to the relative levels of PAT expression and activity. Conventional cotton was sensitive to glufosinate. The single copy of the pat gene present in the insect-resistant cultivar resulted in very low RNA expression of the gene and undetectable PAT activity in in vitro assays. Nonetheless, the presence of this gene provided a good level of resistance to glufosinate in terms of visual injury and effect on photosynthetic electron transport. The injury is proportional to the amount of ammonia accumulation. The strong promoter associated with bar expression in the glufosinate-resistant cultivar led to high RNA expression levels and PAT activity which protected this cultivar from glufosinate injury. While the insect-resistant cultivar demonstrated a good level of resistance to glufosinate, its safety margin is lower than that of the glufosinate-resistant cultivar. Therefore, farmers should be extremely careful in using glufosinate on cultivars not expressly designed and commercialized as resistant to this

Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield.

Science.gov (United States)

Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

2017-08-30

RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3 , a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA- HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing ds HaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera . Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls.

Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

Science.gov (United States)

Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

2018-01-01

A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

STUDY OF GENE FLOW FROM GM COTTON (Gossypium hirsutum VARIETIES IN “EL ESPINAL” (TOLIMA, COLOMBIA.

Directory of Open Access Journals (Sweden)

Alejandro Chaparro Giraldo

2013-09-01

Full Text Available In 2009, 4088 hectares of genetically modified (GM cotton were planted in Tolima (Colombia, however there is some uncertainty about containment measures needed to prevent the flow of pollen and seed from regulated GM fields into adjacent fields. In this study, the gene flow from GM cotton varieties to conventional or feral cotton plants via seed and pollen was evaluated. ImmunostripTM, PCR and ELISA assays were used to detect gene flow. Fifty six refuges, 27 fields with conventional cotton and four feral individuals of the enterprise “Remolinos Inc.” located in El Espinal (Tolima were analyzed in the first half of 2010. The results indicated seeds mediated gene flow in 45 refuges (80,4 % and 26 fields with conventional cotton (96 %, besides a pollen mediated gene flow in one field with conventional cotton and nine refuges. All fields cultivated with conventional cotton showed gene flow from GM cotton. Two refuges and two feral individuals did not reveal gene flow from GM cotton.

Construction of microsatellite-based linkage map and mapping of nectarilessness and hairiness genes in Gossypium tomentosum.

Science.gov (United States)

Hou, Meiying; Cai, Caiping; Zhang, Shuwen; Guo, Wangzhen; Zhang, Tianzhen; Zhou, Baoliang

2013-12-01

Gossypium tomentosum, a wild tetraploid cotton species with AD genomes, possesses genes conferring strong fibers and high heat tolerance. To effectively transfer these genes into Gossypium hirsutum, an entire microsatellite (simple sequence repeat, SSR)-based genetic map was constructed using the interspecific cross of G. hirsutum x G. tomentosum (HT). We detected 1800 loci from 1347 pairs of polymorphic primers. Of these, 1204 loci were grouped into 35 linkage groups at LOD ≥ 4. The map covers 3320.8 cM, with a mean density of 2.76 cM per locus. We detected 420 common loci (186 in the At subgenome and 234 in Dt) between the HT map and the map of TM-1 (G. hirsutum) and Hai 7124 (G. barbadense; HB map). The linkage groups were assigned chromosome numbers based on location of common loci and the HB map as reference. A comparison of common markers revealed that no significant chromosomal rearrangement exist between G. tomentosum and G. barbadense. Interestingly, however, we detected numerous (33.7%) segregation loci deviating from 3:1 ratio (P constructed in this study will be useful for further genetic studies on cotton breeding, including mapping loci controlling quantitative traits associated with fiber quality, stress tolerance and developing chromosome segment specific introgression lines from G. tomentosum into G. hirsutum using marker-assisted selection.

A comparison of soda and soda-AQ pulps from cotton stalks | Akgül ...

African Journals Online (AJOL)

In this study, cotton stalks (Gossypium hirsutum L.) were cooked using soda and soda-anthraquinone (AQ) process. Nine soda cooks were conducted by changing cooking conditions including active alkali charge and pulping time. Soda-AQ cooks were obtained by adding 0.075, 0.10, 0.15, 0.2% AQ (based on o.d stalks) to ...

Annual glyphosate treatments alter growth of unaffected bentgrass (Agrostis weeds and plant community composition.

Directory of Open Access Journals (Sweden)

Collin W Ahrens

Full Text Available Herbicide resistance is becoming more common in weed ecotypes and crop species including turfgrasses, but current gaps in knowledge limit predictive ecological risk assessments and risk management plans. This project examined the effect of annual glyphosate applications on the vegetative growth and reproductive potential of two weedy bentgrasses, creeping bentgrass (CB and redtop (RT, where the glyphosate resistance (GR trait was mimicked by covering the bentgrass plants during glyphosate application. Five field plots were studied in habitats commonly inhabited by weedy bentgrasses including an agricultural hayfield, natural meadow, and wasteland. Results showed that annual glyphosate treatment improved bentgrass survivorship, vegetative growth, and reproductive potential compared with bentgrass in unsprayed subplots. In the second year of growth, RT plants had an 86-fold increase in flower number in glyphosate-treated subplots versus controls, while CB plants had a 20-fold increase. At the end of the three year study, plant community composition had changed in glyphosate-treated subplots in hayfield and meadow plots compared to controls. Soils in subplots receiving glyphosate had higher nitrate concentrations than controls. This is the first study to mimic the GR trait in bentgrass plants with the goal of quantifying bentgrass response to glyphosate selection pressure and understanding the impacts on surrounding plant communities.

Glyphosate, a chelating agent-relevant for ecological risk assessment?

Science.gov (United States)

Mertens, Martha; Höss, Sebastian; Neumann, Günter; Afzal, Joshua; Reichenbecher, Wolfram

2018-02-01

Glyphosate-based herbicides (GBHs), consisting of glyphosate and formulants, are the most frequently applied herbicides worldwide. The declared active ingredient glyphosate does not only inhibit the EPSPS but is also a chelating agent that binds macro- and micronutrients, essential for many plant processes and pathogen resistance. GBH treatment may thus impede uptake and availability of macro- and micronutrients in plants. The present study investigated whether this characteristic of glyphosate could contribute to adverse effects of GBH application in the environment and to human health. According to the results, it has not been fully elucidated whether the chelating activity of glyphosate contributes to the toxic effects on plants and potentially on plant-microorganism interactions, e.g., nitrogen fixation of leguminous plants. It is also still open whether the chelating property of glyphosate is involved in the toxic effects on organisms other than plants, described in many papers. By changing the availability of essential as well as toxic metals that are bound to soil particles, the herbicide might also impact soil life, although the occurrence of natural chelators with considerably higher chelating potentials makes an additional impact of glyphosate for most metals less likely. Further research should elucidate the role of glyphosate (and GBH) as a chelator, in particular, as this is a non-specific property potentially affecting many organisms and processes. In the process of reevaluation of glyphosate its chelating activity has hardly been discussed.

Linkage and association mapping reveals the genetic basis of brown fibre (Gossypium hirsutum).

Science.gov (United States)

Wen, Tianwang; Wu, Mi; Shen, Chao; Gao, Bin; Zhu, De; Zhang, Xianlong; You, Chunyuan; Lin, Zhongxu

2018-02-24

Brown fibre cotton is an environmental-friendly resource that plays a key role in the textile industry. However, the fibre quality and yield of natural brown cotton are poor, and fundamental research on brown cotton is relatively scarce. To understand the genetic basis of brown fibre cotton, we constructed linkage and association populations to systematically examine brown fibre accessions. We fine-mapped the brown fibre region, Lc 1 , and dissected it into 2 loci, qBF-A07-1 and qBF-A07-2. The qBF-A07-1 locus mediates the initiation of brown fibre production, whereas the shade of the brown fibre is affected by the interaction between qBF-A07-1 and qBF-A07-2. Gh_A07G2341 and Gh_A07G0100 were identified as candidate genes for qBF-A07-1 and qBF-A07-2, respectively. Haploid analysis of the signals significantly associated with these two loci showed that most tetraploid modern brown cotton accessions exhibit the introgression signature of Gossypium barbadense. We identified 10 quantitative trait loci (QTLs) for fibre yield and 19 QTLs for fibre quality through a genome-wide association study (GWAS) and found that qBF-A07-2 negatively affects fibre yield and quality through an epistatic interaction with qBF-A07-1. This study sheds light on the genetics of fibre colour and lint-related traits in brown fibre cotton, which will guide the elite cultivars breeding of brown fibre cotton. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Lack of glyphosate resistance gene transfer from Roundup Ready soybean to Bradyrhizobium japonicum under field and laboratory conditions.

Science.gov (United States)

Isaza, Laura Arango; Opelt, Katja; Wagner, Tobias; Mattes, Elke; Bieber, Evi; Hatley, Elwood O; Roth, Greg; Sanjuán, Juan; Fischer, Hans-Martin; Sandermann, Heinrich; Hartmann, Anton; Ernst, Dieter

2011-01-01

A field study was conducted at the Russell E. Larson Agricultural Research Center to determine the effect of transgenic glyphosate-resistant soybean in combination with herbicide (Roundup) application on its endosymbiont Bradyrhizobium japonicum. DNA of bacteroids from isolated nodules was analysed for the presence of the transgenic 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) DNA sequence using polymerase chain reaction (PCR). To further assess the likelihood that the EPSPS gene may be transferred from the Roundup Ready (RR) soybean to B. japonicum, we have examined the natural transformation efficiency of B. japonicum strain 110spc4. Analyses of nodules showed the presence of the transgenic EPSPS DNA sequence. In bacteroids that were isolated from nodules of transgenic soybean plants and then cultivated in the presence of glyphosate this sequence could not be detected. This indicates that no stable horizontal gene transfer (HGT) of the EPSPS gene had occurred under field conditions. Under laboratory conditions, no natural transformation was detected in B. japonicum strain 110spc4 in the presence of various amounts of recombinant plasmid DNA. Our results indicate that no natural competence state exists in B. japonicum 110spc4. Results from field and laboratory studies indicate the lack of functional transfer of the CP4-EPSPS gene from glyphosate-tolerant soybean treated with glyphosate to root-associated B. japonicum.

Optimizing Organophosphorus Fire Resistant Finish for Cotton Fabric Using Box-Behnken Design

International Nuclear Information System (INIS)

Sohail, Y.; Parag, B.; Nemeshwaree, B.; Giorgio, R.

2016-01-01

N-methylol dimethyl phosphono propionamide (MDPA) is one of the most utilized fire resistant (FR) finishes for cotton fabrics, utilized as part of a formulation with trimethylol melamine (TMM) to acquire better crosslinking and enhanced FR properties. The system parameters of the finishing treatment were upgraded for better FR properties and low mechanical loss to the fabric by the response surface methodology utilizing Box-Behnken statistical designed experimental strategy. The impacts of concentration on the cotton fabric’s properties (fire resistance and mechanical properties) were assessed with the regression equations. The optimum conditions by predicting the FR reagents focusing intact mechanical properties of the fabric were additionally studied. It was found that the parameters of crosslinking agents in the FR formulation have a prime role in the general FR properties of the cotton fabrics. The R-squared estimations of the considerable number of responses were above 92%, demonstrating the level of relationship between the predicted values by the Box-Behnken frameworks and the real test results.

Relay cropping of wheat (Triticum aestivum L.) in cotton (Gossypium hirsutum L.) improves the profitability of cotton-wheat cropping system in Punjab, Pakistan.

Science.gov (United States)

Sajjad, Aamer; Anjum, Shakeel Ahmad; Ahmad, Riaz; Waraich, Ejaz Ahmad

2018-01-01

Delayed sowing of wheat (Triticum aestivum L.) in cotton-based system reduces the productivity and profitability of the cotton-wheat cropping system. In this scenario, relay cropping of wheat in standing cotton might be a viable option to ensure the timely wheat sowing with simultaneous improvement in wheat yields and system profitability. This 2-year study (2012-2013 and 2013-2014) aimed to evaluate the influence of sowing dates and relay cropping combined with different management techniques of cotton sticks on the wheat yield, soil physical properties, and the profitability of the cotton-wheat system. The experiment consisted of five treatments viz. (S1) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, (S2) sowing of wheat at the 7th of November by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator, (S3) sowing of wheat at the 7th of November as relay crop in standing cotton with broadcast method, (S4) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + one rotavator + two plankings) after the removal of cotton sticks, and (S5) sowing of wheat at the 15th of December by conventional tillage (two disc harrows + two plankings) after the incorporation of cotton sticks in the field with a rotavator. The highest seed cotton yield was observed in the S5 treatment which was statistically similar with the S3 and S4 treatments; seed cotton yield in the S1 and S2 treatments has been the lowest in both years of experimentation. However, the S2 treatment produced substantially higher root length, biological yield, and grain yield of wheat than the other treatments. The lower soil bulk density at 0-10-cm depth was recorded in the S2 treatment which was statistically similar with the S5 treatment during both years of experimentation. The volumetric water contents, net

Uses of glyphosate in German arable farming – operational aspects

Directory of Open Access Journals (Sweden)

Wiese, Armin

2016-02-01

Full Text Available Glyphosate is the most frequently used herbicide active ingredient in Germany. Studies regarding its usage in non-GMO arable farming are still rare even though it plays an important role in several agronomic situations. Therefore, we conducted a comprehensive survey, which was carried out among conventional German farms in Winter 2014/2015. Based on the results of this survey we analyzed via cluster analysis how types of farms differ in terms of glyphosate usage. An illustration of seven clusters allows deep insights into arable farm structures. The farm types can be distinguished regarding their tillage system and similar to this differentiation also concerning their intensity of glyphosate application. Furthermore, it becomes obvious that farm clusters with a higher level of glyphosate usage are characterized by a lower number of labourers per hectare, more arable land and/or enhanced cover cropping. Moreover, groups of farmers who rely more on glyphosate are more likely to state that they need glyphosate for herbicide resistance management. Farmers’ assessments of the economic importance of glyphosate usage vary depending on the type of farm. By means of the farm clusters, the most important situations of glyphosate usage can be further analyzed economically and scenarios for impact assessments can be made.

Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

Science.gov (United States)

Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

2016-06-15

Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

Global alteration of microRNAs and transposon-derived small RNAs in cotton (Gossypium hirsutum) during Cotton leafroll dwarf polerovirus (CLRDV) infection.

Science.gov (United States)

Romanel, Elisson; Silva, Tatiane F; Corrêa, Régis L; Farinelli, Laurent; Hawkins, Jennifer S; Schrago, Carlos E G; Vaslin, Maite F S

2012-11-01

Small RNAs (sRNAs) are a class of non-coding RNAs ranging from 20- to 40-nucleotides (nts) that are present in most eukaryotic organisms. In plants, sRNAs are involved in the regulation of development, the maintenance of genome stability and the antiviral response. Viruses, however, can interfere with and exploit the silencing-based regulatory networks, causing the deregulation of sRNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). To understand the impact of viral infection on the plant sRNA pathway, we deep sequenced the sRNAs in cotton leaves infected with Cotton leafroll dwarf virus (CLRDV), which is a member of the economically important virus family Luteoviridae. A total of 60 putative conserved cotton miRNAs were identified, including 19 new miRNA families that had not been previously described in cotton. Some of these miRNAs were clearly misregulated during viral infection, and their possible role in symptom development and disease progression is discussed. Furthermore, we found that the 24-nt heterochromatin-associated siRNAs were quantitatively and qualitatively altered in the infected plant, leading to the reactivation of at least one cotton transposable element. This is the first study to explore the global alterations of sRNAs in virus-infected cotton plants. Our results indicate that some CLRDV-induced symptoms may be correlated with the deregulation of miRNA and/or epigenetic networks.

Molecular Characterization and Germination Analysis of Cotton (Gossypium hirsutum L. Genotypes under Water Deficit Irrigation

Directory of Open Access Journals (Sweden)

Eminur ELÇİ

2016-09-01

Full Text Available Cotton is an important crop in terms of economic and strategic impacts. Drought stress is one of the most important environmental stress factors which negatively affects growth and yield of plants in Turkey as occurred in many countries in the world. In this study, 11 different cotton cultivars selected based on their agronomical characters were tested under water deficit irrigation strategies. Thus, it was aimed to select and/or determine appropriate new varieties for breeding new national materials resistant to drought stress, and to characterize with the molecular microsatellite markers. According to the different irrigation levels (25%, 50%, 75% and 100% plants were observed under the stressed conditions at the irrigation levels of 50% and 25%. Among the tested varieties, Tamcot Sphinx, Tamcot 94, Tamcot CamdEs and BA525 varieties were found to be more water stress tolerant than others in terms of germination time and germinated plant. The UPGMA (Unweighted Pair-Group Method Using Arithmetic Averages analysis was carried out using 28 markers with average 0.306 polymorphism information content (PIC for molecular characterization studies. Based on the UPGMA results, the varieties were clustered into two groups. It is expected that the results obtained from this study might provide considerable data for improving new drought tolerant varieties.

Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda.

Science.gov (United States)

Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng

2017-12-01

Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Changes in activities of both photosystems and the regulatory effect of cyclic electron flow in field-grown cotton (Gossypium hirsutum L) under water deficit.

Science.gov (United States)

Yi, Xiao-Ping; Zhang, Ya-Li; Yao, He-Sheng; Han, Ji-Mei; Chow, Wah Soon; Fan, Da-Yong; Zhang, Wang-Feng

2018-01-01

To clarify the influence of water deficit on the functionality of the photosynthetic apparatus of cotton plants, leaf gas exchange, chlorophyll a fluorescence, and P700 redox state were examined in field-grown cotton Gossypium hirsutum L. cv. Xinluzao 45. In addition, we measured changes in the P515 signal and analyzed the activity of ATP synthase and the trans-thylakoid proton gradient (ΔpH). With increasing water deficit, the net CO 2 assimilation rate (A N ) and stomatal conductance (g s ) significantly decreased, but the maximum quantum efficiency of PSII photochemistry (F v /F m ) did not change. The photochemical activity of photosystem II (PSII) was reflected by the photochemical quenching coefficient (qP), quantum efficiency of photosystem II [Y(II)], and electron transport rate through PSII [ETR(II)], while the activity of photosystem I (PSI) was reflected by the quantum efficiency of photosystem I [Y(I)] and the electron transport rate through PSI [ETR(I)]. Both activities were maintained under mild water deficit, but were slightly decreased under moderate water deficit. Under moderate water deficit, cyclic electron flow (CEF), the fraction of absorbed light dissipated thermally via the ΔpH- and xanthophyll-regulated process [Y(NPQ)], and the fraction of P700 oxidized under a given set of conditions [Y(ND)] increased. Our results suggest that the activities of both photosystems are stable under mild water deficit and decrease only slightly under moderate water deficit. Moderate water deficit stimulates CEF, and the stimulation of CEF is essential for protecting PSI and PSII against photoinhibition. Copyright © 2017 Elsevier GmbH. All rights reserved.

The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

Directory of Open Access Journals (Sweden)

Qian Yan

Full Text Available Basic/helix-loop-helix (bHLH proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum, a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062 showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus.

The effect of Saccharomyces cerevisiae on the stability of the herbicide glyphosate during bread leavening.

Science.gov (United States)

Low, F L; Shaw, I C; Gerrard, J A

2005-01-01

To investigate the ability of baker's yeast (Saccharomyces cerevisiae) to degrade the herbicide glyphosate during the fermentation cycle of the breadmaking process. Aqueous glyphosate was added to bread ingredients and kneaded by commercially available breadmaking equipment into dough cultures. Cultures were incubated in the breadmaker throughout the fermentation cycle. The recovery of glyphosate levels following fermentation was determined, thus allowing an estimation of glyphosate degradation by yeast. It was shown, for the first time, that S. cerevisiae plays a role in metabolizing glyphosate during the fermentation stages of breadmaking. Approximately 21% was degraded within 1 h. As a result of projected increases in the glyphosate use on wheat and the role of bread as a dietary staple, this may contribute to more informed decisions being made relating to the use of glyphosate on glyphosate-resistant wheat, from a public health/regulatory perspective.

Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

Science.gov (United States)

Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2013-01-01

Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

Meta-analysis of cotton fiber quality QTLs across diverse environments in a Gossypium hirsutum x G. barbadense RIL population

Directory of Open Access Journals (Sweden)

Giband Marc

2010-06-01

Full Text Available Abstract Background Cotton fibers (produced by Gossypium species are the premier natural fibers for textile production. The two tetraploid species, G. barbadense (Gb and G. hirsutum (Gh, differ significantly in their fiber properties, the former having much longer, finer and stronger fibers that are highly prized. A better understanding of the genetics and underlying biological causes of these differences will aid further improvement of cotton quality through breeding and biotechnology. We evaluated an inter-specific Gh × Gb recombinant inbred line (RIL population for fiber characteristics in 11 independent experiments under field and glasshouse conditions. Sites were located on 4 continents and 5 countries and some locations were analyzed over multiple years. Results The RIL population displayed a large variability for all major fiber traits. QTL analyses were performed on a per-site basis by composite interval mapping. Among the 651 putative QTLs (LOD > 2, 167 had a LOD exceeding permutation based thresholds. Coincidence in QTL location across data sets was assessed for the fiber trait categories strength, elongation, length, length uniformity, fineness/maturity, and color. A meta-analysis of more than a thousand putative QTLs was conducted with MetaQTL software to integrate QTL data from the RIL and 3 backcross populations (from the same parents and to compare them with the literature. Although the global level of congruence across experiments and populations was generally moderate, the QTL clustering was possible for 30 trait x chromosome combinations (5 traits in 19 different chromosomes where an effective co-localization of unidirectional (similar sign of additivity QTLs from at least 5 different data sets was observed. Most consistent meta-clusters were identified for fiber color on chromosomes c6, c8 and c25, fineness on c15, and fiber length on c3. Conclusions Meta-analysis provided a reliable means of integrating phenotypic and

Asymmetric Evolution and Expansion of the NAC Transcription Factor in Polyploidized Cotton

Directory of Open Access Journals (Sweden)

Kai Fan

2018-01-01

Full Text Available Polyploidy in Gossypium hirsutum conferred different properties from its diploid ancestors under the regulation of transcription factors. The NAC transcription factor is a plant-specific family that can be related to plant growth and development. So far, little is known about the NAC family in cotton. This study identified 495 NAC genes in three cotton species and investigated the evolution and expansion of different genome-derived NAC genes in cotton. We revealed 15 distinct NAC subfamilies in cotton. Different subfamilies had different gene proportions, expansion rate, gene loss rate, and orthologous exchange rate. Paleohexaploidization (35% and cotton-specific decaploidy (32% might have primarily led to the expansion of the NAC family in cotton. Half of duplication events in G. hirsutum were inherited from its diploid ancestor, and others might have occurred after interspecific hybridization. In addition, NAC genes in the At and Dt subgenomes displayed asymmetric molecular evolution, as evidenced by their different gene loss rates, orthologous exchange, evolutionary rates, and expression levels. The dominant duplication event was different during the cotton evolutionary history. Different genome-derived NACs might have interacted with each other, which ultimately resulted in morphogenetic evolution. This study delineated the expansion and evolutionary history of the NAC family in cotton and illustrated the different fates of NAC genes during polyploidization.

Comparison of herbicide regimes and the associated potential enviromental effects of glyphosate-resistant crops versus what they replace in Europe

NARCIS (Netherlands)

Kleter, G.A.; Harris, C.; Stephenson, G.R.; Unsworth, J.

2008-01-01

While cultivation of transgenic crops takes place in seven of the EU member states, this constitutes a relatively limited part of the total acreage planted to these crops worldwide. The only glyphosate-resistant (GR) crop grown commercially until recently has been soybean in Romania. In addition,

Fitness cost of resistance to Bt cotton linked with increased gossypol content in pink bollworm larvae.

Directory of Open Access Journals (Sweden)

Jennifer L Williams

Full Text Available Fitness costs of resistance to Bacillus thuringiensis (Bt crops occur in the absence of Bt toxins, when individuals with resistance alleles are less fit than individuals without resistance alleles. As costs of Bt resistance are common, refuges of non-Bt host plants can delay resistance not only by providing susceptible individuals to mate with resistant individuals, but also by selecting against resistance. Because costs typically vary across host plants, refuges with host plants that magnify costs or make them less recessive could enhance resistance management. Limited understanding of the physiological mechanisms causing fitness costs, however, hampers attempts to increase costs. In several major cotton pests including pink bollworm (Pectinophora gossypiella, resistance to Cry1Ac cotton is associated with mutations altering cadherin proteins that bind this toxin in susceptible larvae. Here we report that the concentration of gossypol, a cotton defensive chemical, was higher in pink bollworm larvae with cadherin resistance alleles than in larvae lacking such alleles. Adding gossypol to the larval diet decreased larval weight and survival, and increased the fitness cost affecting larval growth, but not survival. Across cadherin genotypes, the cost affecting larval growth increased as the gossypol concentration of larvae increased. These results suggest that increased accumulation of plant defensive chemicals may contribute to fitness costs associated with resistance to Bt toxins.

Reproduction of Meloidogyne incognita on Winter Cover Crops Used in Cotton Production.

Science.gov (United States)

Timper, Patricia; Davis, Richard F; Tillman, P Glynn

2006-03-01

Substantial reproduction of Meloidogyne incognita on winter cover crops may lead to damaging populations in a subsequent cotton (Gossypium hirsutum) crop. The amount of population increase during the winter depends on soil temperature and the host status of the cover crop. Our objectives were to quantify M. incognita race 3 reproduction on rye (Secale cereale) and several leguminous cover crops and to determine if these cover crops increase population densities of M. incognita and subsequent damage to cotton. The cover crops tested were 'Bigbee' berseem clover (Trifolium alexandrinum), 'Paradana' balansa clover (T. balansae), 'AU Sunrise' and 'Dixie' crimson clover (T. incarnatum), 'Cherokee' red clover (T. pratense), common and 'AU Early Cover' hairy vetch (Vicia villosa), 'Cahaba White' vetch (V. sativa), and 'Wrens Abruzzi' rye. In the greenhouse tests, egg production was greatest on berseem clover, Dixie crimson clover, AU Early Cover hairy vetch, and common hairy vetch; intermediate on Balansa clover and AU Sunrise crimson clover; and least on rye, Cahaba White vetch, and Cherokee red clover. In both 2002 and 2003 field tests, enough heat units were accumulated between 1 January and 20 May for the nematode to complete two generations. Both AU Early Cover and common hairy vetch led to greater root galling than fallow in the subsequent cotton crop; they also supported high reproduction of M. incognita in the greenhouse. Rye and Cahaba White vetch did not increase root galling on cotton and were relatively poor hosts for M. incognita. Only those legumes that increased populations of M. incognita reduced cotton yield. In the southern US, M. incognita can complete one to two generations on a susceptible winter cover crop, so cover crops that support high nematode reproduction may lead to damage and yield losses in the following cotton crop. Planting rye or Meloidogyne-resistant legumes as winter cover crops will lower the risk of increased nematode populations

INDUCING RESISTANCE IN COTTON AGAINST COLLETOTRICHUM GOSSYPII VAR. CEPHALOSPORIOIDES WITH ESSENTIAL OILS

Directory of Open Access Journals (Sweden)

B. T. Santos

2016-11-01

Full Text Available This study aimed to evaluate the potential of essential oils of rosemary (Rosmarinus officinalis, baccharis (Baccharis trimera, lemon grass (Cymbopogon citratus, basil (Ocimum basilicum and eucalyptus (Corymbia citriodora in inducing resistance in cotton plants against C. gossypii var. cephalosporioides. The inductive effect of the essential oils was evaluated in plants growing in pots in the environment, which were treated with 1% essential oil at 47 days of age. 24 hours after elicitor treatment the plants were inoculated with a suspension of 1.5 x 105 conidia mL-1 of C. gossypii var. cephalosporioides. Five evaluations were performed disease and calculated the area under the disease progress curve. All essential oils showed potential for inducing resistance against cotton C. gossypii var. cephalosporioides.

Glyphosate

NARCIS (Netherlands)

A. Arcuri (Alessandra)

2017-01-01

markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the

A novel 5-enolpyruvylshikimate-3-phosphate synthase from Rahnella aquatilis with significantly reduced glyphosate sensitivity.

Directory of Open Access Journals (Sweden)

Ri-He Peng

Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.

Recent advances in glyphosate biodegradation.

Science.gov (United States)

Zhan, Hui; Feng, Yanmei; Fan, Xinghui; Chen, Shaohua

2018-06-01

Glyphosate has emerged as the most widespread herbicide to control annual and perennial weeds. Massive use of glyphosate for decades has resulted in its ubiquitous presence in the environment, and poses a threat to humans and ecosystem. Different approaches such as adsorption, photocatalytic degradation, and microbial degradation have been studied to break down glyphosate in the environment. Among these, microbial degradation is the most effective and eco-friendly method. During its degradation, various microorganisms can use glyphosate as a sole source of phosphorus, carbon, and nitrogen. Major glyphosate degradation pathways and its metabolites have been frequently investigated, but the related enzymes and genes have been rarely studied. There are many reviews about the toxicity and fate of glyphosate and its major metabolite, aminomethylphosphonic acid. However, there is lack of reviews on biodegradation and bioremediation of glyphosate. The aims of this review are to summarize the microbial degradation of glyphosate and discuss the potential of glyphosate-degrading microorganisms to bioremediate glyphosate-contaminated environments. This review will provide an instructive direction to apply glyphosate-degrading microorganisms in the environment for bioremediation.

TRACTION RESISTANCE IN CHITOSAN TREATED COTTON

Directory of Open Access Journals (Sweden)

LOX Wouter

2015-05-01

Full Text Available Nowadays natural products interest has increased. However, when some products are included on textile fibers, they have no affinity and need some binders or other kind of auxiliaries to improve the yeld of the process, and some of them are not so natural as the product which are binding and consequently the “bio” definition is missed as some of them can be considered as highly pollutant. Chitosan is a common used bonding agent for cotton. It improves the antimicrobial and antifungal activity, improves wound healing and is a non-toxic bonding agent. The biopolymer used in this work is chitosan, which is a deacetylated derivative of chitin. These properties depend on the amount of deacetylation (DD and the Molecular weight (MW. Along with these improving properties, as it requires some acid pH to ve solved the treatment with chitosan can have some decreasing mechanical properties. The aim of that paper is to evaluate the change in breaking force of the treated samples and a change in elongation of those samples. It compared different amounts of concentration of chitosan with non treated cotton. The traction resistance test were performed on a dynamometer. The test was conducted according to the UNE EN ISO 13934-1 standard.

Using and development of multi adversity resistance system in cotton

Directory of Open Access Journals (Sweden)

Metin Durmuş ÇETİN

2014-12-01

Full Text Available The basic approach in plant breeding, make it possible to show the full genetic potential of plant. This methods also protect the health of plant growth over the period, by increasing resistance to diseases and pests is expected to provide. For this purpose, by Bird in 1963, with the name of multi adversity resistance has been initiated in cotton breeding and for many years as a result of the work carried out important varieties and germplasm have been developed. Nowadays, those using for varieties resistant to stress factors such as heat and drought are evaluated. And successful results are obtained.

Improving hybrid seed production in corn with glyphosate-mediated male sterility.

Science.gov (United States)

Feng, Paul C C; Qi, Youlin; Chiu, Tommy; Stoecker, Martin A; Schuster, Christopher L; Johnson, Scott C; Fonseca, Augustine E; Huang, Jintai

2014-02-01

Hybrid corn varieties exhibit benefits associated with heterosis and account for most of the corn acreage in the USA. Hybrid seed corn is produced by crossing a female parent which is male-sterile and therefore incapable of self-pollination with a male parent as the pollen donor. The majority of hybrid seed corn is produced by mechanical detasseling which involves physically removing the tassel, a process that is laborious and costly. Glyphosate-resistant corn was developed via expression of a glyphosate insensitive 5-enolpyruvyl-shikimate 3-phosphate synthase enzyme (CP4-EPSPS). Experimentation with molecular expression elements resulted in selective reduction of CP4-EPSPS expression in male reproductive tissues. The resulting plant demonstrated sterile tassel following glyphosate application with little to no injury to the rest of the plant. Using (14)C-glyphosate as a marker, we also examined the translocation of glyphosate to the tassel via spray application in a track sprayer to simulate field application. The results allowed optimization of spray parameters such as dose, spray timing and target to maximize tassel delivery of glyphosate for efficient sterilization. The Roundup hybridization system (RHS) is a novel process for hybrid seed production based on glyphosate-mediated male sterility. RHS replaces mechanical detasseling with glyphosate spray and greatly simplifies the process of hybrid seed corn production. © 2013 Society of Chemical Industry.

Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton.

Science.gov (United States)

Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping

2016-07-20

Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. Copyright © 2016 Elsevier B.V. All rights reserved.

Interação de glyphosate com carfentrazone-ethyl Glyphosate - carfentrazone-ethyl interaction

Directory of Open Access Journals (Sweden)

R.C. Werlang

2002-04-01

Full Text Available Foi conduzido um experimento em condições controladas para determinar a interação do carfentrazone-ethyl em mistura no tanque com o herbicida glyphosate, no controle de seis espécies de plantas daninhas. Glyphosate aplicado isoladamente na dose de 720 g ha-1 foi eficaz no controle de Amaranthus hybridus (100%, Desmodium tortuosum (100%, Bidens pilosa (99%, Eleusine indica (96%, Digitaria horizontalis (100% e Commelina benghalensis (93% aos 21 DAA. Carfentrazone-ethyl aplicado isoladamente controlou eficazmente C. benghalensis. As misturas de glyphosate nas doses de 252 e 720 g ha-1 com carfentrazone-ethyl nas doses de 15 e 30 g ha¹ demonstraram efeito aditivo no controle de A. hybridus, D. tortuosum e Bidens pilosa, à exceção das misturas de glyphosate na dose de 252 g ha-1 com as doses de 15 e 30 g ha-1 de carfentrazone-ethyl, que proporcionam efeito sinergístico no controle de D. tortuosum. A adição das duas doses de carfentrazone-ethyl antagonizou o efeito de glyphosate na menor dose (252 g ha-1 no controle de E. indica, apresentando, no entanto, efeito aditivo com o glyphosate na maior dose (720 g ha-1. Já para D. horizontalis, as misturas de carfentrazone-ethyl com glyphosate na menor dose (252 g ha-1 apresentaram efeito sinergístico no controle dessa espécie, demonstrando, ainda, efeito aditivo na mistura com glyphosate na dose de 720 g ha-1. A mistura de carfentrazone-ethyl com glyphosate proporcionou efeito aditivo no controle de C. benghalensis, independentemente das combinações de doses avaliadas. Os resultados deste experimento indicam que carfentrazone-ethyl apresenta comportamento diferenciado quanto à interação com glyphosate, dependendo da espécie de planta daninha e da dose dos herbicidas utilizados na mistura em tanque, sendo complementar na mistura em tanque com glyphosate, pois demonstrou efeito antagônico em poucas das combinações estudadas, prevalecendo seu efeito aditivo na mistura com glyphosate, no

Sorption and desorption of glyphosate in Mollisols and Ultisols soils of Argentina.

Science.gov (United States)

Gómez Ortiz, Ana Maria; Okada, Elena; Bedmar, Francisco; Costa, José Luis

2017-10-01

In Argentina, glyphosate use has increased exponentially in recent years as a result of the widespread adoption of no-till management combined with genetically modified glyphosate-resistant crops. This massive use of glyphosate has created concern about its potential environmental impact. Sorption-desorption of glyphosate was studied in 3 Argentinean soils with contrasting characteristics. Glyphosate sorption isotherms were modeled using the Freundlich equation to estimate the sorption coefficient (K f ). Glyphosate sorption was high, and the K f varied from 115.6 to 1612 mg 1-1/n L 1/n /kg. Cerro Azul soil had the highest glyphosate sorption capacity as a result of a combination of factors such as higher clay content, cation exchange capacity, total iron, and aluminum oxides, and lower available phosphorus and pH. Desorption isotherms were also modeled using the Freundlich equation. In general, desorption was very low (glyphosate strongly sorbs to the soils and that it is almost an irreversible process. Anguil soil had a significantly higher desorption coefficient (K fd ) than the other soils, associated with its lower clay content and higher pH and phosphorus. Glyphosate high sorption and low desorption to the studied soils may prevent groundwater contamination. However, it may also affect its bioavailability, increasing its persistence and favoring its accumulation in the environment. The results of the present study contribute to the knowledge and characterization of glyphosate retention in different soils. Environ Toxicol Chem 2017;36:2587-2592. © 2017 SETAC. © 2017 SETAC.

Comprehensive cytological characterization of the Gossypium hirsutum genome based on the development of a set of chromosome cytological markers

Institute of Scientific and Technical Information of China (English)

Wenbo; Shan; Yanqin; Jiang; Jinlei; Han; Kai; Wang

2016-01-01

Cotton is the world’s most important natural fiber crop. It is also a model system for studying polyploidization, genomic organization, and genome-size variation. Integrating the cytological characterization of cotton with its genetic map will be essential for understanding its genome structure and evolution, as well as for performing further genetic-map based mapping and cloning. In this study, we isolated a complete set of bacterial artificial chromosome clones anchored to each of the 52 chromosome arms of the tetraploid cotton Gossypium hirsutum. Combining these with telomere and centromere markers, we constructed a standard karyotype for the G. hirsutum inbred line TM-1. We dissected the chromosome arm localizations of the 45 S and 5S r DNA and suggest a centromere repositioning event in the homoeologous chromosomes AT09 and DT09. By integrating a systematic karyotype analysis with the genetic linkage map, we observed different genome sizes and chromosomal structures between the subgenomes of the tetraploid cotton and those of its diploid ancestors. Using evidence of conserved coding sequences, we suggest that the different evolutionary paths of non-coding retrotransposons account for most of the variation in size between the subgenomes of tetraploid cotton and its diploid ancestors. These results provide insights into the cotton genome and will facilitate further genome studies in G. hirsutum.

Comprehensive cytological characterization of the Gossypium hirsutum genome based on the development of a set of chromosome cytological markers

Directory of Open Access Journals (Sweden)

Wenbo Shan

2016-08-01

Full Text Available Cotton is the world's most important natural fiber crop. It is also a model system for studying polyploidization, genomic organization, and genome-size variation. Integrating the cytological characterization of cotton with its genetic map will be essential for understanding its genome structure and evolution, as well as for performing further genetic-map based mapping and cloning. In this study, we isolated a complete set of bacterial artificial chromosome clones anchored to each of the 52 chromosome arms of the tetraploid cotton Gossypium hirsutum. Combining these with telomere and centromere markers, we constructed a standard karyotype for the G. hirsutum inbred line TM-1. We dissected the chromosome arm localizations of the 45S and 5S rDNA and suggest a centromere repositioning event in the homoeologous chromosomes AT09 and DT09. By integrating a systematic karyotype analysis with the genetic linkage map, we observed different genome sizes and chromosomal structures between the subgenomes of the tetraploid cotton and those of its diploid ancestors. Using evidence of conserved coding sequences, we suggest that the different evolutionary paths of non-coding retrotransposons account for most of the variation in size between the subgenomes of tetraploid cotton and its diploid ancestors. These results provide insights into the cotton genome and will facilitate further genome studies in G. hirsutum.

Interactions of glyphosate use with farm characteristics and cropping patterns in Central Europe.

Science.gov (United States)

Wiese, Armin; Schulte, Michael; Theuvsen, Ludwig; Steinmann, Horst-Henning

2018-05-01

Although glyphosate is the most widely used herbicide in the European Union, little is known about the patterns of its usage in arable farming. Therefore, a nationwide survey of 2026 German farmers was analysed to obtain further knowledge about glyphosate applications in conventional European arable farming. Given its broad range of agri-environmental and farm-type conditions, Germany can be regarded as a suitable study region to represent Central European farming. The growing season 2013/2014 was set as a reference. Farmers who participated in the survey employ diverse patterns of glyphosate use. While 23% stated that they did not use glyphosate in the season in question, others applied glyphosate to their total arable area. However, most applications occurred on specific parts of the farm. Application patterns of oilseed rape, winter wheat, maize and sugar beet were studied in detail, and U-shaped distributions of glyphosate use intensity were observed. The effects of farm type and management practices on glyphosate use patterns were mixed in the various crops. Motivation for glyphosate use differs widely within the farming community. Agricultural researchers, extension services and policy makers are recommended to mitigate vulnerabilities associated with glyphosate use, such as routine spraying and practices that increase selection pressure for the evolution of glyphosate-resistant weeds. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Density and Seasonal Dynamics of Bemisia tabaci (Gennadius) Mediterranean on Common Crops and Weeds around Cotton Fields in Northern China

DEFF Research Database (Denmark)

Zhang, Xiao-ming; Yang, Nian-wan; Wan, Fang-hao

2014-01-01

theophrasti Medicus), sunflower (Helianthus annuus L.), sweet potato (Ipomoea batatas L.), soybean (Glycine max L.), and maize (Zea mays L.). The whitefly species identity was repeatedly tested and confirmed; seasonal dynamics on the various host plants was standardized by the quartile method. B. tabaci MED......The density seasonal dynamics of Bemisia tabaci MED were evaluated over two-years in a cotton-growing area in Langfang, Hebei Province, northern China on cotton (Gossypium hirsutum L.) and six other, co-occurring common plants: common ragweed (Ambrosia artemisiifolia L.), piemarker (Abutilon...

On glyphosate

Directory of Open Access Journals (Sweden)

Tamas Komives

2016-11-01

Full Text Available This Editorial briefly discusses the current issues surrounding glyphosate - the most controversial pesticide active ingredient of our time. The paper pays special attention to the effects of glyphosate on plant-pathogen interactions.

Trends in pesticide use on soybean, corn and cotton since the introduction of major genetically modified crops in the United States

Science.gov (United States)

Coupe, Richard H.; Capel, Paul D.

2016-01-01

BACKGROUNDGenetically modified (GM) varieties of soybean, corn and cotton have largely replaced conventional varieties in the United States. The most widely used applications of GM technology have been the development of crops that are resistant to a specific broad-spectrum herbicide (primarily glyphosate) or that produce insecticidal compounds within the plant itself. With the widespread adoption of GM crops, a decline in the use of conventional pesticides was expected.RESULTSThere has been a reduction in the annual herbicide application rate to corn since the advent of GM crops, but the herbicide application rate is mostly unchanged for cotton. Herbicide use on soybean has increased. There has been a substantial reduction in the amount of insecticides used on both corn and cotton since the introduction of GM crops.CONCLUSIONSThe observed changes in pesticide use are likely to be the result of many factors, including the introduction of GM crops, regulatory restrictions on some conventional pesticides, introduction of new pesticide technologies and changes in farming practices. In order to help protect human and environmental health and to help agriculture plan for the future, more detailed and complete documentation on pesticide use is needed on a frequent and ongoing basis.

GhNAC18, a novel cotton (Gossypium hirsutum L.) NAC gene, is ...

African Journals Online (AJOL)

EVANS

especially inhibition of leaf senescence and plant stress responses in cotton. This study provides .... For exogenous application of hormone treatments, leaves of uniformly ...... with incompatible interactions between chili pepper and pathogens.

Goss’s wilt incidence in sweet corn is independent of transgenic traits and glyphosate

Science.gov (United States)

Recently claims have been made that the use of glyphosate and transgenic crop traits increases the risk of plant diseases. Transgenic traits used widely for years in dent corn are now available in commercial sweet corn cultivars, specifically, the combination of glyphosate resistance (GR) and Lepid...

Genetic and epigenetic status of triple exotic consanguinity cotton introgression lines.

Science.gov (United States)

He, S P; Sun, J L; Du, X M

2011-10-03

Introgression lines are some of the most important germplasm for breeding applications and other research conducted on cotton crops. The DNA methylation level among 10 introgression lines of cotton (Gossypium hirsutum) and three exotic parental species (G. arboreum, G. thurberi and G. barbadense) were assessed by methylation-sensitive amplified polymorphism (MSAP) technology. The methylation level in the introgression lines ranged from 33.3 to 51.5%. However, the lines PD0111 and PD0113 had the lowest methylation level (34.6 and 33.3%, respectively) due to demethylation of most non-coding sequences. Amplified fragment length polymorphism (AFLP) was used to evaluate the genetic polymorphism in the cotton introgression lines. A high degree of polymorphism was observed in all introgression lines (mean 47.2%) based on AFLP and MSAP analyses. This confirmed the effects of genetic improvement on cotton introgression lines. The low methylation varieties, PD0111 and PD0113 (introgression lines), clustered outside of the introgression lines based on MSAP data, which was incongruent with an AFLP-based dendrogram. This phenomenon could be caused by environmental changes or introgression of exotic DNA fragments.

The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.

Directory of Open Access Journals (Sweden)

Peng Wan

Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.

Functional Characterization of a Dihydroflavanol 4-Reductase from the Fiber of Upland Cotton (Gossypium hirsutum

Directory of Open Access Journals (Sweden)

Le Wang

2016-01-01

Full Text Available Dihydroflavanol 4-reductase (DFR is a key later enzyme involved in two polyphenols’ (anthocyanins and proanthocyanidins (PAs biosynthesis, however it is not characterized in cotton yet. In present reports, a DFR cDNA homolog (designated as GhDFR1 was cloned from developing fibers of upland cotton. Silencing GhDFR1 in cotton by virus-induced gene silencing led to significant decrease in accumulation of anthocyanins and PAs. More interestingly, based on LC-MS analysis, two PA monomers, (–-epicatachin and (–-epigallocatachin, remarkably decreased in content in fibers of GhDFR1-silenced plants, but two new monomers, (–-catachin and (–-gallocatachin were present compared to the control plants infected with empty vector. The ectopic expression of GhDFR1 in an Arabidopsis TT3 mutant allowed for reconstruction of PAs biosynthesis pathway and led to accumulation of PAs in seed coat. Taken together, these data demonstrate that GhDFR1 contributes to the biosynthesis of anthocyanins and PAs in cotton.

Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

Science.gov (United States)

This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

Bermudagrass (Cynodon spp) dose-response relationships with clethodim, glufosinate and glyphosate.

Science.gov (United States)

Webster, Theodore M; Hanna, Wayne W; Mullinix, Benjamin G

2004-12-01

Greenhouse studies were conducted to evaluate the sensitivity of three commercial cultivars, eight experimental cultivars and common bermudagrass to clethodim, glufosinate and glyphosate. Each herbicide was applied at eight doses. Data were regressed on herbicide dose using a log-logistic curve (R2 = 0.56-0.95 for clethodim, R2 = 0.60-0.94 for glufosinate, and R2 = 0.70-0.96 for glyphosate). The herbicide rate that elicited a 50% plant response (I50) in the bermudagrass cultivars ranged from 0.04 to 0.19 kg ha(-1) clethodim, 0.19 to 1.33 kg ha(-1) glufosinate and 0.34 to 1.14 kg ha(-1) glyphosate. Relative to other cultivars, common bermudagrass was intermediate in its response to clethodim and among the most tolerant cultivars to glufosinate and glyphosate. TifSport was relatively tolerant to clethodim and glufosinate compared with other cultivars, but relatively sensitive to glyphosate. One cultivar, 94-437, was consistently among the most sensitive cultivars to each of the herbicides. While there were differential herbicide tolerances among the tested bermudagrass cultivars, there did not appear to be any naturally occurring herbicide resistance that could be commercially utilized. However, research indicated that breeding efforts should target herbicide resistance that is at least four times the registered use rate. Also, TifSport and Tifway have been identified as suitable representatives of triploid hybrid bermudagrass cultivars to be used to evaluate the success of turfgrass renovation programs. 2004 Society of Chemical Industry.

ptxD gene in combination with phosphite serves as a highly effective selection system to generate transgenic cotton (Gossypium hirsutum L.).

Science.gov (United States)

Pandeya, Devendra; Campbell, LeAnne M; Nunes, Eugenia; Lopez-Arredondo, Damar L; Janga, Madhusudhana R; Herrera-Estrella, Luis; Rathore, Keerti S

2017-12-01

This report demonstrates the usefulness of ptxD/phosphite as a selection system that not only provides a highly efficient and simple means to generate transgenic cotton plants, but also helps address many of the concerns related to the use of antibiotic and herbicide resistance genes in the production of transgenic crops. Two of the most popular dominant selectable marker systems for plant transformation are based on either antibiotic or herbicide resistance genes. Due to concerns regarding their safety and in order to stack multiple traits in a single plant, there is a need for alternative selectable marker genes. The ptxD gene, derived from Pseudomonas stutzeri WM88, that confers to cells the ability to convert phosphite (Phi) into orthophosphate (Pi) offers an alternative selectable marker gene as demonstrated for tobacco and maize. Here, we show that the ptxD gene in combination with a protocol based on selection medium containing Phi, as the sole source of phosphorus (P), can serve as an effective and efficient system to select for transformed cells and generate transgenic cotton plants. Fluorescence microscopy examination of the cultures under selection and molecular analyses on the regenerated plants demonstrate the efficacy of the system in recovering cotton transformants following Agrobacterium-mediated transformation. Under the ptxD/Phi selection, an average of 3.43 transgenic events per 100 infected explants were recovered as opposed to only 0.41% recovery when bar/phosphinothricin (PPT) selection was used. The event recovery rates for nptII/kanamycin and hpt/hygromycin systems were 2.88 and 2.47%, respectively. Molecular analysis on regenerated events showed a selection efficiency of ~ 97% under the ptxD/Phi system. Thus, ptxD/Phi has proven to be a very efficient, positive selection system for the generation of transgenic cotton plants with equal or higher transformation efficiencies compared to the commonly used, negative selection systems.

Limited uptake, translocation and enhanced metabolic degradation contribute to glyphosate tolerance in Mucuna pruriens var. utilis plants.

Science.gov (United States)

Rojano-Delgado, Antonia María; Cruz-Hipolito, Hugo; De Prado, Rafael; Luque de Castro, María Dolores; Franco, Antonio Rodríguez

2012-01-01

Velvet bean (Mucuna pruriens, Fabaceae) plants exhibits an innate, very high resistance (i.e., tolerance) to glyphosate similar to that of plants which have acquired resistance to this herbicide as a trait. We analyzed the uptake of [(14)C]-glyphosate by leaves and its translocation to meristematic tissues, and used scanning electron micrographs to further analyze the cuticle and 3D capillary electrophoresis to investigate a putative metabolism capable of degrading the herbicide. Velvet bean exhibited limited uptake of glyphosate and impaired translocation of the compound to meristematic tissues. Also, for the first time in a higher plant, two concurrent pathways capable of degrading glyphosate to AMPA, Pi, glyoxylate, sarcosine and formaldehyde as end products were identified. Based on the results, the innate tolerance of velvet bean to glyphosate is possibly a result of the combined action of the previous three traits, namely: limited uptake, impaired translocation and enhanced degradation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Ten alien chromosome additions of Gossypium hirsutum-Gossypium bickii developed by integrative uses of GISH and species-specific SSR markers.

Science.gov (United States)

Tang, Dong; Feng, Shouli; Li, Sai; Chen, Yu; Zhou, Baoliang

2018-03-27

Gossypium bickii: (2n = 26, G 1 G 1 ), a wild diploid cotton, carries many favourable traits. However, these favourable traits cannot be directly transferred into G. hirsutum (2n = 52, AADD) cultivars due to the differences in genomes. Monosomic alien addition lines (MAALs) are considered an invaluable tool for the introgression of genes of interest from wild relatives into cultivated crops. In this study, the G. hirsutum-G. bickii amphidiploid (2n = 78, AADDG 1 G 1 ) was backcrossed with G. hirsutum to develop alien additions containing individual G. bickii chromosomes in a G. hirsutum background. Genomic in situ hybridization was employed to detect the number of alien chromosomes added to the backcross progenies. A total of 183 G. bickii-specific DNA markers were developed to discriminate the identities of the G. bickii chromosomes added to G. hirsutum and assess the alien chromosome transmissibility. Chromosomes 4G b and 13G b showed the highest transmissibility, while chromosomes 1G b , 7G b and 11G b showed the lowest. Ten of the 13 possible G. hirsutum-G. bickii MAALs were isolated and characterized, which will lay the foundation for transferring resistance genes of G. bickii into G. hirsutum, as well as for gene assignment, physical mapping, and selective isolation and mapping of cDNAs for particular G. bickii chromosomes. The strategies of how to use MAALs to develop varieties with the trait of interest from wild species (such as glanded plant-glandless seed) were proposed and discussed.

[Genetic improvement of cotton varieties in Huang-Huai region in China since 1950's. III. Improvement on agronomy properties, disease resistance and stability].

Science.gov (United States)

Jiang, B G; Kong, F L; Zhang, Q Y; Yang, F X; Jiang, R Q

2000-01-01

Data from a set of 5-location and 2-year experiments on 10 representative historical cotton varieties and the data of Huang-Huai Regional Cotton Trials from 1973 to 1996 were analyzed to estimate the effects of genetic improvement in agronomy properties, disease resistance and stability of cotton in Huang-Huai Region in China. The results indicated that a great genetic progress of earliness and disease resistance had been achieved by breeding programs since 1950's. The maturity was shortened 3-5 days; The rate of preforst yield was increased about 7 percentages. The problem of resistance to Fususium wilt has been solved and the resistance to Verticillum wilt was improving. Some progress in stability of cotton varieties also has been achieved by breeding programs since 1950.

The complete mitochondrial genome of Gossypium hirsutum and evolutionary analysis of higher plant mitochondrial genomes.

Science.gov (United States)

Liu, Guozheng; Cao, Dandan; Li, Shuangshuang; Su, Aiguo; Geng, Jianing; Grover, Corrinne E; Hu, Songnian; Hua, Jinping

2013-01-01

Mitochondria are the main manufacturers of cellular ATP in eukaryotes. The plant mitochondrial genome contains large number of foreign DNA and repeated sequences undergone frequently intramolecular recombination. Upland Cotton (Gossypium hirsutum L.) is one of the main natural fiber crops and also an important oil-producing plant in the world. Sequencing of the cotton mitochondrial (mt) genome could be helpful for the evolution research of plant mt genomes. We utilized 454 technology for sequencing and combined with Fosmid library of the Gossypium hirsutum mt genome screening and positive clones sequencing and conducted a series of evolutionary analysis on Cycas taitungensis and 24 angiosperms mt genomes. After data assembling and contigs joining, the complete mitochondrial genome sequence of G. hirsutum was obtained. The completed G.hirsutum mt genome is 621,884 bp in length, and contained 68 genes, including 35 protein genes, four rRNA genes and 29 tRNA genes. Five gene clusters are found conserved in all plant mt genomes; one and four clusters are specifically conserved in monocots and dicots, respectively. Homologous sequences are distributed along the plant mt genomes and species closely related share the most homologous sequences. For species that have both mt and chloroplast genome sequences available, we checked the location of cp-like migration and found several fragments closely linked with mitochondrial genes. The G. hirsutum mt genome possesses most of the common characters of higher plant mt genomes. The existence of syntenic gene clusters, as well as the conservation of some intergenic sequences and genic content among the plant mt genomes suggest that evolution of mt genomes is consistent with plant taxonomy but independent among different species.

Effects of glyphosate and endosulfan on soil microorganisms in soybean crop Efeitos do endosulfan e glyphosate sobre microrganismos do solo na cultura da soja

Directory of Open Access Journals (Sweden)

J.L. Pereira

2008-01-01

Full Text Available Transgenic soybean, resistant to glyphosate, is the most dominant transgenic crop grown commercially in the world. Research works on herbicide and insecticide mixtures and their effects on microorganisms are rarely reported. This work aimed to study the impact of glyphosate, endosulfan and their mixtures on the microbial soil activity in soybean crop. The experiment was carried out in a complete randomized block design with four treatments and five replications. The treatments were glyphosate 480 SL [540 g of active ingredient (a.i. ha-1], endosulfan 350 EC (525 g a.i. ha-1, the glyphosate 480 SL [540 g of active ingredient (a.i. ha-1] mixed with endosulfan 350 EC (525 g a.i. ha-1 and the control. Microbial activity was evaluated five days after treatment application. Glyphosate application was not an impacting factor for soil CO2 production. Endosulfan application (alone or mixed with glyphosate suppressed CO2 production by microorganisms in the soil. Microbial biomass and microbial quotient were lower in the treatments using endosulfan alone and in those using endosulfan mixed with glyphosate than in the treatments using glyphosate alone and control.A soja resistente ao glyphosate é a cultura transgênica mais cultivada em todo o mundo. Pesquisas envolvendo o impacto de mistura de herbicidas e inseticidas e seus efeitos sobre microrganismos do solo são raramente reportadas. Este trabalho teve por objetivo avaliar o impacto do herbicida (glyphosate, do inseticida (endosulfan e da mistura de ambos sobre a atividade microbiana do solo na cultura da soja. O delineamento experimental foi em blocos casualizados, com quatro tratamentos e cinco repetições. Os tratamentos foram o herbicida glyphosate 480 SL [540 g de ingrediente ativo (i.a. ha-1], endosulfan 350 EC (525 g i.a. ha-1, a mistura de glyphosate 480 SL (540 g de i.a. ha-1 com endosulfan 350 EC (525 g i.a. ha-1 e a testemunha onde se aplicou água. A atividade microbiana foi avaliada aos

Suppressing Resistance to Bt Cotton with Sterile Insect Releases

Energy Technology Data Exchange (ETDEWEB)

Tabashnik, B E [Department of Entomology, University of Arizona, Tucson, AZ (United States); Sisterson, M S [USDA-ARS, San Joaquin Valley Agricultural Sciences Center, Parlier, CA (United States); Ellsworth, P C [Department of Entomology, University of Arizona, Maricopa Agricultural Center, Maricopa, AZ (United States)

2011-01-15

Genetically engineered crops that produce insecticidal toxins from Bacillus thuringiensis (Bt) are grown widely for pest control. However, insect adaptation can reduce the toxins' efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to provide susceptible insects to mate with resistant insects. Variable farmer compliance is one of the limitations of this approach. Here we report the benefits of an alternative strategy where sterile insects are released to mate with resistant insects and refuges are scarce or absent. Computer simulations show that this approach works in principle against pests with recessive or dominant inheritance of resistance. During a largescale, four-year field deployment of this strategy in Arizona, resistance of pink bollworm (Pectinophora gossypiella) to Bt cotton did not increase. A multitactic eradication program that included the release of sterile moths reduced pink bollworm abundance by >99%, while eliminating insecticide sprays against this key invasive pest. (author)

Influence of mutagens on enzymes of germinating seeds of cotton (Gossypium hirsutum L.)

International Nuclear Information System (INIS)

Muthusamy, A.; Jayabalan, N.; Juliana, B.

2000-01-01

The activities of the enzymes amylases, protease and phosphatases were studied in cotton during germination. The seeds were treated with 100-500 Gy of gamma rays, 10-50 mM of EMS, CA and SA in two cultivated varieties viz.. MCU 5 and MCU 11. Activity pattern of amylases, protease and phosphatases in treated seeds were significantly altered from controls. The alteration were positively correlated with increasing dose/concentration of mutagens up to 300 Gy of gamma rays and 30 mM of EMS, CA and SA. The present study pave the ways to discuss the importance of the enzymes and mutagens in germination of cotton seeds. (author)

Airborne remote sensing assessment of the damage to cotton caused by spray drift from aerially applied glyphosate through spray deposition measurements

Science.gov (United States)

Off-target drift of aerially applied glyphosate can cause plant injury, which is of great concern to farmers and aerial applicators. To determine the extent of crop injury due to near-field drift, an experiment was conducted with a single aerial application of glyphosate. For identification of the d...

Glyphosate Dissipation in Different Soils Under No-Till and Conventional Till

Science.gov (United States)

Okada, Elena; Costa, Jose Luis; Francisco, Bedmar

2017-04-01

Glyphosate is the most used herbicide in Argentina, accounting for 62% of the commercialized pesticides in the market. It is used as a weed controller in chemical fallow under no-till systems, and it is also applied in various genetically modified crops (e.g. soybean, corn, cotton). Though it has a high solubility in water, it tends to adsorb and accumulate in agricultural soils. The description of glyphosate biodegradation in soils with a long term history under agricultural practices is of interest. The main objectives of this work were to compare the dissipation of glyphosate and the accumulation of its metabolite aminomethylphosphonic acid (AMPA) over time in three soils from Argentina. The studied soils belong to areas of high agronomic land use and different edaphoclimatic conditions, situated in Manfredi (MAN), Pergamino (PER) and Paraná (PAR). Soil samples were taken from long-term field trials with a history of more than 16 years under no-till and conventional tillage management. To study glyphosate dissipation in soil under controlled laboratory conditions, 400 g of dry soil sample were placed in 1.5 L flasks. A dose corresponding to 6 L ha-1 of commercial glyphosate ATANOR II® (35.6 % a.i.) was applied on day 0. The dose applied was equivalent to a final concentration in soil of 4000 μg Kg-1 of active ingredient. The moisture of the soil samples was kept at 60 % of the field capacity. Samples were incubated in the dark at a constant temperature of 22°C ± 1°C. A sub-sample of 5 g was taken from each flask at day 0 (after application), 1, 3, 7, 15, 20, 28, 44 and 62. Glyphosate and AMPA in soil samples was extracted with a strong basic solution (100 mM Na2B4O7•10H2O/ 100 mM K3PO4, pH=9) and then derivitazed with FMOC-Cl. Detection and quantification of the compounds was performed by ultra-performance liquid chromatography coupled with a mass spectrometer (UPLC MS/MS). The results showed that forty percent of the applied glyphosate was degraded

Seed protein electrophoresis for identification of fine fibre cotton line in Gossypium hirsutum L

International Nuclear Information System (INIS)

Gao Guoqiang; Lv Tiexin; Su Xuehe; Liu Xiaoyong; Wu Defang; Zhu Doubei

2003-01-01

Gel electrophoresis was conducted to test seed ethanol resolvable protein in cotton. 13 lines were used, including a fine fibre cotton line (98301) in G. hirsutum L., 4 varieties in G. barbadense L. and 8 varieties in G. hirsutum L.. In results of the 98301 line, Zhongmiansuo 12 and Shiyuan 321, no different protein electro-phoresis band pattern was shown among different seeds belong to the same variety, respectively. In comparison among the 98301 seeds sampled from seven different growth sets in Shandong province, their protein band patterns were the same. On the gel plate, three special bands were distinctive to all the varieties in G. hirsutum L. and other three special bands were distinctive to all the varieties in G. barbadense L.. The three characteristic bands of G. hirsutum L. appeared in the protein band pattern of the 98301 line. It showed that the seed protein composition of the line was inclined to G. hirsutum L. mainly. And, a characteristic band of G. Barbadense L. in the band pattern of the 98301 line proved that the fine fibre cotton line derived from a hybrid between G. barbadense and G. hirsutum L.. The 98301 line was easily distinguished from other varieties in G. hirsutum L. by its distinctive band, i.e. band No.1, and another island cotton band, i.e. band No.10

Detoxifying enzyme studies on cotton leafhopper, Amrasca biguttula biguttula (Ishida, resistance to neonicotinoid insecticides in field populations in Karnataka, India

Directory of Open Access Journals (Sweden)

Halappa Banakar

2016-12-01

Full Text Available The cotton leafhopper (Amrasca biguttula biguttula Ishida is considered to be an alarming insect pest causing both quantitative and qualitative loss in cotton. In situ bioassay studies were done and the role of detoxifying enzymes in conferring resistance to neonicotinoid groups of insecticides in low (MUD, medium (DVG, high (HVR and very high (GLB pesticide usage areas of Karnataka were determined. Bioassay studies showed that imidacloprid, thiamethoxam, acetamiprid, thiacloprid and clothianidin registered varying levels of resistance for all the locations studied. The resistance ratio was high in imidacloprid (3.35, 8.57, 9.15 and 12.27 fold respectively and the lowest in dinoferuran (1.86, 5.13, 6.71 and 9.88 fold respectively. Furthermore, the enzyme activity ratio (glutathione-S-transferase was relatively greater, and corresponded to the higher LC50 values of neonicotinoids for very high, high, medium and low pesticide usage areas. Our study suggested that the higher activity of the detoxifying enzyme in the resistance population of cotton leafhopper apparently has a significant role in endowing resistance to neonicotinoid groups of insecticides. However, this study recommends using neonicotinoids in cotton growing areas with caution.

Case Study: Trap Crop with Pheromone Traps for Suppressing Euschistus servus (Heteroptera: Pentatomidae in Cotton

Directory of Open Access Journals (Sweden)

P. G. Tillman

2012-01-01

Full Text Available The brown stink bug, Euschistus servus (Say, can disperse from source habitats, including corn, Zea mays L., and peanut, Arachis hypogaea L., into cotton, Gossypium hirsutum L. Therefore, a 2-year on-farm experiment was conducted to determine the effectiveness of a sorghum (Sorghum bicolor (L. Moench spp. bicolor trap crop, with or without Euschistus spp. pheromone traps, to suppress dispersal of this pest to cotton. In 2004, density of E. servus was lower in cotton fields with sorghum trap crops (with or without pheromone traps compared to control cotton fields. Similarly, in 2006, density of E. servus was lower in cotton fields with sorghum trap crops and pheromone traps compared to control cotton fields. Thus, the combination of the sorghum trap crop and pheromone traps effectively suppressed dispersal of E. servus into cotton. Inclusion of pheromone traps with trap crops potentially offers additional benefits, including: (1 reducing the density of E. servus adults in a trap crop, especially females, to possibly decrease the local population over time and reduce the overwintering population, (2 reducing dispersal of E. servus adults from the trap crop into cotton, and (3 potentially attracting more dispersing E. servus adults into a trap crop during a period of time when preferred food is not prevalent in the landscape.

Confirmation and quantification of strigolactones, germination stimulants for root parasitic plants Striga and Orobanche, produced by cotton.

Science.gov (United States)

Sato, Daisuke; Awad, Ayman A; Takeuchi, Yasutomo; Yoneyama, Koichi

2005-01-01

The germination stimulants for root parasitic plants Striga and Orobanche produced by cotton (Gossypium hirsutum L.) were examined in detail. Seeds of cotton were germinated and grown on glass wool wetted with sterile distilled water in sterile filter units. The root exudate was collected daily and extracted with ethyl acetate. Each of these ethyl acetate extracts was analyzed directly by high-performance liquid chromatography linked with tandem mass spectrometry (LC/MS/MS). The results demonstrate that cotton roots exuded strigol and strigyl acetate, but no other known strigolactones such as orobanchol and alectrol. The production of strigol was detected even in the root exudate collected during the first 24 h of incubation and reached a maximum 5-7 days later. The average exudation of strigol and strigyl acetate during the incubation period was ca. 15 and 2 pg/plant/day, respectively, indicating that strigol mainly contributed to germination stimulation by the cotton root exudate.

Effects of nematicides on cotton root mycobiota.

Science.gov (United States)

Baird, R E; Carling, D E; Watson, C E; Scruggs, M L; Hightower, P

2004-02-01

Baseline information on the diversity and population densities of fungi collected from soil debris and cotton (Gossypium hirsutum L.) roots was determined. Samples were collected from Tifton, GA, and Starkville, MS containing cotton field soil treated with the nematicides 1,3-dichloroproprene (fumigant) and aldicarb (granules). A total of 10,550 and 13,450 fungal isolates were collected from these two study sites, respectively. Of this total, 34 genera of plant pathogenic or saprophytic species were identified. Pathogenic root fungi included Fusarium spp. (40% of all isolations), Macrophomina, Pythium, Rhizoctonia, and Sclerotium. Fusarium and Rhizoctonia were the most common fungal species identified and included F. oxysporum, F. verticillioides and F. solani, the three Fusarium species pathogenic on cotton plants. Population densities of Fusarium were not significantly different among locations or tissue types sampled. Macrophomina was isolated at greater numbers near the end of the growing seasons. Anastomosis groups of R. solani isolated from roots and soil debris included AG-3, -4, -7, 2-2, and -13 and anastomosis groups of binucleate Rhizoctonia included CAG-2, -3, and -5. Occurrences and frequency of isolations among sampling dates were not consistent. Fluctuations in the frequency of isolation of Rhizoctonia did not correspond with changes in frequency of isolation of the biological control fungus, Trichoderma. When individual or pooled frequencies of the mycobiota were compared to nematicide treatments, no specific trends occurred between treatments, application methods or rates. Results from this study show that use of 1,3-D and aldicarb in cotton fields does not significantly impact plant pathogenic fungi or saprophytic fungal populations. Thus cotton producers need not adjust seedling disease control measures when these two nematicides are used.

Variation in water-use efficiency and its relation to carbon isotope ratio in cotton

International Nuclear Information System (INIS)

Saranga, Y.; Flash, I.; Yakir, D.

1998-01-01

Cotton (Gossypium spp.) is often exposed to drought, which adversely affects both yield and quality. Improved water-use efficiency (WUE = total dry matter produced or yield harvested / water used) is expected to reduce these adverse effects. Genetic variability in WUE and its association with photosynthetic rate and carbon isotope ratio (13C/12C) in cotton are reported in this paper. WUE of six cotton cultivars--G. hirsutum L., G. barbadense L., and an interspecific F1 hybrid (G. hirsutum x G. barbadense, ISH), was examined under two irrigation regimes in two field trials. The greatest WUE was obtained by two G. hirsutum cultivars (2.55 g dry matter or 1.12 g seed-cotton L-1 H2O) the ISH obtained similar or somewhat lower values, and that G. barbadense cultivars and one G. hirsutum cultivar exhibited the lowest values (2.1 g dry matter or 0.8 to 0.85 g seed-cotton L-1 H2O). These results indicate that different cotton cultivars may have evolved different environmental adaptations that affect their WUE. Photosynthetic rate was correlated with WUE in only a few cases emphasizing the limitation of this parameter as a basis for estimating crop WUE. Under both trials WUE was positively correlated with carbon isotope ratio, indicating the potential of this technique as a selection criterion for improving cotton WUE

Glyphosate toxicity and carcinogenicity: a review of the scientific basis of the European Union assessment and its differences with IARC

OpenAIRE

Tarazona, Jose V.; Court-Marques, Daniele; Tiramani, Manuela; Reich, Hermine; Pfeil, Rudolf; Istace, Frederique; Crivellente, Federica

2017-01-01

Glyphosate is the most widely used herbicide worldwide. It is a broad spectrum herbicide and its agricultural uses increased considerably after the development of glyphosate-resistant genetically modified (GM) varieties. Since glyphosate was introduced in 1974, all regulatory assessments have established that glyphosate has low hazard potential to mammals, however, the International Agency for Research on Cancer (IARC) concluded in March 2015 that it is probably carcinogenic. The IARC conclus...

Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

OpenAIRE

Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

2015-01-01

Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

Carbohydrate production and transport in cotton cultivars grown under boron deficiency

Directory of Open Access Journals (Sweden)

Julio Cesar Bogiani

2013-12-01

Full Text Available An adequate supply of boron (B is required for the optimal growth and development of cotton (Gossypium hirsutum L. plants, but the low phloem mobility of B limits the possibilities of correcting B deficiency. There are indications that different cotton cultivars could have different responses to B deficiency. The differences in responses of cotton cultivars to B regarding photoassimilate production and transport were studied in a greenhouse experiment with nutrient solution. Treatments consisted of three cotton cultivars (FMT 701, DP 604BG and FMX 993 and five concentrations of B (0.0, 2.5, 5.0, 10.0 and 20.0 µmol L−1. Sampling began at the phenological stage B1 (first square and continued for four weeks. The leaf area and the number of reproductive branches and structures decreased due to B deficiency. A higher level of abortion of reproductive structures was observed under B deficiency. Boron deficiency increased the internal CO2 concentration but decreased the transpiration rate, stomatal conductance and photosynthesis. Despite the decrease in photosynthesis, nonstructural carbohydrates accumulated in the leaves due to decreased export to bolls in B-deficient plants. The response to B deficiency is similar among cotton cultivars, which shows that the variability for this trait is low even for cultivars with different genetic backgrounds.

Effective dominance of resistance of Spodoptera frugiperda to Bt maize and cotton varieties: implications for resistance management

Science.gov (United States)

Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. De A. E.; Omoto, Celso

2016-10-01

The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants.

Effects of ionizing radiation on the hypocotyl-root axis of three species of gossypium

International Nuclear Information System (INIS)

Reed, J.P.

1977-01-01

The hypocotyl-root axis of cotton seedlings grown from irradiated and non-irradiated seeds was investigated using light microscopy and histological techniques. Special emphasis was placed on the pattern of vascular transition. Two patterns of vascular transition in non-irradiated seedlings were found. In Gossypium hirsutum and G. barbadense there are prominent metaxylem bands between the vascular bundles in the hypocotyl. In G. gossypioides there are no bands. The presence or absence of the bands was easily detected using polarized light. The most outstanding effects of radiation were inhibition of lateral root development and alteration of the pattern of vascular transition in seedlings grown from irradiated seeds. The findings suggest that the root apical meristem determines the vascular pattern

Flavonoid biosynthesis controls fiber color in naturally colored cotton

Directory of Open Access Journals (Sweden)

Hai-Feng Liu

2018-04-01

Full Text Available The existence of only natural brown and green cotton fibers (BCF and GCF, respectively, as well as poor fiber quality, limits the use of naturally colored cotton (Gossypium hirsutum L.. A better understanding of fiber pigment regulation is needed to surmount these obstacles. In this work, transcriptome analysis and quantitative reverse transcription PCR revealed that 13 and 9 phenylpropanoid (metabolic pathway genes were enriched during pigment synthesis, while the differential expression of phenylpropanoid (metabolic and flavonoid metabolic pathway genes occurred among BCF, GCF, and white cotton fibers (WCF. Silencing the chalcone flavanone isomerase gene in a BCF line resulted in three fiber phenotypes among offspring of the RNAi lines: BCF, almost WCF, and GCF. The lines with almost WCF suppressed chalcone flavanone isomerase, while the lines with GCF highly expressed the glucosyl transferase (3GT gene. Overexpression of the Gh3GT or Arabidopsis thaliana 3GT gene in BCF lines resulted in GCF. Additionally, the phenylpropanoid and flavonoid metabolites of BCF and GCF were significantly higher than those of WCF as assessed by a metabolomics analysis. Thus, the flavonoid biosynthetic pathway controls both brown and green pigmentation processes. Like natural colored fibers, the transgenic colored fibers were weaker and shorter than WCF. This study shows the potential of flavonoid pathway modifications to alter cotton fibers’ color and quality.

Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

Directory of Open Access Journals (Sweden)

Jie Chen

2014-03-01

Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

SSR-based association mapping of salt tolerance in cotton (Gossypium hirsutum L.).

Science.gov (United States)

Zhao, Y L; Wang, H M; Shao, B X; Chen, W; Guo, Z J; Gong, H Y; Sang, X H; Wang, J J; Ye, W W

2016-05-25

The identification of simple sequence repeat (SSR) markers associated with salt tolerance in cotton contributes to molecular assisted selection (MAS), which can improve the efficiency of traditional breeding. In this study, 134 samples of upland cotton cultivars were selected. The seedling emergence rates were tested under 0.3% NaCl stress. A total of 74 SSR markers were used to scan the genomes of these samples. To identify SSR markers associated with salt tolerance, an association analysis was performed between salt tolerance and SSR markers using TASSEL 2.1, based on the analysis of genetic structure using Structure 2.3.4. The results showed that the seedling emergence rates of 134 cultivars were significantly different, and 27 salt-sensitive and 10 salt-tolerant cultivars were identified. A total of 148 loci were found in 74 SSR markers involving 246 allelic variations, which ranged from 2 to 7 with an average of 3.32 per SSR marker. The gene diversity ranged from 0.0295 to 0.4959, with the average being 0.2897. The polymorphic information content ranged from0.0290 to 0.3729, with the average being 0.2381. This natural population was classified into two subgroups by Structure 2.3.4, containing 89 and 45 samples, respectively. Finally, eight SSR sites associated with salt tolerance ware found through an association analysis, with the rate of explanation ranging from 2.91 to 7.82% and an average of 4.32%. These results provide reference data for the use MAS for salt tolerance in cotton.

Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

Directory of Open Access Journals (Sweden)

Min Lin

Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

Science.gov (United States)

Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

2015-01-01

COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

Is it time to reassess current safety standards for glyphosate-based herbicides?

Science.gov (United States)

Vandenberg, Laura N; Blumberg, Bruce; Antoniou, Michael N; Benbrook, Charles M; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vom Saal, Frederick S; Welshons, Wade V; Myers, John Peterson

2017-06-01

Use of glyphosate-based herbicides (GBHs) increased ∼100-fold from 1974 to 2014. Additional increases are expected due to widespread emergence of glyphosate-resistant weeds, increased application of GBHs, and preharvest uses of GBHs as desiccants. Current safety assessments rely heavily on studies conducted over 30 years ago. We have considered information on GBH use, exposures, mechanisms of action, toxicity and epidemiology. Human exposures to glyphosate are rising, and a number of in vitro and in vivo studies challenge the basis for the current safety assessment of glyphosate and GBHs. We conclude that current safety standards for GBHs are outdated and may fail to protect public health or the environment. To improve safety standards, the following are urgently needed: (1) human biomonitoring for glyphosate and its metabolites; (2) prioritisation of glyphosate and GBHs for hazard assessments, including toxicological studies that use state-of-the-art approaches; (3) epidemiological studies, especially of occupationally exposed agricultural workers, pregnant women and their children and (4) evaluations of GBHs in commercially used formulations, recognising that herbicide mixtures likely have effects that are not predicted by studying glyphosate alone. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Evaluation of Brevibacillus brevis as a potential plant growth promoting rhizobacteria for cotton (Gossypium hirsutum) crop.

Science.gov (United States)

Nehra, Vibha; Saharan, Baljeet Singh; Choudhary, Madhu

2016-01-01

The present investigation was undertaken to isolate, screen and evaluate a selected promising PGPR Brevibacillus brevis on cotton crop. Out of 156 bacterial isolates one of the most promising isolate was analyzed for the various PGP traits. A seed germination analysis was conducted with cotton seeds to evaluate the potential of the isolate to promote plant growth. The bacterial isolate was checked for its growth and survival at high temperatures. The isolate was also analyzed for the PGP traits exhibited after the heat treatment. To identify the isolate morphological, biochemical and molecular characterization was performed. The isolate was found positive for many of the PGP attributes like IAA, ARA, anti-fungal activity and ammonia production. Effect of seed bacterization on various plant growth parameters was used as an indicator. The isolate showed significant growth and exhibited various PGP traits at high temperature making it suitable as an inoculant for cotton crop. Isolate was identified as Brevibacillus brevis [SVC(II)14] based on phenotypic as well as genotypic attributes and after conducting this research we propose that the B. brevis which is reported for the first time for its PGP potential in cotton, exerts its beneficial effects on cotton crop through combined modes of actions.

[Characterization of the damage of Spodoptera eridania (Cramer) and Spodoptera cosmioides (Walker) (Lepidoptera: Noctuidae) to structures of cotton plants].

Science.gov (United States)

Santos, Karen B Dos; Meneguim, Ana M; Santos, Walter J Dos; Neves, Pedro M O J; Santos, Rachel B Dos

2010-01-01

The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud; leaf and boll; flower bud or boll; and leaf, flower bud and boll. The survival of S. cosmioides and S. eridania was greater than 80% and 70% for larvae fed on cotton plant parts offered separately or together, respectively. One larva of S. eridania damaged 1.7 flower buds, but did not damage bolls, while one larva of S. cosmioides damaged 5.2 flower buds and 3.0 cotton bolls. Spodoptera eridania and S. cosmioides can be considered species with potential to cause economic damage to cotton plants because they can occur throughout cotton developmental stages causing defoliation and losses of reproductive structures. Therefore, the results validate field observations that these two species of Spodoptera are potential pests for cotton.

Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

Directory of Open Access Journals (Sweden)

Bingfu eGuo

2015-10-01

Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

Non Target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis

Directory of Open Access Journals (Sweden)

Pablo Tomas Fernandez-Moreno

2016-08-01

Full Text Available Sterile wild oat (Avena sterilis L. is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage before the beginning of summer period (due to the possibility of intense drought stress. In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha-1 for exposed (E and un-exposed (UE glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of 14C- glyphosate absorption was the same in the two accessions (E and UE, while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica and Lolium rigidum.

Non-target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis.

Science.gov (United States)

Fernández-Moreno, Pablo T; Alcantara-de la Cruz, Ricardo; Cruz-Hipólito, Hugo E; Rojano-Delgado, Antonia M; Travlos, Ilias; De Prado, Rafael

2016-01-01

Sterile wild oat (Avena sterilis L.) is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage) before the beginning of summer period (due to the possibility of intense drought stress). In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha(-1) for exposed (E) and un-exposed (UE) glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of (14)C- glyphosate absorption was the same in the two accessions (E and UE), while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA) and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica, and Lolium rigidum.

Combining ability estimates for earliness in cotton leaf curl virus resistant inbred parents

International Nuclear Information System (INIS)

Baloch, M.J.; Baloch, Q.B.

2005-01-01

Four female cotton leaf curl virus-resistant resistant (cclv) parents consisting of advance strains and commercial varieties (VH-137, FH-901, CRIS-467 and Cyto-51) and four male parents, all clcv resistant Punjab varieties (FH-945, CIM-707, CIM-473 and FH-1000) were mated in a cross classification Design-II fashion. The results show that genetic variances due to additive genes were higher than the dominant variances, yet both types of variances were substantial, implying that significant improvement could reliably be made from segregating populations. The general combining ability (gca) estimates by and large suggested that for improvement in the appearance of first white flower and 1st sympodial branch node number, parents FH-945 and VH-137 whereas for 1st effective boll setting, parents FH-1000 and FH-901 and for percent of open bolls at 120 days after planting, parents CIM-707 and CRIS-467 may be given preference. However, for hybrid cotton development regarding earliness, hybrids CRIS-467 x CIM-707, VH-137 x FH-945 and Cyto-51 x FH-1000 may be chosen. (author)

Formulants of glyphosate-based herbicides have more deleterious impact than glyphosate on TM4 Sertoli cells.

Science.gov (United States)

Vanlaeys, Alison; Dubuisson, Florine; Seralini, Gilles-Eric; Travert, Carine

2018-05-15

Roundup and Glyphogan are glyphosate-based herbicides containing the same concentration of glyphosate and confidential formulants. Formulants are declared as inert diluents but some are more toxic than glyphosate, such as the family of polyethoxylated alkylamines (POEA). We tested glyphosate alone, glyphosate-based herbicide formulations and POEA on the immature mouse Sertoli cell line (TM4), at concentrations ranging from environmental to agricultural-use levels. Our results show that formulations of glyphosate-based herbicides induce TM4 mitochondrial dysfunction (like glyphosate, but to a lesser extent), disruption of cell detoxification systems, lipid droplet accumulation and mortality at sub-agricultural doses. Formulants, especially those present in Glyphogan, are more deleterious than glyphosate and thus should be considered as active principles of these pesticides. Lipid droplet accumulation after acute exposure to POEA suggests the rapid penetration and accumulation of formulants, leading to mortality after 24 h. As Sertoli cells are essential for testicular development and normal onset of spermatogenesis, disturbance of their function by glyphosate-based herbicides could contribute to disruption of reproductive function demonstrated in mammals exposed to these pesticides at a prepubertal stage of development. Copyright © 2017. Published by Elsevier Ltd.

A Gly65Val substitution in an actin, GhACT_LI1, disrupts cell polarity and membrane anchoring of F-actin resulting in dwarf, lintless Li1 cotton plants

Science.gov (United States)

• Actin polymerizes to form the cytoskeleton and organize polar growth in all eukaryotic cells. Species with numerous actin genes are especially useful for the dissection of actin molecular function due to redundancy and neofunctionalization. Here, we investigated the role of a cotton (Gossypium hi...

Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

Science.gov (United States)

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

Glyphosate and Roundup® alter morphology and behavior in zebrafish.

Science.gov (United States)

Bridi, Daiane; Altenhofen, Stefani; Gonzalez, Jonas Brum; Reolon, Gustavo Kellermann; Bonan, Carla Denise

2017-12-01

Glyphosate has become the most widely used herbicide in the world, due to the wide scale adoption of transgenic glyphosate resistant crops after its introduction in 1996. Glyphosate may be used alone, but it is commonly applied as an active ingredient of the herbicide Roundup ® . This pesticide contains several adjuvants, which may promote an unknown toxicity. The indiscriminate application poses numerous problems, both for the health of the applicators and consumers, and for the environment, contaminating the soil, water and leading to the death of plants and animals. Zebrafish (Danio rerio) is quickly gaining popularity in behavioral research, because of physiological similarity to mammals, sensitivity to pharmacological factors, robust performance, low cost, short spawning intervals, external fertilization, transparency of embryos through larval stages, and rapid development. The aim of this study was evaluate the effects of glyphosate and Roundup ® on behavioral and morphological parameters in zebrafish larvae and adults. Zebrafish larvae at 3days post-fertilization and adults were exposed to glyphosate (0.01, 0.065, and 0.5mg/L) or Roundup ® (0.01, 0.065, and 0.5mg/L) for 96h. Immediately after the exposure, we performed the analysis of locomotor activity, aversive behavior, and morphology for the larvae and exploratory behavior, aggression and inhibitory avoidance memory for adult zebrafish. In zebrafish larvae, there were significant differences in the locomotor activity and aversive behavior after glyphosate or Roundup ® exposure when compared to the control group. Our findings demonstrated that exposure to glyphosate at the concentration of 0.5mg/L, Roundup ® at 0.065 or 0.5mg/L reduced the distance traveled, the mean speed and the line crossings in adult zebrafish. A decreased ocular distance was observed for larvae exposed at 0.5mg/L of glyphosate. We verified that at 0.5mg/L of Roundup ® -treated adult zebrafish demonstrated a significant

Glyphosate

OpenAIRE

Arcuri, Alessandra

2017-01-01

markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the substance is carcinogenic to humans and toxic for the environment. The controversy took a sharp legal turn when, in March 2015, the International Agency for Research on Cancer (IARC), which is the ...

Impacts of Repeated Glyphosate Use on Wheat-Associated Bacteria Are Small and Depend on Glyphosate Use History.

Science.gov (United States)

Schlatter, Daniel C; Yin, Chuntao; Hulbert, Scot; Burke, Ian; Paulitz, Timothy

2017-11-15

Glyphosate is the most widely used herbicide worldwide and a critical tool for weed control in no-till cropping systems. However, there are concerns about the nontarget impacts of long-term glyphosate use on soil microbial communities. We investigated the impacts of repeated glyphosate treatments on bacterial communities in the soil and rhizosphere of wheat in soils with and without long-term history of glyphosate use. We cycled wheat in the greenhouse using soils from 4 paired fields under no-till (20+-year history of glyphosate) or no history of use. At each cycle, we terminated plants with glyphosate (2× the field rate) or by removing the crowns, and soil and rhizosphere bacterial communities were characterized. Location, cropping history, year, and proximity to the roots had much stronger effects on bacterial communities than did glyphosate, which only explained 2 to 5% of the variation. Less than 1% of all taxa were impacted by glyphosate, more in soils with a long history of use, and more increased than decreased in relative abundance. Glyphosate had minimal impacts on soil and rhizosphere bacteria of wheat, although dying roots after glyphosate application may provide a "greenbridge" favoring some copiotrophic taxa. IMPORTANCE Glyphosate (Roundup) is the most widely used herbicide in the world and the foundation of Roundup Ready soybeans, corn, and the no-till cropping system. However, there have been recent concerns about nontarget impacts of glyphosate on soil microbes. Using next-generation sequencing methods and glyphosate treatments of wheat plants, we described the bacterial communities in the soil and rhizosphere of wheat grown in Pacific Northwest soils across multiple years, different locations, and soils with different histories of glyphosate use. The effects of glyphosate were subtle and much less than those of drivers such as location and cropping systems. Only a small percentage of the bacterial groups were influenced by glyphosate, and most of