Manejo de Conyza bonariensis resistente ao herbicida glyphosate Management of Glyphosate-resistant Conyza bonariensis

Directory of Open Access Journals (Sweden)

J.M. Paula

2011-03-01

Full Text Available C. bonariensis (Conyza bonariensis é uma planta daninha da família Asteraceae, amplamente distribuída no Brasil, com presença marcante nos Estados do Rio Grande do Sul e do Paraná. Biótipos de C. bonariensis resistentes ao glyphosate foram identificados nos Estados do Rio Grande do Sul, Paraná e São Paulo. O objetivo deste trabalho foi avaliar o efeito de diferentes manejos de inverno e na pré-semeadura da soja sobre a população de plantas de C. bonariensis resistente ao herbicida glyphosate. Os resultados evidenciaram que a população de C. bonariensis é maior em áreas mantidas sem cultivo (pousio do que naquelas áreas cultivadas com trigo ou aveia-preta durante o inverno. Observou-se que o trigo e a aveia-preta exercem efeito supressor sobre a população de C. bonariensis, proporcionando maior facilidade de controle com herbicida na pré-semeadura da cultura usada em sucessão. O controle de C. bonariensis resistente ao herbicida glyphosate foi satisfatório quando se utilizaram herbicidas pós-emergentes na cultura do trigo e glyphosate + 2,4-D ou glyphosate + diuron + paraquat na pré-semeadura da soja.Horseweed (Conyza bonariensis, which belongs to the Asteraceae family, is a weed species widely spread in Brazil. Horseweed biotypes resistant to glyphosate, the main herbicide used in Roundup Ready soybean fields, were identified in the states of Rio Grande do Sul and Parana. The aim of this study was to evaluate the effect of different winter and pre-sowing management techniques on soybean plant population of C. bonariensis resistant to glyphosate. The results showed that the population of C. bonariensis is larger in areas maintained fallow than in areas planted with wheat or oats during the winter. Wheat and oats were found to exert a suppressive effect on the population of C. bonariensis, providing greater ease of control with herbicide before seeding in the culture used in succession. The control of glyphosate-resistant C

Germination test as a fast method to detect glyphosate-resistant sourgrass

Directory of Open Access Journals (Sweden)

Marcos Altomani Neves Dias

2015-01-01

Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

Germination test as a fast method to detect glyphosate-resistant sourgrass

Directory of Open Access Journals (Sweden)

Marcos Altomani Neves Dias

2015-09-01

Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

Identification of glyphosate resistance in Salsola tragus in north-eastern Oregon.

Science.gov (United States)

Barroso, Judit; Gourlie, Jennifer A; Lutcher, Larry K; Liu, Mingyang; Mallory-Smith, Carol A

2018-05-01

Farmers in the low-rainfall region of eastern Oregon rely on repeated applications of non-selective herbicides, predominately glyphosate, to control Salsola tragus in no-till fallow systems. Reports of poor glyphosate effectiveness have increased in recent years. Reduced efficacy is often attributed to dust, water stress, or generally poor growing conditions during application. Inadequate control also may be the result of the evolution of glyphosate resistance. Therefore, studies were undertaken to determine if glyphosate-resistant S. tragus populations occur in Oregon. Results from dose-response studies confirmed glyphosate resistance in three of 10 Oregon Salsola tragus populations. The ratio I 50R /I 50S from dose-response curves was, on average, 3.1 for the relative dry biomass per plant and 3.2 for the % of surviving plants per pot in these three populations. Plant mortality at recommended glyphosate doses for the resistant populations was less than 30% 3 weeks after treatment. Glyphosate resistance in S. tragus highlights the imperative need to diversify weed control strategies to preserve the longevity and sustainability of herbicides in semi-arid cropping systems of the Pacific Northwest. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

The history and current status of glyphosate.

Science.gov (United States)

Duke, Stephen O

2018-05-01

Glyphosate is the only herbicide to target the enzyme 5-enolpyruvyl-3-shikimate phosphate synthase (EPSPS). It is a high use rate, non-selective herbicide that translocates primarily to metabolic sinks, killing meristematic tissues away from the application site. Its phloem-mobile properties and slow action in killing weeds allow the herbicide to move throughout the plant to kill all meristems, making it effective for perennial weed control. Since commercialization in 1974, its use has grown to dominate the herbicide market. Much of its use is on transgenic, glyphosate-resistant crops (GRCs), which have been the dominant transgenic crops worldwide. GRCs with glyphosate provided the most effective and inexpensive weed management technology in history for a decade or more. However, as a consequence of the rapid increase in glyphosate-resistant (GR) weeds, the effectiveness of glyphosate use in GRCs is declining. Critics have claimed that glyphosate-treated GRCs have altered mineral nutrition and increased susceptibility to plant pathogens because of glyphosate's ability to chelate divalent metal cations, but the complete resistance of GRCs to glyphosate indicates that chelating metal cations do not contribute to the herbicidal activity or significantly affect mineral nutrition. The rates of increases in yields of maize, soybean, and cotton in the USA have been unchanged after high adoption rates of GRCs. Glyphosate is toxic to some plant pathogens, and thereby can act as a fungicide in GRCs. Ultra-low doses of glyphosate stimulate plant growth in glyphosate-susceptible plants by unknown mechanisms. Despite rapid and widespread increases in GR weeds, glyphosate use has not decreased. However, as GR weeds increase, adoption of alternative technologies will eventually lead to decreased use. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in

EPSPS gene amplification conferring resistance to glyphosate in windmill grass (Chloris truncata) in Australia.

Science.gov (United States)

Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

2018-05-01

Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Glyphosate-Resistant Parthenium hysterophorus in the Caribbean Islands: Non Target Site Resistance and Target Site Resistance in Relation to Resistance Levels.

Directory of Open Access Journals (Sweden)

Enzo Bracamonte

2016-12-01

Full Text Available Glyphosate has been the most intensely herbicide used worldwide for decades, and continues to be a single tool for controlling weeds in woody crops. However, the adoption of this herbicide in a wide range of culture systems has led to the emergence of resistant weeds. Glyphosate has been widely used primarily on citrus in the Caribbean area, but a study of resistance in the Caribbean islands of Cuba and the Dominican Republic has never been carried out. Unfortunately, Parthenium hysterophorus has developed glyphosate-resistance in both islands, independently. The resistance level and mechanisms of different P. hysterophorus accessions (three collected in Cuba (Cu-R and four collected in the Dominican Republic (Do-R have been studied under greenhouse and laboratory conditions. In in vivo assays (glyphosate dose causing 50% reduction in above-ground vegetative biomass and survival, the resistance factor levels showed susceptible accessions (Cu-S≥Do-S, low-resistance accessions (Cu-R3Do-R2>Cu-R2>Do-R3>Do-R4>Cu-R3>>Cu-S≥Do-S. Glyphosate was degraded to aminomethylphosphonic acid, glyoxylate and sarcosine by >88% in resistant accessions except in Cu-R3 and Do-R4 resistant accessions (51.12 and 44.21, respectively, whereas a little glyphosate (<9.32% was degraded in both susceptible accessions at 96 h after treatment. There were significant differences between P. hysterophorus accessions in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS activity enzyme with and without different glyphosate rates. The R accessions showed values of between 0.026 and 0.21 µmol µg-1 TSP protein min-1 basal EPSPS activity values with respect to the S (0.024 and 0.025 accessions. The same trend was found in the EPSPS enzyme activity treated with glyphosate, where a higher enzyme activity inhibition (glyphosate µM corresponded to greater resistance levels in P. hysterophorus accessions. One amino acid substitution was found at position 106 in EPSPS, consisting

Glyphosate efficacy on sourgrass biotypes with suspected resistance collected in GR-crop fields

Directory of Open Access Journals (Sweden)

Hellen Martins da Silveira

2017-11-01

Full Text Available In Brazil, infestations of crop areas with glyphosate-resistant (GR sourgrass (Digitaria insularis (L. Fedde biotypes has risen significantly, increasing crop production costs. Glyphosate efficacy on three biotypes (GO, BA and MT of sourgrass with suspected resistance was evaluated. A susceptible biotype (MG was used as the control. The results confirmed that the MG and GO biotypes were susceptible to glyphosate (control > 90%. The MG biotype exhibited growth reduction and mortality by 50% (GR50 and LD50, respectively with mean glyphosate doses of 243.7 and 431.6 g ae ha-1. The resistance index of the biotypes with suspected resistance ranged from 2.8 to 6.1 in relation to GR50 and between 1.4 to 26.7 in relation to LD50. The glyphosate susceptibility ranking of the sourgrass biotypes was MG < GO < MT < BA. The MT and BA biotypes demonstrated high glyphosate resistance levels, and the GO biotype had a high potential to develop resistance. Farmers should avoid the application of glyphosate overdoses to minimize the selection pressure on weeds.

Identifying Chloris Species from Cuban Citrus Orchards and Determining Their Glyphosate-Resistance Status

Directory of Open Access Journals (Sweden)

Enzo R. Bracamonte

2017-11-01

Full Text Available The Chloris genus is a C4 photosynthetic species mainly distributed in tropical and subtropical regions. Populations of three Chloris species occurring in citrus orchards from central Cuba, under long history glyphosate-based weed management, were studied for glyphosate-resistant status by characterizing their herbicide resistance/tolerance mechanisms. Morphological and molecular analyses allowed these species to be identified as C. ciliata Sw., Chloris elata Desv., and Chloris barbata Sw. Based on the glyphosate rate that causes 50% mortality of the treated plants, glyphosate resistance (R was confirmed only in C. elata, The R population was 6.1-fold more resistant compared to the susceptible (S population. In addition, R plants of C. elata accumulated 4.6-fold less shikimate after glyphosate application than S plants. Meanwhile, populations of C. barbata and C. ciliata with or without glyphosate application histories showed similar LD50 values and shikimic acid accumulation rates, demonstrating that resistance to glyphosate have not evolved in these species. Plants of R and S populations of C. elata differed in 14C-glyphosate absorption and translocation. The R population exhibited 27.3-fold greater 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS activity than the S population due to a target site mutation corresponding to a Pro-106-Ser substitution found in the EPSPS gene. These reports show the innate tolerance to glyphosate of C. barbata and C. ciliata, and confirm the resistance of C. elata to this herbicide, showing that both non-target site and target-site mechanisms are involved in its resistance to glyphosate. This is the first case of herbicide resistance in Cuba.

Molecular basis of glyphosate resistance: Different approaches through protein engineering

Science.gov (United States)

Pollegioni, Loredano; Schonbrunn, Ernst; Siehl, Daniel

2011-01-01

Glyphosate (N-phosphonomethyl-glycine) is the most-used herbicide in the world: glyphosate-based formulations exhibit broad-spectrum herbicidal activity with minimal human and environmental toxicity. The extraordinary success of this simple small molecule is mainly due to the high specificity of glyphosate towards the plant enzyme enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway leading to biosynthesis of aromatic amino acids. Starting in 1996, transgenic glyphosate-resistant plants were introduced thus allowing the application of the herbicide to the crop (post-emergence) to remove emerged weeds without crop damage. This review focuses on the evolution of mechanisms of resistance to glyphosate as obtained through natural diversity, the gene shuffling approach to molecular evolution, and a rational, structure-based approach to protein engineering. In addition, we offer rationale for the means by which the modifications made have had their intended effect. PMID:21668647

Inheritance of Evolved Glyphosate Resistance in a North Carolina Palmer Amaranth (Amaranthus palmeri Biotype

Directory of Open Access Journals (Sweden)

Aman Chandi

2012-01-01

Full Text Available Inheritance of glyphosate resistance in a Palmer amaranth biotype from North Carolina was studied. Glyphosate rates for 50% survival of glyphosate-resistant (GR and glyphosate-susceptible (GS biotypes were 1288 and 58 g ha−1, respectively. These values for F1 progenies obtained from reciprocal crosses (GR×GS and GS×GR were 794 and 501 g ha−1, respectively. Dose response of F1 progenies indicated that resistance was not fully dominant over susceptibility. Lack of significant differences between dose responses for reciprocal F1 families suggested that genetic control of glyphosate resistance was governed by nuclear genome. Analysis of F1 backcross (BC1F1 families showed that 10 and 8 BC1F1 families out of 15 fitted monogenic inheritance at 2000 and 3000 g ha−1 glyphosate, respectively. These results indicate that inheritance of glyphosate resistance in this biotype is incompletely dominant, nuclear inherited, and might not be consistent with a single gene mechanism of inheritance. Relative 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS copy number varied from 22 to 63 across 10 individuals from resistant biotype. This suggested that variable EPSPS copy number in the parents might be influential in determining if inheritance of glyphosate resistance is monogenic or polygenic in this biotype.

The benefits of herbicide-resistant crops.

Science.gov (United States)

Green, Jerry M

2012-10-01

Since 1996, genetically modified herbicide-resistant crops, primarily glyphosate-resistant soybean, corn, cotton and canola, have helped to revolutionize weed management and have become an important tool in crop production practices. Glyphosate-resistant crops have enabled the implementation of weed management practices that have improved yield and profitability while better protecting the environment. Growers have recognized their benefits and have made glyphosate-resistant crops the most rapidly adopted technology in the history of agriculture. Weed management systems with glyphosate-resistant crops have often relied on glyphosate alone, have been easy to use and have been effective, economical and more environmentally friendly than the systems they have replaced. Glyphosate has worked extremely well in controlling weeds in glyphosate-resistant crops for more than a decade, but some key weeds have evolved resistance, and using glyphosate alone has proved unsustainable. Now, growers need to renew their weed management practices and use glyphosate with other cultural, mechanical and herbicide options in integrated systems. New multiple-herbicide-resistant crops with resistance to glyphosate and other herbicides will expand the utility of existing herbicide technologies and will be an important component of future weed management systems that help to sustain the current benefits of high-efficiency and high-production agriculture. Copyright © 2012 Society of Chemical Industry.

Lack of transgene and glyphosate effects on yield, and mineral and amino acid content of glyphosate-resistant soybean.

Science.gov (United States)

Duke, Stephen O; Rimando, Agnes M; Reddy, Krishna N; Cizdziel, James V; Bellaloui, Nacer; Shaw, David R; Williams, Martin M; Maul, Jude E

2018-05-01

There has been controversy as to whether the glyphosate resistance gene and/or glyphosate applied to glyphosate-resistant (GR) soybean affect the content of cationic minerals (especially Mg, Mn and Fe), yield and amino acid content of GR soybean. A two-year field study (2013 and 2014) examined these questions at sites in Mississippi, USA. There were no effects of glyphosate, the GR transgene or field crop history (for a field with both no history of glyphosate use versus one with a long history of glyphosate use) on grain yield. Furthermore, these factors had no consistent effects on measured mineral (Al, As, Ba, Cd, Ca, Co, Cr, Cs, Cu, Fe, Ga, K, Li, Mg, Mn, Ni, Pb, Rb, Se, Sr, Tl, U, V, Zn) content of leaves or harvested seed. Effects on minerals were small and inconsistent between years, treatments and mineral, and appeared to be random false positives. No notable effects on free or protein amino acids of the seed were measured, although glyphosate and its degradation product, aminomethylphosphonic acid (AMPA), were found in the seed in concentrations consistent with previous studies. Neither glyphosate nor the GR transgene affect the content of the minerals measured in leaves and seed, harvested seed amino acid composition, or yield of GR soybean. Furthermore, soils with a legacy of GR crops have no effects on these parameters in soybean. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli*S⃞

Science.gov (United States)

Funke, Todd; Yang, Yan; Han, Huijong; Healy-Fried, Martha; Olesen, Sanne; Becker, Andreas; Schönbrunn, Ernst

2009-01-01

The shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the target of the broad spectrum herbicide glyphosate. The genetic engineering of EPSPS led to the introduction of glyphosate-resistant crops worldwide. The genetically engineered corn lines NK603 and GA21 carry distinct EPSPS enzymes. CP4 EPSPS, expressed in NK603 corn and transgenic soybean, cotton, and canola, belongs to class II EPSPS, glyphosate-insensitive variants of this enzyme isolated from certain Gram-positive bacteria. GA21 corn, on the other hand, was created by point mutations of class I EPSPS, such as the enzymes from Zea mays or Escherichia coli, which are sensitive to low glyphosate concentrations. The structural basis of the glyphosate resistance resulting from these point mutations has remained obscure. We studied the kinetic and structural effects of the T97I/P101S double mutation, the molecular basis for GA21 corn, using EPSPS from E. coli. The T97I/P101S enzyme is essentially insensitive to glyphosate (Ki = 2.4 mm) but maintains high affinity for the substrate phosphoenolpyruvate (PEP) (Km = 0.1 mm). The crystal structure at 1.7-Å resolution revealed that the dual mutation causes a shift of residue Gly96 toward the glyphosate binding site, impairing efficient binding of glyphosate, while the side chain of Ile97 points away from the substrate binding site, facilitating PEP utilization. The single site T97I mutation renders the enzyme sensitive to glyphosate and causes a substantial decrease in the affinity for PEP. Thus, only the concomitant mutations of Thr97 and Pro101 induce the conformational changes necessary to produce catalytically efficient, glyphosate-resistant class I EPSPS. PMID:19211556

Aldo-keto reductase enzymes detoxify glyphosate and improve herbicide resistance in plants.

Science.gov (United States)

Vemanna, Ramu S; Vennapusa, Amaranatha Reddy; Easwaran, Murugesh; Chandrashekar, Babitha K; Rao, Hanumantha; Ghanti, Kirankumar; Sudhakar, Chinta; Mysore, Kirankumar S; Makarla, Udayakumar

2017-07-01

In recent years, concerns about the use of glyphosate-resistant crops have increased because of glyphosate residual levels in plants and development of herbicide-resistant weeds. In spite of identifying glyphosate-detoxifying genes from microorganisms, the plant mechanism to detoxify glyphosate has not been studied. We characterized an aldo-keto reductase gene from Pseudomonas (PsAKR1) and rice (OsAKR1) and showed, by docking studies, both PsAKR1 and OsAKR1 can efficiently bind to glyphosate. Silencing AKR1 homologues in rice and Nicotiana benthamiana or mutation of AKR1 in yeast and Arabidopsis showed increased sensitivity to glyphosate. External application of AKR proteins rescued glyphosate-mediated cucumber seedling growth inhibition. Regeneration of tobacco transgenic lines expressing PsAKR1 or OsAKRI on glyphosate suggests that AKR can be used as selectable marker to develop transgenic crops. PsAKR1- or OsAKRI-expressing tobacco and rice transgenic plants showed improved tolerance to glyphosate with reduced accumulation of shikimic acid without affecting the normal photosynthetic rates. These results suggested that AKR1 when overexpressed detoxifies glyphosate in planta. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

Science.gov (United States)

Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

2017-08-01

Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Effects of glyphosate on the mineral content of glyphosate-resistant soybeans (Glycine max).

Science.gov (United States)

Duke, Stephen O; Reddy, Krishna N; Bu, Kaixuan; Cizdziel, James V

2012-07-11

There are conflicting claims as to whether treatment with glyphosate adversely affects mineral nutrition of glyphosate-resistant (GR) crops. Those who have made claims of adverse effects have argued links between reduced Mn and diseases in these crops. This article describes experiments designed to determine the effects of a recommended rate (0.86 kg ha(-1)) of glyphosate applied once or twice on the mineral content of young and mature leaves, as well as in seeds produced by GR soybeans (Glycine max) in both the greenhouse and field using inductively coupled plasma mass spectrometry (ICP-MS). In the greenhouse, there were no effects of either one application (at 3 weeks after planting, WAP) or two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves sampled at 6, 9, and 12 WAP and in harvested seed. Se concentrations were too low for accurate detection in leaves, but there was also no effect of glyphosate applications on Se in the seeds. In the field study, there were no effects of two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves at either 9 or 12 WAP. There was also no effect on Se in the seeds. There was no difference in yield between control and glyphosate-treated GR soybeans in the field. The results indicate that glyphosate does not influence mineral nutrition of GR soybean at recommended rates for weed management in the field. Furthermore, the field studies confirm the results of greenhouse studies.

Target-site mutations conferring resistance to glyphosate in feathertop Rhodes grass (Chloris virgata) populations in Australia.

Science.gov (United States)

Ngo, The D; Krishnan, Mahima; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

2018-05-01

Chloris virgata is a warm-season, C 4 , annual grass weed affecting field crops in northern Australia that has become an emerging weed in southern Australia. Four populations with suspected resistance to glyphosate were collected in South Australia, Queensland and New South Wales, Australia, and compared with one susceptible (S) population to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the rate of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in four populations of C. virgata (V12, V14.2, V14.16 and V15). GR plants were 2-9.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. GR and S plants did not differ in glyphosate absorption and translocation. Target-site EPSPS mutations corresponding to Pro-106-Leu (V14.2) and Pro-106-Ser (V15, V14.16 and V12) substitutions were found in GR populations. The population with Pro-106-Leu substitution was 2.9-4.9-fold more resistant than the three other populations with Pro-106-Ser substitution. This report confirms glyphosate resistance in C. virgata and shows that target-site EPSPS mutations confer resistance to glyphosate in this species. The evolution of glyphosate resistance in C. virgata highlights the need to identify alternative control tactics. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Glyphosate Effects on Plant Mineral Nutrition, Crop Rhizosphere Microbiota, and Plant Disease in Glyphosate-Resistant Crops

Science.gov (United States)

2012-01-01

Claims have been made recently that glyphosate-resistant (GR) crops sometimes have mineral deficiencies and increased plant disease. This review evaluates the literature that is germane to these claims. Our conclusions are: (1) although there is conflicting literature on the effects of glyphosate on mineral nutrition on GR crops, most of the literature indicates that mineral nutrition in GR crops is not affected by either the GR trait or by application of glyphosate; (2) most of the available data support the view that neither the GR transgenes nor glyphosate use in GR crops increases crop disease; and (3) yield data on GR crops do not support the hypotheses that there are substantive mineral nutrition or disease problems that are specific to GR crops. PMID:23013354

Review of potential environmental impacts of transgenic glyphosate-resistant soybean in Brazil.

Science.gov (United States)

Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B; Spadotto, Claudio A

2007-01-01

Transgenic glyphosate-resistant soybeans (GRS) have been commercialized and grown extensively in the Western Hemisphere, including Brazil. Worldwide, several studies have shown that previous and potential effects of glyphosate on contamination of soil, water, and air are minimal, compared to those caused by the herbicides that they replace when GRS are adopted. In the USA and Argentina, the advent of glyphosate-resistant soybeans resulted in a significant shift to reduced- and no-tillage practices, thereby significantly reducing environmental degradation by agriculture. Similar shifts in tillage practiced with GRS might be expected in Brazil. Transgenes encoding glyphosate resistance in soybeans are highly unlikely to be a risk to wild plant species in Brazil. Soybean is almost completely self-pollinated and is a non-native species in Brazil, without wild relatives, making introgression of transgenes from GRS virtually impossible. Probably the highest agricultural risk in adopting GRS in Brazil is related to weed resistance. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. These include Chamaesyce hirta (erva-de-Santa-Luzia), Commelina benghalensis (trapoeraba), Spermacoce latifolia (erva-quente), Richardia brasiliensis (poaia-branca), and Ipomoea spp. (corda-de-viola). Four weed species, Conyza bonariensis, Conyza Canadensis (buva), Lolium multiflorum (azevem), and Euphorbia heterophylla (amendoim bravo), have evolved resistance to glyphosate in GRS in Brazil and have great potential to become problems.

Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

Science.gov (United States)

Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

2015-10-01

Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

Science.gov (United States)

Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

2017-12-01

A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

Error-prone PCR mutation of Ls-EPSPS gene from Liriope spicata conferring to its enhanced glyphosate-resistance.

Science.gov (United States)

Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng

2017-09-01

Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.

The intensity of non-target site mechanisms influences the level of resistance of sourgrass to glyphosate

Directory of Open Access Journals (Sweden)

Flávia Regina da Costa

2014-02-01

Full Text Available Non-target site mechanisms are involved in the resistance of sourgrass (Digitaria insularis to glyphosate. Studies on the 14C-glyphosate absorption and translocation as well as the detection of glyphosate and its metabolites in sourgrass plants were carried out under controlled conditions to investigate if the differential response of resistant sourgrass biotypes (R1 and R2 is derived from the intensity of non-target site mechanisms involved in the resistance to glyphosate. Different pattern of absorption was observed between S (susceptible and R2 from 12 up to 48 hours after treatment with glyphosate (HAT, and between S and R1 just at 12 HAT. The initial difference in glyphosate absorption among the biotypes did not maintained at 96 HAT and afterwards. Smaller amount of herbicide left the treated leaf into the rest of shoot and roots in R2 (25% than in S (58% and R1 (52%. In addition, slight difference in glyphosate translocation was observed between S and R1. We found high percentage (81% of glyphosate in the S biotype up to 168 HAT, while just 44% and 2% of glyphosate was recovered from R1 and R2 plant tissues. In addition, high percentage of glyphosate metabolites was found in R2 (98% and R1 (56% biotypes, while a very low percentage (11% was found in the S biotype. As previous studies indicated resistant factors of 3.5 and 5.6 for R1 and R2, respectively, we conclude that the differential response of sourgrass biotypes is derived from the intensity of the non-target site mechanisms involved in the resistance to glyphosate.

Impact of glyphosate resistant corn, glyphosate applications, and tillage on soil nutrient ratios, exoenzyme activities, and nutrient acquisition ratios

Science.gov (United States)

We report results of the last two years of a 7-year (2008-2014) field experiment designed to test the null hypothesis that applications of glyphosate on glyphosate resistant corn (Zea mays L.) as a routine weed control practice under both conventional and reduced tillage practices would have no effe...

What do farmers' weed control decisions imply about glyphosate resistance? Evidence from surveys of US corn fields.

Science.gov (United States)

Wechsler, Seth J; McFadden, Jonathan R; Smith, David J

2018-05-01

The first case of glyphosate-resistant weeds in the United States was documented in 1998, 2 years after the commercialization of genetically engineered herbicide-resistant (HR) corn and soybeans. Currently, over 15 glyphosate-resistant weed species affect US crop production areas. These weeds have the potential to reduce yields, increase costs, and lower farm profitability. The objective of our study is to develop a behavioral model of farmers' weed management decisions and use it to analyze weed resistance to glyphosate in US corn farms. On average, we find that weed control increased US corn yields by 3700 kg ha -1 (worth approximately $US 255 ha -1 ) in 2005 and 3500 kg ha -1 (worth approximately $US 575 ha -1 ) in 2010. If glyphosate resistant weeds were absent, glyphosate killed approximately 99% of weeds, on average, when applied at the label rate in HR production systems. Average control was dramatically lower in states where glyphosate resistance was widespread. We find that glyphosate resistance had a significant impact on weed control costs and corn yields of US farmers in 2005 and 2010. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Identification of regulated genes conferring resistance to high concentrations of glyphosate in a new strain of Enterobacter.

Science.gov (United States)

Fei, Yun-Yan; Gai, Jun-Yi; Zhao, Tuan-Jie

2013-12-01

Glyphosate is a widely used herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity. Most plants and microbes are sensitive to glyphosate. However, transgenic-resistant crops that contain a modified epsps obtained from the resistant microbes have been commercially successful and therefore, new resistance genes and their adaptive regulatory mechanisms are of great interest. In this study, a soil-borne, glyphosate-resistant bacterium was selected and identified as Enterobacter. The EPSPS in this strain was found to have been altered to a resistant one. A total of 42 differentially expressed genes (DEGs) in the glyphosate were screened using microarray techniques. Under treatment, argF, sdhA, ivbL, rrfA-H were downregulated, whereas the transcripts of speA, osmY, pflB, ahpC, fusA, deoA, uxaC, rpoD and a few ribosomal protein genes were upregulated. Data were verified by quantitative real-time PCR on selected genes. All transcriptional changes appeared to protect the bacteria from glyphosate and associated osmotic, acidic and oxidative stresses. Many DEGs may have the potential to confer resistance to glyphosate alone, and some may be closely related to the shikimate pathway, reflecting the complex gene interaction network for glyphosate resistance. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Yield of glyphosate-resistant sugar beets and efficiency of weed management systems with glyphosate and conventional herbicides under German and Polish crop production.

Science.gov (United States)

Nichterlein, Henrike; Matzk, Anja; Kordas, Leszek; Kraus, Josef; Stibbe, Carsten

2013-08-01

In sugar beet production, weed control is one of the most important and most expensive practices to ensure yield. Since glyphosate-resistant sugar beets are not yet approved for cultivation in the EU, little commercial experience exists with these sugar beets in Europe. Experimental field trials were conducted at five environments (Germany, Poland, 2010, 2011) to compare the effects of glyphosate with the effects of conventional weed control programs on the development of weeds, weed control efficiency and yield. The results show that the glyphosate weed control programs compared to the conventional methods decreased not only the number of herbicide applications but equally in magnitude decreased the dosage of active ingredients. The results also showed effective weed control with glyphosate when the weed covering was greater and sugar beets had a later growth stage of four true leaves. Glyphosate-resistant sugar beets applied with the glyphosate herbicide two or three times had an increase in white sugar yield from 4 to 18 % in comparison to the high dosage conventional herbicide systems. In summary, under glyphosate management sugar beets can positively contribute to the increasingly demanding requirements regarding efficient sugar beet cultivation and to the demands by society and politics to reduce the use of chemical plant protection products in the environment.

EPSPS variability, gene expression, and enzymatic activity in glyphosate-resistant biotypes of Digitaria insularis.

Science.gov (United States)

Galeano, E; Barroso, A A M; Vasconcelos, T S; López-Rubio, A; Albrecht, A J P; Victoria Filho, R; Carrer, H

2016-08-12

Weed resistance to herbicides is a natural phenomenon that exerts selection on individuals in a population. In Brazil, glyphosate resistance was recently detected in Digitaria insularis. The objective of this study was to elucidate mechanisms of weed resistance in this plant, including genetic variability, allelism, amino acid substitutions, gene expression, and enzymatic activity levels. Most of these have not previously been studied in this species. D. insularis DNA sequences were used to analyze genetic variability. cDNA from resistant and susceptible plants was used to identify mutations, alleles, and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) expression, using real-time quantitative reverse transcription-polymerase chain reaction. In addition, EPSPS activity was measured. We found a decrease in genetic variability between populations related to glyphosate application. Substitutions from proline to threonine and tyrosine to cysteine led to a decrease in EPSPS affinity for the glyphosate. In addition, the EPSPS enzymatic activity was slightly higher in resistant plants, whereas EPSPS gene expression was almost identical in both biotypes, suggesting feedback regulation at different levels. To conclude, our results suggest new molecular mechanisms used by D. insularis to increase glyphosate resistance.

Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase.

Science.gov (United States)

Baerson, Scott R; Rodriguez, Damian J; Tran, Minhtien; Feng, Yongmei; Biest, Nancy A; Dill, Gerald M

2002-07-01

The spontaneous occurrence of resistance to the herbicide glyphosate in weed species has been an extremely infrequent event, despite over 20 years of extensive use. Recently, a glyphosate-resistant biotype of goosegrass (Eleusine indica) was identified in Malaysia exhibiting an LD(50) value approximately 2- to 4-fold greater than the sensitive biotype collected from the same region. A comparison of the inhibition of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity by glyphosate in extracts prepared from the resistant (R) and sensitive (S) biotypes revealed an approximately 5-fold higher IC(50)(glyphosate) for the (R) biotype. Sequence comparisons of the predicted EPSPS mature protein coding regions from both biotypes revealed four single-nucleotide differences, two of which result in amino acid changes. One of these changes, a proline to serine substitution at position 106 in the (R) biotype, corresponds to a substitution previously identified in a glyphosate-insensitive EPSPS enzyme from Salmonella typhimurium. Kinetic data generated for the recombinant enzymes suggests that the second substitution identified in the (R) EPSPS does not contribute significantly to its reduced glyphosate sensitivity. Escherichia coli aroA- (EPSPS deficient) strains expressing the mature EPSPS enzyme from the (R) biotype exhibited an approximately 3-fold increase in glyphosate tolerance relative to strains expressing the mature EPSPS from the (S) biotype. These results provide the first evidence for an altered EPSPS enzyme as an underlying component of evolved glyphosate resistance in any plant species.

Early warning of cotton bollworm resistance associated with intensive planting of Bt cotton in China.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins kill some key insect pests, but evolution of resistance by pests can reduce their efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to promote survival of susceptible pests. To delay pest resistance to transgenic cotton producing Bt toxin Cry1Ac, farmers in the United States and Australia planted refuges of non-Bt cotton, while farmers in China have relied on "natural" refuges of non-Bt host plants other than cotton. Here we report data from a 2010 survey showing field-evolved resistance to Cry1Ac of the major target pest, cotton bollworm (Helicoverpa armigera, in northern China. Laboratory bioassay results show that susceptibility to Cry1Ac was significantly lower in 13 field populations from northern China, where Bt cotton has been planted intensively, than in two populations from sites in northwestern China where exposure to Bt cotton has been limited. Susceptibility to Bt toxin Cry2Ab did not differ between northern and northwestern China, demonstrating that resistance to Cry1Ac did not cause cross-resistance to Cry2Ab, and implying that resistance to Cry1Ac in northern China is a specific adaptation caused by exposure to this toxin in Bt cotton. Despite the resistance detected in laboratory bioassays, control failures of Bt cotton have not been reported in China. This early warning may spur proactive countermeasures, including a switch to transgenic cotton producing two or more toxins distinct from Cry1A toxins.

Evolution of a double amino acid substitution in the 5-enolpyruvylshikimate-3-phosphate synthase in Eleusine indica conferring high-level glyphosate resistance.

Science.gov (United States)

Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R Douglas; Powles, Stephen B

2015-04-01

Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I+P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. © 2015 American Society of Plant Biologists. All Rights Reserved.

Control of glyphosate resistant hairy fleabane (Conyza bonariensis with dicamba and 2,4-D Controle de buva (Conyza bonariensis resistente ao glyphosate com dicamba e 2,4-D

Directory of Open Access Journals (Sweden)

D.J. Soares

2012-06-01

Full Text Available Auxyn type herbicides such as dicamba and 2,4-D are alternative herbicides that can be used to control glyphosate-resistant hairy fleabane. With the forthcoming possibility of releasing dicamba-resistant and 2,4-D-resistant crops, use of these growth regulator herbicides will likely be an alternative that can be applied to the control of glyphosate resistant hairy fleabane (Conyza bonariensis. The objective of this research was to model the efficacy, through dose-response curves, of glyphosate, 2,4-D, isolated dicamba and glyphosatedicamba combinations to control a brazilian hairy fleabane population resistant to glyphosate. The greenhouse dose-response studies were conducted as a completely randomized experimental design, and the rates used for dose response curve construction were 0, 120, 240, 480, 720 and 960 g a.i. ha-1 for 2,4-D, dicamba and the dicamba combination, with glyphosate at 540 g a.e. ha-1. The rates for glyphosate alone were 0, 180, 360, 540, 720 and 960 g a.e. ha-1. Herbicides were applied when the plants were in a vegetative stage with 10 to 12 leaves and height between 12 and 15 cm. Hairy fleabane had low sensitivity to glyphosate, with poor control even at the 960 g a.e. ha-1 rate. Dicamba and 2,4-D were effective in controlling the studied hairy fleabane. Hairy fleabane responds differently to 2,4-D and dicamba. The combination of glyphosate and dicamba was not antagonistic to hairy fleabane control, and glyphosate may cause an additive effect on the control, despite the population resistance.Os herbicidas mimetizadores de auxinas como dicamba e 2,4-D são alternativas para o controle de buva resistente ao glyphosate. Com a possível futura liberação comercial de culturas resistentes ao dicamba e 2,4-D, a aplicação destes herbicidas reguladores de crescimento será uma provável alternativa de controle de buva resistente ao glyphosate. O objetivo desta pesquisa foi modelar por meio de curvas de dose-resposta a efic

Evolution of a Double Amino Acid Substitution in the 5-Enolpyruvylshikimate-3-Phosphate Synthase in Eleusine indica Conferring High-Level Glyphosate Resistance1

Science.gov (United States)

Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.

2015-01-01

Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039

Investigating the mechanisms of glyphosate resistance in goosegrass (Eleusine indica (L.) Gaertn.) by RNA sequencing technology.

Science.gov (United States)

Chen, Jingchao; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Xu; Zhang, Chaoxian

2017-01-01

Glyphosate is an important non-selective herbicide that is in common use worldwide. However, evolved glyphosate-resistant (GR) weeds significantly affect crop yields. Unfortunately, the mechanisms underlying resistance in GR weeds, such as goosegrass (Eleusine indica (L.) Gaertn.), an annual weed found worldwide, have not been fully elucidated. In this study, transcriptome analysis was conducted to further assess the potential mechanisms of glyphosate resistance in goosegrass. The RNA sequencing libraries generated 24 597 462 clean reads. De novo assembly analysis produced 48 852 UniGenes with an average length of 847 bp. All UniGenes were annotated using seven databases. Sixteen candidate differentially expressed genes selected by digital gene expression analysis were validated by quantitative real-time PCR (qRT-PCR). Among these UniGenes, the EPSPS and PFK genes were constitutively up-regulated in resistant (R) individuals and showed a higher copy number than that in susceptible (S) individuals. The expressions of four UniGenes relevant to photosynthesis were inhibited by glyphosate in S individuals, and this toxic response was confirmed by gas exchange analysis. Two UniGenes annotated as glutathione transferase (GST) were constitutively up-regulated in R individuals, and were induced by glyphosate both in R and S. In addition, the GST activities in R individuals were higher than in S. Our research confirmed that two UniGenes (PFK, EPSPS) were strongly associated with target resistance, and two GST-annotated UniGenes may play a role in metabolic glyphosate resistance in goosegrass. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

Science.gov (United States)

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Identification and characterization of RAPD-SCAR markers linked to glyphosate-susceptible and -resistant biotypes of Eleusine indica (L.) Gaertn.

Science.gov (United States)

Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng

2014-02-01

Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.

Investigation of glyphosate resistance levels and target-site based resistance (TSR) mechanisms in Conyza canadensis (L.) from apple orchards around areas of Bohai seas and Loess Plateau in China.

Science.gov (United States)

Mei, Yu; Xu, Yufang; Wang, Shipeng; Qiu, Lihong; Zheng, Mingqi

2018-04-01

The resistance levels to glyphosate and target-site based resistance mechanisms in susceptible (S) and resistant (R) Conyza canadensis (L.) populations, which were collected from apple orchards around areas of Bohai seas and Loess Plateau in China, were investigated. Among forty C. canadensis populations, eighteen populations (45%) were still susceptible; fourteen populations (35%) evolved low resistance levels resistance to glyphosate with resistance index (RI) of 2.02 to 3.90. In contrast, eight populations (20%) evolved medium resistance levels with RI of 4.35 to 8.38. The shikimic acid concentrations in R populations were highly negative relative with the glyphosate resistance levels in C. canadensis, the Pearson correlation coefficient was -0.82 treated by glyphosate at 1.8mg/L. Three 5-enoylpyruvylshikimate 3'-phosphate synthase genes (EPSPS1, EPSPS2 and EPSPS3) were cloned in all S and glyphosate-resistant C. canadensis populations. No amino acid substitution was identified at site of 102 and 106 in three EPSPS genes, which were reported to confer glyphosate resistance in other weed species. The relative expression level of EPSPS mRNA in R populations (SD07, LN05, SHX06 and SD09) was 4.5 to 13.2 times higher than in S biotype. The Pearson correlation coefficient between EPSPS expression levels and RI was 0.79, which indicated the over expression of EPSPS mRNA may cause these R populations evolve higher resistance level to glyphosate. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification of geneticaly modified soybean seeds resistant to glyphosate

Directory of Open Access Journals (Sweden)

Tillmann Maria Ângela André

2004-01-01

Full Text Available Advances in genetic engineering permit the modification of plants to be tolerant to certain herbicides that are usually not selective. For practical and commercial purposes, it is important to be able to detect the presence or absence of these traits in genotypes. The objective of this research was to develop a procedure for identifying genetically modified soybean (Glycine max L. Merr. with resistance to the herbicide glyphosate. Two studies were conducted based on germination test. In the first study, soybean seeds were pre-imbibed in paper towel with the herbicide solutions, then transferred to moist paper towel for the germination test. In the second study, seeds were placed directly in herbicide solutions in plastic cups and tested for germination using the paper towel method. Eight soybean genotypes were compared: four Roundup Ready, that contained the gene resistant to the herbicide (G99-G725, Prichard RR, G99-G6682, and H7242 RR and four non-transgenic parental cultivars (Boggs, Haskell, Benning, and Prichard. In the first study, the seeds were imbibed for 16 hours at 25°C in herbicide concentrations between 0.0 and 1.5% of the glyphosate active ingredient. In the second, seeds were subjected to concentrations between 0.0 and 0.48%, for one hour, at 30°C. The evaluation parameters were: germination, hypocotyl length, root length and total length of the seedlings. Both methods are efficient in identifying glyphosate-resistant soybean genotypes. It is possible to identify the genetically modified soybean genotypes after three days, by imbibing the seed in 0.12% herbicide solution, and after six days if the substrate is pre-imbibed in a 0.6% herbicide solution. The resistance trait was identified in all cultivars, independent of the initial physiological quality of the seed.

Changes in Amino Acid Profile in Roots of Glyphosate Resistant and Susceptible Soybean (Glycine max) Induced by Foliar Glyphosate Application.

Science.gov (United States)

Moldes, Carlos Alberto; Cantarelli, Miguel Angel; Camiña, José Manuel; Tsai, Siu Mui; Azevedo, Ricardo Antunes

2017-10-11

Amino acid profiles are useful to analyze the responses to glyphosate in susceptible and resistant soybean lines. Comparisons of profiles for 10 amino acids (Asp, Asn, Glu, Gln, Ser, His, Gly, Thr, Tyr, Leu) by HPLC in soybean roots were performed in two near isogenic pairs (four varieties). Foliar application of glyphosate was made to soybean plants after 5 weeks of seeding. Roots of four varieties were collected at 0 and 72 h after glyphosate application (AGA) for amino acid analysis by HPLC. Univariate analysis showed a significant increase of several amino acids in susceptible as well as resistant soybean lines; however, amino acids from the major pathways of carbon (C) and nitrogen (N) metabolism, such as Asp, Asn, Glu and Gln, and Ser, increased significantly in susceptible varieties at 72 h AGA. Multivariate analysis using principal component analysis (2D PCA and 3D PCA) allowed different groups to be identified and discriminated based on the soybean genetic origin, showing the amino acid responses on susceptible and resistant varieties. Based on the results, it is possible to infer that the increase of Asn, Asp, Glu, Gln, and Ser in susceptible varieties would be related to the deregulation of C and N metabolism, as well as changes in the growth mechanisms regulated by Ser.

Multiple resistance to glyphosate, paraquat and ACCase-inhibiting herbicides in Italian ryegrass populations from California: confirmation and mechanisms of resistance.

Science.gov (United States)

Tehranchian, Parsa; Nandula, Vijay; Jugulam, Mithila; Putta, Karthik; Jasieniuk, Marie

2018-04-01

Glyphosate, paraquat and acetyl CoA carboxylase (ACCase)-inhibiting herbicides are widely used in California annual and perennial cropping systems. Recently, glyphosate, paraquat, and ACCase- and acetolactate synthase (ALS)-inhibitor resistance was confirmed in several Italian ryegrass populations from the Central Valley of California. This research characterized the possible mechanisms of resistance. Multiple-resistant populations (MR1, MR2) are resistant to several herbicides from at least three modes of action. Dose-response experiments revealed that the MR1 population was 45.9-, 122.7- and 20.5-fold, and the MR2 population was 24.8-, 93.9- and 4.0-fold less susceptible to glyphosate, sethoxydim and paraquat, respectively, than the susceptible (Sus) population. Accumulation of shikimate in Sus plants was significantly greater than in MR plants 32 h after light pretreatments. Glyphosate resistance in MR plants was at least partially due to Pro106-to-Ala and Pro106-to-Thr substitutions at site 106 of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). EPSPS gene copy number and expression level were similar in plants from the Sus and MR populations. An Ile1781-to-Leu substitution in ACCase gene of MR plants conferred a high level of resistance to sethoxydim and cross-resistance to other ACCase-inhibitors. Radiolabeled herbicide studies and phosphorimaging indicated that MR plants had restricted translocation of 14 C-paraquat to untreated leaves compared to Sus plants. This study shows that multiple herbicide resistance in Italian ryegrass populations in California, USA, is due to both target-site and non-target-site resistance mechanisms. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Simulating the evolution of glyphosate resistance in grains farming in northern Australia.

Science.gov (United States)

Thornby, David F; Walker, Steve R

2009-09-01

The evolution of resistance to herbicides is a substantial problem in contemporary agriculture. Solutions to this problem generally consist of the use of practices to control the resistant population once it evolves, and/or to institute preventative measures before populations become resistant. Herbicide resistance evolves in populations over years or decades, so predicting the effectiveness of preventative strategies in particular relies on computational modelling approaches. While models of herbicide resistance already exist, none deals with the complex regional variability in the northern Australian sub-tropical grains farming region. For this reason, a new computer model was developed. The model consists of an age- and stage-structured population model of weeds, with an existing crop model used to simulate plant growth and competition, and extensions to the crop model added to simulate seed bank ecology and population genetics factors. Using awnless barnyard grass (Echinochloa colona) as a test case, the model was used to investigate the likely rate of evolution under conditions expected to produce high selection pressure. Simulating continuous summer fallows with glyphosate used as the only means of weed control resulted in predicted resistant weed populations after approx. 15 years. Validation of the model against the paddock history for the first real-world glyphosate-resistant awnless barnyard grass population shows that the model predicted resistance evolution to within a few years of the real situation. This validation work shows that empirical validation of herbicide resistance models is problematic. However, the model simulates the complexities of sub-tropical grains farming in Australia well, and can be used to investigate, generate and improve glyphosate resistance prevention strategies.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Tolerance of Glyphosate-Resistant Maize to Glyphosate Plus MCPA Amine Is Influenced by Dose and Timing

Directory of Open Access Journals (Sweden)

Nader Soltani

2015-01-01

Full Text Available There is little information on tolerance of glyphosate-resistant maize to glyphosate plus MCPA amine as influenced by dose and timing under Ontario environmental conditions. A total of seven field trials were conducted at various locations in Ontario, Canada, in 2011–2013 to evaluate tolerance of field maize to tank mixes of glyphosate (900 g a.e./ha plus MCPA amine (79, 158, 315, 630, 1260, 2520, or 5040 g a.e./ha at either the 4- or 8-leaf stage. The predicted dose of MCPA amine that caused 5, 10, and 20% injury was 339, 751, and 1914 g a.e./ha when applied to 4-leaf maize but only 64, 140, and 344 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% reduction in shoot dry weight of maize was 488, 844, and 1971 g a.e./ha when applied to 4-leaf maize and only 14, 136, and 616 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% yield reduction was 2557, 4247, and >5040 g a.e./ha when applied to 4-leaf maize and 184, 441, and 1245 g a.e./ha when applied to 8-leaf maize, respectively. Based on these results, glyphosate plus MCPA amine applied at the manufacturer’s recommended dose of 630 g a.e./ha applied to 4-leaf maize has potential to cause injury but the injury is transient with no significant reduction in yield. However, when glyphosate plus MCPA amine is applied to 8-leaf maize it has the potential to cause significant injury and yield loss in maize.

Forward selection for multiple resistance across the non-selective glyphosate, glufosinate and oxyfluorfen herbicides in Lolium weed species.

Science.gov (United States)

Fernández, Pablo; Alcántara, Ricardo; Osuna, María D; Vila-Aiub, Martin M; Prado, Rafael De

2017-05-01

In the Mediterranean area, Lolium species have evolved resistance to glyphosate after decades of continual use without other alternative chemicals in perennial crops (olive, citrus and vineyards). In recent years, oxyfluorfen alone or mixed with glyphosate and glufosinate has been introduced as a chemical option to control dicot and grass weeds. Dose-response studies confirmed that three glyphosate-resistant Lolium weed species (L. rigidum, L. perenne, L. multiflorum) collected from perennial crops in the Iberian Peninsula have also evolved resistance to glufosinate and oxyfluorfen herbicides, despite their recent introduction. Based on the LD 50 resistance parameter, the resistance factor was similar among Lolium species and ranged from 14- to 21-fold and from ten- to 12-fold for oxyfluorfen and glufosinate respectively. Similarly, about 14-fold resistance to both oxyfluorfen and glufosinate was estimated on average for the three Lolium species when growth reduction (GR 50 ) was assessed. This study identified oxyfluorfen resistance in a grass species for the first time. A major threat to sustainability of perennial crops in the Iberian Peninsula is evident, as multiple resistance to non-selective glyphosate, glufosinate and oxyfluorfen herbicides has evolved in L. rigidum, L. perenne and L. multiflorum weeds. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Flame retardant cotton fabrics by electron beam-induced polymerization of vinyl phosphonate oligomer

International Nuclear Information System (INIS)

Sawai, Takeshi; Ametani, Kazuo; Enomoto, Ichiro

1988-01-01

Vinyl phosphonate oligomer is presently used commercially as a cellulosic flame retardant in conjugation with N-methylol acrylamide, using a persulfate catalyst and a thermal cure. This combination can also be cured at room temperature with electron beams, as can the vinyl phosphonate alone. For the textile application, fixation of flame retardants by electron beams with low energy is one of the most promising applications. For the purpose of preparing flame resistant cotton fabrics such as bed sheets and pajamas, flame retardant curing of vinyl phosphonate oligomer on cotton fabrics was examined using electron beams from a self-sealed electron beam processor and gamma rays from a 60 Co source. A joint investigation was undertaken by the Tokyo Metropolitan Textile Research Institute and Tokyo Metropolitan Isotope Research Center to determine the feasibility of curing vinyl phosphonate oligomer on the cotton fabrics for textile finishing. (author)

Evaluation of glyphosate resistance in Arabidopsis thaliana expressing an altered target site EPSPS.

Science.gov (United States)

Sammons, R Douglas; You, Jinsong; Qi, Youlin; Flasinski, Stanislaw; Kavanaugh, Christina; Washam, Jeannie; Ostrander, Elizabeth; Wang, Dafu; Heck, Greg

2018-05-01

Glyphosate-resistant goosegrass has recently evolved and is homozygous for the double mutant of EPSPS (T 102 I, P 106 S or TIPS). These same mutations combined with EPSPS overexpression, have been used to create transgenic glyphosate-resistant crops. Arabidopsis thaliana (Wt EPSPS K i ∼ 0.5 μM) was engineered to express a variant AtEPSPS-T 102 I, P 106 A (TIPA K i = 150 μM) to determine the resistance magnitude for a more potent variant EPSPS that might evolve in weeds. Transgenic A. thaliana plants, homozygous for one, two or four copies of AtEPSPS-TIPA, had resistance (IC 50 values, R/S) as measured by seed production ranging from 4.3- to 16-fold. Plants treated in reproductive stage were male sterile with a range of R/S from 10.1- to 40.6-fold. A significant hormesis (∼ 63% gain in fresh weight) was observed for all genotypes when treated at the initiation of reproductive stage with 0.013 kg ha -1 . AtEPSPS-TIPA enzyme activity was proportional to copy number and correlated with resistance magnitude. A. thaliana, as a model weed expressing one copy of AtEPSPS-TIPA (300-fold more resistant), had only 4.3-fold resistance to glyphosate for seed production. Resistance behaved as a single dominant allele. Vegetative tissue resistance was 4.7-fold greater than reproductive tissue resistance and was linear with gene copy number. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

Pro-106-Ser mutation and EPSPS overexpression acting together simultaneously in glyphosate-resistant goosegrass (Eleusine indica).

Science.gov (United States)

Gherekhloo, Javid; Fernández-Moreno, Pablo T; Alcántara-de la Cruz, Ricardo; Sánchez-González, Eduardo; Cruz-Hipolito, Hugo E; Domínguez-Valenzuela, José A; De Prado, Rafael

2017-07-27

Glyphosate has been used for more than 15 years for weed management in citrus groves in the Gulf of Mexico, at up to 3-4 applications per year. Goosegrass (Eleusine indica (L.) Gaertn.) control has sometimes failed. In this research, the mechanisms governing three goosegrass biotypes (Ein-Or from an orange grove, and Ein-Pl1 and Ein-Pl2 from Persian lime groves) with suspected resistance to glyphosate were characterized and compared to a susceptible biotype (Ein-S). Dose-response and shikimate accumulation assays confirmed resistance of the resistant (R) biotypes. There were no differences in glyphosate absorption, but the R biotypes retained up to 62-78% of the herbicide in the treated leaf at 96 h after treatment (HAT), in comparison to the Ein-S biotype (36%). The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity in the Ein-Or and Ein-S biotypes was over 100-fold lower than the Ein-Pl1 and Ein-Pl2 ones. The latter showed a high EPSPS-basal activity, a mutation at Pro-106-Ser position in the EPSPS gene, and EPSPS overexpression. The EPSPS basal and EPSPS overexpression were positively correlated. The R goosegrass biotypes displayed poor glyphosate translocation. Furthermore, this grassweed showed, for the first time, two mechanisms at the target-site level (Pro-106-Ser mutation + EPSPS overexpression) acting together simultaneously against glyphosate.

Herbicidas alternativos para controle de biótipos de Conyza bonariensis e C. canadensis resistentes ao glyphosate Alternative herbicides to control glyphosate-resistant biotypes of Conyza bonariensis and C. canadensis

Directory of Open Access Journals (Sweden)

M.S. Moreira

2010-01-01

Full Text Available Após sucessivos anos, aplicações do herbicida glyphosate em pomares de citros no Estado de São Paulo selecionaram biótipos resistentes de Conyza bonariensis e C. canadensis. Na ocorrência de plantas daninhas resistentes em uma área agrícola, tornam-se necessárias mudanças nas práticas de manejo para obtenção de adequado controle das populações resistentes, bem como para a redução da pressão de seleção sobre outras espécies. Assim, este trabalho foi realizado com o objetivo de identificar herbicidas alternativos para controle de biótipos de Conyza spp. resistentes ao herbicida glyphosate, com aplicações em diferentes estádios fenológicos da planta daninha. Três experimentos foram conduzidos em campo, em pomares de citros em formação, sobre plantas de buva em estádio fenológico de dez folhas e no pré-florescimento. Para plantas no estádio de dez folhas, controle satisfatório foi obtido com aplicações de glyphosate + bromacil + diuron (1.440 + 1.200 + 1.200 g ha-1, glyphosate + atrazina (1.440 + 1.500 g ha-1 e glyphosate + diuron (1.440 + 1.500 g ha-1. Quando em estádio de pré-florescimento de Conyza spp., a aplicação do herbicida amônio-glufosinato, na dose de 400 g ha-1, isolado ou associado a MSMA, bromacil+diuron, metsulfuron, carfentrazone e paraquat, foi a alternativa viável para controle dos biótipos resistentes ao glyphosate.After successive years, glyphosate applications on São Paulo-Brazil citrus orchards selected resistant biotypes of Conyza bonariensis and C. canadensis. The occurrence of herbicide-resistant weed biotypes at some agricultural area makes it necessary to change the management practices to reach effective control of the selected resistant populations, as well as to reduce selection pressure on the other species. Thus, this work aimed to identify the alternative herbicides to control glyphosate-resistant biotypes of Conyza spp., with applications at different weed phenological

Perspectives on transgenic, herbicide-resistant crops in the United States almost 20 years after introduction.

Science.gov (United States)

Duke, Stephen O

2015-05-01

Herbicide-resistant crops have had a profound impact on weed management. Most of the impact has been by glyphosate-resistant maize, cotton, soybean and canola. Significant economic savings, yield increases and more efficacious and simplified weed management have resulted in widespread adoption of the technology. Initially, glyphosate-resistant crops enabled significantly reduced tillage and reduced the environmental impact of weed management. Continuous use of glyphosate with glyphosate-resistant crops over broad areas facilitated the evolution of glyphosate-resistant weeds, which have resulted in increases in the use of tillage and other herbicides with glyphosate, reducing some of the initial environmental benefits of glyphosate-resistant crops. Transgenic crops with resistance to auxinic herbicides, as well as to herbicides that inhibit acetolactate synthase, acetyl-CoA carboxylase and hydroxyphenylpyruvate dioxygenase, stacked with glyphosate and/or glufosinate resistance, will become available in the next few years. These technologies will provide additional weed management options for farmers, but will not have all of the positive effects (reduced cost, simplified weed management, lowered environmental impact and reduced tillage) that glyphosate-resistant crops had initially. In the more distant future, other herbicide-resistant crops (including non-transgenic ones), herbicides with new modes of action and technologies that are currently in their infancy (e.g. bioherbicides, sprayable herbicidal RNAi and/or robotic weeding) may affect the role of transgenic, herbicide-resistant crops in weed management. Published 2014. This article is a U.S. Government work and is in the public domain in the USA. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

Cell suspension culture-mediated incorporation of the rice bel gene into transgenic cotton.

Directory of Open Access Journals (Sweden)

Liping Ke

Full Text Available Cotton plants engineered for resistance to the herbicides, glyphosate or glufosinate have made a considerable impact on the production of the crop worldwide. In this work, embryogenic cell cultures derived from Gossypium hirsutum L. cv Coker 312 hypocotyl callus were transformed via Agrobacterium tumefaciens with the rice cytochrome P450 gene, CYP81A6 (bel. In rice, bel has been shown to confer resistance to both bentazon and sulfanylurea herbicides. Transformed cells were selected on a liquid medium supplemented alternately or simultaneously with kanamycin (50mg/L and bentazon (4.2 µmol. A total of 17 transgenic cotton lines were recovered, based on the initial resistance to bentazon and on PCR detection of the bel transgene. Bel integration into the cotton genome was confirmed by Southern blot and expression of the transgene was verified by RT-PCR. In greenhouse and experimental plot trials, herbicide (bentazon tolerance of up to 1250 mg/L was demonstrated in the transgenic plants. Transgenic lines with a single copy of the bel gene showed normal Mendelian inheritance of the characteristic. Importantly, resistance to bentazon was shown to be stably incorporated in the T1, T2 and T3 generations of self-fertilised descendents and in plants outcrossed to another upland cotton cultivar. Engineering resistance to bentazon in cotton through the heterologous expression of bel opens the possibility of incorporating this trait into elite cultivars, a strategy that would give growers a more flexible alternative to weed management in cotton crops.

Environmental and health effects of the herbicide glyphosate.

Science.gov (United States)

Van Bruggen, A H C; He, M M; Shin, K; Mai, V; Jeong, K C; Finckh, M R; Morris, J G

2018-03-01

The herbicide glyphosate, N-(phosphonomethyl) glycine, has been used extensively in the past 40years, under the assumption that side effects were minimal. However, in recent years, concerns have increased worldwide about the potential wide ranging direct and indirect health effects of the large scale use of glyphosate. In 2015, the World Health Organization reclassified glyphosate as probably carcinogenic to humans. A detailed overview is given of the scientific literature on the movement and residues of glyphosate and its breakdown product aminomethyl phosphonic acid (AMPA) in soil and water, their toxicity to macro- and microorganisms, their effects on microbial compositions and potential indirect effects on plant, animal and human health. Although the acute toxic effects of glyphosate and AMPA on mammals are low, there are animal data raising the possibility of health effects associated with chronic, ultra-low doses related to accumulation of these compounds in the environment. Intensive glyphosate use has led to the selection of glyphosate-resistant weeds and microorganisms. Shifts in microbial compositions due to selective pressure by glyphosate may have contributed to the proliferation of plant and animal pathogens. Research on a link between glyphosate and antibiotic resistance is still scarce but we hypothesize that the selection pressure for glyphosate-resistance in bacteria could lead to shifts in microbiome composition and increases in antibiotic resistance to clinically important antimicrobial agents. We recommend interdisciplinary research on the associations between low level chronic glyphosate exposure, distortions in microbial communities, expansion of antibiotic resistance and the emergence of animal, human and plant diseases. Independent research is needed to revisit the tolerance thresholds for glyphosate residues in water, food and animal feed taking all possible health risks into account. Copyright © 2017 Elsevier B.V. All rights reserved.

How glyphosate affects plant disease development: it is more than enhanced susceptibility.

Science.gov (United States)

Hammerschmidt, Ray

2018-05-01

Glyphosate has been shown to affect the development of plant disease in several ways. Plants utilize phenolic and other shikimic acid pathway-derived compounds as part of their defense against pathogens, and glyphosate inhibits the biosynthesis of these compounds via its mode of action. Several studies have shown a correlation between enhanced disease and suppression of phenolic compound production after glyphosate. Glyphosate-resistant crop plants have also been studied for changes in resistance as a result of carrying the glyphosate resistance trait. The evidence indicates that neither the resistance trait nor application of glyphosate to glyphosate-resistant plants increases susceptibility to disease. The only exceptions to this are cases where glyphosate has been shown to reduce rust diseases on glyphosate-resistant crops, supporting a fungicidal role for this chemical. Finally, glyphosate treatment of weeds or volunteer crops can cause a temporary increase in soil-borne pathogens that may result in disease development if crops are planted too soon after glyphosate application. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Herbicide-resistant crops: utilities and limitations for herbicide-resistant weed management.

Science.gov (United States)

Green, Jerry M; Owen, Micheal D K

2011-06-08

Since 1996, genetically modified herbicide-resistant (HR) crops, particularly glyphosate-resistant (GR) crops, have transformed the tactics that corn, soybean, and cotton growers use to manage weeds. The use of GR crops continues to grow, but weeds are adapting to the common practice of using only glyphosate to control weeds. Growers using only a single mode of action to manage weeds need to change to a more diverse array of herbicidal, mechanical, and cultural practices to maintain the effectiveness of glyphosate. Unfortunately, the introduction of GR crops and the high initial efficacy of glyphosate often lead to a decline in the use of other herbicide options and less investment by industry to discover new herbicide active ingredients. With some exceptions, most growers can still manage their weed problems with currently available selective and HR crop-enabled herbicides. However, current crop management systems are in jeopardy given the pace at which weed populations are evolving glyphosate resistance. New HR crop technologies will expand the utility of currently available herbicides and enable new interim solutions for growers to manage HR weeds, but will not replace the long-term need to diversify weed management tactics and discover herbicides with new modes of action. This paper reviews the strengths and weaknesses of anticipated weed management options and the best management practices that growers need to implement in HR crops to maximize the long-term benefits of current technologies and reduce weed shifts to difficult-to-control and HR weeds.

Secondary effects of glyphosate on plants

Science.gov (United States)

Glyphosate is a unique herbicide with interesting secondary effects. Unfortunately, some have assumed that the secondary effects that occur in glyphosate-susceptible plants treated with glyphosate, such as altered mineral nutrition, reduced phenolic compound production and pathogen resistance, also ...

A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

Science.gov (United States)

Sharkhuu, Altanbadralt; Narasimhan, Meena L; Merzaban, Jasmeen S; Bressan, Ray A; Weller, Steve; Gehring, Chris

2014-01-01

Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide. PMID:24654847

A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

KAUST Repository

Sharkhuu, Altanbadralt; Narasimhan, Meena L.; Merzaban, Jasmeen; Bressan, Ray A.; Weller, Steve; Gehring, Christoph A

2014-01-01

Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide.

A red and far-red light receptor mutation confers resistance to the herbicide glyphosate

KAUST Repository

Sharkhuu, Altanbadralt

2014-06-01

Glyphosate is a widely applied broad-spectrum systemic herbicide that inhibits competitively the penultimate enzyme 5-enolpyruvylshikimate 3-phosphate synthase (EPSPS) from the shikimate pathway, thereby causing deleterious effects. A glyphosate-resistant Arabidopsis mutant (gre1) was isolated and genetic analyses indicated that a dysfunctional red (R) and far-red (FR) light receptor, phytochrome B (phyB), caused this phenotype. This finding is consistent with increased glyphosate sensitivity and glyphosate-induced shikimate accumulation in low R:FR light, and the induction of genes encoding enzymes of the shikimate pathway in high R:FR light. Expression of the shikimate pathway genes exhibited diurnal oscillation and this oscillation was altered in the phyB mutant. Furthermore, transcript analysis suggested that this diurnal oscillation was not only dependent on phyB but was also due to circadian regulatory mechanisms. Our data offer an explanation of the well documented observation that glyphosate treatment at various times throughout the day, with their specific composition of light quality and intensity, results in different efficiencies of the herbicide.

Fitness Outcomes Related to Glyphosate Resistance in Kochia (Kochia scoparia: What Life History Stage to Examine?

Directory of Open Access Journals (Sweden)

Omobolanle Adewale Osipitan

2017-06-01

Full Text Available A fast-spreading weed, kochia (Kochia scoparia, has developed resistance to the widely-used herbicide, glyphosate. Understanding the relationship between the occurrence of glyphosate resistance caused by multiple EPSPS gene copies and kochia fitness may suggest a more effective way of controlling kochia. A study was conducted to assess fitness cost of glyphosate resistance compared to susceptibility in kochia populations at different life history stages, that is rate of seed germination, increase in plant height, days to flowering, biomass accumulation at maturity, and fecundity. Six kochia populations from Scott, Finney, Thomas, Phillips, Wallace, and Wichita counties in western Kansas were characterized for resistance to field-use rate of glyphosate and with an in vivo shikimate accumulation assay. Seed germination was determined in growth chambers at three constant temperatures (5, 10, and 15 C while vegetative growth and fecundity responses were evaluated in a field study using a target-neighborhood competition design in 2014 and 2015. One target plant from each of the six kochia populations was surrounded by neighboring kochia densities equivalent to 10 (low, 35 (moderate, or 70 (high kochia plants m−2. In 2015, neighboring corn densities equivalent to 10 and 35 plants m−2 were also evaluated. Treatments were arranged in a randomized complete block design with at least 7 replications. Three kochia populations were classified as glyphosate-resistant (GR [Scott (SC-R, Finney (FN-R, and Thomas (TH-R] and three populations were classified as glyphosate-susceptible (GS [Phillips (PH-S, Wallace (WA-S and Wichita (WI-S]. Of the life history stages measured, fitness differences between the GR and GS kochia populations were consistently found in their germination characteristics. The GR kochia showed reduced seed longevity, slower germination rate, and less total germination than the GS kochia. In the field, increases in plant height, biomass

Problems and achievements of cotton (Gossypium Hirsutum L. weeds control

Directory of Open Access Journals (Sweden)

T. Barakova

2017-09-01

Full Text Available Abstract. Weed control in the cultivation of cotton is critical to the yield and quality of production. The influence of economically important weeds was studied. Chemical control is the most effective method of weed control in cotton but much of the information on it relates to primary weed infestation. Problems with primary weed infestation in cotton have been solved to a significant extent. The question of secondary weed infestation with annual and perennial graminaceous weeds during the period of cotton vegetation is also determined largely by the use of antigraminaceous herbicides. The data related to herbicides to effectively control secondary germinated broadleaf weeds in conventional technology for cotton growing are quite scarce, even globally. We are still seeking effective herbicides for control of these weeds in cotton crops. Studies on their influence on the sowing characteristics of cotton seed and the quality of cotton fiber are still insufficient. In the scientific literature there is not enough information on these questions. The combinations of herbicides, as well as their tank mixtures with fertilizers or plant growth regulators are more efficient than autonomous application. Often during their combined application higher synergistic effect on yield is produced. There is information about cotton cultivars resistant to glyphosate. These cultivars are GMO and they are banned within the European Union, including Bulgaria.

Integrated Palmer Amaranth Management in Glufosinate-Resistant Cotton: II. Primary, Secondary and Conservation Tillage

Directory of Open Access Journals (Sweden)

Michael G. Patterson

2013-01-01

Full Text Available A three year field experiment was conducted to evaluate the role of soil inversion, cover crops and spring tillage methods for Palmer amaranth between-row (BR and within-row (WR management in glufosinate-resistant cotton. Main plots were two soil inversion treatments: fall inversion tillage (IT and non-inversion tillage (NIT. Subplots were three cover treatments: crimson clover, cereal rye or none (i.e., winter fallow; and the sub subplots were four secondary spring tillage methods: disking followed by (fb cultivator (DCU, disking fb chisel plow (DCH, disking fb disking (DD and no tillage (NT. Averaged over years and soil inversion, the crimson clover produced maximum cover biomass (4390 kg ha−1 fb cereal rye (3698 kg ha−1 and winter fallow (777 kg ha−1. Two weeks after planting (WAP and before the postemergence (POST application, Palmer amaranth WR and BR density were two- and four-times less, respectively, in IT than NIT. Further, Palmer amaranth WR and BR density were reduced two-fold following crimson clover and cereal rye than following winter fallow at 2 WAP. Without IT, early season Palmer amaranth densities were 40% less following DCU, DCH and DD, when compared with IT. Following IT, no spring tillage method improved Palmer amaranth control. The timely application of glufosinate + S-metolachlor POST tank mixture greatly improved Palmer amaranth control in both IT and NIT systems. The highest cotton yields were obtained with DD following cereal rye (2251 kg ha−1, DD following crimson clover (2213 kg ha−1 and DD following winter fallow (2153 kg ha−1. On average, IT cotton yields (2133 kg ha−1 were 21% higher than NIT (1766 kg ha−1. Therefore, from an integrated weed management standpoint, an occasional fall IT could greatly reduce Palmer amaranth emergence on farms highly infested with glyphosate-resistant Palmer amaranth. In addition, a cereal rye or crimson clover cover crop can effectively reduce early season Palmer

Engineering cotton (Gossypium hirsutum L.) for resistance to cotton leaf curl disease using viral truncated AC1 DNA sequences.

Science.gov (United States)

Hashmi, Jamil A; Zafar, Yusuf; Arshad, Muhammad; Mansoor, Shahid; Asad, Shaheen

2011-04-01

Several important biological processes are performed by distinct functional domains found on replication-associated protein (Rep) encoded by AC1 of geminiviruses. Two truncated forms of replicase (tAC1) gene, capable of expressing only the N-terminal 669 bp (5'AC1) and C-terminal 783 bp (3'AC1) nucleotides cloned under transcriptional control of the CaMV35S were introduced into cotton (Gossypium hirsutum L.) using LBA4404 strain of Agrobacterium tumefaciens to make use of an interference strategy for impairing cotton leaf curl virus (CLCuV) infection in transgenic cotton. Compared with nontransformed control, we observed that transgenic cotton plants overexpressing either N-terminal (5'AC1) or C-terminal (3'AC1) sequences confer resistance to CLCuV by inhibiting replication of viral genomic and β satellite DNA components. Molecular analysis by Northern blot hybridization revealed high transgene expression in early and late growth stages associated with inhibition of CLCuV replication. Of the eight T(1) transgenic lines tested, six had delayed and minor symptoms as compared to nontransformed control lines which developed disease symptoms after 2-3 weeks of whitefly-mediated viral delivery. Virus biological assay and growth of T(2) plants proved that transgenic cotton plants overexpressing 5'- and 3'AC1 displayed high resistance level up to 72, 81%, respectively, as compared to non-transformed control plants following inoculation with viruliferous whiteflies giving significantly high cotton seed yield. Progeny analysis of these plants by polymerase chain reaction (PCR), Southern blotting and virus biological assay showed stable transgene, integration, inheritance and cotton leaf curl disease (CLCuD) resistance in two of the eight transgenic lines having single or two transgene insertions. Transgenic cotton expressing partial AC1 gene of CLCuV can be used as virus resistance source in cotton breeding programs aiming to improve virus resistance in cotton crop.

Chemical control of different Digitaria insularis populations and management of a glyphosate-resistant population

OpenAIRE

CORREIA,N.M.; ACRA,L.T.; BALIEIRO,G.

2015-01-01

This study aimed to control different populations of Digitaria insularisby glyphosate herbicide, isolated and mixed, besides the combination of methods (chemical and mechanical) to manage resistant adult plants. Three experiments were conducted, one in pots which were maintained under non-controlled conditions and two under field conditions. In the experiment in pots, twelve populations of D. insularis were sprayed with isolated glyphosate (1.44 and 2.16 kg a.e. ha-1) and mixed (1.44 and 2.16...

Differential response of two sourgrass populations to glyphosate

Directory of Open Access Journals (Sweden)

São Paulo State University, Jaboticabal, SP, Brazil

2013-02-01

Full Text Available The repetitive use of glyphosate may cause increase on the resistance of sourgrass (Digitaria insularis through mechanisms of natural selection. The aim of this study was to verify the response of two populations of sourgrass (one collected from nonagricultural area and the other one from area suspected of glyphosate resistance to increasing doses of glyphosate. The experimental design was completely randomized with four repetitions. For both populations, glyphosate was sprayed at 10 doses (0D, D/16, D/8, D/4, D/2, D, 2D, 4D, 8D, and 16D; so that D is the dose of 1.08 kg e.a. ha-1. The treatments were sprayed when the plants had shown 3-5 tillers. The population collected in the nonagricultural area was slightly more sensible to the herbicide glyphosate than the population originated from an area where the herbicide application is common, not indicating glyphosate resistance.

Resistance to glufosinate is proportional to phosphinothricin acetyltransferase expression and activity in LibertyLink(®) and WideStrike(®) cotton.

Science.gov (United States)

Carbonari, Caio A; Latorre, Débora O; Gomes, Giovanna L G C; Velini, Edivaldo D; Owens, Daniel K; Pan, Zhiqiang; Dayan, Franck E

2016-04-01

Insertion of the gene encoding phosphinothricin acetyltransferase (PAT) has resulted in cotton plants resistant to the herbicide glufosinate. However, the lower expression and commensurate reduction in PAT activity is a key factor in the low level of injury observed in the WideStrike(®) cotton and relatively high level of resistance observed in LibertyLink(®) cotton. LibertyLink(®) cotton cultivars are engineered for glufosinate resistance by overexpressing the bar gene that encodes phosphinothricin acetyltransferase (PAT), whereas the insect-resistant WideStrike(®) cultivars were obtained using the similar pat gene as a selectable marker. The latter cultivars carry some level of resistance to glufosinate which enticed certain farmers to select this herbicide for weed control with WideStrike(®) cotton. The potency of glufosinate on conventional FM 993, insect-resistant FM 975WS, and glufosinate-resistant IMACD 6001LL cotton cultivars was evaluated and contrasted to the relative levels of PAT expression and activity. Conventional cotton was sensitive to glufosinate. The single copy of the pat gene present in the insect-resistant cultivar resulted in very low RNA expression of the gene and undetectable PAT activity in in vitro assays. Nonetheless, the presence of this gene provided a good level of resistance to glufosinate in terms of visual injury and effect on photosynthetic electron transport. The injury is proportional to the amount of ammonia accumulation. The strong promoter associated with bar expression in the glufosinate-resistant cultivar led to high RNA expression levels and PAT activity which protected this cultivar from glufosinate injury. While the insect-resistant cultivar demonstrated a good level of resistance to glufosinate, its safety margin is lower than that of the glufosinate-resistant cultivar. Therefore, farmers should be extremely careful in using glufosinate on cultivars not expressly designed and commercialized as resistant to this

Identificação de biótipos de azevém (Lolium multiflorum resistentes ao herbicida glyphosate em pomares de maçã Identification of glyphosate-resistant ryegrass (Lolium multiflorum biotypes in apple orchards

Directory of Open Access Journals (Sweden)

L. Vargas

2004-12-01

Full Text Available O glyphosate é um herbicida de amplo espectro utilizado há mais de 15 anos em pomares de maçã na região de Vacaria-RS, para manejo da vegetação nas linhas da cultura. São realizadas, em geral, três a quatro aplicações por ciclo e a dose normalmente utilizada é de 720 a 1.080 g e.a. ha-1 de glyphosate (2 a 3 L ha-1 do produto comercial. O azevém (Lolium multiflorum é uma planta daninha comum em pomares e, tradicionalmente, sensível ao glyphosate. Entretanto, nos últimos anos a ocorrência de plantas de azevém que, após receberem o tratamento com glyphosate, não manifestam sintomas significativos de toxicidade sugere que elas adquiriram resistência ao produto. Assim, com o objetivo de avaliar a resposta de uma população de plantas de azevém ao glyphosate, foram realizados três experimentos: um em campo e dois em casa de vegetação. No experimento em campo os tratamentos avaliados constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880, 5.760 e 11.520 g e.a. ha-1, e os herbicidas paraquat, glufosinate, haloxyfop e diclofop foram empregados como produtos-padrão, aplicados em dois estádios vegetativos do azevém. No experimento em casa de vegetação, os tratamentos constaram de doses crescentes de glyphosate (0, 360, 720, 1.440, 2.880 e 5.760 g e.a. ha-1 mais os herbicidas testemunhas, aplicados sobre plantas do biótipo considerado resistente e de um sensível. No segundo experimento realizado em casa de vegetação foram avaliados tratamentos contendo glyphosate (720, 1.440, 2.880, 720 + 720 e 720 + 1.440 g e.a. ha-1, em aplicações únicas e seqüenciais, mais os herbicidas paraquat, glufosinate, haloxyfop, clethodim, sethoxydim, diclofop, fenoxaprop, fluazifop, paraquat + diuron, atrazine + simazine, trifluralin e metolachlor. A toxicidade dos tratamentos herbicidas foi avaliada aos 15, 30 e 45 DAT (dias após tratamento. Os resultados obtidos nos experimentos em campo e em casa de vegetação, de forma

Transgene escape and persistence in an agroecosystem: the case of glyphosate-resistant Brassica rapa L. in central Argentina.

Science.gov (United States)

Pandolfo, Claudio E; Presotto, Alejandro; Carbonell, Francisco Torres; Ureta, Soledad; Poverene, Mónica; Cantamutto, Miguel

2018-03-01

Brassica rapa L. is an annual Brassicaceae species cultivated for oil and food production, whose wild form is a weed of crops worldwide. In temperate regions of South America and especially in the Argentine Pampas region, this species is widely distributed. During 2014, wild B. rapa populations that escaped control with glyphosate applications by farmers were found in this area. These plants were characterized by morphology and seed acidic profile, and all the characters agreed with B. rapa description. The dose-response assays showed that the biotypes were highly resistant to glyphosate. It was also shown that they had multiple resistance to AHAS-inhibiting herbicides. The transgenic origin of the glyphosate resistance in B. rapa biotypes was verified by an immunological test which confirmed the presence of the CP4 EPSPS protein and by an event-specific GT73 molecular marker. The persistence of the transgene in nature was confirmed for at least 4 years, in ruderal and agrestal habitats. This finding suggests that glyphosate resistance might come from GM oilseed rape crops illegally cultivated in the country or as a seed contaminant, and it implies gene flow and introgression between feral populations of GM B. napus and wild B. rapa. The persistence and spread of the resistance in agricultural environments was promoted by the high selection pressure imposed by intensive herbicide usage in the prevalent no-till farming systems.

The multi-year effects of repeatedly growing cotton with moderate resistance to Meloidogyne incognita

Science.gov (United States)

Kemerait, Robert C.

2009-01-01

Meloidogyne incognita causes more damage to cotton in the US than any other pathogen. The objective of this study was to document the cumulative effect of moderate resistance on M. incognita population density, root galling, and yield suppression in the southern United States on a moderately resistant cotton genotype grown continuously for three years. Cotton genotypes were Phytogen PH98-3196 (77% suppression of M. incognita), Acala NemX (85% suppression of M. incognita), and Delta and Pine Land DP458 B/R (susceptible standard, 0% suppression). Cotton was grown in fumigated and non-fumigated plots to measure yield loss. Each genotype and nematicide combination was planted in the same place for three years at two sites to document cumulative effects. In 2006, following three years of the different genotypes, all plots at one site were planted with susceptible cotton to document residual effects of planting resistant genotypes. Root galling and nematode population densities in the soil were significantly lower, and percentage yield suppression was numerically lower, when moderately resistant cotton was grown compared to the susceptible standard in both fields in all three years. Differences between susceptible and moderately resistant genotypes are established quickly (after only one season) and then either maintained at similar levels or slightly increased in subsequent years depending on initial nematode levels. However, when susceptible cotton was grown following three years of the moderately resistant genotypes, the nematode suppression provided by moderate resistance was undetectable by the end of the first season. Moderately resistant cotton genotypes are more beneficial than previously reported and should be pursued for nematode management. Rotation of moderately resistant and susceptible cotton could be used along with nematicides to manage root-knot nematodes in a continuous cotton cropping system and reduce selection pressure on the nematodes. PMID:22661787

Limited uptake, translocation and enhanced metabolic degradation contribute to glyphosate tolerance in Mucuna pruriens var. utilis plants.

Science.gov (United States)

Rojano-Delgado, Antonia María; Cruz-Hipolito, Hugo; De Prado, Rafael; Luque de Castro, María Dolores; Franco, Antonio Rodríguez

2012-01-01

Velvet bean (Mucuna pruriens, Fabaceae) plants exhibits an innate, very high resistance (i.e., tolerance) to glyphosate similar to that of plants which have acquired resistance to this herbicide as a trait. We analyzed the uptake of [(14)C]-glyphosate by leaves and its translocation to meristematic tissues, and used scanning electron micrographs to further analyze the cuticle and 3D capillary electrophoresis to investigate a putative metabolism capable of degrading the herbicide. Velvet bean exhibited limited uptake of glyphosate and impaired translocation of the compound to meristematic tissues. Also, for the first time in a higher plant, two concurrent pathways capable of degrading glyphosate to AMPA, Pi, glyoxylate, sarcosine and formaldehyde as end products were identified. Based on the results, the innate tolerance of velvet bean to glyphosate is possibly a result of the combined action of the previous three traits, namely: limited uptake, impaired translocation and enhanced degradation. Copyright © 2011 Elsevier Ltd. All rights reserved.

Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

Science.gov (United States)

Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

2018-07-01

The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

Herbicide Glyphosate Impact to Earthworm (E. fetida

Directory of Open Access Journals (Sweden)

Greta Dajoraitė

2016-10-01

Full Text Available Glyphosate is a broad spectrum weed resistant herbicide. Glyphosate may pose negative impact on land ecosystems because of wide broad usage and hydrofilic characteristic. The aim of this study was to investigate negative effects of glyphosate on soil invertebrate organisms (earthworm Eisenia fetida. The duration of experiment was 8 weeks. The range of the test concentrations of glyphosate were: 0,1, 1, 5, 10, 20 mg/kg. To investigate the glyphosate impact on earthworm Eisenia fetida the following endpoints were measured: survival, reproduction and weight. The exposure to 20 mg/kg glyphosate has led to the 100% mortality of earthworms. Glyphosate has led to decreased E. fetida reproduction, the cocoons were observed only in the lowest concentration (0,1 mg/kg. In general: long-term glyphosate toxicity to earthworms (E. fetida may be significant.

Manejo de Conyza bonariensis resistente ao glyphosate: coberturas de inverno e herbicidas em pré-semeadura da soja Management of glyphosate resistant Conyza bonariensis: winter cover crops and herbicides in soybean pre-seeding

Directory of Open Access Journals (Sweden)

F.P. Lamego

2013-06-01

Full Text Available Conyza bonariensis tornou-se a principal planta daninha da cultura da soja no Sul do Brasil, em decorrência da evolução para resistência ao herbicida glyphosate. O objetivo deste trabalho foi avaliar o efeito de diferentes coberturas de inverno e da associação de manejo de dessecação pré-semeadura da soja, visando ao controle de C. bonariensis resistente ao glyphosate. Um experimento foi conduzido em campo, na safra 2010/2011. Os tratamentos foram conduzidos em esquema de parcelas subdivididas, em que as coberturas de inverno foram alocadas nas parcelas principais: aveia-preta, nabo, ervilhaca, azevém, trigo e pousio. Nas subparcelas, foram alocados os tratamentos de manejo de dessecação pré-semeadura da soja: glyphosate (720 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha‑1 e roçada. O nabo foi a espécie de cobertura que produziu o maior volume de massa seca durante o inverno, enquanto a ervilhaca foi a que apresentou maior efeito supressor sobre a germinação e o desenvolvimento inicial de C. bonariensis. Associações de glyphosate com 2,4-D ou chlorimuron-ethyl, seguidas da aplicação sequencial de paraquat + diuron, causaram maior redução na infestação de C. bonariensis.Conyza bonariensis became the main weed in soybean crop in Southern Brazil, as a consequence of the evolution of resistance to the herbicide glyphosate. The objective of this work was to evaluate the effect of different winter cover crops and the association of burn-down herbicides on the control of glyphosate-resistant C. bonariensis. A field experiment was conducted in the 2010/2011 season. The treatments were arranged in a split-plot scheme, with the winter

Fitness of Bt-resistant cabbage loopers on Bt cotton plants.

Science.gov (United States)

Tetreau, Guillaume; Wang, Ran; Wang, Ping

2017-10-01

Development of resistance to the insecticidal toxins from Bacillus thuringiensis (Bt) in insects is the major threat to the continued success of transgenic Bt crops in agriculture. The fitness of Bt-resistant insects on Bt and non-Bt plants is a key parameter that determines the development of Bt resistance in insect populations. In this study, a comprehensive analysis of the fitness of Bt-resistant Trichoplusia ni strains on Bt cotton leaves was conducted. The Bt-resistant T. ni strains carried two genetically independent mechanisms of resistance to Bt toxins Cry1Ac and Cry2Ab. The effects of the two resistance mechanisms, individually and in combination, on the fitness of the T. ni strains on conventional non-Bt cotton and on transgenic Bt cotton leaves expressing a single-toxin Cry1Ac (Bollgard I) or two Bt toxins Cry1Ac and Cry2Ab (Bollgard II) were examined. The presence of Bt toxins in plants reduced the fitness of resistant insects, indicated by decreased net reproductive rate (R 0 ) and intrinsic rate of increase (r). The reduction in fitness in resistant T. ni on Bollgard II leaves was greater than that on Bollgard I leaves. A 12.4-day asynchrony of adult emergence between the susceptible T. ni grown on non-Bt cotton leaves and the dual-toxin-resistant T. ni on Bollgard II leaves was observed. Therefore, multitoxin Bt plants not only reduce the probability for T. ni to develop resistance but also strongly reduce the fitness of resistant insects feeding on the plants. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Effect of chitosan on resist printing of cotton fabrics with reactive dyes

African Journals Online (AJOL)

The concentration of chitosan, types of resist agent, curing temperature and curing time were varied to determine their effects on resist-printed cotton fabrics. An optimal chitosan concentration of 1.6% resulted in the greatest resist effect on printed cotton fabrics. For mixtures, a 6:4 ratio of citric acid : chitosan and an 8:2 ...

Simulating changes in cropping practises in conventional and glyphosate-tolerant maize. I. Effects on weeds.

Science.gov (United States)

Colbach, Nathalie; Fernier, Alice; Le Corre, Valérie; Messéan, Antoine; Darmency, Henri

2017-04-01

Herbicide-tolerant (HT) crops such as those tolerant to glyphosate simplify weed management and make it more efficient, at least at short-term. Overreliance on the same herbicide though leads to the spread of resistant weeds. Here, the objective was to evaluate, with simulations, the impact on the advent of glyphosate resistance in weeds of modifications in agricultural practises resulting from introducing HT maize into cropping systems. First, we included a single-gene herbicide resistance submodel in the existing multispecific FLORSYS model. Then, we (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, (2) compared these systems in terms of glyphosate resistance, (3) identified pertinent cultural practises influencing glyphosate resistance, and (4) investigated correlations between cultural practises and species traits, using RLQ analyses. The simulation study showed that, during the analysed 28 years, (1) glyphosate spraying only results in glyphosate resistance in weeds when combined with other cultural factors favouring weed infestation, particularly no till; (2) pre-sowing glyphosate applications select more for herbicide resistance than post-sowing applications on HT crops; and (3) glyphosate spraying selects more for species traits avoiding exposure to the herbicide (e.g. delayed early growth, small leaf area) or compensating for fitness costs (e.g. high harvest index) than for actual resistance to glyphosate, (4) actual resistance is most frequent in species that do not avoid glyphosate, either via plant size or timing, and/or in less competitive species, (5) in case of efficient weed control measures, actual resistance proliferates best in outcrossing species. An advice table was built, with the quantitative, synthetic ranking of the crop management effects in terms of glyphosate-resistance management, identifying the optimal choices for each management technique.

Oxidative stress in duckweed (Lemna minor L.) induced by glyphosate: Is the mitochondrial electron transport chain a target of this herbicide?

Science.gov (United States)

Gomes, Marcelo Pedrosa; Juneau, Philippe

2016-11-01

We investigated the physiological responses of Lemna minor plants exposed to glyphosate. The deleterious effects of this herbicide on photosynthesis, respiration, and pigment concentrations were related to glyphosate-induced oxidative stress through hydrogen peroxide (H 2 O 2 ) accumulation. By using photosynthetic and respiratory electron transport chain (ETC) inhibitors we located the primary site of reactive oxygen species (ROS) production in plants exposed to 500 mg glyphosate l -1 . Inhibition of mitochondrial ETC Complex I by rotenone reduced H 2 O 2 concentrations in glyphosate-treated plants. Complex III activity was very sensitive to glyphosate which appears to act much like antimycin A (an inhibitor of mitochondrial ETC Complex III) by shunting electrons from semiquinone to oxygen, with resulting ROS formation. Confocal evaluations for ROS localization showed that ROS are initially produced outside of the chloroplasts upon initial glyphosate exposure. Our results indicate that in addition to interfering with the shikimate pathway, glyphosate can induce oxidative stress in plants through H 2 O 2 formation by targeting the mitochondrial ETC, which would explain its observed effects on non-target organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

Controle químico de biótipos de buva (Conyza canadensis e Conyza bonariensis resistentes ao glyphosate Chemical Control of glyphosate-resistant horseweed (Conyza Canadensis and hairy fleabane (Conyza bonariensis biotypes

Directory of Open Access Journals (Sweden)

Micheli Satomi Yamauti

2010-09-01

Full Text Available Estudos foram conduzidos na Estação Experimental de Citricultura de Bebedouro, SP para avaliar a resposta de biótipos de buva resistentes aos herbicidas glyphosate, bromacil + diuron, diuron e paraquat isolados e em mistura, e o efeito de uma aplicação seqüencial com glyphosate. O delineamento foi o de blocos casualizados com quatro repetições e sete tratamentos.. Os herbicidas foram aplicados com pulverizador costal, à pressão constante (mantido por CO2 comprimido, munido com barra com três bicos do tipo TT110015 com um consumo de calda equivalente a 150 L ha-1. O controle foi avaliado visualmente, através de escala percentual de notas. Para o controle geral das plantas daninhas os melhores resultados foram obtidos com diuron isolado e com glyphosate em mistura com bromacil + diuron, enquanto para o controle da buva não houve diferença entre os tratamentos. Depois da aplicação seqüencial, o melhor tratamento para o controle de buva foi com diuron e bromacil+diuron.Studies were conducted at Estação Experimental de Citricultura de Bebedouro, SP to evaluate the response of glyphosate-resistant horseweed and hairy fleabane biotypes to herbicides glyphosate, bromacil + diuron, diuron e paraquat isolated and in mixture and effect of a sequential application of glyphosate. The experimental design was of complete randomized blocks with four replication and seven treatments. The herbicides were applied with costal sprayer, constant pressure with three nozzles TT110015, the equivalent spray volume was 150 L ha-1. The control was visually evaluated, trough percentile note scale. The best results were obtained to general control of weed with diuron isolated and glyphosate in mixture with bromacil + diuron while to glyphosate-resistant horseweed and hairy fleabane there was no difference between the treatments. After sequential application to Conyza sp control, the best treatment was obtained associated with diuron and bromacil+diuron.

Glyphosate tolerance of soybean mutant gained after boarding on satellite

International Nuclear Information System (INIS)

Jiang Lingxue; Ren Honglei; Zhang Hongyan; Liu Zhangxiong; Jin Longguo; Guo Yong; Qiu Lijuan; Tao Bo

2011-01-01

Glyphosate-tolerant germplasm and genetic variation characteristics of SP 2 and SP 3 soybean varieties boarded on Shijian No.8 satellite were analyzed after treated by herbicide glyphosate in the field. Abundant variations of traits were produced, and the resistance within and among cultivars were different in their offspring of space mutagenesis. Plant height and maturity were used as index to screen glyphosate tolerant materials. Space mutation increased of soybean 661 SP 3 of Zhongpin, and one glyphosate-resistance variant was screened from Zhongpin 661 SP 3 . It showed that glyphosate tolerance was different among offspring of different space mutagenesis soybean materials. It is feasible to systemically screen elite traits soybean by applying space mutation breeding. (authors)

Role of secondary metabolites biosynthesis in resistance to cotton ...

African Journals Online (AJOL)

use

2011-12-12

Dec 12, 2011 ... Disease percentage on six cotton varieties with respect to time for cotton leaf curl virus (CLCuV) was evaluated. In August 2007, the maximum disease was observed in CIM-506, CYTO-89 and BH-118. (susceptible), whereas CIM-443 was resistant with lower disease percentage. It was found that the leaf.

Factors affecting the fate and transport of glyphosate and AMPA into surface waters of agricultural watersheds in the United States and Europe

Science.gov (United States)

Coupe, R.; Kalkhoff, S.; Capel, P.; Gregoire, C.

2012-04-01

Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used extensively in almost all agricultural and urban areas of the United States and Europe. Although, glyphosate is used widely throughout the world in the production of many crops, it is predominately used in the United States on soybeans, corn, potatoes, and cotton that have been genetically modified to be tolerant to glyphosate. From 1992 to 2007, the agricultural use of glyphosate has increased from less than 10,000 Mg to more than 80,000 Mg, respectively. The greatest areal use is in the midwestern United States where glyphosate is applied on transgenic corn and soybeans. Because of the difficulty and expense in analyzing for glyphosate and AMPA (aminomethylphosphonic acid, a primary glyphosate degradate) in water, there have been only small scale studies on the fate and transport of glyphosate. The characterization of the transport of glyphosate and AMPA on a watershed scale is lacking. Glyphosate and AMPA were frequently detected in the surface waters of 4 agricultural watersheds in studies conducted by the U.S. Geological Survey in the United States and at the Laboratory of Hydrology and Geochemistry of Strasbourg. Two of these basins were located in the midwestern United States where the major crops are corn and soybean, the third is located the lower Mississippi River Basin where the major crops are soybean, corn, rice, and cotton, and the fourth was located near Strasbourg, France where the use of glyphosate was on a vineyard. The load as a percent of use ranged from 0.009 to 0.86 percent and could be related to 3 factors: source strength, hydrology, and flowpath. Glyphosate use in a watershed results in some occurrence in surface water at the part per billion level; however, those watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff, and a flowpath that does not include transport through the soil.

Fate and transport of glyphosate and aminomethylphosphonic acid in surface waters of agricultural basins

Science.gov (United States)

Coupe, R.H.; Kalkhoff, S.J.; Capel, P.D.; Gregoire, C.

2012-01-01

Background: Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used widely throughout the world in the production of many crops and is heavily used on soybeans, corn and cotton. Glyphosate is used in almost all agricultural areas of the United States, and the agricultural use of glyphosate has increased from less than 10 000 Mg in 1992 to more than 80 000 Mg in 2007. The greatest intensity of glyphosate use is in the midwestern United States, where applications are predominantly to genetically modified corn and soybeans. In spite of the increase in usage across the United States, the characterization of the transport of glyphosate and its degradate aminomethylphosphonic acid (AMPA) on a watershed scale is lacking. Results: Glyphosate and AMPA were frequently detected in the surface waters of four agricultural basins. The frequency and magnitude of detections varied across basins, and the load, as a percentage of use, ranged from 0.009 to 0.86% and could be related to three general characteristics: source strength, rainfall runoff and flow route. Conclusions: Glyphosate use in a watershed results in some occurrence in surface water; however, the watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff and a flow route that does not include transport through the soil. ?? 2011 Society of Chemical Industry.

Glyphosate sustainability in South American cropping systems.

Science.gov (United States)

Christoffoleti, Pedro J; Galli, Antonio J B; Carvalho, Saul J P; Moreira, Murilo S; Nicolai, Marcelo; Foloni, Luiz L; Martins, Bianca A B; Ribeiro, Daniela N

2008-04-01

South America represents about 12% of the global land area, and Brazil roughly corresponds to 47% of that. The major sustainable agricultural system in South America is based on a no-tillage cropping system, which is a worldwide adopted agricultural conservation system. Societal benefits of conservation systems in agriculture include greater use of conservation tillage, which reduces soil erosion and associated loading of pesticides, nutrients and sediments into the environment. However, overreliance on glyphosate and simpler cropping systems has resulted in the selection of tolerant weed species through weed shifts (WSs) and evolution of herbicide-resistant weed (HRW) biotypes to glyphosate. It is a challenge in South America to design herbicide- and non-herbicide-based strategies that effectively delay and/or manage evolution of HRWs and WSs to weeds tolerant to glyphosate in cropping systems based on recurrent glyphosate application, such as those used with glyphosate-resistant soybeans. The objectives of this paper are (i) to provide an overview of some factors that influence WSs and HRWs to glyphosate in South America, especially in Brazil, Argentina and Paraguay soybean cropped areas; (ii) to discuss the viability of using crop rotation and/or cover crops that might be integrated with forage crops in an economically and environmentally sustainable system; and (iii) to summarize the results of a survey of the perceptions of Brazilian farmers to problems with WSs and HRWs to glyphosate, and the level of adoption of good agricultural practices in order to prevent or manage it. Copyright (c) 2008 Society of Chemical Industry.

Response of Pennsylvania native plant species to dicamba and/or glyphosate

Science.gov (United States)

Weeds may become resistant to intensive and extensive use of specific herbicides associated with the growth of herbicide tolerant crops, e.g., the use of glyphosate for weed control with glyphosate tolerant soybeans. To counter this resistance, crops modified to contain genes for...

Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

Science.gov (United States)

Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-08-01

Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Simulating changes in cropping practices in conventional and glyphosate-resistant maize. II. Weed impacts on crop production and biodiversity.

Science.gov (United States)

Colbach, Nathalie; Darmency, Henri; Fernier, Alice; Granger, Sylvie; Le Corre, Valérie; Messéan, Antoine

2017-05-01

Overreliance on the same herbicide mode of action leads to the spread of resistant weeds, which cancels the advantages of herbicide-tolerant (HT) crops. Here, the objective was to quantify, with simulations, the impact of glyphosate-resistant (GR) weeds on crop production and weed-related wild biodiversity in HT maize-based cropping systems differing in terms of management practices. We (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, with the weed dynamics model FLORSYS; (2) quantified how much the presence of GR weeds contributed to weed impacts on crop production and biodiversity; (3) determined the effect of cultural practices on the impact of GR weeds and (4) identified which species traits most influence weed-impact indicators. The simulation study showed that during the analysed 28 years, the advent of glyphosate resistance had little effect on plant biodiversity. Glyphosate-susceptible populations and species were replaced by GR ones. Including GR weeds only affected functional biodiversity (food offer for birds, bees and carabids) and weed harmfulness when weed effect was initially low; when weed effect was initially high, including GR weeds had little effect. The GR effect also depended on cultural practices, e.g. GR weeds were most detrimental for species equitability when maize was sown late. Species traits most harmful for crop production and most beneficial for biodiversity were identified, using RLQ analyses. None of the species presenting these traits belonged to a family for which glyphosate resistance was reported. An advice table was built; the effects of cultural practices on crop production and biodiversity were synthesized, explained, quantified and ranked, and the optimal choices for each management technique were identified.

Inheritance of resistance to cotton blue disease Herança da resistência do algodoeiro à doença-azul

Directory of Open Access Journals (Sweden)

Osmério Pupim Junior

2008-05-01

Full Text Available The objective of this work was to determine the inheritance of cotton blue disease resistance by cotton plants. Populations derived from the CD 401 and Delta Opal resistant varieties were evaluated, through a greenhouse test with artificial inoculation by viruliferous aphids. Cotton blue disease resistance is conditioned by one dominant gene, both in CD 401 and Delta Opal varieties.O objetivo deste trabalho foi determinar a herança da resistência do algodoeiro à doença-azul. Populações derivadas das variedades resistentes CD 401 e Delta Opal foram avaliadas em casa de vegetação, por meio da inoculação de pulgões virulíferos. A resistência à doença-azul do algodoeiro é condicionada por um gene dominante, tanto em 'DC 401' quanto em 'Delta Opal'.

Identification of resistance to Aspergillus flavus infection in cotton germplasm

Science.gov (United States)

Natural resistance of in cottonseed to Aspergillus flavus infection has not been explored to date. A green fluorescent protein (GFP) expressing -70 strain was used to assess the resistance of seed from thirty five35 cotton varieties including representatives from Gossypium arboreum, G. barbadense, a...

Early detection of crop injury from herbicide glyphosate by leaf biochemical parameter inversion

Science.gov (United States)

Early detection of crop injury from glyphosate is of significant importance in crop management. In this paper, we attempt to detect glyphosate-induced crop injury by PROSPECT (leaf optical PROperty SPECTra model) inversion through leaf hyperspectral reflectance measurements for non-Glyphosate-Resist...

Glyphosate and dicamba herbicide tank mixture effects on native plant and non-genetically engineered soybean seedlings

Science.gov (United States)

Weed species are becoming resistant to intensive and extensive use of specific herbicides associated with the production of herbicide resistant crops, e.g., the use of glyphosate for weed management with glyphosate resistant soybeans. To counter this resistance, crops engineered ...

Genetic diversity/impurity estimation in sources of natural resistance against cotton leaf curl disease in pakistan

International Nuclear Information System (INIS)

Sarwar, G.

2007-01-01

Cotton accounts for more than 60% of Pakistan's export earnings through the export of both raw cotton and cotton products. An epidemic of cotton leaf curl disease (CLCuD) in Pakistan during the 1990s led to the withdrawal of high yielding cotton cultivars. Due of their susceptibility to the disease. The identification of natural resistance in some genotypes provided a means to manage reduce losses due to the disease. But it has been an adversity that almost all these resistant varieties have ultimately 'lost' their resistance. There are also reports that the original sources of resistance, as well as the varieties developed from them, are now susceptible to the disease when grafted with infected scion. For the present studies. Seed of two resistant varieties (LRA-5166 and (CP-152) was obtained from six different research organizations. Plants raised from these seed were grafted with symptomatic scion and used for morphological comparisons. Our results indicated that the genetic pool of these cultivars is not well maintained and that an unacceptable diversity impurity is present within and among the genetic stock of both these lines. There is thus a requirement for screening of these elite lines at the molecular level to ensure the purity of these varieties for future development. The virus causing CLCuD showed change by recombination making the search for new sources of resistance, as well as the maintenance of established sources, indispensable for the sustainable cotton production in Pakistan. (author)

Characterization of Eleusine indica with gene mutation or amplification in EPSPS to glyphosate.

Science.gov (United States)

Chen, Jingchao; Jiang, Cuilan; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Huimin; Zhao, Dandan; Zhang, Chaoxian

2017-11-01

The evolution of weed-resistant species threatens the sustainable use of glyphosate, which is the most important herbicide widely used in agriculture worldwide. Moreover, the high glyphosate resistance (>180-fold based on LD 50 ) of Eleusine indica found in Malaysia, which carries a double mutation in its 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), made the control of this species more difficult. By contrast, the same species carrying the same double mutation in EPSPS (T102I+P106S) but found in China only shows a resistance level of not more than 14-fold based on GR 50 . The resistance level of this population is four times higher than that of the population carrying a single mutation (P106L). Although the members of this population survive under a high glyphosate dosage of 10,080gaeha -1 , their growth was significantly inhibited by glyphosate under the recommend dose (840gaeha -1 ), where in the fresh weight was 85.4% of the control. EPSPS expression, relative copy number, and EPSPS activity in this population were similar to those of the susceptible population. In addition, the expression of two glutathione transferase (GST) genes (GST-U8 and GST-23) and the enzyme activity of the GST in this population did not significantly differ from those of the susceptible population. This finding is important in elucidating the resistance of the naturally evolved glyphosate-resistant (GR) weed species carrying a double mutation in EPSPS to glyphosate. Copyright © 2017. Published by Elsevier Inc.

Electronic emission and electron spin resonance of irradiated clothes: (cottons, synthetic clothes)

International Nuclear Information System (INIS)

El Ajouz Rima, H.

1984-10-01

This thesis is devoted to a new method of dosimetry applicable to accidental irradiations. It is based on the use of cotton and synthetic fabric clothes as detectors. It enables absorbed doses and body dose distributions to be estimated after an accidental irradiation. A bibliography on textile fibres used for clothing is presented in the first chapter: origin, structure, industrial treatments, effects of heat, light, ionizing radiations. In the second chapter, electronic emission generated by double stimulation (thermal and optic) is described. This phenomenon reveals changes in the surface state of cotton. Exo-emission was chosen because of its high sensitivity in dosimetry. The third chapter is devoted to the application of electron paramagnetic resonance to the dosimetry of irradiated fabrics. After a brief description of the spectrometer used, the results obtained with commercial cotton fabrics and with a special fabric realized by the Institut Textile de France are described some of these fabrics were subjected to special treatments either before or after irradiation. Synthetic fabrics (polyesters and polypropylene) have also been studied. (author)

Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

Science.gov (United States)

Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

2017-04-01

Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

Improvement in Dissolution of Cotton Pulp with Ionic liquid by the Electron Beam Treatment

International Nuclear Information System (INIS)

Lee, Won Sil; Jung, Wong Gi; Sung, Yong Joo

2013-01-01

Electron beam treatment was applied for improving dissolution of cotton pulp with ionic liquids. Two ionic liquids, 1-allyl-3-methylimidazolium chloride ([Amim]Cl]: AC) and 1,3-dimethylimidzolium methlphosphite ([Dmim][(MeO)(H)PO2]: Me) were used for this experiment. Treatment with electron beams up to dose of 400 kGy resulted in the increase of hot water extract and alkali extract of cotton pulp and the great reduction in the molecular weight of cellulose. For the dissolution of cotton pulp with two ionic liquids, the electron beam treated samples showed faster dissolution. The dissolved cellulose with Me ionic liquid were regenerated with Acetonitrile and the structure of regenerated cellulose showed distinct difference depending on the electron beam treatment. Those results provide the electron beam pre-treatment could be applied as an energy efficient and environmentally benign method to increase the dissolution of cotton pulp with ionic liquids

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

Science.gov (United States)

Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

2013-01-01

Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

Manejo de capim pé-de-galinha em lavouras de soja transgênica resistente ao glifosato Management of goose grass on transgenic soybean, resistant to glyphosate

Directory of Open Access Journals (Sweden)

André da Rosa Ulguim

2013-01-01

Full Text Available O objetivo deste trabalho foi avaliar a resistência de capim pé-de-galinha (Eleusine indica ao glifosato, em lavouras de soja transgênica; avaliar o efeito de aplicações de glifosato em diferentes estádios de desenvolvimento; identificar práticas agronômicas associadas à seleção de biótipos resistentes; e avaliar a eficiência dos herbicidas cletodim, fluazifope-P-butílico, clomazona, glufosinato de amônio e glifosato nas plantas resistentes. Plantas escapes ao tratamento com glifosato foram coletadas em 24 propriedades, no Rio Grande do Sul. As plantas foram cultivadas em casa de vegetação, tendo-se avaliado a sua resistência ao glifosato. Os acessos resistentes foram selecionados e avaliados quanto ao efeito da aplicação do glifosato em diferentes estádios de crescimento e quanto à sensibilidade aos herbicidas. Foi aplicado um questionário aos produtores para identificação das práticas agronômicas associadas às falhas no controle. O controle de E. indica pelo glifosato é mais efetivo com a aplicação em estádios iniciais de desenvolvimento. Práticas agronômicas, como uso contínuo de baixas doses do herbicida, aplicação em estádios de desenvolvimento avançados das plantas daninhas (mais de um afilho e a ausência de rotação de culturas foram relacionadas às falhas de controle observadas. Os herbicidas cletodim, fluazifope-P-butílico e glufosinato de amônio são alternativas eficientes para o controle de E. indica.The objective of this work was to evaluate the resistance of goose grass (Eleusine indica to glyphosate application in transgenic soybean crops; evaluate the effect of glyphosate applications in different growth stages; identify the main agronomic practices associated with the selection of resistant biotypes; and evaluate the effect of the herbicides clethodim, fluazifop-p-butyl, clomazone, glufosinate ammonium, and glyphosate on resistant plants. Plants that survived glyphosate application

Stacked -gene hybrids were not found to be superior to glyphosate resistant or Non-GMO corn hybrids

Science.gov (United States)

Seed costs of modern corn hybrids genetically modified with multiple traits for insect and herbicide resistance “stacked-gene” are in excess of $100.00 US per acre. Yields and net returns per acre along with yield component data were determined for ten hybrids, four stacked-gene, four glyphosate re...

Pleiotropic effects of herbicide-resistance genes on crop yield: a review.

Science.gov (United States)

Darmency, Henri

2013-08-01

The rapid adoption of genetically engineered herbicide-resistant crop varieties (HRCVs)-encompassing 83% of all GM crops and nearly 8% of the worldwide arable area-is due to technical efficiency and higher returns. Other herbicide-resistant varieties obtained from genetic resources and mutagenesis have also been successfully released. Although the benefit for weed control is the main criteria for choosing HRCVs, the pleiotropic costs of genes endowing resistance have rarely been investigated in crops. Here the available data of comparisons between isogenic resistant and susceptible varieties are reviewed. Pleiotropic harmful effects on yield are reported in half of the cases, mostly with resistance mechanisms that originate from genetic resources and mutagenesis (atrazine in oilseed rape and millet, trifluralin in millet, imazamox in cotton) rather than genetic engineering (chlorsulfuron and glufosinate in some oilseed rape varieties, glyphosate in soybean). No effect was found for sethoxydim and bromoxynil resistance. Variable minor effects were found for imazamox, chlorsulfuron, glufosinate and glyphosate resistance. The importance of the breeding plan and the genetic background on the emergence of these effects is pointed out. Breeders' efforts to produce better varieties could compensate for the yield loss, which eliminates any possibility of formulating generic conclusions on pleiotropic effects that can be applied to all resistant crops. © 2013 Society of Chemical Industry.

76 FR 60448 - Syngenta Biotechnology, Inc.; Determination of Nonregulated Status for Lepidopteran-Resistant Cotton

Science.gov (United States)

2011-09-29

...] Syngenta Biotechnology, Inc.; Determination of Nonregulated Status for Lepidopteran-Resistant Cotton AGENCY... our determination that a cotton line developed by Syngenta Biotechnology, Inc., designated as event... submitted by Syngenta Biotechnology, Inc., in its petition for a determination of nonregulated status, our...

Superamphiphobic cotton fabrics with enhanced stability

Energy Technology Data Exchange (ETDEWEB)

Xu, Bi, E-mail: xubi@dhu.edu.cn [National Engineering Research Center for Dyeing and Finishing of Textiles, Donghua University, Shanghai 201620 (China); Key Laboratory of Science & Technology of Eco-Textile, Ministry of Education, Donghua University, Shanghai 201620 (China); College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Ding, Yinyan; Qu, Shaobo [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Cai, Zaisheng, E-mail: zshcai@dhu.edu [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China)

2015-11-30

Highlights: • Superamphiphobic cotton fabrics were prepared. • Water and hexadecane contact angels reach to 164.4° and 156.3°, respectively. • Nanoporous organically modified silica alcogel particles were synthesized. • The superamphiphobic cotton fabrics exhibit enhanced stability against abrasion, laundering and acid. - Abstract: Superamphiphobic cotton fabrics were prepared by alternately depositing organically modified silica alcogel (ormosil) particles onto chitosan precoated cotton fabrics and subsequent 1H, 1H, 2H, 2H-perfluorooctyltrimethoxysilane (PFOTMS) modification. Transmission electron microscopy and scanning electron microscopy images reveal that the ormosil particles display a fluffy, sponge-like nanoporous structure, and the entire cotton fiber surface is covered with highly porous networks. PFOTMS acts as not only a modifier to lower the surface energy of the cotton fabric but also a binder to enhance the coating stability against abrasion and washing. The treated cotton fabrics show highly liquid repellency with the water, cooking oil and hexadecane contact angels reaching to 164.4°, 160.1° and 156.3°, respectively. Meanwhile, the treated cotton fabrics exhibit good abrasion resistance and high laundering durability, which can withstand 10,000 cycles of abrasion and 30 cycles of machine wash without apparently changing the superamphiphobicity. The superamphiphobic cotton fabric also shows high acid stability, and can withstand 98% H{sub 2}SO{sub 4}. Moreover, the superamphiphobic coating has almost no influence on the other physical properties of the cotton fabrics including tensile strength, whiteness and air permeability. This durable non-wetting surface may provide a wide range of new applications in the future.

Field trials to evaluate effects of continuously planted transgenic insect-resistant cottons on soil invertebrates.

Science.gov (United States)

Li, Xiaogang; Liu, Biao; Wang, Xingxiang; Han, Zhengmin; Cui, Jinjie; Luo, Junyu

2012-03-01

Impacts on soil invertebrates are an important aspect of environmental risk assessment and post-release monitoring of transgenic insect-resistant plants. The purpose of this study was to research and survey the effects of transgenic insect-resistant cottons that had been planted over 10 years on the abundance and community structure of soil invertebrates under field conditions. During 3 consecutive years (2006-2008), eight common taxa (orders) of soil invertebrates belonging to the phylum Arthropoda were investigated in two different transgenic cotton fields and one non-transgenic cotton field (control). Each year, soil samples were taken at four different growth stages of cotton (seedling, budding, boll forming and boll opening). Animals were extracted from the samples using the improved Tullgren method, counted and determined to the order level. The diversity of the soil fauna communities in the different fields was compared using the Simpson's, Shannon's diversity indices and evenness index. The results showed a significant sampling time variation in the abundance of soil invertebrates monitored in the different fields. However, no difference in soil invertebrate abundance was found between the transgenic cotton fields and the control field. Both sampling time and cotton treatment had a significant effect on the Simpson's, Shannon's diversity indices and evenness index. They were higher in the transgenic fields than the control field at the growth stages of cotton. Long-term cultivation of transgenic insect-resistant cottons had no significant effect on the abundance of soil invertebrates. Collembola, Acarina and Araneae could act as the indicators of soil invertebrate in this region to monitor the environmental impacts of transgenic plants in the future. This journal is © The Royal Society of Chemistry 2012

Transgenic cotton plants expressing Cry1Ia12 toxin confer resistance to fall armyworm (Spodoptera frugiperda and cotton boll weevil (Anthonomus grandis

Directory of Open Access Journals (Sweden)

Raquel Sampaio Oliveira

2016-02-01

Full Text Available Gossypium hirsutum (commercial cooton is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized with PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold. Also, a significant reduction of Anthonomus grandis emerging adults (up to 60% was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda and the Coleopteran (A. grandis insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis).

Science.gov (United States)

de Oliveira, Raquel S; Oliveira-Neto, Osmundo B; Moura, Hudson F N; de Macedo, Leonardo L P; Arraes, Fabrício B M; Lucena, Wagner A; Lourenço-Tessutti, Isabela T; de Deus Barbosa, Aulus A; da Silva, Maria C M; Grossi-de-Sa, Maria F

2016-01-01

Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests.

Transgenic Cotton Plants Expressing Cry1Ia12 Toxin Confer Resistance to Fall Armyworm (Spodoptera frugiperda) and Cotton Boll Weevil (Anthonomus grandis)

Science.gov (United States)

de Oliveira, Raquel S.; Oliveira-Neto, Osmundo B.; Moura, Hudson F. N.; de Macedo, Leonardo L. P.; Arraes, Fabrício B. M.; Lucena, Wagner A.; Lourenço-Tessutti, Isabela T.; de Deus Barbosa, Aulus A.; da Silva, Maria C. M.; Grossi-de-Sa, Maria F.

2016-01-01

Gossypium hirsutum (commercial cooton) is one of the most economically important fibers sources and a commodity crop highly affected by insect pests and pathogens. Several transgenic approaches have been developed to improve cotton resistance to insect pests, through the transgenic expression of different factors, including Cry toxins, proteinase inhibitors, and toxic peptides, among others. In the present study, we developed transgenic cotton plants by fertilized floral buds injection (through the pollen-tube pathway technique) using an DNA expression cassette harboring the cry1Ia12 gene, driven by CaMV35S promoter. The T0 transgenic cotton plants were initially selected with kanamycin and posteriorly characterized by PCR and Southern blot experiments to confirm the genetic transformation. Western blot and ELISA assays indicated the transgenic cotton plants with higher Cry1Ia12 protein expression levels to be further tested in the control of two major G. hirsutum insect pests. Bioassays with T1 plants revealed the Cry1Ia12 protein toxicity on Spodoptera frugiperda larvae, as evidenced by mortality up to 40% and a significant delay in the development of the target insects compared to untransformed controls (up to 30-fold). Also, an important reduction of Anthonomus grandis emerging adults (up to 60%) was observed when the insect larvae were fed on T1 floral buds. All the larvae and adult insect survivors on the transgenic lines were weaker and significantly smaller compared to the non-transformed plants. Therefore, this study provides GM cotton plant with simultaneous resistance against the Lepidopteran (S. frugiperda), and the Coleopteran (A. grandis) insect orders, and all data suggested that the Cry1Ia12 toxin could effectively enhance the cotton transgenic plants resistance to both insect pests. PMID:26925081

Transgenic Cotton Plants Expressing the HaHR3 Gene Conferred Enhanced Resistance to Helicoverpa armigera and Improved Cotton Yield.

Science.gov (United States)

Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei

2017-08-30

RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3 , a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA- HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing ds HaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera . Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls.

Overlapping Residual Herbicides for Control of Photosystem (PS) II- and 4-Hydroxyphenylpyruvate Dioxygenase (HPPD)-Inhibitor-Resistant Palmer amaranth (Amaranthus palmeri S. Watson) in Glyphosate-Resistant Maize

Science.gov (United States)

Chahal, Parminder S.; Ganie, Zahoor A.; Jhala, Amit J.

2018-01-01

A Palmer amaranth (Amaranthus palmeri S. Watson) biotype has evolved resistance to photosystem (PS) II- (atrazine) and 4-hydroxyphenylpyruvate dioxygenase (HPPD)-inhibiting herbicides (mesotrione, tembotrione, and topramezone) in maize seed production field in Nebraska, USA. The objectives of this study were to determine the effect of soil residual pre-emergence (PRE) herbicides followed by (fb) tank-mixture of residual and foliar active post-emergence (POST) herbicides on PS-II- and HPPD-inhibitor-resistant Palmer amaranth control, maize yield, and net economic returns. Field experiments were conducted in a grower's field infested with PS II- and HPPD-inhibitor-resistant Palmer amaranth near Shickley in Fillmore County, Nebraska, USA in 2015 and 2016. The contrast analysis suggested that saflufenacil plus dimethenamid-P or pyroxasulfone plus saflufenacil applied PRE provided 80–82% Palmer amaranth control compared to 65 and 39% control with saflufenacil and pyroxasulfone applied alone at 3 weeks after PRE (WAPRE), respectively. Among the PRE fb POST herbicide programs, 95–98% Palmer amaranth control was achieved with pyroxasulfone plus safluefenacil, or saflufenacil plus dimethenamid-P applied PRE, fb glyphosate plus topramezone plus dimethenamid-P plus atrazine, glyphosate plus diflufenzopyr plus dicamba plus pyroxasulfone, glyphosate plus diflufenzopyr plus pendimethalin, or glyphosate plus diflufenzopyr plus dicamba plus atrazine applied POST at 3 weeks after POST (WAPOST) through maize harvest. Based on contrast analysis, PRE fb POST programs provided 77–83% Palmer amaranth control at 3 WAPOST through maize harvest compared to 12–15% control with PRE-only and 66–84% control with POST-only programs. Similarly, PRE fb POST programs provided 99% biomass reduction at 6 WAPOST compared to PRE-only (28%) and POST-only (87%) programs. PRE fb POST programs provided higher maize yield (13,617 kg ha−1) and net return (US $1,724 ha−1) compared to the PRE

Effects of glyphosate acid and the glyphosate-commercial formulation (Roundup) on Dimorphandra wilsonii seed germination: Interference of seed respiratory metabolism.

Science.gov (United States)

Gomes, Marcelo Pedrosa; da Silva Cruz, Fernanda Vieira; Bicalho, Elisa Monteze; Borges, Felipe Viègas; Fonseca, Marcia Bacelar; Juneau, Philippe; Garcia, Queila Souza

2017-01-01

Glyphosate-formulations are widely used in the Brazilian Cerrado (neotropical savanna) with little or no control, threatening population of the endangered species Dimorphandra wilsonii. We investigated the toxicity of different concentrations (0, 5, 25 and 50 mg l -1 ) of glyphosate acid and one of its formulations (Roundup ® ) on seed germination in D. wilsonii. Glyphosate acid and Roundup drastically decreased seed germination by decreasing seed respiration rates. The activation of antioxidant enzymes, ascorbate peroxidase and catalase assure no hydrogen peroxide accumulation in exposed seeds. Glyphosate acid and the Roundup-formulation negatively affected the activities of enzymes associated with the mitochondrial electron transport chain (ETC), with Complex III as its precise target. The toxicity of Roundup-formulation was greater than that of glyphosate acid due to its greater effects on respiration. The herbicide glyphosate must impair D. wilsonii seed germination by disrupting the mitochondrial ETC, resulting in decreased energy (ATP) production. Our results therefore indicate the importance of avoiding (or closely regulating) the use of glyphosate-based herbicides in natural Cerrado habitats of D. wilsonni as they are toxic to seed germination and therefore threaten conservation efforts. It will likewise be important to investigate the effects of glyphosate on the seeds of other species and to investigate the impacts of these pesticides elsewhere in the world. Copyright © 2016 Elsevier Ltd. All rights reserved.

Annual glyphosate treatments alter growth of unaffected bentgrass (Agrostis weeds and plant community composition.

Directory of Open Access Journals (Sweden)

Collin W Ahrens

Full Text Available Herbicide resistance is becoming more common in weed ecotypes and crop species including turfgrasses, but current gaps in knowledge limit predictive ecological risk assessments and risk management plans. This project examined the effect of annual glyphosate applications on the vegetative growth and reproductive potential of two weedy bentgrasses, creeping bentgrass (CB and redtop (RT, where the glyphosate resistance (GR trait was mimicked by covering the bentgrass plants during glyphosate application. Five field plots were studied in habitats commonly inhabited by weedy bentgrasses including an agricultural hayfield, natural meadow, and wasteland. Results showed that annual glyphosate treatment improved bentgrass survivorship, vegetative growth, and reproductive potential compared with bentgrass in unsprayed subplots. In the second year of growth, RT plants had an 86-fold increase in flower number in glyphosate-treated subplots versus controls, while CB plants had a 20-fold increase. At the end of the three year study, plant community composition had changed in glyphosate-treated subplots in hayfield and meadow plots compared to controls. Soils in subplots receiving glyphosate had higher nitrate concentrations than controls. This is the first study to mimic the GR trait in bentgrass plants with the goal of quantifying bentgrass response to glyphosate selection pressure and understanding the impacts on surrounding plant communities.

Glyphosate, a chelating agent-relevant for ecological risk assessment?

Science.gov (United States)

Mertens, Martha; Höss, Sebastian; Neumann, Günter; Afzal, Joshua; Reichenbecher, Wolfram

2018-02-01

Glyphosate-based herbicides (GBHs), consisting of glyphosate and formulants, are the most frequently applied herbicides worldwide. The declared active ingredient glyphosate does not only inhibit the EPSPS but is also a chelating agent that binds macro- and micronutrients, essential for many plant processes and pathogen resistance. GBH treatment may thus impede uptake and availability of macro- and micronutrients in plants. The present study investigated whether this characteristic of glyphosate could contribute to adverse effects of GBH application in the environment and to human health. According to the results, it has not been fully elucidated whether the chelating activity of glyphosate contributes to the toxic effects on plants and potentially on plant-microorganism interactions, e.g., nitrogen fixation of leguminous plants. It is also still open whether the chelating property of glyphosate is involved in the toxic effects on organisms other than plants, described in many papers. By changing the availability of essential as well as toxic metals that are bound to soil particles, the herbicide might also impact soil life, although the occurrence of natural chelators with considerably higher chelating potentials makes an additional impact of glyphosate for most metals less likely. Further research should elucidate the role of glyphosate (and GBH) as a chelator, in particular, as this is a non-specific property potentially affecting many organisms and processes. In the process of reevaluation of glyphosate its chelating activity has hardly been discussed.

Lack of glyphosate resistance gene transfer from Roundup Ready soybean to Bradyrhizobium japonicum under field and laboratory conditions.

Science.gov (United States)

Isaza, Laura Arango; Opelt, Katja; Wagner, Tobias; Mattes, Elke; Bieber, Evi; Hatley, Elwood O; Roth, Greg; Sanjuán, Juan; Fischer, Hans-Martin; Sandermann, Heinrich; Hartmann, Anton; Ernst, Dieter

2011-01-01

A field study was conducted at the Russell E. Larson Agricultural Research Center to determine the effect of transgenic glyphosate-resistant soybean in combination with herbicide (Roundup) application on its endosymbiont Bradyrhizobium japonicum. DNA of bacteroids from isolated nodules was analysed for the presence of the transgenic 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) DNA sequence using polymerase chain reaction (PCR). To further assess the likelihood that the EPSPS gene may be transferred from the Roundup Ready (RR) soybean to B. japonicum, we have examined the natural transformation efficiency of B. japonicum strain 110spc4. Analyses of nodules showed the presence of the transgenic EPSPS DNA sequence. In bacteroids that were isolated from nodules of transgenic soybean plants and then cultivated in the presence of glyphosate this sequence could not be detected. This indicates that no stable horizontal gene transfer (HGT) of the EPSPS gene had occurred under field conditions. Under laboratory conditions, no natural transformation was detected in B. japonicum strain 110spc4 in the presence of various amounts of recombinant plasmid DNA. Our results indicate that no natural competence state exists in B. japonicum 110spc4. Results from field and laboratory studies indicate the lack of functional transfer of the CP4-EPSPS gene from glyphosate-tolerant soybean treated with glyphosate to root-associated B. japonicum.

Optimizing Organophosphorus Fire Resistant Finish for Cotton Fabric Using Box-Behnken Design

International Nuclear Information System (INIS)

Sohail, Y.; Parag, B.; Nemeshwaree, B.; Giorgio, R.

2016-01-01

N-methylol dimethyl phosphono propionamide (MDPA) is one of the most utilized fire resistant (FR) finishes for cotton fabrics, utilized as part of a formulation with trimethylol melamine (TMM) to acquire better crosslinking and enhanced FR properties. The system parameters of the finishing treatment were upgraded for better FR properties and low mechanical loss to the fabric by the response surface methodology utilizing Box-Behnken statistical designed experimental strategy. The impacts of concentration on the cotton fabric’s properties (fire resistance and mechanical properties) were assessed with the regression equations. The optimum conditions by predicting the FR reagents focusing intact mechanical properties of the fabric were additionally studied. It was found that the parameters of crosslinking agents in the FR formulation have a prime role in the general FR properties of the cotton fabrics. The R-squared estimations of the considerable number of responses were above 92%, demonstrating the level of relationship between the predicted values by the Box-Behnken frameworks and the real test results.

Uses of glyphosate in German arable farming – operational aspects

Directory of Open Access Journals (Sweden)

Wiese, Armin

2016-02-01

Full Text Available Glyphosate is the most frequently used herbicide active ingredient in Germany. Studies regarding its usage in non-GMO arable farming are still rare even though it plays an important role in several agronomic situations. Therefore, we conducted a comprehensive survey, which was carried out among conventional German farms in Winter 2014/2015. Based on the results of this survey we analyzed via cluster analysis how types of farms differ in terms of glyphosate usage. An illustration of seven clusters allows deep insights into arable farm structures. The farm types can be distinguished regarding their tillage system and similar to this differentiation also concerning their intensity of glyphosate application. Furthermore, it becomes obvious that farm clusters with a higher level of glyphosate usage are characterized by a lower number of labourers per hectare, more arable land and/or enhanced cover cropping. Moreover, groups of farmers who rely more on glyphosate are more likely to state that they need glyphosate for herbicide resistance management. Farmers’ assessments of the economic importance of glyphosate usage vary depending on the type of farm. By means of the farm clusters, the most important situations of glyphosate usage can be further analyzed economically and scenarios for impact assessments can be made.

Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

Science.gov (United States)

Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

2016-06-15

Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

Identification of a New Cotton Disease Caused by an Atypical Cotton Leafroll Dwarf Virus in Argentina.

Science.gov (United States)

Agrofoglio, Yamila C; Delfosse, Verónica C; Casse, María F; Hopp, Horacio E; Kresic, Iván Bonacic; Distéfano, Ana J

2017-03-01

An outbreak of a new disease occurred in cotton (Gossypium hirsutum) fields in northwest Argentina starting in the 2009-10 growing season and is still spreading steadily. The characteristic symptoms of the disease included slight leaf rolling and a bushy phenotype in the upper part of the plant. In this study, we determined the complete nucleotide sequences of two independent virus genomes isolated from cotton blue disease (CBD)-resistant and -susceptible cotton varieties. This virus genome comprised 5,866 nucleotides with an organization similar to that of the genus Polerovirus and was closely related to cotton leafroll dwarf virus, with protein identity ranging from 88 to 98%. The virus was subsequently transmitted to a CBD-resistant cotton variety using Aphis gossypii and symptoms were successfully reproduced. To study the persistence of the virus, we analyzed symptomatic plants from CBD-resistant varieties from different cotton-growing fields between 2013 and 2015 and showed the presence of the same virus strain. In addition, a constructed full-length infectious cDNA clone from the virus caused disease symptoms in systemic leaves of CBD-resistant cotton plants. Altogether, the new leafroll disease in CBD-resistant cotton plants is caused by an atypical cotton leafroll dwarf virus.

Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda.

Science.gov (United States)

Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng

2017-12-01

Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

The effect of Saccharomyces cerevisiae on the stability of the herbicide glyphosate during bread leavening.

Science.gov (United States)

Low, F L; Shaw, I C; Gerrard, J A

2005-01-01

To investigate the ability of baker's yeast (Saccharomyces cerevisiae) to degrade the herbicide glyphosate during the fermentation cycle of the breadmaking process. Aqueous glyphosate was added to bread ingredients and kneaded by commercially available breadmaking equipment into dough cultures. Cultures were incubated in the breadmaker throughout the fermentation cycle. The recovery of glyphosate levels following fermentation was determined, thus allowing an estimation of glyphosate degradation by yeast. It was shown, for the first time, that S. cerevisiae plays a role in metabolizing glyphosate during the fermentation stages of breadmaking. Approximately 21% was degraded within 1 h. As a result of projected increases in the glyphosate use on wheat and the role of bread as a dietary staple, this may contribute to more informed decisions being made relating to the use of glyphosate on glyphosate-resistant wheat, from a public health/regulatory perspective.

Development of transgenic cotton lines expressing Allium sativum agglutinin (ASAL) for enhanced resistance against major sap-sucking pests.

Science.gov (United States)

Vajhala, Chakravarthy S K; Sadumpati, Vijaya Kumar; Nunna, Hariprasad Rao; Puligundla, Sateesh Kumar; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2013-01-01

Mannose-specific Allium sativum leaf agglutinin encoding gene (ASAL) and herbicide tolerance gene (BAR) were introduced into an elite cotton inbred line (NC-601) employing Agrobacterium-mediated genetic transformation. Cotton transformants were produced from the phosphinothricin (PPT)-resistant shoots obtained after co-cultivation of mature embryos with the Agrobacterium strain EHA105 harbouring recombinant binary vector pCAMBIA3300-ASAL-BAR. PCR and Southern blot analysis confirmed the presence and stable integration of ASAL and BAR genes in various transformants of cotton. Basta leaf-dip assay, northern blot, western blot and ELISA analyses disclosed variable expression of BAR and ASAL transgenes in different transformants. Transgenes, ASAL and BAR, were stably inherited and showed co-segregation in T1 generation in a Mendelian fashion for both PPT tolerance and insect resistance. In planta insect bioassays on T2 and T3 homozygous ASAL-transgenic lines revealed potent entomotoxic effects of ASAL on jassid and whitefly insects, as evidenced by significant decreases in the survival, development and fecundity of the insects when compared to the untransformed controls. Furthermore, the transgenic cotton lines conferred higher levels of resistance (1-2 score) with minimal plant damage against these major sucking pests when bioassays were carried out employing standard screening techniques. The developed transgenics could serve as a potential genetic resource in recombination breeding aimed at improving the pest resistance of cotton. This study represents the first report of its kind dealing with the development of transgenic cotton resistant to two major sap-sucking insects.

Comparison of herbicide regimes and the associated potential enviromental effects of glyphosate-resistant crops versus what they replace in Europe

NARCIS (Netherlands)

Kleter, G.A.; Harris, C.; Stephenson, G.R.; Unsworth, J.

2008-01-01

While cultivation of transgenic crops takes place in seven of the EU member states, this constitutes a relatively limited part of the total acreage planted to these crops worldwide. The only glyphosate-resistant (GR) crop grown commercially until recently has been soybean in Romania. In addition,

Fitness cost of resistance to Bt cotton linked with increased gossypol content in pink bollworm larvae.

Directory of Open Access Journals (Sweden)

Jennifer L Williams

Full Text Available Fitness costs of resistance to Bacillus thuringiensis (Bt crops occur in the absence of Bt toxins, when individuals with resistance alleles are less fit than individuals without resistance alleles. As costs of Bt resistance are common, refuges of non-Bt host plants can delay resistance not only by providing susceptible individuals to mate with resistant individuals, but also by selecting against resistance. Because costs typically vary across host plants, refuges with host plants that magnify costs or make them less recessive could enhance resistance management. Limited understanding of the physiological mechanisms causing fitness costs, however, hampers attempts to increase costs. In several major cotton pests including pink bollworm (Pectinophora gossypiella, resistance to Cry1Ac cotton is associated with mutations altering cadherin proteins that bind this toxin in susceptible larvae. Here we report that the concentration of gossypol, a cotton defensive chemical, was higher in pink bollworm larvae with cadherin resistance alleles than in larvae lacking such alleles. Adding gossypol to the larval diet decreased larval weight and survival, and increased the fitness cost affecting larval growth, but not survival. Across cadherin genotypes, the cost affecting larval growth increased as the gossypol concentration of larvae increased. These results suggest that increased accumulation of plant defensive chemicals may contribute to fitness costs associated with resistance to Bt toxins.

INDUCING RESISTANCE IN COTTON AGAINST COLLETOTRICHUM GOSSYPII VAR. CEPHALOSPORIOIDES WITH ESSENTIAL OILS

Directory of Open Access Journals (Sweden)

B. T. Santos

2016-11-01

Full Text Available This study aimed to evaluate the potential of essential oils of rosemary (Rosmarinus officinalis, baccharis (Baccharis trimera, lemon grass (Cymbopogon citratus, basil (Ocimum basilicum and eucalyptus (Corymbia citriodora in inducing resistance in cotton plants against C. gossypii var. cephalosporioides. The inductive effect of the essential oils was evaluated in plants growing in pots in the environment, which were treated with 1% essential oil at 47 days of age. 24 hours after elicitor treatment the plants were inoculated with a suspension of 1.5 x 105 conidia mL-1 of C. gossypii var. cephalosporioides. Five evaluations were performed disease and calculated the area under the disease progress curve. All essential oils showed potential for inducing resistance against cotton C. gossypii var. cephalosporioides.

Glyphosate

NARCIS (Netherlands)

A. Arcuri (Alessandra)

2017-01-01

markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the

A novel 5-enolpyruvylshikimate-3-phosphate synthase from Rahnella aquatilis with significantly reduced glyphosate sensitivity.

Directory of Open Access Journals (Sweden)

Ri-He Peng

Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.

Recent advances in glyphosate biodegradation.

Science.gov (United States)

Zhan, Hui; Feng, Yanmei; Fan, Xinghui; Chen, Shaohua

2018-06-01

Glyphosate has emerged as the most widespread herbicide to control annual and perennial weeds. Massive use of glyphosate for decades has resulted in its ubiquitous presence in the environment, and poses a threat to humans and ecosystem. Different approaches such as adsorption, photocatalytic degradation, and microbial degradation have been studied to break down glyphosate in the environment. Among these, microbial degradation is the most effective and eco-friendly method. During its degradation, various microorganisms can use glyphosate as a sole source of phosphorus, carbon, and nitrogen. Major glyphosate degradation pathways and its metabolites have been frequently investigated, but the related enzymes and genes have been rarely studied. There are many reviews about the toxicity and fate of glyphosate and its major metabolite, aminomethylphosphonic acid. However, there is lack of reviews on biodegradation and bioremediation of glyphosate. The aims of this review are to summarize the microbial degradation of glyphosate and discuss the potential of glyphosate-degrading microorganisms to bioremediate glyphosate-contaminated environments. This review will provide an instructive direction to apply glyphosate-degrading microorganisms in the environment for bioremediation.

TRACTION RESISTANCE IN CHITOSAN TREATED COTTON

Directory of Open Access Journals (Sweden)

LOX Wouter

2015-05-01

Full Text Available Nowadays natural products interest has increased. However, when some products are included on textile fibers, they have no affinity and need some binders or other kind of auxiliaries to improve the yeld of the process, and some of them are not so natural as the product which are binding and consequently the “bio” definition is missed as some of them can be considered as highly pollutant. Chitosan is a common used bonding agent for cotton. It improves the antimicrobial and antifungal activity, improves wound healing and is a non-toxic bonding agent. The biopolymer used in this work is chitosan, which is a deacetylated derivative of chitin. These properties depend on the amount of deacetylation (DD and the Molecular weight (MW. Along with these improving properties, as it requires some acid pH to ve solved the treatment with chitosan can have some decreasing mechanical properties. The aim of that paper is to evaluate the change in breaking force of the treated samples and a change in elongation of those samples. It compared different amounts of concentration of chitosan with non treated cotton. The traction resistance test were performed on a dynamometer. The test was conducted according to the UNE EN ISO 13934-1 standard.

Using and development of multi adversity resistance system in cotton

Directory of Open Access Journals (Sweden)

Metin Durmuş ÇETİN

2014-12-01

Full Text Available The basic approach in plant breeding, make it possible to show the full genetic potential of plant. This methods also protect the health of plant growth over the period, by increasing resistance to diseases and pests is expected to provide. For this purpose, by Bird in 1963, with the name of multi adversity resistance has been initiated in cotton breeding and for many years as a result of the work carried out important varieties and germplasm have been developed. Nowadays, those using for varieties resistant to stress factors such as heat and drought are evaluated. And successful results are obtained.

Improving hybrid seed production in corn with glyphosate-mediated male sterility.

Science.gov (United States)

Feng, Paul C C; Qi, Youlin; Chiu, Tommy; Stoecker, Martin A; Schuster, Christopher L; Johnson, Scott C; Fonseca, Augustine E; Huang, Jintai

2014-02-01

Hybrid corn varieties exhibit benefits associated with heterosis and account for most of the corn acreage in the USA. Hybrid seed corn is produced by crossing a female parent which is male-sterile and therefore incapable of self-pollination with a male parent as the pollen donor. The majority of hybrid seed corn is produced by mechanical detasseling which involves physically removing the tassel, a process that is laborious and costly. Glyphosate-resistant corn was developed via expression of a glyphosate insensitive 5-enolpyruvyl-shikimate 3-phosphate synthase enzyme (CP4-EPSPS). Experimentation with molecular expression elements resulted in selective reduction of CP4-EPSPS expression in male reproductive tissues. The resulting plant demonstrated sterile tassel following glyphosate application with little to no injury to the rest of the plant. Using (14)C-glyphosate as a marker, we also examined the translocation of glyphosate to the tassel via spray application in a track sprayer to simulate field application. The results allowed optimization of spray parameters such as dose, spray timing and target to maximize tassel delivery of glyphosate for efficient sterilization. The Roundup hybridization system (RHS) is a novel process for hybrid seed production based on glyphosate-mediated male sterility. RHS replaces mechanical detasseling with glyphosate spray and greatly simplifies the process of hybrid seed corn production. © 2013 Society of Chemical Industry.

Interação de glyphosate com carfentrazone-ethyl Glyphosate - carfentrazone-ethyl interaction

Directory of Open Access Journals (Sweden)

R.C. Werlang

2002-04-01

Full Text Available Foi conduzido um experimento em condições controladas para determinar a interação do carfentrazone-ethyl em mistura no tanque com o herbicida glyphosate, no controle de seis espécies de plantas daninhas. Glyphosate aplicado isoladamente na dose de 720 g ha-1 foi eficaz no controle de Amaranthus hybridus (100%, Desmodium tortuosum (100%, Bidens pilosa (99%, Eleusine indica (96%, Digitaria horizontalis (100% e Commelina benghalensis (93% aos 21 DAA. Carfentrazone-ethyl aplicado isoladamente controlou eficazmente C. benghalensis. As misturas de glyphosate nas doses de 252 e 720 g ha-1 com carfentrazone-ethyl nas doses de 15 e 30 g ha¹ demonstraram efeito aditivo no controle de A. hybridus, D. tortuosum e Bidens pilosa, à exceção das misturas de glyphosate na dose de 252 g ha-1 com as doses de 15 e 30 g ha-1 de carfentrazone-ethyl, que proporcionam efeito sinergístico no controle de D. tortuosum. A adição das duas doses de carfentrazone-ethyl antagonizou o efeito de glyphosate na menor dose (252 g ha-1 no controle de E. indica, apresentando, no entanto, efeito aditivo com o glyphosate na maior dose (720 g ha-1. Já para D. horizontalis, as misturas de carfentrazone-ethyl com glyphosate na menor dose (252 g ha-1 apresentaram efeito sinergístico no controle dessa espécie, demonstrando, ainda, efeito aditivo na mistura com glyphosate na dose de 720 g ha-1. A mistura de carfentrazone-ethyl com glyphosate proporcionou efeito aditivo no controle de C. benghalensis, independentemente das combinações de doses avaliadas. Os resultados deste experimento indicam que carfentrazone-ethyl apresenta comportamento diferenciado quanto à interação com glyphosate, dependendo da espécie de planta daninha e da dose dos herbicidas utilizados na mistura em tanque, sendo complementar na mistura em tanque com glyphosate, pois demonstrou efeito antagônico em poucas das combinações estudadas, prevalecendo seu efeito aditivo na mistura com glyphosate, no

Sorption and desorption of glyphosate in Mollisols and Ultisols soils of Argentina.

Science.gov (United States)

Gómez Ortiz, Ana Maria; Okada, Elena; Bedmar, Francisco; Costa, José Luis

2017-10-01

In Argentina, glyphosate use has increased exponentially in recent years as a result of the widespread adoption of no-till management combined with genetically modified glyphosate-resistant crops. This massive use of glyphosate has created concern about its potential environmental impact. Sorption-desorption of glyphosate was studied in 3 Argentinean soils with contrasting characteristics. Glyphosate sorption isotherms were modeled using the Freundlich equation to estimate the sorption coefficient (K f ). Glyphosate sorption was high, and the K f varied from 115.6 to 1612 mg 1-1/n L 1/n /kg. Cerro Azul soil had the highest glyphosate sorption capacity as a result of a combination of factors such as higher clay content, cation exchange capacity, total iron, and aluminum oxides, and lower available phosphorus and pH. Desorption isotherms were also modeled using the Freundlich equation. In general, desorption was very low (glyphosate strongly sorbs to the soils and that it is almost an irreversible process. Anguil soil had a significantly higher desorption coefficient (K fd ) than the other soils, associated with its lower clay content and higher pH and phosphorus. Glyphosate high sorption and low desorption to the studied soils may prevent groundwater contamination. However, it may also affect its bioavailability, increasing its persistence and favoring its accumulation in the environment. The results of the present study contribute to the knowledge and characterization of glyphosate retention in different soils. Environ Toxicol Chem 2017;36:2587-2592. © 2017 SETAC. © 2017 SETAC.

Interactions of glyphosate use with farm characteristics and cropping patterns in Central Europe.

Science.gov (United States)

Wiese, Armin; Schulte, Michael; Theuvsen, Ludwig; Steinmann, Horst-Henning

2018-05-01

Although glyphosate is the most widely used herbicide in the European Union, little is known about the patterns of its usage in arable farming. Therefore, a nationwide survey of 2026 German farmers was analysed to obtain further knowledge about glyphosate applications in conventional European arable farming. Given its broad range of agri-environmental and farm-type conditions, Germany can be regarded as a suitable study region to represent Central European farming. The growing season 2013/2014 was set as a reference. Farmers who participated in the survey employ diverse patterns of glyphosate use. While 23% stated that they did not use glyphosate in the season in question, others applied glyphosate to their total arable area. However, most applications occurred on specific parts of the farm. Application patterns of oilseed rape, winter wheat, maize and sugar beet were studied in detail, and U-shaped distributions of glyphosate use intensity were observed. The effects of farm type and management practices on glyphosate use patterns were mixed in the various crops. Motivation for glyphosate use differs widely within the farming community. Agricultural researchers, extension services and policy makers are recommended to mitigate vulnerabilities associated with glyphosate use, such as routine spraying and practices that increase selection pressure for the evolution of glyphosate-resistant weeds. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

On glyphosate

Directory of Open Access Journals (Sweden)

Tamas Komives

2016-11-01

Full Text Available This Editorial briefly discusses the current issues surrounding glyphosate - the most controversial pesticide active ingredient of our time. The paper pays special attention to the effects of glyphosate on plant-pathogen interactions.

Trends in pesticide use on soybean, corn and cotton since the introduction of major genetically modified crops in the United States

Science.gov (United States)

Coupe, Richard H.; Capel, Paul D.

2016-01-01

BACKGROUNDGenetically modified (GM) varieties of soybean, corn and cotton have largely replaced conventional varieties in the United States. The most widely used applications of GM technology have been the development of crops that are resistant to a specific broad-spectrum herbicide (primarily glyphosate) or that produce insecticidal compounds within the plant itself. With the widespread adoption of GM crops, a decline in the use of conventional pesticides was expected.RESULTSThere has been a reduction in the annual herbicide application rate to corn since the advent of GM crops, but the herbicide application rate is mostly unchanged for cotton. Herbicide use on soybean has increased. There has been a substantial reduction in the amount of insecticides used on both corn and cotton since the introduction of GM crops.CONCLUSIONSThe observed changes in pesticide use are likely to be the result of many factors, including the introduction of GM crops, regulatory restrictions on some conventional pesticides, introduction of new pesticide technologies and changes in farming practices. In order to help protect human and environmental health and to help agriculture plan for the future, more detailed and complete documentation on pesticide use is needed on a frequent and ongoing basis.

Goss’s wilt incidence in sweet corn is independent of transgenic traits and glyphosate

Science.gov (United States)

Recently claims have been made that the use of glyphosate and transgenic crop traits increases the risk of plant diseases. Transgenic traits used widely for years in dent corn are now available in commercial sweet corn cultivars, specifically, the combination of glyphosate resistance (GR) and Lepid...

The halo effect: suppression of pink bollworm on non-Bt cotton by Bt cotton in China.

Directory of Open Access Journals (Sweden)

Peng Wan

Full Text Available In some previously reported cases, transgenic crops producing insecticidal proteins from Bacillus thuringiensis (Bt have suppressed insect pests not only in fields planted with such crops, but also regionally on host plants that do not produce Bt toxins. Here we used 16 years of field data to determine if Bt cotton caused this "halo effect" against pink bollworm (Pectinophora gossypiella in six provinces of the Yangtze River Valley of China. In this region, the percentage of cotton hectares planted with Bt cotton increased from 9% in 2000 to 94% in 2009 and 2010. We found that Bt cotton significantly decreased the population density of pink bollworm on non-Bt cotton, with net decreases of 91% for eggs and 95% for larvae on non-Bt cotton after 11 years of Bt cotton use. Insecticide sprays targeting pink bollworm and cotton bollworm (Helicoverpa armigera decreased by 69%. Previously reported evidence of the early stages of evolution of pink bollworm resistance to Bt cotton in China has raised concerns that if unchecked, such resistance could eventually diminish or eliminate the benefits of Bt cotton. The results reported here suggest that it might be possible to find a percentage of Bt cotton lower than the current level that causes sufficient regional pest suppression and reduces the risk of resistance.

Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

Science.gov (United States)

This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

Bermudagrass (Cynodon spp) dose-response relationships with clethodim, glufosinate and glyphosate.

Science.gov (United States)

Webster, Theodore M; Hanna, Wayne W; Mullinix, Benjamin G

2004-12-01

Greenhouse studies were conducted to evaluate the sensitivity of three commercial cultivars, eight experimental cultivars and common bermudagrass to clethodim, glufosinate and glyphosate. Each herbicide was applied at eight doses. Data were regressed on herbicide dose using a log-logistic curve (R2 = 0.56-0.95 for clethodim, R2 = 0.60-0.94 for glufosinate, and R2 = 0.70-0.96 for glyphosate). The herbicide rate that elicited a 50% plant response (I50) in the bermudagrass cultivars ranged from 0.04 to 0.19 kg ha(-1) clethodim, 0.19 to 1.33 kg ha(-1) glufosinate and 0.34 to 1.14 kg ha(-1) glyphosate. Relative to other cultivars, common bermudagrass was intermediate in its response to clethodim and among the most tolerant cultivars to glufosinate and glyphosate. TifSport was relatively tolerant to clethodim and glufosinate compared with other cultivars, but relatively sensitive to glyphosate. One cultivar, 94-437, was consistently among the most sensitive cultivars to each of the herbicides. While there were differential herbicide tolerances among the tested bermudagrass cultivars, there did not appear to be any naturally occurring herbicide resistance that could be commercially utilized. However, research indicated that breeding efforts should target herbicide resistance that is at least four times the registered use rate. Also, TifSport and Tifway have been identified as suitable representatives of triploid hybrid bermudagrass cultivars to be used to evaluate the success of turfgrass renovation programs. 2004 Society of Chemical Industry.

Diversity in Betasatellites Associated with Cotton Leaf Curl Disease During Source-To-Sink Movement Through a Resistant Host

Directory of Open Access Journals (Sweden)

Iftikhar Ali Khan

2016-02-01

Full Text Available Cotton leaf curl is devastating disease of cotton characterized by leaf curling, vein darkening and enations. The disease symptoms are induced by DNA satellite known as Cotton leaf curl Multan betasatellite (CLCuMuB, dominant betasatellite in cotton but another betasatellite known as Chili leaf curl betasatellite (ChLCB is also found associated with the disease. Grafting experiment was performed to determine if host plant resistance is determinant of dominant population of betasatellite in cotton (several distinct strains of CLCuMuB are associated with the disease. Infected scion of Gossypium hirsutum collected from field (the source was grafted on G. arboreum, a diploid cotton species, resistant to the disease. A healthy scion of G. hirsutum (sink was grafted at the top of G. arboreum to determine the movement of virus/betasatellite to upper susceptible scion of G. hirsutum. Symptoms of disease appeared in the upper scion and presence of virus/betasatellite in the upper scion was confirmed via molecular techniques, showing that virus/betasatellite was able to move to upper scion through resistant G. arboreum. However, no symptoms appeared on G. arboreum. Betasatelites were cloned and sequenced from lower scion, upper scion and G. arboreum which show that the lower scion contained both CLCuMuB and ChLCB, however only ChLCB was found in G. arboreum. The upper scion contained CLCuMuB with a deletion of 78 nucleotides (nt in the non-coding region between A-rich sequence and βC1 gene and insertion of 27 nt in the middle of βC1 ORF. This study may help in investigating molecular basis of resistance in G. arboreum.

PVP capped silver nanocubes assisted removal of glyphosate from water-A photoluminescence study.

Science.gov (United States)

Sarkar, Sumit; Das, Ratan

2017-10-05

Glyphosate [N-phosphono-methylglycine (PMG)] is the most used herbicide worldwide and it has been reported very recently that Glyphosate is very harmful and can produce lots of diseases such as alzheimer and parkinson's disease, depression, cancer, infertility including genotoxic effects. As it is mostly present in stable water body and ground water system, its detection and removal is very important. Here, we have shown a fluorescence technique for the removal of glyphosate from water using chemically synthesized polyvinylpyrrolidone (PVP) silver nanocrystals. Transmission Electron Microscopy (TEM) study shows the average size of silver nanocrystals of 100nm approximately with a morphology of cubic shape. Glyphosate does not show absorption in the visible region. But both glyphosate and silver nanocrystals show strong fluorescence in the visible region. So, photoluminescence study has been successfully utilized to detect the glyphosate in water samples and on treating the glyphosate contaminated water sample with silver nanocrystals, the sample shows no emission peak of glyphosate at 458nm. Thus, this approach is a promising and very rapid method for the detection and removal of glyphosate from water samples on treatment with silver nanocubes. NMR spectra further confirms that the silver nanocrystals treated contaminated water samples are glyphosate free. Copyright © 2017 Elsevier B.V. All rights reserved.

Influence of Soil Temperature on Meloidogyne incognita Resistant and Susceptible Cotton, Gossypium hirsutum

OpenAIRE

Carter, William W.

1982-01-01

The degree of resistance by a cotton plant to Meloidogyne incognita is affected by soil temperature, particularly in moderately resistant cultivars, The total number of nematodes in the resistant and moderately resistant rools at 35 C was equal to, or greater than, the number in susceptible roots at 20, 25, or 30 C. A shift in numbers to developing and egg-bearing forms of nematodes in the susceptible cultivar as tentperature increased indicates development was affected by temperature rather ...

[Genetic improvement of cotton varieties in Huang-Huai region in China since 1950's. III. Improvement on agronomy properties, disease resistance and stability].

Science.gov (United States)

Jiang, B G; Kong, F L; Zhang, Q Y; Yang, F X; Jiang, R Q

2000-01-01

Data from a set of 5-location and 2-year experiments on 10 representative historical cotton varieties and the data of Huang-Huai Regional Cotton Trials from 1973 to 1996 were analyzed to estimate the effects of genetic improvement in agronomy properties, disease resistance and stability of cotton in Huang-Huai Region in China. The results indicated that a great genetic progress of earliness and disease resistance had been achieved by breeding programs since 1950's. The maturity was shortened 3-5 days; The rate of preforst yield was increased about 7 percentages. The problem of resistance to Fususium wilt has been solved and the resistance to Verticillum wilt was improving. Some progress in stability of cotton varieties also has been achieved by breeding programs since 1950.

Effects of glyphosate and endosulfan on soil microorganisms in soybean crop Efeitos do endosulfan e glyphosate sobre microrganismos do solo na cultura da soja

Directory of Open Access Journals (Sweden)

J.L. Pereira

2008-01-01

Full Text Available Transgenic soybean, resistant to glyphosate, is the most dominant transgenic crop grown commercially in the world. Research works on herbicide and insecticide mixtures and their effects on microorganisms are rarely reported. This work aimed to study the impact of glyphosate, endosulfan and their mixtures on the microbial soil activity in soybean crop. The experiment was carried out in a complete randomized block design with four treatments and five replications. The treatments were glyphosate 480 SL [540 g of active ingredient (a.i. ha-1], endosulfan 350 EC (525 g a.i. ha-1, the glyphosate 480 SL [540 g of active ingredient (a.i. ha-1] mixed with endosulfan 350 EC (525 g a.i. ha-1 and the control. Microbial activity was evaluated five days after treatment application. Glyphosate application was not an impacting factor for soil CO2 production. Endosulfan application (alone or mixed with glyphosate suppressed CO2 production by microorganisms in the soil. Microbial biomass and microbial quotient were lower in the treatments using endosulfan alone and in those using endosulfan mixed with glyphosate than in the treatments using glyphosate alone and control.A soja resistente ao glyphosate é a cultura transgênica mais cultivada em todo o mundo. Pesquisas envolvendo o impacto de mistura de herbicidas e inseticidas e seus efeitos sobre microrganismos do solo são raramente reportadas. Este trabalho teve por objetivo avaliar o impacto do herbicida (glyphosate, do inseticida (endosulfan e da mistura de ambos sobre a atividade microbiana do solo na cultura da soja. O delineamento experimental foi em blocos casualizados, com quatro tratamentos e cinco repetições. Os tratamentos foram o herbicida glyphosate 480 SL [540 g de ingrediente ativo (i.a. ha-1], endosulfan 350 EC (525 g i.a. ha-1, a mistura de glyphosate 480 SL (540 g de i.a. ha-1 com endosulfan 350 EC (525 g i.a. ha-1 e a testemunha onde se aplicou água. A atividade microbiana foi avaliada aos

Suppressing Resistance to Bt Cotton with Sterile Insect Releases

Energy Technology Data Exchange (ETDEWEB)

Tabashnik, B E [Department of Entomology, University of Arizona, Tucson, AZ (United States); Sisterson, M S [USDA-ARS, San Joaquin Valley Agricultural Sciences Center, Parlier, CA (United States); Ellsworth, P C [Department of Entomology, University of Arizona, Maricopa Agricultural Center, Maricopa, AZ (United States)

2011-01-15

Genetically engineered crops that produce insecticidal toxins from Bacillus thuringiensis (Bt) are grown widely for pest control. However, insect adaptation can reduce the toxins' efficacy. The predominant strategy for delaying pest resistance to Bt crops requires refuges of non-Bt host plants to provide susceptible insects to mate with resistant insects. Variable farmer compliance is one of the limitations of this approach. Here we report the benefits of an alternative strategy where sterile insects are released to mate with resistant insects and refuges are scarce or absent. Computer simulations show that this approach works in principle against pests with recessive or dominant inheritance of resistance. During a largescale, four-year field deployment of this strategy in Arizona, resistance of pink bollworm (Pectinophora gossypiella) to Bt cotton did not increase. A multitactic eradication program that included the release of sterile moths reduced pink bollworm abundance by >99%, while eliminating insecticide sprays against this key invasive pest. (author)

Airborne remote sensing assessment of the damage to cotton caused by spray drift from aerially applied glyphosate through spray deposition measurements

Science.gov (United States)

Off-target drift of aerially applied glyphosate can cause plant injury, which is of great concern to farmers and aerial applicators. To determine the extent of crop injury due to near-field drift, an experiment was conducted with a single aerial application of glyphosate. For identification of the d...

Glyphosate Dissipation in Different Soils Under No-Till and Conventional Till

Science.gov (United States)

Okada, Elena; Costa, Jose Luis; Francisco, Bedmar

2017-04-01

Glyphosate is the most used herbicide in Argentina, accounting for 62% of the commercialized pesticides in the market. It is used as a weed controller in chemical fallow under no-till systems, and it is also applied in various genetically modified crops (e.g. soybean, corn, cotton). Though it has a high solubility in water, it tends to adsorb and accumulate in agricultural soils. The description of glyphosate biodegradation in soils with a long term history under agricultural practices is of interest. The main objectives of this work were to compare the dissipation of glyphosate and the accumulation of its metabolite aminomethylphosphonic acid (AMPA) over time in three soils from Argentina. The studied soils belong to areas of high agronomic land use and different edaphoclimatic conditions, situated in Manfredi (MAN), Pergamino (PER) and Paraná (PAR). Soil samples were taken from long-term field trials with a history of more than 16 years under no-till and conventional tillage management. To study glyphosate dissipation in soil under controlled laboratory conditions, 400 g of dry soil sample were placed in 1.5 L flasks. A dose corresponding to 6 L ha-1 of commercial glyphosate ATANOR II® (35.6 % a.i.) was applied on day 0. The dose applied was equivalent to a final concentration in soil of 4000 μg Kg-1 of active ingredient. The moisture of the soil samples was kept at 60 % of the field capacity. Samples were incubated in the dark at a constant temperature of 22°C ± 1°C. A sub-sample of 5 g was taken from each flask at day 0 (after application), 1, 3, 7, 15, 20, 28, 44 and 62. Glyphosate and AMPA in soil samples was extracted with a strong basic solution (100 mM Na2B4O7•10H2O/ 100 mM K3PO4, pH=9) and then derivitazed with FMOC-Cl. Detection and quantification of the compounds was performed by ultra-performance liquid chromatography coupled with a mass spectrometer (UPLC MS/MS). The results showed that forty percent of the applied glyphosate was degraded

Detoxifying enzyme studies on cotton leafhopper, Amrasca biguttula biguttula (Ishida, resistance to neonicotinoid insecticides in field populations in Karnataka, India

Directory of Open Access Journals (Sweden)

Halappa Banakar

2016-12-01

Full Text Available The cotton leafhopper (Amrasca biguttula biguttula Ishida is considered to be an alarming insect pest causing both quantitative and qualitative loss in cotton. In situ bioassay studies were done and the role of detoxifying enzymes in conferring resistance to neonicotinoid groups of insecticides in low (MUD, medium (DVG, high (HVR and very high (GLB pesticide usage areas of Karnataka were determined. Bioassay studies showed that imidacloprid, thiamethoxam, acetamiprid, thiacloprid and clothianidin registered varying levels of resistance for all the locations studied. The resistance ratio was high in imidacloprid (3.35, 8.57, 9.15 and 12.27 fold respectively and the lowest in dinoferuran (1.86, 5.13, 6.71 and 9.88 fold respectively. Furthermore, the enzyme activity ratio (glutathione-S-transferase was relatively greater, and corresponded to the higher LC50 values of neonicotinoids for very high, high, medium and low pesticide usage areas. Our study suggested that the higher activity of the detoxifying enzyme in the resistance population of cotton leafhopper apparently has a significant role in endowing resistance to neonicotinoid groups of insecticides. However, this study recommends using neonicotinoids in cotton growing areas with caution.

Glyphosate toxicity and carcinogenicity: a review of the scientific basis of the European Union assessment and its differences with IARC

OpenAIRE

Tarazona, Jose V.; Court-Marques, Daniele; Tiramani, Manuela; Reich, Hermine; Pfeil, Rudolf; Istace, Frederique; Crivellente, Federica

2017-01-01

Glyphosate is the most widely used herbicide worldwide. It is a broad spectrum herbicide and its agricultural uses increased considerably after the development of glyphosate-resistant genetically modified (GM) varieties. Since glyphosate was introduced in 1974, all regulatory assessments have established that glyphosate has low hazard potential to mammals, however, the International Agency for Research on Cancer (IARC) concluded in March 2015 that it is probably carcinogenic. The IARC conclus...

Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

OpenAIRE

Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

2015-01-01

Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

Effective dominance of resistance of Spodoptera frugiperda to Bt maize and cotton varieties: implications for resistance management

Science.gov (United States)

Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. De A. E.; Omoto, Celso

2016-10-01

The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants.

Is it time to reassess current safety standards for glyphosate-based herbicides?

Science.gov (United States)

Vandenberg, Laura N; Blumberg, Bruce; Antoniou, Michael N; Benbrook, Charles M; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vom Saal, Frederick S; Welshons, Wade V; Myers, John Peterson

2017-06-01

Use of glyphosate-based herbicides (GBHs) increased ∼100-fold from 1974 to 2014. Additional increases are expected due to widespread emergence of glyphosate-resistant weeds, increased application of GBHs, and preharvest uses of GBHs as desiccants. Current safety assessments rely heavily on studies conducted over 30 years ago. We have considered information on GBH use, exposures, mechanisms of action, toxicity and epidemiology. Human exposures to glyphosate are rising, and a number of in vitro and in vivo studies challenge the basis for the current safety assessment of glyphosate and GBHs. We conclude that current safety standards for GBHs are outdated and may fail to protect public health or the environment. To improve safety standards, the following are urgently needed: (1) human biomonitoring for glyphosate and its metabolites; (2) prioritisation of glyphosate and GBHs for hazard assessments, including toxicological studies that use state-of-the-art approaches; (3) epidemiological studies, especially of occupationally exposed agricultural workers, pregnant women and their children and (4) evaluations of GBHs in commercially used formulations, recognising that herbicide mixtures likely have effects that are not predicted by studying glyphosate alone. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

Directory of Open Access Journals (Sweden)

Bingfu eGuo

2015-10-01

Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

Non Target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis

Directory of Open Access Journals (Sweden)

Pablo Tomas Fernandez-Moreno

2016-08-01

Full Text Available Sterile wild oat (Avena sterilis L. is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage before the beginning of summer period (due to the possibility of intense drought stress. In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha-1 for exposed (E and un-exposed (UE glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of 14C- glyphosate absorption was the same in the two accessions (E and UE, while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica and Lolium rigidum.

Non-target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis.

Science.gov (United States)

Fernández-Moreno, Pablo T; Alcantara-de la Cruz, Ricardo; Cruz-Hipólito, Hugo E; Rojano-Delgado, Antonia M; Travlos, Ilias; De Prado, Rafael

2016-01-01

Sterile wild oat (Avena sterilis L.) is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage) before the beginning of summer period (due to the possibility of intense drought stress). In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha(-1) for exposed (E) and un-exposed (UE) glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of (14)C- glyphosate absorption was the same in the two accessions (E and UE), while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA) and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica, and Lolium rigidum.

Combining ability estimates for earliness in cotton leaf curl virus resistant inbred parents

International Nuclear Information System (INIS)

Baloch, M.J.; Baloch, Q.B.

2005-01-01

Four female cotton leaf curl virus-resistant resistant (cclv) parents consisting of advance strains and commercial varieties (VH-137, FH-901, CRIS-467 and Cyto-51) and four male parents, all clcv resistant Punjab varieties (FH-945, CIM-707, CIM-473 and FH-1000) were mated in a cross classification Design-II fashion. The results show that genetic variances due to additive genes were higher than the dominant variances, yet both types of variances were substantial, implying that significant improvement could reliably be made from segregating populations. The general combining ability (gca) estimates by and large suggested that for improvement in the appearance of first white flower and 1st sympodial branch node number, parents FH-945 and VH-137 whereas for 1st effective boll setting, parents FH-1000 and FH-901 and for percent of open bolls at 120 days after planting, parents CIM-707 and CRIS-467 may be given preference. However, for hybrid cotton development regarding earliness, hybrids CRIS-467 x CIM-707, VH-137 x FH-945 and Cyto-51 x FH-1000 may be chosen. (author)

Formulants of glyphosate-based herbicides have more deleterious impact than glyphosate on TM4 Sertoli cells.

Science.gov (United States)

Vanlaeys, Alison; Dubuisson, Florine; Seralini, Gilles-Eric; Travert, Carine

2018-05-15

Roundup and Glyphogan are glyphosate-based herbicides containing the same concentration of glyphosate and confidential formulants. Formulants are declared as inert diluents but some are more toxic than glyphosate, such as the family of polyethoxylated alkylamines (POEA). We tested glyphosate alone, glyphosate-based herbicide formulations and POEA on the immature mouse Sertoli cell line (TM4), at concentrations ranging from environmental to agricultural-use levels. Our results show that formulations of glyphosate-based herbicides induce TM4 mitochondrial dysfunction (like glyphosate, but to a lesser extent), disruption of cell detoxification systems, lipid droplet accumulation and mortality at sub-agricultural doses. Formulants, especially those present in Glyphogan, are more deleterious than glyphosate and thus should be considered as active principles of these pesticides. Lipid droplet accumulation after acute exposure to POEA suggests the rapid penetration and accumulation of formulants, leading to mortality after 24 h. As Sertoli cells are essential for testicular development and normal onset of spermatogenesis, disturbance of their function by glyphosate-based herbicides could contribute to disruption of reproductive function demonstrated in mammals exposed to these pesticides at a prepubertal stage of development. Copyright © 2017. Published by Elsevier Ltd.

Transcriptome Analysis of Cotton (Gossypium hirsutum L. Genotypes That Are Susceptible, Resistant, and Hypersensitive to Reniform Nematode (Rotylenchulus reniformis.

Directory of Open Access Journals (Sweden)

Ruijuan Li

Full Text Available Reniform nematode is a semi-endoparasitic nematode species causing significant yield loss in numerous crops, including cotton (Gossypium hirsutum L.. An RNA-sequencing analysis was conducted to measure transcript abundance in reniform nematode susceptible (DP90 & SG747, resistant (BARBREN-713, and hypersensitive (LONREN-1 genotypes of cotton (Gossypium hirsutum L. with and without reniform nematode infestation. Over 90 million trimmed high quality reads were assembled into 84,711 and 80, 353 transcripts using the G. arboreum and the G. raimondii genomes as references. Many transcripts were significantly differentially expressed between the three different genotypes both prior to and during nematode pathogenesis, including transcripts corresponding to the gene ontology categories of cell wall, hormone metabolism and signaling, redox reactions, secondary metabolism, transcriptional regulation, stress responses, and signaling. Further analysis revealed that a number of these differentially expressed transcripts mapped to the G. raimondii and/or the G. arboreum genomes within 1 megabase of quantitative trait loci that had previously been linked to reniform nematode resistance. Several resistance genes encoding proteins known to be strongly linked to pathogen perception and resistance, including LRR-like and NBS-LRR domain-containing proteins, were among the differentially expressed transcripts mapping near these quantitative trait loci. Further investigation is required to confirm a role for these transcripts in reniform nematode susceptibility, hypersensitivity, and/or resistance. This study presents the first systemic investigation of reniform nematode resistance-associated genes using different genotypes of cotton. The candidate reniform nematode resistance-associated genes identified in this study can serve as the basis for further functional analysis and aid in further development of reniform a nematode resistant cotton germplasm.

Glyphosate and Roundup® alter morphology and behavior in zebrafish.

Science.gov (United States)

Bridi, Daiane; Altenhofen, Stefani; Gonzalez, Jonas Brum; Reolon, Gustavo Kellermann; Bonan, Carla Denise

2017-12-01

Glyphosate has become the most widely used herbicide in the world, due to the wide scale adoption of transgenic glyphosate resistant crops after its introduction in 1996. Glyphosate may be used alone, but it is commonly applied as an active ingredient of the herbicide Roundup ® . This pesticide contains several adjuvants, which may promote an unknown toxicity. The indiscriminate application poses numerous problems, both for the health of the applicators and consumers, and for the environment, contaminating the soil, water and leading to the death of plants and animals. Zebrafish (Danio rerio) is quickly gaining popularity in behavioral research, because of physiological similarity to mammals, sensitivity to pharmacological factors, robust performance, low cost, short spawning intervals, external fertilization, transparency of embryos through larval stages, and rapid development. The aim of this study was evaluate the effects of glyphosate and Roundup ® on behavioral and morphological parameters in zebrafish larvae and adults. Zebrafish larvae at 3days post-fertilization and adults were exposed to glyphosate (0.01, 0.065, and 0.5mg/L) or Roundup ® (0.01, 0.065, and 0.5mg/L) for 96h. Immediately after the exposure, we performed the analysis of locomotor activity, aversive behavior, and morphology for the larvae and exploratory behavior, aggression and inhibitory avoidance memory for adult zebrafish. In zebrafish larvae, there were significant differences in the locomotor activity and aversive behavior after glyphosate or Roundup ® exposure when compared to the control group. Our findings demonstrated that exposure to glyphosate at the concentration of 0.5mg/L, Roundup ® at 0.065 or 0.5mg/L reduced the distance traveled, the mean speed and the line crossings in adult zebrafish. A decreased ocular distance was observed for larvae exposed at 0.5mg/L of glyphosate. We verified that at 0.5mg/L of Roundup ® -treated adult zebrafish demonstrated a significant

Glyphosate

OpenAIRE

Arcuri, Alessandra

2017-01-01

markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the substance is carcinogenic to humans and toxic for the environment. The controversy took a sharp legal turn when, in March 2015, the International Agency for Research on Cancer (IARC), which is the ...

Impacts of Repeated Glyphosate Use on Wheat-Associated Bacteria Are Small and Depend on Glyphosate Use History.

Science.gov (United States)

Schlatter, Daniel C; Yin, Chuntao; Hulbert, Scot; Burke, Ian; Paulitz, Timothy

2017-11-15

Glyphosate is the most widely used herbicide worldwide and a critical tool for weed control in no-till cropping systems. However, there are concerns about the nontarget impacts of long-term glyphosate use on soil microbial communities. We investigated the impacts of repeated glyphosate treatments on bacterial communities in the soil and rhizosphere of wheat in soils with and without long-term history of glyphosate use. We cycled wheat in the greenhouse using soils from 4 paired fields under no-till (20+-year history of glyphosate) or no history of use. At each cycle, we terminated plants with glyphosate (2× the field rate) or by removing the crowns, and soil and rhizosphere bacterial communities were characterized. Location, cropping history, year, and proximity to the roots had much stronger effects on bacterial communities than did glyphosate, which only explained 2 to 5% of the variation. Less than 1% of all taxa were impacted by glyphosate, more in soils with a long history of use, and more increased than decreased in relative abundance. Glyphosate had minimal impacts on soil and rhizosphere bacteria of wheat, although dying roots after glyphosate application may provide a "greenbridge" favoring some copiotrophic taxa. IMPORTANCE Glyphosate (Roundup) is the most widely used herbicide in the world and the foundation of Roundup Ready soybeans, corn, and the no-till cropping system. However, there have been recent concerns about nontarget impacts of glyphosate on soil microbes. Using next-generation sequencing methods and glyphosate treatments of wheat plants, we described the bacterial communities in the soil and rhizosphere of wheat grown in Pacific Northwest soils across multiple years, different locations, and soils with different histories of glyphosate use. The effects of glyphosate were subtle and much less than those of drivers such as location and cropping systems. Only a small percentage of the bacterial groups were influenced by glyphosate, and most of

[Poisonings with the herbicides glyphosate and glyphosate-trimesium].

Science.gov (United States)

Mortensen, O S; Sørensen, F W; Gregersen, M; Jensen, K

2000-08-28

Generally the herbicide glyphosate is considered harmless to humans. Glyphosate-trimesium is labelled harmful (Xn), whereas glyphosate-isopropylamine carries no warning sign. As cases of serious poisoning have emerged contacts to the Poison Information Centre have been reviewed. The persons exposed were mainly smaller children and adults 20 to 59 years of age. Oral exposure was recorded in 47 persons, inhalation exposure in 24 and topical contact in 42. About one fourth of the exposed persons were asymptomatic. Most of the symptomatic poisonings demonstrated complaints from the mouth, the gastrointestinal tract and the airways. Eleven patients were admitted to hospital. Two died, one of them having ingested the isopropylamine salt, the other the trimesium salt. Death ensued quickly in the latter patient. A similar fate was observed in a child--not included in the present material--who had also ingested the trimesium compound.

Occurrence and levels of glyphosate and AMPA in shallow lakes from the Pampean and Patagonian regions of Argentina.

Science.gov (United States)

Castro Berman, M; Marino, D J G; Quiroga, María Victoria; Zagarese, Horacio

2018-06-01

Glyphosate (N-(phosphonomethyl)glycine) is a broad-spectrum systemic herbicide used to kill weeds that compete with commercial crops. In Argentina, the use of glyphosate-based herbicides increased dramatically (up to ∼200,000 tons on 2012) since the introduction of glyphosate-resistant crops, such as transgenic soy and resistant corn, and the adoption of non-till practices in the 1990's. Sallow lakes within the Pampa region may be potentially impacted by continuous herbicide usage. We surveyed 52 shallow lakes from the Pampa region (Buenos Aires Province, Argentina) to assess the occurrence and concentrations of glyphosate and its main degradation product (AMPA). For comparison, we also sampled 24 shallow lakes from an area with no agricultural use of glyphosate (Northern Patagonia). Glyphosate and AMPA were analyzed by UPLC-MS/MS ESI (±) in lake water, suspended particulate matter (SPM), and sediment samples. Within the Pampa region, glyphosate residues were detected in >40% of samples. Glyphosate residues were detected more frequently in sediment and surface water than in SPM samples. The mean (maximum) concentrations of glyphosate were 2.11 (4.52) μg l -1 for surface water; 0.10 (0.13) μg l -1 for SPM and 10.47 (20.34) μg kg -1 for sediment samples, respectively. Whereas, mean (maximum) concentrations of AMPA were 0.84 and (0.90) μg l -1 for surface water; 0.07 (0.07) μg l -1 for SPM; and 22.53 (32.89) μg kg -1 for sediment samples. The herbicide was not detected in samples from the Patagonian region. To our knowledge, this is the first study reporting the occurrence and concentrations of the herbicide in freshwater lakes of Argentina. Copyright © 2018 Elsevier Ltd. All rights reserved.

Inheritance of resistance to Colletotrichum gossypii var. cephalosporioides in cotton

Directory of Open Access Journals (Sweden)

Mansuêmia Alves Couto de Oliveira

2010-01-01

Full Text Available The objective of this study was to analyze the inheritance of the resistance to cotton ramulosis. For thispurpose, two groups of lines with contrasting performance for the evaluated trait were crossed. The disease-susceptibleparents were Delta Opal, CNPA 999 and CNPA 2161, and those with resistance BRS Facual, CNPA 2043 and CNPA 2984,resulting in nine crosses, always of one resistant and one susceptible parent, totalizing 42 treatments. The experiment was setup in a randomized complete block design with three replications. It was verified that the genetic control of ramulosisresistance is predominantly oligogenic, and the number of genes involved depends on the parents that participate in eachcross, due to the possibility of differential loci fixation. Evidence of partial dominance in the sense of increasing diseaseresistance was found, but there were also indications that dominance is not unidirectional.

Heterologous Expression of the Cotton NBS-LRR Gene GbaNA1 Enhances Verticillium Wilt Resistance in Arabidopsis

Directory of Open Access Journals (Sweden)

Nan-Yang Li

2018-02-01

Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.

Crescimento diferencial de biótipos de Conyza SPP. resistente e suscetível ao herbicida glifosato Differential growth of glyphosate-resistant and susceptible biotypes of Conyza SPP

Directory of Open Access Journals (Sweden)

Murilo Sala Moreira

2010-01-01

Full Text Available Este trabalho foi realizado com o objetivo de comparar, em condição controlada e não-competitiva, o crescimento de biótipos de Conyza canadensis e C. bonariensis resistente e suscetível ao herbicida glifosato, a fim de quantificar os efeitos da pressão de seleção para resistência nos biótipos. Dois experimentos foram desenvolvidos com tratamentos organizados em esquema fatorial 9 x 2, com nove avaliações periódicas de crescimento e dois biótipos de cada espécie. As variáveis avaliadas por planta foram: área foliar; massa seca da parte aérea, das raízes e total, obtendo-se, a partir desta última, a taxa de crescimento absoluto. O biótipo de C. canadensis resistente ao glifosato possui crescimento mais lento, menor acúmulo de área foliar e de massa seca que o biótipo suscetível. Menores áreas foliar e massa seca também foram registradas para o biótipo de C. bonariensis resistente ao glifosato quando comparado ao suscetível, porém com diferenças mais sutis que aquelas constatadas para C. canadensis. O crescimento absoluto do biótipo suscetível foi superior ao do resistente em ambas as espécies. A pressão de seleção para resistência ao glifosato teve impactos negativos na habilidade de crescimento dos biótipos.This work was carried out with the objective of comparing, under controlled and non-competitive condition, the growth of glyphosate-resistant and susceptible biotypes of Conyza canadensis and C. bonariensis; to quantify the effects of resistance selection pressure on the biotypes. Two trials were developed with treatments organized according to a factorial scheme 9 x 2, where nine were periodical growth evaluations and two were biotypes of each species. The variables evaluated per plant were: leaf area and dry mass (shoot, root and total; to determine absolute growth rate from the total dry mass. The glyphosate-resistant biotype of C. canadensis exhibits slower growth and smaller accumulation of leaf area

Analyses of Fusarium wilt race 3 resistance in Upland cotton (Gossypium hirsutum L.).

Science.gov (United States)

Abdullaev, Alisher A; Salakhutdinov, Ilkhom B; Egamberdiev, Sharof Sh; Kuryazov, Zarif; Glukhova, Ludmila A; Adilova, Azoda T; Rizaeva, Sofiya M; Ulloa, Mauricio; Abdurakhmonov, Ibrokhim Y

2015-06-01

Fusarium wilt [Fusarium oxysporum f.sp. vasinfectum (FOV) Atk. Sny & Hans] represents a serious threat to cotton (Gossypium spp.) production. For the last few decades, the FOV pathogen has become a significant problem in Uzbekistan causing severe wilt disease and yield losses of G. hirsutum L. cultivars. We present the first genetic analyses of FOV race 3 resistance on Uzbek Cotton Germplasm with a series of field and greenhouse artificial inoculation-evaluations and inheritance studies. The field experiments were conducted in two different sites: the experimental station in Zangiota region-Environment (Env) 1 and the Institute of Cotton Breeding (Env-2, Tashkent province). The Env-1 was known to be free of FOV while the Env-2 was known to be a heavily FOV infested soil. In both (Env-1 and Env-2) of these sites, field soil was inoculated with FOV race 3. F2 and an F3 Upland populations ("Mebane B1" × "11970") were observed with a large phenotypic variance for plant survival and FOV disease severity within populations and among control or check Upland accessions. Wilt symptoms among studied F2 individuals and F3 families significantly differed depending on test type and evaluation site. Distribution of Mendelian rations of susceptible (S) and resistant (R) phenotypes were 1S:1R field Env-1 and 3S:1R field Env-2 in the F2 population, and 1S:3R greenhouse site in the F3 population. The different segregation distribution of the Uzbek populations may be explained by differences in FOV inoculum level and environmental conditions during assays. However, genetic analysis indicated a recessive single gene action under high inoculum levels or disease pressure for FOV race 3 resistance. Uzbek germplasm may be more susceptible than expected to FOV race 3, and sources of resistance to FOV may be limited under the FOV inoculum levels present in highly-infested fields making the breeding process more complex.

Perturbations of amino acid metabolism associated with glyphosate-dependent inhibition of shikimic acid metabolism affect cellular redox homeostasis and alter the abundance of proteins involved in photosynthesis and photorespiration.

Science.gov (United States)

Vivancos, Pedro Diaz; Driscoll, Simon P; Bulman, Christopher A; Ying, Liu; Emami, Kaveh; Treumann, Achim; Mauve, Caroline; Noctor, Graham; Foyer, Christine H

2011-09-01

The herbicide glyphosate inhibits the shikimate pathway of the synthesis of amino acids such as phenylalanine, tyrosine, and tryptophan. However, much uncertainty remains concerning precisely how glyphosate kills plants or affects cellular redox homeostasis and related processes in glyphosate-sensitive and glyphosate-resistant crop plants. To address this issue, we performed an integrated study of photosynthesis, leaf proteomes, amino acid profiles, and redox profiles in the glyphosate-sensitive soybean (Glycine max) genotype PAN809 and glyphosate-resistant Roundup Ready Soybean (RRS). RRS leaves accumulated much more glyphosate than the sensitive line but showed relatively few changes in amino acid metabolism. Photosynthesis was unaffected by glyphosate in RRS leaves, but decreased abundance of photosynthesis/photorespiratory pathway proteins was observed together with oxidation of major redox pools. While treatment of a sensitive genotype with glyphosate rapidly inhibited photosynthesis and triggered the appearance of a nitrogen-rich amino acid profile, there was no evidence of oxidation of the redox pools. There was, however, an increase in starvation-associated and defense proteins. We conclude that glyphosate-dependent inhibition of soybean leaf metabolism leads to the induction of defense proteins without sustained oxidation. Conversely, the accumulation of high levels of glyphosate in RRS enhances cellular oxidation, possibly through mechanisms involving stimulation of the photorespiratory pathway.

The Improvement of the Resistance to Candida albicans and Trichophyton interdigitale of Some Woven Fabrics Based on Cotton

Science.gov (United States)

Stelescu, Maria Daniela; Manaila, Elena; Nicula, Gheorghe; Iordache, Ovidiu; Dinca, Laurentiu Christian; Berechet, Mariana-Daniela; Vamesu, Mariana; Gurau, Dana

2014-01-01

This paper presents the improvement of the antimicrobial character of woven fabrics based on cotton. The woven fabrics were cleaned in oxygen plasma and treated by padding with silver chloride and titanium dioxide particles. The existence of silver and titanium on woven fabrics was evidenced by electronic microscope images (SEM, EDAX) and by flame atomic absorption spectrophotometry. The antimicrobial tests were performed with two fungi: Candida albicans and Trichophyton interdigitale. The obtained antimicrobial effect was considerably higher compared to the raw fabrics. Treatment of dyed fabrics with a colloidal solution based on silver chloride and titanium dioxide particles does not considerably influence colour resistance of dyes. PMID:25276112

Glyphosate-Degrading Microorganisms from Industrial Activated Sludge

OpenAIRE

Balthazor, Terry M.; Hallas, Laurence E.

1986-01-01

A plating medium was developed to isolate N-phosphonomethylglycine (glyphosate)-degrading microorganisms, with glyphosate as the sole phosphorus source. Two industrial biosystems treating glyphosate wastes contained elevated microbial counts on the medium. One purified isolate metabolized glyphosate to aminomethylphosphonic acid, mineralizing this accumulating intermediate during log growth. This microorganism has been identified as a Flavobacterium species.

76 FR 27268 - Glyphosate; Pesticide Tolerance

Science.gov (United States)

2011-05-11

... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 180 [EPA-HQ-OPP-2010-0938; FRL-8872-6] Glyphosate... regulation increases the established tolerance for residues of glyphosate in or on corn, field, forage... tolerance for residues of the herbicide glyphosate, N-(phosphonomethyl) glycine, in or on corn, field...

Induced resistance by cresotic acid (3-hydroxy-4-methyl methylbenzoic acid) against wilt disease of melon and cotton

International Nuclear Information System (INIS)

Dong, H.; Li, Z.; Zhang, D.; Li, W.; Tang, W.

2004-01-01

Cresotic acid (3-hydroxy-4-methylbenzoic acid) was proved be active in controlling wilt diseases of melon and cotton plants grown in the house. Soil drench with 200-1000 ppm cresotic acid induced 62-77 %, 69-79 % and 50-60 % protection against Fusarium oxysporum f.sp melonis (FOM) in melon, Fusarium oxysporum f.sp vasinfectum (FOV) and Verticillium dahliae in cotton, respectively. Since no inhibitory effect of cresotic acid on mycelial growth of these three fungual pathogens was observed in vitro, it is suggested that control of these wilt diseases with cresotic acid resulted from induced resistance. Cresotic acid induced resistance in melon plants not only against race 0, race 1, race 2 and race 1,2, but also against a mixture of these four races of FOM, suggesting a non-race- specific resistance. Level of induced resistance by cresotic acid against FOM depended on inoculum pressure applied to melon plants. At 25 day after inoculation with FOM, percentage protection induced by cresotic acid under low inoculum pressure retained a level of 51 %, while under high inoculum pressure percentage protection decreased to only 10 %. High concentrations of cresotic acid significantly reduced plant growth. Reduction in fresh weight of melon (36-51%) and cotton (42-71%) was obtained with 500-1000 ppm cresotic acid, while only less than 8% reduction occurred with 100-200 ppm. (author)

Methylation-sensitive amplified polymorphism analysis of Verticillium wilt-stressed cotton (Gossypium).

Science.gov (United States)

Wang, W; Zhang, M; Chen, H D; Cai, X X; Xu, M L; Lei, K Y; Niu, J H; Deng, L; Liu, J; Ge, Z J; Yu, S X; Wang, B H

2016-10-06

In this study, a methylation-sensitive amplification polymorphism analysis system was used to analyze DNA methylation level in three cotton accessions. Two disease-sensitive near-isogenic lines, PD94042 and IL41, and one disease-resistant Gossypium mustelinum accession were exposed to Verticillium wilt, to investigate molecular disease resistance mechanisms in cotton. We observed multiple different DNA methylation types across the three accessions following Verticillium wilt exposure. These included hypomethylation, hypermethylation, and other patterns. In general, the global DNA methylation level was significantly increased in the disease-resistant accession G. mustelinum following disease exposure. In contrast, there was no significant difference in the disease-sensitive accession PD94042, and a significant decrease was observed in IL41. Our results suggest that disease-resistant cotton might employ a mechanism to increase methylation level in response to disease stress. The differing methylation patterns, together with the increase in global DNA methylation level, might play important roles in tolerance to Verticillium wilt in cotton. Through cloning and analysis of differently methylated DNA sequences, we were also able to identify several genes that may contribute to disease resistance in cotton. Our results revealed the effect of DNA methylation on cotton disease resistance, and also identified genes that played important roles, which may shed light on the future cotton disease-resistant molecular breeding.

The economic impact and the distribution of benefits and risk from the adoption of insect resistant (Bt) cotton in West Africa:

OpenAIRE

Falck-Zepeda, Jose; Horna, Daniela; Smale, Melinda

2007-01-01

"Cotton is the largest source of export receipts of several West African countries. Statistics however show a decreasing tendency in cotton yields and an increasing tendency in pesticide use. Under this circumstances there appear to be potential payoffs from the use of biotechnology products in the farming systems of the region. In this study we estimate different scenarios for the potential deployment of insect resistant cotton in selected countries in West Africa (WA). We use an economic su...

Glyphosate em mistura com herbicidas alternativos para o manejo de plantas daninhas Glyphosate combined with alternative herbicides for vegetation management

Directory of Open Access Journals (Sweden)

P.A. Monquero

2001-12-01

Full Text Available O uso intensivo de glyphosate como herbicida não-seletivo tem selecionado espécies de plantas daninhas tolerantes. Dessa forma, é importante que sejam estudadas misturas de tanque com herbicidas de mecanismos de ação alternativos e que apresentem efeitos sinergísticos ou aditivos. Por essa razão, foi instalado um experimento inteiramente casualizado, composto por 13 tratamentos e 4 repetições, em casa de vegetação da Universidade de São Paulo - ESALQ/USP, Piracicaba-SP, com as plantas daninhas Richardia brasiliensis, Commelina benghalensis, Amaranthus hybridus, Galinsoga parviflora e Ipomoea grandifolia em misturas de tanque dos herbicidas chlorimuron-ethyl, sulfentrazone, carfentrazone, bentazon ou flumioxazin com glyphosate. As interações foram aditivas para as plantas daninhas I. grandifolia e C. benghalensis, e os herbicidas flumioxazin, sulfentrazone e carfentrazone aplicados isoladamente e em mistura com glyphosate foram os que proporcionaram os melhores níveis de controle. A interação de glyphosate com sulfentrazone foi antagônica em R. brasiliensis; a mistura de glyphosate com os demais herbicidas estudados foi aditiva, sendo os tratamentos com mistura de glyphosate e chlorimuron-ethyl ou flumioxazin os mais eficazes. Em A. hybridus, os tratamentos que apresentaram melhores níveis de controle foram o glyphosate e carfentrazone, aplicados isoladamente, e a mistura de glyphosate com flumioxazin, sulfentrazone, chlorimuron-ethyl e bentazon, sendo estes interações aditivas. No caso de G. parviflora, os tratamentos com flumioxazin e sulfentrazone apresentaram controle total, o mesmo acontecendo com as misturas de glyphosate com carfentrazone, flumioxazin, sulfentrazone, chlorimuron-ethyl ou bentazon.The intensive use of glyphosate as a non-selective herbicide for weed vegetation management has selected some tolerant weed species. Thus, it is important to study the synergistic or antagonic or additive effects of tank

The use of BMED for glyphosate recovery from glyphosate neutralization liquor in view of zero discharge.

Science.gov (United States)

Shen, Jiangnan; Huang, Jie; Liu, Lifen; Ye, Wenyuan; Lin, Jiuyang; Van der Bruggen, Bart

2013-09-15

Alkaline glyphosate neutralization liquors containing a high salinity pose a severe environmental pollution problem by the pesticide industry. However, there is a high potential for glyphosate recovery due to the high concentration of glyphosate in the neutralization liquors. In the study, a three-compartment bipolar membrane electrodialysis (BMED) process was applied on pilot scale for the recovery of glyphosate and the production of base/acid with high concentration in view of zero discharge of wastewater. The experimental results demonstrate that BMED can remove 99.0% of NaCl from the feed solution and transform this fraction into HCl and NaOH with high concentration and purity. This is recycled for the hydrolysis reaction of the intermediate product generated by the means of the Mannich reaction of paraformaldehyde, glycine and dimethylphosphite catalyzed by triethylamine in the presence of HCl and reclamation of the triethylamine catalyst during the production process of glyphosate. The recovery of glyphosate in the feed solution was over 96%, which is acceptable for industrial production. The current efficiency for producing NaOH with a concentration of 2.0 mol L(-1) is above 67% and the corresponding energy consumption is 2.97 kWh kg(-1) at a current density of 60 mA cm(-2). The current efficiency increases and energy consumption decreases as the current density decreases, to 87.13% and 2.37 kWh kg(-1), respectively, at a current density of 30 mA cm(-2). Thus, BMED has a high potential for desalination of glyphosate neutralization liquor and glyphosate recovery, aiming at zero discharge and resource recycling in industrial application. Copyright © 2013 Elsevier B.V. All rights reserved.

The cotton MAPK kinase GhMPK20 negatively regulates resistance to Fusarium oxysporum by mediating the MKK4-MPK20-WRKY40 cascade.

Science.gov (United States)

Wang, Chen; He, Xiaowen; Li, Yuzhen; Wang, Lijun; Guo, Xulei; Guo, Xingqi

2017-11-02

Fusarium wilt is one of the most serious diseases affecting cotton. However, the pathogenesis and mechanism by which Fusarium oxysporum overcomes plant defence responses are unclear. Here, a new group D mitogen-activated protein kinase (MAPK) gene, GhMPK20, was identified and functionally analysed in cotton. GhMPK20 expression was significantly induced by F. oxysporum. Virus-induced gene silencing (VIGS) of GhMPK20 in cotton increased the tolerance to F. oxysporum, whereas ectopic GhMPK20 overexpression in Nicotiana benthamiana reduced F. oxysporum resistance via disruption of the salicylic acid (SA)-mediated defence pathway. More importantly, an F. oxysporum-induced MAPK cascade pathway composed of GhMKK4, GhMPK20 and GhWRKY40 was identified. VIGS of GhMKK4 and GhWRKY40 also enhanced F. oxysporum resistance in cotton, and the function of GhMKK4-GhMPK20 was shown to be essential for F. oxysporum-induced GhWRKY40 expression. Together, our results indicate that the GhMKK4-GhMPK20-GhWRKY40 cascade in cotton plays an important role in the pathogenesis of F. oxysporum. This research broadens our knowledge of the negative role of the MAPK cascade in disease resistance in cotton and provides an important scientific basis for the formulation of Fusarium wilt prevention strategies. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Glyphosate: too much of a good thing?

Directory of Open Access Journals (Sweden)

Marek eCuhra

2016-04-01

Full Text Available Although previously accepted as the less toxic alternative, with low impact on animals, farmers as well as consumers who are exposed to residues in food, glyphosate chemicals are now increasingly controversial as new evidence from research is emerging. We argue that specific aspects of the history, chemistry and safety of glyphosate and glyphosate-based herbicides should be thoroughly considered in present and future re-evaluations of these dominant agrochemicals:· Glyphosate is not a single chemical, it is a family of compounds with different chemical, physical and toxicological properties.· Glyphosate is increasingly recognized as having more profound toxicological effects than assumed from previous assessments.· Global use of glyphosate is continuously increasing and residues are detected in food, feed and drinking water. Thus, consumers are increasingly exposed to higher levels of glyphosate residues, and from an increasing number of sources.· Glyphosate regulation is predominantly still based on primary safety-assessment testing in various indicator organisms. However, archive studies indicate fraud and misbehavior committed by the commercial laboratories providing such research.We see emerging evidences from studies in test-animals, ecosystems indicators and studies in human health, which justify stricter regulatory measures. This implies revising glyphosate residue definitions and lowering Maximum Residue Limits (MRLs permissible in biological material intended for food and feed, as well as strengthening environmental criteria such as accepted residue concentrations in surface waters.It seems that although recent research indicates that glyphosates are less harmless than previously assumed and have complex toxicological potential, still regulatory authorities accept industry demands for approving higher levels of these residues in food and feed.

Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

International Nuclear Information System (INIS)

Mamy, Laure; Gabrielle, Benoit; Barriuso, Enrique

2010-01-01

The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

Energy Technology Data Exchange (ETDEWEB)

Mamy, Laure, E-mail: laure.mamy@versailles.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Gabrielle, Benoit, E-mail: benoit.gabrielle@agroparistech.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Barriuso, Enrique, E-mail: barriuso@grignon.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France)

2010-10-15

The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

Perturbations of Amino Acid Metabolism Associated with Glyphosate-Dependent Inhibition of Shikimic Acid Metabolism Affect Cellular Redox Homeostasis and Alter the Abundance of Proteins Involved in Photosynthesis and Photorespiration1[W][OA

Science.gov (United States)

Vivancos, Pedro Diaz; Driscoll, Simon P.; Bulman, Christopher A.; Ying, Liu; Emami, Kaveh; Treumann, Achim; Mauve, Caroline; Noctor, Graham; Foyer, Christine H.

2011-01-01

The herbicide glyphosate inhibits the shikimate pathway of the synthesis of amino acids such as phenylalanine, tyrosine, and tryptophan. However, much uncertainty remains concerning precisely how glyphosate kills plants or affects cellular redox homeostasis and related processes in glyphosate-sensitive and glyphosate-resistant crop plants. To address this issue, we performed an integrated study of photosynthesis, leaf proteomes, amino acid profiles, and redox profiles in the glyphosate-sensitive soybean (Glycine max) genotype PAN809 and glyphosate-resistant Roundup Ready Soybean (RRS). RRS leaves accumulated much more glyphosate than the sensitive line but showed relatively few changes in amino acid metabolism. Photosynthesis was unaffected by glyphosate in RRS leaves, but decreased abundance of photosynthesis/photorespiratory pathway proteins was observed together with oxidation of major redox pools. While treatment of a sensitive genotype with glyphosate rapidly inhibited photosynthesis and triggered the appearance of a nitrogen-rich amino acid profile, there was no evidence of oxidation of the redox pools. There was, however, an increase in starvation-associated and defense proteins. We conclude that glyphosate-dependent inhibition of soybean leaf metabolism leads to the induction of defense proteins without sustained oxidation. Conversely, the accumulation of high levels of glyphosate in RRS enhances cellular oxidation, possibly through mechanisms involving stimulation of the photorespiratory pathway. PMID:21757634

Survival and Development of Spodoptera frugiperda and Chrysodeixis includens (Lepidoptera: Noctuidae) on Bt Cotton and Implications for Resistance Management Strategies in Brazil.

Science.gov (United States)

Sorgatto, Rodrigo J; Bernardi, Oderlei; Omoto, Celso

2015-02-01

In Brazil, Spodoptera frugiperda (J. E. Smith) and Chrysodeixis includens (Walker) are important cotton pests and target of control of Bollgard II (Cry1Ac/Cry2Ab2) and WideStrike (Cry1Ac/Cry1F) cotton technologies. To subsidize an insect resistance management program, we conducted laboratory studies to evaluate the toxicity of these Bt cotton plants throughout larval development of S. frugiperda and C. includens. In bioassays with leaf disc, the efficacy of both Bt cotton plants against neonates was >80% for S. frugiperda and 100% for C. includens. However, S. frugiperda larvae that survived on Bt cotton had >76% of growth inhibition and stunting. In bioassays with S. frugiperda and C. includens larvae fed on non-Bt near-isoline during different time period (from 3 to 18 d) and then transferred to Bollgard II or WideStrike leaves showed that larval susceptibility decreased as larval age increased. For Bollgard II cotton, in all S. frugiperda instars, there were larvae that reached the pupal and adult stages. In contrast, on WideStrike cotton, a few larvae in fifth and sixth instar completed the biological cycle. For C. includens, some larvae in sixth instar originated adults in both Bt cotton plants. In conclusion, Bollgard II and WideStrike cotton technologies showed high efficacy against neonates of S. frugiperda and C. includens. However, the mortality of these species decreases as larval age increase, allowing insect survival in a possible seed mixture environment and favoring the resistance evolution. © The Author 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Effects of EPSPS Copy Number Variation (CNV and Glyphosate Application on the Aromatic and Branched Chain Amino Acid Synthesis Pathways in Amaranthus palmeri

Directory of Open Access Journals (Sweden)

Manuel Fernández-Escalada

2017-11-01

Full Text Available A key enzyme of the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19, is the known target of the widely used herbicide glyphosate. Glyphosate resistance in Amaranthus palmeri, one of the most troublesome weeds in agriculture, has evolved through increased EPSPS gene copy number. The aim of this work was to study the pleiotropic effects of (i EPSPS increased transcript abundance due to gene copy number variation (CNV and of (ii glyphosate application on the aromatic amino acid (AAA and branched chain amino acid (BCAA synthesis pathways. Hydroponically grown glyphosate sensitive (GS and glyphosate resistant (GR plants were treated with glyphosate 3 days after treatment. In absence of glyphosate treatment, high EPSPS gene copy number had only a subtle effect on transcriptional regulation of AAA and BCAA pathway genes. In contrast, glyphosate treatment provoked a general accumulation of the transcripts corresponding to genes of the AAA pathway leading to synthesis of chorismate in both GS and GR. After chorismate, anthranilate synthase transcript abundance was higher while chorismate mutase transcription showed a small decrease in GR and remained stable in GS, suggesting a regulatory branch point in the pathway that favors synthesis toward tryptophan over phenylalanine and tyrosine after glyphosate treatment. This was confirmed by studying enzyme activities in vitro and amino acid analysis. Importantly, this upregulation was glyphosate dose dependent and was observed similarly in both GS and GR populations. Glyphosate treatment also had a slight effect on the expression of BCAA genes but no general effect on the pathway could be observed. Taken together, our observations suggest that the high CNV of EPSPS in A. palmeri GR populations has no major pleiotropic effect on the expression of AAA biosynthetic genes, even in response to glyphosate treatment. This finding supports the idea that the fitness cost associated

Location, Root Proximity, and Glyphosate-use History Modulate the Effects of Glyphosate on Fungal Community Networks of Wheat

Science.gov (United States)

Glyphosate is the most-used herbicide worldwide and an essential tool for weed control in no-till cropping systems. However, concerns have been raised regarding the long-term effects of glyphosate on soil microbial communities. We examined the impact of repeated glyphosate application on bulk and rh...

The effect of glyphosate application on soil microbial activities in ...

African Journals Online (AJOL)

Yomi

2011-12-21

Dec 21, 2011 ... bacterial populations in the presence of glyphosate as P source was significantly (p<0.01) higher than N ... bes by transferring hydrogen or electrons from substrates .... of utilizing GP as carbon or other nutrient sources.

Improving Fire Resistance of Cotton Fabric through Layer-by-Layer Assembled Graphene Multilayer Nanocoating

Science.gov (United States)

Jang, Wonjun; Chung, Il Jun; Kim, Junwoo; Seo, Seongmin; Park, Yong Tae; Choi, Kyungwho

2018-05-01

In this study, thin films containing poly(vinyl alcohol) (PVA) and graphene nanoplatelets (GNPs), stabilized with poly(4-styrene-sulfonic acid) (PSS), were assembled by a simple and cost-effective layer-by-layer (LbL) technique in order to introduce the anti-flammability to cotton. These antiflammable layers were characterized by using UV-vis spectrometry and quartz crystal microbalance as a function of the number of bilayers deposited. Scanning electron microscopy was used to visualize the morphology of the thin film coatings on the cotton fabric. The graphene-polymer thin films introduced anti-flammable properties through thermally stable carbonaceous layers at a high temperature. The thermal stability and flame retardant property of graphene-coated cotton was demonstrated by thermogravimetric analysis, cone calorimetry, and vertical flame test. The results indicate that LbL-assembled graphene-polymer thin films can be applied largely in the field of flame retardant.

Phytoplankton growth and PSII efficiency sensitivity to a glyphosate-based herbicide (Factor 540®).

Science.gov (United States)

Smedbol, Élise; Lucotte, Marc; Labrecque, Michel; Lepage, Laurent; Juneau, Philippe

2017-11-01

The use of glyphosate-based herbicides in agriculture has increased steadily since the mid 90's and there is now evidence of glyphosate leaching and contamination of aquatic ecosystems. The aim of this study was to evaluate the effects of a glyphosate-based herbicide (Factor 540 ® ) on growth and photosynthetic capacity of algae and cyanobacteria. Six algal and three cyanobacterial species/strains, of three different taxonomic groups, were exposed to five glyphosate concentrations (10, 50, 100, 500 and 1000μgl -1 ) during 48h. All species have significant growth inhibition at concentrations varying between 50 and 500μgl -1 . The photosynthetic response, after glyphosate exposure, varied among species, but a general pattern has emerged. There was an increase in the amount of photons absorbed (ABS/RC), in dissipated (DI O /RC) and trapped (TR O /RC) energy in the photosystem II reaction centers, along with a decreased of the maximum photosystem II quantum yield (F V /F M ) and electron transport per reaction center (ET O /RC). The EC 50 and LOEC values for growth and photosynthesis were calculated and established that growth was the most affected parameter by glyphosate-based herbicide, while parameter TR O /RC was the least affected. All species showed reduced growth at glyphosate concentrations lower than the Canadian standard for the protection of aquatic life, set at 800μgl -1 or the American aquatic life benchmark for acute toxicity in non vascular plants of 12 100μgl -1 questioning the validity of these thresholds in assessing the risks related to the presence of glyphosate and glyphosate-based herbicides in aquatic systems. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Glyphosate-based herbicides toxicity on life history parameters of zoophytophagous Podisus nigrispinus (Heteroptera: Pentatomidae).

Science.gov (United States)

C Zanuncio, José; C Lacerda, Mabio; Alcántara-de la Cruz, Ricardo; P Brügger, Bruno; Pereira, Alexandre I A; F Wilcken, Carlos; E Serrão, José; S Sediyama, Carlos

2018-01-01

The increase of agricultural areas with glyphosate-resistant (GR) crops, and use of this herbicide in Brazil, makes necessary to assess its impacts on non-target organisms. The objective was to evaluate the development, reproduction and life table parameters of Podisus nigrispinus (Heteroptera: Pentatomidae) reared on GR-soybean plants treated with glyphosate formulations (Zapp-Qi, Roundup-Transorb-R and Roundup-Original) at the recommended field dose (720g acid equivalent ha -1 ). Glyphosate formulations had no affect on nymph and adult weight of this predator. Fourth instar stage was shortest with Zapp Qi. Egg-adult period was similar between treatments (26 days) with a survival over 90%. Zapp-Qi and Roundup-Transorb-R (potassium-salt: K-salt) reduced the egg, posture and nymph number per female, and the longevity and oviposition periods of this predator. Podisus nigrispinus net reproductive rate was highest in GR-soybean plants treated with Roundup-Original (isopropylamine-salt: IPA-salt). However, the duration of one generation, intrinsic and finite increase rates, and time to duplicate the population, were similar between treatments. Glyphosate toxicity on P. nigrispinus depends of the glyphosate salt type. IPA-salt was least harmless to this predator. Formulations based on K-salt altered its reproductive parameters, however, the development and population dynamic were not affect. Therefore, these glyphosate formulations are compatible with the predator P. nigrispinus with GR-soybean crop. Copyright © 2017 Elsevier Inc. All rights reserved.

Inversion tillage, high residue covers, and different herbicide regimes for palmer amaranth control in liberty link systems

Science.gov (United States)

Glyphosate-resistant Palmer amaranth is adversely affecting cotton production in the Southeast US. A field experiment was established in fall 2008 at the E.V. Smith Research Center, Field Crops Unit near Shorter, AL, to investigate the role of inversion tillage, high residue cover crops, and differ...

Genome-wide functional analysis of cotton (Gossypium hirsutum in response to drought.

Directory of Open Access Journals (Sweden)

Yun Chen

Full Text Available Cotton is one of the most important crops for its natural textile fibers in the world. However, it often suffered from drought stress during its growth and development, resulting in a drastic reduction in cotton productivity. Therefore, study on molecular mechanism of cotton drought-tolerance is very important for increasing cotton production. To investigate molecular mechanism of cotton drought-resistance, we employed RNA-Seq technology to identify differentially expressed genes in the leaves of two different cultivars (drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6 of cotton. The results indicated that there are about 13.38% to 18.75% of all the unigenes differentially expressed in drought-resistant sample and drought-sensitive control, and the number of differentially expressed genes was increased along with prolonged drought treatment. DEG (differentially expression gene analysis showed that the normal biophysical profiles of cotton (cultivar J-13 were affected by drought stress, and some cellular metabolic processes (including photosynthesis were inhibited in cotton under drought conditions. Furthermore, the experimental data revealed that there were significant differences in expression levels of the genes related to abscisic acid signaling, ethylene signaling and jasmonic acid signaling pathways between drought-resistant cultivar J-13 and drought-sensitive cultivar Lu-6, implying that these signaling pathways may participate in cotton response and tolerance to drought stress.

[Glyphosate--a non-toxic pesticide?].

Science.gov (United States)

Pieniazek, Danuta; Bukowska, Bozena; Duda, Wirgiliusz

2003-01-01

Glyphosate is currently the most commonly applied herbicide and its use is still growing. Nowadays, over 50 commercial preparations containing this compound are used, and these formulations are much more toxic than their active compound, glyphosate, owing to the presence of many surfactants and carrier compounds. Toxicological investigations provide evidence that glyphosate is an extremely "safe" herbicide for animals. This is why its use in agriculture is universal. In June 1991, the Environmental Protection Agency (EPA) categorized this compound into class E (according to EPA there are five categories of carcinogenicity), which means that it is probably not carcinogenic to humans. Unfortunately, the study carried out by Swedish oncologists in 2001 showed that glyphosate may induce cancer of the lymphatic system. The results of the Swedish study have changed our opinion about "safety" of this herbicide. Investigations concerning both its accumulation and toxic effect in animals and plants are now under way in many laboratories.

Cotton fabrics with UV blocking properties through metal salts deposition

International Nuclear Information System (INIS)

Emam, Hossam E.; Bechtold, Thomas

2015-01-01

Graphical abstract: - Highlights: • Introducing metal salt based UV-blocking properties into cotton fabric. • A quite simple technique used to produce wash resistant UV-absorbers using different Cu-, Zn- and Ti-salts. • Good UPF was obtained after treatment with Cu and Ti salts, and ranged between 11.6 and 14. • The efficiency of the deposited metal oxides is compared on molar basis. - Abstract: Exposure to sunlight is important for human health as this increases the resistance to diverse pathogens, but the higher doses cause skin problems and diseases. Hence, wearing of sunlight protective fabrics displays a good solution for people working in open atmosphere. The current study offered quite simple and technically feasible ways to prepare good UV protection fabrics based on cotton. Metal salts including Zn, Cu and Ti were immobilized into cotton and oxidized cotton fabrics by using pad-dry-cure technique. Metal contents on fabrics were determined by AAS; the highest metal content was recorded for Cu-fabric and it was 360.6 mmol/kg after treatment of oxidized cotton with 0.5 M of copper nitrate. Ti contents on fabrics were ranged between 168.0 and 200.8 mmol/kg and it showed the lowest release as only 38.1–46.4% leached out fabrics after five laundry washings. Metal containing deposits were specified by scanning electron microscopy and energy dispersive X-ray spectroscopy. UV-transmission radiation over treated fabrics was measured and ultraviolet protection factor (UPF) was calculated. UPF was enhanced after treatment with Cu and Ti salts to be 11.6 and 14, respectively. After five washings, the amount of metal (Cu or Ti) retained indicates acceptable laundering durability.

Genotoxicity Expert Panel review: weight of evidence evaluation of the genotoxicity of glyphosate, glyphosate-based formulations, and aminomethylphosphonic acid.

Science.gov (United States)

Brusick, David; Aardema, Marilyn; Kier, Larry; Kirkland, David; Williams, Gary

2016-09-01

In 2015, the International Agency for Research on Cancer (IARC) published a monograph concluding there was strong evidence for genotoxicity of glyphosate and glyphosate formulations and moderate evidence for genotoxicity of the metabolite aminomethylphosphonic acid (AMPA). These conclusions contradicted earlier extensive reviews supporting the lack of genotoxicity of glyphosate and glyphosate formulations. The IARC Monograph concluded there was strong evidence of induction of oxidative stress by glyphosate, glyphosate formulations, and AMPA. The Expert Panel reviewed the genotoxicity and oxidative stress data considered in the IARC Monograph, together with other available data not considered by IARC. The Expert Panel defined and used a weight of evidence (WoE) approach that included ranking of studies and endpoints by the strength of their linkage to events associated with carcinogenic mechanisms. Importantly, the Expert Panel concluded that there was sufficient information available from a very large number of regulatory genotoxicity studies that should have been considered by IARC. The WoE approach, the inclusion of all relevant regulatory studies, and some differences in interpretation of individual studies led to significantly different conclusions by the Expert Panel compared with the IARC Monograph. The Expert Panel concluded that glyphosate, glyphosate formulations, and AMPA do not pose a genotoxic hazard and the data do not support the IARC Monograph genotoxicity evaluation. With respect to carcinogenicity classification and mechanism, the Expert Panel concluded that evidence relating to an oxidative stress mechanism of carcinogenicity was largely unconvincing and that the data profiles were not consistent with the characteristics of genotoxic carcinogens.

Are herbicide-resistant crops the answer to controlling Cuscuta?

Science.gov (United States)

Nadler-Hassar, Talia; Shaner, Dale L; Nissen, Scott; Westra, Phill; Rubin, Baruch

2009-07-01

Herbicide-resistant crop technology could provide new management strategies for the control of parasitic plants. Three herbicide-resistant oilseed rape (Brassica napus L.) genotypes were used to examine the response of attached Cuscuta campestris Yuncker to glyphosate, imazamox and glufosinate. Cuscata campestris was allowed to establish on all oilseed rape genotypes before herbicides were applied. Unattached seedlings of C. campestris, C. subinclusa Durand & Hilg. and C. gronovii Willd. were resistant to imazamox and glyphosate and sensitive to glufosinate, indicating that resistance initially discovered in C. campestris is universal to all Cuscuta species. Glufosinate applied to C. campestris attached to glufosinate-resistant oilseed rape had little impact on the parasite, while imazamox completely inhibited C. campestris growth on the imidazolinone-resistant host. The growth of C. campestris on glyphosate-resistant host was initially inhibited by glyphosate, but the parasite recovered and resumed growth within 3-4 weeks. The ability of C. campestris to recover was related to the quality of interaction between the host and parasite and to the resistance mechanism of the host. The parasite was less likely to recover when it had low compatibility with the host, indicating that parasite-resistant crops coupled with herbicide resistance could be highly effective in controlling Cuscuta. (c) 2009 by John Wiley & Sons, Ltd.

Glyphosate catabolism by Pseudomonas sp

International Nuclear Information System (INIS)

Shinabarger, D.L.

1986-01-01

The pathway for the degradation of glyphosate (N-phosphonomethylglycine) by Pseudomonas sp. PG2982 has been determined using metabolic radiolabeling experiments. Radiorespirometry experiments utilizing [3- 14 C] glyphosate revealed that approximately 50-59% of the C3 carbon was oxidized to CO 2 . Fractionation of stationary phase cells labeled with [3- 14 C]glyphosate revealed that from 45-47% of the assimilated C3 carbon is distributed to proteins and that amino acids methionine and serine are highly labeled. The nucleic acid bases adenine and guanine received 90% of the C3 label that was incorporated into nucleic acids, and the only pyrimidine base labeled was thymine. Pulse labeling of PG2982 cells with [3- 14 C]glyphosate revealed that [3- 14 C]sarcosine is an intermediate in glyphosate degradation. Examination of crude extracts prepared from PG2982 cells revealed the presence of an enzyme that oxidizes sarcosine to glycine and formaldehyde. These results indicate that the first step in glyphosate degradation by PG2982 is cleavage of the carbon-phosphorus bond, resulting in the release of sarcosine and a phosphate group. The phosphate group is utilized as a source of phosphorus, and the sarcosine is degraded to glycine and formaldehyde. Phosphonate utilization by Pseudomonas sp. PG2982 was investigated. Each of the ten phosphonates tested were utilized as a sole source of phosphorus by PG2982. Representative compounds tested included alkylphosphonates, 1-amino-substituted alkylphosphonates, amino-terminal phosphonates, and an arylphosphonate. PG2982 cultures degraded phenylphosphonate to benzene and produced methane from methylphosphonate. The data indicate that PG2982 is capable of cleaving the carbon-phosphorus bond of several structurally different phosphonates

BRS 369RF and BRS 370RF: Glyphosate tolerant, high-yielding upland cotton cultivars for central Brazilian savanna

Directory of Open Access Journals (Sweden)

Camilo de Lelis Morello

2015-12-01

Full Text Available BRS 369RF and BRS 370RF were developed by the EMBRAPA as a part of efforts to create high-yielding germplasm with combinations of transgenic traits. BRS 369RF and BRS 370RF are midseason cultivars and have yield stability, adaptation to the central Brazilian savanna, good fiber quality and tolerance to glyphosate herbicide.

Electrochemical degradation and mineralization of glyphosate herbicide.

Science.gov (United States)

Tran, Nam; Drogui, Patrick; Doan, Tuan Linh; Le, Thanh Son; Nguyen, Hoai Chau

2017-12-01

The presence of herbicide is a concern for both human and ecological health. Glyphosate is occasionally detected as water contaminants in agriculture areas where the herbicide is used extensively. The removal of glyphosate in synthetic solution using advanced oxidation process is a possible approach for remediation of contaminated waters. The ability of electrochemical oxidation for the degradation and mineralization of glyphosate herbicide was investigated using Ti/PbO 2 anode. The current intensity, treatment time, initial concentration and pH of solution are the influent parameters on the degradation efficiency. An experimental design methodology was applied to determine the optimal condition (in terms of cost/effectiveness) based on response surface methodology. Glyphosate concentration (C 0  = 16.9 mg L -1 ) decreased up to 0.6 mg L -1 when the optimal conditions were imposed (current intensity of 4.77 A and treatment time of 173 min). The removal efficiencies of glyphosate and total organic carbon were 95 ± 16% and 90.31%, respectively. This work demonstrates that electrochemical oxidation is a promising process for degradation and mineralization of glyphosate.

Non-recessive Bt toxin resistance conferred by an intracellular cadherin mutation in field-selected populations of cotton bollworm.

Directory of Open Access Journals (Sweden)

Haonan Zhang

Full Text Available Transgenic crops producing Bacillus thuringiensis (Bt toxins have been planted widely to control insect pests, yet evolution of resistance by the pests can reduce the benefits of this approach. Recessive mutations in the extracellular domain of toxin-binding cadherin proteins that confer resistance to Bt toxin Cry1Ac by disrupting toxin binding have been reported previously in three major lepidopteran pests, including the cotton bollworm, Helicoverpa armigera. Here we report a novel allele from cotton bollworm with a deletion in the intracellular domain of cadherin that is genetically linked with non-recessive resistance to Cry1Ac. We discovered this allele in each of three field-selected populations we screened from northern China where Bt cotton producing Cry1Ac has been grown intensively. We expressed four types of cadherin alleles in heterologous cell cultures: susceptible, resistant with the intracellular domain mutation, and two complementary chimeric alleles with and without the mutation. Cells transfected with each of the four cadherin alleles bound Cry1Ac and were killed by Cry1Ac. However, relative to cells transfected with either the susceptible allele or the chimeric allele lacking the intracellular domain mutation, cells transfected with the resistant allele or the chimeric allele containing the intracellular domain mutation were less susceptible to Cry1Ac. These results suggest that the intracellular domain of cadherin is involved in post-binding events that affect toxicity of Cry1Ac. This evidence is consistent with the vital role of the intracellular region of cadherin proposed by the cell signaling model of the mode of action of Bt toxins. Considered together with previously reported data, the results suggest that both pore formation and cell signaling pathways contribute to the efficacy of Bt toxins.

Radiation synthesis of silver nanostructures in cotton matrix

International Nuclear Information System (INIS)

Chmielewska, Dagmara; Sartowska, Bożena

2012-01-01

Cotton is one of the most popular natural fibres, composed mainly of cellulose, which finds a wide range of applications in paper, textile and health care products industry. Researchers have focused their interest on the synthesis of cotton nanocomposites, which enhances its mechanical, thermal and antimicrobial properties by the incorporation of various nanoparticles into the cotton matrix. Silver is one of the most popular antimicrobial agents with a wide spectrum of antibacterial and antifungal activity that results from a complex mechanism of its interactions with the cells of harmful microorganism. In this work, electron beam radiation was applied to synthesise silver nanostructures in cotton fibres. Investigations of the influence of the initial silver salt concentration on the size and distribution of the obtained silver nanostructures were carried out. A detailed characterisation of these nanocomposites with SEM-BSE and EDS methods was performed. TGA and DSC analyses were performed to assess the influence of different size silver nanoparticles and the effect of electron beam irradiation on the thermal properties of cotton fibres. A microbiological investigation to determine the antibacterial activity of Ag-cotton nanocomposites was carried out. - Highlights: ► Ag NPs embedded in cotton matrix were synthesised by electron beam irradiation. ► Concentration of silver salt solution influences on size of silver nanoparticles. ► Silver content as well as irradiation affect thermal properties of cotton fabrics. ► Ag-cotton nanocomposites exhibit antibacterial activity against bacteria and fungi.

Glyphosate: cancerous or not? Perspectives from both ends of the debate

Directory of Open Access Journals (Sweden)

Syeda Aamna Hassan

2017-08-01

Full Text Available Glyphosate is non-selective herbicide. Studies published in the last decade, point towards glyphosate toxicity. Shikimic acid pathway for the biosynthesis of folates and aromatic amino acids is inhibited by glyphosate. Glyphosate carcinogenicity is still considered to be a controversial issue. The World Health Organizations’ International Agency recently concluded that glyphosate is “probably carcinogenic to humans.” Some researchers believed that glyphosate is not linked with carcinogenicity.

75 FR 24969 - Glyphosate From China

Science.gov (United States)

2010-05-06

... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Notice of withdrawal of petition in... investigation concerning glyphosate from China (investigation No. 731-TA-1178 (Preliminary)) is discontinued...

Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate.

Directory of Open Access Journals (Sweden)

Cong Wang

Full Text Available Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta. Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina regardless of DIP condition. Group V (Amphidinium carterae exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine

Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate

Science.gov (United States)

Wang, Cong; Lin, Xin; Li, Ling; Lin, Senjie

2016-01-01

Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P) nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta). Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP) conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum) could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella) could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana) and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina) regardless of DIP condition. Group V (Amphidinium carterae) exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine phytoplankton

75 FR 17768 - Glyphosate From China

Science.gov (United States)

2010-04-07

... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Institution of antidumping investigation... States is materially retarded, by reason of imports from China of glyphosate, provided for in subheadings...

Saussurea involucrata SiDhn2 gene confers tolerance to drought stress in upland cotton

International Nuclear Information System (INIS)

Liu, B.; Zhu, J.; Mu, J.; Zhu, J.; Liang, Z.; Zhang, L.

2017-01-01

Severe water shortage has long been acknowledged as one major limiting factor for global cotton production, and cultivation of cotton varieties with strong drought resistance is of important economic and social significances. In this study, the Xinjiang upland cotton variety Xinluzao 42 was transformed with the SiDhn2 gene by optimized agrobacterium transformation system. The integration of SiDhn2 gene into cotton genome was confirmed by PCR and Southern blot hybridization, and the drought resistance of transgenic and corresponding receptor cotton plants and their physiological indexes under drought stress were detailedly analyzed. Multiple physiological and biochemical indexes including soluble sugar content, free proline content, chlorophyll content, relative water content, net photosynthetic rate, transpiration rate, intercellular CO/sub 2/ concentration in transgenic cotton expressing SiDhn2 gene under drought stress were significantly higher than those of receptor cotton. More importantly, the transgenic cotton plants exhibited remarkably decreased boll abscission rate and highly increased seed yield, indicating the significant role of SiDhn2 gene in cotton drought resistance and its great application potential in agricultural production. (author)

Glyphosate in Irish adults - A pilot study in 2017.

Science.gov (United States)

Connolly, Alison; Leahy, Michelle; Jones, Kate; Kenny, Laura; Coggins, Marie A

2018-05-02

Glyphosate is the highest volume herbicide used globally and has recently been classified as a 2 A 'probably carcinogenic to humans' by the International Agency for Research on Cancer (IARC). There is limited data to evaluate the public health impacts from glyphosate exposure. The objective of this study is to conduct an exploratory glyphosate exposure assessment study among Irish adults, who were non-occupational users of glyphosate. A convenient sampling method was used, collecting one first morning void spot urine sample from each participant. A biomonitoring survey involving the collection and analysis of 20 ml spot urine samples from 50 Irish adults was conducted in June 2017. Participants completed a short questionnaire to collect information on demographics, dietary habits and lifestyle. Glyphosate was extracted using solid phase extraction (SPE) and analysed by liquid chromatography tandem mass spectrometry (LC-MC/MS). Of the 50 urine samples analysed, 10 (20%) contained detectable levels of glyphosate (0.80-1.35 µg L -1 ). Exposure concentrations are higher than those reported in comparable studies of European and American adults. Glyphosate was detectable in 20% of the samples collected from Irish adults. The low proportion of detectable glyphosate levels could be due to lower localised use of pesticides, having a small sample size or the higher analytical detection limit used in this study (0.5 µg L -1 ), which could underestimate the true exposure and warrants further investigation. Given the widespread use of glyphosate, further information on population exposure is required to advance our understanding of the relationship between chronic low dose exposure to glyphosate and human health risk. Copyright © 2018 Elsevier Inc. All rights reserved.

Glyphosate induces human breast cancer cells growth via estrogen receptors.

Science.gov (United States)

Thongprakaisang, Siriporn; Thiantanawat, Apinya; Rangkadilok, Nuchanart; Suriyo, Tawit; Satayavivad, Jutamaad

2013-09-01

Glyphosate is an active ingredient of the most widely used herbicide and it is believed to be less toxic than other pesticides. However, several recent studies showed its potential adverse health effects to humans as it may be an endocrine disruptor. This study focuses on the effects of pure glyphosate on estrogen receptors (ERs) mediated transcriptional activity and their expressions. Glyphosate exerted proliferative effects only in human hormone-dependent breast cancer, T47D cells, but not in hormone-independent breast cancer, MDA-MB231 cells, at 10⁻¹² to 10⁻⁶M in estrogen withdrawal condition. The proliferative concentrations of glyphosate that induced the activation of estrogen response element (ERE) transcription activity were 5-13 fold of control in T47D-KBluc cells and this activation was inhibited by an estrogen antagonist, ICI 182780, indicating that the estrogenic activity of glyphosate was mediated via ERs. Furthermore, glyphosate also altered both ERα and β expression. These results indicated that low and environmentally relevant concentrations of glyphosate possessed estrogenic activity. Glyphosate-based herbicides are widely used for soybean cultivation, and our results also found that there was an additive estrogenic effect between glyphosate and genistein, a phytoestrogen in soybeans. However, these additive effects of glyphosate contamination in soybeans need further animal study. Copyright © 2013 Elsevier Ltd. All rights reserved.

78 FR 60707 - Glyphosate; Pesticide Tolerances

Science.gov (United States)

2013-10-02

... chromatography/mass spectrometry/mass spectrometry Method 15444) is available to enforce the tolerance expression...) 566-1744, and the telephone number for the OPP Docket is (703) 305- 5805. Please review the visitor...-acetyl-glyphosate (expressed as glyphosate equivalents). VI. Statutory and Executive Order Reviews This...

Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

Science.gov (United States)

Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

Creation of glyphosate-resistant Brassica napus L. plants expressing DesC desaturase of cyanobacterium Synechococcus vulcanus

Directory of Open Access Journals (Sweden)

Goldenkova-Pavlova I. V.

2012-12-01

Full Text Available Aim. Creation of glyphosate-resistant canola plants expressing bifunctional hybrid desC::licBM3 gene. In the hybrid gene the sequence of DesC desaturase of cyanobacterium S. vulcanus without plastid targeting was fused with the sequence of thermostable lichenase reporter LicBM3 gene. Methods. Agrobacterium tumefaciens-mediated transformation, PCR, quantitative and qualitative determination of lichenase activity, genetic analysis. Results. Transgenic canola plants, carring the enolpyruvat shikimat phosphate syntase gene (epsps, conferring on plants resistance to phosphonomethyl glycine herbicides (Roundup, as well as the desC::licBM3 gene, were selected. The presence of transgenes was confimed by multiplex PCR. The epsps gene expression in canola was shown at the transcription level, during in vitro growth and after greenhouse herbicide treatment. Activity of the licBM3 gene product as a part of hybrid protein allowed quantitative and qualitative estimation of the desaturase gene expression. Inheritance of heterologous genes and their expression in the first generation were investigated. Conclusions. Transgenic canola plants were obtained, the presence of trangenes in plant genome was proved and expression of the target genes was detected.

Elisa development for detection of glyphosat resistant gm soybean

Directory of Open Access Journals (Sweden)

Владислав Геннадійович Спиридонов

2015-11-01

Full Text Available During research we have utilized recombinant enzyme 5-enolpyruvylshikimate-3-phosphate synthase (CP4 EPSPS, conferring resistance to glyphosate for GM soybean, for the hen immunization and obtaining specific yolk antibodies IgY. Stages of ELISA development that can detect at least 0,1 % of GM-soybean resistant to glyphosate were present

Real-time electron density measurements from Cotton-Mouton effect in JET machine

International Nuclear Information System (INIS)

Brombin, M.; Boboc, A.; Zabeo, L.; Murari, A.

2008-01-01

Real-time density profile measurements are essential for advanced fusion tokamak operation and interferometry is a proven method for this task. Nevertheless, as a consequence of edge localized modes, pellet injections, fast density increases, or disruptions, the interferometer is subject to fringe jumps, which produce loss of the signal preventing reliable use of the measured density in a real-time feedback controller. An alternative method to measure the density is polarimetry based on the Cotton-Mouton effect, which is proportional to the line-integrated electron density. A new analysis approach has been implemented and tested to verify the reliability of the Cotton-Mouton measurements for a wide range of plasma parameters and to compare the density evaluated from polarimetry with that from interferometry. The density measurements based on polarimetry are going to be integrated in the real-time control system of JET since the difference with the interferometry is within one fringe for more than 90% of the cases.

Facilitated transport of diuron and glyphosate in high copper vineyard soils.

Science.gov (United States)

Dousset, Sylvie; Jacobson, Astrid R; Dessogne, Jean-Baptiste; Guichard, Nathalie; Baveye, Philippe C; Andreux, Francis

2007-12-01

The fate of organic herbicides applied to agricultural fields may be affected by other soil amendments, such as copper applied as a fungicide. The effect of copper on the leaching of diuron and glyphosate through a granitic and a calcareous soil was studied in the laboratory using sieved-soil columns. Each soil was enriched with copper sulfate to obtain soil copper concentrations of 125, 250, 500, and 1000 mg kg(-1). Glyphosate leaching was influenced by soil pH and copper concentration, whereas diuron leaching was not. In the calcareous soil, glyphosate leaching decreased as copper levels increased from 17 mg kg(-1) (background) to 500 mg kg(-1). In the granitic soil, glyphosate leaching increased as copper levels increased from 34 mg kg(-1) (background) to 500 mg kg(-1). The shapes of the copper elution curves in presence of glyphosate were similar to shapes of the glyphosate curves, suggesting the formation of Cu-glyphosate complexes that leach through the soil. Soil copper concentration does not influence diuron leaching. In contrast, increasing copper concentrations reduces glyphosate leaching through calcareous soils, and conversely, increases glyphosate leaching through granitic soils. Our findings suggest that the risk of groundwater contamination by glyphosate increases in granitic soils with elevated copper concentrations.

Coupling of MIC-3 overexpression with the chromosomes 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton (Gossypium hirsutum).

Science.gov (United States)

Wubben, Martin J; Callahan, Franklin E; Jenkins, Johnie N; Deng, Dewayne D

2016-09-01

Genetic analysis of MIC-3 transgene with RKN resistance QTLs provides insight into the resistance regulatory mechanism and provides a framework for testing additional hypotheses. Resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. The MIC-3 (Meloidogyne Induced Cotton3) protein accumulates specifically within the immature galls of RKN-resistant plants that possess these QTLs. Recently, we showed that MIC-3 overexpression in an RKN-susceptible cotton genotype suppressed RKN egg production but not RKN-induced root galling. In this study, the MIC-3 overexpression construct T-DNA in the single-copy transgenic line '14-7-1' was converted into a codominant molecular marker that allowed the marker assisted selection of F2:3 cotton lines, derived from a cross between 14-7-1 and M-240 RNR, having all possible combinations of the chromosomes 11 and 14 QTLs with and without the MIC-3 overexpression construct. Root-knot nematode reproduction (eggs g(-1) root) and severity of RKN-induced root galling were assessed in these lines. We discovered that the addition of MIC-3 overexpression suppressed RKN reproduction in lines lacking both resistance QTLs and in lines having only the chromosome 14 QTL, suggesting an additive effect of the MIC-3 construct with this QTL. In contrast, MIC-3 overexpression did not improve resistance in lines having the single chromosome 11 QTL or in lines having both resistance QTLs, suggesting an epistatic interaction between the chromosome 11 QTL and the MIC-3 construct. Overexpression of MIC-3 did not affect the severity of RKN-induced root galling regardless of QTL genotype. These data provide new insights into the relative order of action of the chromosomes 11 and 14 QTLs and their potential roles in regulating MIC-3 expression as part of the RKN resistance response.

Surfactant-induced deposit structures in relation to the biological efficacy of glyphosate on easy- and difficult-to-wet weed species.

Science.gov (United States)

Kraemer, Thorsten; Hunsche, Mauricio; Noga, Georg

2009-08-01

Typical active ingredient (AI) residue patterns are formed during droplet drying on plant surfaces owing to the interaction of spray solution characteristics and leaf micromorphology. Currently, comparatively little is known about the influence of AI deposit patterns within a spray droplet residue area on the penetration and biological efficacy of glyphosate. A scanning electron microscope with energy dispersive X-ray microanalysis has been used to characterise residue patterns and to quantify the area ultimately covered by glyphosate within the droplet spread area. The easy-to-wet weed species Stellaria media L. and Viola arvensis L., as well as the difficult-to-wet Chenopodium album L. and Setaria viridis L., differing in their surface micromorphology, have been used. Rapeseed oil ethoxylates (RSO 5 or RSO 60) were added to glyphosate solutions to provide different droplet spread areas. Addition of RSO 5 enhanced droplet spread area more than RSO 60, and both caused distinct glyphosate residue patterns. The biological efficacy of treatment solutions showed no significant correlation with the area ultimately covered by glyphosate. The results have implications on herbicide uptake models. This study shows that droplet spread area does not correspond to the area ultimately covered by glyphosate, and that the latter does not affect glyphosate phytotoxicity.

Degradation of 14C-glyphosate in compost amended soils.

Science.gov (United States)

Alexa, E; Bragea, M; Sumalan, R; Negrea, M; Lazureanu, A

2009-01-01

Glyphosate (N-phosphonomethyl-glycine), the active ingredient in several herbicide formulations, is a non-selective, post-emergent herbicide used in a variety of crop and non-crop situations. Glyphosate is a non-volatile herbicide that is relatively immobile in soil. Its degradation is due to microbiological processes and most laboratory studies have been conducted with 14C-glyphosate with the rate of 14CO2 evolution being used as an indication of herbicide breakdown. In this paper we have studied the glyphosate degradation in compost amendment soils using Scientilator Liquid TRIATHLER and Glyphosate-phosphonomethyl-14C-labeled with specific activity 2,2mCi/mmol. Four types of soils have been taken under study: Black Chernozem, Vertisol, Gleysol and Phaeozem with different characteristics. For the each type of soil have been realized four experimental variants (glyphosate blind sample with 1,5 ppm, concentration, autoclaved soil, soil with glyphosate and addition of compost in field concentration of 40 t/ha, respectively 60 t/ha. The mineralization curves of 14CO2 accumulated were compared during of 40 days. All the mineralization curves for the soils exhibited same patterns, with only two phases, the initial rapid phase of degradation, for about 20 days, attributed to microbial action on the free glyphosate and the second slow phase, when the curves attained plateaus. Compost applied with different concentrations to Vertisol and Black Chernozem did not appear to stimulate the microbial degradation of glyphosate. In Gleysol and Phaeozem with lower humus content, the mineralization curve of 14C indicate the increase degradation capacity, expressed as accumulated 14CO2 as % total 14C, with the increase of compost concentration.

Dissipation of glyphosate from grapevine soils in Sonora, Mexico

Directory of Open Access Journals (Sweden)

Norma J. Salazar López

2016-10-01

Full Text Available Grapevine is one of the important crops in Sonora, due to revenue generation from its export to foreign countries. Among the most widely used herbicides for this crop is glyphosate, which is considered moderately toxic and persistent. The present research evaluates the dissipation of glyphosate in grapevine planted soil at three depths (5, 30 and 60 cm. Sampling was carried out before glyphosate application, and 5, 10, 18, 27, and 65 days after. Glyphosate was extracted from soil samples using ammonium hydroxide. The derivate extracts were partitioned with dichloromethane and analyzed using gas chromatography with pulsed flame photometric detector (PFPD. The results showed that average glyphosate residues are significantly greater at 5 cm (0.09 mg kg-1 than the other depths (30 and 60 cm, having a difference of 0.078 mg kg-1 between them (P < 0.03. Glyphosate concentration time profiles were similar; it reached maximum soil concentration in a range of 10 to 18 days after application. The half-life of glyphosate in soil has an average of 39 days at all depths. Our data suggests that the release in soil of glyphosate applied to weeds delays its transference to soil by 14 days, and extends residue half life to 55 days after application. These results could be the basis for further research, including more environmental parameters that could affect the dissipation or degradation process in soil.

A glyphosate-based pesticide impinges on transcription

International Nuclear Information System (INIS)

Marc, Julie; Le Breton, Magali; Cormier, Patrick; Morales, Julia; Belle, Robert; Mulner-Lorillon, Odile

2005-01-01

Widely spread chemicals used for human benefits may exert adverse effects on health or the environment, the identification of which are a major challenge. The early development of the sea urchin constitutes an appropriate model for the identification of undesirable cellular and molecular targets of pollutants. The widespread glyphosate-based pesticide affected sea urchin development by impeding the hatching process at millimolar range concentration of glyphosate. Glyphosate, the active herbicide ingredient of Roundup, by itself delayed hatching as judged from the comparable effect of different commercial glyphosate-based pesticides and from the effect of pure glyphosate addition to a threshold concentration of Roundup. The surfactant polyoxyethylene amine (POEA), the major component of commercial Roundup, was found to be highly toxic to the embryos when tested alone and therefore could contribute to the inhibition of hatching. Hatching, a landmark of early development, is a transcription-dependent process. Correlatively, the herbicide inhibited the global transcription, which follows fertilization at the 16-cell stage. Transcription inhibition was dose-dependent in the millimolar glyphosate range concentration. A 1257-bp fragment of the hatching enzyme transcript from Sphaerechinus granularis was cloned and sequenced; its transcription was delayed by 2 h in the pesticide-treated embryos. Because transcription is a fundamental basic biological process, the pesticide may be of health concern by inhalation near herbicide spraying at a concentration 25 times the adverse transcription concentration in the sprayed microdroplets

THE REMOVAL OF GLYPHOSATE FROM DRINKING WATER

Science.gov (United States)

The effectiveness of granulated activated carbon (GAC), packed activated carbon (PAC), conventional treatment, membranes, and oxidation for removing glyphosate from natural waters is evaluated. Results indicate that GAC and PAC are not effective in removing glyphosate, while oxid...

Removal of glyphosate herbicide from water using biopolymer membranes.

Science.gov (United States)

Carneiro, Rafael T A; Taketa, Thiago B; Gomes Neto, Reginaldo J; Oliveira, Jhones L; Campos, Estefânia V R; de Moraes, Mariana A; da Silva, Camila M G; Beppu, Marisa M; Fraceto, Leonardo F

2015-03-15

Enormous amounts of pesticides are manufactured and used worldwide, some of which reach soils and aquatic systems. Glyphosate is a non-selective herbicide that is effective against all types of weeds and has been used for many years. It can therefore be found as a contaminant in water, and procedures are required for its removal. This work investigates the use of biopolymeric membranes prepared with chitosan (CS), alginate (AG), and a chitosan/alginate combination (CS/AG) for the adsorption of glyphosate present in water samples. The adsorption of glyphosate by the different membranes was investigated using the pseudo-first order and pseudo-second order kinetic models, as well as the Langmuir and Freundlich isotherm models. The membranes were characterized regarding membrane solubility, swelling, mechanical, chemical and morphological properties. The results of kinetics experiments showed that adsorption equilibrium was reached within 4 h and that the CS membrane presented the best adsorption (10.88 mg of glyphosate/g of membrane), followed by the CS/AG bilayer (8.70 mg of glyphosate/g of membrane). The AG membrane did not show any adsorption capacity for this herbicide. The pseudo-second order model provided good fits to the glyphosate adsorption data on CS and CS/AG membranes, with high correlation coefficient values. Glyphosate adsorption by the membranes could be fitted by the Freundlich isotherm model. There was a high affinity between glyphosate and the CS membrane and moderate affinity in the case of the CS/AG membrane. Physico-chemical characterization of the membranes showed low values of solubility in water, indicating that the membranes are stable and not soluble in water. The SEM and AFM analysis showed evidence of the presence of glyphosate on CS membranes and on chitosan face on CS/AG membranes. The results showed that the glyphosate herbicide can be adsorbed by chitosan membranes and the proposed membrane-based methodology was successfully used to

Thwarting one of cotton's nemeses

International Nuclear Information System (INIS)

Senft, D.

1991-01-01

There's not much good to be said for the pink bollworm, cotton's most destructive pest, except that it is being controlled to cut crop damage. Scientists have developed strategies, such as increasing native populations of predatory insects and pest-resistant cotton varieties. Thanks to research, growers today can also use cultural practices such as early plowdown of harvested cotton to break up stalks and bury overwintering pink bollworms. And they can disrupt normal mating by releasing sterile insects and using copies of natural compounds, called pheromones, that the pink bollworm uses to attract mates. Such strategies, together with judicious use of insecticides, put together in various combinations, form what is called an integrated pest management system

Impacts of transgenic poplar-cotton agro-ecosystems upon target pests and non-target insects under field conditions.

Science.gov (United States)

Zhang, D J; Liu, J X; Lu, Z Y; Li, C L; Comada, E; Yang, M S

2015-07-27

Poplar-cotton agro-ecosystems are the main agricultural planting modes of cotton fields in China. With increasing acres devoted to transgenic insect-resistant poplar and transgenic insect-resistant cotton, studies examining the effects of transgenic plants on target and non-target insects become increasingly important. We systematically surveyed populations of both target pests and non-target insects for 4 different combinations of poplar-cotton eco-systems over 3 years. Transgenic Bt cotton strongly resisted the target insects Fall webworm moth [Hyphantria cunea (Drury)], Sylepta derogata Fabrieius, and American bollworm (Heliothis armigera), but no clear impact on non-target insect cotton aphids (Aphis gossypii). Importantly, intercrops containing transgenic Pb29 poplar significantly increased the inhibitory effects of Bt cotton on Fall webworm moth in ecosystem IV. Highly resistant Pb29 poplar reduced populations of the target pests Grnsonoma minutara Hubner and non-target insect poplar leaf aphid (Chaitophorus po-pulialbae), while Fall webworm moth populations were unaffected. We determined the effects of Bt toxin from transgenic poplar and cotton on target and non-target pests in different ecosystems of cotton-poplar intercrops and identified the synergistic effects of such combinations toward both target and non-target insects.

Effects of additives on glyphosate activity in purple nutsedge

International Nuclear Information System (INIS)

Rungsit Suwanketnikom

1998-01-01

Effects of additives on 14 C-glyphosate penetration into purple nutsedge leaves were examined in the laboratory and efficacy of glyphosate for purple nutsedge control was studied in the greenhouse and field. The addition of (NH 4 ) 2 SO 4 at 1.0% (v/v) + diesel oil at 1,0% (v/v) + Tendal at 1.0% (v/v) increased 14 C-glyphosate penetration into nutsedge leaves more than the addition of either one alone. (NH 4 ) 2 SO 4 at 1.0% + diesel oil at 1.0% + Tendal at 0.12 or 0.25% increased the phytotoxicity of glyphosate at 0.5 and 0.75 kg, a.e./ha on nutsedge plants in the greenhouse but not in the field. Additives did not enhance glyphosate activity by reducing the number of nutsedae tubers. (author)

Epidemiologic studies of glyphosate and cancer: a review.

Science.gov (United States)

Mink, Pamela J; Mandel, Jack S; Sceurman, Bonnielin K; Lundin, Jessica I

2012-08-01

The United States Environmental Protection Agency and other regulatory agencies around the world have registered glyphosate as a broad-spectrum herbicide for use on multiple food and non-food use crops. Glyphosate is widely considered by regulatory authorities and scientific bodies to have no carcinogenic potential, based primarily on results of carcinogenicity studies of rats and mice. To examine potential cancer risks in humans, we reviewed the epidemiologic literature to evaluate whether exposure to glyphosate is associated causally with cancer risk in humans. We also reviewed relevant methodological and biomonitoring studies of glyphosate. Seven cohort studies and fourteen case-control studies examined the association between glyphosate and one or more cancer outcomes. Our review found no consistent pattern of positive associations indicating a causal relationship between total cancer (in adults or children) or any site-specific cancer and exposure to glyphosate. Data from biomonitoring studies underscore the importance of exposure assessment in epidemiologic studies, and indicate that studies should incorporate not only duration and frequency of pesticide use, but also type of pesticide formulation. Because generic exposure assessments likely lead to exposure misclassification, it is recommended that exposure algorithms be validated with biomonitoring data. Copyright © 2012 Elsevier Inc. All rights reserved.

Root growth and lignification of glyphosate susceptible and resistant soybean at low temperaturesCrescimento e lignificação de raízes de soja convencional e resistente ao glifosato, em baixa temperatura

Directory of Open Access Journals (Sweden)

Patricia da Costa Zonetti

2013-05-01

Full Text Available Low temperature stress affects plant growth, including primary and secondary metabolism. Glyphosateresistant soybean contains a modified DNA, which encodes a different type of secondary metabolism enzyme related to lignin synthesis compared to conventional glyphosate-susceptible cultivars. Thus, this soybean cultivar might respond differently to low temperatures, compared to glyphosate-susceptible cultivars. This work aimed to investigate how decreasing temperatures influence the growth and lignin content of the glyphosate-resistant soybean compared to its susceptible parental cultivars. Three-day-old seedlings were cultivated in nutrient solution at 10, 15, 20, and 25°C (±2°C, using a 12-h photoperiod. After 96 h, taproot growth, fresh and dry biomass, and lignin levels were determined. The results indicate that lower temperatures decreased seedling and root growth in both types of cultivars; however, glyphosate-resistant soybean exhibited greater root length, biomass, and lignin content compared to the glyphosate-susceptible parental cultivar. O estresse causado pela baixa temperatura, dentre outras implicações, afeta o crescimento do vegetal assim como o seu metabolismo secundário. Pelo fato da soja RR apresentar variante enzimática de uma das principais vias do metabolismo secundário, ligada à síntese de lignina, pode apresentar comportamento diferenciado, sob baixa temperatura, se comparada com sua linhagem parental. O objetivo deste trabalho foi investigar possíveis diferenças no crescimento e nos conteúdos de lignina nas raízes de soja cultivar transgênica resistente ao glifosato e cultivar parental em resposta a redução de temperatura. Após três dias de germinação das sementes, as plântulas foram mantidas em solução nutritiva, a 10, 15, 20 e 25°C (±2°C, com fotoperíodo de 12 horas. Após 96 horas, foi avaliado o comprimento relativo da raiz primária, biomassa fresca e seca das raízes e os teores de lignina

Glyphosate sorption/desorption on biochars - interactions of physical and chemical processes.

Science.gov (United States)

Hall, Kathleen E; Spokas, Kurt A; Gamiz, Beatriz; Cox, Lucia; Papiernik, Sharon K; Koskinen, William C

2018-05-01

Biochar, a carbon-rich product of biomass pyrolysis, could limit glyphosate transport in soil and remediate contaminated water. The present study investigates the sorption/desorption behavior of glyphosate on biochars prepared from different hardwoods at temperatures ranging from 350 to 900 °C to elucidate fundamental mechanisms. Glyphosate (1 mg L -1 ) sorption on biochars increased with pyrolysis temperature and was highest on 900 °C biochars; however, total sorption was low on a mass basis (glyphosate in soils, did not alter biochar sorption capacities. Glyphosate did not desorb from biochar with CaCl 2 solution; however, up to 86% of the bound glyphosate was released with a K 2 HPO 4 solution. Results from this study suggest a combined impact of surface chemistry and physical constraints on glyphosate sorption/desorption on biochar. Based on the observed phosphate-induced desorption of glyphosate, the addition of P-fertilizer to biochar-amended soils can remobilize the herbicide and damage non-target plants; therefore, improved understanding of this risk is necessary. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Fabrication of cotton fabric with superhydrophobicity and flame retardancy.

Science.gov (United States)

Zhang, Ming; Wang, Chengyu

2013-07-25

A simple and facile method for fabricating the cotton fabric with superhydrophobicity and flame retardancy is described in the present work. The cotton fabric with the maximal WCA of 160° has been prepared by the covalent deposition of amino-silica nanospheres and the further graft with (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The geometric microstructure of silica spheres was measured by transmission electron microscopy (TEM). The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, diverse performances of superhydrophobic cotton textiles have been evaluated as well. The results exhibited the outstanding superhydrophobicity, excellent waterproofing durability and flame retardancy of the cotton fabric after treatment, offering a good opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications. Copyright © 2013 Elsevier Ltd. All rights reserved.

Subtle impacts of repeated glyphosate use on wheat-associated bacteria are small and depend on glyphosate use history

Science.gov (United States)

Glyphosate (Roundup) is the most widely used herbicide in the world and a critical tool for weed control in no-till wheat cropping systems. However, there are persistent concerns about non-target impacts of long-term glyphosate use on soil communities. We investigated the impacts of repeated glyphos...

Glyphosate accumulation, translocation, and biological effects in Coffea arabica after single and multiple exposures

DEFF Research Database (Denmark)

Schrübbers, Lars Christoph; Valverde, Bernal E.; Strobel, Bjarne W.

2016-01-01

In perennial crops like coffee, glyphosate drift exposure can occur multiple times during its commercial life span. Due to limited glyphosate degradation in higher plants, a potential accumulation of glyphosate could lead to increased biological effects with increased exposure frequency....... In this study, we investigated glyphosate translocation over time, and its concentration and biological effects after single and multiple simulated spray-drift exposures. Additionally, shikimic acid/glyphosate ratios were used as biomarkers for glyphosate binding to its target enzyme.Four weeks after...... the exposure, glyphosate was continuously translocated. Shikimic acid levels were lin-ear correlated with glyphosate levels. After two months, however, glyphosate appeared to have reduced activity. In the greenhouse, multiple applications resulted in higher internal glyphosate concentrations.The time...

Effects of genetically modified cotton stalks on antibiotic resistance genes, intI1, and intI2 during pig manure composting.

Science.gov (United States)

Duan, Manli; Gu, Jie; Wang, Xiaojuan; Li, Yang; Zhang, Sheqi; Yin, Yanan; Zhang, Ranran

2018-01-01

Genetically modified (GM) cotton production generates a large yield of stalks and their disposal is difficult. In order to study the feasibility of using GM cotton stalks for composting and the changes that occur in antibiotic resistance genes (ARGs) during composting, we supplemented pig manure with GM or non-GM cotton stalks during composting and we compared their effects on the absolute abundances (AA) of intI1, intI2, and ARGs under the two treatments. The compost was mature after processing based on the germination index and C/N ratio. After composting, the AAs of ARGs, intI1, and intI2 were reduced by 41.7% and 45.0% in the non-GM and GM treatments, respectively. The ARG profiles were affected significantly by temperature and ammonia nitrogen. In addition, excluding tetC, GM cotton stalks had no significant effects on ARGs, intI1, and intI2 compared with the non-GM treatment (p composting with livestock manure, and the AAs of ARGs can be reduced. Furthermore, the results of this study provide a theoretical basis for the harmless utilization of GM cotton stalks. Copyright © 2017 Elsevier Inc. All rights reserved.

Natural glyphosate tolerance in sweetvetch Hedysarum boreale

Science.gov (United States)

Sweetvetch (Hedysarum boreale Nutt.) a legume native to the western USA and Canada, is purported to have tolerance to glyphosate {N-(phosphonomethyl) glycine} herbide. Eight rates of glyphosate were tested for their effect on biomass yield (BMY) and survival of seedlings and mature plants. Treatme...

Glyphosate toxicity and carcinogenicity: a review of the scientific basis of the European Union assessment and its differences with IARC.

Science.gov (United States)

Tarazona, Jose V; Court-Marques, Daniele; Tiramani, Manuela; Reich, Hermine; Pfeil, Rudolf; Istace, Frederique; Crivellente, Federica

2017-08-01

Glyphosate is the most widely used herbicide worldwide. It is a broad spectrum herbicide and its agricultural uses increased considerably after the development of glyphosate-resistant genetically modified (GM) varieties. Since glyphosate was introduced in 1974, all regulatory assessments have established that glyphosate has low hazard potential to mammals, however, the International Agency for Research on Cancer (IARC) concluded in March 2015 that it is probably carcinogenic. The IARC conclusion was not confirmed by the EU assessment or the recent joint WHO/FAO evaluation, both using additional evidence. Glyphosate is not the first topic of disagreement between IARC and regulatory evaluations, but has received greater attention. This review presents the scientific basis of the glyphosate health assessment conducted within the European Union (EU) renewal process, and explains the differences in the carcinogenicity assessment with IARC. Use of different data sets, particularly on long-term toxicity/carcinogenicity in rodents, could partially explain the divergent views; but methodological differences in the evaluation of the available evidence have been identified. The EU assessment did not identify a carcinogenicity hazard, revised the toxicological profile proposing new toxicological reference values, and conducted a risk assessment for some representatives uses. Two complementary exposure assessments, human-biomonitoring and food-residues-monitoring, suggests that actual exposure levels are below these reference values and do not represent a public concern.

Effect of heat-treatment with raw cotton seed oil on decay resistance and dimensional stability of Beech (Fagus orientalis

Directory of Open Access Journals (Sweden)

مریم قربانی

2015-05-01

Full Text Available This research was conducted to determine the effect of heat-treatment with raw cotton seed oil on decay resistance and dimensional stability of beech according to EN113 and ASTM-D1037 standards respectively. The heat treatment with raw cotton seed oil was carried out in the cylinder at the temperatures of 130 and 170oC for 30 and 60 minutes. Oil uptake, density, volumetric swelling, water absorption and weight loss exposed to decay were measured. Oil uptake at 30 and 60 min were determined 10.5 and 13.3 Kg/cm3 respectively. Oil-heat treated samples at 30min and 130°C indicated the maximum density with 87.7% increase. According to results, oil-heat treatment improved water repellency and dimensional stability. Water absorption in 130°C and 60 minutes decreased 76% in comparison with control. Decay resistance of oil soaked samples for 60minutes was 80.2% more than control samples. Oil-heat treatment compared with oil treatment improved decay resistance, this effect was significant at 30 min. The temperature rise of oil–heat treatment at 30 minutes improved decay resistance, but the improvement under same level of temperature with increase time was not significant.

Determination of glyphosate by high performance liquid ...

African Journals Online (AJOL)

The aim of this study was to design a glyphosate analysis method. This molecule is an organic pollutant from water and soil. We have developed a chromatographic method with phenylisothiocyanate. This molecule has allowed obtaining an intermediate molecule with the glyphosate being easily detectable in ...

150 ACUTE TOXICITY OF GLYPHOSATE ON CLARIAS ...

African Journals Online (AJOL)

The effects of glyphosate on mortality rate and behavioural responses of Clarias gariepinus fingerlings were investigated under laboratory conditions for 96 hours exposure period. The lethal concentration (LC50) value of glyphosate on fingerlings of Clarias gariepinus was 0.0018 ml/l for 96 hours of exposure.

Both point mutations and low expression levels of the nicotinic acetylcholine receptor β1 subunit are associated with imidacloprid resistance in an Aphis gossypii (Glover) population from a Bt cotton field in China.

Science.gov (United States)

Chen, Xuewei; Li, Fen; Chen, Anqi; Ma, Kangsheng; Liang, Pingzhuo; Liu, Ying; Song, Dunlun; Gao, Xiwu

2017-09-01

Aphis gossypii Glover is a destructive pest of numerous crops throughout the world. Although the expansion of Bt cotton cultivation has helped to control some insect pests, the damage from cotton aphids has not been mitigated. The evolution of aphid resistance to imidacloprid has made its chemical control more difficult since its introduction in 1991. Field populations of A. gossypii that were collected from different transgenic (Bt) cotton planting areas of China in 2014 developed different levels of resistance to imidacloprid. The IMI_R strain has developed high resistance to imidacloprid with the resistance ratio >1200-fold. Compared with the susceptible IMI_S strain, the IMI_R strain also developed a high level cross resistance to sulfoxaflor and acetamiprid. The limited synergism with either PBO or DEF suggests that resistance may be due to the site mutation of molecular target rather than to enhanced detoxification. Three target-site mutations within the nicotinic acetylcholine receptor (nAChR) β1 subunit were detected in the IMI_R strain. The R81T mutation has been reported to be responsible for imidacloprid resistance in A. gossypii and M. persicae. Both V62I and K264E were first detected in A. gossypii. These point mutations are also present in field populations, suggesting that they play a role in the resistance to imidacloprid. Furthermore, the expression level of transcripts encoding β1 subunit was decreased significantly in the IMI_R strain compared with the IMI_S strain, suggesting that both point mutations and the down-regulation of nAChR β1 subunit expression may be involved in the resistance mechanism for imidacloprid in A. gossypii. These results should be useful for the management of imidacloprid-resistant cotton aphids in Bt cotton fields in China. Copyright © 2016 Elsevier B.V. All rights reserved.

Response of Pennsylvania native plant species, corn and soybean to tank mixes of dicamba and glyphosate

Science.gov (United States)

Crops such as soybean are being genetically modified to be tolerant to multiple herbicides, such as dicamba and glyphosate, in order to allow treatment with several herbicides to control the development of herbicide resistance in weeds. However, with increased use of multiple-he...

Losing Chlordimeform Use in Cotton Production. Its Effects on the Economy and Pest Resistance. Agricultural Economic Report Number 587.

Science.gov (United States)

Osteen, Craig; Suguiyama, Luis

This report examines the economic implications of losing chlordimeform use on cotton and considers chlordimeform's role in managing the resistance of bollworms and tobacco budworms to synthetic pyrethroids. It estimates changes in prices, production, acreage, consumer expenditures, aggregate producer returns, regional crop effects, and returns to…

Selection and characterization of glyphosate tolerance in birdsfoot trefoil (Lotus corniculatus)

International Nuclear Information System (INIS)

Boerboom, C.M.

1989-01-01

If birdsfoot trefoil (Lotus corniculatus L.) was tolerant to glyphosate [N-(phosphonomethyl)glycine], Canada thistle [Cirsium arvense (L.) Scop.] and other dicot weeds could be selectively controlled in certified seed production fields. Glyphosate tolerance in birdsfoot trefoil was identified in plants from the cultivar Leo, plants regenerated from tolerant callus, and selfed progeny of plants regenerated from callus. Plants from the three sources were evaluated in field studies for tolerance to glyphosate at rates up to 1.6 kg ae/ha. Plants of Leo selected for tolerance exhibited a twofold range in the rate required to reduce shoot weight 50% (I 50 s from 0.6 to 1.2 kg/ha glyphosate). Plants regenerated from tolerant callus had tolerance up to 66% greater than plants regenerated from unselected callus. Transgressive segregation for glyphosate tolerance was observed in the selfed progeny of two regenerated plants that both had I 50 s of 0.7 kg/ha glyphosate. The selfed progeny ranged from highly tolerant (I 50 of 1.5 kg/ha) to susceptible (I 50 of 0.5 kg/ha). Spray retention, 14 C-glyphosate absorption and translocation did not account for the differential tolerance of nine plants that were evaluated from the three sources. The specific activity of 5-enolpyruvylshikimate 3-phosphate (EPSP) synthase ranged from 1.3 to 3.5 nmol/min sm-bullet mg among the nine plants and was positively correlated with glyphosate tolerance. Leo birdsfoot trefoil was found to have significant variation in glyphosate tolerance which made it possible to initiate a recurrent selection program to select for glyphosate tolerance in birdsfoot trefoil. Two cycles of selection for glyphosate tolerance were practiced in three birdsfoot trefoil populations, Leo, Norcen, and MU-81

Effect of glyphosate on wheat quality characteristics

Science.gov (United States)

Glyphosate is the most widely used herbicide in the world. It is a non-selective, broad spectrum, post-emergence herbicide, and therefore controls a wide range of different species. Although glyphosate is effective in weed control, side effects of this herbicide on the crop itself, micro and macro o...

Glyphosate biodegradation and potential soil bioremediation by Bacillus subtilis strain Bs-15.

Science.gov (United States)

Yu, X M; Yu, T; Yin, G H; Dong, Q L; An, M; Wang, H R; Ai, C X

2015-11-23

Glyphosate and glyphosate-containing herbicides have an adverse effect on mammals, humans, and soil microbial ecosystems. Therefore, it is important to develop methods for enhancing glyphosate degradation in soil through bioremediation. We investigated the potential of glyphosate degradation and bioremediation in soil by Bacillus subtilis Bs-15. Bs-15 grew well at high concentrations of glyphosate; the maximum concentration tolerated by Bs-15 reached 40,000 mg/L. The optimal conditions for bacterial growth and glyphosate degradation were less than 10,000 mg/L glyphosate, with a temperature of 35°C and a pH of 8.0. Optimal fermentation occurred at 180 rpm for 60 h with an inoculum ratio of 4%. Bs-15 degraded 17.65% (12 h) to 66.97% (96 h) of glyphosate in sterile soil and 19.01% (12 h) to 71.57% (96 h) in unsterilized soil. Using a BIOLOG ECO plate test, we observed no significant difference in average well color development values between the soil inoculated with Bs-15 and the control soil before 72 h, although there was a significant difference (P bioremediation of glyphosate-contaminated soils.

Resposta de diferentes populações de Digitaria insularis ao herbicida glyphosate Response of different Digitaria insularis populations to glyphosate

Directory of Open Access Journals (Sweden)

N.M Correia

2010-12-01

Full Text Available Objetivou-se com estse trabalho avaliar o controle químico de diferentes populações de capim-amargoso (Digitaria insularis pelo herbicida glyphosate por meio de curva de dose-resposta, além de propor tratamentos alternativos para as populações mais tolerantes. O delineamento experimental foi o de blocos ao acaso, com quatro repetições, em esquema fatorial 5 x 9. As sementes de capim-amargoso foram coletadas em cinco locais: área de produção de grãos da Fazenda de Ensino, Pesquisa e Produção da UNESP, Jaboticabal (SP; área de produção comercial de grãos, localizada nos municípios de Campo Florido-MG e Rio Verde-GO; pomar de laranja, localizado no município de Matão (SP; e área não agrícola sem histórico da aplicação de glyphosate (Jaboticabal-SP. O glyphosate (0D, 1/4D, 1/2D, D, 2D, 4D e 8D, em que D é a dose recomendada de 1,5 kg ha-1 de equivalente ácido e as suas associações [glyphosate + fluazifop-p-butil (1,5 + 0,25 kg ha-1 e glyphosate (1,5 kg ha-1 com sequencial de diuron + paraquat (0,20 + 0,40 kg ha-1 + 0,2% de surfatante] foram pulverizados em plantas de sete a oito perfilhos e altura média de 20 cm. As populações de capim-amargoso de Campo Florido e Rio Verde foram consideradas suscetíveis; as de Jaboticabal e Matão, tolerantes; e a da área não agrícola, de sensibilidade intermediária. A associação de glyphosate ao fluazifop ou a sua aplicação com sequencial de diuron + paraquat foram eficazes no controle das populações mais tolerantes de capim-amargoso.The objective of this study was to evaluate the chemical control of different sourgrass (Digitaria insularis populations by the herbicide glyphosate through dose-response curves, besides considering alternative treatments to control tolerant populations. A randomized block design was used with four replications, in a factorial scheme (5 x 9. Sourgrass seeds were colleted from five locations: a grain production area located at the educational

The herbicide Glyphosate affects nitrification in the Elbe estuary, Germany

Science.gov (United States)

Sanders, Tina; Lassen, Stephan

2015-04-01

The Elbe River is one of the biggest European rivers discharging into the North Sea. It also transports high amounts of nutrients and pollutants like pesticides. Important source regions of both nutrients and pollutants are located within the river catchment, which is dominated by agricultural land-use. From these agricultural soils, pesticides can be carried via the river and estuary into the North Sea. Glyphosate (N-(phosphonomethyl) glycine) is the most commonly used herbicide worldwide and mainly used to regulate unwanted plant growth and for the expedition of crop ripening. In Germany, ~ 6000 tons of glyphosate are applied yearly in agriculture and private use. Glyphosate is degradable by microorganisms and has a half-life in water of 35 to 60 days. This herbicide specifically inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), an enzyme that catalyzes the biosynthesis of essential aromatic amino acids in plants, fungi, and bacteria. Nitrifying bacteria, which play an important role in the internal nitrogen cycling in the Elbe estuary, also possess this enzyme. The aim of our study was to quantify the concentration of glyphosate in water and sediment samples of the Elbe to get an overview about relevant environmental levels and to assess the impact of glyphosate on inhibition of nitrifying activities. To quantify the effect of glyphosate on nitrification activity, natural samples as well as pure cultures of Nitrosomonas europea (strain Nm50) were incubated with different concentrations of glyphosate over a period of some weeks. The nitrifying activity was determined according to changes of the nitrite and nitrate concentration as well as the cell number. Glyphosate was detectable in water and sediment samples in the Elbe estuary with up to 5 ppb mainly in the Port of Hamburg region. In both incubation experiments an inhibiting effect of glyphosate on nitrification could be shown. The incubated natural water sample was affected by a glyphosate

The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

Directory of Open Access Journals (Sweden)

George Anifandis

2018-05-01

Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

Degradation of the Phosphonate Herbicide Glyphosate by Arthrobacter atrocyaneus ATCC 13752

OpenAIRE

Pipke, Rüdiger; Amrhein, Nikolaus

1988-01-01

Of nine authentic Arthrobacter strains tested, only A. atrocyaneus ATCC 13752 was capable of using the herbicide glyphosate [N-(phosphonomethyl)glycine] as its sole source of phosphorus. Contrary to the previously isolated Arthrobacter sp. strain GLP-1, which degrades glyphosate via sarcosine, A. atrocyaneus metabolized glyphosate to aminomethylphosphonic acid. The carbon of aminomethylphosphonic acid was entirely converted to CO2. This is the first report on glyphosate degradation by a bacte...

Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents.

Science.gov (United States)

Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J Christopher; Ugarte, Ricardo; Antoniou, Michael N

2017-10-01

The safety, including the endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased the expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBluc cells, which was blocked by the estrogen antagonist ICI 182,780. Commercial GBH formulations or their adjuvants alone did not exhibit estrogenic effects in either assay. Transcriptomics analysis of MCF-7 cells treated with glyphosate revealed changes in gene expression reflective of hormone-induced cell proliferation but did not overlap with an ERα gene expression biomarker. Calculation of glyphosate binding energy to ERα predicts a weak and unstable interaction (-4.10 kcal mol -1 ) compared to estradiol (-25.79 kcal mol -1 ), which suggests that activation of this receptor by glyphosate is via a ligand-independent mechanism. Induction of ERE-luc expression by the PKA signalling activator IBMX shows that ERE-luc is responsive to ligand-independent activation, suggesting a possible mechanism of glyphosate-mediated activation. Our study reveals that glyphosate, but not other components present in GBHs, can activate ERα in vitro, albeit at relatively high concentrations. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Phytotoxicity of glyphosate in the germination of and its effect on germinated seedlings

Directory of Open Access Journals (Sweden)

Subinoy Mondal

2017-08-01

Full Text Available The present study evaluated the effects of glyphosate on Pisum sativum germination as well as its effect on the physiology and biochemistry of germinated seedlings. Different physico-chemical biomarkers, viz., chlorophyll, root and shoot length, total protein and soluble sugar, along with sodium and potassium concentration, were investigated in germinated seedlings at different glyphosate concentrations. This study reports the influence of different concentrations of glyphosate on pea seeds and seedlings. Physicochemical biomarkers were significantly changed by glyphosate exposure after 15 days. The germination of seedlings under control conditions (0 mg/L was 100% after 3 days of treatment but at 3 and 4 mg/L glyphosate, germination was reduced to 55 and 40%, respectively. Physiological parameters like root and shoot length decreased monotonically with increasing glyphosate concentration, at 14 days of observation. Average root and shoot length (n=30 in three replicates were reduced to 14.7 and 17.6%, respectively, at 4 mg/L glyphosate. Leaf chlorophyll content also decreased, with a similar trend to root and shoot length, but the protein content initially decreased and then increased with an increase in glyphosate concentration to 3 mg/L. The study suggests that glyphosate reduces the soluble sugar content significantly, by 21.6% (v/v. But internal sodium and potassium tissue concentrations were significantly altered by glyphosate exposure with increasing concentrations of glyphosate. Biochemical and physiological analysis also supports the inhibitory effect of glyphosate on seed germination and biochemical effects on seedlings.

EPA's evaluation of the carcinogenic potential of glyphosate

Science.gov (United States)

Recently, several international agencies have evaluated the carcinogenic potential of glyphosate. In March 2015, the International Agency for Research on Cancer (IARC), a subdivision of the World Health Organization (WHO), determined that glyphosate was a probable carcinogen (gro...

[Mutual Effect on Determination of Gibberellins and Glyphosate in Groundwater by Spectrophotometry].

Science.gov (United States)

Zhang, Li; Chen, Liang; Liu, Fei

2015-04-01

In the present study, a spectrophotometry method for the simultaneous determination of gibberellins (GA3) and glyphosate in groundwater was established and optimized. In addition, the mutual effect on simultaneous determination of GA3 and glyphosate was studied. Based on the experiment, good linearity (R2 > 0.99) was obtained for GA3 in the range of 0-20 and 0-100 µg and for glyphosate in the range of 0-8 and 5-15 µg. The method's detection limit (MDL) of GA3 and glyphosate was 0.48 and 0.82 µg, respectively; and the recovery rates of 15 to 150 µg GA3 and 3 to 10 µg glyphosate in all samples at a spiked level were 71.3% ± 1.9% and 98.4% ± 8.1%, respectively. No obvious influence of glyphosate (0-100 mg · L(-1)) on the recovery rates of GA3 was observed, but the presence of glyphosate could cause slight determination precision decrease of GA3. Meanwhile, adding 2 mg · L(-1) GA3 can increase the recovery rate of glyphosate.

Glyphosate and aminomethylphosphonic acid are not detectable in human milk.

Science.gov (United States)

McGuire, Michelle K; McGuire, Mark A; Price, William J; Shafii, Bahman; Carrothers, Janae M; Lackey, Kimberly A; Goldstein, Daniel A; Jensen, Pamela K; Vicini, John L

2016-05-01

Although animal studies have shown that exposure to glyphosate (a commonly used herbicide) does not result in glyphosate bioaccumulation in tissues, to our knowledge there are no published data on whether it is detectable in human milk and therefore consumed by breastfed infants. We sought to determine whether glyphosate and its metabolite aminomethylphosphonic acid (AMPA) could be detected in milk and urine produced by lactating women and, if so, to quantify typical consumption by breastfed infants. We collected milk (n = 41) and urine (n = 40) samples from healthy lactating women living in and around Moscow, Idaho and Pullman, Washington. Milk and urine samples were analyzed for glyphosate and AMPA with the use of highly sensitive liquid chromatography-tandem mass spectrometry methods validated for and optimized to each sample matrix. Our milk assay, which was sensitive down to 1 μg/L for both analytes, detected neither glyphosate nor AMPA in any milk sample. Mean ± SD glyphosate and AMPA concentrations in urine were 0.28 ± 0.38 and 0.30 ± 0.33 μg/L, respectively. Because of the complex nature of milk matrixes, these samples required more dilution before analysis than did urine, thus decreasing the sensitivity of the assay in milk compared with urine. No difference was found in urine glyphosate and AMPA concentrations between subjects consuming organic compared with conventionally grown foods or between women living on or near a farm/ranch and those living in an urban or suburban nonfarming area. Our data provide evidence that glyphosate and AMPA are not detectable in milk produced by women living in this region of the US Pacific Northwest. By extension, our results therefore suggest that dietary glyphosate exposure is not a health concern for breastfed infants. This study was registered at clinicaltrials.gov as NCT02670278. © 2016 American Society for Nutrition.

Root-Zone Glyphosate Exposure Adversely Affects Two Ditch Species

Directory of Open Access Journals (Sweden)

Lyndsay E. Saunders

2013-12-01

Full Text Available Glyphosate, one of the most applied herbicides globally, has been extensively studied for its effects on non-target organisms. In the field, following precipitation, glyphosate runs off into agricultural ditches where it infiltrates into the soil and thus may encounter the roots of vegetation. These edge-of-field ditches share many characteristics with wetlands, including the ability to reduce loads of anthropogenic chemicals through uptake, transformation, and retention. Different species within the ditches may have a differential sensitivity to exposure of the root zone to glyphosate, contributing to patterns of abundance of ruderal species. The present laboratory experiment investigated whether two species commonly found in agricultural ditches in southcentral United States were affected by root zone glyphosate in a dose-dependent manner, with the objective of identifying a sublethal concentration threshold. The root zone of individuals of Polygonum hydropiperoides and Panicum hemitomon were exposed to four concentrations of glyphosate. Leaf chlorophyll content was measured, and the ratio of aboveground biomass to belowground biomass and survival were quantified. The findings from this study showed that root zone glyphosate exposure negatively affected both species including dose-dependent reductions in chlorophyll content. P. hydropiperdoides showed the greatest negative response, with decreased belowground biomass allocation and total mortality at the highest concentrations tested.

Biotechnology: herbicide-resistant crops

Science.gov (United States)

Transgenic, herbicide-resistant (HR) crops are planted on about 80% of the land covered by transgenic crops. More than 90% of HR crios are glyphosate-resistant (GR) crops, the others being resistant to glufosinate. The wide-scale adoption of HR crops, largely for economic reasons, has been the mos...

Circular RNA expression profiles in hippocampus from mice with perinatal glyphosate exposure.

Science.gov (United States)

Yu, Ning; Tong, Yun; Zhang, Danni; Zhao, Shanshan; Fan, Xinli; Wu, Lihui; Ji, Hua

2018-05-19

Glyphosate is the active ingredient in numerous herbicide formulations. The roles of glyphosate in embryo-toxicity and neurotoxicity have been reported in human and animal models. Recently, several studies have reported evidence linking neurodevelopmental disorders (NDDs) with gestational glyphosate exposure. However, the role of glyphosate in neuronal development is still not fully understood. Our previous study found that perinatal glyphosate exposure resulted in differential microRNA expression in the prefrontal cortex of mouse offspring. However, the mechanism of glyphosate-induced neurotoxicity in the developing brain is still not fully understood. Considering the pivotal role of Circular RNAs (circRNAs) in the regulation of gene expression, a circRNA microarray method was used in this study to investigate circRNA expression changes in the hippocampus of mice with perinatal glyphosate exposure. The circRNA microarrays revealed that 663 circRNAs were significantly altered in the perinatal glyphosate exposure group compared with the control group. Among them, 330 were significantly upregulated, and the other 333 were downregulated. Furthermore, the relative expression levels of mmu-circRNA-014015, mmu-circRNA-28128 and mmu-circRNA-29837 were verified using quantitative real-time polymerase chain reaction (qRT-PCR). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses demonstrated that stress-associated steroid metabolism pathways, such as aldosterone synthesis and secretion pathways, may be involved in the neurotoxicity of glyphosate. These results showed that circRNAs are aberrantly expressed in the hippocampus of mice with perinatal glyphosate exposure and play potential roles in glyphosate-induced neurotoxicity. Copyright © 2018 Elsevier Inc. All rights reserved.

Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance

Science.gov (United States)

Samsel, Anthony

2013-01-01

Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the active ingredient in the herbicide, Roundup®, is the most important causal factor in this epidemic. Fish exposed to glyphosate develop digestive problems that are reminiscent of celiac disease. Celiac disease is associated with imbalances in gut bacteria that can be fully explained by the known effects of glyphosate on gut bacteria. Characteristics of celiac disease point to impairment in many cytochrome P450 enzymes, which are involved with detoxifying environmental toxins, activating vitamin D3, catabolizing vitamin A, and maintaining bile acid production and sulfate supplies to the gut. Glyphosate is known to inhibit cytochrome P450 enzymes. Deficiencies in iron, cobalt, molybdenum, copper and other rare metals associated with celiac disease can be attributed to glyphosate's strong ability to chelate these elements. Deficiencies in tryptophan, tyrosine, methionine and selenomethionine associated with celiac disease match glyphosate's known depletion of these amino acids. Celiac disease patients have an increased risk to non-Hodgkin's lymphoma, which has also been implicated in glyphosate exposure. Reproductive issues associated with celiac disease, such as infertility, miscarriages, and birth defects, can also be explained by glyphosate. Glyphosate residues in wheat and other crops are likely increasing recently due to the growing practice of crop desiccation just prior to the harvest. We argue that the practice of “ripening” sugar cane with glyphosate may explain the recent

Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance.

Science.gov (United States)

Samsel, Anthony; Seneff, Stephanie

2013-12-01

Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the active ingredient in the herbicide, Roundup(®), is the most important causal factor in this epidemic. Fish exposed to glyphosate develop digestive problems that are reminiscent of celiac disease. Celiac disease is associated with imbalances in gut bacteria that can be fully explained by the known effects of glyphosate on gut bacteria. Characteristics of celiac disease point to impairment in many cytochrome P450 enzymes, which are involved with detoxifying environmental toxins, activating vitamin D3, catabolizing vitamin A, and maintaining bile acid production and sulfate supplies to the gut. Glyphosate is known to inhibit cytochrome P450 enzymes. Deficiencies in iron, cobalt, molybdenum, copper and other rare metals associated with celiac disease can be attributed to glyphosate's strong ability to chelate these elements. Deficiencies in tryptophan, tyrosine, methionine and selenomethionine associated with celiac disease match glyphosate's known depletion of these amino acids. Celiac disease patients have an increased risk to non-Hodgkin's lymphoma, which has also been implicated in glyphosate exposure. Reproductive issues associated with celiac disease, such as infertility, miscarriages, and birth defects, can also be explained by glyphosate. Glyphosate residues in wheat and other crops are likely increasing recently due to the growing practice of crop desiccation just prior to the harvest. We argue that the practice of "ripening" sugar cane with glyphosate may explain the recent

Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents

OpenAIRE

Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J. Christopher; Ugarte, Ricardo; Antoniou, Michael N.

2017-01-01

The safety, including endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBl...

Aqueous supercapacitors on conductive cotton

KAUST Repository

Pasta, Mauro; La Mantia, Fabio; Hu, Liangbing; Deshazer, Heather Dawn; Cui, Yi

2010-01-01

Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

Aqueous supercapacitors on conductive cotton

KAUST Repository

Pasta, Mauro

2010-06-01

Wearable electronics offer the combined advantages of both electronics and fabrics. In this article, we report the fabrication of wearable supercapacitors using cotton fabric as an essential component. Carbon nanotubes are conformally coated onto the cotton fibers, leading to a highly electrically conductive interconnecting network. The porous carbon nanotube coating functions as both active material and current collector in the supercapacitor. Aqueous lithium sulfate is used as the electrolyte in the devices, because it presents no safety concerns for human use. The supercapacitor shows high specific capacitance (~70-80 F·g-1 at 0.1 A·g-1) and cycling stability (negligible decay after 35,000 cycles). The extremely simple design and fabrication process make it applicable for providing power in practical electronic devices. © 2010 Tsinghua University Press and Springer-Verlag Berlin Heidelberg.

The different behaviors of glyphosate and AMPA in compost-amended soil.

Science.gov (United States)

Erban, Tomas; Stehlik, Martin; Sopko, Bruno; Markovic, Martin; Seifrtova, Marcela; Halesova, Tatana; Kovaricek, Pavel

2018-05-04

The broad-spectrum herbicide glyphosate is one of the most widely used pesticides. Both glyphosate and its major metabolite, aminomethylphosphonic acid (AMPA), persist in waters; thus, their environmental fates are of interest. We investigated the influence of compost dose, sampling depth, moisture and saturated hydraulic conductivity (K s ) on the persistence of these substances. The amounts of AMPA quantified by triple quadrupole liquid chromatography-mass spectrometry (LC-QqQ-MS/MS) using isotopically labeled extraction standards were higher than those of glyphosate and differed among the samples. Both glyphosate and AMPA showed gradually decreasing concentrations with soil depth, and bootstrapped ANOVA showed significant differences between the contents of glyphosate and AMPA and their behavior related to different compost dosages and sampling depths. However, the compost dose alone did not cause significant differences among samples. Bayesian statistics revealed that the amounts of glyphosate and AMPA were both dependent on the sampling depth and compost dose, but differences were found when considering the physical factors of K s and moisture. Glyphosate was influenced by moisture but not K s , whereas AMPA was influenced by K s but not moisture. Importantly, we found behavioral differences between glyphosate and its major metabolite, AMPA, related to the physical properties of K s and moisture. Copyright © 2018 Elsevier Ltd. All rights reserved.

Questions concerning the potential impact of glyphosate-based herbicides on amphibians.

Science.gov (United States)

Wagner, Norman; Reichenbecher, Wolfram; Teichmann, Hanka; Tappeser, Beatrix; Lötters, Stefan

2013-08-01

Use of glyphosate-based herbicides is increasing worldwide. The authors review the available data related to potential impacts of these herbicides on amphibians and conduct a qualitative meta-analysis. Because little is known about environmental concentrations of glyphosate in amphibian habitats and virtually nothing is known about environmental concentrations of the substances added to the herbicide formulations that mainly contribute to adverse effects, glyphosate levels can only be seen as approximations for contamination with glyphosate-based herbicides. The impact on amphibians depends on the herbicide formulation, with different sensitivity of taxa and life stages. Effects on development of larvae apparently are the most sensitive endpoints to study. As with other contaminants, costressors mainly increase adverse effects. If and how glyphosate-based herbicides and other pesticides contribute to amphibian decline is not answerable yet due to missing data on how natural populations are affected. Amphibian risk assessment can only be conducted case-specifically, with consideration of the particular herbicide formulation. The authors recommend better monitoring of both amphibian populations and contamination of habitats with glyphosate-based herbicides, not just glyphosate, and suggest including amphibians in standardized test batteries to study at least dermal administration. Copyright © 2013 SETAC.

Micromorfologia foliar na análise da fitotoxidez por glyphosate em Eucalyptus grandis Leaf micromorphology in the analysis of glyphosate toxicity in Eucalyptus grandis

Directory of Open Access Journals (Sweden)

L.D. Tuffi Santos

2009-01-01

Full Text Available Foram avaliados os efeitos da deriva de formulações comerciais de glyphosate sobre a superfície foliar e o crescimento de clones de eucalipto. Mudas de seis clones foram submetidas a 129,6 g ha-1 de glyphosate das formulações comerciais Scout®, Roundup NA®, Roundup transorb® e Zapp QI®. Entre os clones não foram identificadas diferenças quanto à tolerância ao glyphosate. Plantas expostas à deriva simulada de Roundup transorb® e Zapp QI® apresentaram, respectivamente, a maior e menor porcentagem de intoxicação. Observou-se menor massa seca em plantas expostas ao glyphosate, independentemente da formulação, e menor altura naquelas expostas ao Scout® e ao Roundup transorb®. As características quantitativas da superfície foliar não foram afetadas pelo glyphosate. As alterações micromorfológicas ocorreram na ausência de danos visíveis e foram observadas em ambas as faces da epiderme, em todos os clones avaliados. Danos como erosão e aspecto amorfo das ceras epicuticulares e infestação por hifas fúngicas ocorreram, independentemente da formulação utilizada. A avaliação anatômica da superfície foliar foi relevante para descrição e interpretação dos danos causados pelo glyphosate. Os dados de crescimento e de intoxicação indicam o Zapp QI® como a formulação de menor risco para a cultura do eucalipto quanto aos efeitos indesejáveis da deriva.The effects of commercial glyphosate drift on the leaf surface and growth of eucalypt clones were evaluated. Seedlings of six clones were submitted to 129.6 g ha-1 sub-rate of commercial glyphosate formulations Scout®, Roundup NA®, Roundup transorb® and Zapp QI®. No differences in tolerance to glyphosate were observed among the clones. Plants exposed to simulated drift of Roundup transorb® and Zapp QI® presented the highest and lowest intoxication percentages, respectively. Plants exposed to glyphosate reduced dry biomass, regardless of the formulation, and also

Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean; Efeito de formulacoes na absorcao e translocacao do glyphosate em soja transgenica

Energy Technology Data Exchange (ETDEWEB)

Santos, J.B. [UNIVALE, Governador Valadares, MG (Brazil). FAAG. Agronomia]. E-mail: jbarbosa@univale.br; Ferreira, E.A.; Silva, A.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Fitotecnia]. E-mail: evanderalves@yahoo.com.br; aasilva@ufv.br; Oliveira, J.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Geral]. E-mail: jalves@ufv.br; Fialho, C.M.T. [Universidade Federal de Vicosa (UFV), MG (Brazil). Agronomia]. E-mail: cintiamtfialho@yahoo.com.br

2007-07-01

This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

A glyphosate micro-emulsion formulation displays teratogenicity in Xenopus laevis.

Science.gov (United States)

Bonfanti, Patrizia; Saibene, M; Bacchetta, R; Mantecca, P; Colombo, A

2018-02-01

Glyphosate is the active ingredient in broad-spectrum herbicide formulations used in agriculture, domestic area and aquatic weed control worldwide. Its market is growing steadily concurrently with the cultivation of glyphosate-tolerant transgenic crops and emergence of weeds less sensitive to glyphosate. Ephemeral and lentic waters near to agricultural lands, representing favorite habitats for amphibian reproduction and early life-stage development, may thus be contaminated by glyphosate based herbicides (GBHs) residues. Previous studies on larval anuran species highlighted increased mortality and growth effects after exposure to different GBHs in comparison to glyphosate itself, mainly because of the surfactants such as polyethoxylated tallow amine present in the formulations. Nevertheless, these conclusions are not completely fulfilled when the early development, characterized by primary organogenesis events, is considered. In this study, we compare the embryotoxicity of Roundup ® Power 2.0, a new GBH formulation currently authorized in Italy, with that of technical grade glyphosate using the Frog Embryo Teratogenesis Assay-Xenopus (FETAX). Our results evidenced that glyphosate was not embryolethal and only at the highest concentration (50 mg a.e./L) caused edemas. Conversely, Roundup ® Power 2.0 exhibited a 96 h LC50 of 24.78 mg a.e./L and a 96 h EC50 of 7.8 mg a.e./L. A Teratogenic Index of 3.4 was derived, pointing out the high teratogenic potential of the Roundup ® Power 2.0. Specific concentration-dependent abnormal phenotypes, such as craniofacial alterations, microphthalmia, narrow eyes and forebrain regionalization defects were evidenced by gross malformation screening and histopathological analysis. These phenotypes are coherent with those evidenced in Xenopus laevis embryos injected with glyphosate, allowing us to hypothesize that the teratogenicity observed for Roundup ® Power 2.0 may be related to the improved efficacy in delivering

Uptake, Translocation, Metabolism, and Distribution of Glyphosate in Nontarget Tea Plant (Camellia sinensis L.).

Science.gov (United States)

Tong, Mengmeng; Gao, Wanjun; Jiao, Weiting; Zhou, Jie; Li, Yeyun; He, Lili; Hou, Ruyan

2017-09-06

The uptake, translocation, metabolism, and distribution behavior of glyphosate in nontarget tea plant were investigated. The negative effects appeared to grown tea saplings when the nutrient solution contained glyphosate above 200 mg L -1 . Glyphosate was highest in the roots of the tea plant, where it was also metabolized to aminomethyl phosphonic acid (AMPA). The glyphosate and AMPA in the roots were transported through the xylem or phloem to the stems and leaves. The amount of AMPA in the entire tea plant was less than 6.0% of the amount of glyphosate. The glyphosate level in fresh tea shoots was less than that in mature leaves at each day. These results indicated that free glyphosate in the soil can be continuously absorbed by, metabolized in, and transported from the roots of the tea tree into edible leaves, and therefore, free glyphosate residues in the soil should be controlled to produce teas free of glyphosate.

Facts and Fallacies in the Debate on Glyphosate Toxicity

Directory of Open Access Journals (Sweden)

Robin Mesnage

2017-11-01

Full Text Available The safety profile of the herbicide glyphosate and its commercial formulations is controversial. Reviews have been published by individuals who are consultants and employees of companies commercializing glyphosate-based herbicides in support of glyphosate’s reapproval by regulatory agencies. These authors conclude that glyphosate is safe at levels below regulatory permissible limits. In contrast, reviews conducted by academic scientists independent of industry report toxic effects below regulatory limits, as well as shortcomings of the current regulatory evaluation of risks associated with glyphosate exposures. Two authors in particular (Samsel and Seneff have published a series of commentaries proposing that long-term exposure to glyphosate is responsible for many chronic diseases (including cancers, diabetes, neuropathies, obesity, asthma, infections, osteoporosis, infertility, and birth defects. The aim of this review is to examine the evidential basis for these claimed negative health effects and the mechanisms that are alleged to be at their basis. We found that these authors inappropriately employ a deductive reasoning approach based on syllogism. We found that their conclusions are not supported by the available scientific evidence. Thus, the mechanisms and vast range of conditions proposed to result from glyphosate toxicity presented by Samsel and Seneff in their commentaries are at best unsubstantiated theories, speculations, or simply incorrect. This misrepresentation of glyphosate’s toxicity misleads the public, the scientific community, and regulators. Although evidence exists that glyphosate-based herbicides are toxic below regulatory set safety limits, the arguments of Samsel and Seneff largely serve to distract rather than to give a rational direction to much needed future research investigating the toxicity of these pesticides, especially at levels of ingestion that are typical for human populations.

Facts and Fallacies in the Debate on Glyphosate Toxicity

Science.gov (United States)

Mesnage, Robin; Antoniou, Michael N.

2017-01-01

The safety profile of the herbicide glyphosate and its commercial formulations is controversial. Reviews have been published by individuals who are consultants and employees of companies commercializing glyphosate-based herbicides in support of glyphosate’s reapproval by regulatory agencies. These authors conclude that glyphosate is safe at levels below regulatory permissible limits. In contrast, reviews conducted by academic scientists independent of industry report toxic effects below regulatory limits, as well as shortcomings of the current regulatory evaluation of risks associated with glyphosate exposures. Two authors in particular (Samsel and Seneff) have published a series of commentaries proposing that long-term exposure to glyphosate is responsible for many chronic diseases (including cancers, diabetes, neuropathies, obesity, asthma, infections, osteoporosis, infertility, and birth defects). The aim of this review is to examine the evidential basis for these claimed negative health effects and the mechanisms that are alleged to be at their basis. We found that these authors inappropriately employ a deductive reasoning approach based on syllogism. We found that their conclusions are not supported by the available scientific evidence. Thus, the mechanisms and vast range of conditions proposed to result from glyphosate toxicity presented by Samsel and Seneff in their commentaries are at best unsubstantiated theories, speculations, or simply incorrect. This misrepresentation of glyphosate’s toxicity misleads the public, the scientific community, and regulators. Although evidence exists that glyphosate-based herbicides are toxic below regulatory set safety limits, the arguments of Samsel and Seneff largely serve to distract rather than to give a rational direction to much needed future research investigating the toxicity of these pesticides, especially at levels of ingestion that are typical for human populations. PMID:29226121

Glyphosate and AMPA in U.S. streams, groundwater, precipitation and soils

Science.gov (United States)

Battaglin, William A.; Meyer, Michael T.; Kuivila, Kathryn; Dietze, Julie E.

2014-01-01

Herbicides containing glyphosate are used in more than 130 countries on more than 100 crops. In the United States (U.S.), agricultural use of glyphosate [N-(phosphonomethyl)glycine] has increased from less than 10,000 metric tons per year (active ingredient) in 1993 to more than 70,000 metric tons per year in 2006. In 2006, glyphosate accounted for about 20 percent of all herbicide use (by weight of active ingredient). Glyphosate formulations such as Roundup® are used in homes and in agriculture. Part of the reason for the popularity of glyphosate is the perception that it is an “environmentally benign” herbicide that has low toxicity and little mobility or persistence in the environment. The U.S. Geological Survey developed an analytical method using liquid chromatography/tandem mass spectrometry that can detect small amounts of glyphosate and its primary degradation product aminomethylphosphonic acid (AMPA) in water and sediment. Results from more than 2,000 samples collected from locations distributed across the U.S. indicate that glyphosate is more mobile and occurs more widely in the environment than was previously thought. Glyphosate and AMPA were detected (reporting limits between 0.1 and 0.02 micrograms per liter) in samples collected from surface water, groundwater, rainfall, soil water, and soil, at concentrations from less than 0.1 to more than 100 micrograms per liter. Glyphosate was detected more frequently in rain (86%), ditches and drains (71%), and soil (63%); and less frequently in groundwater (3%) and large rivers (18%). AMPA was detected more frequently in rain (86%), soil (82%), and large rivers (78%); and less frequently in groundwater (8%) and wetlands or vernal pools (37%). Most observed concentrations of glyphosate were well below levels of concern for humans or wildlife, and none exceeded the U.S. Environmental Protection Agency’s Maximum Contaminant Level of 700 micrograms per liter. However, the ecosystem effects of chronic low

Evaluation of the Impact of Genetically Modified Cotton After 20 Years of Cultivation in Mexico

Directory of Open Access Journals (Sweden)

Martha G. Rocha-Munive

2018-06-01

Full Text Available For more than 20 years cotton has been the most widely sown genetically modified (GM crop in Mexico. Its cultivation has fulfilled all requirements and has gone through the different regulatory stages. During the last 20 years, both research-institutions and biotech-companies have generated scientific and technical information regarding GM cotton cultivation in Mexico. In this work, we collected data in order to analyze the environmental and agronomic effects of the use of GM cotton in Mexico. In 1996, the introduction of Bt cotton made it possible to reactivate this crop, which in previous years was greatly reduced due to pest problems, production costs and environmental concerns. Bt cotton is a widely accepted tool for cotton producers and has proven to be efficient for the control of lepidopteran pests. The economic benefits of its use are variable, and depend on factors such as the international cotton-prices and other costs associated with its inputs. So far, the management strategies used to prevent development of insect resistance to GM cotton has been successful, and there are no reports of insect resistance development to Bt cotton in Mexico. In addition, no effects have been observed on non-target organisms. For herbicide tolerant cotton, the prevention of herbicide resistance has also been successful since unlike other countries, the onset of resistance weeds is still slow, apparently due to cultural practices and rotation of different herbicides. Environmental benefits have been achieved with a reduction in chemical insecticide applications and the subsequent decrease in primary pest populations, so that the inclusion of other technologies—e.g., use of non-Bt cotton- can be explored. Nevertheless, control measures need to be implemented during transport of the bolls and fiber to prevent dispersal of volunteer plants and subsequent gene flow to wild relatives distributed outside the GM cotton growing areas. It is still necessary to

[Study of the effect of occupational exposure to glyphosate on hepatorenal function].

Science.gov (United States)

Zhang, F; Pan, L P; Ding, E M; Ge, Q J; Zhang, Z H; Xu, J N; Zhang, L; Zhu, B L

2017-07-06

Objective: To explore the effect of occupational exposure to glyphosate on hepatorenal function. Methods: 526 workers who were occupationally exposed to glyphosate from 5 glyphosate-producing factories were selected as cases; and another 442 administrative staffs who were not exposed to glyphosate were selected as controls from April to November, 2014. All the subjects accepted occupational health examination. The concentration level of glyphosate in the air of workshop was detected and the time weighted average concentration (TWA) was calculated. And analyze the difference of hepatorenal fuction between case group and control group. Result: The age of the subjects in the case and control groups were separately (35.6±10.3), (34.3±9.7) years old, with the length of working for (6.5±5.7), (7.7±6.8) years. The TWA of glyphosate in the case group was between Glyphosate can affect the hepatic and renal function among occupational exposure population, and there was an association between the effect and the exposure dose.

Concerns over use of glyphosate-based herbicides and risks associated with exposures: a consensus statement.

Science.gov (United States)

Myers, John Peterson; Antoniou, Michael N; Blumberg, Bruce; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vandenberg, Laura N; Vom Saal, Frederick S; Welshons, Wade V; Benbrook, Charles M

2016-02-17

The broad-spectrum herbicide glyphosate (common trade name "Roundup") was first sold to farmers in 1974. Since the late 1970s, the volume of glyphosate-based herbicides (GBHs) applied has increased approximately 100-fold. Further increases in the volume applied are likely due to more and higher rates of application in response to the widespread emergence of glyphosate-resistant weeds and new, pre-harvest, dessicant use patterns. GBHs were developed to replace or reduce reliance on herbicides causing well-documented problems associated with drift and crop damage, slipping efficacy, and human health risks. Initial industry toxicity testing suggested that GBHs posed relatively low risks to non-target species, including mammals, leading regulatory authorities worldwide to set high acceptable exposure limits. To accommodate changes in GBH use patterns associated with genetically engineered, herbicide-tolerant crops, regulators have dramatically increased tolerance levels in maize, oilseed (soybeans and canola), and alfalfa crops and related livestock feeds. Animal and epidemiology studies published in the last decade, however, point to the need for a fresh look at glyphosate toxicity. Furthermore, the World Health Organization's International Agency for Research on Cancer recently concluded that glyphosate is "probably carcinogenic to humans." In response to changing GBH use patterns and advances in scientific understanding of their potential hazards, we have produced a Statement of Concern drawing on emerging science relevant to the safety of GBHs. Our Statement of Concern considers current published literature describing GBH uses, mechanisms of action, toxicity in laboratory animals, and epidemiological studies. It also examines the derivation of current human safety standards. We conclude that: (1) GBHs are the most heavily applied herbicide in the world and usage continues to rise; (2) Worldwide, GBHs often contaminate drinking water sources, precipitation, and air

Effect of fire retardants on cotton fabric grafted with acrylic acid by EB radiation: a thermal analysis study

International Nuclear Information System (INIS)

Mitra, D.; Sabharwal, S.; Majali, A.B.

1998-01-01

Electron beam irradiation technique has been utilized to graft acrylic acid to cotton fabric in order to provide suitable functional groups that can subsequently react with urea or borax for making the fabric fire resistant. Thermal analytical technique such as, DSC and TG have been utilized to investigate the flame retardency characteristic of the grafted and treated fabric. The result shows that decay curve of exothermic peak due to combustion of cotton fabric in case of urea treated fabric at 330 degC becomes broad and shifts to higher temperature in DSC analysis as compared to pure cotton fabric and char residue in TG analysis is 20% in both the case. In borax treated fabric, char residue is found to be 40% in TG analysis and DSC profile is similar to that of urea treated fabric. (author)

Effect of glyphosate on the microbial activity of two Romanian soils.

Science.gov (United States)

Sumalan, R M; Alexa, E; Negrea, M; Sumalan, R L; Doncean, A; Pop, G

2010-01-01

Glyphosate applied to soils potentially affect microbial activity. A series of field and laboratory experiments assessed the effect of this herbicide on soil microorganisms. The aim of experiments was to evaluate the effect of glyphosate application on the soil microbial community structure, function and their activity. We studied "in vitro", changes in the microbial activity of typical Chernozem and Gleysol soils, with and without applied glyphosate. The herbicide was applied at a rate of 2, respectively 4 mg kg(-1) of soil and microbial activity were measured by fluorescein diacetate (FDA) hydrolysis. We found an increase of 9 to 13% in FDA hydrolyses in the presence of glyphosate in rate of 2 mg kg (-1) compared with the same type of soil which had never received herbicide. The double quantity of glyphosate decrease soil microbial activity; the amount of hydrolyzed fluorescein is lower than the addition of 2 ppm. The greater decrease was observed in the Gleysol type where the fluorescein hydrolyzed is with 4, 85% lower than version control without glyphosate. Chemical characters of soil, influence soil biological activity when herbicide is added. In Chemozem case, rich in humus, whose predominant micro flora is represented by actinomycetes through glyphosate treatment these organisms growths of as major producers of antibiotics actinomycetes determine an inhibitory effect on eubacteria and micromycetes growth, which is highlighted by estimating a relatively small number of them. After 10 days, once with decreasing of glyphosate content in soil, decreases the number of active actinomycetes, therefore we are witnessing to a numerical growth of bacterial population. In Gleysol type the indigenous micro flora is represented by eubacteria, so when the glyphosate is added it was registered a high growth of these organisms fraction.

Cotton-based Cellulose Nanomaterials for Applications in Composites and Electronics

Science.gov (United States)

Farahbakhsh, Nasim

A modern society demands development of highly valued and sustainable products via innovative process technologies and utilizing bio-based alternatives for petroleum based materials. Systematic comparative study of nanocellulose particles as a biodegradable and renewable reinforcing agent can help to develop criteria for selecting an appropriate candidate to be incorporated in polymer nanocomposites. Of particular interest has been nanocellulosic materials including cellulose nanocrystal (CNC) and micro/nanofibrilated cellulose (MFC/NFC) which possess a hierarchical structure that permits an ordered structure with unique properties that has served as building blocks for the design of green and novel materials composites for applications in flexible electronics, medicine and composites. Key differences exist in nanocellulosic materials as a result the process by which the material is produced. This research demonstrates the applicability for the use of recycled cotton as promising sustainable material to be utilized as a substrate for electronic application and a reinforcing agent choice that can be produced without any intensive purification process and be applied to synthetic-based polymer nanocomposites in melt-processing. (Abstract shortened by ProQuest.).

DIFFERENTIAL RESPONSE OF CLONES OF EUCALYPT TO GLYPHOSATE1

Directory of Open Access Journals (Sweden)

Leonardo Bianco de Carvalho

2015-02-01

Full Text Available Weed control is commonly performed by the inter-row mechanical weeding associated to intrarow glyphosate directed spraying, causing a risk for drift or accidental herbicide application, that can affect the crop of interest. The objective was to evaluate the response of clones C219, GG100, I144, and I224 of eucalypt (Eucalyptus grandis x E. urophylla to glyphosate doses of 0, 18, 36, 72, 180, 360, and 720 g of acid equivalent per hectare. The clones showed different growth patterns with regard to height, leaf number, stem dry weight, relative growth rate, net assimilation rate, and relative leaf growth rate. The clones I144 and GG100 were more susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 113.4 and 119.6 g acid equivalent per hectare, respectively. The clones C219 and I224 were less susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 237.5 and 313.5 g acid equivalent per hectare, respectively. Eucalyptus clones respond differently to glyphosate exposure, so that among I224, C219, GG100, and I144, the susceptibility to the herbicide is increasing.

The preparation and antibacterial effects of dopa-cotton/AgNPs

International Nuclear Information System (INIS)

Xu Hong; Shi Xue; Ma Hui; Lv Yihang; Zhang Linping; Mao Zhiping

2011-01-01

Silver nanoparticles (AgNPs) have been known to have powerful antibacterial activity. In this paper, in situ generation of AgNPs on the surface of dopamine modified cotton fabrics (dopa-cotton/AgNPs) in aqueous solution under room temperature is presented. X-ray photoelectron spectroscopy (XPS) and field emission scanning electron microscope (FE-SEM) were used to analyze the surface chemical composition and the morphology of the modified cotton fabrics, respectively. The results indicated that the surface of cotton fabrics was successfully coated with polydopamine and AgNPs. The cotton fabrics with AgNPs showed durable antibacterial activity.

Diversity of arthropod community in transgenic poplar-cotton ecosystems.

Science.gov (United States)

Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

2015-12-02

Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

Cancer incidence among glyphosate-exposed pesticide applicators in the Agricultural Health Study.

Science.gov (United States)

De Roos, Anneclaire J; Blair, Aaron; Rusiecki, Jennifer A; Hoppin, Jane A; Svec, Megan; Dosemeci, Mustafa; Sandler, Dale P; Alavanja, Michael C

2005-01-01

Glyphosate is a broad-spectrum herbicide that is one of the most frequently applied pesticides in the world. Although there has been little consistent evidence of genotoxicity or carcinogenicity from in vitro and animal studies, a few epidemiologic reports have indicated potential health effects of glyphosate. We evaluated associations between glyphosate exposure and cancer incidence in the Agricultural Health Study (AHS), a prospective cohort study of 57,311 licensed pesticide applicators in Iowa and North Carolina. Detailed information on pesticide use and other factors was obtained from a self-administered questionnaire completed at time of enrollment (1993-1997). Among private and commercial applicators, 75.5% reported having ever used glyphosate, of which > 97% were men. In this analysis, glyphosate exposure was defined as a) ever personally mixed or applied products containing glyphosate; b) cumulative lifetime days of use, or "cumulative exposure days" (years of use times days/year); and c) intensity-weighted cumulative exposure days (years of use times days/year times estimated intensity level). Poisson regression was used to estimate exposure-response relations between glyphosate and incidence of all cancers combined and 12 relatively common cancer subtypes. Glyphosate exposure was not associated with cancer incidence overall or with most of the cancer subtypes we studied. There was a suggested association with multiple myeloma incidence that should be followed up as more cases occur in the AHS. Given the widespread use of glyphosate, future analyses of the AHS will allow further examination of long-term health effects, including less common cancers.

Conductive Cotton Fabrics for Motion Sensing and Heating Applications

Directory of Open Access Journals (Sweden)

Mengyun Yang

2018-05-01

Full Text Available Conductive cotton fabric was prepared by coating single-wall carbon nanotubes (CNTs on a knitted cotton fabric surface through a “dip-and-dry” method. The combination of CNTs and cotton fabric was analyzed using scanning electron microscopy (SEM and Raman scattering spectroscopy. The CNTs coating improved the mechanical properties of the fabric and imparted conductivity to the fabric. The electromechanical performance of the CNT-cotton fabric (CCF was evaluated. Strain sensors made from the CCF exhibited a large workable strain range (0~100%, fast response and great stability. Furthermore, CCF-based strain sensors was used to monitor the real-time human motions, such as standing, walking, running, squatting and bending of finger and elbow. The CCF also exhibited strong electric heating effect. The flexible strain sensors and electric heaters made from CCF have potential applications in wearable electronic devices and cold weather conditions.

Circumvention of over-excitation of PSII by maintaining electron transport rate in leaves of four cotton genotypes developed under long-term drought.

Science.gov (United States)

Kitao, M; Lei, T T

2007-01-01

We investigated the patterns of response to a long-term drought in the field in cotton cultivars (genotypes) with known differences in their drought tolerance. Four cotton genotypes with varying physiological and morphological traits, suited to different cropping conditions, were grown in the field and subjected to a long-term moderate drought. In general, cotton leaves developed under drought had significantly higher area-based leaf nitrogen content (N (area)) than those under well irrigation. Droughted plants showed a lower light-saturated net photosynthetic rate (A (sat)) with lower stomatal conductance (g (s)) and intercellular CO (2) concentration (C (i)) than irrigated ones. Based on the responses of A (sat) to g (s) and C (i), there was no decreasing trend in A (sat) at a given g (s) and C (i) in droughted leaves, suggesting that the decline in A (sat) in field-grown cotton plants under a long-term drought can be attributed mainly to stomatal closure, but not to nonstomatal limitations. There was little evidence of an increase in thermal energy dissipation as indicated by the lack of a decrease in the photochemical efficiency of open PSII (F (v)'/F (m)') in droughted plants. On the basis of electron transport (ETR) and photochemical quenching (q (P)), however, we found evidence indicating that droughted cotton plants can circumvent the risk of excessive excitation energy in photosystem (PS) II by maintaining higher electron transport rates associated with higher N (area), even while photosynthetic rates were reduced by stomatal closure.

Gone with transgenic cotton cropping in the USA. A perception of the presentations and interactions at the Beltwide Cotton Conferences, New Orleans (Louisiana, USA, 4-7/01/2010

Directory of Open Access Journals (Sweden)

Fok, M.

2011-01-01

Full Text Available The 2010 Beltwide Cotton Conferences provided a new vision of the consequences of about 15 years of widespread and uncoordinated cropping of transgenic cotton in the United States. Insect-resistant and/or herbicide-tolerant cotton varieties modified parasite complexes, namely those of insects and weeds damaging cotton crops. The Conferences have revealed that the adaptation solutions so far proposed make illusory the expectations at the launch of transgenic cotton, in terms of effective pest control, cost reduction, and antagonism between chemical and biotech methods. The USA case points out that the technical and economic sustainability of transgenic varieties must lie in a systemic and coordinated approach.

Avaliação do uso de glyphosate em soja geneticamente modificada e sua relação com o ácido chiquímico Evaluation of glyphosate application on transgenic soybean and its relationship with shikimic acid

Directory of Open Access Journals (Sweden)

D.A.S. Franco

2012-09-01

plantas de soja transgênica no campo quando tratadas de forma isolada com glyphosate. Os resultados também mostraram exsudação radicular do glyphosate por soja transgênica, com posterior absorção por soja convencional. Foram detectados resíduos de glyphosate e ácido aminometilfosfônico na solução nutritiva.Glyphosate [N-(phosphonomethyl glycine]-resistant crops (GRC are the transgenic crops most extensively grown worldwide, with soybean being the major GRC. It is important to evaluate the impact of glyphosate on transgenic soybean and its relationship with shikimic acid. A field experiment was conducted at Engenheiro Coelho-SP, Brazil, during the agricultural year 2007/2008 to evaluate the effect of glyphosate on the growth, development, and seed quality of GRC soybean variety BRS Valiosa RR. A randomized block design was used with four replications. Glyphosate was applied at 720 and 960 g a.e. ha-1 (acid equivalent and in sequence at the doses 720/720, 960/720, and 960/720/720 g a.e. ha-1 (acid equivalent. To evaluate transfer from GRC soybean to non GRC soybean cultivated in nutrient solution, a pot experiment was conducted at Instituto Biológico, SP, Brazil. Glyphosate was applied on the GRC soybean (M8045RR at 2,400 g a.e. ha-1. Both GRC soybean and non GRC soybean were sown in the same box with nutrient solution. At 0, 1, 3, 7, and 10 days after application, shikimic acid was measured by HPLC and the glyphosate and aminomethylphosphonic acid (AMPA levels in nutrient solution were determined by GC-MS. The results showed that yield, plant height, seed oil, and protein contents were not affected by glyphosate application. GRC soybean accumulated shikimic acid in the field. Glyphosate and AMPA were released through the roots of GRC soybean, and subsequently taken up by non-GRC soybean, exerting inhibitory effects on their shikimic pathway.

Sensibilidade de estirpes de Bradyrhizobium ao glyphosate

Directory of Open Access Journals (Sweden)

Rodrigo Josemar Seminoti Jacques

2010-02-01

Full Text Available A aplicação do glyphosate sobre a soja resistente a este herbicida pode causar prejuízos à simbiose com o rizóbio. O objetivo deste trabalho foi avaliar a sensibilidade ao herbicida glyphosate de três estirpes de Bradyrhizobium recomendadas para a produção de inoculantes de sementes de soja no Brasil. Avaliou-se o efeito das concentrações de 0,0; 5,4; 10,8; 21,6 e 43,2 µg L-1 do ingrediente ativo do glyphosate [N-(fosfonometil glicina] no meio YM líquido sobre o crescimento de B. japonicum (estirpe SEMIA 5079 e de B. elkanii (estirpe SEMIA 5019 e estirpe SEMIA 587, por meio de leituras das densidades óticas e geração de curvas de crescimento. As reduções de crescimento na presença da menor concentração do glyphosate foram de 18% para SEMIA 5079, 29% para SEMIA 5019 e de 35% para SEMIA 587, sendo, de modo geral, quanto maior a concentração do herbicida no meio de cultura maior a inibição do crescimen­to. As estirpes apresentaram sensibilidade diferencial somente às concentrações mais baixas do glyphosate; nesse caso, foi possível determinar a seguinte ordem de sensibilidade: SEMIA 587 > SEMIA 5019 > SEMIA 5079. Essa sensibilidade diferencial é dependente da concentração do herbicida, pois na presença de 43,2 µg L-1 todas as estirpes tiveram seu crescimento severamente reduzido, não havendo diferença entre elas.

Effects of mixtures of dicamba and glyphosate on nontarget plants

Science.gov (United States)

New technologies are being developed using mixtures of herbicides to manage a broader variety of weeds in multiple herbicide resistant crops such as soybean and cotton. As part of its regulation of pesticides, the US Environmental Protection Agency considers environmental risks,...

Herbicide-resistant crop biotechnology: potential and pitfalls

Science.gov (United States)

Herbicide-resistant crops are an important agricultural biotechnology that can enable farmers to effectively control weeds without harming their crops. Glyphosate-resistant (i.e. Roundup Ready) crops have been the most commercially successful varieties of herbicide-resistant crops and have been plan...

Implication of Legal References on Technological Dissemination: A Study on Transgenic Soybeans Resistant to Glyphosate Herbicide in Brazil

Directory of Open Access Journals (Sweden)

Roberta Rodrigues

2013-04-01

Full Text Available The following paper aims at establishing a connection between the evolution of legal landmarks related to soybeans tolerant to glyphosate-based herbicide in Brazil and the planting growth of this transgenic soybean in Brazil, in order to determine the role that such soybeans play in today's domestic agricultural scenario. To do so, a study of Brazilian laws that protect intellectual creations was carried out (Industrial Property Law - Law number 9.279/96 and the Plant Protection Law – Law number 9.456/97, the Law on Biosafety – Law number 11105 / 05 – and the Law on Brazilian Seeds and Seedlings - Law number 10.711/03, in order to delimit the matter protected by each of those laws while establishing its interfaces. Regarding planting, the Biosafety Law of 2005 corresponds to the fourth law which deals with soybeans tolerant to glyphosate-based herbicide and ensures that those previously registered may be marketed without limitation per crop. In order to estimate the space that soybean seeds tolerant to glyphosate-based herbicide began to occupy in the Brazilian market, in the 2008/2009 harvest, compared to the other not genetically modified soybeans, a search in the Ministry of Agriculture´s database was done (http://www.agricultura.gov.br through the available records of certified, non-certified and basic seeds.

Analysis of root-knot nematode and fusarium wilt disease resistance in cotton (Gossypium spp.) using chromosome substitution lines from two alien species

Science.gov (United States)

To Identify a new germplasm resource, and to validate chromosomal regions and favorable alleles associated with nematode and fungal disease resistance traits, a series of interspecific cotton (Gossypium spp.) chromosome substitution (CS) lines were used in this study. The CS lines were developed in ...

Improving food and agricultural production. Thailand. Breeding for resistance to diseases in cotton

International Nuclear Information System (INIS)

Wallace, T.P.

1992-01-01

This document reports the results of a 20-day mission to Thailand within the framework of the project ''Improving food and agricultural production with nuclear and related technology''. The expert discussed the status of cotton breeding, production practices and problems with personnel of the Department of Agriculture in Bangkok, and travelled to cotton-producing regions of the central and northern areas of the country to discuss current research, pest problems and social factors affecting cotton production

Screening of post emergence herbicides for weed control in cotton (GOSSYPIUM HIRSUTUM) and their effect on yield and yield components

International Nuclear Information System (INIS)

Hussain, N.; Khan, M.B.; Khan, M.A.; Hameed, R.A.

2005-01-01

Response of varying herbicides at different levels: round up 490 G/L at the rate of 4.7 L ha/sup -1/ and 1.5 L ha/sup -1/ (Glyphosat) and Gramaxone 20 EC (Paraquat) at the rate of 2.5 L ha/sup -1/ against untreated (control, were investigated to cotton cultivar CIM-473 under field conditions during Kharif 2002 at Agronomic Research Area. Central Cotton Research Institute, Multan. Significant control of weeds and increase in yield and yield contributing factors were observed. It was indicated that maximum yield and weed control were obtained by using Round up (Glyphosate) at the rate of 4.7 L ha/sup -1/ as compared to other treatments including untreated (control). Average boll weight was not significant among treatments but significant against control. Maximum net profit was obtained from Round up 490 G/L when treated at the rate of 4.7 L ha/sup -1/ than all other treatments. (author)

Degradation of the Herbicide Glyphosate by Members of the Family Rhizobiaceae

OpenAIRE

Liu, C.-M.; McLean, P. A.; Sookdeo, C. C.; Cannon, F. C.

1991-01-01

Several strains of the family Rhizobiaceae were tested for their ability to degrade the phosphonate herbicide glyphosate (isopropylamine salt of N-phosphonomethylglycine). All organisms tested (seven Rhizobium meliloti strains, Rhizobium leguminosarum, Rhizobium galega, Rhizobium trifolii, Agrobacterium rhizogenes, and Agrobacterium tumefaciens) were able to grow on glyphosate as the sole source of phosphorus in the presence of the aromatic amino acids, although growth on glyphosate was not a...

Glyphosate Use and Cancer Incidence in the Agricultural Health Study.

Science.gov (United States)

Andreotti, Gabriella; Koutros, Stella; Hofmann, Jonathan N; Sandler, Dale P; Lubin, Jay H; Lynch, Charles F; Lerro, Catherine C; De Roos, Anneclaire J; Parks, Christine G; Alavanja, Michael C; Silverman, Debra T; Beane Freeman, Laura E

2018-05-01

Glyphosate is the most commonly used herbicide worldwide, with both residential and agricultural uses. In 2015, the International Agency for Research on Cancer classified glyphosate as "probably carcinogenic to humans," noting strong mechanistic evidence and positive associations for non-Hodgkin lymphoma (NHL) in some epidemiologic studies. A previous evaluation in the Agricultural Health Study (AHS) with follow-up through 2001 found no statistically significant associations with glyphosate use and cancer at any site. The AHS is a prospective cohort of licensed pesticide applicators from North Carolina and Iowa. Here, we updated the previous evaluation of glyphosate with cancer incidence from registry linkages through 2012 (North Carolina)/2013 (Iowa). Lifetime days and intensity-weighted lifetime days of glyphosate use were based on self-reported information from enrollment (1993-1997) and follow-up questionnaires (1999-2005). We estimated incidence rate ratios (RRs) and 95% confidence intervals (CIs) using Poisson regression, controlling for potential confounders, including use of other pesticides. All statistical tests were two-sided. Among 54 251 applicators, 44 932 (82.8%) used glyphosate, including 5779 incident cancer cases (79.3% of all cases). In unlagged analyses, glyphosate was not statistically significantly associated with cancer at any site. However, among applicators in the highest exposure quartile, there was an increased risk of acute myeloid leukemia (AML) compared with never users (RR = 2.44, 95% CI = 0.94 to 6.32, Ptrend = .11), though this association was not statistically significant. Results for AML were similar with a five-year (RRQuartile 4 = 2.32, 95% CI = 0.98 to 5.51, Ptrend = .07) and 20-year exposure lag (RRTertile 3 = 2.04, 95% CI = 1.05 to 3.97, Ptrend = .04). In this large, prospective cohort study, no association was apparent between glyphosate and any solid tumors or lymphoid malignancies overall, including NHL and

The natural refuge policy for Bt cotton (Gossypium L. in Pakistan – a situation analysis

Directory of Open Access Journals (Sweden)

Muhammad Sajjad Ali

2013-07-01

Full Text Available Bt cotton (event Cry1Ac was formally commercialized in Pakistan in 2010. However, there has been an increasing trend of planting unauthorized Bt cotton germplasm in farmers' fields since 2003 with a high rate of adoption in the core cotton areas especially in the province Punjab. The transgenic cotton technology has provided the growers with substantial economic benefits and has reduced their dependence on pesticides for pest control, especially against Helicoverpa armigera (Hubner. However, keeping in view the capacity of this insect to develop resistance against novel chemical formulations, it is easily speculated that Bt toxin, too, is no exception. Refuge crop policy for mono transgenic crop events has helped in delaying the rate of resistance evolution in the target pests. Thus, in Pakistan, where planting of structured refuge crops along Bt cotton fields is not mandatory, the effectiveness and durability of Bt cotton technology may decrease due to a number of factors which are discussed in this review.

Incipient resistance of Helicoverpa punctigera to the Cry2Ab Bt toxin in Bollgard II cotton.

Directory of Open Access Journals (Sweden)

Sharon Downes

Full Text Available Combinations of dissimilar insecticidal proteins ("pyramids" within transgenic plants are predicted to delay the evolution of pest resistance for significantly longer than crops expressing a single transgene. Field-evolved resistance to Bacillus thuringiensis (Bt transgenic crops has been reported for first generation, single-toxin varieties and the Cry1 class of proteins. Our five year data set shows a significant exponential increase in the frequency of alleles conferring Cry2Ab resistance in Australian field populations of Helicoverpa punctigera since the adoption of a second generation, two-toxin Bt cotton expressing this insecticidal protein. Furthermore, the frequency of cry2Ab resistance alleles in populations from cropping areas is 8-fold higher than that found for populations from non-cropping regions. This report of field evolved resistance to a protein in a dual-toxin Bt-crop has precisely fulfilled the intended function of monitoring for resistance; namely, to provide an early warning of increases in frequencies that may lead to potential failures of the transgenic technology. Furthermore, it demonstrates that pyramids are not 'bullet proof' and that rapid evolution to Bt toxins in the Cry2 class is possible.

Influence of glyphosate in planktonic and biofilm growth of Pseudomonas aeruginosa

Directory of Open Access Journals (Sweden)

Ilana Schneider Lima

2014-09-01

Full Text Available This study evaluated the impact of different concentrations of glyphosate (Rondup® on planktonic and biofilm growth of P. aeruginosa. Aerobic and anaerobic cultures of P. aeruginosa ATCC®15442 inoculated in MHB + glyphosate (0.845 ppm, 1.690 ppm, 8.45 ppm, 16.90 ppm, 84.50 ppm, 169 ppm, 845 ppm, and 1690 ppm and cultured in normoxia and anoxia, following their OD560nm every hour for 24 h. Biofilms of adapted cells were formed in the presence of glyphosate (0.845 to 1690 ppm in normoxia and anoxia for 36 h. Glyphosate at concentrations higher than 84.5 ppm reduces the cell density of planktonic aerobic cultures (p 0.05, and more pronounced over 169 ppm. Anaerobic biofilms have their growth more readily favored (p < 0.05, regardless of concentration. In a concentration-dependent manner, glyphosate interferes with the growth ability of P. aeruginosa ATCC®15442.

Effect of pyramiding Bt and CpTI genes on resistance of cotton to Helicoverpa armigera (Lepidoptera: Noctuidae) under laboratory and field conditions

NARCIS (Netherlands)

Cui, J.J.; Luo, J.Y.; Werf, van der W.; Ma, Y.; Xia, J.Y.

2011-01-01

Transgenic cotton (Gossypium hirsutum L.) varieties, adapted to China, have been bred that express two genes for resistance to insects. the Cry1Ac gene from Bacillus thuringiensis (Berliner) (Bt), and a trypsin inhibitor gene from cowpea (CpTI). Effectiveness of the double gene modification in

High permeation rates in liposome systems explain rapid glyphosate biodegradation associated with strong isotope fractionation.

Science.gov (United States)

Ehrl, Benno; Mogusu, Emmanuel O; Kim, Kyoungtea; Hofstetter, Heike; Pedersen, Joel A; Elsner, Martin

2018-05-23

Bacterial uptake of charged organic pollutants such as the widely used herbicide glyphosate is typically attributed to active transporters, whereas passive membrane permeation as an uptake pathway is usually neglected. For 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) liposomes, pH-dependent membrane permeation coefficients (Papp) of glyphosate, determined by nuclear magnetic resonance (NMR) spectroscopy, varied from Papp(pH 7.0) = 3.7 (+/-0.3) × 10-7 m∙s-1 to Papp(pH 4.1) = 4.2 (+/-0.1) × 10-6 m∙s-1. This surprisingly rapid membrane permeation depended on glyphosate speciation and was, at physiological pH, in the range of polar, non-charged molecules suggesting that passive membrane permeation is a potential uptake pathway during glyphosate biodegradation. To test this hypothesis, a Gram-negative glyphosate degrader, Ochrobactrum sp. FrEM, was isolated from glyphosate-treated soil and glyphosate permeation rates inferred from the liposome model were compared to bacterial degradation rates. Estimated maximum permeation rates were, indeed, two orders of magnitudes higher than glyphosate degradation rates. Moreover, biodegradation of millimolar glyphosate concentrations gave rise to pronounced carbon isotope fractionation with an apparent kinetic isotope effect of AKIEcarbon= 1.014 ± 0.003. This value is consistent with unmasked enzymatic isotope fractionation demonstrating that glyphosate biodegradation was little mass transfer-limited and glyphosate exchange across the cell membrane was rapid relative to enzymatic turnover.

Resistance and sheet resistance measurements using electron beam induced current

International Nuclear Information System (INIS)

Czerwinski, A.; Pluska, M.; Ratajczak, J.; Szerling, A.; KaPtcki, J.

2006-01-01

A method for measurement of spatially uniform or nonuniform resistance in layers and strips, based on electron beam induced current (EBIC) technique, is described. High electron beam currents are used so that the overall resistance of the measurement circuit affects the EBIC signal. During the evaluation, the electron beam is scanned along the measured object, whose load resistance varies with the distance. The variation is compensated by an adjustable resistance within an external circuit. The method has been experimentally deployed for sheet resistance determination of buried regions of lateral confinements in semiconductor laser heterostructures manufactured by molecular beam epitaxy

Biodegradation of glyphosate herbicide by Salinicoccus spp isolated from Qom Hoze-soltan lake, Iran

Directory of Open Access Journals (Sweden)

Yaser Sharifi

2015-01-01

Full Text Available Background: Glyphosate (N-phosphonomethyl Glycine is an organophosphorus pesticide with dangerous effects on the environment. In this study, the biodegradation of glyphosate herbicide by halophilic bacteria isolated from Qom Hoze-Soltan Lake has been investigated. Methods: After sampling and bacterial isolation, native halophilic strains grown in the presence of glyphosate at a wavelength of 660 nm and also the disappearance of the glyphosate in the plates at a wavelength of 220 nm were determined and the dominant bacteria were isolated. Biochemical, molecular (according to the 16S rRNA sequence, antibiotic, and the Minimum Inhibitory Concentration (MIC test was performed for the dominant bacteria. Analysis of the remaining glyphosate herbicide was performed by HPLC analysis after derivation with FMOC-Cl. Results: According to the results of the biochemical, antibiotic and molecular 16S rRNA tests, the native halophilic isolates with the ability to biodegrade glyphosate were gram positive cocci very similar to Salinicoccusspp. The results of HPLC showed that Salinicoccusspp is able to biodegrade glyphosate herbicide. Conclusion: The native bacteria in Qom Hoze-soltanlake, Iran can be used for biodegradation of glyphosate herbicide.

Alteration of plant physiology by glyphosate and its by-product aminomethylphosphonic acid: an overview.

Science.gov (United States)

Gomes, Marcelo P; Smedbol, Elise; Chalifour, Annie; Hénault-Ethier, Louise; Labrecque, Michel; Lepage, Laurent; Lucotte, Marc; Juneau, Philippe

2014-09-01

It is generally claimed that glyphosate kills undesired plants by affecting the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzyme, disturbing the shikimate pathway. However, the mechanisms leading to plant death may also be related to secondary or indirect effects of glyphosate on plant physiology. Moreover, some plants can metabolize glyphosate to aminomethylphosphonic acid (AMPA) or be exposed to AMPA from different environmental matrices. AMPA is a recognized phytotoxin, and its co-occurrence with glyphosate could modify the effects of glyphosate on plant physiology. The present review provides an overall picture of alterations of plant physiology caused by environmental exposure to glyphosate and its metabolite AMPA, and summarizes their effects on several physiological processes. It particularly focuses on photosynthesis, from photochemical events to C assimilation and translocation, as well as oxidative stress. The effects of glyphosate and AMPA on several plant physiological processes have been linked, with the aim of better understanding their phytotoxicity and glyphosate herbicidal effects. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Glyphosate: environmental contamination, toxicity and potential risks to human health via food contamination.

Science.gov (United States)

Bai, Shahla Hosseini; Ogbourne, Steven M

2016-10-01

Glyphosate has been the most widely used herbicide during the past three decades. The US Environmental Protection Agency (EPA) classifies glyphosate as 'practically non-toxic and not an irritant' under the acute toxicity classification system. This classification is based primarily on toxicity data and due to its unique mode of action via a biochemical pathway that only exists in a small number of organisms that utilise the shikimic acid pathway to produce amino acids, most of which are green plants. This classification is supported by the majority of scientific literature on the toxic effects of glyphosate. However, in 2005, the Food and Agriculture Organisation (FAO) reported that glyphosate and its major metabolite, aminomethylphosphonic acid (AMPA), are of potential toxicological concern, mainly as a result of accumulation of residues in the food chain. The FAO further states that the dietary risk of glyphosate and AMPA is unlikely if the maximum daily intake of 1 mg kg(-1) body weight (bw) is not exceeded. Research has now established that glyphosate can persist in the environment, and therefore, assessments of the health risks associated with glyphosate are more complicated than suggested by acute toxicity data that relate primarily to accidental high-rate exposure. We have used recent literature to assess the possible risks associated with the presence of glyphosate residues in food and the environment.

Consequences of phosphate application on glyphosate uptake by roots: Impacts for environmental management practices.

Science.gov (United States)

Gomes, Marcelo Pedrosa; Maccario, Sophie; Lucotte, Marc; Labrecque, Michel; Juneau, Philippe

2015-12-15

Phosphate (PO4(3-)) fertilization is a common practice in agricultural fields also targets for glyphosate application. Due to their chemical similarities, PO4(3-) and glyphosate compete for soil adsorbing sites, with PO4(3-) fertilization increasing glyphosate bioavailability in the soil solution. After PO4(3-) fertilization, its concentration will be elevated in the soil solution and both PO4(3-) and glyphosate will be readily available for runoff into aquatic ecosystems. In this context, man-made riparian buffer strips (RBS) at the interface of agricultural lands and waterways can be used as a green technology to mitigate water contamination. The plants used in RBS form a barrier to agricultural wastes that can limit runoff, and the ability of these plants to take up these compounds through their roots plays an important role in RBS efficacy. However, the implications of PO4(3-) for glyphosate uptake by roots are not yet clearly demonstrated. Here, we addressed this problem by hydroponically cultivating willow plants in nutrient solutions amended with glyphosate and different concentrations of PO4(3-), assuring full availability of both chemicals to the roots. Using a phosphate carrier inhibitor (phosphonophormic acid-PFA), we found that part of the glyphosate uptake is mediated by PO4(3-) transporters. We observed, however, that PO4(3-) increased glyphosate uptake by roots, an effect that was related to increased root cell membrane stability. Our results indicate that PO4(3-) has an important role in glyphosate physiological effects. Under agricultural conditions, PO4(3-) fertilization can amplify glyphosate efficiency by increasing its uptake by the roots of undesired plants. On the other hand, since simultaneous phosphate and glyphosate runoffs are common, non-target species found near agricultural fields can be affected. Copyright © 2015. Published by Elsevier B.V.

Is the growth stimulation by low doses of glyphosate sustained over time?

International Nuclear Information System (INIS)

Cedergreen, Nina

2008-01-01

The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha -1 , corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses -1 . This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time

Is the growth stimulation by low doses of glyphosate sustained over time?

Energy Technology Data Exchange (ETDEWEB)

Cedergreen, Nina [Department of Agricultural Sciences, Faculty of Life Science, University of Copenhagen, Hojbakkegard Alle 13, 2630 Tastrup (Denmark)], E-mail: ncf@life.ku.dk

2008-12-15

The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha{sup -1}, corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses <60 g a.e. ha{sup -1}. This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time.

Water use efficiency by coffee arabica after glyphosate application

Directory of Open Access Journals (Sweden)

Felipe Paolinelli de Carvalho

2014-07-01

Full Text Available Many coffee growers apply glyphosate in directed applications, but some phytotoxicity has been noted. It is believed some herbicides can exert a direct or indirect negative effect on photosynthesis by reducing the metabolic rate in a way that can affect the water use efficiency. The objective of this study was to investigate the variables related to water use among coffee cultivars subjected to the application of glyphosate and the effects of each dose. The experiment was conducted in a greenhouse using three varieties of coffee (Coffea arabica, Acaiá (MG-6851, Catucaí Amarelo (2SL and Topázio (MG-1190, and three doses of glyphosate (0.0, 115.2 and 460.8 g acid equivalent ha-1, in a factorial 3 x 3 design. At 15 days after application, a reduction in stomatal conductance was observed, and smaller transpiration rate and water use efficiency were found in the fourth leaf at 15 days after application. There was a decrease in the transpiration rate at 45 DAA, with the Acaiá cultivar showing reductions with 115.2 g ha-1. There was transitory reduction in water use efficiency with glyphosate application, but can affect the growth and production. The Acaiá cultivar showed the highest tolerance to glyphosate because the water use efficiency after herbicide application.

A facile method to fabricate superhydrophobic cotton fabrics

Science.gov (United States)

Zhang, Ming; Wang, Shuliang; Wang, Chengyu; Li, Jian

2012-11-01

A facile and novel method for fabricating superhydrophobic cotton fabrics is described in the present work. The superhydrophobic surface has been prepared by utilizing cationic poly (dimethyldiallylammonium chloride) and silica particles together with subsequent modification of (heptadecafluoro-1,1,2,2-tetradecyl) trimethoxysilane. The size distribution of silica particles was measured by Particle Size Analyzer. The cotton textiles before and after treatment were characterized by using scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS). The wetting behavior of cotton samples was investigated by water contact angle measurement. Moreover, the superhydrophobic durability of coated cotton textiles has been evaluated by exposure, immersion and washing tests. The results show that the treated cotton fabrics exhibited excellent chemical stability and outstanding non-wettability with the WCA of 155 ± 2°, which offers an opportunity to accelerate the large-scale production of superhydrophobic textiles materials for new industrial applications.

Adsorption-desorption, mobility and degradation of 14C-Glyphosate in two soil series

International Nuclear Information System (INIS)

Ismail, B. S.; Zaifah Abdul Kadir; Khairiah Jusoh; Nashriyah Mat

2002-01-01

The adsorption desorption and degradation of glyphosate (Roundup) have been studied using 14 C glyphosate in two soils, namely Serdang Series and Sungai Buloh Series. The percentage of adsorption was not significantly different (p 14 C- glyphosate was detected in 0-10 cm zone of the two soils studied. However, in Sungai Buloh Series, a significant amount of 14 C-glyphosate was detected in the 10-20 cm zone. A small amount of 14 C radioactivity was also detected in the leachate of the two soils. The percentage of degradation in the Sungai Buloh and Serdang Series soils was higher at 10 μg/ml and 50 μg/ml, concentration, respectively. At 50 μg/ml concentration the Sungai Buloh Series soil showed higher glyphosate residue (83%) as compared to Serdang Series (48%). In contrast, the glyphosate residue was found to be higher in the Serdang Series (73916) as compared to the Sungai Buloh Series (30%) at 10 μg/ml concentration. (Author)

Spatial and temporal trends and flow dynamics of glyphosate and other pesticides within an agricultural watershed in Argentina.

Science.gov (United States)

Pérez, Débora J; Okada, Elena; De Gerónimo, Eduardo; Menone, Mirta L; Aparicio, Virginia C; Costa, José L

2017-12-01

In the present study, we evaluated the spatial and temporal trends of current-use pesticides in surface water and sediments as well as their relationship with hydrological stream dynamics within the agricultural watershed of El Crespo stream (Buenos Aires Province, Argentina). We sampled 2 contrasting sites: site 1 (upstream), surrounded by agricultural lands, and site 2 (downstream), surrounded by natural grasslands. Most of the applied pesticides (glyphosate, 2,4-D, atrazine, tebuconazole, and imidacloprid) were detected at high frequencies in surface water samples at both sites. However, only glyphosate and aminomethylphosphonic acid (AMPA) were present at high concentrations and had a significant spatial-temporal trend. The highest concentrations were found during spring 2014 at site 1, in association with the intense rains that occurred in that season. The fact that glyphosate and AMPA concentrations were higher than the rest of the studied compounds is closely related to the land use within the watershed, as glyphosate was the most applied herbicide during the fallow period of glyphosate-resistant crops (soybean, maize). The pesticide mixture had a significant spatial-temporal trend, reaching the highest levels during storm flow events in spring 2014. The intensive rains in spring 2014 could be the main factor influencing stream hydrology and pesticide behavior at El Crespo watershed. The estimated annual pesticide losses were 3.11 g/ha at site 1 and 0.72 g/ha at site 2. This result indicates that an attenuation process could be decreasing pesticide loads during downstream transport from site 1 to site 2. Environ Toxicol Chem 2017;36:3206-3216. © 2017 SETAC. © 2017 SETAC.

Research on the weed control degree and glyphosate soil biodegradation in apple plantations (Pioneer variety

Directory of Open Access Journals (Sweden)

Ersilia ALEXA

2010-05-01

Full Text Available In this study we follow control degree of glyphosate herbicide on weeds in apple plantations (Pioneer variety of the Research Station Timisoara. It was also followed glyphosate biodegradation capacity in the soil by determining the amount of CO2 released by the action of microorganisms on C14 glyphosate marked isotope. Laboratory analysis of glyphosate residues in soil was made using a Liquid Scintillation TRIATHLER. Glyphosate biodegradation ability in the presence of soil microorganisms is high, so glyphosate residues remaining in soil, in terms of its use in weed combating, are minimal. Study of glyphosate biodegradation capacity in the experimental field indicates that the CO2 fraction accumulated after 50 days is 28.02% for samples exposed in the experimental field. Weather conditions, especially temperature variations between day and night, influences the activity of soilmicroorganisms and affect biodegraded glyphosate percentage.Chemical method of weed control consisted in: herbicide used was Roundup 3 l/ha (glyphosate isopropyl amine salt 360 g/l and are based on chemical application on weeds, on the rows of trees, on their uptake and translocation in their organs having as principal scope the total destruction of weeds. The experimental results obtained reveal a weed combat degree of 82.98% , in the case of chemical variant, compared with control variant. The species combated mainly due to glyphosate herbicide, which is no longer found in the final mapping are: Capsella bursa-pastoris, Chenopodium album, Echinochloa crus-galli, Plantago major, Polygonum aviculare. Total combated weeds /m2 with glyphosate is 126.67.

Detecting cotton boll rot with an electronic nose

Science.gov (United States)

South Carolina Boll Rot is an emerging disease of cotton, Gossypium hirsutum L., caused by the opportunistic bacteria, Pantoea agglomerans (Ewing and Fife). Unlike typical fungal diseases, bolls infected with P. agglomerans continue to appear normal externally, complicating early and rapid detectio...

Glyphosate Shapes a Dinoflagellate-Associated Bacterial Community While Supporting Algal Growth as Sole Phosphorus Source

Directory of Open Access Journals (Sweden)

Cong Wang

2017-12-01

Full Text Available Glyphosate is a widely used herbicide that can potentially be a phosphorus (P source for phytoplankton and microbes when discharged into the coastal ocean. In contrast to bacteria, few eukaryotic phytoplankton species appear capable of directly utilizing glyphosate. In this study, we observed, after a long delay (>60 days, Prorocentrum donghaiense, a dinoflagellate known to cause major harmful algal blooms in the East China Sea, could grow in a medium with glyphosate as the sole P source; suggesting that P. donghaiense growth was through bacterial mediation. To understand how the bacteria community might respond to glyphosate, we analyzed the 16S rRNA genes of the microbial community present in P. donghaiense cultures when grown under lower (36 μM and higher (360 μM glyphosate concentrations. Based on both Sanger and Illumina high throughput sequencing, we obtained more than 55,323 good-quality sequences, which were classified into six phyla. As the concentration of glyphosate rose, our results showed a significant increase in the phyla Proteobacteria and Firmicutes and a decrease in the phylum Bacteroidetes. Further qPCR (Quantitative PCR analysis showed higher abundances of two specific phylotypes in the higher-glyphosate P. donghaiense cultures when compared to the lower-glyphosate and no-glyphosate cultures. Correspondingly, qPCR displayed the same trend for the abundance of a gammaproteobacterial type of phnJ, a gene encoding Alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase, which is responsible for phosphonate degradation. In addition, Tax4Fun analysis based on our 16S rRNA gene sequences results in higher predicted abundances of phosphonate metabolizing genes in glyphosate-treated cultures. This study demonstrates that glyphosate could selectively promote the growth of particular groups of bacteria within an algal culture and in glyphosate enriched coastal waters, this interaction may potentially further facilitate the growth of

Effect of cotton leaf-curl virus on the yield-components and fibre properties of cotton genotypes under varying plant spacing and nitrogen fertilizer

International Nuclear Information System (INIS)

Ahmad, S.; Hayat, K.; Ashraf, F.; Sadiq, M.A.

2008-01-01

Cotton leaf-curl virus (CLCu VB. Wala strain) is one of the major biotic constraints of cotton production in Punjab. Development of resistant cotton genotype is the most feasible, economical and effective method to combat this hazardous problem, but so far no resistant genotype has been reported. Therefore, the objective of this study was to compare yield and yield-components and fiber traits of different genotypes/varieties under different plant spacing and nitrogen fertilizer as a management strategy to cope with this viral disease. Field experiment was conducted during 2006-07 to evaluate the effect of genotype, plant spacing and nitrogen fertilizer on cotton. Five genotypes (MNH-786, MNH-789, MNH- 6070, CIM- 496, and BH-160), three plant-spacings (15, 30 and 45 cm) and three nitrogen fertilizer-levels (6.5, 8.6 and 11 bags Urea / ha) were studied. Results showed that significant differences exist for plant height, no. of bolls/m/sup -2/, seed-cotton yield (kg/ha) due to genotype, interaction of genotype with plant spacing and nitrogen fertilizer level. Whereas boll weight, ginning out-turn, staple length and fiber fineness were not affected significantly by the plant spacing and nitrogen fertilizer, the effect due to genotype was significant for these traits. CLCuV infestation varied significantly with genotypes, while all other factors, i.e., plant spacing and nitrogen fertilizers, have non-significant effect. As the major objective of cotton cultivation is production of lint for the country and seed- cotton yield for the farmers, it is noted that genotypes grown in narrow plant-spacing (15 cm) and higher nitrogen fertilizer level (11.0 bags of urea/ha) produced maximum seed-cotton yield under higher CLCu V infestation in case of CIM-496, MNH-789 and BH-I60, while the new strain MNH-6070 gave maximum yield under 30cm plant-spacing and 8.6 bags of urea/ha has the 2.3% CLCu V infestation was observed in this variety. From the present study, it is concluded that

Investigation of antibacterial activity of cotton fabric incorporating nano silver colloid

International Nuclear Information System (INIS)

Ngo Vo Ke Thanh; Nguyen Thi Phuong Phong

2009-01-01

In this work, silver nanoparticles were prepared by polyol process with microwave heating and incorporated on cotton fabric surfaces. The antibacterial performance of the antibacterial cotton fabric was tested for different concentration of nano-sized silver colloid, contact time germs, and washing times. It was found that antibacterial activity increased with the increasing concentration of nano-sized silver colloid. The antibacterial fabric with 758 mg/kg of silver nanoparticles on surface cotton was highly effective in killing test bacteria and had excellent water resisting property.

Correlation of leaf damage with uptake and translocation of glyphosate in velvetleaf (Abutilon theophrasti)

International Nuclear Information System (INIS)

Feng, P.C.C.; Ryerse, J.S.; Sammons, R.D.

1998-01-01

Uptake and translocation of glyphosate in three commercial formulations were examined in velvetleaf, a dicotyledonous weed that is commonly treated with glyphosate. The formulations included Roundup(R) (MON35085), Roundup Ultra, and Touchdown(R) as sold in Canada. A minimal amount of 14C-glyphosate was spiked into a lethal rate of each formulation, and the short-term (3 to 72 h) uptake into the treated leaf and subsequent translocation into the plant were measured. Time-course studies showed very rapid uptake and translocation of glyphosate in the Ultra formulation. In comparison, the uptake and translocation of glyphosate in Touchdown was much slower but continued throughout the 72-h period. Glyphosate in the Roundup formulation showed intermediate uptake and translocation. Tissue necrosis at the application sites of Ultra and Roundup was visible within 24 h after treatment. Examinations using stereo and fluorescence microscopy revealed extensive cell death and tissue disruption. Tissue necrosis from Ultra and Roundup was also observed in blank formulations containing no glyphosate and therefore was likely caused by the surfactants. In contrast, the application sites of Touchdown produced little to no leaf damage. Our results demonstrated a direct correlation between tissue necrosis and rapid rates of glyphosate uptake and translocation. (author)

Coupling of MIC-3 overexpression with the chromosome 11 and 14 root-knot nematode (RKN) (Meloidogyne incognita) resistance QTLs provides insights into the regulation of the RKN resistance response in Upland cotton...

Science.gov (United States)

High levels of resistance to root-knot nematode (RKN) (Meloidogyne incognita) in Upland cotton (Gossypium hirsutum) is mediated by two major quantitative trait loci (QTL) located on chromosomes 11 and 14. We had previously determined that MIC-3 expression played a direct role in suppressing RKN egg...

Glyphosate-Induced Specific and Widespread Perturbations in the Metabolome of Soil Pseudomonas Species

Directory of Open Access Journals (Sweden)

Ludmilla Aristilde

2017-06-01

Full Text Available Previous studies have reported adverse effects of glyphosate on crop-beneficial soil bacterial species, including several soil Pseudomonas species. Of particular interest is the elucidation of the metabolic consequences of glyphosate toxicity in these species. Here we investigated the growth and metabolic responses of soil Pseudomonas species grown on succinate, a common root exudate, and glyphosate at different concentrations. We conducted our experiments with one agricultural soil isolate, P. fluorescens RA12, and three model species, P. putida KT2440, P. putida S12, and P. protegens Pf-5. Our results demonstrated both species- and strain-dependent growth responses to glyphosate. Following exposure to a range of glyphosate concentrations (up to 5 mM, the growth rate of both P. protegens Pf-5 and P. fluorescens RA12 remained unchanged whereas the two P. putida strains exhibited from 0 to 100% growth inhibition. We employed a 13C-assisted metabolomics approach using liquid chromatography-mass spectrometry to monitor disruptions in metabolic homeostasis and fluxes. Profiling of the whole-cell metabolome captured deviations in metabolite levels involved in the tricarboxylic acid cycle, ribonucleotide biosynthesis, and protein biosynthesis. Altered metabolite levels specifically in the biosynthetic pathway of aromatic amino acids (AAs, the target of toxicity for glyphosate in plants, implied the same toxicity target in the soil bacterium. Kinetic flux experiments with 13C-labeled succinate revealed that biosynthetic fluxes of the aromatic AAs were not inhibited in P. fluorescens Pf-5 in the presence of low and high glyphosate doses but these fluxes were inhibited by up to 60% in P. putida KT2440, even at sub-lethal glyphosate exposure. Notably, the greatest inhibition was found for the aromatic AA tryptophan, an important precursor to secondary metabolites. When the growth medium was supplemented with aromatic AAs, P. putida S12 exposed to a lethal

Molecular cloning of alpha-amylases from cotton boll weevil, Anthonomus grandis and structural relations to plant inhibitors: an approach to insect resistance.

Science.gov (United States)

Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Franco, Octávio L; Falcão, Rosana; Fragoso, Rodrigo R; Mello, Luciane V; dos Santos, Roseane C; Grossi-de-Sá, Maria F

2003-01-01

Anthonomus grandis, the cotton boll weevil, causes severe cotton crop losses in North and South America. Here we demonstrate the presence of starch in the cotton pollen grains and young ovules that are the main A. grandis food source. We further demonstrate the presence of alpha-amylase activity, an essential enzyme of carbohydrate metabolism for many crop pests, in A. grandis midgut. Two alpha-amylase cDNAs from A. grandis larvae were isolated using RT-PCR followed by 5' and 3' RACE techniques. These encode proteins with predicted molecular masses of 50.8 and 52.7kDa, respectively, which share 58% amino acid identity. Expression of both genes is induced upon feeding and concentrated in the midgut of adult insects. Several alpha-amylase inhibitors from plants were assayed against A. grandis alpha-amylases but, unexpectedly, only the BIII inhibitor from rye kernels proved highly effective, with inhibitors generally active against other insect amylases lacking effect. Structural modeling of Amylag1 and Amylag2 showed that different factors seem to be responsible for the lack of effect of 0.19 and alpha-AI1 inhibitors on A. grandis alpha-amylase activity. This work suggests that genetic engineering of cotton to express alpha-amylase inhibitors may offer a novel route to A. grandis resistance.

Characterization of bacterial functional groups and microbial activity in microcosms with glyphosate application

Science.gov (United States)

Moyano, Sofia; Bonetto, Mariana; Baigorria, Tomas; Pegoraro, Vanesa; Ortiz, Jimena; Faggioli, Valeria; Conde, Belen; Cazorla, Cristian; Boccolini, Monica

2017-04-01

Glyphosate is a worldwide used herbicide as c. 90% of transgenic crops are tolerant to it. Microbial degradation of glyphosate molecule in soil is considered the most important process that determines its persistence in the environment. However, the impact of this herbicide on target groups of soil biota remains poorly understood. Our objective was to characterize the abundance of bacterial groups and global microbial activity, under controlled conditions with application of increasing doses of glyphosate. A bioassay was carried out in microcosms using an agricultural soil (Typic Argiudoll) with registered history of glyphosate application from National Institute of Agricultural Technology (INTA, EEA Marcos Juarez, Argentina). Glyphosate of commercial formulation (74.7%) was used and the following treatments were evaluated: Soil without glyphosate (control), and Soil with doses equivalent to 1.12 and 11.2 kg ai ha-1. Microbiological parameters were estimated at 3, 7, 14 and 21 days after herbicide application by counting heterotrophic, cellulolytic, nitrogen fixing (N), and nitrifying bacteria; and fluorescein diacetate hydrolysis (FDA), microbial respiration (MR) and microbial biomass (C-BM). The N cycle related bacteria showed greater sensitivity to glyphosate with significant increases in abundance. On the other hand the C cycle parameters were strongly conditioned by the time elapsed since the application of the herbicide, as did the MR. The FDA declined with the highest dose, while the C-BM was not affected. Therefore, we conclude that in the studied experimental conditions glyphosate stimulated bacterial growth (i.e. target abundances) representing a source of N, C and nutrients. On the other hand, enzymatic activity (FDA) decreased when glyphosate was applied in the highest dose, whereas, it had no effect on the MR nor C-BM, which could be attributable to the organic matter content of the soil. However, future research in field conditions is necessary, for

Glyphosate Accumulation and Detrimental Effects on Coffea Arabica

DEFF Research Database (Denmark)

Schrübbers, Lars Christoph

and the MS/MS system provided a limit of quantification (LOQ) below 0.1 mg/kg; the commonly used maximum residue limit (MRL) for glyphosate in plant derived food products. Glyphosate was found in all samples analyzed from different coffee fields, regardless of management practices. AMPA was not detected......Coffee is one of the most popular beverages worldwide and a highly traded commodity. In order to maintain a high yield of the perennial crop, weed competition for resources needs to be reduced. For this purpose herbicides are commonly applied, with glyphosate being one of the most prominent...

Stimulation of bacteria and protists in rhizosphere of glyphosate-treated barley

DEFF Research Database (Denmark)

Imparato, Valentina; Santos, Susana; Johansen, Anders

2016-01-01

and protist communities to foliar application of glyphosate, we measured bacterial and protist abundance, diversity and physiological status, as well as soil organic carbon. Foliar application of glyphosate doubled bacterial abundance of the culturable fraction present in the rhizosphere compared to the other...... treatments with no effect on total abundance. Also the abundance of culturable protists increased as an effect of glyphosate and the bacterial genetic diversity as revealed by 16S rDNA DGGE analysis was affected. Overall, the results indicate that when barley leaves are treated with glyphosate......, the availability of organic carbon in the rhizosphere of the dying roots is altered, which in turn may alter the bacterial and protist communities and their interactions. This can have implications for general soil carbon turnover processes and CO2 release in arable systems....

Effects of glyphosate herbicide on the gastrointestinal microflora of Hawaiian green turtles (Chelonia mydas) Linnaeus.

Science.gov (United States)

Kittle, Ronald P; McDermid, Karla J; Muehlstein, Lisa; Balazs, George H

2018-02-01

In Hawaii, glyphosate-based herbicides frequently sprayed near shorelines may be affecting non-target marine species. Glyphosate inhibits aromatic amino acid biosynthesis (shikimate pathway), and is toxic to beneficial gut bacteria in cattle and chickens. Effects of glyphosate on gut bacteria in marine herbivorous turtles were assessed in vitro. When cultures of mixed bacterial communities from gastrointestinal tracts of freshly euthanized green turtles (Chelonia mydas), were exposed for 24h to six glyphosate concentrations (plus deionized water control), bacterial density was significantly lower at glyphosate concentrations≥2.2×10 -4 gL -1 (absorbance measured at 600nm wavelength). Using a modified Kirby-Bauer disk diffusion assay, the growth of four bacterial isolates (Pantoea, Proteus, Shigella, and Staphylococcus) was significantly inhibited by glyphosate concentrations≥1.76×10 -3 gL -1 . Reduced growth or lower survival of gut bacteria in green turtles exposed to glyphosate could have adverse effects on turtle digestion and overall health. Copyright © 2017 Elsevier Ltd. All rights reserved.

Fate of glyphosate and degradates in cover crop residues and underlying soil: A laboratory study

Energy Technology Data Exchange (ETDEWEB)

Cassigneul, A. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France); INRA, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Benoit, P.; Bergheaud, V.; Dumeny, V.; Etiévant, V. [INRA, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Goubard, Y. [AgroParisTech, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Maylin, A. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France); Justes, E. [INRA, UMR 1248 AGIR Auzeville — BP 52 627, 31 326, Castanet-Tolosan cedex (France); Alletto, L. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France)

2016-03-01

The increasing use of cover crops (CC) may lead to an increase in glyphosate application for their destruction. Sorption and degradation of {sup 14}C-glyphosate on and within 4 decaying CC-amended soils were compared to its fate in a bare soil. {sup 14}C-Glyphosate and its metabolites distribution between mineralized, water-soluble, NH{sub 4}OH-soluble and non-extractable fractions was determined at 5 dates during a 20 °C/84-d period. The presence of CC extends {sup 14}C-glyphosate degradation half-life from 7 to 28 days depending on the CC. {sup 14}C-Glyphosate dissipation occurred mainly through mineralization in soils and through mineralization and bound residue formation in decaying CC. Differences in sorption and degradation levels were attributed to differences in composition and availability to microorganisms. CC- and soil-specific dissipation patterns were established with the help of explicit relationships between extractability and microbial activity. - Highlights: • Glyphosate sorption on cover crop residues increases with their decomposition degree. • Glyphosate degradation and mineralization are lower in mulch than in soil. • Nonextractable residue formation is one of the main dissipation pathways of glyphosate in cover crop mulch.

Fate of glyphosate and degradates in cover crop residues and underlying soil: A laboratory study

International Nuclear Information System (INIS)

Cassigneul, A.; Benoit, P.; Bergheaud, V.; Dumeny, V.; Etiévant, V.; Goubard, Y.; Maylin, A.; Justes, E.; Alletto, L.

2016-01-01

The increasing use of cover crops (CC) may lead to an increase in glyphosate application for their destruction. Sorption and degradation of "1"4C-glyphosate on and within 4 decaying CC-amended soils were compared to its fate in a bare soil. "1"4C-Glyphosate and its metabolites distribution between mineralized, water-soluble, NH_4OH-soluble and non-extractable fractions was determined at 5 dates during a 20 °C/84-d period. The presence of CC extends "1"4C-glyphosate degradation half-life from 7 to 28 days depending on the CC. "1"4C-Glyphosate dissipation occurred mainly through mineralization in soils and through mineralization and bound residue formation in decaying CC. Differences in sorption and degradation levels were attributed to differences in composition and availability to microorganisms. CC- and soil-specific dissipation patterns were established with the help of explicit relationships between extractability and microbial activity. - Highlights: • Glyphosate sorption on cover crop residues increases with their decomposition degree. • Glyphosate degradation and mineralization are lower in mulch than in soil. • Nonextractable residue formation is one of the main dissipation pathways of glyphosate in cover crop mulch.

Non-point source pollution of glyphosate and AMPA in a rural basin from the southeast Pampas, Argentina.

Science.gov (United States)

Okada, Elena; Pérez, Débora; De Gerónimo, Eduardo; Aparicio, Virginia; Massone, Héctor; Costa, José Luis

2018-05-01

We measured the occurrence and seasonal variations of glyphosate and its metabolite, aminomethylphosphonic acid (AMPA), in different environmental compartments within the limits of an agricultural basin. This topic is of high relevance since glyphosate is the most applied pesticide in agricultural systems worldwide. We were able to quantify the seasonal variations of glyphosate that result mainly from endo-drift inputs, that is, from direct spraying either onto genetically modified (GM) crops (i.e., soybean and maize) or onto weeds in no-till practices. We found that both glyphosate and AMPA accumulate in soil, but the metabolite accumulates to a greater extent due to its higher persistence. Knowing that glyphosate and AMPA were present in soils (> 93% of detection for both compounds), we aimed to study the dispersion to other environmental compartments (surface water, stream sediments, and groundwater), in order to establish the degree of non-point source pollution. Also, we assessed the relationship between the water-table depth and glyphosate and AMPA levels in groundwater. All of the studied compartments had variable levels of glyphosate and AMPA. The highest frequency of detections was found in the stream sediments samples (glyphosate 95%, AMPA 100%), followed by surface water (glyphosate 28%, AMPA 50%) and then groundwater (glyphosate 24%, AMPA 33%). Despite glyphosate being considered a molecule with low vertical mobility in soils, we found that its detection in groundwater was strongly associated with the month where glyphosate concentration in soil was the highest. However, we did not find a direct relation between groundwater table depth and glyphosate or AMPA detections. This is the first simultaneous study of glyphosate and AMPA seasonal variations in soil, groundwater, surface water, and sediments within a rural basin.

Glyphosate, other herbicides, and transformation products in Midwestern streams, 2002

Science.gov (United States)

Battaglin, W.A.; Kolpin, D.W.; Scribner, E.A.; Kuivila, K.M.; Sandstrom, M.W.

2005-01-01

The use of glyphosate has increased rapidly, and there is limited understanding of its environmental fate. The objective of this study was to document the occurrence of glyphosate and the transformation product aminomethylphosphonic acid (AMPA) in Midwestern streams and to compare their occurrence with that of more commonly measured herbicides such as acetochlor, atrazine, and metolachlor. Water samples were collected at sites on 51 streams in nine Midwestern states in 2002 during three runoff events: after the application of pre-emergence herbicides, after the application of post-emergence herbicides, and during harvest season. All samples were analyzed for glyphosate and 20 other herbicides using gas chromatography/mass spectrometry or high performance liquid chromatography/mass spectrometry. The frequency of glyphosate and AMPA detection, range of concentrations in runoff samples, and ratios of AMPA to glyphosate concentrations did not vary throughout the growing season as substantially as for other herbicides like atrazine, probably because of different seasonal use patterns. Glyphosate was detected at or above 0.1 μg/1 in 35 percent of pre-emergence, 40 percent of post-emergence, and 31 percent of harvest season samples, with a maximum concentration of 8.7 μg/1. AMPA was detected at or above 0.1 μg/1 in 53 percent of pre-emergence, 83 percent of post-emergence, and 73 percent of harvest season samples, with a maximum concentration of 3.6 μg/1. Glyphosate was not detected at a concentration at or above the U.S. Environmental Protection Agency's maximum contamination level (MCL) of 700 μg/1 in any sample. Atrazine was detected at or above 0.1 μg/1 in 94 percent of pre-emergence, 96 percent of post-emergence, and 57 percent of harvest season samples, with a maximum concentration of 55 μg/1. Atrazine was detected at or above its MCL (3 μg/1) in 57 percent of pre-emergence and 33 percent of post-emergence samples

Resposta de varjão (Parkia multijuga a subdoses de glyphosate Response of varjão (Parkia multijuga seedlings to reduced glyphosate rates

Directory of Open Access Journals (Sweden)

O.M. Yamashita

2006-09-01

Full Text Available O consumo de madeira no Brasil e no mundo apresenta demanda crescente. Em confronto com a pressão ambientalista de manutenção das florestas nativas, há necessidade de se estabelecerem áreas de reflorestamento para suprir o aumento da demanda de madeira, com a utilização de formas de manejo e tratos culturais que permitam o pleno crescimento das essências florestais. Um dos principais problemas do manejo de reflorestamento é a interferência das plantas daninhas após o plantio das mudas no campo, sendo o uso de herbicidas a principal forma de manejo. Este trabalho teve o objetivo de avaliar a eficiência de doses crescentes de glyphosate em mudas de varjão em condições de ambiente protegido. Foram avaliadas as doses de 0, 90, 180, 360 e 720 g ha-1 de glyphosate em plantas com quatro meses de idade, observando a intoxicação das plantas, altura, diâmetro do caule e número de folhas. O varjão, nas condições do experimento, apresentou tolerância e recuperação ao glyphosate até a dose de 360 g ha-1. Doses superiores a esta retardaram o crescimento da planta. O prejuízo causado pela deriva de glyphosate nessas plantas foi diretamente proporcional ao aumento da dose. Os sintomas evoluíram para queda de folhas, comprometendo o crescimento das plantas.Wood consumption has significantly increased in Brazil and worldwide.The environmental pressure to preserve native forest led to the need to establish reforestation areas to meet the increasing wood demand by applying cultural practices and management allowing a total growth of forest trees. One of the main problems in reforestation management is weed competition after seedling planting, with herbicide use being the main form of management. The objective of this work was to evaluate the phytotoxic effect of increasing rates of glyphosate on Varjão seedlings, under greenhouse conditions. Concentrations of 90, 180, 360 and 720 g ha-1 of glyphosate were evaluated in four

Possible effects of glyphosate on Mucorales abundance in the rumen of dairy cows in Germany.

Science.gov (United States)

Schrödl, Wieland; Krüger, Susanne; Konstantinova-Müller, Theodora; Shehata, Awad A; Rulff, Ramon; Krüger, Monika

2014-12-01

Glyphosate (N-phosphonomethyl glycine) is registered as a herbicide for many food and non-food crops, as well as non-crop areas where total vegetation control is desired. Glyphosate influences the soil mycobiota; however, the possible effect of glyphosate residues in animal feed (soybean, corn, etc.) on animal mycobiota is almost unknown. Accordingly, the present study was initiated to investigate the mycological characteristics of dairy cows in relationship to glyphosate concentrations in urine. A total of 258 dairy cows on 14 dairy farms in Germany were examined. Glyphosate was detected in urine using ELISA. The fungal profile was analyzed in rumen fluid samples using conventional microbiological culture techniques and differentiated by MALDI-TOF mass spectrometry. LPS-binding protein (LBP) and antibodies (IgG1, IgG2, IgA, and IgM) against fungi were determined in blood using ELISA. Different populations of Lichtheimia corymbifera, Lichtheimia ramosa, Mucor, and Rhizopus were detected. L. corymbifera and L. ramosa were significantly more abundant in animals containing high glyphosate (>40 ng/ml) concentrations in urine. There were no significant changes in IgG1 and IgG2 antibodies toward isolated fungi that were related to glyphosate concentration in urine; however, IgA antibodies against L. corymbifera and L. ramosa were significantly lower in the higher glyphosate groups. Moreover, a negative correlation between IgM antibodies against L. corymbifera, L. ramosa, and Rhizopus relative to glyphosate concentration in urine was observed. LBP also was significantly decreased in animals with higher concentrations of glyphosate in their urine. In conclusion, glyphosate appears to modulate the fungal community. The reduction of IgM antibodies and LBP indicates an influence on the innate immune system of animals.

Clastogenic Effects of Glyphosate in Bone Marrow Cells of Swiss Albino Mice

International Nuclear Information System (INIS)

Prasad, S.; Srivastava, S.; Singh, M.; Shukla, Y.

2009-01-01

Glyphosate (N-(phosphonomethyl) glycine, C 3 H 8 NO 5 P), a herbicide, used to control unwanted annual and perennial plants all over the world. Nevertheless, occupational and environmental exposure to pesticides can pose a threat to nontarget species including human beings. Therefore, in the present study, genotoxic effects of the herbicide glyphosate were analyzed by measuring chromosomal aberrations (CAs) and micronuclei (MN) in bone marrow cells of Swiss albino mice. A single dose of glyphosate was given intraperitoneally (i.p) to the animals at a concentration of 25 and 50 mg/kg b.wt. Animals of positive control group were injected i.p. benzo(a)pyrene (100 mg/kg b.wt., once only), whereas, animals of control (vehicle) group were injected i.p. dimethyl sulfoxide (0.2 mL). Animals from all the groups were sacrificed at sampling times of 24, 48, and 72 hours and their bone marrow was analyzed for cytogenetic and chromosomal damage. Glyphosate treatment significantly increases CAs and MN induction at both treatments and time compared with the vehicle control (P<.05). The cytotoxic effects of glyphosate were also evident, as observed by significant decrease in mitotic index (MI). The present results indicate that glyphosate is clastogenic and cytotoxic to mouse bone marrow.

Glyphosate Utilization as the Source of Carbon: Isolation and Identification of new Bacteria

Directory of Open Access Journals (Sweden)

M. Mohsen Nourouzi

2011-01-01

Full Text Available Mixed bacteria from oil palm plantation soil (OPS were isolated to investigate their ability to utilize glyphosate as carbon source. Results showed that approximately all of the glyphosate was converted to aminomethyl-phosphonic acid (AMPA (99.5%. It is worthy to note that mixed bacteria were able to degrade only 2% of AMPA to further metabolites. Two bacterial strains i.e. Stenotrophomonas maltophilia and Providencia alcalifaciens were obtained from enrichment culture. Bacterial isolates were cultured individually on glyphosate as a sole carbon source. It was observed that both isolates were able to convert glyphosate to AMPA.

Physiological responses to glyphosate are dependent on Eucalyptus urograndis genotype

Science.gov (United States)

Two experiments were conducted to evaluate the response of Eucalyptus urograndis genotypes (C219 and GG100) to glyphosate in growth chambers. As glyphosate dose increased (18 up to 720 g ae ha-1), CO2 assimilation rate, transpiration rate, and stomatal conductance decreased fastest and strongest in ...

DISPERSION OF GLYPHOSATE IN SOILS UNDERGOING EROSION

Directory of Open Access Journals (Sweden)

Gorana Todorovic Rampazzo

2010-08-01

Full Text Available Different physical, chemical and biological processes influence the behaviour of organic contaminants in soils. A better understanding of the organic pollutant behaviour in soils would improve the environmental protection. One possible way for better attenuation of the risk of pollution in agriculture can be achieved through ta better-specified pesticide management based on the adaptation of the pesticide type and application rates to the specific environmental characteristics of the area of application. Nowadays, one of the actually most applied herbicide world wide is glyphosate. Glyphosate is highly water soluble and traces have been found in surface and groundwater systems. For a better understanding of the natural influence of erosion processes on glyphosate behaviour and dispersion under heavy rain conditions after application in the field, two erosion simulation experiments were conducted on two different locations in Austria with completely different soil types in September 2008. The results of the experiments showed that under normal practical conditions (e.g. no rainfall is expected immediatly after application, the potential adsorption capacity of the Kirchberg soil (Stagnic Cambisol, with about 16.000 ppm Fe-oxides is confirmed compared to the low adsorption Chernosem soil (about 8.000 ppm pedogenic Fe-oxides.  Considering the enormous difference in the run-off amounts between the two sites Pixendorf and Kirchberg soils it can be concluded how important the soil structural conditions and vegetation type and cover are for the risks of erosion and, as a consequence, pollution of neighbouring waters. In the rainfall experiments under comparable simulation conditions, the amount of run-off was about 10 times higher at Kirchberg, owing to its better infiltration rate, than at the Pixendorf site. Moreover, the total loss of glyphosate (NT+CT through run-off at the Kirchberg site was more than double that at Pixendorf, which confirms the

Effects of interactions between Collembola and soil microbial community on the degradation of glyphosate-based herbicide

Science.gov (United States)

Wee, J.; Lee, Y. S.; Son, J.; Kim, Y.; Nam, T. H.; Cho, K.

2017-12-01

Glyphosate is the most widely used herbicide because of its broad spectrum activity and effectiveness, however, little is known about adverse effects on non-target species and their interactions. Therefore, in this study, we investigated the effects of glyphosate on interactions between Collembola and soil microbial community and the effect of Collembola on degradation of glyphosate. The experiment carried out in PS container filled with 30g of soil according to OECD 232 guidelines. Investigating the effects of soil microbial community and Collembola on degradation of glyphosate, we prepared defaunated field soil (only maintaining soil microbial community, sampling in May and September, 2016.) and autoclaved soil with 0, 10, 30 adults of Paronychiurus kimi (Collembola) respectively. Survived adults and hatched juveniles of P. kimi were counted after 28-day exposures in both soils spiked with 100 mg/kg of glyphosate. Glyphosate in soil of 7, 14, 21, 28 days after spiking of glyphosate based herbicide was analyzed by spectrophotometer (Jan et al., 2009). Also soil microbial community structure was investigated using phospholipid fatty acids (PLFAs) composition analysis of soils following the procedures given by the Sherlock Microbial Identification System (MIDI Inc., Newark, DE). Glyphosate (100mg/kg soil) has no effects on reproduction and survival of P. kimi in any soils. Also, glyphosate in soils with Collembola was more rapidly degraded. Rapid increase of soil microbial biomass(PLFAs) was shown in soil with Collembola addition. This result showed that glyphosate affected interactions between Collembola and soil microorganisms, and also soil microbial community affected by Collembola changed degradation of glyphosate.

Utilization of glyphosate as phosphate source: biochemistry and genetics of bacterial carbon-phosphorous lyase

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Zechel, David L; Jochimsen, Bjarne

2014-01-01

After several decades of use of glyphosate, the active ingredient in weed killers such as Roundup, in fields, forests, and gardens, the biochemical pathway of transformation of glyphosate phosphorus to a useful phosphorus source for microorganisms has been disclosed. Glyphosate is a member of a l...

Cancer Incidence among Glyphosate-Exposed Pesticide Applicators in the Agricultural Health Study

OpenAIRE

De Roos, Anneclaire J.; Blair, Aaron; Rusiecki, Jennifer A.; Hoppin, Jane A.; Svec, Megan; Dosemeci, Mustafa; Sandler, Dale P.; Alavanja, Michael C.

2004-01-01

Glyphosate is a broad-spectrum herbicide that is one of the most frequently applied pesticides in the world. Although there has been little consistent evidence of genotoxicity or carcinogenicity from in vitro and animal studies, a few epidemiologic reports have indicated potential health effects of glyphosate. We evaluated associations between glyphosate exposure and cancer incidence in the Agricultural Health Study (AHS), a prospective cohort study of 57,311 licensed pesticide applicators in...

Epidemiologic studies of glyphosate and non-cancer health outcomes: a review.

Science.gov (United States)

Mink, Pamela J; Mandel, Jack S; Lundin, Jessica I; Sceurman, Bonnielin K

2011-11-01

The United States (US) Environmental Protection Agency (EPA) and other regulatory agencies around the world have registered glyphosate as a broad-spectrum herbicide for use on multiple food and non-food use crops. To examine potential health risks in humans, we searched and reviewed the literature to evaluate whether exposure to glyphosate is associated causally with non-cancer health risks in humans. We also reviewed biomonitoring studies of glyphosate to allow for a more comprehensive discussion of issues related to exposure assessment and misclassification. Cohort, case-control and cross-sectional studies on glyphosate and non-cancer outcomes evaluated a variety of endpoints, including non-cancer respiratory conditions, diabetes, myocardial infarction, reproductive and developmental outcomes, rheumatoid arthritis, thyroid disease, and Parkinson's disease. Our review found no evidence of a consistent pattern of positive associations indicating a causal relationship between any disease and exposure to glyphosate. Most reported associations were weak and not significantly different from 1.0. Because accurate exposure measurement is crucial for valid results, it is recommended that pesticide-specific exposure algorithms be developed and validated. Copyright © 2011 Elsevier Inc. All rights reserved.

The need for independent research on the health effects of glyphosate-based herbicides.

Science.gov (United States)

Landrigan, Philip J; Belpoggi, Fiorella

2018-05-29

Glyphosate, formulated as Roundup, is the world's most widely used herbicide. Glyphosate is used extensively on genetically modified (GM) food crops designed to tolerate the herbicide, and global use is increasing rapidly. Two recent reviews of glyphosate's health hazards report conflicting results. An independent review by the International Agency for Research on Cancer (IARC) found that glyphosate is a "probable human carcinogen". A review by the European Food Safety Agency (EFSA) found no evidence of carcinogenic hazard. These differing findings have produced regulatory uncertainty. Reflecting this regulatory uncertainty, the European Commission on November 27 2017, extended authorization for glyphosate for another 5 years, while the European Parliament opposed this decision and issued a call that pesticide approvals be based on peer-reviewed studies by independent scientists rather than on the current system that relies on proprietary industry studies. The Ramazzini Institute has initiated a pilot study of glyphosate's health hazards that will be followed by an integrated experimental research project. This evaluation will be independent of industry support and entirely sponsored by worldwide crowdfunding. The aim of the Ramazzini Institute project is to explore comprehensively the effects of exposures to glyphosate-based herbicides at current real-world levels on several toxicological endpoints, including carcinogenicity, long-term toxicity, neurotoxicity, endocrine disrupting effects, prenatal developmental toxicity, the microbiome and multi-generational effects.

Glyphosate (Ab)sorption by Shoots and Rhizomes of Native versus Hybrid Cattail (Typha).

Science.gov (United States)

Zheng, Tianye; Sutton, Nora B; de Jager, Pim; Grosshans, Richard; Munira, Sirajum; Farenhorst, Annemieke

2017-11-01

Wetlands in the Prairie Pothole Region of North America are integrated with farmland and contain mixtures of herbicide contaminants. Passive nonfacilitated diffusion is how most herbicides can move across plant membranes, making this perhaps an important process by which herbicide contaminants are absorbed by wetland vegetation. Prairie wetlands are dominated by native cattail (Typha latifolia) and hybrid cattail (Typha x glauca). The objective of this batch equilibrium study was to compare glyphosate absorption by the shoots and rhizomes of native versus hybrid cattails. Although it has been previously reported for some pesticides that passive diffusion is greater for rhizome than shoot components, this is the first study to demonstrate that the absorption capacity of rhizomes is species dependent, with the glyphosate absorption being significantly greater for rhizomes than shoots in case of native cattails, but with no significant differences in glyphosate absorption between rhizomes and shoots in case of hybrid cattails. Most importantly, glyphosate absorption by native rhizomes far exceeded that of the absorption occurring for hybrid rhizomes, native shoots and hybrid shoots. Glyphosate has long been used to manage invasive hybrid cattails in wetlands in North America, but hybrid cattail expansions continue to occur. Since our results showed limited glyphosate absorption by hybrid shoots and rhizomes, this lack of sorption may partially explain the poorer ability of glyphosate to control hybrid cattails in wetlands.

Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean

International Nuclear Information System (INIS)

Santos, J.B.; Ferreira, E.A.; Silva, A.A.; Oliveira, J.A.; Fialho, C.M.T.

2007-01-01

This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

Elevated Urinary Glyphosate and Clostridia Metabolites With Altered Dopamine Metabolism in Triplets With Autistic Spectrum Disorder or Suspected Seizure Disorder: A Case Study.

Science.gov (United States)

Shaw, William

2017-02-01

Autism is a neurodevelopmental disorder for which a number of genetic, environmental, and nutritional causes have been proposed. Glyphosate is used widely as a crop desiccant and as an herbicide in fields of genetically modified foods that are glyphosate resistant. Several researchers have proposed that it may be a cause of autism, based on epidemiological data that correlates increased usage of glyphosate with an increased autism rate. The current study was intended to determine if excessive glyphosate was present in the triplets and their parents and to evaluate biochemical findings for the family to determine the potential effects of its presence. The author performed a case study with the cooperation of the parents and the attending physician. The study took place at The Great Plains Laboratory, Inc (Lenexa, KS, USA). Participants were triplets, 2 male children and 1 female, and their parents. The 2 male children had autism, whereas the female had a possible seizure disorder. All 3 had elevated urinary glyphosate, and all of the triplets and their mother had elevated values of succinic acid or tiglylglycine, which are indicators of mitochondrial dysfunction. The participants received a diet of organic food only. The study performed organic acids, glyphosate, toxic chemicals and tiglylglycine, and creatinine testing of the participants' urine. The 2 male triplets with autism had abnormalities on at least 1 organic acids test, including elevated phenolic compounds such as 4-cresol, 3-[3-hydroxyphenyl]-3-hydroxypropionic acid and 4-hydroxyphenylacetic acid, which have been previously associated with Clostridia bacteria and autism. The female, who was suspected of having a seizure disorder but not autism, did not have elevated phenolic compounds but did have a significantly elevated value of the metabolite tiglylglycine, a marker for mitochondrial dysfunction and/or mutations. One male triplet was retested postintervention and was found to have a markedly lower

Integrated Palmer Amaranth Management in Glufosinate-Resistant Cotton: I. Soil-Inversion, High-Residue Cover Crops and Herbicide Regimes

Directory of Open Access Journals (Sweden)

Michael G. Patterson

2012-11-01

Full Text Available A three year field experiment was conducted to evaluate the role of soil-inversion, cover crops and herbicide regimes for Palmer amaranth between-row (BR and within-row (WR management in glufosinate-resistant cotton. The main plots were two soil-inversion treatments: fall inversion tillage (IT and non-inversion tillage (NIT. The subplots were three cover crop treatments: crimson clover, cereal rye and winter fallow; and sub subplots were four herbicide regimes: preemergence (PRE alone, postemergence (POST alone, PRE + POST and a no herbicide check (None. The PRE herbicide regime consisted of a single application of pendimethalin at 0.84 kg ae ha−1 plus fomesafen at 0.28 kg ai ha−1. The POST herbicide regime consisted of a single application of glufosinate at 0.60 kg ai ha−1 plus S-metolachlor at 0.54 kg ai ha−1 and the PRE + POST regime combined the prior two components. At 2 weeks after planting (WAP cotton, Palmer amaranth densities, both BR and WR, were reduced ≥90% following all cover crop treatments in the IT. In the NIT, crimson clover reduced Palmer amaranth densities >65% and 50% compared to winter fallow and cereal rye covers, respectively. At 6 WAP, the PRE and PRE + POST herbicide regimes in both IT and NIT reduced BR and WR Palmer amaranth densities >96% over the three years. Additionally, the BR density was reduced ≥59% in no-herbicide (None following either cereal rye or crimson clover when compared to no-herbicide in the winter fallow. In IT, PRE, POST and PRE + POST herbicide regimes controlled Palmer amaranth >95% 6 WAP. In NIT, Palmer amaranth was controlled ≥79% in PRE and ≥95% in PRE + POST herbicide regimes over three years. POST herbicide regime following NIT was not very consistent. Averaged across three years, Palmer amaranth controlled ≥94% in PRE and PRE + POST herbicide regimes regardless of cover crop. Herbicide regime effect on cotton yield was highly significant; the maximum cotton yield was

Structural coloration of chitosan-cationized cotton fabric using photonic crystals

OpenAIRE

Yavuz, Gonul; Zille, Andrea; Seventekin, N.; Souto, A. Pedro

2017-01-01

Abstract. In this work, poly (styrene-methyl methacrylate-acrylic acid) P(St-MMA-AA) composite nanospheres were deposited onto chitosan-cationized woven cotton fabrics followed by a second layer of chitosan. The deposited photonic crystals (PCs) on the fabrics were evaluated for coating efficiency and resistance, chemical analysis and color variation by optical and SEM microscopy, ATR-FTIR, diffuse reflectance spectroscopy and washing fastness. Chitosan deposition on cotton fab...

Synthesis of Cotton from Tossa Jute Fiber and Comparison with Original Cotton

Directory of Open Access Journals (Sweden)

Md. Mizanur Rahman

2015-01-01

Full Text Available Cotton fibers were synthesized from tossa jute and characteristics were compared with original cotton by using FTIR and TGA. The FTIR results indicated that the peak intensity of OH group from jute cotton fibers occurred at 3336 cm−1 whereas the peak intensity of original cotton fibers occurred at 3338 cm−1. This indicated that the synthesized cotton fiber properties were very similar to the original cotton fibers. The TGA result showed that maximum rate of mass loss, the onset of decomposition, end of decomposition, and activation energy of synthesized cotton were higher than original cotton. The activation energy of jute cotton fibers was higher than the original cotton fibers.

Glyphosate contaminated soil remediation by atmospheric pressure dielectric barrier discharge plasma and its residual toxicity evaluation.

Science.gov (United States)

Wang, Tiecheng; Ren, Jingyu; Qu, Guangzhou; Liang, Dongli; Hu, Shibin

2016-12-15

Glyphosate was one of the most widely used herbicides in the world. Remediation of glyphosate-contaminated soil was conducted using atmospheric pressure dielectric barrier discharge (DBD) plasma. The feasibility of glyphosate degradation in soil was explored, and the soil leachate toxicity after remediation was assessed via a seed germination test. The experimental results showed that approximately 93.9% of glyphosate was degraded within 45min of DBD plasma treatment with an energy yield of 0.47gkWh -1 , and the degradation process fitted the first-order kinetic model. Increasing the discharge voltage and decreasing the organic matter content of the soil were both found to facilitate glyphosate degradation. There existed appropriate soil moisture to realize high glyphosate degradation efficiency. Glyphosate mineralization was confirmed by changes of total organic carbon (TOC), chemical oxygen demand (COD), PO 4 3- and NO 3 - . The degradation intermediates including glycine, aminomethylphosphonic acid, acetic acid, formic acid, PO 4 3- and NO 3 - , CO 2 and CO were observed. A possible pathway for glyphosate degradation in the soil using this system was proposed. Based on the soil leachate toxicity test using wheat seed germination, the soil did not exhibit any hazardous effects following high-efficiency glyphosate degradation. Copyright © 2016 Elsevier B.V. All rights reserved.

Effect of foliar treatments on distribution of 14C-glyphosate in Convolvulus arvensis L

International Nuclear Information System (INIS)

Lauridson, T.C.

1986-01-01

Field bindweed is a perennial weed which produces shoots from buds on its roots. Herbicides, such as glyphosate [N-(phosphonomethyl)glycine] used for control of field bindweed usually do not kill all shoot buds on the roots, thus field bindweed often reinfests areas within 3 to 6 weeks of treatment. This dissertation deals with the development of a technique to change glyphosate distribution in field bindweed roots and could result in less shoot regrowth after glyphosate application. In field studies eight plant growth regulators were applied in September, 3 days before 2.24 kg/ha of 2.4-D[(2,4-dichlorophenoxy) acetic acid] or 1.68 kg/ha of glyphosate. Eight months later, regrowth of shoots was least where glyphosate was applied at 0.028 kg/ha as a pretreatment, followed by a standard rate of 1.68 kg/ha. In subsequent greenhouse studies, typical patterns of shoot growth and 14 C-glyphosate distribution in isolated root sections taken from 15-week-old intact plants were determined. In subsequent growth chamber studies, plants were decapitated to observe the effect of shoot apical dominance on 14 C-glyphosate translocation. After 14 C-glyphosate was applied, intact plants had about twice as much 14 C in distal root sections as in proximal or middle root sections. Decapitated plants had more 14 C in proximal and middle root sections than in distal sections, and about twice as much 14 C was translocated to roots of decapitated plants than intact plants. Eight concentrations of 2,4,-D or glyphosate from 1 to 5000 ppm were applied in logarithmic series to 6-week old plants

Características da epiderme foliar de eucalipto e seu envolvimento com a tolerância ao glyphosate Characteristics of eucalypt leaf epidermis and its role in glyphosate tolerance

Directory of Open Access Journals (Sweden)

L.D. Tuffi Santos

2006-09-01

Full Text Available Em áreas de reflorestamento, a deriva do glyphosate causa injúrias nas plantas de eucalipto. Trabalhos preliminares de pesquisa e observações de campo apontam para uma tolerância diferencial ao glyphosate entre os genótipos cultivados. Nesse contexto, objetivou-se estudar as estruturas anatômicas da epiderme foliar de cinco espécies de eucalipto, correlacionando com a tolerância ao glyphosate em deriva simulada. Utilizou-se o esquema fatorial, sendo cinco espécies (Eucalyptus urophylla, E. grandis, E. pellita, E. resinifera e E. saligna e cinco subdoses (0; 43,2; 86,4; 172,8 e 345,6 g e.a. ha-1 de glyphosate, simulando uma deriva. Imediatamente antes da aplicação do herbicida, coletaram-se folhas, totalmente expandidas, para análise anatômica da superfície epidérmica segundo metodologia de dissociação. Entre as espécies estudadas, E. resinifera mostrou-se mais tolerante à deriva de glyphosate, apresentando os menores valores de porcentagem de intoxicação aos 45 dias após aplicação, não sendo encontrada diferença entre as demais espécies. As cinco espécies apresentam folhas glabras, anfiestomáticas, com estômatos do tipo anomocítico e cutícula proeminente. Apesar de presentes em ambas as faces, os estômatos são raros na face adaxial, apresentando baixo índice e densidade estomática. Os maiores valores para índice estomático foram observados em E. resinifera, enquanto E. saligna apresentou a maior densidade estomática. Cavidades subepidérmicas evidenciadas na superfície pelas células de cobertura estão presentes nas cinco espécies, com maior densidade em E. pellita. Houve alta correlação entre a porcentagem de intoxicação por glyphosate e o número de células epidérmicas da superfície adaxial, indicando envolvimento desta característica com a tolerância diferencial ao herbicida. Estudos sobre absorção, translocação e metabolismo do glyphosate em eucalipto devem ser realizados para elucidar

Evidence that agricultural use of pesticides selects pyrethroid resistance within Anopheles gambiae s.l. populations from cotton growing areas in Burkina Faso, West Africa.

Directory of Open Access Journals (Sweden)

Aristide Sawdetuo Hien

Full Text Available Many studies have shown the role of agriculture in the selection and spread of resistance of Anopheles gambiae s.l. to insecticides. However, no study has directly demonstrated the presence of insecticides in breeding sources as a source of selection for this resistance. It is in this context that we investigated the presence of pesticide residues in breeding habitats and their formal involvement in vector resistance to insecticides in areas of West Africa with intensive farming. This study was carried out from June to November 2013 in Dano, southwest Burkina Faso in areas of conventional (CC and biological cotton (BC growing. Water and sediment samples collected from breeding sites located near BC and CC fields were submitted for chromatographic analysis to research and titrate the residual insecticide content found there. Larvae were also collected in these breeding sites and used in toxicity tests to compare their mortality to those of the susceptible strain, Anopheles gambiae Kisumu. All tested mosquitoes (living and dead were analyzed by PCR for species identification and characterization of resistance genes. The toxicity analysis of water from breeding sites showed significantly lower mortality rates in breeding site water from biological cotton (WBC growing sites compared to that from conventional cotton (WCC sites respective to both An. gambiae Kisumu (WBC: 80.75% vs WCC: 92.75% and a wild-type strain (49.75% vs 66.5%. The allele frequencies L1014F, L1014S kdr, and G116S ace -1R mutations conferring resistance, respectively, to pyrethroids and carbamates / organophosphates were 0.95, 0.4 and 0.12. Deltamethrin and lambda-cyhalothrin were identified in the water samples taken in October/November from mosquitoes breeding in the CC growing area. The concentrations obtained were respectively 0.0147ug/L and 1.49 ug/L to deltamethrin and lambdacyhalothrin. Our results provided evidence by direct analysis (biological and chromatographic tests

Effects of glyphosate-based herbicides on survival, development and growth of invasive snail (Pomacea canaliculata).

Science.gov (United States)

Xu, Yanggui; Li, Adela Jing; Li, Kaibin; Qin, Junhao; Li, Huashou

2017-12-01

This study tests the hypotheses that whether environmental relevance of glyphosate would help control spread of the invasive snail Pomacea canaliculata, or benefit its population growth worldwide. Our results showed that glyphosate induced acute toxicity to the snail only at high concentrations (96h LC50 at 175mg/L) unlikely to occur in the environment. Long-term exposures to glyphosate at sublethal levels (20 and 120mg/L) caused inhibition of food intake, limitation of growth performance and alterations in metabolic profiles of the snail. It is worth noting that glyphosate at 2mg/L benefited growth performance in P. canaliculata. Chronic exposures of glyphosate significantly enhanced overall metabolic rate and altered catabolism from protein to carbohydrate/lipid mode. Cellular responses in enzyme activities showed that the exposed snails could increase tolerance by their defense system against glyphosate-induced oxidative stress, and adjustment of metabolism to mitigate energy crisis. Our study displayed that sublethal concentrations of glyphosate might be helpful in control of the invasive species by food intake, growth performance and metabolic interruption; whether environmental relevance of glyphosate (≤2mg/L) benefits population growth of P. canaliculata is still inconclusive, which requires further field study. Copyright © 2017 Elsevier B.V. All rights reserved.

Performance of some transgenic cotton cultivars against insect pest complex, virus incidence and yield

International Nuclear Information System (INIS)

Babar, T.K.; Karar, H.; Hasnain, M.; Saleem, M.; Ali, A.

2013-01-01

Five cultivars of cotton i.e., IR4-NIBGE, IR5-NIBGE Bt-121, Sitara-10M and Sitara-11M were screened for resistance against insect pest complex and Cotton Leaf Curl Virus (CLCuV) incidence in the research area of Cotton Research Station, Multan. The result depicted that the most resistant variety against jassids was IR4-NIBGE and Sitara-11M whereas IR4-NIBGE showed the maximum resistance against whitefly infestation. The least susceptible variety to the infestation of thrips was Sitara-10M. The most susceptible variety to the prevalence of Red Cotton Bug (RCB) was IR4-NIBGE. The genotype Bt-121 showed the attack of spotted bollworm. The high population of Dusky Cotton Bug (DCB) was observed on Bt-121 throughout the season. The incidence of virus percentage increased with the passage of time; however, the variety IR5-NIBGE exhibited maximum level of tolerance. Variety Bt-121 gave the maximum yield i.e., 1852 kg per acre followed by IR5-NIBGE, Sitara-11M, Sitara-10M 1584, 1503, 1466 kg per acre respectively. Our results suggest that IR4-NIBGE and Sitara -11M are comparatively tolerant to jassids and whitefly which are the yield losing pest. So IR4-NIBGE and Sitara -11M varieties can be included in IPM programme for the management of these voracious pests. (author)

The effect of glyphosate application on soil microbial activities in ...

African Journals Online (AJOL)

In this study, glyphosate effects as N, P and C nutrient sources on microbial population and the effect of different concentration of it on dehydrogenease activity and soil respiration were investigated. The results show that in a soil with a long historical use of glyphosate (soil 1), the hetrotrophic bacterial population was ...

Interactions of calcium ions with weakly acidic active ingredients slow cuticular penetration: a case study with glyphosate.

Science.gov (United States)

Schönherr, Jörg; Schreiber, Lukas

2004-10-20

Potassium and calcium salts of glyphosate were obtained by titrating glyphosate acid with the respective bases to pH 4.0, and rates of penetration of these salts across isolated astomatous cuticular membranes (CMs) were measured at 20 degrees C and 70, 80, 90, and 100% humidity. K-glyphosate exhibited first-order penetration kinetics, and rate constants (k) increased with increasing humidity. Ca-glyphosate penetrated only when the humidity above the salt residue was 100%. At 90% humidity and below, Ca-glyphosate formed a solid residue on the CMs and penetration was not measurable. With Ca-glyphosate, the k value at 100% humidity decreased with time and the initial rates were lower than for K-glyphosate by a factor of 3.68. After equimolar concentrations of ammonium oxalate were added to Ca-glyphosate, high penetration rates close to those measured with K-glyphosate were measured at all humidities. Adding ammonium sulfate or potassium carbonate also increased rates between 70 and 100% humidity, but they were not as high as with ammonium oxalate. The data indicate that at pH 4.0 one Ca2+ ion is bound to two glyphosate anions. This salt has its deliquescence point near 100% humidity. Therefore, it is a solid at lower humidity and does not penetrate. Its molecular weight is 1.82 times larger than that of K-glyphosate, and this greatly slows down rates of penetration, even at 100% humidity. The additives tested have low solubility products and form insoluble precipitates with Ca2+ ions, but only ammonium oxalate binds Ca2+ quantitatively. The resulting ammonium salt of glyphosate penetrates at 70-100% humidity and at rates comparable to K-glyphosate. The results contribute to a better understanding of the hard water antagonism observed with glyphosate. It is argued that other pesticides and hormones with carboxyl functions are likely to respond to Ca2+ ions in a similar fashion. In all of these cases, ammonium oxalate is expected to overcome hard water antagonism

Controle de plantas daninhas na cultura de soja resistente ao glyphosate

Directory of Open Access Journals (Sweden)

Núbia Maria Correia

2010-01-01

Full Text Available O objetivo da pesquisa foi avaliar o controle de plantas daninhas em área cultivada com soja resistente ao herbicida glyphosate, sem a utilização de práticas complementares de manejo de plantas daninhas. Foram desenvolvidos experimentos, em condições de campo, nos anos agrícolas 2005/2006 e 2006/2007 em Jaboticabal (SP. Foram avaliadas duas cultivares de soja resistentes ao glyphosate (CD 214 RR e M-SOY 8008 RR, oito tratamentos de herbicidas (glyphosate, em aplicação única, nas doses de 0,48; 0,72; 0,96 e 1,20 kg ha-1 de equivalente ácido, associadas ou não a aplicação sequencial na dose de 0,48 kg ha-1, além de duas testemunhas, uma capinada e outra mantida infestada. As cultivares de soja influenciaram na infestação das espécies de plantas daninhas na área. Sem a aplicação de glyphosate, houve o predomínio de X. strumarium na área, desfavorecendo a ocorrência de outras espécies. Quando utilizado glyphosate, independentemente da dose, a infestação contabilizada aos 35 e 40 dias após a primeira aplicação, no primeiro e segundo ano, respectivamente, foi baixa. O controle de plantas daninhas na cultura da soja transgênica é diretamente influenciado pela dose de glyphosate, havendo controle satisfatório com a aplicação única de 0,96 kg ha-1 ou a sequencial de 0,48 + 0,48 kg ha-1 de glyphosate. Em situação de menor infestação (2006/2007, a aplicação única de 0,48 kg ha-1 de glyphosate é suficiente para o controle das plantas daninhas. As cultivares de soja transgênica CD 214 RR e M-SOY 8008 RR influenciam diferencialmente a dinâmica das espécies de plantas daninhas, sendo o controle químico mais efetivo na situação de cultivo de M-SOY 8008 RR, em que houve menor diversidade e desenvolvimento das plantas daninhas.

Assessment of the levels of N- (Phosphonomethyl) glycine glyphosate in selected glyphosate-based herbicides on the Ghanaian market

International Nuclear Information System (INIS)

Iddrisu, Adisatu

2016-07-01

Sixty one (61) samples of Glyphosate based herbicides were collected from the central commercial hub of Kumasi (Kejetia) and ware houses of importers in Ashanti and Greater Accra regions of Ghana and analyzed using high performance liquid chromatography (HPLC). Information about the efficacy of the numerous Glyphosate herbicides on the market was also collected by way of questionnaire. Results of the analysis indicated that only ten (16.4 %) out of the sixty one samples met the Environmental Protection Agency’s requirement of ±5 % of the stated active ingredient concentration and 51 samples representing 83.6 % were all out of the acceptable range. Active ingredient was either understated or overstated. About 21.6 % of the samples that failed to meet requirements were overstated and 78.4 % were understated. Apart from a few of the samples that had concentrations higher than stated label claims with 69 g/L (19.2 %) highest, most samples were generally lower than stated label claims. Some (G09, G18 and G44) samples contained virtually no active ingredient with shortfalls as high as 98.6%. Some of these shortfalls explained findings from the field investigations where some respondents complained of Glyphosate not being efficacious. Farmers may follow the application and safety instructions but this only holds true as long as the herbicides provide efficient control of weed. This can only be achieved with products of consistently high quality. This study also discovered that, there was no possibility of adulteration of the herbicide along the value chain as results for products picked from ware houses of importers did not differ much from those picked from the open market. Results from the other method employed in Glyphosate determination was UV/VIV spectroscopy, this method is simpler and faster and readily available in most laboratories in Ghana. Results from UV/VIS were comparable to that of the HPLC with generally lower values for UV/VIS readings. It is therefore

Herbicide resistance and biodiversity: agronomic and environmental aspects of genetically modified herbicide-resistant plants.

Science.gov (United States)

Schütte, Gesine; Eckerstorfer, Michael; Rastelli, Valentina; Reichenbecher, Wolfram; Restrepo-Vassalli, Sara; Ruohonen-Lehto, Marja; Saucy, Anne-Gabrielle Wuest; Mertens, Martha

2017-01-01

Farmland biodiversity is an important characteristic when assessing sustainability of agricultural practices and is of major international concern. Scientific data indicate that agricultural intensification and pesticide use are among the main drivers of biodiversity loss. The analysed data and experiences do not support statements that herbicide-resistant crops provide consistently better yields than conventional crops or reduce herbicide amounts. They rather show that the adoption of herbicide-resistant crops impacts agronomy, agricultural practice, and weed management and contributes to biodiversity loss in several ways: (i) many studies show that glyphosate-based herbicides, which were commonly regarded as less harmful, are toxic to a range of aquatic organisms and adversely affect the soil and intestinal microflora and plant disease resistance; the increased use of 2,4-D or dicamba, linked to new herbicide-resistant crops, causes special concerns. (ii) The adoption of herbicide-resistant crops has reduced crop rotation and favoured weed management that is solely based on the use of herbicides. (iii) Continuous herbicide resistance cropping and the intensive use of glyphosate over the last 20 years have led to the appearance of at least 34 glyphosate-resistant weed species worldwide. Although recommended for many years, farmers did not counter resistance development in weeds by integrated weed management, but continued to rely on herbicides as sole measure. Despite occurrence of widespread resistance in weeds to other herbicides, industry rather develops transgenic crops with additional herbicide resistance genes. (iv) Agricultural management based on broad-spectrum herbicides as in herbicide-resistant crops further decreases diversity and abundance of wild plants and impacts arthropod fauna and other farmland animals. Taken together, adverse impacts of herbicide-resistant crops on biodiversity, when widely adopted, should be expected and are indeed very hard

A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

Directory of Open Access Journals (Sweden)

Gaoyi Cao

Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

The rise of glyphosate and new opportunities for biosentinel early-warning studies.

Science.gov (United States)

Kissane, Zoe; Shephard, Jill M

2017-12-01

Glyphosate has become the most commonly used herbicide worldwide and is reputedly environmentally benign, nontoxic, and safe for use near wildlife and humans. However, studies indicate its toxicity is underestimated and its persistence in the environment is greater than once thought. Its actions as a neurotoxin and endocrine disruptor indicate its potential to act in similar ways to persistent organic pollutants such as the organochlorines dichlorodiphenyltrichloroethane (DDT) and dioxin. Exposure to glyphosate and glyphosate-based herbicides for both wildlife and people is likely to be chronic and at sublethal levels, with multiple and ongoing exposure events occurring in urban and agricultural landscapes. Despite this, there has been little research on the impact of glyphosate on wildlife populations, and existing studies appear in the agricultural, toxicology, and water-chemistry literature that may have limited visibility among wildlife biologists. These studies clearly demonstrate a link between chronic exposure and neurotoxicity, endocrine disruption, cell damage, and immune suppression. There is a strong case for the recognition of glyphosate as an emerging organic contaminant and substantial potential exists for collaborative research among ecologists, toxicologists, and chemists to quantify the impact of glyphosate on wildlife and to evaluate the role of biosentinel species in a preemptive move to mitigate downstream impacts on people. There is scope to develop a decision framework to aid the choice of species to biomonitor and analysis methods based on the target contaminant, spatial and temporal extent of contamination, and perceived risk. Birds in particular offer considerable potential in this role because they span agricultural and urban environments, coastal, inland, and wetland ecosystems where glyphosate residues are known to be present. © 2017 Society for Conservation Biology.

Volatile Organic Compounds Induced by Herbivory of the Soybean Looper Chrysodeixis includens in Transgenic Glyphosate-Resistant Soybean and the Behavioral Effect on the Parasitoid, Meteorus rubens.

Science.gov (United States)

Strapasson, Priscila; Pinto-Zevallos, Delia M; Da Silva Gomes, Sandra M; Zarbin, Paulo H G

2016-08-01

Transgenic soybean plants (RR) engineered to express resistance to glyphosate harbor a variant of the enzyme EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) involved in the shikimic acid pathway, the biosynthetic route of three aromatic amino acids: phenylalanine, tyrosine, and tryptophan. The insertion of the variant enzyme CP4 EPSPS confers resistance to glyphosate. During the process of genetic engineering, unintended secondary effects are likely to occur. In the present study, we quantified volatile organic compounds (VOCs) emitted constitutively or induced in response to herbivory by the soybean looper Chrysodeixis includens in transgenic soybean and its isogenic (untransformed) line. Since herbivore-induced plant volatiles (HIPVs) are known to play a role in the recruitment of natural enemies, we assessed whether changes in VOC profiles alter the foraging behavior of the generalist endoparasitic larval parasitoid, Meteorus rubens in the transgenic line. Additionally, we assessed whether there was a difference in plant quality by measuring the weight gain of the soybean looper. In response to herbivory, several VOCs were induced in both the conventional and the transgenic line; however, larger quantities of a few compounds were emitted by transgenic plants. Meteorus rubens females were able to discriminate between the odors of undamaged and C. includens-damaged plants in both lines, but preferred the odors emitted by herbivore-damaged transgenic plants over those emitted by herbivore-damaged conventional soybean plants. No differences were observed in the weight gain of the soybean looper. Our results suggest that VOC-mediated tritrophic interactions in this model system are not negatively affected. However, as the preference of the wasps shifted towards damaged transgenic plants, the results also suggest that genetic modification affects that tritrophic interactions in multiple ways in this model system.

Differential effects of glyphosate and aminomethylphosphonic acid (AMPA) on photosynthesis and chlorophyll metabolism in willow plants.

Science.gov (United States)

Gomes, Marcelo Pedrosa; Le Manac'h, Sarah Gingras; Maccario, Sophie; Labrecque, Michel; Lucotte, Marc; Juneau, Philippe

2016-06-01

We used a willow species (Salix miyabeana cultivar SX64) to examine the differential secondary-effects of glyphosate and aminomethylphosphonic acid (AMPA), the principal glyphosate by-product, on chlorophyll metabolism and photosynthesis. Willow plants were treated with different concentrations of glyphosate (equivalent to 0, 1.4, 2.1 and 2.8kgha(-1)) and AMPA (equivalent to 0, 0.28, 1.4 and 2.8kgha(-1)) and evaluations of pigment contents, chlorophyll fluorescence, and oxidative stress markers (hydrogen peroxide content and antioxidant enzyme activities) in leaves were performed after 12h of exposure. We observed that AMPA and glyphosate trigger different mechanisms leading to decreases in chlorophyll content and photosynthesis rates in willow plants. Both chemicals induced ROS accumulation in willow leaves although only glyphosate-induced oxidative damage through lipid peroxidation. By disturbing chlorophyll biosynthesis, AMPA induced decreases in chlorophyll contents, with consequent effects on photosynthesis. With glyphosate, ROS increases were higher than the ROS-sensitive threshold, provoking chlorophyll degradation (as seen by pheophytin accumulation) and invariable decreases in photosynthesis. Peroxide accumulation in both AMPA and glyphosate-treated plants was due to the inhibition of antioxidant enzyme activities. The different effects of glyphosate on chlorophyll contents and photosynthesis as described in the literature may be due to various glyphosate:AMPA ratios in those plants. Copyright © 2015 Elsevier Inc. All rights reserved.

Analysis of glyphosate residues in cereals using liquid chromatography-mass spectrometry (LC-MS/MS)

DEFF Research Database (Denmark)

Granby, Kit; Johannesen, S.; Gabrielsen, Martin Vahl

2003-01-01

A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean-up) in ser......A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean...... monitored m/z 168--> 150 (glyphosate) and 170-->152 (internal standard 2- 13 (CN)-N-15-glyphosate) for quantification. The mean recovery was 85% ( n =32) at spiking levels from 0.03 to 0.33 mg kg(-1) . From 1998 to 2001, from the analysis of about 50 samples per annum, a reduction in the glyphosate residues...... was observed owing to a Danish trade decision not to use grain with glyphosate residues for milling or bread production....

A point mutation (L1015F) of the voltage-sensitive sodium channel gene associated with lambda-cyhalothrin resistance in Apolygus lucorum (Meyer-Dür) population from the transgenic Bt cotton field of China.

Science.gov (United States)

Zhen, Congai; Gao, Xiwu

2016-02-01

In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.

Current status of genetic engineering in cotton (Gossypium hirsutum L): an assessment.

Science.gov (United States)

Chakravarthy, Vajhala S K; Reddy, Tummala Papi; Reddy, Vudem Dashavantha; Rao, Khareedu Venkateswara

2014-06-01

Cotton is considered as the foremost commercially important fiber crop and is deemed as the backbone of the textile industry. The productivity of cotton crop, worldwide, is severely hampered by the occurrence of pests, weeds, pathogens apart from various environmental factors. Several beneficial agronomic traits, viz., early maturity, improved fiber quality, heat tolerance, etc. have been successfully incorporated into cotton varieties employing conventional hybridization and mutation breeding. Crop losses, due to biotic factors, are substantial and may be reduced through certain crop protection strategies. In recent years, pioneering success has been achieved through the adoption of modern biotechnological approaches. Genetically engineered cotton varieties, expressing Bacillus thuringiensis cry genes, proved to be highly successful in controlling the bollworm complex. Various other candidate genes responsible for resistance to insect pests and pathogens, tolerance to major abiotic stress factors such as temperature, drought and salinity, have been introduced into cotton via genetic engineering methods to enhance the agronomic performance of cotton cultivars. Furthermore, genes for improving the seed oil quality and fiber characteristics have been identified and introduced into cotton cultivars. This review provides a brief overview of the various advancements made in cotton through genetic engineering approaches.

GLYPHOSATE REMOVAL FROM DRINKING WATER

Science.gov (United States)

Activated-carbon, oxidation, conventional-treatment, filtration, and membrane studies are conducted to determine which process is best suited to remove the herbicide glyphosate from potable water. Both bench-scale and pilot-scale studies are completed. Computer models are used ...

Single-Wall Carbon Nanotube-Coated Cotton Yarn for Electrocardiography Transmission

Directory of Open Access Journals (Sweden)

Yuliang Zhao

2018-03-01

Full Text Available We fabricated a type of conductive fabric, specifically single-wall carbon nanotube-coated cotton yarns (SWNT-CYs, for electrocardiography (ECG signal transmission utilizing a “dipping and drying” method. The conductive cotton yarns were prepared by dipping cotton yarns in SWNTs (single-wall carbon nanotubes solutions and then drying them at room temperature—a simple process that shows consistency in successfully coating cotton yarns with conductive carbon nanotubes (CNTs. The influence of fabrication conditions on the conductivity properties of SWNT-CYs was investigated. The results demonstrate that our conductive yarns can transmit weak bio-electrical (i.e., ECG signals without significant attenuation and distortion. Our conductive cotton yarns, which combine the flexibility of conventional fabrics and the good conductivity of SWNTs, are promising materials for wearable electronics and sensor applications in the future.

Indirect glyphosate detection based on ninhydrin reaction and surface-enhanced Raman scattering spectroscopy

Science.gov (United States)

Xu, Meng-Lei; Gao, Yu; Li, Yali; Li, Xueliang; Zhang, Huanjie; Han, Xiao Xia; Zhao, Bing; Su, Liang

2018-05-01

Glyphosate is one of the most commonly-used and non-selective herbicides in agriculture, which may directly pollute the environment and threaten human health. A simple and effective approach to assessment of its damage to the natural environment is thus quite necessary. However, traditional chromatography-based detection methods usually suffer from complex pretreatment procedures. Herein, we propose a simple and sensitive method for the determination of glyphosate by combining ninhydrin reaction and surface-enhanced Raman scattering (SERS) spectroscopy. The product (purple color dye, PD) of the ninhydrin reaction is found to SERS-active and directly correlate with the glyphosate concentration. The limit of detection of the proposed method for glyphosate is as low as 1.43 × 10- 8 mol·L- 1 with a relatively wider linear concentration range (1.0 × 10- 7-1.0 × 10- 4 mol·L- 1), which demonstrates its great potential in rapid, highly sensitive concentration determination of glyphosate in practical applications for safety assessment of food and environment.

Potential use of Lemna minor for the phytoremediation of isoproturon and glyphosate.

Science.gov (United States)

Dosnon-Olette, Rachel; Couderchet, Michel; Oturan, Mehmet A; Oturan, Nihal; Eullaffroy, Philippe

2011-07-01

Pesticides are being detected in water bodies on an increasingly frequent basis. The present study focused on toxicity and phytoremediation potential of aquatic plants to remove phytosanitary products from contaminated water. We investigated the capacity of Lemna minor (L. minor) to eliminate two herbicides isoproturon and glyphosate from their medium. Since phytoremediation relies on healthy plants, pesticide toxicity was evaluated by exposing plants to 5 concentrations (0-20 microg L(-1) for isoproturon and 0-120 microg L(-1) for glyphosate) in culture media for 4 d using growth rate and chlorophyll a fluorescence as endpoints. At exposure concentrations of 10 microg x L(-1) for isoproturon and 80 microg x L(-1) for glyphosate, effects on growth rate and chlorophyll fluorescence were minor (isoproturon and glyphosate, respectively.

The fate of glyphosate in water hyacinth and its physiological and biochemical influences on growth of algae

International Nuclear Information System (INIS)

Tsai, Baolong.

1989-01-01

Absorption, translocation, distribution, exudation, and guttation of 14 C-glyphosate in water hyacinth (Eichhornia crassipes) were studied. Glyphosphate entered the plant by foliage and solution treatment. Plants were harvested and separated into the following parts: treated leaf blade, treated leaf petiole, young leaf blade, young leaf petiole, old leak blade, old leaf petiole, and root. Each part was extracted with methanol. Treated leaves, which exist only in foliage treatment, were washed with water and chloroform to remove the glyphosate residues. All 14 C counting was made by liquid scintillation spectrometry. Autoradiography was used to locate 14 C-glyphosate after foliage treatment. Results indicated that glyphosate can be absorbed from the leaf surface and translocated rapidly through phloem tissues into the whole plant body. The roots of water hyacinth absorbed glyphosate without vertical transport. Guttation of glyphosate occurred in treated leaf tips. Exudation of glyphosate from roots of water hyacinth occurred within 8 hr after foliage treatment. Chlorella vulgaris, Chlamydomonas reihardii, Anabaena cylindrica, and Chroococcus turgidus were used to explore the physiological and biochemical effects of glyphosate on algae. Spectrophotometric assays were performed for algal growth, chlorophyll, carotenoids, phycobiliprotein, carbohydrate, and protein. TLC procedures and an image analyzer were used to detect the metabolites of glyphosate inside algal cells. The common visible symptom of glyphosate toxicity in all algal cells were bleaching effect and reduction of contents of carbohydrate, protein, and pigments. The results highly suggested that glyphosate injured the algal cells by destruction of photosynthetic pigments and resulted in lowering the contents of carbohydrate and protein in algal cells

The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

Energy Technology Data Exchange (ETDEWEB)

Albers, Christian N., E-mail: calbers@ruc.d [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark); Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Banta, Gary T. [Dept. of Environmental, Social and Spatial Change, Roskilde University, DK-4000 Roskilde (Denmark); Hansen, Poul Erik [Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Jacobsen, Ole S. [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark)

2009-10-15

Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, approx40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only approx10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

International Nuclear Information System (INIS)

Albers, Christian N.; Banta, Gary T.; Hansen, Poul Erik; Jacobsen, Ole S.

2009-01-01

Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, ∼40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only ∼10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

Differential content of glyphosate and its metabolites in Digitaria insularis biotypes

Directory of Open Access Journals (Sweden)

Leonardo Bianco de Carvalho

2013-07-01

Full Text Available Experiments were carried out in controlled conditions to analyze the role of metabolism of glyphosate in Digitaria insularis (sourgrass biotypes with differential response to the herbicide. Contents of glyphosate, aminomethylphosphonic acid (AMPA, glyoxylate, and sarcosine was detected in leaf tissues by using reversed-polarity capillarity electrophoresis. Glyphosate content in the A biotype increased from 19.7 up to 65.5 µg g fresh weight-1, whereas decreasing from 19.9 down to 5.0 µg g fresh weight-1 in the B biotype, from 48 up to 168 hours after treatment. At 168 hours after treatment, percentage of the sum of AMPA, glyoxylate, and sarcosine was > 56% in the B biotype, whereas a small percentage of metabolites (< 10% was found in the A biotype. Thus, the faster herbicide degradation in the B biotype is evidence that a differential metabolism of glyphosate can be conferring its lesser susceptibility to the herbicide.

Monitoring glyphosate and AMPA concentrations in wells and drains using the sorbicell passive sampler

DEFF Research Database (Denmark)

Vendelboe, Anders Lindblad; de Jonge, Hubert; Møldrup, Per

2012-01-01

Glyphosate is one of the world’s most extensively used weed control agents. Glyphosate, and its metabolite aminomethylphosphonic acid (AMPA), are suspected to be hazardous to human health and the aquatic environment. In Denmark, the extensive use has resulted in an increasing number of occurrences......Cell, will decrease the workload and number of samples freeing up funds for larger monitoring programs. When installed in a well the SorbiCell will continuously sample the water giving either a flux-weighed or time-weighted average measurement of the glyphosate/AMPA concentration throughout the sampling period....... It may therefore be possible to measure lower concentrations as the glyphosate/AMPA sorbed in the SorbiCell is an accumulated measurement. Also, glyphosate/AMPA associated with sudden flush events will be detected by the SorbiCells, while such events may pass between two consecutive grab samples...

Glyphosate e adubação foliar com manganês na cultura da soja transgênica Glyphosate and foliar fertilization using manganese in transgenic soybean crop

Directory of Open Access Journals (Sweden)

N.M. Correia

2009-01-01

Full Text Available Com base na hipótese de que a soja transgênica tolerante ao glyphosate necessitaria da adição complementar de manganês devido a alterações na absorção e no metabolismo do elemento pelas plantas, objetivou-se estudar a interação da soja transgênica pulverizada com glyphosate e a adubação foliar com manganês. Foi desenvolvido experimento em campo, no ano agrícola 2007/2008, na Fazenda de Ensino, Pesquisa e Produção da UNESP, campus de Jaboticabal, SP. O delineamento experimental foi o de blocos ao acaso, no esquema fatorial 4 x 4, com quatro repetições. Foram avaliados quatro manejos de plantas daninhas [glyphosate (p.c. Roundup Ready a 0,72 e 1,20 kg ha-1 de equivalente ácido, fluazifop-p-butyl + fomesafen (p.c. Fusiflex a 0,25 + 0,25 kg ha-1 e testemunha capinada, sem herbicida] e quatro doses (0, 42, 84 e 126 g ha-1 de manganês em aplicação foliar na soja. Os tratamentos estudados não alteraram significativamente a produtividade de grãos, os teores de manganês no solo, a altura e a matéria seca das plantas de soja. Apenas a mistura fluazifop-p-butyl mais fomesafen ocasionou injúrias visuais nas plantas, porém os sintomas ficaram restritos às folhas que interceptaram o jato de pulverização. Para massa de 100 grãos, os herbicidas estudados não diferiram da testemunha; no entanto, as plantas tratadas com 0,72 kg ha-1 de glyphosate apresentaram menor massa de grãos. A aplicação de manganês não influenciou os teores do elemento nas plantas tratadas com glyphosate e naquelas sem herbicida. Portanto, o glyphosate não prejudicou a absorção ou o metabolismo do manganês pela planta, e o crescimento e desenvolvimento das plantas tratadas foram estatisticamente similares aos das não tratadas com herbicidas.Based on the hypothesis that glyphosate-tolerant transgenic soybean would need a manganese complementation due to alterations in the absorption and metabolism of this element by the plants, this work aimed to

Amplicon based RNA interference targeting V2 gene of cotton leaf curl Kokhran virus-Burewala strain can provide resistance in transgenic cotton plants

Science.gov (United States)

An RNAi based gene construct designated “C2” was used to target the V2 region of the cotton leaf curl virus (CLCuV) genome which is responsible for virus movement. The construct was transformed into two elite cotton varieties MNH-786 and VH-289. A shoot apex method of plant transformation using Agr...

Novel AroA from Pseudomonas putida Confers Tobacco Plant with High Tolerance to Glyphosate

Science.gov (United States)

Yan, Hai-Qin; Chang, Su-Hua; Tian, Zhe-Xian; Zhang, Le; Sun, Yi-Cheng; Li, Yan; Wang, Jing; Wang, Yi-Ping

2011-01-01

Glyphosate is a non-selective broad-spectrum herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, also designated as AroA), a key enzyme in the aromatic amino acid biosynthesis pathway in microorganisms and plants. Previously, we reported that a novel AroA (PpAroA1) from Pseudomonas putida had high tolerance to glyphosate, with little homology to class I or class II glyphosate-tolerant AroA. In this study, the coding sequence of PpAroA1 was optimized for tobacco. For maturation of the enzyme in chloroplast, a chloroplast transit peptide coding sequence was fused in frame with the optimized aroA gene (PparoA1optimized) at the 5′ end. The PparoA1optimized gene was introduced into the tobacco (Nicotiana tabacum L. cv. W38) genome via Agrobacterium-mediated transformation. The transformed explants were first screened in shoot induction medium containing kanamycin. Then glyphosate tolerance was assayed in putative transgenic plants and its T1 progeny. Our results show that the PpAroA1 from Pseudomonas putida can efficiently confer tobacco plants with high glyphosate tolerance. Transgenic tobacco overexpressing the PparoA1optimized gene exhibit high tolerance to glyphosate, which suggest that the novel PpAroA1 is a new and good candidate applied in transgenic crops with glyphosate tolerance in future. PMID:21611121

Transfer of glyphosate and its degradate AMPA to surface waters through urban sewerage systems.

Science.gov (United States)

Botta, Fabrizio; Lavison, Gwenaëlle; Couturier, Guillaume; Alliot, Fabrice; Moreau-Guigon, Elodie; Fauchon, Nils; Guery, Bénédicte; Chevreuil, Marc; Blanchoud, Hélène

2009-09-01

A study of glyphosate and aminomethyl phosphonic acid (AMPA) transfer in the Orge watershed (France) was carried out during 2007 and 2008. Water samples were collected in surface water, wastewater sewer, storm sewer and wastewater treatment plant (WWTP). These two molecules appeared to be the most frequently detected ones in the rivers and usually exceeded the European quality standard concentrations of 0.1microg L(-1) for drinking water. The annual glyphosate estimated load was 1.9 kg year(-1) upstream (agricultural zone) and 179.5 kg year(-1) at the catchment outlet (urban zone). This result suggests that the contamination of this basin by glyphosate is essentially from urban origin (road and railway applications). Glyphosate reached surface water prevalently through storm sewer during rainfall event. Maximum concentrations were detected in storm sewer just after a rainfall event (75-90 microg L(-1)). High concentrations of glyphosate in surface water during rainfall events reflected urban runoff impact. AMPA was always detected in the sewerage system. This molecule reached surface water mainly via WWTP effluent and also through storm sewer. Variations in concentrations of AMPA during hydrological episodes were minor compared to glyphosate variations. Our study highlights that AMPA and glyphosate origins in urban area are different. During dry period, detergent degradation seemed to be the major AMPA source in wastewater.

Role of secondary metabolites biosynthesis in resistance to cotton ...

African Journals Online (AJOL)

Secondary metabolites production in healthy and diseased sample of leaves of cotton varieties after the attack of CLCuV found maximum phenolics, carotenoids, chlorophyll a, chlorophyll b and total chlorophyll a and b in healthy sample and minimum contents present in diseased sample. CIM-446 was the best variety to ...

Effects of temperature on the feeding behavior of Alabama argillacea (Hübner (Lepidoptera: Noctuidae on Bt and non-Bt cotton plants

Directory of Open Access Journals (Sweden)

FRANCISCO S. RAMALHO

2017-12-01

Full Text Available ABSTRACT The host acceptance behavior and environmental factors as temperature affect the feeding behavior of Lepidoptera pests. Thus, they must be considered in studies about the risk potential of resistance evolution. The current study sets the differences in the feeding behavior of neonate Alabama argillacea (Hübner (Lepidoptera: Noctuidae larvae exposed to Bt and non-Bt cotton plants, under different temperatures and time gap after hatching. Two cotton cultivars were used: the Bt (DP 404 BG - bollgard and the non-transformed isoline, DP 4049. We found that the feeding behavior of neonate A. argillacea is significantly different between Bt and non-Bt cotton. Based on the number of larvae with vegetal tissue in their gut found on the plant and in the organza as well as on the amount of vegetal tissue ingested by the larvae. A. argillacea shows feeding preference for non-Bt cotton plants, in comparison to that on the Bt. However, factors such as temperature and exposure time may affect detection capacity and plant abandonment by the larvae and it results in lower ingestion of vegetal tissue. Such results are relevant to handle the resistance of Bt cotton cultivars to A. argillacea and they also enable determining how the cotton seeds mix will be a feasible handling option to hold back resistance evolution in A. argillacea populations on Bt cotton, when it is compared to other refuge strategies. The results can also be useful to determine which refuge distribution of plants is more effective for handling Bt cotton resistance to A. argillacea.

Genomics-enabled analysis of the emergent disease cotton bacterial blight.