WorldWideScience

Sample records for glyphosate tolerant soybean

  1. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    OpenAIRE

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Jin, Longguo; Zhang, Lijuan; Chang, Ru-Zhen; Lu, Wei; Lin, Min; Qiu, Li-Juan

    2015-01-01

    Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-...

  2. Glyphosate tolerance of soybean mutant gained after boarding on satellite

    International Nuclear Information System (INIS)

    Jiang Lingxue; Ren Honglei; Zhang Hongyan; Liu Zhangxiong; Jin Longguo; Guo Yong; Qiu Lijuan; Tao Bo

    2011-01-01

    Glyphosate-tolerant germplasm and genetic variation characteristics of SP 2 and SP 3 soybean varieties boarded on Shijian No.8 satellite were analyzed after treated by herbicide glyphosate in the field. Abundant variations of traits were produced, and the resistance within and among cultivars were different in their offspring of space mutagenesis. Plant height and maturity were used as index to screen glyphosate tolerant materials. Space mutation increased of soybean 661 SP 3 of Zhongpin, and one glyphosate-resistance variant was screened from Zhongpin 661 SP 3 . It showed that glyphosate tolerance was different among offspring of different space mutagenesis soybean materials. It is feasible to systemically screen elite traits soybean by applying space mutation breeding. (authors)

  3. Co-expression of G2-EPSPS and glyphosate acetyltransferase GAT genes conferring high tolerance to glyphosate in soybean

    Directory of Open Access Journals (Sweden)

    Bingfu eGuo

    2015-10-01

    Full Text Available Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.

  4. Glyphosate-tolerant soybeans remain compositionally equivalent to conventional soybeans (Glycine max L.) during three years of field testing.

    Science.gov (United States)

    McCann, Melinda C; Liu, Keshun; Trujillo, William A; Dobert, Raymond C

    2005-06-29

    Previous studies have shown that the composition of glyphosate-tolerant soybeans (GTS) and selected processed fractions was substantially equivalent to that of conventional soybeans over a wide range of analytes. This study was designed to determine if the composition of GTS remains substantially equivalent to conventional soybeans over the course of several years and when introduced into multiple genetic backgrounds. Soybean seed samples of both GTS and conventional varieties were harvested during 2000, 2001, and 2002 and analyzed for the levels of proximates, lectin, trypsin inhibitor, and isoflavones. The measured analytes are representative of the basic nutritional and biologically active components in soybeans. Results show a similar range of natural variability for the GTS soybeans as well as conventional soybeans. It was concluded that the composition of commercial GTS over the three years of breeding into multiple varieties remains equivalent to that of conventional soybeans.

  5. Intellectual property rights related to the genetically modified glyphosate tolerant soybeans in Brazil.

    Science.gov (United States)

    Rodrigues, Roberta L; Lage, Celso L S; Vasconcellos, Alexandre G

    2011-06-01

    The present work analyzes the different modalities of protection of the intellectual creations in the biotechnology agricultural field. Regarding the Brazilian legislations related to the theme (the Industrial Property Law - no. 9. 279/96 and the Plant Variety Protection Law - no. 9. 456/97), and based in the international treaties signed by Brazil, the present work points to the inclusions of each of them, as well as to their interfaces using as reference the case study of glyphosate tolerant genetically modified soybean. For this case study, Monsanto's pipelines patents were searched and used to analyze the limits of patent protection in respect to others related to the Intellectual Property (IP) laws. Thus, it was possible to elucidate the complex scenario of the Intellectual Property of the glyphosate tolerant soybeans, since for the farmer it is hard to correlate the royalties payment with the IP enterprise's rights.

  6. Gene flow from GM glyphosate-tolerant to conventional soybeans under field conditions in Japan.

    Science.gov (United States)

    Yoshimura, Yasuyuki; Matsuo, Kazuhito; Yasuda, Koji

    2006-01-01

    Natural out-crossing rates were evaluated for conventional soybeans (Glycine max (L.) Merr.) cultivated adjacent to genetically modified (GM) glyphosate-tolerant soybeans under field conditions during a four-year period in Japan. A total of 107 846 progeny of 2772 plants harvested from conventional varieties were screened for glyphosate herbicide tolerance. The highest out-crossing rates, 0.19% in 2001 and 0.16% in 2002, were observed in adjacent rows 0.7 m from the pollen source. The highest rate in 2004 was 0.052%, which was observed at 2.1 m. No out-crossing was observed in the rows 10.5 m from the pollen source over the four-year period. The farthest distances between receptor and pollen source at which out-crossing was observed were 7 m in 2001, 2.8 m in 2002, and 3.5 m in 2004. The greatest airborne pollen density during the flowering period, determined by Durham pollen samplers located between the rows of each variety, was 0.368 grains.cm(-2).day(-1), with the average value at 0.18 grains.cm(-2).day(-1), indicating that the possibility of out-crossing by wind is minimal. Thrips species and predatory Hemiptera visited the soybean flowers more frequently during the four-year period than any other common pollinators, such as bees.

  7. WEED CONTROL IN GENETICALLY MODIFIED GLYPHOSATE-TOLERANT SOYBEAN MANEJO DE PLANTAS DANINHAS EM SOJA GENETICAMENTE MODIFICADA TOLERANTE AO GLYPHOSATE

    Directory of Open Access Journals (Sweden)

    Júlio Cezar Durigan

    2011-04-01

    Full Text Available The transgenic production systems, as well as conventional systems, require, in addition to chemical control, the adoption of other weed management strategies. This study was developed to evaluate the weed chemical control in glyphosate tolerant soybean, associated to cover crops cultivated in the autumn/winter. The experiment was carried out under field conditions at the FCAV/Unesp, Jaboticabal, São Paulo State, Brazil. A randomized split-plot block design was used, with four replications. St. Lucia Grass (Brachiaria brizantha ‘Marandu’, forage millet (Pennisetum americanum ‘BN2’, and a treatment with spontaneous growth vegetation were evaluated for plots, and, for subplots, the herbicides glyphosate, chlorimuron - ethyl plus lactofen, and fluazifop-p-butyl, in a sequential spraying, and two controls without any application. Grass cover contributed to the chemical control, suppressing weeds, and the single application of 720 g a.e. ha-1 of glyphosate, independently of the cover crop cultivated in the autumn/winter, was sufficient for adequately controlling Acanthospermum hispidum, Alternanthera tenella, Amaranthus sp., Bidens pilosa, Xanthium strumarium, Cenchrus echinatus, Digitaria sp., and Eleusine indica, with results similar to the treatment (chlorimuron-ethyl + lactofen + fluazifop-p-buthyl. When compared to the weeded control, the herbicides did not affect plants height, dry matter of the aerial parts, mass of 100 grains, and grain yield. Soybean plants grown over St. Lucia Grass and forage millet presented a higher height, however, no other feature was influenced by the cover crop.

    KEY-WORDS: Brachiaria brizantha; Pennisetum americanum; no-tillage; Roundup Ready; spontaneous vegetation.

    Os sistemas de produção transgênicos, assim como os

  8. Intellectual property rights related to the genetically modified glyphosate tolerant soybeans in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta L Rodrigues

    2011-06-01

    Full Text Available The present work analyzes the different modalities of protection of the intellectual creations in the biotechnology agricultural field. Regarding the Brazilian legislations related to the theme (the Industrial Property Law - no. 9. 279/96 and the Plant Variety Protection Law - no. 9. 456/97, and based in the international treaties signed by Brazil, the present work points to the inclusions of each of them, as well as to their interfaces using as reference the case study of glyphosate tolerant genetically modified soybean. For this case study, Monsanto's pipelines patents were searched and used to analyze the limits of patent protection in respect to others related to the Intellectual Property (IP laws. Thus, it was possible to elucidate the complex scenario of the Intellectual Property of the glyphosate tolerant soybeans, since for the farmer it is hard to correlate the royalties payment with the IP enterprise's rightsO presente trabalho analisa as diferentes modalidades de proteção das criações intelectuais no campo da biotecnologia agrícola. A partir das leis Brasileiras relacionadas ao tema (Lei da Propriedade Industrial - nº 9.279/96 e Lei da Proteção de Cultivares - nº 9.456/97, e com base nos tratados internacionais assinados pelo Brasil, o presente trabalho aponta as inclusões de cada uma, assim como, suas interfaces usando como referência o estudo de caso da soja geneticamente modificada para tolerância ao glifosato. Para este caso, patentes pipelines da Monsanto foram buscadas e usadas para analisar os limites de proteção das patentes frente às outras leis de Propriedade Intelectual (PI relacionadas. Assim, foi possível elucidar o cenário complexo da Propriedade Intelectual das sojas tolerantes ao glifosato, já que para o agricultor não é fácil correlacionar o pagamento dos royalties com os direitos de PI da empresa

  9. Assessing the effects of cultivating genetically modified glyphosate-tolerant varieties of soybeans (Glycine max (L.) Merr.) on populations of field arthropods.

    Science.gov (United States)

    Imura, Osamu; Shi, Kun; Iimura, Keiji; Takamizo, Tadashi

    2010-01-01

    We assessed the effects of cultivating two genetically modified (GM) glyphosate-tolerant soybean varieties (Glycine max (L.) Merr.) derived from Event 40-3-2 and a Japanese conventional variety on arthropods under field conditions, with weed control using glyphosate and conventional weed control for two years. Plant height and dry weight of the conventional variety were significantly larger than those of the GM varieties, but the GM varieties bore more pods than the conventional variety. We found arthropods of nine taxonomic orders (Araneae, Acari, Thysanoptera, Homoptera, Heteroptera, Coleoptera, Diptera, Lepidoptera, and Hymenoptera) on the plants. The arthropod incidence (number per plant unit weight pooled for each taxonomic order) on the soybean stems and leaves generally did not differ significantly between the GM and conventional varieties. However, the incidence of Thysanoptera and total incidence (all orders combined) were greater on the GM variety in the second year. The weed control regimes had no significant influence on the arthropod incidence on the soybean stems and leaves. The number of flower-inhabiting Thysanoptera (the dominant arthropod in the flowers) was not significantly different between the GM and conventional varieties. Asphondylia yushimai (Diptera, Cecidomyiidae) was more numerous on the pods of the GM variety in both years. Neither the soybean variety nor the weed control regime significantly affected the density of soil macro-organisms. However, the glyphosate weed control affected arthropods between the rows of plants by decreasing the abundances of Homoptera, Heteroptera, Coleoptera and Lepidoptera, and diversity of arthropods. © ISBR, EDP Sciences, 2011.

  10. 76 FR 27268 - Glyphosate; Pesticide Tolerance

    Science.gov (United States)

    2011-05-11

    ... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 180 [EPA-HQ-OPP-2010-0938; FRL-8872-6] Glyphosate... regulation increases the established tolerance for residues of glyphosate in or on corn, field, forage... tolerance for residues of the herbicide glyphosate, N-(phosphonomethyl) glycine, in or on corn, field...

  11. Identification of geneticaly modified soybean seeds resistant to glyphosate

    Directory of Open Access Journals (Sweden)

    Tillmann Maria Ângela André

    2004-01-01

    Full Text Available Advances in genetic engineering permit the modification of plants to be tolerant to certain herbicides that are usually not selective. For practical and commercial purposes, it is important to be able to detect the presence or absence of these traits in genotypes. The objective of this research was to develop a procedure for identifying genetically modified soybean (Glycine max L. Merr. with resistance to the herbicide glyphosate. Two studies were conducted based on germination test. In the first study, soybean seeds were pre-imbibed in paper towel with the herbicide solutions, then transferred to moist paper towel for the germination test. In the second study, seeds were placed directly in herbicide solutions in plastic cups and tested for germination using the paper towel method. Eight soybean genotypes were compared: four Roundup Ready, that contained the gene resistant to the herbicide (G99-G725, Prichard RR, G99-G6682, and H7242 RR and four non-transgenic parental cultivars (Boggs, Haskell, Benning, and Prichard. In the first study, the seeds were imbibed for 16 hours at 25°C in herbicide concentrations between 0.0 and 1.5% of the glyphosate active ingredient. In the second, seeds were subjected to concentrations between 0.0 and 0.48%, for one hour, at 30°C. The evaluation parameters were: germination, hypocotyl length, root length and total length of the seedlings. Both methods are efficient in identifying glyphosate-resistant soybean genotypes. It is possible to identify the genetically modified soybean genotypes after three days, by imbibing the seed in 0.12% herbicide solution, and after six days if the substrate is pre-imbibed in a 0.6% herbicide solution. The resistance trait was identified in all cultivars, independent of the initial physiological quality of the seed.

  12. Compositional differences in soybeans on the market: glyphosate accumulates in Roundup Ready GM soybeans.

    Science.gov (United States)

    Bøhn, T; Cuhra, M; Traavik, T; Sanden, M; Fagan, J; Primicerio, R

    2014-06-15

    This article describes the nutrient and elemental composition, including residues of herbicides and pesticides, of 31 soybean batches from Iowa, USA. The soy samples were grouped into three different categories: (i) genetically modified, glyphosate-tolerant soy (GM-soy); (ii) unmodified soy cultivated using a conventional "chemical" cultivation regime; and (iii) unmodified soy cultivated using an organic cultivation regime. Organic soybeans showed the healthiest nutritional profile with more sugars, such as glucose, fructose, sucrose and maltose, significantly more total protein, zinc and less fibre than both conventional and GM-soy. Organic soybeans also contained less total saturated fat and total omega-6 fatty acids than both conventional and GM-soy. GM-soy contained high residues of glyphosate and AMPA (mean 3.3 and 5.7 mg/kg, respectively). Conventional and organic soybean batches contained none of these agrochemicals. Using 35 different nutritional and elemental variables to characterise each soy sample, we were able to discriminate GM, conventional and organic soybeans without exception, demonstrating "substantial non-equivalence" in compositional characteristics for 'ready-to-market' soybeans. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. 78 FR 60707 - Glyphosate; Pesticide Tolerances

    Science.gov (United States)

    2013-10-02

    ... chromatography/mass spectrometry/mass spectrometry Method 15444) is available to enforce the tolerance expression...) 566-1744, and the telephone number for the OPP Docket is (703) 305- 5805. Please review the visitor...-acetyl-glyphosate (expressed as glyphosate equivalents). VI. Statutory and Executive Order Reviews This...

  14. Natural glyphosate tolerance in sweetvetch Hedysarum boreale

    Science.gov (United States)

    Sweetvetch (Hedysarum boreale Nutt.) a legume native to the western USA and Canada, is purported to have tolerance to glyphosate {N-(phosphonomethyl) glycine} herbide. Eight rates of glyphosate were tested for their effect on biomass yield (BMY) and survival of seedlings and mature plants. Treatme...

  15. Response of Pennsylvania native plant species, corn and soybean to tank mixes of dicamba and glyphosate

    Science.gov (United States)

    Crops such as soybean are being genetically modified to be tolerant to multiple herbicides, such as dicamba and glyphosate, in order to allow treatment with several herbicides to control the development of herbicide resistance in weeds. However, with increased use of multiple-he...

  16. Salt Tolerance in Soybean

    Institute of Scientific and Technical Information of China (English)

    Tsui-Hung Phang; Guihua Shao; Hon-Ming Lam

    2008-01-01

    Soybean is an Important cash crop and its productivity is significantly hampered by salt stress. High salt Imposes negative impacts on growth, nodulation, agronomy traits, seed quality and quantity, and thus reduces the yield of soybean. To cope with salt stress, soybean has developed several tolerance mechanisms, including: (I) maintenance of ion homeostasis; (ii) adjustment in response to osmotic stress; (iii) restoration of osmotic balance; and (iv) other metabolic and structural adaptations. The regulatory network for abiotic stress responses in higher plants has been studied extensively in model plants such as Arabidopsis thaliana. Some homologous components involved in salt stress responses have been identified in soybean. In this review, we tried to integrate the relevant works on soybean and proposes a working model to descdbe Its salt stress responses at the molecular level.

  17. Effects of glyphosate on the mineral content of glyphosate-resistant soybeans (Glycine max).

    Science.gov (United States)

    Duke, Stephen O; Reddy, Krishna N; Bu, Kaixuan; Cizdziel, James V

    2012-07-11

    There are conflicting claims as to whether treatment with glyphosate adversely affects mineral nutrition of glyphosate-resistant (GR) crops. Those who have made claims of adverse effects have argued links between reduced Mn and diseases in these crops. This article describes experiments designed to determine the effects of a recommended rate (0.86 kg ha(-1)) of glyphosate applied once or twice on the mineral content of young and mature leaves, as well as in seeds produced by GR soybeans (Glycine max) in both the greenhouse and field using inductively coupled plasma mass spectrometry (ICP-MS). In the greenhouse, there were no effects of either one application (at 3 weeks after planting, WAP) or two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves sampled at 6, 9, and 12 WAP and in harvested seed. Se concentrations were too low for accurate detection in leaves, but there was also no effect of glyphosate applications on Se in the seeds. In the field study, there were no effects of two applications (at 3 and 6 WAP) of glyphosate on Ca, Mg, Mn, Zn, Fe, Cu, Sr, Ba, Al, Cd, Cr, Co, or Ni content of young or old leaves at either 9 or 12 WAP. There was also no effect on Se in the seeds. There was no difference in yield between control and glyphosate-treated GR soybeans in the field. The results indicate that glyphosate does not influence mineral nutrition of GR soybean at recommended rates for weed management in the field. Furthermore, the field studies confirm the results of greenhouse studies.

  18. Implication of Legal References on Technological Dissemination: A Study on Transgenic Soybeans Resistant to Glyphosate Herbicide in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Rodrigues

    2013-04-01

    Full Text Available The following paper aims at establishing a connection between the evolution of legal landmarks related to soybeans tolerant to glyphosate-based herbicide in Brazil and the planting growth of this transgenic soybean in Brazil, in order to determine the role that such soybeans play in today's domestic agricultural scenario. To do so, a study of Brazilian laws that protect intellectual creations was carried out (Industrial Property Law - Law number 9.279/96 and the Plant Protection Law – Law number 9.456/97, the Law on Biosafety – Law number 11105 / 05 – and the Law on Brazilian Seeds and Seedlings - Law number 10.711/03, in order to delimit the matter protected by each of those laws while establishing its interfaces. Regarding planting, the Biosafety Law of 2005 corresponds to the fourth law which deals with soybeans tolerant to glyphosate-based herbicide and ensures that those previously registered may be marketed without limitation per crop. In order to estimate the space that soybean seeds tolerant to glyphosate-based herbicide began to occupy in the Brazilian market, in the 2008/2009 harvest, compared to the other not genetically modified soybeans, a search in the Ministry of Agriculture´s database was done (http://www.agricultura.gov.br through the available records of certified, non-certified and basic seeds.

  19. Lack of transgene and glyphosate effects on yield, and mineral and amino acid content of glyphosate-resistant soybean.

    Science.gov (United States)

    Duke, Stephen O; Rimando, Agnes M; Reddy, Krishna N; Cizdziel, James V; Bellaloui, Nacer; Shaw, David R; Williams, Martin M; Maul, Jude E

    2018-05-01

    There has been controversy as to whether the glyphosate resistance gene and/or glyphosate applied to glyphosate-resistant (GR) soybean affect the content of cationic minerals (especially Mg, Mn and Fe), yield and amino acid content of GR soybean. A two-year field study (2013 and 2014) examined these questions at sites in Mississippi, USA. There were no effects of glyphosate, the GR transgene or field crop history (for a field with both no history of glyphosate use versus one with a long history of glyphosate use) on grain yield. Furthermore, these factors had no consistent effects on measured mineral (Al, As, Ba, Cd, Ca, Co, Cr, Cs, Cu, Fe, Ga, K, Li, Mg, Mn, Ni, Pb, Rb, Se, Sr, Tl, U, V, Zn) content of leaves or harvested seed. Effects on minerals were small and inconsistent between years, treatments and mineral, and appeared to be random false positives. No notable effects on free or protein amino acids of the seed were measured, although glyphosate and its degradation product, aminomethylphosphonic acid (AMPA), were found in the seed in concentrations consistent with previous studies. Neither glyphosate nor the GR transgene affect the content of the minerals measured in leaves and seed, harvested seed amino acid composition, or yield of GR soybean. Furthermore, soils with a legacy of GR crops have no effects on these parameters in soybean. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  20. Lack of glyphosate resistance gene transfer from Roundup Ready soybean to Bradyrhizobium japonicum under field and laboratory conditions.

    Science.gov (United States)

    Isaza, Laura Arango; Opelt, Katja; Wagner, Tobias; Mattes, Elke; Bieber, Evi; Hatley, Elwood O; Roth, Greg; Sanjuán, Juan; Fischer, Hans-Martin; Sandermann, Heinrich; Hartmann, Anton; Ernst, Dieter

    2011-01-01

    A field study was conducted at the Russell E. Larson Agricultural Research Center to determine the effect of transgenic glyphosate-resistant soybean in combination with herbicide (Roundup) application on its endosymbiont Bradyrhizobium japonicum. DNA of bacteroids from isolated nodules was analysed for the presence of the transgenic 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) DNA sequence using polymerase chain reaction (PCR). To further assess the likelihood that the EPSPS gene may be transferred from the Roundup Ready (RR) soybean to B. japonicum, we have examined the natural transformation efficiency of B. japonicum strain 110spc4. Analyses of nodules showed the presence of the transgenic EPSPS DNA sequence. In bacteroids that were isolated from nodules of transgenic soybean plants and then cultivated in the presence of glyphosate this sequence could not be detected. This indicates that no stable horizontal gene transfer (HGT) of the EPSPS gene had occurred under field conditions. Under laboratory conditions, no natural transformation was detected in B. japonicum strain 110spc4 in the presence of various amounts of recombinant plasmid DNA. Our results indicate that no natural competence state exists in B. japonicum 110spc4. Results from field and laboratory studies indicate the lack of functional transfer of the CP4-EPSPS gene from glyphosate-tolerant soybean treated with glyphosate to root-associated B. japonicum.

  1. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate

    OpenAIRE

    Gris,Cristiane Fortes; Pinho,Edila Vilela de Resende Von; Carvalho,Maria Laene de Moreira; Diniz,Rafael Parreira; Andrade,Thaís de

    2013-01-01

    Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the muni...

  2. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  3. Changes in Amino Acid Profile in Roots of Glyphosate Resistant and Susceptible Soybean (Glycine max) Induced by Foliar Glyphosate Application.

    Science.gov (United States)

    Moldes, Carlos Alberto; Cantarelli, Miguel Angel; Camiña, José Manuel; Tsai, Siu Mui; Azevedo, Ricardo Antunes

    2017-10-11

    Amino acid profiles are useful to analyze the responses to glyphosate in susceptible and resistant soybean lines. Comparisons of profiles for 10 amino acids (Asp, Asn, Glu, Gln, Ser, His, Gly, Thr, Tyr, Leu) by HPLC in soybean roots were performed in two near isogenic pairs (four varieties). Foliar application of glyphosate was made to soybean plants after 5 weeks of seeding. Roots of four varieties were collected at 0 and 72 h after glyphosate application (AGA) for amino acid analysis by HPLC. Univariate analysis showed a significant increase of several amino acids in susceptible as well as resistant soybean lines; however, amino acids from the major pathways of carbon (C) and nitrogen (N) metabolism, such as Asp, Asn, Glu and Gln, and Ser, increased significantly in susceptible varieties at 72 h AGA. Multivariate analysis using principal component analysis (2D PCA and 3D PCA) allowed different groups to be identified and discriminated based on the soybean genetic origin, showing the amino acid responses on susceptible and resistant varieties. Based on the results, it is possible to infer that the increase of Asn, Asp, Glu, Gln, and Ser in susceptible varieties would be related to the deregulation of C and N metabolism, as well as changes in the growth mechanisms regulated by Ser.

  4. Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean

    International Nuclear Information System (INIS)

    Santos, J.B.; Ferreira, E.A.; Silva, A.A.; Oliveira, J.A.; Fialho, C.M.T.

    2007-01-01

    This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

  5. Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

    International Nuclear Information System (INIS)

    Mamy, Laure; Gabrielle, Benoit; Barriuso, Enrique

    2010-01-01

    The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

  6. Comparative environmental impacts of glyphosate and conventional herbicides when used with glyphosate-tolerant and non-tolerant crops

    Energy Technology Data Exchange (ETDEWEB)

    Mamy, Laure, E-mail: laure.mamy@versailles.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Gabrielle, Benoit, E-mail: benoit.gabrielle@agroparistech.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France); Barriuso, Enrique, E-mail: barriuso@grignon.inra.f [INRA-AgroParisTech, UMR 1091 Environnement et Grandes Cultures, 78850 Thiverval-Grignon (France)

    2010-10-15

    The introduction of glyphosate-tolerant (GT) crops is expected to mitigate the environmental contamination by herbicides because glyphosate is less persistent and toxic than the herbicides used on non-GT crops. Here, we compared the environmental balances of herbicide applications for both crop types in three French field trials. The dynamic of herbicides and their metabolites in soil, groundwater and air was simulated with PRZM model and compared to field measurements. The associated impacts were aggregated with toxicity potentials calculated with the fate and exposure model USES for several environmental endpoints. The impacts of GT systems were lower than those of non-GT systems, but the accumulation in soils of one glyphosate metabolite (aminomethylphosphonic acid) questions the sustainability of GT systems. The magnitude of the impacts depends on the rates and frequency of glyphosate application being highest for GT maize monoculture and lowest for combination of GT oilseed rape and non-GT sugarbeet crops. - The impacts of herbicide applications on glyphosate-tolerant crops could be higher than expected due to the accumulation of a metabolite of glyphosate in soils.

  7. Review of potential environmental impacts of transgenic glyphosate-resistant soybean in Brazil.

    Science.gov (United States)

    Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B; Spadotto, Claudio A

    2007-01-01

    Transgenic glyphosate-resistant soybeans (GRS) have been commercialized and grown extensively in the Western Hemisphere, including Brazil. Worldwide, several studies have shown that previous and potential effects of glyphosate on contamination of soil, water, and air are minimal, compared to those caused by the herbicides that they replace when GRS are adopted. In the USA and Argentina, the advent of glyphosate-resistant soybeans resulted in a significant shift to reduced- and no-tillage practices, thereby significantly reducing environmental degradation by agriculture. Similar shifts in tillage practiced with GRS might be expected in Brazil. Transgenes encoding glyphosate resistance in soybeans are highly unlikely to be a risk to wild plant species in Brazil. Soybean is almost completely self-pollinated and is a non-native species in Brazil, without wild relatives, making introgression of transgenes from GRS virtually impossible. Probably the highest agricultural risk in adopting GRS in Brazil is related to weed resistance. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. These include Chamaesyce hirta (erva-de-Santa-Luzia), Commelina benghalensis (trapoeraba), Spermacoce latifolia (erva-quente), Richardia brasiliensis (poaia-branca), and Ipomoea spp. (corda-de-viola). Four weed species, Conyza bonariensis, Conyza Canadensis (buva), Lolium multiflorum (azevem), and Euphorbia heterophylla (amendoim bravo), have evolved resistance to glyphosate in GRS in Brazil and have great potential to become problems.

  8. Agricultural impacts of glyphosate-resistant soybean cultivation in South America.

    Science.gov (United States)

    Cerdeira, Antonio L; Gazziero, Dionsio L P; Duke, Stephen O; Matallo, Marcus B

    2011-06-08

    In the 2009/2010 growing season, Brazil was the second largest world soybean producer, followed by Argentina. Glyphosate-resistant soybeans (GRS) are being cultivated in most of the soybean area in South America. Overall, the GRS system is beneficial to the environment when compared to conventional soybean. GRS resulted in a significant shift toward no-tillage practices in Brazil and Argentina, but weed resistance may reduce this trend. Probably the highest agricultural risk in adopting GRS in Brazil and South America is related to weed resistance due to use of glyphosate. Weed species in GRS fields have shifted in Brazil to those that can more successfully withstand glyphosate or to those that avoid the time of its application. Five weed species, in order of importance, Conyza bonariensis (L.) Cronquist, Conyza canadensis (L.) Cronquist, Lolium multiflorum Lam., Digitaria insularis (L.) Mez ex Ekman, and Euphorbia heterophylla L., have evolved resistance to glyphosate in GRS in Brazil. Conyza spp. are the most difficult to control. A glyphosate-resistant biotype of Sorghum halepense L. has evolved in GRS in Argentina and one of D. insularis in Paraguay. The following actions are proposed to minimize weed resistance problem: (a) rotation of GRS with conventional soybeans in order to rotate herbicide modes of action; (b) avoidance of lower than recommended glyphosate rates; (c) keeping soil covered with a crop or legume at intercrop intervals; (d) keeping machinery free of weed seeds; and (d) use of a preplant nonselective herbicide plus residuals to eliminate early weed interference with the crop and to minimize escapes from later applications of glyphosate due to natural resistance of older weeds and/or incomplete glyphosate coverage.

  9. Non Target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis

    Directory of Open Access Journals (Sweden)

    Pablo Tomas Fernandez-Moreno

    2016-08-01

    Full Text Available Sterile wild oat (Avena sterilis L. is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage before the beginning of summer period (due to the possibility of intense drought stress. In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha-1 for exposed (E and un-exposed (UE glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of 14C- glyphosate absorption was the same in the two accessions (E and UE, while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica and Lolium rigidum.

  10. Non-target Site Tolerance Mechanisms Describe Tolerance to Glyphosate in Avena sterilis.

    Science.gov (United States)

    Fernández-Moreno, Pablo T; Alcantara-de la Cruz, Ricardo; Cruz-Hipólito, Hugo E; Rojano-Delgado, Antonia M; Travlos, Ilias; De Prado, Rafael

    2016-01-01

    Sterile wild oat (Avena sterilis L.) is an autogamous grass established in warm climate regions. This species has been used as a cover crop in Mediterranean perennial crops during the spring period prior to initiating competition with the main crop for water and nutrients. However, such cover crops need to be controlled (by glyphosate or tillage) before the beginning of summer period (due to the possibility of intense drought stress). In 2011, the olive grove farmers of southern Spain expressed dissatisfaction because of the ineffective control with glyphosate on A. sterilis. Experiments were conducted to determine whether the continued use of glyphosate over a 5 year period had selected a new resistant or tolerant species. The GR50 values obtained for A. sterilis were 297.12 and 245.23 g ae ha(-1) for exposed (E) and un-exposed (UE) glyphosate accessions, respectively. The spray retention and shikimic acid accumulation exhibited a non-significant difference between the two accessions. The results of (14)C- glyphosate absorption was the same in the two accessions (E and UE), while the translocation from the treated leaf to the rest of the shoots and roots was similar in A. sterilis accessions. Glyphosate metabolism to aminomethylphosphonic acid (AMPA) and glyoxylate was similar in both accessions, but increased after treatment with glyphosate, indicating that metabolism plays an important role in tolerance. Both A. sterilis accessions, present similarity in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity enzyme with different glyphosate concentrations and without glyphosate, confirming that both accessions present the same genomic characteristics. The above-mentioned results indicate that innate tolerance to glyphosate in A. sterilis is probably and partly due to reduced herbicide absorption and translocation and metabolism compared to the susceptibility of other grasses weeds like Chloris inflata, Eleusine indica, and Lolium rigidum.

  11. Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean; Efeito de formulacoes na absorcao e translocacao do glyphosate em soja transgenica

    Energy Technology Data Exchange (ETDEWEB)

    Santos, J.B. [UNIVALE, Governador Valadares, MG (Brazil). FAAG. Agronomia]. E-mail: jbarbosa@univale.br; Ferreira, E.A.; Silva, A.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Fitotecnia]. E-mail: evanderalves@yahoo.com.br; aasilva@ufv.br; Oliveira, J.A. [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Geral]. E-mail: jalves@ufv.br; Fialho, C.M.T. [Universidade Federal de Vicosa (UFV), MG (Brazil). Agronomia]. E-mail: cintiamtfialho@yahoo.com.br

    2007-07-01

    This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM) soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready and R. Transorb - both with +isopropylamine salt, and Zapp Qi, formulated from potassic salt ), using a precision micro syringe. Plant samples were collected after herbicide application (4, 16, 40 and 64 hours) and then divided into leaf (trifolium), aerial part, roots and root nodes for radiation reading. 14C-glyphosate that was not absorbed was recovered and counted by washing the leaf with methanol. Penetration and translocation of 14C-glyphosate to the different parts evaluated was found to vary. However, the highest absorption was verified at intervals after 16 hours of application. The highest herbicide percentage in the aerial part of the soybean plants was found when Zapp (potassic salt) was applied on the aerial part and when isopropylamin salt was applied on the roots; 14C-glyphosate was found in the plant root nodules in all treatments, with the highest percentage being observed with R. Transorb, 40 hours after application (0.13% of the total measured or 0.4%, considering only the plant total). Results highlight the hypothesis that glyphosate could harm symbiosis between rhizobium and soybean, since the former also shows in its metabolism EPSPS, which is susceptible to this herbicide. (author)

  12. Selection and characterization of glyphosate tolerance in birdsfoot trefoil (Lotus corniculatus)

    International Nuclear Information System (INIS)

    Boerboom, C.M.

    1989-01-01

    If birdsfoot trefoil (Lotus corniculatus L.) was tolerant to glyphosate [N-(phosphonomethyl)glycine], Canada thistle [Cirsium arvense (L.) Scop.] and other dicot weeds could be selectively controlled in certified seed production fields. Glyphosate tolerance in birdsfoot trefoil was identified in plants from the cultivar Leo, plants regenerated from tolerant callus, and selfed progeny of plants regenerated from callus. Plants from the three sources were evaluated in field studies for tolerance to glyphosate at rates up to 1.6 kg ae/ha. Plants of Leo selected for tolerance exhibited a twofold range in the rate required to reduce shoot weight 50% (I 50 s from 0.6 to 1.2 kg/ha glyphosate). Plants regenerated from tolerant callus had tolerance up to 66% greater than plants regenerated from unselected callus. Transgressive segregation for glyphosate tolerance was observed in the selfed progeny of two regenerated plants that both had I 50 s of 0.7 kg/ha glyphosate. The selfed progeny ranged from highly tolerant (I 50 of 1.5 kg/ha) to susceptible (I 50 of 0.5 kg/ha). Spray retention, 14 C-glyphosate absorption and translocation did not account for the differential tolerance of nine plants that were evaluated from the three sources. The specific activity of 5-enolpyruvylshikimate 3-phosphate (EPSP) synthase ranged from 1.3 to 3.5 nmol/min sm-bullet mg among the nine plants and was positively correlated with glyphosate tolerance. Leo birdsfoot trefoil was found to have significant variation in glyphosate tolerance which made it possible to initiate a recurrent selection program to select for glyphosate tolerance in birdsfoot trefoil. Two cycles of selection for glyphosate tolerance were practiced in three birdsfoot trefoil populations, Leo, Norcen, and MU-81

  13. Glyphosate and dicamba herbicide tank mixture effects on native plant and non-genetically engineered soybean seedlings

    Science.gov (United States)

    Weed species are becoming resistant to intensive and extensive use of specific herbicides associated with the production of herbicide resistant crops, e.g., the use of glyphosate for weed management with glyphosate resistant soybeans. To counter this resistance, crops engineered ...

  14. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate

    Directory of Open Access Journals (Sweden)

    Cristiane Fortes Gris

    2013-04-01

    Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.

  15. 78 FR 25396 - Glyphosate; Pesticide Tolerances

    Science.gov (United States)

    2013-05-01

    ... found no systemic effects in any of the parameters examined (body weight, food consumption, clinical... evidence of carcinogenicity was found in mice or rats. In a chronic toxicity study in dogs, no systemic... chromatography (HPLC)) is available to enforce the tolerance expression. The method may be requested from: Chief...

  16. Glyphosate

    NARCIS (Netherlands)

    A. Arcuri (Alessandra)

    2017-01-01

    markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the

  17. Novel AroA from Pseudomonas putida Confers Tobacco Plant with High Tolerance to Glyphosate

    Science.gov (United States)

    Yan, Hai-Qin; Chang, Su-Hua; Tian, Zhe-Xian; Zhang, Le; Sun, Yi-Cheng; Li, Yan; Wang, Jing; Wang, Yi-Ping

    2011-01-01

    Glyphosate is a non-selective broad-spectrum herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS, also designated as AroA), a key enzyme in the aromatic amino acid biosynthesis pathway in microorganisms and plants. Previously, we reported that a novel AroA (PpAroA1) from Pseudomonas putida had high tolerance to glyphosate, with little homology to class I or class II glyphosate-tolerant AroA. In this study, the coding sequence of PpAroA1 was optimized for tobacco. For maturation of the enzyme in chloroplast, a chloroplast transit peptide coding sequence was fused in frame with the optimized aroA gene (PparoA1optimized) at the 5′ end. The PparoA1optimized gene was introduced into the tobacco (Nicotiana tabacum L. cv. W38) genome via Agrobacterium-mediated transformation. The transformed explants were first screened in shoot induction medium containing kanamycin. Then glyphosate tolerance was assayed in putative transgenic plants and its T1 progeny. Our results show that the PpAroA1 from Pseudomonas putida can efficiently confer tobacco plants with high glyphosate tolerance. Transgenic tobacco overexpressing the PparoA1optimized gene exhibit high tolerance to glyphosate, which suggest that the novel PpAroA1 is a new and good candidate applied in transgenic crops with glyphosate tolerance in future. PMID:21611121

  18. Glyphosate

    OpenAIRE

    Arcuri, Alessandra

    2017-01-01

    markdownabstractGlyphosate is the rock star of pesticides, albeit a controversial one. With 6.1 billion kilograms applied globally in the last decade alone, it is the most widely used herbicide compound in the world. Glyphosate, is at the centre of an acrimonious controversy relating to whether the substance is carcinogenic to humans and toxic for the environment. The controversy took a sharp legal turn when, in March 2015, the International Agency for Research on Cancer (IARC), which is the ...

  19. Effects of glyphosate and endosulfan on soil microorganisms in soybean crop Efeitos do endosulfan e glyphosate sobre microrganismos do solo na cultura da soja

    Directory of Open Access Journals (Sweden)

    J.L. Pereira

    2008-01-01

    Full Text Available Transgenic soybean, resistant to glyphosate, is the most dominant transgenic crop grown commercially in the world. Research works on herbicide and insecticide mixtures and their effects on microorganisms are rarely reported. This work aimed to study the impact of glyphosate, endosulfan and their mixtures on the microbial soil activity in soybean crop. The experiment was carried out in a complete randomized block design with four treatments and five replications. The treatments were glyphosate 480 SL [540 g of active ingredient (a.i. ha-1], endosulfan 350 EC (525 g a.i. ha-1, the glyphosate 480 SL [540 g of active ingredient (a.i. ha-1] mixed with endosulfan 350 EC (525 g a.i. ha-1 and the control. Microbial activity was evaluated five days after treatment application. Glyphosate application was not an impacting factor for soil CO2 production. Endosulfan application (alone or mixed with glyphosate suppressed CO2 production by microorganisms in the soil. Microbial biomass and microbial quotient were lower in the treatments using endosulfan alone and in those using endosulfan mixed with glyphosate than in the treatments using glyphosate alone and control.A soja resistente ao glyphosate é a cultura transgênica mais cultivada em todo o mundo. Pesquisas envolvendo o impacto de mistura de herbicidas e inseticidas e seus efeitos sobre microrganismos do solo são raramente reportadas. Este trabalho teve por objetivo avaliar o impacto do herbicida (glyphosate, do inseticida (endosulfan e da mistura de ambos sobre a atividade microbiana do solo na cultura da soja. O delineamento experimental foi em blocos casualizados, com quatro tratamentos e cinco repetições. Os tratamentos foram o herbicida glyphosate 480 SL [540 g de ingrediente ativo (i.a. ha-1], endosulfan 350 EC (525 g i.a. ha-1, a mistura de glyphosate 480 SL (540 g de i.a. ha-1 com endosulfan 350 EC (525 g i.a. ha-1 e a testemunha onde se aplicou água. A atividade microbiana foi avaliada aos

  20. Simulating changes in cropping practises in conventional and glyphosate-tolerant maize. I. Effects on weeds.

    Science.gov (United States)

    Colbach, Nathalie; Fernier, Alice; Le Corre, Valérie; Messéan, Antoine; Darmency, Henri

    2017-04-01

    Herbicide-tolerant (HT) crops such as those tolerant to glyphosate simplify weed management and make it more efficient, at least at short-term. Overreliance on the same herbicide though leads to the spread of resistant weeds. Here, the objective was to evaluate, with simulations, the impact on the advent of glyphosate resistance in weeds of modifications in agricultural practises resulting from introducing HT maize into cropping systems. First, we included a single-gene herbicide resistance submodel in the existing multispecific FLORSYS model. Then, we (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, (2) compared these systems in terms of glyphosate resistance, (3) identified pertinent cultural practises influencing glyphosate resistance, and (4) investigated correlations between cultural practises and species traits, using RLQ analyses. The simulation study showed that, during the analysed 28 years, (1) glyphosate spraying only results in glyphosate resistance in weeds when combined with other cultural factors favouring weed infestation, particularly no till; (2) pre-sowing glyphosate applications select more for herbicide resistance than post-sowing applications on HT crops; and (3) glyphosate spraying selects more for species traits avoiding exposure to the herbicide (e.g. delayed early growth, small leaf area) or compensating for fitness costs (e.g. high harvest index) than for actual resistance to glyphosate, (4) actual resistance is most frequent in species that do not avoid glyphosate, either via plant size or timing, and/or in less competitive species, (5) in case of efficient weed control measures, actual resistance proliferates best in outcrossing species. An advice table was built, with the quantitative, synthetic ranking of the crop management effects in terms of glyphosate-resistance management, identifying the optimal choices for each management technique.

  1. Tolerance of Glyphosate-Resistant Maize to Glyphosate Plus MCPA Amine Is Influenced by Dose and Timing

    Directory of Open Access Journals (Sweden)

    Nader Soltani

    2015-01-01

    Full Text Available There is little information on tolerance of glyphosate-resistant maize to glyphosate plus MCPA amine as influenced by dose and timing under Ontario environmental conditions. A total of seven field trials were conducted at various locations in Ontario, Canada, in 2011–2013 to evaluate tolerance of field maize to tank mixes of glyphosate (900 g a.e./ha plus MCPA amine (79, 158, 315, 630, 1260, 2520, or 5040 g a.e./ha at either the 4- or 8-leaf stage. The predicted dose of MCPA amine that caused 5, 10, and 20% injury was 339, 751, and 1914 g a.e./ha when applied to 4-leaf maize but only 64, 140, and 344 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% reduction in shoot dry weight of maize was 488, 844, and 1971 g a.e./ha when applied to 4-leaf maize and only 14, 136, and 616 g a.e./ha when applied to 8-leaf maize, respectively. The predicted dose of MCPA amine that caused 5, 10, and 20% yield reduction was 2557, 4247, and >5040 g a.e./ha when applied to 4-leaf maize and 184, 441, and 1245 g a.e./ha when applied to 8-leaf maize, respectively. Based on these results, glyphosate plus MCPA amine applied at the manufacturer’s recommended dose of 630 g a.e./ha applied to 4-leaf maize has potential to cause injury but the injury is transient with no significant reduction in yield. However, when glyphosate plus MCPA amine is applied to 8-leaf maize it has the potential to cause significant injury and yield loss in maize.

  2. Response of Pennsylvania native plant species to dicamba and/or glyphosate

    Science.gov (United States)

    Weeds may become resistant to intensive and extensive use of specific herbicides associated with the growth of herbicide tolerant crops, e.g., the use of glyphosate for weed control with glyphosate tolerant soybeans. To counter this resistance, crops modified to contain genes for...

  3. A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Gaoyi Cao

    Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

  4. Glyphosate e adubação foliar com manganês na cultura da soja transgênica Glyphosate and foliar fertilization using manganese in transgenic soybean crop

    Directory of Open Access Journals (Sweden)

    N.M. Correia

    2009-01-01

    Full Text Available Com base na hipótese de que a soja transgênica tolerante ao glyphosate necessitaria da adição complementar de manganês devido a alterações na absorção e no metabolismo do elemento pelas plantas, objetivou-se estudar a interação da soja transgênica pulverizada com glyphosate e a adubação foliar com manganês. Foi desenvolvido experimento em campo, no ano agrícola 2007/2008, na Fazenda de Ensino, Pesquisa e Produção da UNESP, campus de Jaboticabal, SP. O delineamento experimental foi o de blocos ao acaso, no esquema fatorial 4 x 4, com quatro repetições. Foram avaliados quatro manejos de plantas daninhas [glyphosate (p.c. Roundup Ready a 0,72 e 1,20 kg ha-1 de equivalente ácido, fluazifop-p-butyl + fomesafen (p.c. Fusiflex a 0,25 + 0,25 kg ha-1 e testemunha capinada, sem herbicida] e quatro doses (0, 42, 84 e 126 g ha-1 de manganês em aplicação foliar na soja. Os tratamentos estudados não alteraram significativamente a produtividade de grãos, os teores de manganês no solo, a altura e a matéria seca das plantas de soja. Apenas a mistura fluazifop-p-butyl mais fomesafen ocasionou injúrias visuais nas plantas, porém os sintomas ficaram restritos às folhas que interceptaram o jato de pulverização. Para massa de 100 grãos, os herbicidas estudados não diferiram da testemunha; no entanto, as plantas tratadas com 0,72 kg ha-1 de glyphosate apresentaram menor massa de grãos. A aplicação de manganês não influenciou os teores do elemento nas plantas tratadas com glyphosate e naquelas sem herbicida. Portanto, o glyphosate não prejudicou a absorção ou o metabolismo do manganês pela planta, e o crescimento e desenvolvimento das plantas tratadas foram estatisticamente similares aos das não tratadas com herbicidas.Based on the hypothesis that glyphosate-tolerant transgenic soybean would need a manganese complementation due to alterations in the absorption and metabolism of this element by the plants, this work aimed to

  5. Foliar Potassium Fertilizer Additives Affect Soybean Response and Weed Control with Glyphosate

    Directory of Open Access Journals (Sweden)

    Kelly A. Nelson

    2012-01-01

    Full Text Available Research in 2004 and 2005 determined the effects of foliar-applied K-fertilizer sources (0-0-62-0 (%N-%P2O5-%K2O-%S, 0-0-25-17, 3-18-18-0, and 5-0-20-13 and additive rates (2.2, 8.8, and 17.6 kg K ha−1 on glyphosate-resistant soybean response and weed control. Field experiments were conducted at Novelty and Portageville with high soil test K and weed populations and at Malden with low soil test K and weed populations. At Novelty, grain yield increased with fertilizer additives at 8.8 kg K ha−1 in a high-yield, weed-free environment in 2004, but fertilizer additives reduced yield up to 470 kg ha−1 in a low-yield year (2005 depending on the K source and rate. At Portageville, K-fertilizer additives increased grain yield from 700 to 1160 kg ha−1 compared to diammonium sulfate, depending on the K source and rate. At Malden, there was no yield response to K sources. Differences in leaf tissue K (P=0.03, S (P=0.03, B (P=0.0001, and Cu (P=0.008 concentrations among treatments were detected 14 d after treatment at Novelty and Malden. Tank mixtures of K-fertilizer additives with glyphosate may provide an option for foliar K applications.

  6. Comparative Metabolomic Analyses of Ipomoea lacunosa Biotypes with Contrasting Glyphosate Tolerance Captures Herbicide-Induced Differential Perturbations in Cellular Physiology.

    Science.gov (United States)

    Maroli, Amith S; Nandula, Vijay K; Duke, Stephen O; Gerard, Patrick; Tharayil, Nishanth

    2018-02-28

    Glyphosate-tolerant Ipomoea lacunosa is emerging as a problematic weed in the southeastern United States. Metabolomic profiling was conducted to examine the innate physiology and the glyphosate induced perturbations in two biotypes of I. lacunosa (WAS and QUI) that had contrasting glyphosate tolerance. Compared to the less tolerant QUI-biotype, the innate metabolism of the more tolerant WAS-biotype was characterized by a higher abundance of amino acids, and pyruvate; whereas the sugar profile of the QUI biotype was dominated by the transport sugar sucrose. Glyphosate application (80 g ae/ha) caused similar shikimate accumulation in both biotypes. Compared to QUI, in WAS, the content of aromatic amino acids was less affected by glyphosate treatment, and the content of Ala, Val, Ile, and Pro increased. However, the total sugars decreased by ∼75% in WAS, compared to ∼50% decrease in QUI. The innate, higher proportional abundance, of the transport-sugar sucrose in QUI coud partly explain the higher translocation and greater sensitivity of this biotype to glyphosate. The decrease in sugars, accompanied by an increase in amino acids could delay feedback regulation of upstream enzymes of the shikimate acid pathway in WAS, which could contribute to a greater glyphosate tolerance. Our study, through a metabolomics approach, provides complementary data that elucidates the cellular physiology of herbicide tolerance in Ipomoea lacunosa biotypes.

  7. Limited uptake, translocation and enhanced metabolic degradation contribute to glyphosate tolerance in Mucuna pruriens var. utilis plants.

    Science.gov (United States)

    Rojano-Delgado, Antonia María; Cruz-Hipolito, Hugo; De Prado, Rafael; Luque de Castro, María Dolores; Franco, Antonio Rodríguez

    2012-01-01

    Velvet bean (Mucuna pruriens, Fabaceae) plants exhibits an innate, very high resistance (i.e., tolerance) to glyphosate similar to that of plants which have acquired resistance to this herbicide as a trait. We analyzed the uptake of [(14)C]-glyphosate by leaves and its translocation to meristematic tissues, and used scanning electron micrographs to further analyze the cuticle and 3D capillary electrophoresis to investigate a putative metabolism capable of degrading the herbicide. Velvet bean exhibited limited uptake of glyphosate and impaired translocation of the compound to meristematic tissues. Also, for the first time in a higher plant, two concurrent pathways capable of degrading glyphosate to AMPA, Pi, glyoxylate, sarcosine and formaldehyde as end products were identified. Based on the results, the innate tolerance of velvet bean to glyphosate is possibly a result of the combined action of the previous three traits, namely: limited uptake, impaired translocation and enhanced degradation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Volatile Organic Compounds Induced by Herbivory of the Soybean Looper Chrysodeixis includens in Transgenic Glyphosate-Resistant Soybean and the Behavioral Effect on the Parasitoid, Meteorus rubens.

    Science.gov (United States)

    Strapasson, Priscila; Pinto-Zevallos, Delia M; Da Silva Gomes, Sandra M; Zarbin, Paulo H G

    2016-08-01

    Transgenic soybean plants (RR) engineered to express resistance to glyphosate harbor a variant of the enzyme EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) involved in the shikimic acid pathway, the biosynthetic route of three aromatic amino acids: phenylalanine, tyrosine, and tryptophan. The insertion of the variant enzyme CP4 EPSPS confers resistance to glyphosate. During the process of genetic engineering, unintended secondary effects are likely to occur. In the present study, we quantified volatile organic compounds (VOCs) emitted constitutively or induced in response to herbivory by the soybean looper Chrysodeixis includens in transgenic soybean and its isogenic (untransformed) line. Since herbivore-induced plant volatiles (HIPVs) are known to play a role in the recruitment of natural enemies, we assessed whether changes in VOC profiles alter the foraging behavior of the generalist endoparasitic larval parasitoid, Meteorus rubens in the transgenic line. Additionally, we assessed whether there was a difference in plant quality by measuring the weight gain of the soybean looper. In response to herbivory, several VOCs were induced in both the conventional and the transgenic line; however, larger quantities of a few compounds were emitted by transgenic plants. Meteorus rubens females were able to discriminate between the odors of undamaged and C. includens-damaged plants in both lines, but preferred the odors emitted by herbivore-damaged transgenic plants over those emitted by herbivore-damaged conventional soybean plants. No differences were observed in the weight gain of the soybean looper. Our results suggest that VOC-mediated tritrophic interactions in this model system are not negatively affected. However, as the preference of the wasps shifted towards damaged transgenic plants, the results also suggest that genetic modification affects that tritrophic interactions in multiple ways in this model system.

  9. Tolerância do Tifton 85 (Cynodon spp. e da Brachiaria brizantha ao glyphosate Tifton 85 (Cynodon spp. and Brachiaria brizantha tolerance to glyphosate

    Directory of Open Access Journals (Sweden)

    M.V. Santos

    2008-06-01

    Full Text Available Objetivou-se avaliar a tolerância de Tifton 85 e Brachiaria brizantha ao glyphosate e verificar o controle de B. brizantha em área de pastagem de Tifton 85 já estabelecida. O delineamento experimental foi em blocos casualizados, com quatro repetições, em que se testaram as doses: 0, 720, 1.440, 2.160 e 2.880 g ha-1 de glyphosate. Cada parcela possuía dimensões de 3,5 m de comprimento por 3,0 m de largura, totalizando 10,5 m², com área útil de 7,5 m ². A eficiência do herbicida no controle de B. brizantha e o nível de intoxicação nas plantas de Tifton 85 foram avaliados 15, 30 e 60 dias após aplicação (DAA, mediante escala de 0 a 100, em que 0 é ausência de controle e/ou intoxicação e 100, controle total ou morte das plantas. Para avaliação da produção e do potencial de rebrota das forrageiras, as plantas de ambas as espécies foram colhidas aos 300 DAA e secas em estufa. Observou-se controle acima de 90% das plantas de B. brizantha a partir das doses de 1.473,75 e 1.721,25 g ha-1 de glyphosate, aos 30 e 60 DAA, respectivamente. As porcentagens de intoxicação das plantas de Tifton 85, referente a estas doses de controle de B. brizantha, foram, respectivamente, de 24,90 e 4,13% aos 30 e 60 DAA. Além disso, aos 60 DAA, para a maior dose avaliada (2.880 g ha-1 de glyphosate foi observada intoxicação das plantas de Tifton 85 de apenas 18,22%. Aos 300 DAA, observou-se ausência de produção de massa seca de B. brizantha a partir da dose de 2.160 g ha-1 do herbicida, devido ao eficiente controle. Os resultados evidenciam maior tolerância das plantas de Tifton 85 ao glyphosate em relação às plantas de B. brizantha, possibilitando o controle desta espécie em pastagem estabelecida de Tifton 85, sem causar danos à forrageira cultivada.This study aimed to evaluate Tifton 85 and Brachiaria brizantha tolerance glyphosate and verity Brachiaria brizantha control in an established Tifton 85 pasture area. Rates of 0; 720; 1

  10. Proteomic Techniques and Management of Flooding Tolerance in Soybean.

    Science.gov (United States)

    Komatsu, Setsuko; Tougou, Makoto; Nanjo, Yohei

    2015-09-04

    Climate change is considered a major threat to world agriculture and food security. To improve the agricultural productivity and sustainability, the development of high-yielding stress-tolerant, and climate-resilient crops is essential. Of the abiotic stresses, flooding stress is a very serious hazard because it markedly reduces plant growth and grain yield. Proteomic analyses indicate that the effects of flooding stress are not limited to oxygen deprivation but include many other factors. Although many flooding response mechanisms have been reported, flooding tolerance mechanisms have not been fully clarified for soybean. There were limitations in soybean materials, such as mutants and varieties, while they were abundant in rice and Arabidopsis. In this review, plant proteomic technologies are introduced and flooding tolerance mechanisms of soybeans are summarized to assist in the improvement of flooding tolerance in soybeans. This work will expedite transgenic or marker-assisted genetic enhancement studies in crops for developing high-yielding stress-tolerant lines or varieties under abiotic stress.

  11. Proteomic analysis of the flooding tolerance mechanism in mutant soybean.

    Science.gov (United States)

    Komatsu, Setsuko; Nanjo, Yohei; Nishimura, Minoru

    2013-02-21

    Flooding stress of soybean is a serious problem because it reduces growth; however, flooding-tolerant cultivars have not been identified. To analyze the flooding tolerance mechanism of soybean, the flooding-tolerant mutant was isolated and analyzed using a proteomic technique. Flooding-tolerance tests were repeated five times using gamma-ray irradiated soybeans, whose root growth (M6 stage) was not suppressed even under flooding stress. Two-day-old wild-type and mutant plants were subjected to flooding stress for 2days, and proteins were identified using a gel-based proteomic technique. In wild-type under flooding stress, levels of proteins related to development, protein synthesis/degradation, secondary metabolism, and the cell wall changed; however, these proteins did not markedly differ in the mutant. In contrast, an increased number of fermentation-related proteins were identified in the mutant under flooding stress. The root tips of mutant plants were not affected by flooding stress, even though the wild-type plants had damaged root. Alcohol dehydrogenase activity in the mutant increased at an early stage of flooding stress compared with that of the wild-type. Taken together, these results suggest that activation of the fermentation system in the early stages of flooding may be an important factor for the acquisition of flooding tolerance in soybean. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Efeito de formulações na absorção e translocação do glyphosate em soja transgênica Effect of formulations on the absorption and translocation of glyphosate in transgenic soybean

    Directory of Open Access Journals (Sweden)

    J.B. Santos

    2007-01-01

    Full Text Available Este trabalho teve como objetivo avaliar a absorção e translocação de glyphosate em diferentes formulações por plantas de soja (variedade CD 219RR. Para isso, aplicou-se o 14C-glyphosate misturado à calda em três formulações comerciais (Roundup Ready® e R. Transorb®, ambas contendo o sal de isopropilamina, e Zapp Qi��, formulado à base do sal potássico, quando as plantas apresentavam o segundo trifólio completamente expandido. Transcorridas 4, 16, 40 e 64 horas após a aplicação, as plantas foram coletadas e fracionadas, separando-se a folha de aplicação (trifólio, a parte aérea, as raízes e os nódulos radiculares. O 14C-glyphosate não-absorvido foi recuperado e contado por meio da lavagem da folha (metanol 80%. Entre as formulações foi observada variação na penetração e na translocação do 14C-glyphosate para as diferentes partes avaliadas. Todavia, em todas as formulações a maior absorção se deu nos intervalos posteriores a 16 horas da aplicação. Em relação ao total de herbicida encontrado nas plantas de soja, maior percentual na parte aérea foi observado quando se aplicou o Zapp Qi® (sal potássico e, nas raízes, o R. Transorb® (sal de isopropilamina. Detectou-se a presença de 14C glyphosate nos nódulos radiculares das plantas em todos os tratamentos, sendo o maior percentual observado quando se utilizou R. Transorb®, 40 horas após a aplicação (0,13% do total medido ou 0,4% considerando somente o total presente na planta. Os resultados reforçam a hipótese de que o glyphosate pode prejudicar a simbiose entre rizóbio e soja, uma vez que o microssimbionte também apresenta em seu metabolismo a EPSPS, sensível a esse herbicida.This study was carried out to evaluate the absorption and translocation of glyphosate formulations in genetically modified (GM soybean by applying 14C-glyphosate mixed to three glyphosate formulations (Roundup Ready® and R. Transorb® - both with isopropylamine salt

  13. Manejo de Conyza bonariensis resistente ao glyphosate: coberturas de inverno e herbicidas em pré-semeadura da soja Management of glyphosate resistant Conyza bonariensis: winter cover crops and herbicides in soybean pre-seeding

    Directory of Open Access Journals (Sweden)

    F.P. Lamego

    2013-06-01

    Full Text Available Conyza bonariensis tornou-se a principal planta daninha da cultura da soja no Sul do Brasil, em decorrência da evolução para resistência ao herbicida glyphosate. O objetivo deste trabalho foi avaliar o efeito de diferentes coberturas de inverno e da associação de manejo de dessecação pré-semeadura da soja, visando ao controle de C. bonariensis resistente ao glyphosate. Um experimento foi conduzido em campo, na safra 2010/2011. Os tratamentos foram conduzidos em esquema de parcelas subdivididas, em que as coberturas de inverno foram alocadas nas parcelas principais: aveia-preta, nabo, ervilhaca, azevém, trigo e pousio. Nas subparcelas, foram alocados os tratamentos de manejo de dessecação pré-semeadura da soja: glyphosate (720 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1, glyphosate (720 g e.a ha-1 + 2,4-D (1.050 g e.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1, glyphosate (720 g e.a ha-1 + chlorimuron-ethyl (80 g i.a ha-1/paraquat (200 g i.a ha-1 + diuron (100 g i.a ha‑1 e roçada. O nabo foi a espécie de cobertura que produziu o maior volume de massa seca durante o inverno, enquanto a ervilhaca foi a que apresentou maior efeito supressor sobre a germinação e o desenvolvimento inicial de C. bonariensis. Associações de glyphosate com 2,4-D ou chlorimuron-ethyl, seguidas da aplicação sequencial de paraquat + diuron, causaram maior redução na infestação de C. bonariensis.Conyza bonariensis became the main weed in soybean crop in Southern Brazil, as a consequence of the evolution of resistance to the herbicide glyphosate. The objective of this work was to evaluate the effect of different winter cover crops and the association of burn-down herbicides on the control of glyphosate-resistant C. bonariensis. A field experiment was conducted in the 2010/2011 season. The treatments were arranged in a split-plot scheme, with the winter

  14. Overexpression of a modiifed AM79 aroA gene in transgenic maize confers high tolerance to glyphosate

    Institute of Scientific and Technical Information of China (English)

    REN Zhen-jing; CAO Gao-yi; ZHANG Yu-wen; LIU Yan; LIU Yun-jun

    2015-01-01

    It has previously been shown that a bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene AM79 aroA can be a candidate gene to develop glyphosate-tolerant transgenic crops (Cao et al. 2012). In this study, AM79 aroA was redesigned using the plant biased codons and eliminating the motifs which would lead to the instability of mRNA, to create a synthetic gene that would be expressed highly in plant cel s. The redesigned and artiifcial y synthesized gene, named as mAM79, was cloned into plant expression vector pM3301UbiSpAM79, where mAM79 is fused with signal peptide sequence of pea rib-1,5-bisphospate carboxylase (rbcS) smal subunit and control ed by ubiquitin promoter. The plasmid was transformed into maize (Zea mays) immature embryos using Agrobacterium-mediated transformation method. Total 74 regenerated plants were obtained and PCR analysis showed that these transgenic plants had the integration of mAM79. Southern blot analysis was performed on the genomic DNA from four transgenic lines, and the result showed that one or two copies of mAM79 were integrated into maize genome. RT-PCR analysis result indicated that mAM79 was highly transcribed in transgenic maize plants. When sprayed with glyphosate, transgenic maize line AM85 and AM72 could tolerate 4-fold of commercial usage of glyphosate;however, al the non-transgenic maize plants were kil ed by glyphosate. The results in this study conifrmed that mAM79 could be used to develop glyphosate-tolerant maize, and the obtained transgenic maize lines could be used for the breeding of glyphosate-tolerant maize.

  15. Glyphosate sustainability in South American cropping systems.

    Science.gov (United States)

    Christoffoleti, Pedro J; Galli, Antonio J B; Carvalho, Saul J P; Moreira, Murilo S; Nicolai, Marcelo; Foloni, Luiz L; Martins, Bianca A B; Ribeiro, Daniela N

    2008-04-01

    South America represents about 12% of the global land area, and Brazil roughly corresponds to 47% of that. The major sustainable agricultural system in South America is based on a no-tillage cropping system, which is a worldwide adopted agricultural conservation system. Societal benefits of conservation systems in agriculture include greater use of conservation tillage, which reduces soil erosion and associated loading of pesticides, nutrients and sediments into the environment. However, overreliance on glyphosate and simpler cropping systems has resulted in the selection of tolerant weed species through weed shifts (WSs) and evolution of herbicide-resistant weed (HRW) biotypes to glyphosate. It is a challenge in South America to design herbicide- and non-herbicide-based strategies that effectively delay and/or manage evolution of HRWs and WSs to weeds tolerant to glyphosate in cropping systems based on recurrent glyphosate application, such as those used with glyphosate-resistant soybeans. The objectives of this paper are (i) to provide an overview of some factors that influence WSs and HRWs to glyphosate in South America, especially in Brazil, Argentina and Paraguay soybean cropped areas; (ii) to discuss the viability of using crop rotation and/or cover crops that might be integrated with forage crops in an economically and environmentally sustainable system; and (iii) to summarize the results of a survey of the perceptions of Brazilian farmers to problems with WSs and HRWs to glyphosate, and the level of adoption of good agricultural practices in order to prevent or manage it. Copyright (c) 2008 Society of Chemical Industry.

  16. Efeitos da dessecação com glyphosate e chlorimuron-ethyl na comunidade infestante e na produtividade da soja Effects of dissection with glyphosate and chlorimuron-ethyl on weed community and soybean yield

    Directory of Open Access Journals (Sweden)

    L.B Carvalho

    2009-12-01

    Full Text Available O efeito de dessecantes sobre o período anterior à interferência (PAI pode auxiliar na tomada de decisão para o manejo das plantas daninhas. O objetivo desta pesquisa foi verificar se a adição de chlorimuron-ethyl ao glyphosate, para dessecação em pré-semeadura, altera a extensão do PAI na soja. O experimento foi realizado em Jaboticabal-SP, Brasil, submetendo-se o cultivar Monsoy 7908RR a oito períodos de convivência com plantas daninhas, além de testemunhas no mato e no limpo, nos quais foram aplicados dois grupos de tratamentos: glyphosate e glyphosate + chlorimuron-ethyl. Em cada período, foram calculados o índice de importância relativa e os índices de diversidade e equitabilidade; por meio da análise de regressão dos dados de produtividade de grãos, determinou-se o PAI. Digitaria insularis, Acanthospermum hispidum, Raphanus raphanistrum e Commelina benghalensis apresentaram maior importância relativa. Os índices de diversidade e equitabilidade oscilaram durante os períodos, e a diferença entre as plantas daninhas fundamentou-se no acúmulo de massa seca. O PAI na soja no tratamento com glyphosate foi de 37 dias após a semeadura (DAS e de 51 DAS naquele com glyphosate + chlorimuron-ethyl. A adição de chlorimuron-ethyl ao glyphosate permite que a cultura conviva mais tempo com as plantas daninhas sem que ocorra redução significativa na produtividade.The effects of burndown herbicides on the period before weed interference (PBI may provide support to weed management decision-making. The objective of this research was to verify whether the PBI is affected by the application of glyphosate plus chlorimuron-ethyl to pre-sowing burndown in soybean. The experiment was carried out in Jaboticabal-SP, Brazil, submitting the cultivar Monsoy 7908RR to eight coexistence periods with weeds, maintaining weedy and-weed-free checks, which were applied to two groups of treatments: glyphosate and glyphosate + chlorimuron-ethyl. At

  17. BRS 369RF and BRS 370RF: Glyphosate tolerant, high-yielding upland cotton cultivars for central Brazilian savanna

    Directory of Open Access Journals (Sweden)

    Camilo de Lelis Morello

    2015-12-01

    Full Text Available BRS 369RF and BRS 370RF were developed by the EMBRAPA as a part of efforts to create high-yielding germplasm with combinations of transgenic traits. BRS 369RF and BRS 370RF are midseason cultivars and have yield stability, adaptation to the central Brazilian savanna, good fiber quality and tolerance to glyphosate herbicide.

  18. Field Phenotyping of Soybean Roots for Drought Stress Tolerance

    Directory of Open Access Journals (Sweden)

    Berhanu A. Fenta

    2014-08-01

    Full Text Available Root architecture was determined together with shoot parameters under well watered and drought conditions in the field in three soybean cultivars (A5409RG, Jackson and Prima 2000. Morphology parameters were used to classify the cultivars into different root phenotypes that could be important in conferring drought tolerance traits. A5409RG is a drought-sensitive cultivar with a shallow root phenotype and a root angle of <40°. In contrast, Jackson is a drought-escaping cultivar. It has a deep rooting phenotype with a root angle of >60°. Prima 2000 is an intermediate drought-tolerant cultivar with a root angle of 40°–60°. It has an intermediate root phenotype. Prima 2000 was the best performing cultivar under drought stress, having the greatest shoot biomass and grain yield under limited water availability. It had abundant root nodules even under drought conditions. A positive correlation was observed between nodule size, above-ground biomass and seed yield under well-watered and drought conditions. These findings demonstrate that root system phenotyping using markers that are easy-to-apply under field conditions can be used to determine genotypic differences in drought tolerance in soybean. The strong association between root and nodule parameters and whole plant productivity demonstrates the potential application of simple root phenotypic markers in screening for drought tolerance in soybean.

  19. Factors affecting the fate and transport of glyphosate and AMPA into surface waters of agricultural watersheds in the United States and Europe

    Science.gov (United States)

    Coupe, R.; Kalkhoff, S.; Capel, P.; Gregoire, C.

    2012-04-01

    Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used extensively in almost all agricultural and urban areas of the United States and Europe. Although, glyphosate is used widely throughout the world in the production of many crops, it is predominately used in the United States on soybeans, corn, potatoes, and cotton that have been genetically modified to be tolerant to glyphosate. From 1992 to 2007, the agricultural use of glyphosate has increased from less than 10,000 Mg to more than 80,000 Mg, respectively. The greatest areal use is in the midwestern United States where glyphosate is applied on transgenic corn and soybeans. Because of the difficulty and expense in analyzing for glyphosate and AMPA (aminomethylphosphonic acid, a primary glyphosate degradate) in water, there have been only small scale studies on the fate and transport of glyphosate. The characterization of the transport of glyphosate and AMPA on a watershed scale is lacking. Glyphosate and AMPA were frequently detected in the surface waters of 4 agricultural watersheds in studies conducted by the U.S. Geological Survey in the United States and at the Laboratory of Hydrology and Geochemistry of Strasbourg. Two of these basins were located in the midwestern United States where the major crops are corn and soybean, the third is located the lower Mississippi River Basin where the major crops are soybean, corn, rice, and cotton, and the fourth was located near Strasbourg, France where the use of glyphosate was on a vineyard. The load as a percent of use ranged from 0.009 to 0.86 percent and could be related to 3 factors: source strength, hydrology, and flowpath. Glyphosate use in a watershed results in some occurrence in surface water at the part per billion level; however, those watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff, and a flowpath that does not include transport through the soil.

  20. Herbicide-tolerant Transgenic Soybean over 15 Years of Cultivation: Pesticide Use, Weed Resistance, and Some Economic Issues. The Case of the USA

    Directory of Open Access Journals (Sweden)

    Sylvie Bonny

    2011-08-01

    Full Text Available Genetically modified (GM herbicide-tolerant (HT crops have been largely adopted where they have been authorized. Nevertheless, they are fiercely criticized by some, notably because of the herbicide use associated with them. However, how much herbicide is applied to GMHT crops compared to conventional crops, and what impacts does the use of herbicide have? The paper first presents some factors explaining the predominance of GMHT crops. Then, trends in the use of herbicide for GM crops are studied in the case of the most widespread HT crop: HT soybean in the USA. The trends in the toxicity of herbicides applied to HT soybean are also addressed, as well as the appearance of glyphosate-resistant (GR weeds. Lastly, the paper examines the spread of GR weeds and its impact. How are farmers, weed scientists, and the industry coping with this development, and what are the prospects of glyphosate-tolerant crops given weed resistance? In conclusion, some issues of sustainability and innovation governance raised by genetically modified herbicide-tolerant crops are discussed.

  1. Ecotoxicological assessment of Roundup-ready soybean agriculture investigated in a D. magna model

    OpenAIRE

    Cuhra, Marek

    2015-01-01

    Paper III of this thesis is not available i Munin: III: M. Cuhra, T. Traavik & T. Bøhn. 2014. 'Life cycle fitness differences in Daphnia magna fed Roundup-Ready soybean or conventional soybean or organic soybean', available in Aquaculture Nutrition Transgenic glyphosate tolerant soybeans are constituents of an industrial production system with specific agricultural practices and supplementary agrochemicals as interwoven additional elements. Thus the material produced should not be see...

  2. Características da epiderme foliar de eucalipto e seu envolvimento com a tolerância ao glyphosate Characteristics of eucalypt leaf epidermis and its role in glyphosate tolerance

    Directory of Open Access Journals (Sweden)

    L.D. Tuffi Santos

    2006-09-01

    Full Text Available Em áreas de reflorestamento, a deriva do glyphosate causa injúrias nas plantas de eucalipto. Trabalhos preliminares de pesquisa e observações de campo apontam para uma tolerância diferencial ao glyphosate entre os genótipos cultivados. Nesse contexto, objetivou-se estudar as estruturas anatômicas da epiderme foliar de cinco espécies de eucalipto, correlacionando com a tolerância ao glyphosate em deriva simulada. Utilizou-se o esquema fatorial, sendo cinco espécies (Eucalyptus urophylla, E. grandis, E. pellita, E. resinifera e E. saligna e cinco subdoses (0; 43,2; 86,4; 172,8 e 345,6 g e.a. ha-1 de glyphosate, simulando uma deriva. Imediatamente antes da aplicação do herbicida, coletaram-se folhas, totalmente expandidas, para análise anatômica da superfície epidérmica segundo metodologia de dissociação. Entre as espécies estudadas, E. resinifera mostrou-se mais tolerante à deriva de glyphosate, apresentando os menores valores de porcentagem de intoxicação aos 45 dias após aplicação, não sendo encontrada diferença entre as demais espécies. As cinco espécies apresentam folhas glabras, anfiestomáticas, com estômatos do tipo anomocítico e cutícula proeminente. Apesar de presentes em ambas as faces, os estômatos são raros na face adaxial, apresentando baixo índice e densidade estomática. Os maiores valores para índice estomático foram observados em E. resinifera, enquanto E. saligna apresentou a maior densidade estomática. Cavidades subepidérmicas evidenciadas na superfície pelas células de cobertura estão presentes nas cinco espécies, com maior densidade em E. pellita. Houve alta correlação entre a porcentagem de intoxicação por glyphosate e o número de células epidérmicas da superfície adaxial, indicando envolvimento desta característica com a tolerância diferencial ao herbicida. Estudos sobre absorção, translocação e metabolismo do glyphosate em eucalipto devem ser realizados para elucidar

  3. Levels of glyphosate in surface waters, sediments and soils associated with direct sowing soybean cultivation in north pampasic region of Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Peruzzo, Pablo J. [Grupo Materiales Polimericos, INIFTA - Instituto de Investigaciones Fisicoquimicas Teoricas y Aplicadas (UNLP-CONICET), Diag. 113 y 64, CC 16 Suc 4, 1900 La Plata (Argentina); Porta, Atilio A. [CIMA - Centro de Investigaciones del Medio Ambiente, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, 47 y 115, 1900 La Plata (Argentina); Division Quimica Analitica, Departamento de Quimica, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, 47 y 115, 1900 La Plata (Argentina)], E-mail: aporta@quimica.unlp.edu.ar; Ronco, Alicia E. [CIMA - Centro de Investigaciones del Medio Ambiente, Facultad de Ciencias Exactas, Universidad Nacional de La Plata, 47 y 115, 1900 La Plata (Argentina)

    2008-11-15

    Levels of glyphosate were determined in water, soil and sediment samples from a transgenic soybean cultivation area located near to tributaries streams of the Pergamino-Arrecifes system in the north of the Province of Buenos Aires, Argentina. Field work took into account both the pesticide application and the rains occurring after applications. The pesticide was analysed by HPLC-UV detection, previous derivatization with 9-fluorenylmethylchloroformate (FMOC-Cl). In addition, SoilFug multimedia model was used to analyse the environmental distribution of the pesticides. In the field, levels of glyphosate in waters ranged from 0.10 to 0.70 mg/L, while in sediments and soils values were between 0.5 and 5.0 mg/Kg. Temporal variation of glyphosate levels depended directly on the time of application and the rain events. The results obtained from the application of the model are in accordance with the values found in the field. - Glyphosate concentrations in the environment from a region where little information exists about this and intensive cultivation activities predominate in large areas.

  4. Levels of glyphosate in surface waters, sediments and soils associated with direct sowing soybean cultivation in north pampasic region of Argentina

    International Nuclear Information System (INIS)

    Peruzzo, Pablo J.; Porta, Atilio A.; Ronco, Alicia E.

    2008-01-01

    Levels of glyphosate were determined in water, soil and sediment samples from a transgenic soybean cultivation area located near to tributaries streams of the Pergamino-Arrecifes system in the north of the Province of Buenos Aires, Argentina. Field work took into account both the pesticide application and the rains occurring after applications. The pesticide was analysed by HPLC-UV detection, previous derivatization with 9-fluorenylmethylchloroformate (FMOC-Cl). In addition, SoilFug multimedia model was used to analyse the environmental distribution of the pesticides. In the field, levels of glyphosate in waters ranged from 0.10 to 0.70 mg/L, while in sediments and soils values were between 0.5 and 5.0 mg/Kg. Temporal variation of glyphosate levels depended directly on the time of application and the rain events. The results obtained from the application of the model are in accordance with the values found in the field. - Glyphosate concentrations in the environment from a region where little information exists about this and intensive cultivation activities predominate in large areas

  5. Metabolic profiles of flooding-tolerant mechanism in early-stage soybean responding to initial stress.

    Science.gov (United States)

    Wang, Xin; Zhu, Wei; Hashiguchi, Akiko; Nishimura, Minoru; Tian, Jingkui; Komatsu, Setsuko

    2017-08-01

    Metabolomic analysis of flooding-tolerant mutant and abscisic acid-treated soybeans suggests that accumulated fructose might play a role in initial flooding tolerance through regulation of hexokinase and phosphofructokinase. Soybean is sensitive to flooding stress, which markedly reduces plant growth. To explore the mechanism underlying initial-flooding tolerance in soybean, mass spectrometry-based metabolomic analysis was performed using flooding-tolerant mutant and abscisic-acid treated soybeans. Among the commonly-identified metabolites in both flooding-tolerant materials, metabolites involved in carbohydrate and organic acid displayed same profile at initial-flooding stress. Sugar metabolism was highlighted in both flooding-tolerant materials with the decreased and increased accumulation of sucrose and fructose, respectively, compared to flooded soybeans. Gene expression of hexokinase 1 was upregulated in flooded soybean; however, it was downregulated in both flooding-tolerant materials. Metabolites involved in carbohydrate/organic acid and proteins related to glycolysis/tricarboxylic acid cycle were integrated. Increased protein abundance of phosphofructokinase was identified in both flooding-tolerant materials, which was in agreement with its enzyme activity. Furthermore, sugar metabolism was pointed out as the tolerant-responsive process at initial-flooding stress with the integration of metabolomics, proteomics, and transcriptomics. Moreover, application of fructose declined the increased fresh weight of plant induced by flooding stress. These results suggest that fructose might be the critical metabolite through regulation of hexokinase and phosphofructokinase to confer initial-flooding stress in soybean.

  6. Analyses of flooding tolerance of soybean varieties at emergence and varietal differences in their proteomes.

    Science.gov (United States)

    Nanjo, Yohei; Jang, Hee-Young; Kim, Hong-Sig; Hiraga, Susumu; Woo, Sun-Hee; Komatsu, Setsuko

    2014-10-01

    Flooding of fields due to heavy and/or continuous rainfall influences soybean production. To identify soybean varieties with flooding tolerance at the seedling emergence stage, 128 soybean varieties were evaluated using a flooding tolerance index, which is based on plant survival rates, the lack of apparent damage and lateral root development, and post-flooding radicle elongation rate. The soybean varieties were ranked according to their flooding tolerance index, and it was found that the tolerance levels of soybean varieties exhibit a continuum of differences between varieties. Subsequently, tolerant, moderately tolerant and sensitive varieties were selected and subjected to comparative proteomic analysis to clarify the tolerance mechanism. Proteomic analysis of the radicles, combined with correlation analysis, showed that the ratios of RNA binding/processing related proteins and flooding stress indicator proteins were significantly correlated with flooding tolerance index. The RNA binding/processing related proteins were positively correlated in untreated soybeans, whereas flooding stress indicator proteins were negatively correlated in flooded soybeans. These results suggest that flooding tolerance is regulated by mechanisms through multiple factors and is associated with abundance levels of the identified proteins. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Transgenic rice expressing a codon-modified synthetic CP4-EPSPS confers tolerance to broad-spectrum herbicide, glyphosate.

    Science.gov (United States)

    Chhapekar, Sushil; Raghavendrarao, Sanagala; Pavan, Gadamchetty; Ramakrishna, Chopperla; Singh, Vivek Kumar; Phanindra, Mullapudi Lakshmi Venkata; Dhandapani, Gurusamy; Sreevathsa, Rohini; Ananda Kumar, Polumetla

    2015-05-01

    Highly tolerant herbicide-resistant transgenic rice was developed by expressing codon-modified synthetic CP4--EPSPS. The transformants could tolerate up to 1% commercial glyphosate and has the potential to be used for DSR (direct-seeded rice). Weed infestation is one of the major biotic stress factors that is responsible for yield loss in direct-seeded rice (DSR). Herbicide-resistant rice has potential to improve the efficiency of weed management under DSR. Hence, the popular indica rice cultivar IR64, was genetically modified using Agrobacterium-mediated transformation with a codon-optimized CP4-EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene, with N-terminal chloroplast targeting peptide from Petunia hybrida. Integration of the transgenes in the selected rice plants was confirmed by Southern hybridization and expression by Northern and herbicide tolerance assays. Transgenic plants showed EPSPS enzyme activity even at high concentrations of glyphosate, compared to untransformed control plants. T0, T1 and T2 lines were tested by herbicide bioassay and it was confirmed that the transgenic rice could tolerate up to 1% of commercial Roundup, which is five times more in dose used to kill weeds under field condition. All together, the transgenic rice plants developed in the present study could be used efficiently to overcome weed menace.

  8. Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

    Science.gov (United States)

    Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

    2017-04-01

    Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

  9. Avaliação do uso de glyphosate em soja geneticamente modificada e sua relação com o ácido chiquímico Evaluation of glyphosate application on transgenic soybean and its relationship with shikimic acid

    Directory of Open Access Journals (Sweden)

    D.A.S. Franco

    2012-09-01

    plantas de soja transgênica no campo quando tratadas de forma isolada com glyphosate. Os resultados também mostraram exsudação radicular do glyphosate por soja transgênica, com posterior absorção por soja convencional. Foram detectados resíduos de glyphosate e ácido aminometilfosfônico na solução nutritiva.Glyphosate [N-(phosphonomethyl glycine]-resistant crops (GRC are the transgenic crops most extensively grown worldwide, with soybean being the major GRC. It is important to evaluate the impact of glyphosate on transgenic soybean and its relationship with shikimic acid. A field experiment was conducted at Engenheiro Coelho-SP, Brazil, during the agricultural year 2007/2008 to evaluate the effect of glyphosate on the growth, development, and seed quality of GRC soybean variety BRS Valiosa RR. A randomized block design was used with four replications. Glyphosate was applied at 720 and 960 g a.e. ha-1 (acid equivalent and in sequence at the doses 720/720, 960/720, and 960/720/720 g a.e. ha-1 (acid equivalent. To evaluate transfer from GRC soybean to non GRC soybean cultivated in nutrient solution, a pot experiment was conducted at Instituto Biológico, SP, Brazil. Glyphosate was applied on the GRC soybean (M8045RR at 2,400 g a.e. ha-1. Both GRC soybean and non GRC soybean were sown in the same box with nutrient solution. At 0, 1, 3, 7, and 10 days after application, shikimic acid was measured by HPLC and the glyphosate and aminomethylphosphonic acid (AMPA levels in nutrient solution were determined by GC-MS. The results showed that yield, plant height, seed oil, and protein contents were not affected by glyphosate application. GRC soybean accumulated shikimic acid in the field. Glyphosate and AMPA were released through the roots of GRC soybean, and subsequently taken up by non-GRC soybean, exerting inhibitory effects on their shikimic pathway.

  10. Weeds and ground-dwelling predators′ response to two different weed management systems in glyphosate-tolerant cotton: A farm-scale study

    Science.gov (United States)

    Farinós, Gema P.; Gómez, Pablo; Gutiérrez, Elena; Sánchez, Francisco Javier; Escorial, María Concepción; Ortego, Félix; Chueca, María Cristina; Castañera, Pedro

    2018-01-01

    The use of glyphosate, as a post-emergence broad-spectrum herbicide in genetically modified glyphosate-tolerant (GT) cotton, supposes a big change in weed management programs with respect to a conventional regime. Thus, alterations in arable flora and arthropod fauna must be considered when evaluating their potential impacts. A 3-year farm-scale study was conducted in a 2-ha GT cotton crop, in southern Spain, to compare the effects of conventional and glyphosate herbicide regimes on weed abundance and diversity and their consequences for ground-dwelling predators. Surveys reveal that weed density was relatively low within all treatments with a few dominant species, with significantly higher weed densities and modifications of the floristic composition in glyphosate-treated plots that led to an increase in the abundance of Portulaca oleracea and to a reduction in plant diversity. The activity-density of the main predatory arthropod taxa (spiders, ground beetles, rove beetles and earwigs) varied among years, but no significant differences were obtained between conventional and glyphosate herbicide regimes. However, significant differences between treatments were obtained for ground beetles species richness and diversity, being higher under the glyphosate herbicide regime, and a positive correlation with weed density could be established for both parameters. The implications of these findings to weed control in GT cotton are discussed. PMID:29351549

  11. Weeds and ground-dwelling predators' response to two different weed management systems in glyphosate-tolerant cotton: A farm-scale study.

    Science.gov (United States)

    García-Ruiz, Esteban; Loureiro, Íñigo; Farinós, Gema P; Gómez, Pablo; Gutiérrez, Elena; Sánchez, Francisco Javier; Escorial, María Concepción; Ortego, Félix; Chueca, María Cristina; Castañera, Pedro

    2018-01-01

    The use of glyphosate, as a post-emergence broad-spectrum herbicide in genetically modified glyphosate-tolerant (GT) cotton, supposes a big change in weed management programs with respect to a conventional regime. Thus, alterations in arable flora and arthropod fauna must be considered when evaluating their potential impacts. A 3-year farm-scale study was conducted in a 2-ha GT cotton crop, in southern Spain, to compare the effects of conventional and glyphosate herbicide regimes on weed abundance and diversity and their consequences for ground-dwelling predators. Surveys reveal that weed density was relatively low within all treatments with a few dominant species, with significantly higher weed densities and modifications of the floristic composition in glyphosate-treated plots that led to an increase in the abundance of Portulaca oleracea and to a reduction in plant diversity. The activity-density of the main predatory arthropod taxa (spiders, ground beetles, rove beetles and earwigs) varied among years, but no significant differences were obtained between conventional and glyphosate herbicide regimes. However, significant differences between treatments were obtained for ground beetles species richness and diversity, being higher under the glyphosate herbicide regime, and a positive correlation with weed density could be established for both parameters. The implications of these findings to weed control in GT cotton are discussed.

  12. Manejo de capim pé-de-galinha em lavouras de soja transgênica resistente ao glifosato Management of goose grass on transgenic soybean, resistant to glyphosate

    Directory of Open Access Journals (Sweden)

    André da Rosa Ulguim

    2013-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a resistência de capim pé-de-galinha (Eleusine indica ao glifosato, em lavouras de soja transgênica; avaliar o efeito de aplicações de glifosato em diferentes estádios de desenvolvimento; identificar práticas agronômicas associadas à seleção de biótipos resistentes; e avaliar a eficiência dos herbicidas cletodim, fluazifope-P-butílico, clomazona, glufosinato de amônio e glifosato nas plantas resistentes. Plantas escapes ao tratamento com glifosato foram coletadas em 24 propriedades, no Rio Grande do Sul. As plantas foram cultivadas em casa de vegetação, tendo-se avaliado a sua resistência ao glifosato. Os acessos resistentes foram selecionados e avaliados quanto ao efeito da aplicação do glifosato em diferentes estádios de crescimento e quanto à sensibilidade aos herbicidas. Foi aplicado um questionário aos produtores para identificação das práticas agronômicas associadas às falhas no controle. O controle de E. indica pelo glifosato é mais efetivo com a aplicação em estádios iniciais de desenvolvimento. Práticas agronômicas, como uso contínuo de baixas doses do herbicida, aplicação em estádios de desenvolvimento avançados das plantas daninhas (mais de um afilho e a ausência de rotação de culturas foram relacionadas às falhas de controle observadas. Os herbicidas cletodim, fluazifope-P-butílico e glufosinato de amônio são alternativas eficientes para o controle de E. indica.The objective of this work was to evaluate the resistance of goose grass (Eleusine indica to glyphosate application in transgenic soybean crops; evaluate the effect of glyphosate applications in different growth stages; identify the main agronomic practices associated with the selection of resistant biotypes; and evaluate the effect of the herbicides clethodim, fluazifop-p-butyl, clomazone, glufosinate ammonium, and glyphosate on resistant plants. Plants that survived glyphosate application

  13. Understanding abiotic stress tolerance mechanisms in soybean: a comparative evaluation of soybean response to drought and flooding stress.

    Science.gov (United States)

    Mutava, Raymond N; Prince, Silvas Jebakumar K; Syed, Naeem Hasan; Song, Li; Valliyodan, Babu; Chen, Wei; Nguyen, Henry T

    2015-01-01

    Many sources of drought and flooding tolerance have been identified in soybean, however underlying molecular and physiological mechanisms are poorly understood. Therefore, it is important to illuminate different plant responses to these abiotic stresses and understand the mechanisms that confer tolerance. Towards this goal we used four contrasting soybean (Glycine max) genotypes (PI 567690--drought tolerant, Pana--drought susceptible, PI 408105A--flooding tolerant, S99-2281--flooding susceptible) grown under greenhouse conditions and compared genotypic responses to drought and flooding at the physiological, biochemical, and cellular level. We also quantified these variations and tried to infer their role in drought and flooding tolerance in soybean. Our results revealed that different mechanisms contribute to reduction in net photosynthesis under drought and flooding stress. Under drought stress, ABA and stomatal conductance are responsible for reduced photosynthetic rate; while under flooding stress, accumulation of starch granules played a major role. Drought tolerant genotypes PI 567690 and PI 408105A had higher plastoglobule numbers than the susceptible Pana and S99-2281. Drought stress increased the number and size of plastoglobules in most of the genotypes pointing to a possible role in stress tolerance. Interestingly, there were seven fibrillin proteins localized within the plastoglobules that were up-regulated in the drought and flooding tolerant genotypes PI 567690 and PI 408105A, respectively, but down-regulated in the drought susceptible genotype Pana. These results suggest a potential role of Fibrillin proteins, FBN1a, 1b and 7a in soybean response to drought and flooding stress. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  14. Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.

    Directory of Open Access Journals (Sweden)

    Alfi Inayati

    2016-04-01

    Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.

  15. Glyphosate Mineralization: Effect of Temperature and Soybean and Corn Crop Residues Mineralización de Glifosato: Efecto de la Temperatura y los Residuos Vegetales de Soya y Maíz

    Directory of Open Access Journals (Sweden)

    Ariel Rampoldi

    2008-03-01

    Full Text Available Mineralization is the main mechanism of dissipation of glyphosate herbicide (N-[phosphonomethyl] glycine in soil. However, there is scarce information about the mineralization process in strata formed by stubbles in no-tillage systems. The kinetics and rate of mineralization of herbicide in stubbles of soybean (Glycine max L. Merr. and corn (Zea mays L. were investigated. To evaluate the effect of age of crop residues, samples of soybean stubbles were collected immediately after harvest (Soja 1 and four months after harvest (Soja 2. Corn crop residues were collected three months after harvest. Glyphosate evolution and total microbial activity (TMA were monitored by release of 14C-CO2 and C-CO2 under laboratory conditions with two temperatures, 15 and 28 ºC. Crop residues size was evaluated using grinding (1 mm and cut (1 to 2 cm stubbles. Results showed that glyphosate mineralization was affected by the incubation temperature and the origin and age of crop residues. Size of crop residues did not modify glyphosate mineralization. Average glyphosate mineralization after 56 days of incubation at 15 and 28 ºC was of 3.9 and 9.9%, respectively, of the 14C-glyphosate initially applied. In maize crop residues the percentages were 2.0 and 3.0%, respectively, at 15 and 28 ºC. A similar evolution was detected for TMA. The co-metabolic nature of glyphosate mineralization was corroborated. An inverse relation between C/N ratio and glyphosate mineralization was detected. Higher glyphosate mineralization was detected in fresh soybean stubbles, suggesting that applications on aged crop residues could increase the persistence of glyphosate in no-tillage systemsLa mineralización es el principal mecanismo de disipación del herbicida glifosato (N-[fosfonometil] glicina en el suelo. Existe escasa información sobre el proceso de mineralización de glifosato en el estrato formado por rastrojos en suelos cultivados en sistema de siembra directa. Las muestras de

  16. Root growth and lignification of glyphosate susceptible and resistant soybean at low temperaturesCrescimento e lignificação de raízes de soja convencional e resistente ao glifosato, em baixa temperatura

    Directory of Open Access Journals (Sweden)

    Patricia da Costa Zonetti

    2013-05-01

    Full Text Available Low temperature stress affects plant growth, including primary and secondary metabolism. Glyphosateresistant soybean contains a modified DNA, which encodes a different type of secondary metabolism enzyme related to lignin synthesis compared to conventional glyphosate-susceptible cultivars. Thus, this soybean cultivar might respond differently to low temperatures, compared to glyphosate-susceptible cultivars. This work aimed to investigate how decreasing temperatures influence the growth and lignin content of the glyphosate-resistant soybean compared to its susceptible parental cultivars. Three-day-old seedlings were cultivated in nutrient solution at 10, 15, 20, and 25°C (±2°C, using a 12-h photoperiod. After 96 h, taproot growth, fresh and dry biomass, and lignin levels were determined. The results indicate that lower temperatures decreased seedling and root growth in both types of cultivars; however, glyphosate-resistant soybean exhibited greater root length, biomass, and lignin content compared to the glyphosate-susceptible parental cultivar. O estresse causado pela baixa temperatura, dentre outras implicações, afeta o crescimento do vegetal assim como o seu metabolismo secundário. Pelo fato da soja RR apresentar variante enzimática de uma das principais vias do metabolismo secundário, ligada à síntese de lignina, pode apresentar comportamento diferenciado, sob baixa temperatura, se comparada com sua linhagem parental. O objetivo deste trabalho foi investigar possíveis diferenças no crescimento e nos conteúdos de lignina nas raízes de soja cultivar transgênica resistente ao glifosato e cultivar parental em resposta a redução de temperatura. Após três dias de germinação das sementes, as plântulas foram mantidas em solução nutritiva, a 10, 15, 20 e 25°C (±2°C, com fotoperíodo de 12 horas. Após 96 horas, foi avaliado o comprimento relativo da raiz primária, biomassa fresca e seca das raízes e os teores de lignina

  17. On glyphosate

    Directory of Open Access Journals (Sweden)

    Tamas Komives

    2016-11-01

    Full Text Available This Editorial briefly discusses the current issues surrounding glyphosate - the most controversial pesticide active ingredient of our time. The paper pays special attention to the effects of glyphosate on plant-pathogen interactions.

  18. Strategy for selection of soybean genotypes tolerant to drought during germination.

    Science.gov (United States)

    Dantas, S A G; Silva, F C S; Silva, L J; Silva, F L

    2017-05-10

    Water deficit is the main reason for instability in the context of soybean culture. The development of strategies for the selection of more tolerant genotypes is necessary. These strategies include the use of polyethylene glycol 6000 solutions (PEG-6000) for conducting the germination test under conditions of water restriction. Thus, the objective of this study was to determine the osmotic potential and the main characteristics that promote the discrimination of soybean genotypes with regard to water stress tolerance during germination and the vigor test. Thirteen soybean cultivars were used. The seeds were allowed to germinate on sheets of germitest paper moistened in solution with PEG-6000, simulating different levels of water availability, which is expressed as osmotic potential (0.0, -0.2, -0.4, and -0.6 MPa). We assessed germination, length, and dry mass for seedlings and seeds, as well as reserve dynamics. Germination and variables related to the dynamics of reservation have great influence on the expression of variability in environments under stress. Among the different osmotic potentials, the -0.2 MPa was the most efficient for the expression of genetic variability among the cultivars. Conducting the germination test with PEG-6000 solution to -0.2 MPa was efficient for selecting soybean cultivars tolerant to water stress. This was accomplished by evaluating the percentage of germination, along with variables related to the dynamics of reservation.

  19. Concerns over use of glyphosate-based herbicides and risks associated with exposures: a consensus statement.

    Science.gov (United States)

    Myers, John Peterson; Antoniou, Michael N; Blumberg, Bruce; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vandenberg, Laura N; Vom Saal, Frederick S; Welshons, Wade V; Benbrook, Charles M

    2016-02-17

    The broad-spectrum herbicide glyphosate (common trade name "Roundup") was first sold to farmers in 1974. Since the late 1970s, the volume of glyphosate-based herbicides (GBHs) applied has increased approximately 100-fold. Further increases in the volume applied are likely due to more and higher rates of application in response to the widespread emergence of glyphosate-resistant weeds and new, pre-harvest, dessicant use patterns. GBHs were developed to replace or reduce reliance on herbicides causing well-documented problems associated with drift and crop damage, slipping efficacy, and human health risks. Initial industry toxicity testing suggested that GBHs posed relatively low risks to non-target species, including mammals, leading regulatory authorities worldwide to set high acceptable exposure limits. To accommodate changes in GBH use patterns associated with genetically engineered, herbicide-tolerant crops, regulators have dramatically increased tolerance levels in maize, oilseed (soybeans and canola), and alfalfa crops and related livestock feeds. Animal and epidemiology studies published in the last decade, however, point to the need for a fresh look at glyphosate toxicity. Furthermore, the World Health Organization's International Agency for Research on Cancer recently concluded that glyphosate is "probably carcinogenic to humans." In response to changing GBH use patterns and advances in scientific understanding of their potential hazards, we have produced a Statement of Concern drawing on emerging science relevant to the safety of GBHs. Our Statement of Concern considers current published literature describing GBH uses, mechanisms of action, toxicity in laboratory animals, and epidemiological studies. It also examines the derivation of current human safety standards. We conclude that: (1) GBHs are the most heavily applied herbicide in the world and usage continues to rise; (2) Worldwide, GBHs often contaminate drinking water sources, precipitation, and air

  20. Expression of Root-Related Transcription Factors Associated with Flooding Tolerance of Soybean (Glycine max

    Directory of Open Access Journals (Sweden)

    Babu Valliyodan

    2014-09-01

    Full Text Available Much research has been conducted on the changes in gene expression of the model plant Arabidopsis to low-oxygen stress. Flooding results in a low oxygen environment in the root zone. However, there is ample evidence that tolerance to soil flooding is more than tolerance to low oxygen alone. In this study, we investigated the physiological response and differential expression of root-related transcription factors (TFs associated with the tolerance of soybean plants to soil flooding. Differential responses of PI408105A and S99-2281 plants to ten days of soil flooding were evaluated at physiological, morphological and anatomical levels. Gene expression underlying the tolerance response was investigated using qRT-PCR of root-related TFs, known anaerobic genes, and housekeeping genes. Biomass of flood-sensitive S99-2281 roots remained unchanged during the entire 10 days of flooding. Flood-tolerant PI408105A plants exhibited recovery of root growth after 3 days of flooding. Flooding induced the development of aerenchyma and adventitious roots more rapidly in the flood-tolerant than the flood-sensitive genotype. Roots of tolerant plants also contained more ATP than roots of sensitive plants at the 7th and 10th days of flooding. Quantitative transcript analysis identified 132 genes differentially expressed between the two genotypes at one or more time points of flooding. Expression of genes related to the ethylene biosynthesis pathway and formation of adventitious roots was induced earlier and to higher levels in roots of the flood-tolerant genotype. Three potential flood-tolerance TFs which were differentially expressed between the two genotypes during the entire 10-day flooding duration were identified. This study confirmed the expression of anaerobic genes in response to soil flooding. Additionally, the differential expression of TFs associated with soil flooding tolerance was not qualitative but quantitative and temporal. Functional analyses of

  1. Expression of root-related transcription factors associated with flooding tolerance of soybean (Glycine max).

    Science.gov (United States)

    Valliyodan, Babu; Van Toai, Tara T; Alves, Jose Donizeti; de Fátima P Goulart, Patricia; Lee, Jeong Dong; Fritschi, Felix B; Rahman, Mohammed Atiqur; Islam, Rafiq; Shannon, J Grover; Nguyen, Henry T

    2014-09-29

    Much research has been conducted on the changes in gene expression of the model plant Arabidopsis to low-oxygen stress. Flooding results in a low oxygen environment in the root zone. However, there is ample evidence that tolerance to soil flooding is more than tolerance to low oxygen alone. In this study, we investigated the physiological response and differential expression of root-related transcription factors (TFs) associated with the tolerance of soybean plants to soil flooding. Differential responses of PI408105A and S99-2281 plants to ten days of soil flooding were evaluated at physiological, morphological and anatomical levels. Gene expression underlying the tolerance response was investigated using qRT-PCR of root-related TFs, known anaerobic genes, and housekeeping genes. Biomass of flood-sensitive S99-2281 roots remained unchanged during the entire 10 days of flooding. Flood-tolerant PI408105A plants exhibited recovery of root growth after 3 days of flooding. Flooding induced the development of aerenchyma and adventitious roots more rapidly in the flood-tolerant than the flood-sensitive genotype. Roots of tolerant plants also contained more ATP than roots of sensitive plants at the 7th and 10th days of flooding. Quantitative transcript analysis identified 132 genes differentially expressed between the two genotypes at one or more time points of flooding. Expression of genes related to the ethylene biosynthesis pathway and formation of adventitious roots was induced earlier and to higher levels in roots of the flood-tolerant genotype. Three potential flood-tolerance TFs which were differentially expressed between the two genotypes during the entire 10-day flooding duration were identified. This study confirmed the expression of anaerobic genes in response to soil flooding. Additionally, the differential expression of TFs associated with soil flooding tolerance was not qualitative but quantitative and temporal. Functional analyses of these genes will be

  2. Efeitos dos herbicidas glyphosate e paraquat, aplicados ao solo, sobre a emergência de feijão e soja e de algumas espécies daninhas Effects of the herbicides glyphosate and paraquat, applied to the soil, on the emergence of dry beans and soybeans and some weed species

    Directory of Open Access Journals (Sweden)

    C.A. Dias

    1982-06-01

    Full Text Available Em trabalho conduzido a campo na Estação Experimental Agronômica da UFRGS, Guaíba, RS em 1979/80, usaram-se os herbicidas glyphosate, paraquat e sua combinação, objetivando determinar os efe itos de doses e de épocas de aplicação destes herbicidas em plântulas de feijão e de soja e sobre nutrientes do solo. Pelos resultados obtidos para emergência e peso de maté ria seca da parte aé re a de soja , não houve di ferenças para os tratamentos testados. Também não ocorreram diferenças significativas à população in ic ia l de feijão e sobre os elementos de solo analisados (Ca, Mg e K. Com relação ao peso de matéria seca da parte aérea do feijão, verificou-se que houve interação entre herbicida e doses usadas, tendo glyphosate isolado e glyphosate mais paraquat aplicados seqüencialmente nas doses máximas causado redução significativa naquele parâmetro. Com relação ao paraquat, não foram detectadas diferenças significativas entre as doses testadas.A field xeperiment was conducted during the 1979/80 growing season at the Agronomic Experimental Station of the Federal University of Rio Grande do Sul, in Guaíba, RS, Brazil, in order to evaluate the efects of rates and times of appl ication of the herbicides glyphosate, paraqu at, and the ir combin at ion, on dry beans (Phaseolus vulgaris L. and soybeans (Glvcine max (L. Merrill, and on some soil nutrierts. The results indicated no significant differences among the soybeans treatments tested fo r plant population and shoot dry weight. Also no sta ti sti cal diffe re nces occurred fo r dry beans plant population and for soil nutrients analysed (Ca, Mg, and K. For dry beans shoot dry weight, there was an interaction of herbicides and rates, where glyphosate sprayed alone and glyphosate plus paraquat applied at the maxima ra te s te sted caused significant decreases on that variable. For paraquat utilized alone, no significant effects were detected among the rates applied.

  3. GmCLC1 Confers Enhanced Salt Tolerance through Regulating Chloride Accumulation in Soybean

    Directory of Open Access Journals (Sweden)

    Peipei Wei

    2016-07-01

    Full Text Available The family of chloride channel proteins that mediate Cl- transportation play vital roles in plant nutrient supply, cellular action potential and turgor pressure adjustment, stomatal movement, hormone signal recognition and transduction, Cl- homeostasis, and abiotic and biotic stress tolerance. The anionic toxicity, mainly caused by chloride ions (Cl-, on plants under salt stress remains poorly understood. In this work, we investigated the function of soybean Cl-/H+ antiporter GmCLC1 under salt stress in transgenic Arabidopsis thaliana, soybean, and yeast. We found that GmCLC1 enhanced salt tolerance in transgenic A. thaliana by reducing the Cl- accumulation in shoots and hence released the negative impact of salt stress on plant growth. Overexpression of GmCLC1 in the hairy roots of soybean sequestered more Cl- in their roots and transferred less Cl- to their shoots, leading to lower relative electrolyte leakage values in the roots and leaves. When either the soybean GmCLC1 or the yeast chloride transporter gene, GEF1, was transformed into the yeast gef1 mutant, and then treated with different chloride salts (MnCl2, KCl, NaCl, enhanced survival rate was observed. The result indicates that GmCLC1 and GEF1 exerted similar effects on alleviating the stress of diverse chloride salts on the yeast gef1 mutant. Together, this work suggests a protective function of GmCLC1 under Cl- stress.

  4. Seletividade de cultivares de soja RR® submetidos a misturas em tanque de glyphosate + chlorimuron-ethyl associadas a óleo mineral e inseticidas selectivity of soybean RR® genotypes submitted to glyphosate + chlorimuron-ethyl tank mixtures associated to mineral oil and insecticides

    Directory of Open Access Journals (Sweden)

    C.D.G. Maciel

    2009-01-01

    Full Text Available O uso de glyphosate para o controle de plantas daninhas em soja RR® apresenta características essenciais no conceito de praticabilidade. Entretanto, apesar de não permitido na legislação brasileira, tem-se aumentado a associação com outros herbicidas para manejo de espécies de difícil controle, assim como a sua mistura em tanque em combinação com inseticidas e adjuvantes. Com o objetivo de avaliar a seletividade de cultivares de soja RR® submetidos a misturas em tanque de formulações de glyphosate (Polaris®, Roundup Ready® e Roundup WG® com chlorimuron-ethyl (Classic®, e suas associações com óleo mineral (Joint Oil® e inseticidas novaluron (Gallaxy 100 EC®, permethrin (Piredan® e methomyl (Lannate BR®, um experimento foi conduzido a campo na cidade de Maracaí-SP, na safra 2006/2007. O delineamento experimental utilizado foi o de blocos ao acaso, com quatro repetições, em esquema fatorial 16 x 4, sendo 16 as associações das misturas em tanque entre as formulações de glyphosate, óleo mineral e inseticidas e quatro cultivares: Monsoy 7210RR®, Monsoy 7979RR®, BRS 245RR® e CD 214RR®. Sintomas visuais de intoxicação inicial dos cultivares estudados foram caracterizados por clorose e encarquilhamento nas folhas para todas as misturas em tanque das formulações de glyphosate + chlorimuron-ethyl, associadas ou não ao óleo mineral e inseticidas novaluron, permethrin e methomyl. Todas as misturas em tanque não promoveram reduções significativas de produtividade para os cultivares Monsoy 7210RR®, Monsoy 7979RR® e BRS 245RR® e controlaram Ipomoea spp. com eficácia apenas satisfatória a partir dos 21 DAA (dias após aplicação.The use of glyphosate for weed control in soybean RR® presents essential practical characteristics. However, although not allowed by the current Brazilian legislation, the association with other herbicides has been increasing for species of difficult control, as well as the use of tank

  5. Glyphosate induces human breast cancer cells growth via estrogen receptors.

    Science.gov (United States)

    Thongprakaisang, Siriporn; Thiantanawat, Apinya; Rangkadilok, Nuchanart; Suriyo, Tawit; Satayavivad, Jutamaad

    2013-09-01

    Glyphosate is an active ingredient of the most widely used herbicide and it is believed to be less toxic than other pesticides. However, several recent studies showed its potential adverse health effects to humans as it may be an endocrine disruptor. This study focuses on the effects of pure glyphosate on estrogen receptors (ERs) mediated transcriptional activity and their expressions. Glyphosate exerted proliferative effects only in human hormone-dependent breast cancer, T47D cells, but not in hormone-independent breast cancer, MDA-MB231 cells, at 10⁻¹² to 10⁻⁶M in estrogen withdrawal condition. The proliferative concentrations of glyphosate that induced the activation of estrogen response element (ERE) transcription activity were 5-13 fold of control in T47D-KBluc cells and this activation was inhibited by an estrogen antagonist, ICI 182780, indicating that the estrogenic activity of glyphosate was mediated via ERs. Furthermore, glyphosate also altered both ERα and β expression. These results indicated that low and environmentally relevant concentrations of glyphosate possessed estrogenic activity. Glyphosate-based herbicides are widely used for soybean cultivation, and our results also found that there was an additive estrogenic effect between glyphosate and genistein, a phytoestrogen in soybeans. However, these additive effects of glyphosate contamination in soybeans need further animal study. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Overview of glyphosate-resistant weeds worldwide.

    Science.gov (United States)

    Heap, Ian; Duke, Stephen O

    2018-05-01

    Glyphosate is the most widely used and successful herbicide discovered to date, but its utility is now threatened by the occurrence of several glyphosate-resistant weed species. Glyphosate resistance first appeared in Lolium rigidum in an apple orchard in Australia in 1996, ironically the year that the first glyphosate-resistant crop (soybean) was introduced in the USA. Thirty-eight weed species have now evolved resistance to glyphosate, distributed across 37 countries and in 34 different crops and six non-crop situations. Although glyphosate-resistant weeds have been identified in orchards, vineyards, plantations, cereals, fallow and non-crop situations, it is the glyphosate-resistant weeds in glyphosate-resistant crop systems that dominate the area infested and growing economic impact. Glyphosate-resistant weeds present the greatest threat to sustained weed control in major agronomic crops because this herbicide is used to control weeds with resistance to herbicides with other sites of action, and no new herbicide sites of action have been introduced for over 30 years. Industry has responded by developing herbicide resistance traits in major crops that allow existing herbicides to be used in a new way. However, over reliance on these traits will result in multiple-resistance in weeds. Weed control in major crops is at a precarious point, where we must maintain the utility of the herbicides we have until we can transition to new weed management technologies. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  7. The effect of gamma radiation from sources "6"0Co of soybean for shade tolerant

    International Nuclear Information System (INIS)

    Lilik Harsanti; Yulidar

    2016-01-01

    Gamma rays are electromagnetic waves that have a very strong penetrating power. One of the sources of gamma rays is from "6"0Co. The gamma rays have strong penetration power can be used of plant breeding to create new genetic diversity in the make of high-yielding varieties. Irradiation of gamma rays at a dose of 300 gray and 400 gray on soybean Denna 1 seed varieties has been done, then it was planted as M.1 the plants look healthy and robust and strong stems. The parameters observed plant height, sum book leaf, sum seed, sum pod and Percentage plant to live shade tolerant. The parameters observed were good: plant height doze 300 Gy (37.76 cm) and 400 gray (33.03 cm) The number of branches with doze 300 Gy (1.75) and 400 Gy (1.95), number of pod with doze 300 Gy (26.25) and 400 Gy (24.72), number of seed with doze 300 Gy (35.55 kg) and 400 Gy (33.65 kg), number of Naut with doze 300 Gy (9.28) and 400 Gy (8.53) and the percentage of plants capable of shade tolerant with doze 300 Gy (85) and 400 Gy(75). In conclusion, selection mutant lines of soybeans shade tolerant at generation M1 and next generation. (author)

  8. The history and current status of glyphosate.

    Science.gov (United States)

    Duke, Stephen O

    2018-05-01

    Glyphosate is the only herbicide to target the enzyme 5-enolpyruvyl-3-shikimate phosphate synthase (EPSPS). It is a high use rate, non-selective herbicide that translocates primarily to metabolic sinks, killing meristematic tissues away from the application site. Its phloem-mobile properties and slow action in killing weeds allow the herbicide to move throughout the plant to kill all meristems, making it effective for perennial weed control. Since commercialization in 1974, its use has grown to dominate the herbicide market. Much of its use is on transgenic, glyphosate-resistant crops (GRCs), which have been the dominant transgenic crops worldwide. GRCs with glyphosate provided the most effective and inexpensive weed management technology in history for a decade or more. However, as a consequence of the rapid increase in glyphosate-resistant (GR) weeds, the effectiveness of glyphosate use in GRCs is declining. Critics have claimed that glyphosate-treated GRCs have altered mineral nutrition and increased susceptibility to plant pathogens because of glyphosate's ability to chelate divalent metal cations, but the complete resistance of GRCs to glyphosate indicates that chelating metal cations do not contribute to the herbicidal activity or significantly affect mineral nutrition. The rates of increases in yields of maize, soybean, and cotton in the USA have been unchanged after high adoption rates of GRCs. Glyphosate is toxic to some plant pathogens, and thereby can act as a fungicide in GRCs. Ultra-low doses of glyphosate stimulate plant growth in glyphosate-susceptible plants by unknown mechanisms. Despite rapid and widespread increases in GR weeds, glyphosate use has not decreased. However, as GR weeds increase, adoption of alternative technologies will eventually lead to decreased use. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in

  9. Increasing cyclic electron flow is related to Na+ sequestration into vacuoles for salt tolerance in soybean.

    Science.gov (United States)

    He, Yi; Fu, Junliang; Yu, Chenliang; Wang, Xiaoman; Jiang, Qinsu; Hong, Jian; Lu, Kaixing; Xue, Gangping; Yan, Chengqi; James, Andrew; Xu, Ligen; Chen, Jianping; Jiang, Dean

    2015-11-01

    In land plants, the NAD(P)H dehydrogenase (NDH) complex reduces plastoquinones and drives cyclic electron flow (CEF) around PSI. It also produces extra ATP for photosynthesis and improves plant fitness under conditions of abiotic environmental stress. To elucidate the role of CEF in salt tolerance of the photosynthetic apparatus, Na(+) concentration, chlorophyll fluorescence, and expression of NDH B and H subunits, as well as of genes related to cellular and vacuolar Na(+) transport, were monitored. The salt-tolerant Glycine max (soybean) variety S111-9 exhibited much higher CEF activity and ATP accumulation in light than did the salt-sensitive variety Melrose, but similar leaf Na(+) concentrations under salt stress. In S111-9 plants, ndhB and ndhH were highly up-regulated under salt stress and their corresponding proteins were maintained at high levels or increased significantly. Under salt stress, S111-9 plants accumulated Na(+) in the vacuole, but Melrose plants accumulated Na(+) in the chloroplast. Compared with Melrose, S111-9 plants also showed higher expression of some genes associated with Na(+) transport into the vacuole and/or cell, such as genes encoding components of the CBL10 (calcineurin B-like protein 10)-CIPK24 (CBL-interacting protein kinase 24)-NHX (Na(+)/H(+) antiporter) and CBL4 (calcineurin B-like protein 4)-CIPK24-SOS1 (salt overly sensitive 1) complexes. Based on the findings, it is proposed that enhanced NDH-dependent CEF supplies extra ATP used to sequester Na(+) in the vacuole. This reveals an important mechanism for salt tolerance in soybean and provides new insights into plant resistance to salt stress. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  10. Lignification of the plant and seed quality of RR soybeans sprayed with herbicide glyphosate Lignificação da planta e qualidade de sementes de soja RR pulverizadas com herbicida glifosato

    Directory of Open Access Journals (Sweden)

    Cristiane Fortes Gris

    2013-04-01

    Full Text Available Differences in levels of lignin in the plant between conventional and transgenic cultivars RR has been reported by several authors, however, there are few studies evaluating the influence of spraying of glyphosate on the lignin in the plant and RR soybean seeds. The aim of this study was to evaluate the physiological quality of RR transgenic soybean seeds and the lignin contents of plants sprayed with the herbicide glyphosate. The assays were conducted both in greenhouse and field in the municipality of Lavras, MG, in the agricultural year 2007/08. The experiment was arranged in a splitplot design with four replicates, considering the treatments hand weeding and herbicide glyphosate as plots, and five RR soybean cultivars (BRS 245 RR, BRS 247 RR, Valiosa RR, Silvânia RR and Baliza RR as splitplots. In the greenhouse, the cultivars tested were BRS 245 RR and Valiosa RR in a randomized block design with four replicates. The sprayings were carried out at stages V3, V7 and early R5 (3L/ha. The 1000 seed weight, mechanical injury, germination and germination velocity index, emergence velocity index, accelerated aging, electrical conductivity and water soaking seed test, lignin content in the seed coat, in the stem and legumes were determined. The spraying of glyphosate herbicide, in greenhouse and field, did not alter the physiological quality of seeds and the lignin contents in the plant.Diferenças nos teores de lignina na planta entre cultivares transgênicos RR e convencionais, tem sido relatadas, por vários autores, no entanto, são escassos os trabalhos avaliando a influência da aplicação do glifosato sobre os teores de lignina na planta e em sementes de soja RR. Neste sentido, objetivou-se, com este trabalho, avaliar a qualidade fisiológica de sementes de soja transgênica RR e os teores de lignina de plantas submetidas à pulverização com o herbicida glifosato. Os ensaios foram conduzidos em casa de vegetação e em campo, no munic

  11. Expression of an Arabidopsis molybdenum cofactor sulphurase gene in soybean enhances drought tolerance and increases yield under field conditions.

    Science.gov (United States)

    Li, Yajun; Zhang, Jiachang; Zhang, Juan; Hao, Ling; Hua, Jinping; Duan, Liusheng; Zhang, Mingcai; Li, Zhaohu

    2013-08-01

    LOS5/ABA3 gene encoding molybdenum cofactor sulphurase is involved in aldehyde oxidase (AO) activity in Arabidopsis, which indirectly regulates ABA biosynthesis and increased stress tolerance. Here, we used a constitutive super promoter to drive LOS5/ABA3 overexpression in soybean (Glycine max L.) to enhance drought tolerance in growth chamber and field conditions. Expression of LOS5/ABA3 was up-regulated by drought stress, which led to increasing AO activity and then a notable increase in ABA accumulation. Transgenic soybean under drought stress had reduced water loss by decreased stomatal aperture size and transpiration rate, which alleviated leaf wilting and maintained higher relative water content. Exposed to drought stress, transgenic soybean exhibited reduced cell membrane damage by reducing electrolyte leakage and production of malondialdehyde and promoting proline accumulation and antioxidant enzyme activities. Also, overexpression of LOS5/ABA3 enhanced expression of stress-up-regulated genes. Furthermore, the seed yield of transgenic plants is at least 21% higher than that of wide-type plants under drought stress conditions in the field. These data suggest that overexpression of LOS5/ABA3 could improve drought tolerance in transgenic soybean via enhanced ABA accumulation, which could activate expression of stress-up-regulated genes and cause a series of physiological and biochemical resistant responses. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  12. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Glyphosate Oxidoreductase GOX or... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.524 Glyphosate... Glyphosate Oxidoreductase GOX or GOXv247 enzyme in all plants are exempt from the requirement of a tolerance...

  13. Elisa development for detection of glyphosat resistant gm soybean

    Directory of Open Access Journals (Sweden)

    Владислав Геннадійович Спиридонов

    2015-11-01

    Full Text Available During research we have utilized recombinant enzyme 5-enolpyruvylshikimate-3-phosphate synthase (CP4 EPSPS, conferring resistance to glyphosate for GM soybean, for the hen immunization and obtaining specific yolk antibodies IgY. Stages of ELISA development that can detect at least 0,1 % of GM-soybean resistant to glyphosate were present

  14. Soybean Salt Tolerance 1 (GmST1) Reduces ROS Production, Enhances ABA Sensitivity, and Abiotic Stress Tolerance in Arabidopsis thaliana.

    Science.gov (United States)

    Ren, Shuxin; Lyle, Chimera; Jiang, Guo-Liang; Penumala, Abhishek

    2016-01-01

    Abiotic stresses, including high soil salinity, significantly reduce crop production worldwide. Salt tolerance in plants is a complex trait and is regulated by multiple mechanisms. Understanding the mechanisms and dissecting the components on their regulatory pathways will provide new insights, leading to novel strategies for the improvement of salt tolerance in agricultural and economic crops of importance. Here we report that soybean salt tolerance 1, named GmST1, exhibited strong tolerance to salt stress in the Arabidopsis transgenic lines. The GmST1-overexpressed Arabidopsis also increased sensitivity to ABA and decreased production of reactive oxygen species under salt stress. In addition, GmST1 significantly improved drought tolerance in Arabidopsis transgenic lines. GmST1 belongs to a 3-prime part of Glyma.03g171600 gene in the current version of soybean genome sequence annotation. However, comparative reverse transcription-polymerase chain reaction analysis around Glyma.03g171600 genomic region confirmed that GmST1 might serve as an intact gene in soybean leaf tissues. Unlike Glyma.03g171600 which was not expressed in leaves, GmST1 was strongly induced by salt treatment in the leaf tissues. By promoter analysis, a TATA box was detected to be positioned close to GmST1 start codon and a putative ABRE and a DRE cis-acting elements were identified at about 1 kb upstream of GmST1 gene. The data also indicated that GmST1-transgenic lines survived under drought stress and showed a significantly lower water loss than non-transgenic lines. In summary, our results suggest that overexpression of GmST1 significantly improves Arabidopsis tolerance to both salt and drought stresses and the gene may be a potential candidate for genetic engineering of salt- and drought-tolerant crops.

  15. Soybean salt tolerance 1 (GmST1 reduces ROS production, enhances ABA sensitivity and abiotic stress tolerance in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Shuxin eRen

    2016-04-01

    Full Text Available Abiotic stresses, including high soil salinity, significantly reduce crop production worldwide. Salt tolerance in plants is a complex trait and is regulated by multiple mechanisms. Understanding the mechanisms and dissecting the components on their regulatory pathways will provide new insights, leading to novel strategies for the improvement of salt tolerance in agricultural and economic crops of importance. Here we report that soybean salt tolerance 1, named GmST1, exhibited strong tolerance to salt stress in the Arabidopsis transgenic lines. The GmST1-overexpressed Arabidopsis also increased sensitivity to ABA and decreased production of reactive oxygen species (ROS under salt stress. In addition, GmST1 significantly improved drought tolerance in Arabidopsis transgenic lines. GmST1 belongs to a 3-prime part of Glyma.03g171600 gene in the current version of soybean genome sequence annotation. However, comparative RT-PCR analysis around Glyma.03g171600 genomic region confirmed that GmST1 might serve as an intact gene in soybean leaf tissues. Unlike Glyma.03g171600 which was not expressed in leaves, GmST1 was strongly induced by salt treatment in the leaf tissues. By promoter analysis, a TATA box was detected to be positioned close to GmST1 start codon and a putative ABRE and a DRE cis-acting elements were identified at about 1kb upstream of GmST1 gene. The data also indicated that GmST1-transgenic lines survived under drought stress and showed a significantly lower water loss than non-transgenic lines. In summary, our results suggest that overexpression of GmST1 significantly improves Arabidopsis tolerance to both salt and drought stresses and the gene may be a potential candidate for genetic engineering of salt- and drought-tolerant crops.

  16. Safety assessment and feeding value for pigs, poultry and ruminant animals of pest protected (Bt plants and herbicide tolerant (glyphosate, glufosinate plants: interpretation of experimental results observed worldwide on GM plants

    Directory of Open Access Journals (Sweden)

    Aimé Aumaitre

    2010-01-01

    Full Text Available New varieties of plants resistant to pests and/or tolerant to specific herbicides such as maize, soybean, cotton, sugarbeets, canola, have been recently developed by using genetic transformation (GT. These plants contain detectable specificactive recombinant DNA (rDNA and their derived protein. Since they have not been selected for a modification oftheir chemical composition, they can be considered as substantially equivalent to their parents or to commercial varietiesfor their content in nutrients and anti-nutritional factors. However, insect protected maize is less contaminated by mycotoxinsthan its parental counterpart conferring a higher degree of safety to animal feeds. The new feeds, grain and derivatives,and whole plants have been intensively tested in vivo up to 216 days for their safety and their nutritional equivalencefor monogastric farm animals (pig, poultry and ruminants (dairy cows, steers, lambs. The present article is basedon the interpretation and the summary of the scientific results published in original reviewed journals either as full papers(33 or as abstracts (33 available through September 2003. For the duration of the experiments adapted to the species,feed intake, weight gain, milk yield and nutritional equivalence expressed as feed conversion and/or digestibility of nutrientshave never been affected by feeding animals diets containing GT plants. In addition, in all the experimental animals,the body and carcass composition, the composition of milk and animal tissues, as well as the sensory properties of meatare not modified by the use of feeds derived from GT plants. Furthermore, the health of animals, their physiological characteristicsand the survival rate are also not affected.The presence of rDNA and derived proteins can be recognized and quantified in feeds in the case of glyphosate resistant soybeanand canola and in the case of insect protected maize. However, rDNA has never been recovered either in milk, or in

  17. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Science.gov (United States)

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  18. Comparison of the forage and grain composition from insect-protected and glyphosate-tolerant MON 88017 corn to conventional corn (Zea mays L.).

    Science.gov (United States)

    McCann, Melinda C; Trujillo, William A; Riordan, Susan G; Sorbet, Roy; Bogdanova, Natalia N; Sidhu, Ravinder S

    2007-05-16

    The next generation of biotechnology-derived products with the combined benefit of herbicide tolerance and insect protection (MON 88017) was developed to withstand feeding damage caused by the coleopteran pest corn rootworm and over-the-top applications of glyphosate, the active ingredient in Roundup herbicides. As a part of a larger safety and characterization assessment, MON 88017 was grown under field conditions at geographically diverse locations within the United States and Argentina during the 2002 and 2003-2004 field seasons, respectively, along with a near-isogenic control and other conventional corn hybrids for compositional assessment. Field trials were conducted using a randomized complete block design with three replication blocks at each site. Corn forage samples were harvested at the late dough/early dent stage, ground, and analyzed for the concentration of proximate constituents, fibers, and minerals. Samples of mature grain were harvested, ground, and analyzed for the concentration of proximate constituents, fiber, minerals, amino acids, fatty acids, vitamins, antinutrients, and secondary metabolites. The results showed that the forage and grain from MON 88017 are compositionally equivalent to forage and grain from control and conventional corn hybrids.

  19. Roles of Soybean Plasma Membrane Intrinsic Protein GmPIP2;9 in Drought Tolerance and Seed Development

    Directory of Open Access Journals (Sweden)

    Linghong Lu

    2018-04-01

    Full Text Available Aquaporins play an essential role in water uptake and transport in vascular plants. The soybean genome contains a total of 22 plasma membrane intrinsic protein (PIP genes. To identify candidate PIPs important for soybean yield and stress tolerance, we studied the transcript levels of all 22 soybean PIPs. We found that a GmPIP2 subfamily member, GmPIP2;9, was predominately expressed in roots and developing seeds. Here, we show that GmPIP2;9 localized to the plasma membrane and had high water channel activity when expressed in Xenopus oocytes. Using transgenic soybean plants expressing a native GmPIP2;9 promoter driving a GUS-reporter gene, it was found high GUS expression in the roots, in particular, in the endoderm, pericycle, and vascular tissues of the roots of transgenic plants. In addition, GmPIP2;9 was also highly expressed in developing pods. GmPIP2;9 expression significantly increased in short term of polyethylene glycol (PEG-mediated drought stress treatment. GmPIP2;9 overexpression increased tolerance to drought stress in both solution cultures and soil plots. Drought stress in combination with GmPIP2;9 overexpression increased net CO2 assimilation of photosynthesis, stomata conductance, and transpiration rate, suggesting that GmPIP2;9-overexpressing transgenic plants were less stressed than wild-type (WT plants. Furthermore, field experiments showed that GmPIP2;9-overexpressing plants had significantly more pod numbers and larger seed sizes than WT plants. In summary, the study demonstrated that GmPIP2;9 has water transport activity. Its relative high expression levels in roots and developing pods are in agreement with the phenotypes of GmPIP2;9-overexpressing plants in drought stress tolerance and seed development.

  20. Oxygation enhances growth, gas exchange and salt tolerance of vegetable soybean and cotton in a saline vertisol.

    Science.gov (United States)

    Bhattarai, Surya P; Midmore, David J

    2009-07-01

    Impacts of salinity become severe when the soil is deficient in oxygen. Oxygation (using aerated water for subsurface drip irrigation of crop) could minimize the impact of salinity on plants under oxygen-limiting soil environments. Pot experiments were conducted to evaluate the effects of oxygation (12% air volume/volume of water) on vegetable soybean (moderately salt tolerant) and cotton (salt tolerant) in a salinized vertisol at 2, 8, 14, 20 dS/m EC(e). In vegetable soybean, oxygation increased above ground biomass yield and water use efficiency (WUE) by 13% and 22%, respectively, compared with the control. Higher yield with oxygation was accompanied by greater plant height and stem diameter and reduced specific leaf area and leaf Na+ and Cl- concentrations. In cotton, oxygation increased lint yield and WUE by 18% and 16%, respectively, compared with the control, and was accompanied by greater canopy light interception, plant height and stem diameter. Oxygation also led to a greater rate of photosynthesis, higher relative water content in the leaf, reduced crop water stress index and lower leaf water potential. It did not, however, affect leaf Na+ or Cl- concentration. Oxygation invariably increased, whereas salinity reduced the K+ : Na+ ratio in the leaves of both species. Oxygation improved yield and WUE performance of salt tolerant and moderately tolerant crops under saline soil environments, and this may have a significant impact for irrigated agriculture where saline soils pose constraints to crop production.

  1. Manejo de Conyza bonariensis resistente ao herbicida glyphosate Management of Glyphosate-resistant Conyza bonariensis

    Directory of Open Access Journals (Sweden)

    J.M. Paula

    2011-03-01

    Full Text Available C. bonariensis (Conyza bonariensis é uma planta daninha da família Asteraceae, amplamente distribuída no Brasil, com presença marcante nos Estados do Rio Grande do Sul e do Paraná. Biótipos de C. bonariensis resistentes ao glyphosate foram identificados nos Estados do Rio Grande do Sul, Paraná e São Paulo. O objetivo deste trabalho foi avaliar o efeito de diferentes manejos de inverno e na pré-semeadura da soja sobre a população de plantas de C. bonariensis resistente ao herbicida glyphosate. Os resultados evidenciaram que a população de C. bonariensis é maior em áreas mantidas sem cultivo (pousio do que naquelas áreas cultivadas com trigo ou aveia-preta durante o inverno. Observou-se que o trigo e a aveia-preta exercem efeito supressor sobre a população de C. bonariensis, proporcionando maior facilidade de controle com herbicida na pré-semeadura da cultura usada em sucessão. O controle de C. bonariensis resistente ao herbicida glyphosate foi satisfatório quando se utilizaram herbicidas pós-emergentes na cultura do trigo e glyphosate + 2,4-D ou glyphosate + diuron + paraquat na pré-semeadura da soja.Horseweed (Conyza bonariensis, which belongs to the Asteraceae family, is a weed species widely spread in Brazil. Horseweed biotypes resistant to glyphosate, the main herbicide used in Roundup Ready soybean fields, were identified in the states of Rio Grande do Sul and Parana. The aim of this study was to evaluate the effect of different winter and pre-sowing management techniques on soybean plant population of C. bonariensis resistant to glyphosate. The results showed that the population of C. bonariensis is larger in areas maintained fallow than in areas planted with wheat or oats during the winter. Wheat and oats were found to exert a suppressive effect on the population of C. bonariensis, providing greater ease of control with herbicide before seeding in the culture used in succession. The control of glyphosate-resistant C

  2. Glyphosate resistance in common ragweed (Ambrosia artemisiifolia L.)from Mississippi, USA

    Science.gov (United States)

    Glyphosate is one of the most commonly used broad-spectrum herbicides over the last 40 years. Due to widespread adoption of glyphosate-resistant (GR) crop technology, especially, corn, cotton, and soybean, several weed species in agronomic situations have developed resistance to this herbicide. Rese...

  3. Cold Tolerance of Megacopta cribraria (Hemiptera: Plataspidae): An Invasive Pest of Soybeans.

    Science.gov (United States)

    Grant, Jessica I; Lamp, William O

    2017-12-08

    Kudzu bug, Megacopta cribraria Fabricius (Hemiptera: Plataspidae), first discovered in the United States in 2009, is an invasive pest of soybeans. From 2013 to 2016, Maryland has been the northern limit of its distribution in the United States. We sought to determine the physiological cold temperature limits, timing of movement to overwintering locations, and to characterize overwintering microhabitat temperature. We measured supercooling point (SCP) on three populations from distinct USDA plant hardiness zones in Maryland and Virginia between October and December of 2015. The average SCP across all sample months and populations was -12.6°C and no consistent trend of month or population location were observed. Additionally, we assessed the lower lethal temperature to kill 50% of the population (LLT50) at the same population locations in October and November 2015. The average LLT50 over both months and all three population locations was -5.1°C. Again, no consistent trend based on population location was observed but we did find a modest depression in the LLT50 values between October and November. We observed that kudzu bug overwinters in leaf litter and begins to move into the litter in late November to early December. Leaf litter moderates day to night temperature differences and was warmer than ambient temperature by an average of 0.7°C. Evidence suggests that the cold tolerance of the kudzu bug limits its distribution north of Maryland. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Efeitos de dessecantes no controle de plantas daninhas na cultura da soja Effects of burndown herbicides in weed control in soybean crop

    Directory of Open Access Journals (Sweden)

    S.O. Procópio

    2006-01-01

    before sowing day; five days before sowing day; paraquat + diuron 20 days before sowing day and on sowing day; glyphosate 10 days before sowing day and paraquat + diuron on sowing day; glyphosate 15 days before sowing day and paraquat + diuron on sowing day; glyphosate 20 days before sowing day and paraquat + diuron on sowing day; and control (presence of weeds. Acceptable control and re-growth impairing of D. insularis and L. filiformis were obtained when glyphosate was applied five days before soybean sowing or when sequential applications of glyphosate and paraquat + diuron were applied. Sequential applications of paraquat + diuron were not efficient in controlling or impairing re-growth of the weeds D. insularis and L. filiformis. S. grisebachii showed to be tolerant to glyphosate.

  5. Comparative proteomic analysis reveals molecular mechanism of seedling roots of different salt tolerant soybean genotypes in responses to salinity stress

    Directory of Open Access Journals (Sweden)

    Hongyu Ma

    2014-09-01

    Full Text Available Salinity stress is one of the major abiotic stresses that limit agricultural yield. To understand salt-responsive protein networks in soybean seedling, the extracted proteins from seedling roots of two different genotypes (Lee 68 and Jackson were analyzed under salt stress by two-dimensional polyacrylamide gel electrophoresis. Sixty-eight differentially expressed proteins were detected and identified. The identified proteins were involved in 13 metabolic pathways and cellular processes. Proteins correlated to brassinosteroid and gilbberellin signalings were significantly increased only in the genotype Lee 68 under salt stress; abscisic acid content was positively correlated with this genotype; proteins that can be correlated to Ca2+ signaling were more strongly enhanced by salt stress in the seedling roots of genotype Lee 68 than in those of genotype Jackson; moreover, genotype Lee 68 had stronger capability of reactive oxygen species scavenging and cell K+/Na+ homeostasis maintaining in seedling roots than genotype Jackson under salt stress. Since the genotype Lee 68 has been described in literature as being tolerant and Jackson as sensitive, we hypothesize that these major differences in the genotype Lee 68 might contribute to salt tolerance. Combined with our previous comparative proteomics analysis on seedling leaves, the similarities and differences between the salt-responsive protein networks found in the seedling leaves and roots of both the genotypes were discussed. Such a result will be helpful in breeding of salt-tolerant soybean cultivars.

  6. Effect of Temperature and Chemical Additives on the Efficacy of the Herbicides Glufosinate and Glyphosate in Weed Management of Liberty-Link and Roundup-Ready Soybeans

    OpenAIRE

    Pline, Wendy Ann

    1999-01-01

    The introduction of herbicide resistant crops offers producers many more options for weed control systems. These crops allow environmentally safe, non-selective herbicides to be used as selective herbicides, broadening the spectrum of weeds controlled, while not harming the crop. As these crops are very new on the market, investigation of their performance under various environmental conditions as well as in various weed control programs is needed. Liberty-link ® soybeans are resistant t...

  7. Impacts of Repeated Glyphosate Use on Wheat-Associated Bacteria Are Small and Depend on Glyphosate Use History.

    Science.gov (United States)

    Schlatter, Daniel C; Yin, Chuntao; Hulbert, Scot; Burke, Ian; Paulitz, Timothy

    2017-11-15

    Glyphosate is the most widely used herbicide worldwide and a critical tool for weed control in no-till cropping systems. However, there are concerns about the nontarget impacts of long-term glyphosate use on soil microbial communities. We investigated the impacts of repeated glyphosate treatments on bacterial communities in the soil and rhizosphere of wheat in soils with and without long-term history of glyphosate use. We cycled wheat in the greenhouse using soils from 4 paired fields under no-till (20+-year history of glyphosate) or no history of use. At each cycle, we terminated plants with glyphosate (2× the field rate) or by removing the crowns, and soil and rhizosphere bacterial communities were characterized. Location, cropping history, year, and proximity to the roots had much stronger effects on bacterial communities than did glyphosate, which only explained 2 to 5% of the variation. Less than 1% of all taxa were impacted by glyphosate, more in soils with a long history of use, and more increased than decreased in relative abundance. Glyphosate had minimal impacts on soil and rhizosphere bacteria of wheat, although dying roots after glyphosate application may provide a "greenbridge" favoring some copiotrophic taxa. IMPORTANCE Glyphosate (Roundup) is the most widely used herbicide in the world and the foundation of Roundup Ready soybeans, corn, and the no-till cropping system. However, there have been recent concerns about nontarget impacts of glyphosate on soil microbes. Using next-generation sequencing methods and glyphosate treatments of wheat plants, we described the bacterial communities in the soil and rhizosphere of wheat grown in Pacific Northwest soils across multiple years, different locations, and soils with different histories of glyphosate use. The effects of glyphosate were subtle and much less than those of drivers such as location and cropping systems. Only a small percentage of the bacterial groups were influenced by glyphosate, and most of

  8. Split application of glyphosate in herbicide-tolerant maize provides efficient weed control and favors beneficial epigeic arthropods

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Zdeňka; Skoková Habuštová, Oxana; Holec, J.; Holec, M.; Boháč, J.; Jursík, M.; Soukup, J.; Sehnal, František

    2018-01-01

    Roč. 251, JAN 01 (2018), s. 171-179 ISSN 0167-8809 Grant - others:GA ČR(CZ) L200961652 Institutional support: RVO:60077344 Keywords : herbicide-tolerant maize * weed management * conventional tillage Subject RIV: GF - Plant Pathology, Vermin, Weed, Plant Protection OBOR OECD: Agronomy, plant breeding and plant protection Impact factor: 4.099, year: 2016 http://www.sciencedirect.com/science/article/pii/S0167880917304188

  9. A novel cold-inducible zinc finger protein from soybean, SCOF-1, enhances cold tolerance in transgenic plants.

    Science.gov (United States)

    Kim, J C; Lee, S H; Cheong, Y H; Yoo, C M; Lee, S I; Chun, H J; Yun, D J; Hong, J C; Lee, S Y; Lim, C O; Cho, M J

    2001-02-01

    Cold stress on plants induces changes in the transcription of cold response genes. A cDNA clone encoding C2H2-type zinc finger protein, SCOF-1, was isolated from soybean. The transcription of SCOF-1 is specifically induced by low temperature and abscisic acid (ABA) but not by dehydration or high salinity. Constitutive overexpression of SCOF-1 induced cold-regulated (COR) gene expression and enhanced cold tolerance of non-acclimated transgenic Arabidopsis and tobacco plants. SCOF-1 localized to the nucleus but did not bind directly to either C-repeat/dehydration (CRT/DRE) or ABA responsive element (ABRE), cis-acting DNA regulatory elements present in COR gene promoters. However, SCOF-1 greatly enhanced the DNA binding activity of SGBF-1, a soybean G-box binding bZIP transcription factor, to ABRE in vitro. SCOF-1 also interacted with SGBF-1 in a yeast two-hybrid system. The SGBF-1 transactivated the beta-glucuronidase reporter gene driven by the ABRE element in Arabidopsis leaf protoplasts. Furthermore, the SCOF-1 enhanced ABRE-dependent gene expression mediated by SGBF-1. These results suggest that SCOF-1 may function as a positive regulator of COR gene expression mediated by ABRE via protein-protein interaction, which in turn enhances cold tolerance of plants.

  10. Environmental and health effects of the herbicide glyphosate.

    Science.gov (United States)

    Van Bruggen, A H C; He, M M; Shin, K; Mai, V; Jeong, K C; Finckh, M R; Morris, J G

    2018-03-01

    The herbicide glyphosate, N-(phosphonomethyl) glycine, has been used extensively in the past 40years, under the assumption that side effects were minimal. However, in recent years, concerns have increased worldwide about the potential wide ranging direct and indirect health effects of the large scale use of glyphosate. In 2015, the World Health Organization reclassified glyphosate as probably carcinogenic to humans. A detailed overview is given of the scientific literature on the movement and residues of glyphosate and its breakdown product aminomethyl phosphonic acid (AMPA) in soil and water, their toxicity to macro- and microorganisms, their effects on microbial compositions and potential indirect effects on plant, animal and human health. Although the acute toxic effects of glyphosate and AMPA on mammals are low, there are animal data raising the possibility of health effects associated with chronic, ultra-low doses related to accumulation of these compounds in the environment. Intensive glyphosate use has led to the selection of glyphosate-resistant weeds and microorganisms. Shifts in microbial compositions due to selective pressure by glyphosate may have contributed to the proliferation of plant and animal pathogens. Research on a link between glyphosate and antibiotic resistance is still scarce but we hypothesize that the selection pressure for glyphosate-resistance in bacteria could lead to shifts in microbiome composition and increases in antibiotic resistance to clinically important antimicrobial agents. We recommend interdisciplinary research on the associations between low level chronic glyphosate exposure, distortions in microbial communities, expansion of antibiotic resistance and the emergence of animal, human and plant diseases. Independent research is needed to revisit the tolerance thresholds for glyphosate residues in water, food and animal feed taking all possible health risks into account. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. GmGBP1, a homolog of human ski interacting protein in soybean, regulates flowering and stress tolerance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Zhang Yanwei

    2013-02-01

    Full Text Available Abstract Background SKIP is a transcription cofactor in many eukaryotes. It can regulate plant stress tolerance in rice and Arabidopsis. But the homolog of SKIP protein in soybean has been not reported up to now. Results In this study, the expression patterns of soybean GAMYB binding protein gene (GmGBP1 encoding a homolog of SKIP protein were analyzed in soybean under abiotic stresses and different day lengths. The expression of GmGBP1 was induced by polyethyleneglycol 6000, NaCl, gibberellin, abscisic acid and heat stress. GmGBP1 had transcriptional activity in C-terminal. GmGBP1 could interact with R2R3 domain of GmGAMYB1 in SKIP domain to take part in gibberellin flowering pathway. In long-day (16 h-light condition, transgenic Arabidopsis with the ectopic overexpression of GmGBP1 exhibited earlier flowering and less number of rosette leaves; Suppression of AtSKIP in Arabidopsis resulted in growth arrest, flowering delay and down-regulation of many flowering-related genes (CONSTANS, FLOWERING LOCUS T, LEAFY; Arabidopsis myb33 mutant plants with ectopic overexpression of GmGBP1 showed the same flowering phenotype with wild type. In short-day (8 h-light condition, transgenic Arabidopsis plants with GmGBP1 flowered later and showed a higher level of FLOWERING LOCUS C compared with wild type. When treated with abiotic stresses, transgenic Arabidopsis with the ectopic overexpression of GmGBP1 enhanced the tolerances to heat and drought stresses but reduced the tolerance to high salinity, and affected the expressions of several stress-related genes. Conclusions In Arabidopsis, GmGBP1 might positively regulate the flowering time by affecting CONSTANS, FLOWERING LOCUS T, LEAFY and GAMYB directly or indirectly in photoperiodic and gibberellin pathways in LDs, but GmGBP1 might represse flowering by affecting FLOWERING LOCUS C and SHORT VEGETATIVE PHASE in autonomous pathway in SDs. GmGBP1 might regulate the activity of ROS-eliminating to improve the

  12. Expression of an osmotin-like protein from Solanum nigrum confers drought tolerance in transgenic soybean.

    Science.gov (United States)

    Weber, Ricardo Luís Mayer; Wiebke-Strohm, Beatriz; Bredemeier, Christian; Margis-Pinheiro, Márcia; de Brito, Giovani Greigh; Rechenmacher, Ciliana; Bertagnolli, Paulo Fernando; de Sá, Maria Eugênia Lisei; Campos, Magnólia de Araújo; de Amorim, Regina Maria Santos; Beneventi, Magda Aparecida; Margis, Rogério; Grossi-de-Sa, Maria Fátima; Bodanese-Zanettini, Maria Helena

    2014-12-10

    Drought is by far the most important environmental factor contributing to yield losses in crops, including soybeans [Glycine max (L.) Merr.]. To address this problem, a gene that encodes an osmotin-like protein isolated from Solanum nigrum var. americanum (SnOLP) driven by the UBQ3 promoter from Arabidopsis thaliana was transferred into the soybean genome by particle bombardment. Two independently transformed soybean lines expressing SnOLP were produced. Segregation analyses indicated single-locus insertions for both lines. qPCR analysis suggested a single insertion of SnOLP in the genomes of both transgenic lines, but one copy of the hpt gene was inserted in the first line and two in the second line. Transgenic plants exhibited no remarkable phenotypic alterations in the seven analyzed generations. When subjected to water deficit, transgenic plants performed better than the control ones. Leaf physiological measurements revealed that transgenic soybean plants maintained higher leaf water potential at predawn, higher net CO2 assimilation rate, higher stomatal conductance and higher transpiration rate than non-transgenic plants. Grain production and 100-grain weight were affected by water supply. Decrease in grain productivity and 100-grain weight were observed for both transgenic and non-transgenic plants under water deficit; however, it was more pronounced for non-transgenic plants. Moreover, transgenic lines showed significantly higher 100-grain weight than non-transgenic plants under water shortage. This is the first report showing that expression of SnOLP in transgenic soybeans improved physiological responses and yield components of plants when subjected to water deficit, highlighting the potential of this gene for biotechnological applications.

  13. Weed control, biomass and microbial metabolism of soil depending on the application of glyphosate and imazethapyr on crop soybeansControle de plantas daninhas, biomassa e metabolismo microbiano do solo em função da aplicação de glifosato ou imazetapir na cultura da soja

    Directory of Open Access Journals (Sweden)

    Dirceu Agostinetto

    2011-08-01

    Full Text Available Studied the weed control and the changes of biomass and microbial soil properties at crop cultivated both genetically modified and non altered soybeans because of glyphosate or imazethapyr herbicide applications. Soybean cultivations were tested (BRS 244RR, genetically modified and BRS 154, non modified and herbicides (glyphosate and imazethapyr, and control treatment with weed. Variables were evaluated for phytotoxicity to the crop, control of Raphanus raphanistrum (wild radish, Digitaria sp. (crabgrass and Brachiaria plantaginea (alexsandregrass, total organic carbon (TOC, microbial biomass carbon (MBC, basal respiration (BR and metabolic quocient (QCO2. The herbicide glyphosate, applied as a single dose or sequentially, effectively controls the weeds wild radish, crabgrass and alexsandregrass and increases microbial activity, basal respiration and metabolic quocient. The microbial metabolism was not affected by the fact that the genotype or not genetically modified, but the use of the herbicide glyphosate.Estudou-se o controle de plantas daninhas, as variações da biomassa e do metabolismo microbiano do solo em áreas cultivadas com soja geneticamente modificada e não modificada, em função da aplicação dos herbicidas glifosato ou imazetapir. Testaram-se cultivares de soja (BRS 244RR, geneticamente modificada e BRS 154, não modificada e herbicidas (glifosato e imazetapir, e tratamento controle com capina. Como variáveis foram avaliadas a fitotoxicidade à cultura, controle de Raphanus raphanistrum (nabo, Digitaria sp. (milhã e Brachiaria plantaginea (papuã, teores de carbono orgânico total (COT, carbono da biomassa microbiana (CBM, respiração basal (RB e quociente metabólico (QCO2. O herbicida glifosato, aplicado em dose única ou seqüencial, controla eficientemente as plantas daninhas nabo, milhã e papuã, e aumenta a atividade microbiana, a taxa de respiração basal e o quociente metabólico. O metabolismo microbiano do solo

  14. Fate and transport of glyphosate and aminomethylphosphonic acid in surface waters of agricultural basins

    Science.gov (United States)

    Coupe, R.H.; Kalkhoff, S.J.; Capel, P.D.; Gregoire, C.

    2012-01-01

    Background: Glyphosate [N-(phosphonomethyl)glycine] is a herbicide used widely throughout the world in the production of many crops and is heavily used on soybeans, corn and cotton. Glyphosate is used in almost all agricultural areas of the United States, and the agricultural use of glyphosate has increased from less than 10 000 Mg in 1992 to more than 80 000 Mg in 2007. The greatest intensity of glyphosate use is in the midwestern United States, where applications are predominantly to genetically modified corn and soybeans. In spite of the increase in usage across the United States, the characterization of the transport of glyphosate and its degradate aminomethylphosphonic acid (AMPA) on a watershed scale is lacking. Results: Glyphosate and AMPA were frequently detected in the surface waters of four agricultural basins. The frequency and magnitude of detections varied across basins, and the load, as a percentage of use, ranged from 0.009 to 0.86% and could be related to three general characteristics: source strength, rainfall runoff and flow route. Conclusions: Glyphosate use in a watershed results in some occurrence in surface water; however, the watersheds most at risk for the offsite transport of glyphosate are those with high application rates, rainfall that results in overland runoff and a flow route that does not include transport through the soil. ?? 2011 Society of Chemical Industry.

  15. Investigation of endogenous soybean food allergens by using a 2-dimensional gel electrophoresis approach.

    Science.gov (United States)

    Rouquié, David; Capt, Annabelle; Eby, William H; Sekar, Vaithilingam; Hérouet-Guicheney, Corinne

    2010-12-01

    As part of the safety assessment of genetically modified (GM) soybean, 2-dimensional gel electrophoresis analyses were performed with the isoxaflutole and glyphosate tolerant soybean FG72, its non-GM near-isogenic counterpart (Jack) and three commercial non-GM soybean lines. The objective was to compare the known endogenous human food allergens in seeds in the five different soybean lines in order to evaluate any potential unintended effect(s) of the genetic modification. In total, 37 protein spots representing five well known soybean food allergen groups were quantified in each genotype. Qualitatively, all the allergenic proteins were detected in the different genetic backgrounds. Quantitatively, among 37 protein spots, the levels of accumulation of three allergens were slightly lower in the GM soybean than in the non-GM counterparts. Specifically, while the levels of two of these three allergens fell within the normal range of variation observed in the four non-GM varieties, the level of the third allergen was slightly below the normal range. Overall, there was no significant increase in the level of allergens in FG72 soybean seeds. Therefore, the FG72 soybean can be considered as safe as its non-GM counterpart with regards to endogenous allergenicity. Additional research is needed to evaluate the biological variability in the levels of endogenous soybean allergens and the correlation between level of allergens and allergenic potential in order to improve the interpretation of these data in the safety assessment of GM soybean context. Copyright © 2010 Elsevier Inc. All rights reserved.

  16. Efeitos do glifosato sobre microrganismos simbiotróficos de soja, em meio de cultura e casa de vegetação Effects of glyphosate on soybean symbiotic microorganisms, in culture media and in greenhouse

    Directory of Open Access Journals (Sweden)

    Juliano dos Santos Malty

    2006-02-01

    equivalent to 1.25 to 10 L ha-1 before sowing. The herbicide inhibited growth of Bradyrhizobium spp. and AMF in culture medium. These effects were directly related to increasing concentrations, and varied depending on the strain and species evaluated. However, in vitro inhibition occurred only when concentrations were greater than that recommended for use in the field. Strains BR 29, INPA 553A and INPA 80A showed to be more resistant to glyphosate, when compared to BR 86. Herbicide inhibition on germination and growth of AMF spore germ tubes decreased from G. etunicatum to S. heterogama and G. margarita. Soil application of Roundup before sowing up to a dose equivalent to 10 L ha-1 had no effect on nodulation and mycorrhiza colonization of soybean.

  17. Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

    Directory of Open Access Journals (Sweden)

    Bingfu Guo

    2016-07-01

    Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

  18. Heterologous Expression of Panax ginseng PgTIP1 Confers Enhanced Salt Tolerance of Soybean Cotyledon Hairy Roots, Composite, and Whole Plants

    Directory of Open Access Journals (Sweden)

    Jing An

    2017-07-01

    Full Text Available The Panax ginseng TIP gene PgTIP1 was previously demonstrated to have high water channel activity by its heterologous expression in Xenopus laevis oocytes and in yeast; it also plays a significant role in growth of PgTIP1-transgenic Arabidopsis plants under favorable conditions and has enhanced tolerance toward salt and drought treatment. In this work, we first investigated the physiological effects of heterologous PgTIP1 expression in soybean cotyledon hairy roots or composite plants mediated by Agrobacterium rhizogenes toward enhanced salt tolerance. The PgTIP1-transgenic soybean plants mediated by the pollen tube pathway, represented by the lines N and J11, were analyzed at the physiological and molecular levels for enhanced salt tolerance. The results showed that in terms of root-specific heterologous expression, the PgTIP1-transformed soybean cotyledon hairy roots or composite plants displayed superior salt tolerance compared to the empty vector-transformed ones according to the mitigatory effects of hairy root growth reduction, drop in leaf RWC, and rise in REL under salt stress. Additionally, declines in K+ content, increases in Na+ content and Na+/K+ ratios in the hairy roots, stems, or leaves were effectively alleviated by PgTIP1-transformation, particularly the stems and leaves of composite soybean plants. At the whole plant level, PgTIP1-trasgenic soybean lines were found to possess stronger root vigor, reduced root and leaf cell membrane damage, increased SOD, POD, CAT, and APX activities, steadily increased leaf Tr, RWC, and Pn values, and smaller declines in chlorophyll and carotenoid content when exposed to salt stress compared to wild type. Moreover, the distribution patterns of Na+, K+, and Cl- in the roots, stems, and leaves of salt-stressed transgenic plants were readjusted, in that the absorbed Na+ and Cl- were mainly restricted to the roots to reduce their transport to the shoots, and the transport of root-absorbed K+ to the

  19. Perturbations of Amino Acid Metabolism Associated with Glyphosate-Dependent Inhibition of Shikimic Acid Metabolism Affect Cellular Redox Homeostasis and Alter the Abundance of Proteins Involved in Photosynthesis and Photorespiration1[W][OA

    Science.gov (United States)

    Vivancos, Pedro Diaz; Driscoll, Simon P.; Bulman, Christopher A.; Ying, Liu; Emami, Kaveh; Treumann, Achim; Mauve, Caroline; Noctor, Graham; Foyer, Christine H.

    2011-01-01

    The herbicide glyphosate inhibits the shikimate pathway of the synthesis of amino acids such as phenylalanine, tyrosine, and tryptophan. However, much uncertainty remains concerning precisely how glyphosate kills plants or affects cellular redox homeostasis and related processes in glyphosate-sensitive and glyphosate-resistant crop plants. To address this issue, we performed an integrated study of photosynthesis, leaf proteomes, amino acid profiles, and redox profiles in the glyphosate-sensitive soybean (Glycine max) genotype PAN809 and glyphosate-resistant Roundup Ready Soybean (RRS). RRS leaves accumulated much more glyphosate than the sensitive line but showed relatively few changes in amino acid metabolism. Photosynthesis was unaffected by glyphosate in RRS leaves, but decreased abundance of photosynthesis/photorespiratory pathway proteins was observed together with oxidation of major redox pools. While treatment of a sensitive genotype with glyphosate rapidly inhibited photosynthesis and triggered the appearance of a nitrogen-rich amino acid profile, there was no evidence of oxidation of the redox pools. There was, however, an increase in starvation-associated and defense proteins. We conclude that glyphosate-dependent inhibition of soybean leaf metabolism leads to the induction of defense proteins without sustained oxidation. Conversely, the accumulation of high levels of glyphosate in RRS enhances cellular oxidation, possibly through mechanisms involving stimulation of the photorespiratory pathway. PMID:21757634

  20. Perturbations of amino acid metabolism associated with glyphosate-dependent inhibition of shikimic acid metabolism affect cellular redox homeostasis and alter the abundance of proteins involved in photosynthesis and photorespiration.

    Science.gov (United States)

    Vivancos, Pedro Diaz; Driscoll, Simon P; Bulman, Christopher A; Ying, Liu; Emami, Kaveh; Treumann, Achim; Mauve, Caroline; Noctor, Graham; Foyer, Christine H

    2011-09-01

    The herbicide glyphosate inhibits the shikimate pathway of the synthesis of amino acids such as phenylalanine, tyrosine, and tryptophan. However, much uncertainty remains concerning precisely how glyphosate kills plants or affects cellular redox homeostasis and related processes in glyphosate-sensitive and glyphosate-resistant crop plants. To address this issue, we performed an integrated study of photosynthesis, leaf proteomes, amino acid profiles, and redox profiles in the glyphosate-sensitive soybean (Glycine max) genotype PAN809 and glyphosate-resistant Roundup Ready Soybean (RRS). RRS leaves accumulated much more glyphosate than the sensitive line but showed relatively few changes in amino acid metabolism. Photosynthesis was unaffected by glyphosate in RRS leaves, but decreased abundance of photosynthesis/photorespiratory pathway proteins was observed together with oxidation of major redox pools. While treatment of a sensitive genotype with glyphosate rapidly inhibited photosynthesis and triggered the appearance of a nitrogen-rich amino acid profile, there was no evidence of oxidation of the redox pools. There was, however, an increase in starvation-associated and defense proteins. We conclude that glyphosate-dependent inhibition of soybean leaf metabolism leads to the induction of defense proteins without sustained oxidation. Conversely, the accumulation of high levels of glyphosate in RRS enhances cellular oxidation, possibly through mechanisms involving stimulation of the photorespiratory pathway.

  1. Interference of Selected Palmer Amaranth (Amaranthus palmeri Biotypes in Soybean (Glycine max

    Directory of Open Access Journals (Sweden)

    Aman Chandi

    2012-01-01

    Full Text Available Palmer amaranth (Amaranthus palmeri S. Wats. has become difficult to control in row crops due to selection for biotypes that are no longer controlled by acetolactate synthase inhibiting herbicides and/or glyphosate. Early season interference in soybean [Glycine max (L. Merr.] for 40 days after emergence by three glyphosate-resistant (GR and three glyphosate-susceptible (GS Palmer amaranth biotypes from Georgia and North Carolina was compared in the greenhouse. A field experiment over 2 years compared season-long interference of these biotypes in soybean. The six Palmer amaranth biotypes reduced soybean height similarly in the greenhouse but did not affect soybean height in the field. Reduction in soybean fresh weight and dry weight in the greenhouse; and soybean yield in the field varied by Palmer amaranth biotypes. Soybean yield was reduced 21% by Palmer amaranth at the established field density of 0.37 plant m−2. When Palmer amaranth biotypes were grouped by response to glyphosate, the GS group reduced fresh weight, dry weight, and yield of soybean more than the GR group. The results indicate a possible small competitive disadvantage associated with glyphosate resistance, but observed differences among biotypes might also be associated with characteristics within and among biotypes other than glyphosate resistance.

  2. Non-point source pollution of glyphosate and AMPA in a rural basin from the southeast Pampas, Argentina.

    Science.gov (United States)

    Okada, Elena; Pérez, Débora; De Gerónimo, Eduardo; Aparicio, Virginia; Massone, Héctor; Costa, José Luis

    2018-05-01

    We measured the occurrence and seasonal variations of glyphosate and its metabolite, aminomethylphosphonic acid (AMPA), in different environmental compartments within the limits of an agricultural basin. This topic is of high relevance since glyphosate is the most applied pesticide in agricultural systems worldwide. We were able to quantify the seasonal variations of glyphosate that result mainly from endo-drift inputs, that is, from direct spraying either onto genetically modified (GM) crops (i.e., soybean and maize) or onto weeds in no-till practices. We found that both glyphosate and AMPA accumulate in soil, but the metabolite accumulates to a greater extent due to its higher persistence. Knowing that glyphosate and AMPA were present in soils (> 93% of detection for both compounds), we aimed to study the dispersion to other environmental compartments (surface water, stream sediments, and groundwater), in order to establish the degree of non-point source pollution. Also, we assessed the relationship between the water-table depth and glyphosate and AMPA levels in groundwater. All of the studied compartments had variable levels of glyphosate and AMPA. The highest frequency of detections was found in the stream sediments samples (glyphosate 95%, AMPA 100%), followed by surface water (glyphosate 28%, AMPA 50%) and then groundwater (glyphosate 24%, AMPA 33%). Despite glyphosate being considered a molecule with low vertical mobility in soils, we found that its detection in groundwater was strongly associated with the month where glyphosate concentration in soil was the highest. However, we did not find a direct relation between groundwater table depth and glyphosate or AMPA detections. This is the first simultaneous study of glyphosate and AMPA seasonal variations in soil, groundwater, surface water, and sediments within a rural basin.

  3. Glyphosate-based herbicides toxicity on life history parameters of zoophytophagous Podisus nigrispinus (Heteroptera: Pentatomidae).

    Science.gov (United States)

    C Zanuncio, José; C Lacerda, Mabio; Alcántara-de la Cruz, Ricardo; P Brügger, Bruno; Pereira, Alexandre I A; F Wilcken, Carlos; E Serrão, José; S Sediyama, Carlos

    2018-01-01

    The increase of agricultural areas with glyphosate-resistant (GR) crops, and use of this herbicide in Brazil, makes necessary to assess its impacts on non-target organisms. The objective was to evaluate the development, reproduction and life table parameters of Podisus nigrispinus (Heteroptera: Pentatomidae) reared on GR-soybean plants treated with glyphosate formulations (Zapp-Qi, Roundup-Transorb-R and Roundup-Original) at the recommended field dose (720g acid equivalent ha -1 ). Glyphosate formulations had no affect on nymph and adult weight of this predator. Fourth instar stage was shortest with Zapp Qi. Egg-adult period was similar between treatments (26 days) with a survival over 90%. Zapp-Qi and Roundup-Transorb-R (potassium-salt: K-salt) reduced the egg, posture and nymph number per female, and the longevity and oviposition periods of this predator. Podisus nigrispinus net reproductive rate was highest in GR-soybean plants treated with Roundup-Original (isopropylamine-salt: IPA-salt). However, the duration of one generation, intrinsic and finite increase rates, and time to duplicate the population, were similar between treatments. Glyphosate toxicity on P. nigrispinus depends of the glyphosate salt type. IPA-salt was least harmless to this predator. Formulations based on K-salt altered its reproductive parameters, however, the development and population dynamic were not affect. Therefore, these glyphosate formulations are compatible with the predator P. nigrispinus with GR-soybean crop. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Roundup Ready soybean gene concentrations in field soil aggregate size classes.

    Science.gov (United States)

    Levy-Booth, David J; Gulden, Robert H; Campbell, Rachel G; Powell, Jeff R; Klironomos, John N; Pauls, K Peter; Swanton, Clarence J; Trevors, Jack T; Dunfield, Kari E

    2009-02-01

    Roundup Ready (RR) soybeans containing recombinant Agrobacterium spp. CP4 5-enol-pyruvyl-shikimate-3-phosphate synthase (cp4 epsps) genes tolerant to the herbicide glyphosate are extensively grown worldwide. The concentration of recombinant DNA from RR soybeans in soil aggregates was studied due to the possibility of genetic transformation of soil bacteria. This study used real-time PCR to examine the concentration of cp4 epsps in four field soil aggregate size classes (>2000 microm, 2000-500 microm, 500-250 microm and 2000 mum fraction contained between 66.62% and 99.18% of total gene copies, although it only accounted for about 30.00% of the sampled soil. Aggregate formation may facilitate persistence of recombinant DNA.

  5. Aldo-keto reductase enzymes detoxify glyphosate and improve herbicide resistance in plants.

    Science.gov (United States)

    Vemanna, Ramu S; Vennapusa, Amaranatha Reddy; Easwaran, Murugesh; Chandrashekar, Babitha K; Rao, Hanumantha; Ghanti, Kirankumar; Sudhakar, Chinta; Mysore, Kirankumar S; Makarla, Udayakumar

    2017-07-01

    In recent years, concerns about the use of glyphosate-resistant crops have increased because of glyphosate residual levels in plants and development of herbicide-resistant weeds. In spite of identifying glyphosate-detoxifying genes from microorganisms, the plant mechanism to detoxify glyphosate has not been studied. We characterized an aldo-keto reductase gene from Pseudomonas (PsAKR1) and rice (OsAKR1) and showed, by docking studies, both PsAKR1 and OsAKR1 can efficiently bind to glyphosate. Silencing AKR1 homologues in rice and Nicotiana benthamiana or mutation of AKR1 in yeast and Arabidopsis showed increased sensitivity to glyphosate. External application of AKR proteins rescued glyphosate-mediated cucumber seedling growth inhibition. Regeneration of tobacco transgenic lines expressing PsAKR1 or OsAKRI on glyphosate suggests that AKR can be used as selectable marker to develop transgenic crops. PsAKR1- or OsAKRI-expressing tobacco and rice transgenic plants showed improved tolerance to glyphosate with reduced accumulation of shikimic acid without affecting the normal photosynthetic rates. These results suggested that AKR1 when overexpressed detoxifies glyphosate in planta. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Enhanced stresses tolerance of soybean during seed germination by maize / soybean intercropping system%玉米/大豆间作增强大豆种子在萌发期间的抗逆能力

    Institute of Scientific and Technical Information of China (English)

    陈锋; 舒凯; 刘鑫; 孟永杰; 帅海威; 周文冠; 杨峰; 刘卫国; 雍太文; 杨文钰

    2017-01-01

    In maize - soybean intercropping system,soybean was shaded by the taller crop maize,and conse-quently,soybean seeds were under shade stress conditions during their entire developmental stages. The objectives of this study were to find out whether and how the shade stress influence the abiotic stresses tolerance of soybean seeds during germination. Soybean cultivar "Hedou 19"and maize cultivar "Jundan 26"were employed as the ex-perimental materials. The maize - soybean intercropping (IC)system was two rows of maize and soybean crossed planting (1: 1),and the soybean monocropping (MC)was as control. After soybean was harvested,the quality traits including 100 - seed weight,protein content and fat content were measured and the ability of resisting adver-sity (high temperature,mannitol,glucose,PEG,NaCl and abscisic acid)during germination was analyzed. The expression of genes related to signal transduction of ABA was further analyzed by qRT - PCR assay. Results showed that there was no significant difference in 100 - seed weight,fat content and protein content between monocropping and intercropping soybean seeds. Intercropping soybean seeds germinated faster than monocropping soybean seeds under abiotic stresses conditions (high temperature,mannitol,glucose,PEG,NaCl and ABA)and showed strong resistance to abiotic stresses. qRT - PCR demonstrated that the transcription levels of GmABI4 and GmABI5,posi-tive regulators in abscisic acid (ABA)signaling pathway,in the intercropping soybean seeds were lower than that in monocropping soybean seeds. Therefore soybean quality did not change in maize - soybean intercropping system, it could enhance the abiotic stresses tolerance during germination processes,maybe primarily through weakening ABA signaling strength.%玉米/大豆间作模式下,低位作物大豆受到高位作物玉米的遮荫,导致大豆种子在发育期间受到荫蔽胁迫.为研究荫蔽胁迫对大豆种子在随后的萌发期间抗逆性的影响,

  7. Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

    Science.gov (United States)

    Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

    2017-08-01

    Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Glyphosate em mistura com herbicidas alternativos para o manejo de plantas daninhas Glyphosate combined with alternative herbicides for vegetation management

    Directory of Open Access Journals (Sweden)

    P.A. Monquero

    2001-12-01

    Full Text Available O uso intensivo de glyphosate como herbicida não-seletivo tem selecionado espécies de plantas daninhas tolerantes. Dessa forma, é importante que sejam estudadas misturas de tanque com herbicidas de mecanismos de ação alternativos e que apresentem efeitos sinergísticos ou aditivos. Por essa razão, foi instalado um experimento inteiramente casualizado, composto por 13 tratamentos e 4 repetições, em casa de vegetação da Universidade de São Paulo - ESALQ/USP, Piracicaba-SP, com as plantas daninhas Richardia brasiliensis, Commelina benghalensis, Amaranthus hybridus, Galinsoga parviflora e Ipomoea grandifolia em misturas de tanque dos herbicidas chlorimuron-ethyl, sulfentrazone, carfentrazone, bentazon ou flumioxazin com glyphosate. As interações foram aditivas para as plantas daninhas I. grandifolia e C. benghalensis, e os herbicidas flumioxazin, sulfentrazone e carfentrazone aplicados isoladamente e em mistura com glyphosate foram os que proporcionaram os melhores níveis de controle. A interação de glyphosate com sulfentrazone foi antagônica em R. brasiliensis; a mistura de glyphosate com os demais herbicidas estudados foi aditiva, sendo os tratamentos com mistura de glyphosate e chlorimuron-ethyl ou flumioxazin os mais eficazes. Em A. hybridus, os tratamentos que apresentaram melhores níveis de controle foram o glyphosate e carfentrazone, aplicados isoladamente, e a mistura de glyphosate com flumioxazin, sulfentrazone, chlorimuron-ethyl e bentazon, sendo estes interações aditivas. No caso de G. parviflora, os tratamentos com flumioxazin e sulfentrazone apresentaram controle total, o mesmo acontecendo com as misturas de glyphosate com carfentrazone, flumioxazin, sulfentrazone, chlorimuron-ethyl ou bentazon.The intensive use of glyphosate as a non-selective herbicide for weed vegetation management has selected some tolerant weed species. Thus, it is important to study the synergistic or antagonic or additive effects of tank

  9. Possible effects of glyphosate on Mucorales abundance in the rumen of dairy cows in Germany.

    Science.gov (United States)

    Schrödl, Wieland; Krüger, Susanne; Konstantinova-Müller, Theodora; Shehata, Awad A; Rulff, Ramon; Krüger, Monika

    2014-12-01

    Glyphosate (N-phosphonomethyl glycine) is registered as a herbicide for many food and non-food crops, as well as non-crop areas where total vegetation control is desired. Glyphosate influences the soil mycobiota; however, the possible effect of glyphosate residues in animal feed (soybean, corn, etc.) on animal mycobiota is almost unknown. Accordingly, the present study was initiated to investigate the mycological characteristics of dairy cows in relationship to glyphosate concentrations in urine. A total of 258 dairy cows on 14 dairy farms in Germany were examined. Glyphosate was detected in urine using ELISA. The fungal profile was analyzed in rumen fluid samples using conventional microbiological culture techniques and differentiated by MALDI-TOF mass spectrometry. LPS-binding protein (LBP) and antibodies (IgG1, IgG2, IgA, and IgM) against fungi were determined in blood using ELISA. Different populations of Lichtheimia corymbifera, Lichtheimia ramosa, Mucor, and Rhizopus were detected. L. corymbifera and L. ramosa were significantly more abundant in animals containing high glyphosate (>40 ng/ml) concentrations in urine. There were no significant changes in IgG1 and IgG2 antibodies toward isolated fungi that were related to glyphosate concentration in urine; however, IgA antibodies against L. corymbifera and L. ramosa were significantly lower in the higher glyphosate groups. Moreover, a negative correlation between IgM antibodies against L. corymbifera, L. ramosa, and Rhizopus relative to glyphosate concentration in urine was observed. LBP also was significantly decreased in animals with higher concentrations of glyphosate in their urine. In conclusion, glyphosate appears to modulate the fungal community. The reduction of IgM antibodies and LBP indicates an influence on the innate immune system of animals.

  10. Overexpression of GmCaM4 in soybean enhances resistance to pathogens and tolerance to salt stress

    Science.gov (United States)

    Soybean (Glycine max (L.) Merr.) is the major oilseed crop in the world and is a main source of oil and high-quality protein for both humans and animals worldwide. Plant diseases inflict heavy losses on soybean yield that negatively impact the US economy. Implicit in the high economic value of this ...

  11. Glyphosate biodegradation and potential soil bioremediation by Bacillus subtilis strain Bs-15.

    Science.gov (United States)

    Yu, X M; Yu, T; Yin, G H; Dong, Q L; An, M; Wang, H R; Ai, C X

    2015-11-23

    Glyphosate and glyphosate-containing herbicides have an adverse effect on mammals, humans, and soil microbial ecosystems. Therefore, it is important to develop methods for enhancing glyphosate degradation in soil through bioremediation. We investigated the potential of glyphosate degradation and bioremediation in soil by Bacillus subtilis Bs-15. Bs-15 grew well at high concentrations of glyphosate; the maximum concentration tolerated by Bs-15 reached 40,000 mg/L. The optimal conditions for bacterial growth and glyphosate degradation were less than 10,000 mg/L glyphosate, with a temperature of 35°C and a pH of 8.0. Optimal fermentation occurred at 180 rpm for 60 h with an inoculum ratio of 4%. Bs-15 degraded 17.65% (12 h) to 66.97% (96 h) of glyphosate in sterile soil and 19.01% (12 h) to 71.57% (96 h) in unsterilized soil. Using a BIOLOG ECO plate test, we observed no significant difference in average well color development values between the soil inoculated with Bs-15 and the control soil before 72 h, although there was a significant difference (P bioremediation of glyphosate-contaminated soils.

  12. Kernel compositions of glyphosate-tolerant and corn rootworm-protected MON 88017 sweet corn and insect-protected MON 89034 sweet corn are equivalent to that of conventional sweet corn (Zea mays).

    Science.gov (United States)

    Curran, Kassie L; Festa, Adam R; Goddard, Scott D; Harrigan, George G; Taylor, Mary L

    2015-03-25

    Monsanto Co. has developed two sweet corn hybrids, MON 88017 and MON 89034, that contain biotechnology-derived (biotech) traits designed to enhance sustainability and improve agronomic practices. MON 88017 confers benefits of glyphosate tolerance and protection against corn rootworm. MON 89034 provides protection against European corn borer and other lepidopteran insect pests. The purpose of this assessment was to compare the kernel compositions of MON 88017 and MON 89034 sweet corn with that of a conventional control that has a genetic background similar to the biotech sweet corn but does not express the biotechnology-derived traits. The sweet corn samples were grown at five replicated sites in the United States during the 2010 growing season and the conventional hybrid and 17 reference hybrids were grown concurrently to provide an estimate of natural variability for all assessed components. The compositional analysis included proximates, fibers, amino acids, sugars, vitamins, minerals, and selected metabolites. Results highlighted that MON 88017 and MON 89034 sweet corns were compositionally equivalent to the conventional control and that levels of the components essential to the desired properties of sweet corn, such as sugars and vitamins, were more affected by growing environment than the biotech traits. In summary, the benefits of biotech traits can be incorporated into sweet corn with no adverse effects on nutritional quality.

  13. Bacillus aryabhattai SRB02 tolerates oxidative and nitrosative stress and promotes the growth of soybean by modulating the production of phytohormones

    Science.gov (United States)

    Kang, Sang-Mo; Shahzad, Raheem; Seo, Chang-Woo; Kim, Ah-Yeong; Lee, Sang-Uk; Oh, Kyeong Yeol; Lee, Dong Yeol; Lee, In-Jung; Yun, Byung-Wook

    2017-01-01

    Plant growth promoting rhizobacteria (PGPR) are diverse, naturally occurring bacteria that establish a close association with plant roots and promote the growth and immunity of plants. Established mechanisms involved in PGPR-mediated plant growth promotion include regulation of phytohormones, improved nutrient availability, and antagonistic effects on plant pathogens. In this study, we isolated a bacterium from the rhizospheric soil of a soybean field in Chungcheong buk-do, South Korea. Using 16S rRNA sequencing, the bacterium was identified as Bacillus aryabhattai strain SRB02. Here we show that this strain significantly promotes the growth of soybean. Gas chromatography—mass spectrometry analysis showed that SRB02 produced significant amounts of abscisic acid, indole acetic acid, cytokinin and different gibberellic acids in culture. SRB02-treated soybean plants showed significantly better heat stress tolerance than did untreated plants. These plants also produced consistent levels of ABA under heat stress and exhibited ABA-mediated stomatal closure. High levels of IAA, JA, GA12, GA4, and GA7, were recorded in SRB02-treated plants. These plants produced longer roots and shoots than those of control plants. B. aryabhattai SRB02 was found to be highly tolerant to oxidative stress induced by H2O2 and MV potentiated by high catalase (CAT) and superoxide dismutase (SOD) activities. SRB02 also tolerated high nitrosative stress induced by the nitric oxide donors GSNO and CysNO. Because of these attributes, B. aryabhattai SRB02 may prove to be a valuable resource for incorporation in biofertilizers and other soil amendments that seek to improve crop productivity. PMID:28282395

  14. Bacillus aryabhattai SRB02 tolerates oxidative and nitrosative stress and promotes the growth of soybean by modulating the production of phytohormones.

    Directory of Open Access Journals (Sweden)

    Yeon-Gyeong Park

    Full Text Available Plant growth promoting rhizobacteria (PGPR are diverse, naturally occurring bacteria that establish a close association with plant roots and promote the growth and immunity of plants. Established mechanisms involved in PGPR-mediated plant growth promotion include regulation of phytohormones, improved nutrient availability, and antagonistic effects on plant pathogens. In this study, we isolated a bacterium from the rhizospheric soil of a soybean field in Chungcheong buk-do, South Korea. Using 16S rRNA sequencing, the bacterium was identified as Bacillus aryabhattai strain SRB02. Here we show that this strain significantly promotes the growth of soybean. Gas chromatography-mass spectrometry analysis showed that SRB02 produced significant amounts of abscisic acid, indole acetic acid, cytokinin and different gibberellic acids in culture. SRB02-treated soybean plants showed significantly better heat stress tolerance than did untreated plants. These plants also produced consistent levels of ABA under heat stress and exhibited ABA-mediated stomatal closure. High levels of IAA, JA, GA12, GA4, and GA7, were recorded in SRB02-treated plants. These plants produced longer roots and shoots than those of control plants. B. aryabhattai SRB02 was found to be highly tolerant to oxidative stress induced by H2O2 and MV potentiated by high catalase (CAT and superoxide dismutase (SOD activities. SRB02 also tolerated high nitrosative stress induced by the nitric oxide donors GSNO and CysNO. Because of these attributes, B. aryabhattai SRB02 may prove to be a valuable resource for incorporation in biofertilizers and other soil amendments that seek to improve crop productivity.

  15. Recent advances in glyphosate biodegradation.

    Science.gov (United States)

    Zhan, Hui; Feng, Yanmei; Fan, Xinghui; Chen, Shaohua

    2018-06-01

    Glyphosate has emerged as the most widespread herbicide to control annual and perennial weeds. Massive use of glyphosate for decades has resulted in its ubiquitous presence in the environment, and poses a threat to humans and ecosystem. Different approaches such as adsorption, photocatalytic degradation, and microbial degradation have been studied to break down glyphosate in the environment. Among these, microbial degradation is the most effective and eco-friendly method. During its degradation, various microorganisms can use glyphosate as a sole source of phosphorus, carbon, and nitrogen. Major glyphosate degradation pathways and its metabolites have been frequently investigated, but the related enzymes and genes have been rarely studied. There are many reviews about the toxicity and fate of glyphosate and its major metabolite, aminomethylphosphonic acid. However, there is lack of reviews on biodegradation and bioremediation of glyphosate. The aims of this review are to summarize the microbial degradation of glyphosate and discuss the potential of glyphosate-degrading microorganisms to bioremediate glyphosate-contaminated environments. This review will provide an instructive direction to apply glyphosate-degrading microorganisms in the environment for bioremediation.

  16. EMERGÊNCIA E ESTABELECIMENTO DE PLANTAS CULTIVADAS APÓS APLICAÇÃO DE GLYPHOSATE

    OpenAIRE

    BELUCI, Lucas Ribeiro; AZANIA, Carlos Alberto Mathias; VITORINO, Renan; AZANIA, Andrea Padua; GARCIA, Julio César; SILVA, Danilo Manoel da

    2014-01-01

    The research aimed to study the effect glyphosate doses, used in the sugarcane chemical destruction, on the emergence and early development of soybean, corn and peanut, sown in succession. An experiment was conducted for each crop in pots using a randomized design with treatments arranged in a 2 x 6 factorial and four replications with seeding times (1 and 12 days after application) and glyphosate doses (0, 1440, 2160, 2880, 3600 and 4320 g ha-1). The experimental units consisted of plast...

  17. Secondary effects of glyphosate on plants

    Science.gov (United States)

    Glyphosate is a unique herbicide with interesting secondary effects. Unfortunately, some have assumed that the secondary effects that occur in glyphosate-susceptible plants treated with glyphosate, such as altered mineral nutrition, reduced phenolic compound production and pathogen resistance, also ...

  18. Identifying Chloris Species from Cuban Citrus Orchards and Determining Their Glyphosate-Resistance Status

    Directory of Open Access Journals (Sweden)

    Enzo R. Bracamonte

    2017-11-01

    Full Text Available The Chloris genus is a C4 photosynthetic species mainly distributed in tropical and subtropical regions. Populations of three Chloris species occurring in citrus orchards from central Cuba, under long history glyphosate-based weed management, were studied for glyphosate-resistant status by characterizing their herbicide resistance/tolerance mechanisms. Morphological and molecular analyses allowed these species to be identified as C. ciliata Sw., Chloris elata Desv., and Chloris barbata Sw. Based on the glyphosate rate that causes 50% mortality of the treated plants, glyphosate resistance (R was confirmed only in C. elata, The R population was 6.1-fold more resistant compared to the susceptible (S population. In addition, R plants of C. elata accumulated 4.6-fold less shikimate after glyphosate application than S plants. Meanwhile, populations of C. barbata and C. ciliata with or without glyphosate application histories showed similar LD50 values and shikimic acid accumulation rates, demonstrating that resistance to glyphosate have not evolved in these species. Plants of R and S populations of C. elata differed in 14C-glyphosate absorption and translocation. The R population exhibited 27.3-fold greater 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS activity than the S population due to a target site mutation corresponding to a Pro-106-Ser substitution found in the EPSPS gene. These reports show the innate tolerance to glyphosate of C. barbata and C. ciliata, and confirm the resistance of C. elata to this herbicide, showing that both non-target site and target-site mechanisms are involved in its resistance to glyphosate. This is the first case of herbicide resistance in Cuba.

  19. Effects of glyphosate-based herbicides on survival, development and growth of invasive snail (Pomacea canaliculata).

    Science.gov (United States)

    Xu, Yanggui; Li, Adela Jing; Li, Kaibin; Qin, Junhao; Li, Huashou

    2017-12-01

    This study tests the hypotheses that whether environmental relevance of glyphosate would help control spread of the invasive snail Pomacea canaliculata, or benefit its population growth worldwide. Our results showed that glyphosate induced acute toxicity to the snail only at high concentrations (96h LC50 at 175mg/L) unlikely to occur in the environment. Long-term exposures to glyphosate at sublethal levels (20 and 120mg/L) caused inhibition of food intake, limitation of growth performance and alterations in metabolic profiles of the snail. It is worth noting that glyphosate at 2mg/L benefited growth performance in P. canaliculata. Chronic exposures of glyphosate significantly enhanced overall metabolic rate and altered catabolism from protein to carbohydrate/lipid mode. Cellular responses in enzyme activities showed that the exposed snails could increase tolerance by their defense system against glyphosate-induced oxidative stress, and adjustment of metabolism to mitigate energy crisis. Our study displayed that sublethal concentrations of glyphosate might be helpful in control of the invasive species by food intake, growth performance and metabolic interruption; whether environmental relevance of glyphosate (≤2mg/L) benefits population growth of P. canaliculata is still inconclusive, which requires further field study. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Water use efficiency by coffee arabica after glyphosate application

    Directory of Open Access Journals (Sweden)

    Felipe Paolinelli de Carvalho

    2014-07-01

    Full Text Available Many coffee growers apply glyphosate in directed applications, but some phytotoxicity has been noted. It is believed some herbicides can exert a direct or indirect negative effect on photosynthesis by reducing the metabolic rate in a way that can affect the water use efficiency. The objective of this study was to investigate the variables related to water use among coffee cultivars subjected to the application of glyphosate and the effects of each dose. The experiment was conducted in a greenhouse using three varieties of coffee (Coffea arabica, Acaiá (MG-6851, Catucaí Amarelo (2SL and Topázio (MG-1190, and three doses of glyphosate (0.0, 115.2 and 460.8 g acid equivalent ha-1, in a factorial 3 x 3 design. At 15 days after application, a reduction in stomatal conductance was observed, and smaller transpiration rate and water use efficiency were found in the fourth leaf at 15 days after application. There was a decrease in the transpiration rate at 45 DAA, with the Acaiá cultivar showing reductions with 115.2 g ha-1. There was transitory reduction in water use efficiency with glyphosate application, but can affect the growth and production. The Acaiá cultivar showed the highest tolerance to glyphosate because the water use efficiency after herbicide application.

  1. Glyphosate resistance: state of knowledge

    Science.gov (United States)

    Sammons, Robert Douglas; Gaines, Todd A

    2014-01-01

    Studies of mechanisms of resistance to glyphosate have increased current understanding of herbicide resistance mechanisms. Thus far, single-codon non-synonymous mutations of EPSPS (5-enolypyruvylshikimate-3-phosphate synthase) have been rare and, relative to other herbicide mode of action target-site mutations, unconventionally weak in magnitude for resistance to glyphosate. However, it is possible that weeds will emerge with non-synonymous mutations of two codons of EPSPS to produce an enzyme endowing greater resistance to glyphosate. Today, target-gene duplication is a common glyphosate resistance mechanism and could become a fundamental process for developing any resistance trait. Based on competition and substrate selectivity studies in several species, rapid vacuole sequestration of glyphosate occurs via a transporter mechanism. Conversely, as the chloroplast requires transporters for uptake of important metabolites, transporters associated with the two plastid membranes may separately, or together, successfully block glyphosate delivery. A model based on finite glyphosate dose and limiting time required for chloroplast loading sets the stage for understanding how uniquely different mechanisms can contribute to overall glyphosate resistance. PMID:25180399

  2. Assessing the Efficiency of Phenotyping Early Traits in a Greenhouse Automated Platform for Predicting Drought Tolerance of Soybean in the Field.

    Science.gov (United States)

    Peirone, Laura S; Pereyra Irujo, Gustavo A; Bolton, Alejandro; Erreguerena, Ignacio; Aguirrezábal, Luis A N

    2018-01-01

    Conventional field phenotyping for drought tolerance, the most important factor limiting yield at a global scale, is labor-intensive and time-consuming. Automated greenhouse platforms can increase the precision and throughput of plant phenotyping and contribute to a faster release of drought tolerant varieties. The aim of this work was to establish a framework of analysis to identify early traits which could be efficiently measured in a greenhouse automated phenotyping platform, for predicting the drought tolerance of field grown soybean genotypes. A group of genotypes was evaluated, which showed variation in their drought susceptibility index (DSI) for final biomass and leaf area. A large number of traits were measured before and after the onset of a water deficit treatment, which were analyzed under several criteria: the significance of the regression with the DSI, phenotyping cost, earliness, and repeatability. The most efficient trait was found to be transpiration efficiency measured at 13 days after emergence. This trait was further tested in a second experiment with different water deficit intensities, and validated using a different set of genotypes against field data from a trial network in a third experiment. The framework applied in this work for assessing traits under different criteria could be helpful for selecting those most efficient for automated phenotyping.

  3. Assessing the Efficiency of Phenotyping Early Traits in a Greenhouse Automated Platform for Predicting Drought Tolerance of Soybean in the Field

    Directory of Open Access Journals (Sweden)

    Laura S. Peirone

    2018-05-01

    Full Text Available Conventional field phenotyping for drought tolerance, the most important factor limiting yield at a global scale, is labor-intensive and time-consuming. Automated greenhouse platforms can increase the precision and throughput of plant phenotyping and contribute to a faster release of drought tolerant varieties. The aim of this work was to establish a framework of analysis to identify early traits which could be efficiently measured in a greenhouse automated phenotyping platform, for predicting the drought tolerance of field grown soybean genotypes. A group of genotypes was evaluated, which showed variation in their drought susceptibility index (DSI for final biomass and leaf area. A large number of traits were measured before and after the onset of a water deficit treatment, which were analyzed under several criteria: the significance of the regression with the DSI, phenotyping cost, earliness, and repeatability. The most efficient trait was found to be transpiration efficiency measured at 13 days after emergence. This trait was further tested in a second experiment with different water deficit intensities, and validated using a different set of genotypes against field data from a trial network in a third experiment. The framework applied in this work for assessing traits under different criteria could be helpful for selecting those most efficient for automated phenotyping.

  4. Occurrence of glyphosate and AMPA residues in soy-based infant formula sold in Brazil.

    Science.gov (United States)

    Rodrigues, Nadia Regina; de Souza, Ana Paula Ferreira

    2018-04-01

    Glyphosate is an herbicide widely used in the world, being applied in several crops, among them soybeans. Recently, glyphosate and its metabolite aminomethylphosphonic acid (AMPA) have been identified as possible contributors to the emergence of various diseases such as autism, Parkinson's and Alzheimer's diseases, as well as cancer. The child population-consuming cereal-based foods is the most exposed to the effects of pesticides because of their developmental phase and they have a higher food intake per kilogram of body weight than adults. The presence of glyphosate and AMPA residues in soy-based infant formulas was evaluated during the years 2012-2017, totalising 105 analyses carried out on 10 commercial brands from different batches. Glyphosate and AMPA were determined by liquid chromatography with fluorescence detection after derivatisation reaction. The method was validated and showed accuracy and precision with a limit of quantification (LOQ) of 0.02 mg kg -1 . Among those samples that contained levels above the LOQ, the variation of glyphosate residues was from 0.03 mg kg -1 to 1.08 mg kg -1 and for AMPA residues was from 0.02 mg kg -1 to 0.17 mg kg -1 . This is the first scientific communication about glyphosate and AMPA contamination in soy-based infant formula in Brazil, The study was conducted under good laboratory practice (GLP) and supported by good scientific practice.

  5. Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

    2015-10-01

    Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

  6. Characterization of bacterial functional groups and microbial activity in microcosms with glyphosate application

    Science.gov (United States)

    Moyano, Sofia; Bonetto, Mariana; Baigorria, Tomas; Pegoraro, Vanesa; Ortiz, Jimena; Faggioli, Valeria; Conde, Belen; Cazorla, Cristian; Boccolini, Monica

    2017-04-01

    Glyphosate is a worldwide used herbicide as c. 90% of transgenic crops are tolerant to it. Microbial degradation of glyphosate molecule in soil is considered the most important process that determines its persistence in the environment. However, the impact of this herbicide on target groups of soil biota remains poorly understood. Our objective was to characterize the abundance of bacterial groups and global microbial activity, under controlled conditions with application of increasing doses of glyphosate. A bioassay was carried out in microcosms using an agricultural soil (Typic Argiudoll) with registered history of glyphosate application from National Institute of Agricultural Technology (INTA, EEA Marcos Juarez, Argentina). Glyphosate of commercial formulation (74.7%) was used and the following treatments were evaluated: Soil without glyphosate (control), and Soil with doses equivalent to 1.12 and 11.2 kg ai ha-1. Microbiological parameters were estimated at 3, 7, 14 and 21 days after herbicide application by counting heterotrophic, cellulolytic, nitrogen fixing (N), and nitrifying bacteria; and fluorescein diacetate hydrolysis (FDA), microbial respiration (MR) and microbial biomass (C-BM). The N cycle related bacteria showed greater sensitivity to glyphosate with significant increases in abundance. On the other hand the C cycle parameters were strongly conditioned by the time elapsed since the application of the herbicide, as did the MR. The FDA declined with the highest dose, while the C-BM was not affected. Therefore, we conclude that in the studied experimental conditions glyphosate stimulated bacterial growth (i.e. target abundances) representing a source of N, C and nutrients. On the other hand, enzymatic activity (FDA) decreased when glyphosate was applied in the highest dose, whereas, it had no effect on the MR nor C-BM, which could be attributable to the organic matter content of the soil. However, future research in field conditions is necessary, for

  7. Overexpression of a specific soybean GmGSTU4 isoenzyme improves diphenyl ether and chloroacetanilide herbicide tolerance of transgenic tobacco plants.

    Science.gov (United States)

    Benekos, Kostantinos; Kissoudis, Christos; Nianiou-Obeidat, Irini; Labrou, Nikolaos; Madesis, Panagiotis; Kalamaki, Mary; Makris, Antonis; Tsaftaris, Athanasios

    2010-10-01

    Plant glutathione transferases (GSTs) superfamily consists of multifunctional enzymes and forms a major part of the plants herbicide detoxification enzyme network. The tau class GST isoenzyme GmGSTU4 from soybean, exhibits catalytic activity towards the diphenyl ether herbicide fluorodifen and is active as glutathione-dependent peroxidase (GPOX). Transgenic tobacco plants of Basmas cultivar were generated via Agrobacterium transformation. The aim was to evaluate in planta, GmGSTU4's role in detoxifying the diphenyl ether herbicides fluorodifen and oxyfluorfen and the chloroacetanilides alachlor and metolachlor. Transgenic tobacco plants were verified by PCR and Southern blot hybridization and expression of GmGSTU4 was determined by RT-PCR. Leaf extracts from transgenic plants showed moderate increase in GST activity towards CDNB and a significant increase towards fluorodifen and alachlor, and at the same time an increased GPOX activity towards cumene hydroperoxide. GmGSTU4 overexpressing plants when treated with 200 μM fluorodifen or oxyfluorfen exhibited reduced relative electrolyte leakage compared to wild type plants. Moreover all GmGSTU4 overexpressing lines exhibited significantly increased tolerance towards alachlor when grown in vitro at 7.5 mg/L alachlor compared to wild type plants. No significant increased tolerance was observed to metolachlor. These results confirm the contribution of this particular GmGSTU4 isoenzyme from soybean in the detoxification of fluorodifen and alachlor, and provide the basis towards the development of transgenic plants with improved phytoremediation capabilities for future use in environmental cleanup of herbicides. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. A Dehydration-Induced Eukaryotic Translation Initiation Factor iso4G Identified in a Slow Wilting Soybean Cultivar Enhances Abiotic Stress Tolerance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Juan P. Gallino

    2018-03-01

    Full Text Available Water is usually the main limiting factor for soybean productivity worldwide and yet advances in genetic improvement for drought resistance in this crop are still limited. In the present study, we investigated the physiological and molecular responses to drought in two soybean contrasting genotypes, a slow wilting N7001 and a drought sensitive TJS2049 cultivars. Measurements of stomatal conductance, carbon isotope ratios and accumulated dry matter showed that N7001 responds to drought by employing mechanisms resulting in a more efficient water use than TJS2049. To provide an insight into the molecular mechanisms that these cultivars employ to deal with water stress, their early and late transcriptional responses to drought were analyzed by suppression subtractive hybridization. A number of differentially regulated genes from N7001 were identified and their expression pattern was compared between in this genotype and TJS2049. Overall, the data set indicated that N7001 responds to drought earlier than TJ2049 by up-regulating a larger number of genes, most of them encoding proteins with regulatory and signaling functions. The data supports the idea that at least some of the phenotypic differences between slow wilting and drought sensitive plants may rely on the regulation of the level and timing of expression of specific genes. One of the genes that exhibited a marked N7001-specific drought induction profile encoded a eukaryotic translation initiation factor iso4G (GmeIFiso4G-1a. GmeIFiso4G-1a is one of four members of this protein family in soybean, all of them sharing high sequence identity with each other. In silico analysis of GmeIFiso4G-1 promoter sequences suggested a possible functional specialization between distinct family members, which can attain differences at the transcriptional level. Conditional overexpression of GmeIFiso4G-1a in Arabidopsis conferred the transgenic plants increased tolerance to osmotic, salt, drought and low

  9. A model based on spectrofluorimetry to study the interaction between glyphosate and serum albumin of Salminus brasiliensis

    Science.gov (United States)

    Escobar, Marta Araujo Cyrino; Cortez, Celia Martins; Silva, Dilson; Neto, Jayme da Cunha Bastos

    2017-11-01

    The aim of this work is to initiate an investigation on the albumin of Salminus brasiliensis (gold fish) as a biomarker of environmental actions of glyphosate. We started using a mathematical-computational model based on spectrofluorimetric measurements to study the interaction of glyphosate with gold fish albumin and human serum albumin. Salminus brasiliensis is a migratory freshwater fish species found in southern and central-western Brazil, mainly in the Prata river basin, where most of soybean plantations are set. Glyphosate is a very used herbicide in this type of crop. Differently from the organophosphorate methyl parathion, glyphosate does not form complex with HSA, and the quenching constants estimated for its binding with gold fish albumin at 20 °C and 25 °C is 1.3(± 0.3) × 104 / M e 2.5 (± 0.3) × 104 / M, respectively.

  10. What do farmers' weed control decisions imply about glyphosate resistance? Evidence from surveys of US corn fields.

    Science.gov (United States)

    Wechsler, Seth J; McFadden, Jonathan R; Smith, David J

    2018-05-01

    The first case of glyphosate-resistant weeds in the United States was documented in 1998, 2 years after the commercialization of genetically engineered herbicide-resistant (HR) corn and soybeans. Currently, over 15 glyphosate-resistant weed species affect US crop production areas. These weeds have the potential to reduce yields, increase costs, and lower farm profitability. The objective of our study is to develop a behavioral model of farmers' weed management decisions and use it to analyze weed resistance to glyphosate in US corn farms. On average, we find that weed control increased US corn yields by 3700 kg ha -1 (worth approximately $US 255 ha -1 ) in 2005 and 3500 kg ha -1 (worth approximately $US 575 ha -1 ) in 2010. If glyphosate resistant weeds were absent, glyphosate killed approximately 99% of weeds, on average, when applied at the label rate in HR production systems. Average control was dramatically lower in states where glyphosate resistance was widespread. We find that glyphosate resistance had a significant impact on weed control costs and corn yields of US farmers in 2005 and 2010. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  11. The need for independent research on the health effects of glyphosate-based herbicides.

    Science.gov (United States)

    Landrigan, Philip J; Belpoggi, Fiorella

    2018-05-29

    Glyphosate, formulated as Roundup, is the world's most widely used herbicide. Glyphosate is used extensively on genetically modified (GM) food crops designed to tolerate the herbicide, and global use is increasing rapidly. Two recent reviews of glyphosate's health hazards report conflicting results. An independent review by the International Agency for Research on Cancer (IARC) found that glyphosate is a "probable human carcinogen". A review by the European Food Safety Agency (EFSA) found no evidence of carcinogenic hazard. These differing findings have produced regulatory uncertainty. Reflecting this regulatory uncertainty, the European Commission on November 27 2017, extended authorization for glyphosate for another 5 years, while the European Parliament opposed this decision and issued a call that pesticide approvals be based on peer-reviewed studies by independent scientists rather than on the current system that relies on proprietary industry studies. The Ramazzini Institute has initiated a pilot study of glyphosate's health hazards that will be followed by an integrated experimental research project. This evaluation will be independent of industry support and entirely sponsored by worldwide crowdfunding. The aim of the Ramazzini Institute project is to explore comprehensively the effects of exposures to glyphosate-based herbicides at current real-world levels on several toxicological endpoints, including carcinogenicity, long-term toxicity, neurotoxicity, endocrine disrupting effects, prenatal developmental toxicity, the microbiome and multi-generational effects.

  12. Does glyphosate cause cancer?

    OpenAIRE

    German Federal Institute for Risk Assessment

    2015-01-01

    In its recent evaluation from March 2015, the International Agency for Cancer Research (IARC), as the specialized cancer agency of the World Health Organization (WHO), came to the conclusion that glyphosate should now be classified as a carcinogenic substance in Group 2A (probably carcinogenic to humans), based on “limited evidence” in human-experiments and ”sufficient evidence” in animal-experiments. This classification was pub-lished in a short report in the "Lancet" journal on 20 March 201...

  13. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    is linked to a different set of circumstances than the ones suggested by existing models in contemporary democratic theory. Reorienting the discussion of tolerance, the book raises the question of how to disclose new possibilities within our given context of affect and perception. Once we move away from......Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated...... by the desire to experiment and to become otherwise. The objective is to discuss what gets lost, conceptually as well as politically, when we neglect the subsistence of active tolerance within other practices of tolerance, and to develop a theory of active tolerance in which tolerance's mobilizing character...

  14. Ectopic phytocystatin expression leads to enhanced drought stress tolerance in soybean (Glycine max) and Arabidopsis thaliana through effects on strigolactone pathways and can also result in improved seed traits.

    Science.gov (United States)

    Quain, Marian D; Makgopa, Matome E; Márquez-García, Belén; Comadira, Gloria; Fernandez-Garcia, Nieves; Olmos, Enrique; Schnaubelt, Daniel; Kunert, Karl J; Foyer, Christine H

    2014-09-01

    Ectopic cystatin expression has long been used in plant pest management, but the cysteine protease, targets of these inhibitors, might also have important functions in the control of plant lifespan and stress tolerance that remain poorly characterized. We therefore characterized the effects of expression of the rice cystatin, oryzacystatin-I (OCI), on the growth, development and stress tolerance of crop (soybean) and model (Arabidopsis thaliana) plants. Ectopic OCI expression in soybean enhanced shoot branching and leaf chlorophyll accumulation at later stages of vegetative development and enhanced seed protein contents and decreased the abundance of mRNAs encoding strigolactone synthesis enzymes. The OCI-expressing A. thaliana showed a slow-growth phenotype, with increased leaf numbers and enhanced shoot branching at flowering. The OCI-dependent inhibition of cysteine proteases enhanced drought tolerance in soybean and A. thaliana, photosynthetic CO2 assimilation being much less sensitive to drought-induced inhibition in the OCI-expressing soybean lines. Ectopic OCI expression or treatment with the cysteine protease inhibitor E64 increased lateral root densities in A. thaliana. E64 treatment also increased lateral root densities in the max2-1 mutants that are defective in strigolactone signalling, but not in the max3-9 mutants that are defective in strigolactone synthesis. Taken together, these data provide evidence that OCI-inhibited cysteine proteases participate in the control of growth and stress tolerance through effects on strigolactones. We conclude that cysteine proteases are important targets for manipulation of plant growth, development and stress tolerance, and also seed quality traits. © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Effects of the herbicide glyphosate on non-target plant native species from Chaco forest (Argentina).

    Science.gov (United States)

    Florencia, Ferreira María; Carolina, Torres; Enzo, Bracamonte; Leonardo, Galetto

    2017-10-01

    Agriculture based on transgenic crops has expanded in Argentina into areas formerly occupied by Chaco forest. Even though glyphosate is the herbicide most widely used in the world, increasing evidence indicates severe ecotoxicological effects on non-target organisms as native plants. The aim of this work is to determine glyphosate effects on 23 native species present in the remaining Chaco forests immersed in agricultural matrices. This is a laboratory/greenhouse approach studying acute effects on seedlings after 21 days. A gradient of glyphosate rates (525, 1050, 2100, 4200, and 8400g ai/Ha; recommended field application rate (RFAR) = 2100g ai/Ha) was applied on four-week seedlings cultivated in a greenhouse and response variables (phytotoxicity, growth reduction, and sensitivity to the herbicide) were measured. This gradient of herbicide rates covers realistic rates of glyphosate applications in the crop field and also those that can reach vegetation of forest relicts by off-target drift and overspray. Testing was performed following guidelines for vegetative vigour (post-germination spray). All species showed lethal or sublethal effects after the application of the 25% of RFAR (50% of species showed severe phytotoxicity or death and 70% of species showed growth reduction). The results showed a gradient of sensitivity to glyphosate by which some of the studied species are very sensitive to glyphosate and seedlings died with 25% of RFAR while other species can be classified as herbicide-tolerant. Thus, the vegetation present in the forest relicts could be strongly affected by glyphosate application on crops. Lethal and sublethal effects of glyphosate on non-target plants could promote both the loss of biodiversity in native forest relicts immersed in the agroecosystems and the selection of new crop weeds considering that some biotypes are continuously exposed to low doses of glyphosate. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Tolerance

    DEFF Research Database (Denmark)

    Tønder, Lars

    Tolerance: A Sensorial Orientation to Politics is an experiment in re-orientation. The book is based on the wager that tolerance exceeds the more prevalent images of self-restraint and repressive benevolence because neither precludes the possibility of a more “active tolerance” motivated by the d...... these alternatives by returning to the notion of tolerance as the endurance of pain, linking this notion to exemplars and theories relevant to the politics of multiculturalism, religious freedom, and free speech....

  17. Application of Polymerase Chain Reaction for High Sensitivity Detection of Roundup Ready™ Soybean Seeds and Grains in Varietal Mixtures

    Directory of Open Access Journals (Sweden)

    Ashok Pandey

    2011-01-01

    Full Text Available Strong increase in the production of genetically modified organisms (GMOs observed over the years has led to a consolidation of transgenic seed industries worldwide. The dichotomy between the evaluated risk and the perceived risk of transgenic use has defined their level of acceptability among different global societies. GMOs have been widely applied to agricultural commodities, among them the Roundup Ready™ (RR™ soybean line GTS 40-3-2 has become the most prevalent transgenic crop in the world. This variety was developed to confer plant tolerance against glyphosate-based agricultural herbicide Roundup Ready™. Issues related to detection and traceability of GMOs have gained worldwide interest due to their increasing global diffusion and the related socioeconomic and health implications. Also, due to the widespread use of GMOs in food production, labelling regulations have been established in some countries to protect the right of consumers and producers. Besides regulatory demand, consumer concern issues have resulted in the development of several methods of detecting and quantifying foods derived from genetically engineered crops and their raw materials. Polymerase chain reaction (PCR has been proven to be the method of choice to detect the presence or absence of the introduced genes of GMOs at DNA level. The present paper aims to verify whether the PCR technique can detect RR™ soybean seeds among conventional ones to further certification as non-GM soybean seeds and grains. This analysis could be accomplished through the development of new methodology called 'intentional contamination' of soybean conventional seeds or grains with the respective RR™ soybeans. The results show that the PCR method can be applied with high sensitivity in order to certify conventional soybean seeds and grains.

  18. A novel 5-enolpyruvylshikimate-3-phosphate synthase from Rahnella aquatilis with significantly reduced glyphosate sensitivity.

    Directory of Open Access Journals (Sweden)

    Ri-He Peng

    Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.

  19. Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase.

    Science.gov (United States)

    Baerson, Scott R; Rodriguez, Damian J; Tran, Minhtien; Feng, Yongmei; Biest, Nancy A; Dill, Gerald M

    2002-07-01

    The spontaneous occurrence of resistance to the herbicide glyphosate in weed species has been an extremely infrequent event, despite over 20 years of extensive use. Recently, a glyphosate-resistant biotype of goosegrass (Eleusine indica) was identified in Malaysia exhibiting an LD(50) value approximately 2- to 4-fold greater than the sensitive biotype collected from the same region. A comparison of the inhibition of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity by glyphosate in extracts prepared from the resistant (R) and sensitive (S) biotypes revealed an approximately 5-fold higher IC(50)(glyphosate) for the (R) biotype. Sequence comparisons of the predicted EPSPS mature protein coding regions from both biotypes revealed four single-nucleotide differences, two of which result in amino acid changes. One of these changes, a proline to serine substitution at position 106 in the (R) biotype, corresponds to a substitution previously identified in a glyphosate-insensitive EPSPS enzyme from Salmonella typhimurium. Kinetic data generated for the recombinant enzymes suggests that the second substitution identified in the (R) EPSPS does not contribute significantly to its reduced glyphosate sensitivity. Escherichia coli aroA- (EPSPS deficient) strains expressing the mature EPSPS enzyme from the (R) biotype exhibited an approximately 3-fold increase in glyphosate tolerance relative to strains expressing the mature EPSPS from the (S) biotype. These results provide the first evidence for an altered EPSPS enzyme as an underlying component of evolved glyphosate resistance in any plant species.

  20. THE REMOVAL OF GLYPHOSATE FROM DRINKING WATER

    Science.gov (United States)

    The effectiveness of granulated activated carbon (GAC), packed activated carbon (PAC), conventional treatment, membranes, and oxidation for removing glyphosate from natural waters is evaluated. Results indicate that GAC and PAC are not effective in removing glyphosate, while oxid...

  1. 75 FR 24969 - Glyphosate From China

    Science.gov (United States)

    2010-05-06

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Notice of withdrawal of petition in... investigation concerning glyphosate from China (investigation No. 731-TA-1178 (Preliminary)) is discontinued...

  2. 75 FR 17768 - Glyphosate From China

    Science.gov (United States)

    2010-04-07

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Institution of antidumping investigation... States is materially retarded, by reason of imports from China of glyphosate, provided for in subheadings...

  3. Herbicide Glyphosate Impact to Earthworm (E. fetida

    Directory of Open Access Journals (Sweden)

    Greta Dajoraitė

    2016-10-01

    Full Text Available Glyphosate is a broad spectrum weed resistant herbicide. Glyphosate may pose negative impact on land ecosystems because of wide broad usage and hydrofilic characteristic. The aim of this study was to investigate negative effects of glyphosate on soil invertebrate organisms (earthworm Eisenia fetida. The duration of experiment was 8 weeks. The range of the test concentrations of glyphosate were: 0,1, 1, 5, 10, 20 mg/kg. To investigate the glyphosate impact on earthworm Eisenia fetida the following endpoints were measured: survival, reproduction and weight. The exposure to 20 mg/kg glyphosate has led to the 100% mortality of earthworms. Glyphosate has led to decreased E. fetida reproduction, the cocoons were observed only in the lowest concentration (0,1 mg/kg. In general: long-term glyphosate toxicity to earthworms (E. fetida may be significant.

  4. Transgenic and conventional Brazilian soybeans don't cause or prevent preneoplastic colon lesions or oxidative stress in a 90-day in vivo study

    Directory of Open Access Journals (Sweden)

    Felipe Augusto Sbruzzi

    2013-08-01

    Full Text Available OBJECTIVE: The study presents the results of a 90-day safety assessment of rats fed with four varieties of soybeans, BRS 245 RR and BRS Valiosa RR (transgenic, BRS 133 and MG BR46 Conquista (non-transgenic. METHODS: Diets were prepared by incorporating toasted soybean flour to a commercial diet at 1%, 10% or 20% weight In the in vivo experimental the rats' body weight, body weight gain, food consumption, number of aberrant crypt foci, oxidative stress biomarkers, urea and creatinine levels were analyzed and compared between experimental groups, as well as histopathological observations (digestive tract, liver, kidneys. RESULTS: The results indicate that glyphosate-tolerant soy varieties neither induce nor prevent aberrant crypt foci induction, nor do their conventional counterparts. Similarly, none of the four soybean varieties tested induced changes in the digestive tract, liver or kidney. Serum biochemical parameters were also unchanged. CONCLUSION: The consumption of both, conventional and transgenic soybeans, were insufficient to ameliorate dimethylhydrazine-induced oxidative stress.

  5. Phenotyping soybean plants transformed with rd29A:AtDREB1A for drought tolerance in the greenhouse and field.

    Science.gov (United States)

    de Paiva Rolla, Amanda Alves; de Fátima Corrêa Carvalho, Josirley; Fuganti-Pagliarini, Renata; Engels, Cibelle; do Rio, Alexandre; Marin, Silvana Regina Rockenbach; de Oliveira, Maria Cristina Neves; Beneventi, Magda A; Marcelino-Guimarães, Francismar Corrêa; Farias, José Renato Bouças; Neumaier, Norman; Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko; Nepomuceno, Alexandre Lima

    2014-02-01

    The development of drought tolerant plants is a high priority because the area suffering from drought is expected to increase in the future due to global warming. One strategy for the development of drought tolerance is to genetically engineer plants with transcription factors (TFs) that regulate the expression of several genes related to abiotic stress defense responses. This work assessed the performance of soybean plants overexpressing the TF DREB1A under drought conditions in the field and in the greenhouse. Drought was simulated in the greenhouse by progressively drying the soil of pot cultures of the P58 and P1142 lines. In the field, the performance of the P58 line and of 09D-0077, a cross between the cultivars BR16 and P58, was evaluated under four different water regimes: irrigation, natural drought (no irrigation) and water stress created using rain-out shelters in the vegetative or reproductive stages. Although the dehydration-responsive element-binding protein (DREB) plants did not outperform the cultivar BR16 in terms of yield, some yield components were increased when drought was introduced during the vegetative stage, such as the number of seeds, the number of pods with seeds and the total number of pods. The greenhouse data suggest that the higher survival rates of DREB plants are because of lower water use due to lower transpiration rates under well watered conditions. Further studies are needed to better characterize the soil and atmospheric conditions under which these plants may outperform the non-transformed parental plants.

  6. [Poisonings with the herbicides glyphosate and glyphosate-trimesium].

    Science.gov (United States)

    Mortensen, O S; Sørensen, F W; Gregersen, M; Jensen, K

    2000-08-28

    Generally the herbicide glyphosate is considered harmless to humans. Glyphosate-trimesium is labelled harmful (Xn), whereas glyphosate-isopropylamine carries no warning sign. As cases of serious poisoning have emerged contacts to the Poison Information Centre have been reviewed. The persons exposed were mainly smaller children and adults 20 to 59 years of age. Oral exposure was recorded in 47 persons, inhalation exposure in 24 and topical contact in 42. About one fourth of the exposed persons were asymptomatic. Most of the symptomatic poisonings demonstrated complaints from the mouth, the gastrointestinal tract and the airways. Eleven patients were admitted to hospital. Two died, one of them having ingested the isopropylamine salt, the other the trimesium salt. Death ensued quickly in the latter patient. A similar fate was observed in a child--not included in the present material--who had also ingested the trimesium compound.

  7. COMPARATIVE EFFICACY AND TOLERABILITY OF AVOCADO / SOYBEAN UNSAPONIFIABLES AND THEIR COMBINATION WITH INTRA-ARTICULAR HYALURONIC ACID IN PATIENTS WITH KNEE AND HIP OSTEOARTHROSIS

    Directory of Open Access Journals (Sweden)

    Ye. I. Shmidt

    2014-11-01

    Full Text Available Objective: to evaluate the comparative efficacy and tolerability of avocado / soybean unsaponifiables (ASU and their combination with intra-articular hyaluronic acid in patients with knee and hip osteoarthrosis (OA.Subjects and methods. A randomized observational non-interventional non-placebo controlled trial was conducted. It included 18 patients who were randomized to 2 groups with 9 in each. One patient group took only ASU along with nonsteroidal anti-nflammatory drugs (NSAIDs; the other received ASU in combination with intra-articular hyaluronic acid. Their treatment was performed for 6 months, followed by a 6-month follow-up. The results were assessed by the WOMAC index. Account was taken of the opinions of a patient and his / her physician on therapeutic effectiveness, as well as altered needs for NSAIDs during treatment and after the follow-up.Results. There was a gradual reduction in joint pain, stiffness, and dysfunction (as shown by the visual analog scale in both groups just one month posttherapy. This trend remained for 3 months. After 6 months of therapy, there were slight increases in the values of joint pain, stiffness, and dysfunction in the combined therapy group whereas the values continued to decrease in the monotherapy group. Six months after termination of treatment, the examined values doubled in the ASU monotherapy group and remained at posttreatment visit levels in the combined therapy group. Just the same, six months after termination of 6-month therapy, both groups displayed the significantly lower values of pain, stiffness, and dysfunction than those prior to treatment. ASU used both alone and in combination with hyaluronic acid was noted to be well tolerated. The considerable reduction in the needs for NSAIDs in both groups and, in a number of cases, the possibility of reducing their intake proved the efficiency of ASU used alone and in combination with hyaluronic acid. The important result of this trial

  8. Tolerance to water deficiency between two soybean cultivars: transgenic versus conventional Tolerância à deficiência hídrica entre dois cultivares de soja: transgênico versus convencional

    Directory of Open Access Journals (Sweden)

    Tiago Aranda Catuchi

    2011-03-01

    Full Text Available The main goal of the study was to evaluate the effects on the development and physiological aspects of soybean plants grown under water deficiency at greenhouse conditions, comparing the levels of tolerance to water deficiency between one transgenic and one conventional cultivar, enabling a systematic way to carried out physiological comparisons between soybean cultivars under drought. The study was divided into completely randomized using a factorial 2×2 design, with five replicates. The experimental design included two replenishment levels of daily irrigation (100% and 40%, applied to the leaves during the V4 developmental stage (fourth trifoliate fully expanded and two cultivars, 'CD 202' conventional and 'CD 226RR' transgenic. The results showed that both cultivars had similar effects, caused by water deficiency, on dry mass production, but the transgenic cultivar tended to maintain higher biomass allocation in pods, as well as, higher efficiency of leaves to support dry mass production than conventional cultivar in both water conditions. Moreover, the higher maximum CO2 assimilation values and lower membranes damages in the transgenic cultivar under water deficiency showed that the expected higher drought tolerance of the conventional cultivar was not supported by a more accurate physiological investigation.O principal objetivo do estudo foi avaliar os efeitos sobre o desenvolvimento e aspectos fisiológicos de plantas de soja cultivadas sob deficiência hídrica em condições de casa de vegetação, comparando os níveis de tolerância à deficiência de água entre um cultivar transgênico e um convencional, gerando uma forma sistemática de realizar comparações fisiológicas entre cultivares de soja sob déficit hídrico. O delineamento experimental foi inteiramente casualizado, em esquema fatorial 2×2, com cinco repetições. Os tratamentos hídricos foram dois níveis de reposição de irrigação diária (100% e 40%, aplicados a

  9. Tolerância da soja ao desfolhamento afetada pela redução do espaçamento entre fileiras Soybean tolerance to defoliation as affected by row spacing reduction

    Directory of Open Access Journals (Sweden)

    Geovano Parcianello

    2004-04-01

    Full Text Available A redução do espaçamento entre fileiras de 40 para 20cm incrementa a interceptação da radiação, o índice de área foliar e o rendimento de grãos. Este trabalho objetivou avaliar se a redução do espaçamento entre fileiras influencia a tolerância da soja à perda de área fotossintética. O experimento foi conduzido, em semeadura direta na Estação Experimental Agronômica da UFRGS, na safra 2000/01. Utilizou-se o delineamento experimental de blocos ao acaso, com quatro repetições, em parcelas sub-subdivididas. Os tratamentos foram desfolhamento em três estádios de desenvolvimento (V9 - nono nó, R2 - floração e R5 - inicio enchimento de grãos, dois espaçamentos entre fileiras (20 e 40cm e quatro níveis de desfolhamento (0 - testemunha, 33, 67 e 100%. Foi utilizada a cultivar FT-Abyara. Os desfolhamentos realizados no período reprodutivo reduziram o rendimento, sendo o estádio R5 o mais crítico. O rendimento médio de grãos da testemunha não desfolhada foi 21% maior no espaçamento de 20cm (4134kg ha-1 do que no de 40cm (3413kg ha-1 e manteve-se sempre superior, em todos os níveis de desfolhamento. O componente que mais influenciou o rendimento foi o número de legumes m-2. Estes resultados indicam que a redução do espaçamento entre fileiras de 40cm para 20cm é uma prática cultural favorável tanto para as plantas com área foliar intacta quando desfolhadas.The row spacing reduction from 40 to 20 cm increase radiation interception, leaf area index and grain yield. This experiment aimed to evaluate if the row spacing reduction influence soybean tolerance to loss of photosynthetic area. The research was performed using no-till tillage system at the Agronomic Experimental Station of Universidade Federal do Rio Grande do Sul, during the 2000/01 growing season. Treatments were arranged in a split-split plot randomized complete block design, with four replications. Treatments included five combination of defoliation in

  10. Toothpick test: a methodology for the detection of RR soybean plants1

    Directory of Open Access Journals (Sweden)

    Fabiana Mota da Silva

    Full Text Available Due to the large increase in the area cultivated with genetically modified soybean in Brazil, it has become necessary to determine methods that are fast and efficient for detecting these cultivars. The aim of this work was to test the efficiency of the toothpick method in the detection of RR soybean plants, as well as to distinguish between cultivars, for sensitivity caused by herbicide. Ten transgenic soybean cultivars, resistant to the active ingredient glyphosate, and ten conventional soybean cultivars were used. Toothpicks soaked in glyphosate were applied to all the plants at stage V6 and evaluations were made at 2, 4, 6, 8 and 10 days after application (DAA. The effects of the glyphosate on the cultivars, and the symptoms of phytotoxicity caused in the transgenic plants were evaluated by means of grading scales. The toothpick test is effective in identifying RR soybean cultivars and also in separating them into groups by sensitivity to the symptoms caused by the glyphosate.

  11. Glyphosate catabolism by Pseudomonas sp

    International Nuclear Information System (INIS)

    Shinabarger, D.L.

    1986-01-01

    The pathway for the degradation of glyphosate (N-phosphonomethylglycine) by Pseudomonas sp. PG2982 has been determined using metabolic radiolabeling experiments. Radiorespirometry experiments utilizing [3- 14 C] glyphosate revealed that approximately 50-59% of the C3 carbon was oxidized to CO 2 . Fractionation of stationary phase cells labeled with [3- 14 C]glyphosate revealed that from 45-47% of the assimilated C3 carbon is distributed to proteins and that amino acids methionine and serine are highly labeled. The nucleic acid bases adenine and guanine received 90% of the C3 label that was incorporated into nucleic acids, and the only pyrimidine base labeled was thymine. Pulse labeling of PG2982 cells with [3- 14 C]glyphosate revealed that [3- 14 C]sarcosine is an intermediate in glyphosate degradation. Examination of crude extracts prepared from PG2982 cells revealed the presence of an enzyme that oxidizes sarcosine to glycine and formaldehyde. These results indicate that the first step in glyphosate degradation by PG2982 is cleavage of the carbon-phosphorus bond, resulting in the release of sarcosine and a phosphate group. The phosphate group is utilized as a source of phosphorus, and the sarcosine is degraded to glycine and formaldehyde. Phosphonate utilization by Pseudomonas sp. PG2982 was investigated. Each of the ten phosphonates tested were utilized as a sole source of phosphorus by PG2982. Representative compounds tested included alkylphosphonates, 1-amino-substituted alkylphosphonates, amino-terminal phosphonates, and an arylphosphonate. PG2982 cultures degraded phenylphosphonate to benzene and produced methane from methylphosphonate. The data indicate that PG2982 is capable of cleaving the carbon-phosphorus bond of several structurally different phosphonates

  12. 76 FR 5780 - Determination of Regulated Status of Alfalfa Genetically Engineered for Tolerance to the...

    Science.gov (United States)

    2011-02-02

    ...] Determination of Regulated Status of Alfalfa Genetically Engineered for Tolerance to the Herbicide Glyphosate... decision and determination on the petition regarding the regulated status of alfalfa genetically engineered... regulated status of alfalfa genetically engineered for tolerance to the herbicide glyphosate based on an...

  13. Error-prone PCR mutation of Ls-EPSPS gene from Liriope spicata conferring to its enhanced glyphosate-resistance.

    Science.gov (United States)

    Mao, Chanjuan; Xie, Hongjie; Chen, Shiguo; Valverde, Bernal E; Qiang, Sheng

    2017-09-01

    Liriope spicata (Thunb.) Lour has a unique LsEPSPS structure contributing to the highest-ever-recognized natural glyphosate tolerance. The transformed LsEPSPS confers increased glyphosate resistance to E. coli and A. thaliana. However, the increased glyphosate-resistance level is not high enough to be of commercial value. Therefore, LsEPSPS was subjected to error-prone PCR to screen mutant EPSPS genes capable of endowing higher resistance levels. A mutant designated as ELs-EPSPS having five mutated amino acids (37Val, 67Asn, 277Ser, 351Gly and 422Gly) was selected for its ability to confer improved resistance to glyphosate. Expression of ELs-EPSPS in recombinant E. coli BL21 (DE3) strains enhanced resistance to glyphosate in comparison to both the LsEPSPS-transformed and -untransformed controls. Furthermore, transgenic ELs-EPSPS A. thaliana was about 5.4 fold and 2-fold resistance to glyphosate compared with the wild-type and the Ls-EPSPS-transgenic plants, respectively. Therefore, the mutated ELs-EPSPS gene has potential value for has potential for the development of glyphosate-resistant crops. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Comparison of herbicide regimes and the associated potential enviromental effects of glyphosate-resistant crops versus what they replace in Europe

    NARCIS (Netherlands)

    Kleter, G.A.; Harris, C.; Stephenson, G.R.; Unsworth, J.

    2008-01-01

    While cultivation of transgenic crops takes place in seven of the EU member states, this constitutes a relatively limited part of the total acreage planted to these crops worldwide. The only glyphosate-resistant (GR) crop grown commercially until recently has been soybean in Romania. In addition,

  15. SELECTION FOR ALUMINUM TOLERANCE IN TROPICAL SOYBEANS SELEÇÃO PARA TOLERÂNCIA AO ALUMÍNIO EM SOJA TROPICAL

    Directory of Open Access Journals (Sweden)

    Luiz Augusto Copati Souza

    2007-09-01

    Full Text Available

    Soil acidity is a limiting factor for most of the cultivated plants in the Brazilian Savannah. Toxicity caused by aluminum (Al is especially serious in the acid subsurface, which remains acidic after soil has been amended, by hindering root growth and causing drought susceptibility and nutritional unbalance. This research aimed at selecting soybean with increased tolerance to Al through association of hydroponics and field experiments. Crosses including savannah adapted genotypes were obtained. Seeds of contrasting individuals, selected in hydroponics at F2 generation for root growth, were obtained for progeny evaluation at F3, in the field, and at F4 in hydroponics. Grain production and total dry matter of selected progenies were superior to the parentals, in the acid soil experiment. These results were confirmed by performance in hydroponics, indicating the method may be successfully employed in breeding programs for crop adaptation to subsurface acid soil conditions.

    KEY-WORDS: Subsurface acidity; Glycine max; Al stress; plant breeding.

    A acidez do solo é fator limitante para a maioria das plantas cultivadas no Cerrado Brasileiro. A toxidez causada por alumínio (Al é especialmente séria na subsuperfície, que permanece ácida após o uso de corretivos, por impedir o crescimento radicular e causar suscetibilidade à seca e desbalanceamento nutricional. Aqui objetivou-se a seleção de genótipos de soja com maior tolerância ao Al, pela associação de experimentos em hidroponia e no campo. Cruzamentos incluindo genótipos selecionados no Cerrado foram realizados. Sementes de indivíduos contrastantes, selecionados em hidroponia na geração F2 pelo crescimento radicular, foram obtidas para avaliação de progênies em F3, no campo, e em F4, novamente em hidroponia

  16. GmSALT3, which Confers Improved Soybean Salt Tolerance in the Field, Increases Leaf Cl– Exclusion prior to Na+ Exclusion but does not Improve Early Vigour under Salinity

    Directory of Open Access Journals (Sweden)

    Ying Liu

    2016-09-01

    Full Text Available Soil salinity reduces soybean growth and yield. The recently identified GmSALT3 (Glycine max salt Tolerance-associated gene on chromosome 3 has the potential to improve soybean yields in salinized conditions. To evaluate the impact of GmSALT3 on soybean performance under saline or non-saline conditions, three sets of near isogenic lines (NILs, with genetic similarity 95.6-99.3% between each pair of NIL-T and NIL-S, were generated from a cross between two varieties, 85-140 (salt-sensitive, S and Tiefeng 8 (salt-tolerant, T by using marker-assisted selection. Each NIL; 782-T, 820-T and 860-T, contained a common ~1000 kb fragment on chromosome 3 where GmSALT3 was located. We show that GmSALT3 does not contribute to an improvement in seedling emergence rate or early vigour under salt stress. However, when 12-day-old seedlings were exposed to NaCl stress, the NIL-T lines accumulated significantly less leaf Na+ compared with their corresponding NIL-S, while no significant difference of K+ concentration was observed between NIL-T and NIL-S; the magnitude of Na+ accumulation within each NIL-T set was influenced by the different genetic backgrounds. In addition, NIL-T lines accumulated less Cl– in the leaf and more in the root prior to any difference in Na+; in the field they accumulated less pod wall Cl– than the corresponding NIL-S lines. Under non-saline field conditions, no significant differences were observed for yield related traits within each pair of NIL-T and NIL-S lines, indicating there was no yield penalty for having the GmSALT3 gene. In contrast, under saline field conditions the NIL-T lines had significantly greater plant seed weight and 100-seed weight than the corresponding NIL-S lines, meaning GmSALT3 conferred a yield advantage to soybean plants in salinized fields. Our results indicated that GmSALT3 mediated regulation of both Na+ and Cl– accumulation in soybean, and contributes to improved soybean yield through maintaining a

  17. GLYPHOSATE REMOVAL FROM DRINKING WATER

    Science.gov (United States)

    Activated-carbon, oxidation, conventional-treatment, filtration, and membrane studies are conducted to determine which process is best suited to remove the herbicide glyphosate from potable water. Both bench-scale and pilot-scale studies are completed. Computer models are used ...

  18. Evolution of a Double Amino Acid Substitution in the 5-Enolpyruvylshikimate-3-Phosphate Synthase in Eleusine indica Conferring High-Level Glyphosate Resistance1

    Science.gov (United States)

    Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R. Douglas; Powles, Stephen B.

    2015-01-01

    Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I + P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. PMID:25717039

  19. Evolution of a double amino acid substitution in the 5-enolpyruvylshikimate-3-phosphate synthase in Eleusine indica conferring high-level glyphosate resistance.

    Science.gov (United States)

    Yu, Qin; Jalaludin, Adam; Han, Heping; Chen, Ming; Sammons, R Douglas; Powles, Stephen B

    2015-04-01

    Glyphosate is the most important and widely used herbicide in world agriculture. Intensive glyphosate selection has resulted in the widespread evolution of glyphosate-resistant weed populations, threatening the sustainability of this valuable once-in-a-century agrochemical. Field-evolved glyphosate resistance due to known resistance mechanisms is generally low to modest. Here, working with a highly glyphosate-resistant Eleusine indica population, we identified a double amino acid substitution (T102I+P106S [TIPS]) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant individuals. This TIPS mutation recreates the biotechnology-engineered commercial first generation glyphosate-tolerant EPSPS in corn (Zea mays) and now in other crops. In E. indica, the naturally evolved TIPS mutants are highly (more than 180-fold) resistant to glyphosate compared with the wild type and more resistant (more than 32-fold) than the previously known P106S mutants. The E. indica TIPS EPSPS showed very high-level (2,647-fold) in vitro resistance to glyphosate relative to the wild type and is more resistant (600-fold) than the P106S variant. The evolution of the TIPS mutation in crop fields under glyphosate selection is likely a sequential event, with the P106S mutation being selected first and fixed, followed by the T102I mutation to create the highly resistant TIPS EPSPS. The sequential evolution of the TIPS mutation endowing high-level glyphosate resistance is an important mechanism by which plants adapt to intense herbicide selection and a dramatic example of evolution in action. © 2015 American Society of Plant Biologists. All Rights Reserved.

  20. A glyphosate micro-emulsion formulation displays teratogenicity in Xenopus laevis.

    Science.gov (United States)

    Bonfanti, Patrizia; Saibene, M; Bacchetta, R; Mantecca, P; Colombo, A

    2018-02-01

    Glyphosate is the active ingredient in broad-spectrum herbicide formulations used in agriculture, domestic area and aquatic weed control worldwide. Its market is growing steadily concurrently with the cultivation of glyphosate-tolerant transgenic crops and emergence of weeds less sensitive to glyphosate. Ephemeral and lentic waters near to agricultural lands, representing favorite habitats for amphibian reproduction and early life-stage development, may thus be contaminated by glyphosate based herbicides (GBHs) residues. Previous studies on larval anuran species highlighted increased mortality and growth effects after exposure to different GBHs in comparison to glyphosate itself, mainly because of the surfactants such as polyethoxylated tallow amine present in the formulations. Nevertheless, these conclusions are not completely fulfilled when the early development, characterized by primary organogenesis events, is considered. In this study, we compare the embryotoxicity of Roundup ® Power 2.0, a new GBH formulation currently authorized in Italy, with that of technical grade glyphosate using the Frog Embryo Teratogenesis Assay-Xenopus (FETAX). Our results evidenced that glyphosate was not embryolethal and only at the highest concentration (50 mg a.e./L) caused edemas. Conversely, Roundup ® Power 2.0 exhibited a 96 h LC50 of 24.78 mg a.e./L and a 96 h EC50 of 7.8 mg a.e./L. A Teratogenic Index of 3.4 was derived, pointing out the high teratogenic potential of the Roundup ® Power 2.0. Specific concentration-dependent abnormal phenotypes, such as craniofacial alterations, microphthalmia, narrow eyes and forebrain regionalization defects were evidenced by gross malformation screening and histopathological analysis. These phenotypes are coherent with those evidenced in Xenopus laevis embryos injected with glyphosate, allowing us to hypothesize that the teratogenicity observed for Roundup ® Power 2.0 may be related to the improved efficacy in delivering

  1. Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

    Science.gov (United States)

    Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

    2013-01-01

    Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

  2. Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

    Directory of Open Access Journals (Sweden)

    Tao Zhan

    Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

  3. RELATIVE COMPETITIVENESS OF GOOSEGRASS BIOTYPES AND SOYBEAN CROPS

    Directory of Open Access Journals (Sweden)

    JADER JOB FRANCO

    2017-01-01

    Full Text Available he goosegrass ( Eleusine indica (L. Gaertn is an annual plant that has a low - level resistance to glyphosate (LLRG, resulting in control failure in genetically modified soybean crops for resistance to this herbicide. Alleles related to resistance may cause changes in the plant biotype, such as inferior competitive ability. Thus, the objective of this work was to evaluated the competitive ability of soybean crops and susceptible and resistant (LLRG goosegrass biotypes. Replacement series experiments were conducted with soybean crops and goosegrass biotypes. The ratios of soybean to susceptible or resistant (LLRG goosegrass plants were 100:0, 75:25, 50:50, 25:75 and 0:100, with a total population of 481 plants m - 2 . The leaf area, plant height and shoot dry weight were evaluated at 40 days after emergence of the soybean crops and weeds. The soybean crop had superior competitive ability to the susceptible and resistant (LLRG goosegrass biotypes. The soybean crop showed similar competitive ability in both competitions, either with the susceptible or resistant (LLRG goosegrass biotypes. The intraspecific competition was more harmful to the soybean crop, while the interspecific competition caused greater damage to the goosegrass biotypes competing with the soybean crop

  4. Micromorfologia foliar na análise da fitotoxidez por glyphosate em Eucalyptus grandis Leaf micromorphology in the analysis of glyphosate toxicity in Eucalyptus grandis

    Directory of Open Access Journals (Sweden)

    L.D. Tuffi Santos

    2009-01-01

    Full Text Available Foram avaliados os efeitos da deriva de formulações comerciais de glyphosate sobre a superfície foliar e o crescimento de clones de eucalipto. Mudas de seis clones foram submetidas a 129,6 g ha-1 de glyphosate das formulações comerciais Scout®, Roundup NA®, Roundup transorb® e Zapp QI®. Entre os clones não foram identificadas diferenças quanto à tolerância ao glyphosate. Plantas expostas à deriva simulada de Roundup transorb® e Zapp QI® apresentaram, respectivamente, a maior e menor porcentagem de intoxicação. Observou-se menor massa seca em plantas expostas ao glyphosate, independentemente da formulação, e menor altura naquelas expostas ao Scout® e ao Roundup transorb®. As características quantitativas da superfície foliar não foram afetadas pelo glyphosate. As alterações micromorfológicas ocorreram na ausência de danos visíveis e foram observadas em ambas as faces da epiderme, em todos os clones avaliados. Danos como erosão e aspecto amorfo das ceras epicuticulares e infestação por hifas fúngicas ocorreram, independentemente da formulação utilizada. A avaliação anatômica da superfície foliar foi relevante para descrição e interpretação dos danos causados pelo glyphosate. Os dados de crescimento e de intoxicação indicam o Zapp QI® como a formulação de menor risco para a cultura do eucalipto quanto aos efeitos indesejáveis da deriva.The effects of commercial glyphosate drift on the leaf surface and growth of eucalypt clones were evaluated. Seedlings of six clones were submitted to 129.6 g ha-1 sub-rate of commercial glyphosate formulations Scout®, Roundup NA®, Roundup transorb® and Zapp QI®. No differences in tolerance to glyphosate were observed among the clones. Plants exposed to simulated drift of Roundup transorb® and Zapp QI® presented the highest and lowest intoxication percentages, respectively. Plants exposed to glyphosate reduced dry biomass, regardless of the formulation, and also

  5. 76 FR 78232 - Monsanto Co.; Determination of Nonregulated Status for Soybean Genetically Engineered To Have a...

    Science.gov (United States)

    2011-12-16

    ... peer review of safety tests, and health effects of genetically modified organisms and glyphosate. APHIS...] Monsanto Co.; Determination of Nonregulated Status for Soybean Genetically Engineered To Have a Modified... that there is reason to believe are plant pests. Such genetically engineered organisms and products are...

  6. Glyphosate-Degrading Microorganisms from Industrial Activated Sludge

    OpenAIRE

    Balthazor, Terry M.; Hallas, Laurence E.

    1986-01-01

    A plating medium was developed to isolate N-phosphonomethylglycine (glyphosate)-degrading microorganisms, with glyphosate as the sole phosphorus source. Two industrial biosystems treating glyphosate wastes contained elevated microbial counts on the medium. One purified isolate metabolized glyphosate to aminomethylphosphonic acid, mineralizing this accumulating intermediate during log growth. This microorganism has been identified as a Flavobacterium species.

  7. 150 ACUTE TOXICITY OF GLYPHOSATE ON CLARIAS ...

    African Journals Online (AJOL)

    The effects of glyphosate on mortality rate and behavioural responses of Clarias gariepinus fingerlings were investigated under laboratory conditions for 96 hours exposure period. The lethal concentration (LC50) value of glyphosate on fingerlings of Clarias gariepinus was 0.0018 ml/l for 96 hours of exposure.

  8. Effect of glyphosate on wheat quality characteristics

    Science.gov (United States)

    Glyphosate is the most widely used herbicide in the world. It is a non-selective, broad spectrum, post-emergence herbicide, and therefore controls a wide range of different species. Although glyphosate is effective in weed control, side effects of this herbicide on the crop itself, micro and macro o...

  9. Determination of glyphosate by high performance liquid ...

    African Journals Online (AJOL)

    The aim of this study was to design a glyphosate analysis method. This molecule is an organic pollutant from water and soil. We have developed a chromatographic method with phenylisothiocyanate. This molecule has allowed obtaining an intermediate molecule with the glyphosate being easily detectable in ...

  10. Glyphosate-resistant goosegrass from Mississippi

    Science.gov (United States)

    A glyphosate resistant population of goosegrass (Eleusine indica (L.) Gaertn.) was documented near Stoneville, Mississippi, USA, in an area which had received multiple applications of glyphosate each year for the previous eleven years. Resistance ratios based on dose response growth reduction assays...

  11. Glyphosate: too much of a good thing?

    Directory of Open Access Journals (Sweden)

    Marek eCuhra

    2016-04-01

    Full Text Available Although previously accepted as the less toxic alternative, with low impact on animals, farmers as well as consumers who are exposed to residues in food, glyphosate chemicals are now increasingly controversial as new evidence from research is emerging. We argue that specific aspects of the history, chemistry and safety of glyphosate and glyphosate-based herbicides should be thoroughly considered in present and future re-evaluations of these dominant agrochemicals:· Glyphosate is not a single chemical, it is a family of compounds with different chemical, physical and toxicological properties.· Glyphosate is increasingly recognized as having more profound toxicological effects than assumed from previous assessments.· Global use of glyphosate is continuously increasing and residues are detected in food, feed and drinking water. Thus, consumers are increasingly exposed to higher levels of glyphosate residues, and from an increasing number of sources.· Glyphosate regulation is predominantly still based on primary safety-assessment testing in various indicator organisms. However, archive studies indicate fraud and misbehavior committed by the commercial laboratories providing such research.We see emerging evidences from studies in test-animals, ecosystems indicators and studies in human health, which justify stricter regulatory measures. This implies revising glyphosate residue definitions and lowering Maximum Residue Limits (MRLs permissible in biological material intended for food and feed, as well as strengthening environmental criteria such as accepted residue concentrations in surface waters.It seems that although recent research indicates that glyphosates are less harmless than previously assumed and have complex toxicological potential, still regulatory authorities accept industry demands for approving higher levels of these residues in food and feed.

  12. Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli*S⃞

    Science.gov (United States)

    Funke, Todd; Yang, Yan; Han, Huijong; Healy-Fried, Martha; Olesen, Sanne; Becker, Andreas; Schönbrunn, Ernst

    2009-01-01

    The shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the target of the broad spectrum herbicide glyphosate. The genetic engineering of EPSPS led to the introduction of glyphosate-resistant crops worldwide. The genetically engineered corn lines NK603 and GA21 carry distinct EPSPS enzymes. CP4 EPSPS, expressed in NK603 corn and transgenic soybean, cotton, and canola, belongs to class II EPSPS, glyphosate-insensitive variants of this enzyme isolated from certain Gram-positive bacteria. GA21 corn, on the other hand, was created by point mutations of class I EPSPS, such as the enzymes from Zea mays or Escherichia coli, which are sensitive to low glyphosate concentrations. The structural basis of the glyphosate resistance resulting from these point mutations has remained obscure. We studied the kinetic and structural effects of the T97I/P101S double mutation, the molecular basis for GA21 corn, using EPSPS from E. coli. The T97I/P101S enzyme is essentially insensitive to glyphosate (Ki = 2.4 mm) but maintains high affinity for the substrate phosphoenolpyruvate (PEP) (Km = 0.1 mm). The crystal structure at 1.7-Å resolution revealed that the dual mutation causes a shift of residue Gly96 toward the glyphosate binding site, impairing efficient binding of glyphosate, while the side chain of Ile97 points away from the substrate binding site, facilitating PEP utilization. The single site T97I mutation renders the enzyme sensitive to glyphosate and causes a substantial decrease in the affinity for PEP. Thus, only the concomitant mutations of Thr97 and Pro101 induce the conformational changes necessary to produce catalytically efficient, glyphosate-resistant class I EPSPS. PMID:19211556

  13. Bermudagrass (Cynodon spp) dose-response relationships with clethodim, glufosinate and glyphosate.

    Science.gov (United States)

    Webster, Theodore M; Hanna, Wayne W; Mullinix, Benjamin G

    2004-12-01

    Greenhouse studies were conducted to evaluate the sensitivity of three commercial cultivars, eight experimental cultivars and common bermudagrass to clethodim, glufosinate and glyphosate. Each herbicide was applied at eight doses. Data were regressed on herbicide dose using a log-logistic curve (R2 = 0.56-0.95 for clethodim, R2 = 0.60-0.94 for glufosinate, and R2 = 0.70-0.96 for glyphosate). The herbicide rate that elicited a 50% plant response (I50) in the bermudagrass cultivars ranged from 0.04 to 0.19 kg ha(-1) clethodim, 0.19 to 1.33 kg ha(-1) glufosinate and 0.34 to 1.14 kg ha(-1) glyphosate. Relative to other cultivars, common bermudagrass was intermediate in its response to clethodim and among the most tolerant cultivars to glufosinate and glyphosate. TifSport was relatively tolerant to clethodim and glufosinate compared with other cultivars, but relatively sensitive to glyphosate. One cultivar, 94-437, was consistently among the most sensitive cultivars to each of the herbicides. While there were differential herbicide tolerances among the tested bermudagrass cultivars, there did not appear to be any naturally occurring herbicide resistance that could be commercially utilized. However, research indicated that breeding efforts should target herbicide resistance that is at least four times the registered use rate. Also, TifSport and Tifway have been identified as suitable representatives of triploid hybrid bermudagrass cultivars to be used to evaluate the success of turfgrass renovation programs. 2004 Society of Chemical Industry.

  14. 75 FR 17566 - Flutolanil; Pesticide Tolerances

    Science.gov (United States)

    2010-04-07

    ... ppm, and the greater tolerance value is needed to accommodate indirect residues from soybean..., and soybean hay at 2.5 ppm are being revoked since the same tolerance values are being established...; Pesticide Tolerances AGENCY: Environmental Protection Agency (EPA). ACTION: Final rule. SUMMARY: This...

  15. Differential gene expression and mitotic cell analysis of the drought tolerant soybean (Glycine max L. Merrill Fabales, Fabaceae cultivar MG/BR46 (Conquista under two water deficit induction systems

    Directory of Open Access Journals (Sweden)

    Polyana K. Martins

    2008-01-01

    Full Text Available Drought cause serious yield losses in soybean (Glycine max, roots being the first plant organ to detect the water-stress signals triggering defense mechanisms. We used two drought induction systems to identify genes differentially expressed in the roots of the drought-tolerant soybean cultivar MG/BR46 (Conquista and characterize their expression levels during water deficit. Soybean plants grown in nutrient solution hydroponically and in sand-pots were submitted to water stress and gene expression analysis was conducted using the differential display (DD and real time polymerase chain reaction (PCR techniques. Three differentially expressed mRNA transcripts showed homology to the Antirrhinum majus basic helix-loop-helix transcription factor bHLH, the Arabidopsis thaliana phosphatidylinositol transfer protein PITP and the auxin-independent growth regulator 1 (axi 1. The hydroponic experiments showed that after 100 min outside the nutrient solution photosynthesis completely stopped, stomata closed and leaf temperature rose. Both stress induction treatments produced significant decrease in the mitotic indices of root cells. Axi 1, PITP and bHLH were not only differentially expressed during dehydration in the hydroponics experiments but also during induced drought in the pot experiments. Although, there were differences between the two sets of experiments in the time at which up or down regulation occurred, the expression pattern of all three transcripts was related. Similar gene expression and cytological analysis results occurred in both systems, suggesting that hydroponics could be used to simulate drought detection by roots growing in soil and thus facilitate rapid and easy root sampling.

  16. Discrimination of transgenic soybean seeds by terahertz spectroscopy

    Science.gov (United States)

    Liu, Wei; Liu, Changhong; Chen, Feng; Yang, Jianbo; Zheng, Lei

    2016-10-01

    Discrimination of genetically modified organisms is increasingly demanded by legislation and consumers worldwide. The feasibility of a non-destructive discrimination of glyphosate-resistant and conventional soybean seeds and their hybrid descendants was examined by terahertz time-domain spectroscopy system combined with chemometrics. Principal component analysis (PCA), least squares-support vector machines (LS-SVM) and PCA-back propagation neural network (PCA-BPNN) models with the first and second derivative and standard normal variate (SNV) transformation pre-treatments were applied to classify soybean seeds based on genotype. Results demonstrated clear differences among glyphosate-resistant, hybrid descendants and conventional non-transformed soybean seeds could easily be visualized with an excellent classification (accuracy was 88.33% in validation set) using the LS-SVM and the spectra with SNV pre-treatment. The results indicated that THz spectroscopy techniques together with chemometrics would be a promising technique to distinguish transgenic soybean seeds from non-transformed seeds with high efficiency and without any major sample preparation.

  17. Biodegradation of glyphosate in rhizospheric soil cultivated with Glycine max, Canavalia ensiformis e Stizolobium aterrimum Biodegradação de glyphosate em solo rizosférico de Glycine max, Canavalia ensiformis e Stizolobium aterrimum

    Directory of Open Access Journals (Sweden)

    J.B. Santos

    2009-01-01

    Full Text Available Biodegradation of glyphosate was evaluated in rhizospheric soil cultivated with Glycine max (soybean, var. BRS245-RR, Canavalia ensiformis and Stizolobium aterrimum. After these species were cultivated for 60 days, soil samples were collected, placed in flasks and treated with 14C-glyphosate. After 30 days of incubation, the total release rate of C-CO2 was determined along with microbial biomass (MBC, metabolic quotient (qCO2, and degradation percentage of the radio-labeled glyphosate released as 14C-CO2. A higher mass of rhizosphere-associated microorganisms was verified in the soil samples from pots cultivated with soybean, regardless of glyphosate addition. However, in the presence of the herbicide, this characteristic was the most negatively affected. Microorganisms from the C. ensiformis rhizosphere released a lower amount of 14C-CO2, while for those originated from S. aterrimum, the amount released reached 1.3% more than the total carbon derived from the respiratory activity. The rhizospheric soil from S. aterrimum also presented higher glyphosate degradation efficiency per microbial biomass unit. However, considering qCO2, the microbiota of the rhizospheric soil cultivated with soybean was more efficient in herbicide degradation.Avaliou-se neste trabalho a degradação de glyphosate em solo rizosférico proveniente do cultivo de Glycine max (soja var. BRS245-RR, Canavalia ensiformis e Stizolobium aterrimum. Para isso, após o cultivo, em vasos, das citadas espécies por 60 dias, coletaram-se amostras de solo, as quais foram acondicionadas em frascos e tratadas com 14C-glyphosate. Após 32 dias de incubação, foram determinados a taxa de desprendimento total de C-CO2, a biomassa microbiana (MBC, o quociente metabólico (qCO2 e a porcentagem de degradação do glyphosate radiomarcado liberado na forma de 14C-CO2. Verificou-se a maior massa de microrganismos associados à rizosfera em amostras de solo proveniente de vasos cultivados com a

  18. Glyphosate Dissipation in Different Soils Under No-Till and Conventional Till

    Science.gov (United States)

    Okada, Elena; Costa, Jose Luis; Francisco, Bedmar

    2017-04-01

    Glyphosate is the most used herbicide in Argentina, accounting for 62% of the commercialized pesticides in the market. It is used as a weed controller in chemical fallow under no-till systems, and it is also applied in various genetically modified crops (e.g. soybean, corn, cotton). Though it has a high solubility in water, it tends to adsorb and accumulate in agricultural soils. The description of glyphosate biodegradation in soils with a long term history under agricultural practices is of interest. The main objectives of this work were to compare the dissipation of glyphosate and the accumulation of its metabolite aminomethylphosphonic acid (AMPA) over time in three soils from Argentina. The studied soils belong to areas of high agronomic land use and different edaphoclimatic conditions, situated in Manfredi (MAN), Pergamino (PER) and Paraná (PAR). Soil samples were taken from long-term field trials with a history of more than 16 years under no-till and conventional tillage management. To study glyphosate dissipation in soil under controlled laboratory conditions, 400 g of dry soil sample were placed in 1.5 L flasks. A dose corresponding to 6 L ha-1 of commercial glyphosate ATANOR II® (35.6 % a.i.) was applied on day 0. The dose applied was equivalent to a final concentration in soil of 4000 μg Kg-1 of active ingredient. The moisture of the soil samples was kept at 60 % of the field capacity. Samples were incubated in the dark at a constant temperature of 22°C ± 1°C. A sub-sample of 5 g was taken from each flask at day 0 (after application), 1, 3, 7, 15, 20, 28, 44 and 62. Glyphosate and AMPA in soil samples was extracted with a strong basic solution (100 mM Na2B4O7•10H2O/ 100 mM K3PO4, pH=9) and then derivitazed with FMOC-Cl. Detection and quantification of the compounds was performed by ultra-performance liquid chromatography coupled with a mass spectrometer (UPLC MS/MS). The results showed that forty percent of the applied glyphosate was degraded

  19. Tolerância à interferência de plantas competidoras e habilidade de supressão por genótipos de soja: II. Resposta de variáveis de produtividade Tolerance to interference of competing plants and suppressive ability by soybean genotypes: II. Response of yield variables

    Directory of Open Access Journals (Sweden)

    F.P. Lamego

    2004-12-01

    Full Text Available As perdas de produtividade das culturas em decorrência da competição de plantas concorrentes geralmente aumentam quanto mais semelhantes forem suas características morfofisiológicas. O objetivo deste trabalho foi avaliar os efeitos da competição de cultivares de soja, simulando espécies daninhas dicotiledôneas, sobre cultivares de soja portadores de características diferenciais de planta. Para isso, conduziu-se um experimento em campo, em Eldorado do Sul-RS. Os fatores e tratamentos comparados foram: três condições de competição (ausência de plantas de soja concorrentes e presença de plantas concorrentes do cultivar de soja BRS 205 ou Cobb; e quatro cultivares reagentes de soja à competição (IAS 5, BR-16, CD 205 e Fepagro RS-10. Avaliaram-se variáveis relacionadas à produtividade dos cultivares e outras correlatas. Características dissimilares em plantas de cultivares de soja, como estatura e ciclo, resultaram em habilidade competitiva diferenciada com plantas concorrentes. O cultivar de soja CD 205, de estatura elevada e ciclo tardio, mostrou alta habilidade competitiva; IAS 5, de baixa estatura e ciclo precoce, apresentou baixa tolerância à competição, enquanto BR-16 e Fepagro RS-10 são intermediários. Cultivares com elevada habilidade competitiva, além de tolerarem a competição, preservando o potencial de produtividade, também suprimem a produção de grãos das plantas concorrentes.Due to concurrent plant competition, crop yield losses generally increase as their morphophysiological characteristics become more similar. The objective of this research was to evaluate the competitive effects of soybean cultivars mimicking dicotyledonous weed species on soybean cultivars holding dissimilar plant characteristics. Thus, a field experiment was carried out in Eldorado do Sul-RS. The factors and treatments compared were: three competition conditions (absence of competing plants and presence of the soybean cultivar

  20. [Glyphosate--a non-toxic pesticide?].

    Science.gov (United States)

    Pieniazek, Danuta; Bukowska, Bozena; Duda, Wirgiliusz

    2003-01-01

    Glyphosate is currently the most commonly applied herbicide and its use is still growing. Nowadays, over 50 commercial preparations containing this compound are used, and these formulations are much more toxic than their active compound, glyphosate, owing to the presence of many surfactants and carrier compounds. Toxicological investigations provide evidence that glyphosate is an extremely "safe" herbicide for animals. This is why its use in agriculture is universal. In June 1991, the Environmental Protection Agency (EPA) categorized this compound into class E (according to EPA there are five categories of carcinogenicity), which means that it is probably not carcinogenic to humans. Unfortunately, the study carried out by Swedish oncologists in 2001 showed that glyphosate may induce cancer of the lymphatic system. The results of the Swedish study have changed our opinion about "safety" of this herbicide. Investigations concerning both its accumulation and toxic effect in animals and plants are now under way in many laboratories.

  1. Culturable endophytic bacterial communities associated with field-grown soybean.

    Science.gov (United States)

    de Almeida Lopes, K B; Carpentieri-Pipolo, V; Oro, T H; Stefani Pagliosa, E; Degrassi, G

    2016-03-01

    Assess the diversity of the culturable endophytic bacterial population associated with transgenic and nontransgenic soybean grown in field trial sites in Brazil and characterize them phenotypically and genotypically focusing on characteristics related to plant growth promotion. Endophytic bacteria were isolated from roots, stems and leaves of soybean cultivars (nontransgenic (C) and glyphosate-resistant (GR) transgenic soybean), including the isogenic BRS133 and BRS245RR. Significant differences were observed in bacterial densities in relation to genotype and tissue from which the isolates were obtained. The highest number of bacteria was observed in roots and in GR soybean. Based on characteristics related to plant growth promotion, 54 strains were identified by partial 16S rRNA sequence analysis, with most of the isolates belonging to the species Enterobacter ludwigii and Variovorax paradoxus. Among the isolates, 44·4% were able to either produce indoleacetic acid (IAA) or solubilize phosphates, and 9·2% (all from GR soybean) presented both plant growth-promoting activities. The results from this study indicate that the abundance of endophytic bacterial communities of soybean differs between cultivars and in general it was higher in the transgenic cultivars than in nontransgenic cultivars. BRS 245 RR exhibited no significant difference in abundance compared to nontransgenic BRS133. This suggests that the impact of the management used in the GR soybean fields was comparable with the impacts of some enviromental factors. However, the bacterial endophytes associated to GR and nontransgenic soybean were different. The soybean-associated bacteria showing characteristics related to plant growth promotion were identified as belonging to the species Pantoea agglomerans and Variovorax paradoxus. Our study demonstrated differences concerning compostion of culturable endophytic bacterial population in nontransgenic and transgenic soybean. © 2016 The Society for Applied

  2. Electrochemical degradation and mineralization of glyphosate herbicide.

    Science.gov (United States)

    Tran, Nam; Drogui, Patrick; Doan, Tuan Linh; Le, Thanh Son; Nguyen, Hoai Chau

    2017-12-01

    The presence of herbicide is a concern for both human and ecological health. Glyphosate is occasionally detected as water contaminants in agriculture areas where the herbicide is used extensively. The removal of glyphosate in synthetic solution using advanced oxidation process is a possible approach for remediation of contaminated waters. The ability of electrochemical oxidation for the degradation and mineralization of glyphosate herbicide was investigated using Ti/PbO 2 anode. The current intensity, treatment time, initial concentration and pH of solution are the influent parameters on the degradation efficiency. An experimental design methodology was applied to determine the optimal condition (in terms of cost/effectiveness) based on response surface methodology. Glyphosate concentration (C 0  = 16.9 mg L -1 ) decreased up to 0.6 mg L -1 when the optimal conditions were imposed (current intensity of 4.77 A and treatment time of 173 min). The removal efficiencies of glyphosate and total organic carbon were 95 ± 16% and 90.31%, respectively. This work demonstrates that electrochemical oxidation is a promising process for degradation and mineralization of glyphosate.

  3. EPA's evaluation of the carcinogenic potential of glyphosate

    Science.gov (United States)

    Recently, several international agencies have evaluated the carcinogenic potential of glyphosate. In March 2015, the International Agency for Research on Cancer (IARC), a subdivision of the World Health Organization (WHO), determined that glyphosate was a probable carcinogen (gro...

  4. Fate of the herbicides glyphosate, glufosinate-ammonium, phenmedipham, ethofumesate and metamitron in two Finnish arable soils.

    Science.gov (United States)

    Laitinen, Pirkko; Siimes, Katri; Eronen, Liisa; Rämö, Sari; Welling, Leena; Oinonen, Seija; Mattsoff, Leona; Ruohonen-Lehto, Marja

    2006-06-01

    The fate of five herbicides (glyphosate, glufosinate-ammonium, phenmedipham, ethofumesate and metamitron) was studied in two Finnish sugar beet fields for 26 months. Soil types were sandy loam and clay. Two different herbicide-tolerant sugar beet cultivars and three different herbicide application schedules were used. Meteorological data were collected throughout the study and soil properties were thoroughly analysed. An extensive data set of herbicide residue concentrations in soil was collected. Five different soil depths were sampled. The study was carried out using common Finnish agricultural practices and represents typical sugar beet cultivation conditions in Finland. The overall observed order of persistence was ethofumesate > glyphosate > phenmedipham > metamitron > glufosinate-ammonium. Only ethofumesate and glyphosate persisted until the subsequent spring. Seasonal variation in herbicide dissipation was very high and dissipation ceased almost completely during winter. During the 2 year experiment no indication of potential groundwater pollution risk was obtained, but herbicides may cause surface water pollution. Copyright (c) 2006 Society of Chemical Industry

  5. Induced mutation for soybean quality

    International Nuclear Information System (INIS)

    Wang Peiying; Xu Dechun; Guo Yuhong; Meng Lifen; Zhao Xiaonan

    2000-01-01

    Gamma rays of acute and chronic radiation, thermal neutrons as well as ethyl methane sulphonate (EMS), sodium azide (NaN 3 ) of chemical mutagens were used to improve the quality of soybean seed. Some mutants of better quality were selected. 'Heinong No.41' With protein and oil content of 45.23% and 18.80% respectively was tolerant to akali-saline and had a higher yield potential; 90-3527 with earlier mature (110 days of growth period) and high protein content (47.53%) had a resistance to soybean mosaic virus (SMV) and frog-eye lief spot of soybean. The mutants with higher linoleic acid content (more than 60%) and lower linolenic acid content (less than 3.5%) were developed

  6. Glyphosate-Resistant and Conventional Canola (Brassica napus L.) Responses to Glyphosate and Aminomethylphosphonic Acid (AMPA) Treatment.

    Science.gov (United States)

    Corrêa, Elza Alves; Dayan, Franck E; Owens, Daniel K; Rimando, Agnes M; Duke, Stephen O

    2016-05-11

    Glyphosate-resistant (GR) canola contains two transgenes that impart resistance to the herbicide glyphosate: (1) the microbial glyphosate oxidase gene (gox) encoding the glyphosate oxidase enzyme (GOX) that metabolizes glyphosate to aminomethylphosphonic acid (AMPA) and (2) cp4 that encodes a GR form of the glyphosate target enzyme 5-enolpyruvylshikimic acid-3-phosphate synthase. The objectives of this research were to determine the phytotoxicity of AMPA to canola, the relative metabolism of glyphosate to AMPA in GR and conventional non-GR (NGR) canola, and AMPA pool sizes in glyphosate-treated GR canola. AMPA applied at 1.0 kg ha(-1) was not phytotoxic to GR or NGR. At this AMPA application rate, NGR canola accumulated a higher concentration of AMPA in its tissues than GR canola. At rates of 1 and 3.33 kg ae ha(-1) of glyphosate, GR canola growth was stimulated. This stimulatory effect is similar to that of much lower doses of glyphosate on NGR canola. Both shikimate and AMPA accumulated in tissues of these glyphosate-treated plants. In a separate experiment in which young GR and NGR canola plants were treated with non-phytotoxic levels of [(14)C]-glyphosate, very little glyphosate was metabolized in NGR plants, whereas most of the glyphosate was metabolized to AMPA in GR plants at 7 days after application. Untreated leaves of GR plants accumulated only metabolites (mostly AMPA) of glyphosate, indicating that GOX activity is very high in the youngest leaves. These data indicate that more glyphosate is transformed to AMPA rapidly in GR canola and that the accumulated AMPA is not toxic to the canola plant.

  7. Location, Root Proximity, and Glyphosate-use History Modulate the Effects of Glyphosate on Fungal Community Networks of Wheat

    Science.gov (United States)

    Glyphosate is the most-used herbicide worldwide and an essential tool for weed control in no-till cropping systems. However, concerns have been raised regarding the long-term effects of glyphosate on soil microbial communities. We examined the impact of repeated glyphosate application on bulk and rh...

  8. Analysis of Glyphosate and Aminomethylphosphonic Acid in Nutritional Ingredients and Milk by Derivatization with Fluorenylmethyloxycarbonyl Chloride and Liquid Chromatography-Mass Spectrometry.

    Science.gov (United States)

    Ehling, Stefan; Reddy, Todime M

    2015-12-09

    A straightforward analytical method based on derivatization with fluorenylmethyloxycarbonyl chloride and liquid chromatography-mass spectrometry has been developed for the analysis of residues of glyphosate and aminomethylphosphonic acid (AMPA) in a suite of nutritional ingredients derived from soybean, corn, and sugar beet and also in cow's milk and human breast milk. Accuracy and intermediate precision were 91-116% and soy protein isolate. Limits of quantitation were 0.05 and 0.005 μg/g in powdered and liquid samples, respectively. Glyphosate and AMPA were quantified at 0.105 and 0.210 μg/g (soy protein isolate) and 0.850 and 2.71 μg/g (soy protein concentrate, both derived from genetically modified soybean), respectively. Residues were not detected in soy milk, soybean oil, corn oil, maltodextrin, sucrose, cow's milk, whole milk powder, or human breast milk. The method is proposed as a convenient tool for the survey of glyphosate and AMPA in the ingredient supply chain.

  9. Fluxo gênico em soja geneticamente modificada e método para sua detecção Gene flow in genetically modified soybean and method for its detection

    Directory of Open Access Journals (Sweden)

    Welison Andrade Pereira

    2007-07-01

    Full Text Available O objetivo deste trabalho foi avaliar métodos para detecção de sementes de soja tolerante ao glifosato e o fluxo gênico de uma cultivar transgênica para uma convencional, em Florestal e Viçosa, MG. Para adequar método de detecção, foi conduzido experimento comparativo entre cinco bioensaios, dos quais se destacou o teste de germinação em substrato umedecido com solução do glifosato. O experimento de fluxo gênico foi instalado em campo, no esquema de quadrados concêntricos. No centro, foi plantada a cultivar tolerante ao glifosato (fonte de pólen. À sua volta, foi semeada a cultivar sensível (receptora do pólen. No estádio R8, foram colhidas sementes das laterais dos quadrados, em distâncias variadas da fonte de pólen: 0,5, 1, 2, 4 e 8 m. Amostras de 900 sementes, por fileira, foram avaliadas pelo teste de germinação em substrato umedecido com solução de glifosato a 0,06%. Plântulas tolerantes ao glifosato indicaram fecundação cruzada. As maiores porcentagens de hibridação - 1,27% em Florestal e 0,25% em Viçosa - ocorreram a 0,5 m de distância, entre fonte e receptor de pólen, e essas taxas aproximaram-se de zero às distâncias de 2,26 e 1,16 m, para Florestal e Viçosa, respectivamente.The objective of this work was to assess the methods for detection of glyphosate tolerance soybean seeds and the gene flow from a genetically modified soybean cultivar to a conventional one, in Viçosa and Florestal, MG, Brazil. In order to assess the method for detection, a comparative experiment was conduct among five bioassays, from which the germination test in moistened substrate with glyphosate solution was outstanding. The experiment of gene flow was installed in field, in the concentric squares design. In the center, the glyphosate-tolerant cultivar (pollen source was planted. Around it, the sensitive cultivar (pollen receptor was sowed. In the stage R8, seeds of lateral of the squares were harvested, in various distances

  10. Global Expression Patterns of Three Festuca Species Exposed to Different Doses of Glyphosate Using the Affymetrix GeneChip Wheat Genome Array

    Directory of Open Access Journals (Sweden)

    Ozge Cebeci

    2009-01-01

    Full Text Available Glyphosate has been shown to act as an inhibitor of an aromatic amino acid biosynthetic pathway, while other pathways that may be affected by glyphosate are not known. Cross species hybridizations can provide a tool for elucidating biological pathways conserved among organisms. Comparative genome analyses have indicated a high level of colinearity among grass species and Festuca, on which we focus here, and showed rearrangements common to the Pooideae family. Based on sequence conservation among grass species, we selected the Affymetrix GeneChip Wheat Genome Array as a tool for the analysis of expression profiles of three Festuca (fescue species with distinctly different tolerances to varying levels of glyphosate. Differences in transcript expression were recorded upon foliar glyphosate application at 1.58 mM and 6.32 mM, representing 5% and 20%, respectively, of the recommended rate. Differences highlighted categories of general metabolic processes, such as photosynthesis, protein synthesis, stress responses, and a larger number of transcripts responded to 20% glyphosate application. Differential expression of genes encoding proteins involved in the shikimic acid pathway could not be identified by cross hybridization. Microarray data were confirmed by RT-PCR and qRT-PCR analyses. This is the first report to analyze the potential of cross species hybridization in Fescue species and the data and analyses will help extend our knowledge on the cellular processes affected by glyphosate.

  11. Glyphosate-Resistant Goosegrass from Mississippi

    Directory of Open Access Journals (Sweden)

    Vijay K. Nandula

    2013-05-01

    Full Text Available A suspected glyphosate-resistant goosegrass [Eleusine indica (L. Gaertn.] population, found in Washington County, Mississippi, was studied to determine the level of resistance and whether the resistance was due to a point mutation, as was previously identified in a Malaysian population. Whole plant dose response assays indicated a two- to four-fold increase in resistance to glyphosate. Leaf disc bioassays based on a glyphosate-dependent increase in shikimate levels indicated a five- to eight-fold increase in resistance. Sequence comparisons of messenger RNA for epsps, the gene encoding the enzyme 5-enolpyruvylshikimate-3-phosphate synthase, from resistant and sensitive goosegrass, revealed a cytosine to thymine nucleotide change at position 319 in the resistant accessions. This single nucleotide polymorphism causes a proline to serine amino acid substitution at position 106 in 5-enolpyruvylshikimate-3-phosphate synthase. A real-time polymerase chain reaction assay using DNA probes specific for the nucleotide change at position 319 was developed to detect this polymorphism. Goosegrass from 42 locations were screened, and the results indicated that glyphosate-resistant goosegrass remained localized to where it was discovered. Pendimethalin, s-metolachlor, clethodim, paraquat and fluazifop controlled resistant goosegrass 93% to 100%, indicating that several control options for glyphosate-resistant goosegrass are available.

  12. Spatial and temporal trends and flow dynamics of glyphosate and other pesticides within an agricultural watershed in Argentina.

    Science.gov (United States)

    Pérez, Débora J; Okada, Elena; De Gerónimo, Eduardo; Menone, Mirta L; Aparicio, Virginia C; Costa, José L

    2017-12-01

    In the present study, we evaluated the spatial and temporal trends of current-use pesticides in surface water and sediments as well as their relationship with hydrological stream dynamics within the agricultural watershed of El Crespo stream (Buenos Aires Province, Argentina). We sampled 2 contrasting sites: site 1 (upstream), surrounded by agricultural lands, and site 2 (downstream), surrounded by natural grasslands. Most of the applied pesticides (glyphosate, 2,4-D, atrazine, tebuconazole, and imidacloprid) were detected at high frequencies in surface water samples at both sites. However, only glyphosate and aminomethylphosphonic acid (AMPA) were present at high concentrations and had a significant spatial-temporal trend. The highest concentrations were found during spring 2014 at site 1, in association with the intense rains that occurred in that season. The fact that glyphosate and AMPA concentrations were higher than the rest of the studied compounds is closely related to the land use within the watershed, as glyphosate was the most applied herbicide during the fallow period of glyphosate-resistant crops (soybean, maize). The pesticide mixture had a significant spatial-temporal trend, reaching the highest levels during storm flow events in spring 2014. The intensive rains in spring 2014 could be the main factor influencing stream hydrology and pesticide behavior at El Crespo watershed. The estimated annual pesticide losses were 3.11 g/ha at site 1 and 0.72 g/ha at site 2. This result indicates that an attenuation process could be decreasing pesticide loads during downstream transport from site 1 to site 2. Environ Toxicol Chem 2017;36:3206-3216. © 2017 SETAC. © 2017 SETAC.

  13. New evidences of Roundup (glyphosate formulation) impact on the periphyton community and the water quality of freshwater ecosystems.

    Science.gov (United States)

    Vera, María S; Lagomarsino, Leonardo; Sylvester, Matías; Pérez, Gonzalo L; Rodríguez, Patricia; Mugni, Hernán; Sinistro, Rodrigo; Ferraro, Marcela; Bonetto, Carlos; Zagarese, Horacio; Pizarro, Haydée

    2010-04-01

    Argentina is the second largest world producer of soybeans (after the USA) and along with the increase in planted surface and production in the country, glyphosate consumption has grown in the same way. We investigated the effects of Roundup (glyphosate formulation) on the periphyton colonization. The experiment was carried out over 42 days in ten outdoor mesocosms of different typology: "clear" waters with aquatic macrophytes and/or metaphyton and "turbid" waters with great occurrence of phytoplankton or suspended inorganic matter. The herbicide was added at 8 mg L(-1) of the active ingredient (glyphosate) in five mesocosms while five were left as controls (without Roundup addition). The estimate of the dissipation rate (k) of glyphosate showed a half-life value of 4.2 days. Total phosphorus significantly increased in treated mesocosms due to Roundup degradation what favored eutrophication process. Roundup produced a clear delay in periphytic colonization in treated mesocosms and values of the periphytic mass variables (dry weight, ash-free dry weight and chlorophyll a) were always higher in control mesocosms. Despite the mortality of algae, mainly diatoms, cyanobacteria was favored in treated mesocosms. It was observed that glyphosate produced a long term shift in the typology of mesocosms, "clear" turning to "turbid", which is consistent with the regional trend in shallow lakes in the Pampa plain of Argentina. Based on our findings it is clear that agricultural practices that involve the use of herbicides such as Roundup affect non-target organisms and the water quality, modifying the structure and functionality of freshwater ecosystems.

  14. Resposta de varjão (Parkia multijuga a subdoses de glyphosate Response of varjão (Parkia multijuga seedlings to reduced glyphosate rates

    Directory of Open Access Journals (Sweden)

    O.M. Yamashita

    2006-09-01

    Full Text Available O consumo de madeira no Brasil e no mundo apresenta demanda crescente. Em confronto com a pressão ambientalista de manutenção das florestas nativas, há necessidade de se estabelecerem áreas de reflorestamento para suprir o aumento da demanda de madeira, com a utilização de formas de manejo e tratos culturais que permitam o pleno crescimento das essências florestais. Um dos principais problemas do manejo de reflorestamento é a interferência das plantas daninhas após o plantio das mudas no campo, sendo o uso de herbicidas a principal forma de manejo. Este trabalho teve o objetivo de avaliar a eficiência de doses crescentes de glyphosate em mudas de varjão em condições de ambiente protegido. Foram avaliadas as doses de 0, 90, 180, 360 e 720 g ha-1 de glyphosate em plantas com quatro meses de idade, observando a intoxicação das plantas, altura, diâmetro do caule e número de folhas. O varjão, nas condições do experimento, apresentou tolerância e recuperação ao glyphosate até a dose de 360 g ha-1. Doses superiores a esta retardaram o crescimento da planta. O prejuízo causado pela deriva de glyphosate nessas plantas foi diretamente proporcional ao aumento da dose. Os sintomas evoluíram para queda de folhas, comprometendo o crescimento das plantas.Wood consumption has significantly increased in Brazil and worldwide.The environmental pressure to preserve native forest led to the need to establish reforestation areas to meet the increasing wood demand by applying cultural practices and management allowing a total growth of forest trees. One of the main problems in reforestation management is weed competition after seedling planting, with herbicide use being the main form of management. The objective of this work was to evaluate the phytotoxic effect of increasing rates of glyphosate on Varjão seedlings, under greenhouse conditions. Concentrations of 90, 180, 360 and 720 g ha-1 of glyphosate were evaluated in four

  15. Resposta de diferentes populações de Digitaria insularis ao herbicida glyphosate Response of different Digitaria insularis populations to glyphosate

    Directory of Open Access Journals (Sweden)

    N.M Correia

    2010-12-01

    Full Text Available Objetivou-se com estse trabalho avaliar o controle químico de diferentes populações de capim-amargoso (Digitaria insularis pelo herbicida glyphosate por meio de curva de dose-resposta, além de propor tratamentos alternativos para as populações mais tolerantes. O delineamento experimental foi o de blocos ao acaso, com quatro repetições, em esquema fatorial 5 x 9. As sementes de capim-amargoso foram coletadas em cinco locais: área de produção de grãos da Fazenda de Ensino, Pesquisa e Produção da UNESP, Jaboticabal (SP; área de produção comercial de grãos, localizada nos municípios de Campo Florido-MG e Rio Verde-GO; pomar de laranja, localizado no município de Matão (SP; e área não agrícola sem histórico da aplicação de glyphosate (Jaboticabal-SP. O glyphosate (0D, 1/4D, 1/2D, D, 2D, 4D e 8D, em que D é a dose recomendada de 1,5 kg ha-1 de equivalente ácido e as suas associações [glyphosate + fluazifop-p-butil (1,5 + 0,25 kg ha-1 e glyphosate (1,5 kg ha-1 com sequencial de diuron + paraquat (0,20 + 0,40 kg ha-1 + 0,2% de surfatante] foram pulverizados em plantas de sete a oito perfilhos e altura média de 20 cm. As populações de capim-amargoso de Campo Florido e Rio Verde foram consideradas suscetíveis; as de Jaboticabal e Matão, tolerantes; e a da área não agrícola, de sensibilidade intermediária. A associação de glyphosate ao fluazifop ou a sua aplicação com sequencial de diuron + paraquat foram eficazes no controle das populações mais tolerantes de capim-amargoso.The objective of this study was to evaluate the chemical control of different sourgrass (Digitaria insularis populations by the herbicide glyphosate through dose-response curves, besides considering alternative treatments to control tolerant populations. A randomized block design was used with four replications, in a factorial scheme (5 x 9. Sourgrass seeds were colleted from five locations: a grain production area located at the educational

  16. The use of BMED for glyphosate recovery from glyphosate neutralization liquor in view of zero discharge.

    Science.gov (United States)

    Shen, Jiangnan; Huang, Jie; Liu, Lifen; Ye, Wenyuan; Lin, Jiuyang; Van der Bruggen, Bart

    2013-09-15

    Alkaline glyphosate neutralization liquors containing a high salinity pose a severe environmental pollution problem by the pesticide industry. However, there is a high potential for glyphosate recovery due to the high concentration of glyphosate in the neutralization liquors. In the study, a three-compartment bipolar membrane electrodialysis (BMED) process was applied on pilot scale for the recovery of glyphosate and the production of base/acid with high concentration in view of zero discharge of wastewater. The experimental results demonstrate that BMED can remove 99.0% of NaCl from the feed solution and transform this fraction into HCl and NaOH with high concentration and purity. This is recycled for the hydrolysis reaction of the intermediate product generated by the means of the Mannich reaction of paraformaldehyde, glycine and dimethylphosphite catalyzed by triethylamine in the presence of HCl and reclamation of the triethylamine catalyst during the production process of glyphosate. The recovery of glyphosate in the feed solution was over 96%, which is acceptable for industrial production. The current efficiency for producing NaOH with a concentration of 2.0 mol L(-1) is above 67% and the corresponding energy consumption is 2.97 kWh kg(-1) at a current density of 60 mA cm(-2). The current efficiency increases and energy consumption decreases as the current density decreases, to 87.13% and 2.37 kWh kg(-1), respectively, at a current density of 30 mA cm(-2). Thus, BMED has a high potential for desalination of glyphosate neutralization liquor and glyphosate recovery, aiming at zero discharge and resource recycling in industrial application. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Glyphosate resistance in Ambrosia trifida: Part 1. Novel rapid cell death response to glyphosate.

    Science.gov (United States)

    Van Horn, Christopher R; Moretti, Marcelo L; Robertson, Renae R; Segobye, Kabelo; Weller, Stephen C; Young, Bryan G; Johnson, William G; Schulz, Burkhard; Green, Amanda C; Jeffery, Taylor; Lespérance, Mackenzie A; Tardif, François J; Sikkema, Peter H; Hall, J Christopher; McLean, Michael D; Lawton, Mark B; Sammons, R Douglas; Wang, Dafu; Westra, Philip; Gaines, Todd A

    2018-05-01

    Glyphosate-resistant (GR) Ambrosia trifida is now present in the midwestern United States and in southwestern Ontario, Canada. Two distinct GR phenotypes are known, including a rapid response (GR RR) phenotype, which exhibits cell death within hours after treatment, and a non-rapid response (GR NRR) phenotype. The mechanisms of resistance in both GR RR and GR NRR remain unknown. Here, we present a description of the RR phenotype and an investigation of target-site mechanisms on multiple A. trifida accessions. Glyphosate resistance was confirmed in several accessions, and whole-plant levels of resistance ranged from 2.3- to 7.5-fold compared with glyphosate-susceptible (GS) accessions. The two GR phenotypes displayed similar levels of resistance, despite having dramatically different phenotypic responses to glyphosate. Glyphosate resistance was not associated with mutations in EPSPS sequence, increased EPSPS copy number, EPSPS quantity, or EPSPS activity. These encompassing results suggest that resistance to glyphosate in these GR RR A. trifida accessions is not conferred by a target-site resistance mechanism. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Interação de glyphosate com carfentrazone-ethyl Glyphosate - carfentrazone-ethyl interaction

    Directory of Open Access Journals (Sweden)

    R.C. Werlang

    2002-04-01

    Full Text Available Foi conduzido um experimento em condições controladas para determinar a interação do carfentrazone-ethyl em mistura no tanque com o herbicida glyphosate, no controle de seis espécies de plantas daninhas. Glyphosate aplicado isoladamente na dose de 720 g ha-1 foi eficaz no controle de Amaranthus hybridus (100%, Desmodium tortuosum (100%, Bidens pilosa (99%, Eleusine indica (96%, Digitaria horizontalis (100% e Commelina benghalensis (93% aos 21 DAA. Carfentrazone-ethyl aplicado isoladamente controlou eficazmente C. benghalensis. As misturas de glyphosate nas doses de 252 e 720 g ha-1 com carfentrazone-ethyl nas doses de 15 e 30 g ha¹ demonstraram efeito aditivo no controle de A. hybridus, D. tortuosum e Bidens pilosa, à exceção das misturas de glyphosate na dose de 252 g ha-1 com as doses de 15 e 30 g ha-1 de carfentrazone-ethyl, que proporcionam efeito sinergístico no controle de D. tortuosum. A adição das duas doses de carfentrazone-ethyl antagonizou o efeito de glyphosate na menor dose (252 g ha-1 no controle de E. indica, apresentando, no entanto, efeito aditivo com o glyphosate na maior dose (720 g ha-1. Já para D. horizontalis, as misturas de carfentrazone-ethyl com glyphosate na menor dose (252 g ha-1 apresentaram efeito sinergístico no controle dessa espécie, demonstrando, ainda, efeito aditivo na mistura com glyphosate na dose de 720 g ha-1. A mistura de carfentrazone-ethyl com glyphosate proporcionou efeito aditivo no controle de C. benghalensis, independentemente das combinações de doses avaliadas. Os resultados deste experimento indicam que carfentrazone-ethyl apresenta comportamento diferenciado quanto à interação com glyphosate, dependendo da espécie de planta daninha e da dose dos herbicidas utilizados na mistura em tanque, sendo complementar na mistura em tanque com glyphosate, pois demonstrou efeito antagônico em poucas das combinações estudadas, prevalecendo seu efeito aditivo na mistura com glyphosate, no

  19. Glyphosate: cancerous or not? Perspectives from both ends of the debate

    Directory of Open Access Journals (Sweden)

    Syeda Aamna Hassan

    2017-08-01

    Full Text Available Glyphosate is non-selective herbicide. Studies published in the last decade, point towards glyphosate toxicity. Shikimic acid pathway for the biosynthesis of folates and aromatic amino acids is inhibited by glyphosate. Glyphosate carcinogenicity is still considered to be a controversial issue. The World Health Organizations’ International Agency recently concluded that glyphosate is “probably carcinogenic to humans.” Some researchers believed that glyphosate is not linked with carcinogenicity.

  20. Mechanism of Resistance to Glyphosate in Lolium perenne from Argentina

    Directory of Open Access Journals (Sweden)

    Marcos Yanniccari

    2017-10-01

    Full Text Available In Argentina, glyphosate resistance was reported in a Lolium perenne population after 12 years of successful herbicide use. The aim of the current paper was to put in evidence for the mechanism of glyphosate resistance of this weed. Susceptible leaves treated with different doses of glyphosate and incubated in vitro showed an accumulation of shikimic acid of around three to five times the basal level, while no changes were detected in leaves of glyphosate-resistant plants. The resistance mechanism prevents shikimate accumulation in leaves, even under such tissue-isolation conditions. The activity of the glyphosate target enzyme (EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase was quantified at different herbicide concentrations. EPSPS from resistant plants showed no difference in glyphosate-sensitivity compared to EPSPS from susceptible plants, and, accordingly, no amino acid substitution causing mutations associated with resistance were found. While the glyphosate target enzymes were equally sensitive, the basal EPSPS activity in glyphosate resistant plants was approximately 3-fold higher than the EPSPS activity in susceptible plants. This increased EPSPS activity in glyphosate resistant plants was associated with a 15-fold higher expression of EPSPS compared with susceptible plants. Therefore, the over-expression of EPSPS appears to be the main mechanism responsible for resistance to glyphosate. This mechanism has a constitutive character and has important effects on plant fitness, as recently reported.

  1. Haematogical changes induced by subchronic glyphosate exposure ...

    African Journals Online (AJOL)

    The aim of this study was to determine the haematological changes induced by subchronic glyphosate exposure in Wistar rats and the ameliorative effect of zinc. Sixty adult male and female Wistar rats were used for the study. Twelve of them were used for the LD50 which was evaluated to be 3750 mg kg-1 with clinical ...

  2. 75 FR 20862 - Glyphosate From China

    Science.gov (United States)

    2010-04-21

    ... INTERNATIONAL TRADE COMMISSION [Investigation No. 731-TA-1178 (Preliminary)] Glyphosate From China AGENCY: United States International Trade Commission. ACTION: Revised schedule for the subject investigation. DATES: Effective Date: April 16, 2010. FOR FURTHER INFORMATION CONTACT: Amy Sherman (202-205-3289...

  3. Adjuvants for single droplet application of glyphosate

    DEFF Research Database (Denmark)

    Mathiassen, Solvejg Kopp; Kudsk, Per; Lund, Ivar

    2016-01-01

    Retention and biological activity of droplets of glyphosate deposited onto plant leaves using a Drop on Demand inkjet printer application system, was examined on pot-grown Brassica napus, Solanum nigrum, Chenopodium album, Silene noctiflora and Echinocloa crus-galli plants. Retention was measured...

  4. Flow Injection Spectrophotometric Determination of Glyphosate ...

    African Journals Online (AJOL)

    NICOLAAS

    limits and causes digestive tract irritation, eyes and skin irrita- tion, low blood ... techniques, mostly chromatographic, have been developed for ... enhanced photochemically induced fluorescence (MEPIF) .... with glyphosate on the same field or in the nearby fields. .... At 700 µL sample volume two peaks near to each.

  5. Testing the interaction between analytical modules: an example with Roundup Ready® soybean line GTS 40-3-2

    Directory of Open Access Journals (Sweden)

    Bellocchi Gianni

    2010-08-01

    Full Text Available Abstract Background The modular approach to analysis of genetically modified organisms (GMOs relies on the independence of the modules combined (i.e. DNA extraction and GM quantification. The validity of this assumption has to be proved on the basis of specific performance criteria. Results An experiment was conducted using, as a reference, the validated quantitative real-time polymerase chain reaction (PCR module for detection of glyphosate-tolerant Roundup Ready® GM soybean (RRS. Different DNA extraction modules (CTAB, Wizard and Dellaporta, were used to extract DNA from different food/feed matrices (feed, biscuit and certified reference material [CRM 1%] containing the target of the real-time PCR module used for validation. Purity and structural integrity (absence of inhibition were used as basic criteria that a DNA extraction module must satisfy in order to provide suitable template DNA for quantitative real-time (RT PCR-based GMO analysis. When performance criteria were applied (removal of non-compliant DNA extracts, the independence of GMO quantification from the extraction method and matrix was statistically proved, except in the case of Wizard applied to biscuit. A fuzzy logic-based procedure also confirmed the relatively poor performance of the Wizard/biscuit combination. Conclusions For RRS, this study recognises that modularity can be generally accepted, with the limitation of avoiding combining highly processed material (i.e. biscuit with a magnetic-beads system (i.e. Wizard.

  6. Sensibilidade de estirpes de Bradyrhizobium ao glyphosate

    Directory of Open Access Journals (Sweden)

    Rodrigo Josemar Seminoti Jacques

    2010-02-01

    Full Text Available A aplicação do glyphosate sobre a soja resistente a este herbicida pode causar prejuízos à simbiose com o rizóbio. O objetivo deste trabalho foi avaliar a sensibilidade ao herbicida glyphosate de três estirpes de Bradyrhizobium recomendadas para a produção de inoculantes de sementes de soja no Brasil. Avaliou-se o efeito das concentrações de 0,0; 5,4; 10,8; 21,6 e 43,2 µg L-1 do ingrediente ativo do glyphosate [N-(fosfonometil glicina] no meio YM líquido sobre o crescimento de B. japonicum (estirpe SEMIA 5079 e de B. elkanii (estirpe SEMIA 5019 e estirpe SEMIA 587, por meio de leituras das densidades óticas e geração de curvas de crescimento. As reduções de crescimento na presença da menor concentração do glyphosate foram de 18% para SEMIA 5079, 29% para SEMIA 5019 e de 35% para SEMIA 587, sendo, de modo geral, quanto maior a concentração do herbicida no meio de cultura maior a inibição do crescimen­to. As estirpes apresentaram sensibilidade diferencial somente às concentrações mais baixas do glyphosate; nesse caso, foi possível determinar a seguinte ordem de sensibilidade: SEMIA 587 > SEMIA 5019 > SEMIA 5079. Essa sensibilidade diferencial é dependente da concentração do herbicida, pois na presença de 43,2 µg L-1 todas as estirpes tiveram seu crescimento severamente reduzido, não havendo diferença entre elas.

  7. Differential response of two sourgrass populations to glyphosate

    Directory of Open Access Journals (Sweden)

    São Paulo State University, Jaboticabal, SP, Brazil

    2013-02-01

    Full Text Available The repetitive use of glyphosate may cause increase on the resistance of sourgrass (Digitaria insularis through mechanisms of natural selection. The aim of this study was to verify the response of two populations of sourgrass (one collected from nonagricultural area and the other one from area suspected of glyphosate resistance to increasing doses of glyphosate. The experimental design was completely randomized with four repetitions. For both populations, glyphosate was sprayed at 10 doses (0D, D/16, D/8, D/4, D/2, D, 2D, 4D, 8D, and 16D; so that D is the dose of 1.08 kg e.a. ha-1. The treatments were sprayed when the plants had shown 3-5 tillers. The population collected in the nonagricultural area was slightly more sensible to the herbicide glyphosate than the population originated from an area where the herbicide application is common, not indicating glyphosate resistance.

  8. Foliar Desiccators Glyphosate, Carfentrazone, and Paraquat Affect the Technological and Chemical Properties of Cowpea Grains.

    Science.gov (United States)

    Lindemann, Igor da Silva; Lang, Gustavo Heinrich; Hoffmann, Jessica Fernanda; Rombaldi, Cesar Valmor; de Oliveira, Maurício; Elias, Moacir Cardoso; Vanier, Nathan Levien

    2017-08-16

    The effects of the use of glyphosate (GLY), glyphosate plus carfentrazone (GLY/CAR), and paraquat (PAR) as plant desiccators on the technological and chemical properties of cowpea grains were investigated. All studied desiccants provided lower cooking time to freshly harvested cowpea. However, the coat color of PAR- and GLY/CAR-treated cowpea was reddish in comparison to the control treatment. Principal component analysis (PCA) from liquid chromatography-mass spectrometry (LC-MS) data sets showed a clear distinction among cowpea from the different treatments. Catechin-3-glucoside and epicatechin significantly contributed for discriminating GLY-treated cowpea, while citric acid was responsible for discriminating GLY/CAR-treated cowpea. Quercetin derivative and gluconic acid were responsible for discriminating control treatment. Residual glyphosate and paraquat content was higher than the maximum limits allowed by Codex Alimentarius and the European Union Commission. Improvements in the technological and chemical properties of cowpea may not be overlapped by the risks that those desiccants exhibit when exceeding the maximum limits of tolerance in food.

  9. Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines

    OpenAIRE

    Gasnier, C?line; Benachour, Nora; Clair, Emilie; Travert, Carine; Langlois, Fr?d?ric; Laurant, Claire; Decroix-Laporte, C?cile; S?ralini, Gilles-Eric

    2010-01-01

    Abstract Background Worldwide used pesticides containing different adjuvants like Roundup formulations, which are glyphosate-based herbicides, can provoke some in vivo toxicity and in human cells. These pesticides are commonly found in the environment, surface waters and as food residues of Roundup tolerant genetically modified plants. In order to know their effects on cells from liver, a major detoxification organ, we have studied their mechanism of action and possible protection by precise ...

  10. MORPHOLOGICAL AND PHYSIOLOGICAL CHANGES ON Schizolobium parahybaVAR .Amazonicum(HUBER EX DUCKE BARNEBY PLANTS INTOXICATED BY GLYPHOSATE

    Directory of Open Access Journals (Sweden)

    Kaléo Dias Pereira

    2017-06-01

    Full Text Available The objective of this study was to evaluate the morphological and physiological changes in paricá plants (Schizolobium parahyba var. amazonicum intoxicated by glyphosate. The experiment was conducted in a protected environment using paricá plants during their planting stage, which were intoxicated with increasing doses of glyphosate: 0 (control; 43.2; 86.2; 129.6 and 172.8 g.ha-1. At 7 and 21 days after the application of the herbicide, the photosynthesis, transpiration, stomatal conductance and leaf temperature were measured. The visual intoxication degree and the growth of the shoot and the root of the plants were evaluated 21 days after the application. Paricá shows symptoms of visual intoxication characterized by chlorosis/winding, evolving to necrosis/abscission of the youngest leaflets. The growth of the stem and the roots of the intoxicated plants is preserved; however, an expressive leaf loss occurs, and paricá may have adaptation mechanisms to tolerate the action of the herbicide molecule. The photosynthesis decrease promoted by an indirect action of glyphosate represents the main reduction on the growth of plants. The decrease on the stomatal conductance, which was the most sensitive physiological variable to glyphosate, resulted in lower transpiration rates, which, consequently, caused increases on the leaf temperature.

  11. Glyphosate, a chelating agent-relevant for ecological risk assessment?

    Science.gov (United States)

    Mertens, Martha; Höss, Sebastian; Neumann, Günter; Afzal, Joshua; Reichenbecher, Wolfram

    2018-02-01

    Glyphosate-based herbicides (GBHs), consisting of glyphosate and formulants, are the most frequently applied herbicides worldwide. The declared active ingredient glyphosate does not only inhibit the EPSPS but is also a chelating agent that binds macro- and micronutrients, essential for many plant processes and pathogen resistance. GBH treatment may thus impede uptake and availability of macro- and micronutrients in plants. The present study investigated whether this characteristic of glyphosate could contribute to adverse effects of GBH application in the environment and to human health. According to the results, it has not been fully elucidated whether the chelating activity of glyphosate contributes to the toxic effects on plants and potentially on plant-microorganism interactions, e.g., nitrogen fixation of leguminous plants. It is also still open whether the chelating property of glyphosate is involved in the toxic effects on organisms other than plants, described in many papers. By changing the availability of essential as well as toxic metals that are bound to soil particles, the herbicide might also impact soil life, although the occurrence of natural chelators with considerably higher chelating potentials makes an additional impact of glyphosate for most metals less likely. Further research should elucidate the role of glyphosate (and GBH) as a chelator, in particular, as this is a non-specific property potentially affecting many organisms and processes. In the process of reevaluation of glyphosate its chelating activity has hardly been discussed.

  12. Comparative effects of glyphosate and atrazine in chloroplast ultrastructure of wheat and downy brome

    International Nuclear Information System (INIS)

    Auge, R.M.; Gealy, D.R.; Ogg, A.G.; Franceschi, V.R.

    1987-01-01

    Developing and mature leaves of winter wheat (Triticum aestivum L. var. Daws) and the weed species downy brome (Bromus tectorum L.) were subjected to 10 mM (foliar application) and 1 mM (root application) herbicide solutions. Glyphosate (N-(phosphonomethyl) glycine) and atrazine (2-chloro-4-(ethyl-amino)-6-(isopropylamino)-s-triazine) were prepared in a carrier composed of 5% soybean oil concentrate, 35% acetone and 60% water. Penetration experiments with 3 H-labelled herbicides assessed what percentage of herbicide entered leaves, and microautoradiography was used to determine qualitatively how much herbicide was present in the sections viewed with TEM. Tissue was excised at 4, 18, 62 and 200 hours, and then either freeze-substituted or fixed chemically. Ultrastructural effects of each herbicide on chloroplasts from leaves of newly-germinated seedlings and of well-tillered plants are depicted and discussed. Temporal differences in response of chloroplasts to each herbicide are noted

  13. Formulants of glyphosate-based herbicides have more deleterious impact than glyphosate on TM4 Sertoli cells.

    Science.gov (United States)

    Vanlaeys, Alison; Dubuisson, Florine; Seralini, Gilles-Eric; Travert, Carine

    2018-05-15

    Roundup and Glyphogan are glyphosate-based herbicides containing the same concentration of glyphosate and confidential formulants. Formulants are declared as inert diluents but some are more toxic than glyphosate, such as the family of polyethoxylated alkylamines (POEA). We tested glyphosate alone, glyphosate-based herbicide formulations and POEA on the immature mouse Sertoli cell line (TM4), at concentrations ranging from environmental to agricultural-use levels. Our results show that formulations of glyphosate-based herbicides induce TM4 mitochondrial dysfunction (like glyphosate, but to a lesser extent), disruption of cell detoxification systems, lipid droplet accumulation and mortality at sub-agricultural doses. Formulants, especially those present in Glyphogan, are more deleterious than glyphosate and thus should be considered as active principles of these pesticides. Lipid droplet accumulation after acute exposure to POEA suggests the rapid penetration and accumulation of formulants, leading to mortality after 24 h. As Sertoli cells are essential for testicular development and normal onset of spermatogenesis, disturbance of their function by glyphosate-based herbicides could contribute to disruption of reproductive function demonstrated in mammals exposed to these pesticides at a prepubertal stage of development. Copyright © 2017. Published by Elsevier Ltd.

  14. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate.

    Directory of Open Access Journals (Sweden)

    Cong Wang

    Full Text Available Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta. Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina regardless of DIP condition. Group V (Amphidinium carterae exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine

  15. Differential Growth Responses of Marine Phytoplankton to Herbicide Glyphosate

    Science.gov (United States)

    Wang, Cong; Lin, Xin; Li, Ling; Lin, Senjie

    2016-01-01

    Glyphosate is a globally popular herbicide to kill weeds and its wide applications may lead to accumulation in coastal oceans as a source of phosphorus (P) nutrient or growth inhibitor of phytoplankton. We studied the physiological effects of glyphosate on fourteen species representing five major coastal phytoplankton phyla (haptophyta, bacillariophyta, dinoflagellata, raphidophyta, and chlorophyta). Based on growth responses to different concentrations of glyphosate under contrasting dissolved inorganic phosphorus (DIP) conditions, we found that phytoplankton species could be classified into five groups. Group I (Emiliania huxleyi, Skeletonema costatum, Phaeodactylum tricornutum) could utilize glyphosate as sole P-source to support growth in axenic culture, but in the presence of DIP, they were inhibited by both 36-μM and 360-μM glyphosate. Group II (Karenia mikimotoi, Prorocentrum minimum, Dunaliella tertiolecta, Symbiodinium sp., Heterosigma akashiwo and Alexandrium catenella) could not utilize glyphosate as sole P-source to support growth, and in the presence of DIP growth was not affected by 36-μM but inhibited by 360-μM glyphosate. Glyphosate consistently enhanced growth of Group III (Isochrysis galbana) and inhibited Group IV (Thalassiosira weissflogii, Thalassiosira pseudonana and Chattonella marina) regardless of DIP condition. Group V (Amphidinium carterae) exhibited no measurable response to glyphosate regardless of DIP condition. This grouping is not congruent with the phylogenetic relationships of the phytoplankton species suggesting functional differentiation driven by environmental pressure. We conclude that glyphosate could be used as P-source by some species while is toxic to some other species and yet has no effects on others. The observed differential effects suggest that the continued use of glyphosate and increasing concentration of this herbicide in the coastal waters will likely exert significant impact on coastal marine phytoplankton

  16. 40 CFR 180.364 - Glyphosate; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... Grain, cereal, group 15 except field corn, popcorn, rice, sweet corn, and wild rice 30 Grape 0.2 Grass..., grain 5.0 Rambutan 0.2 Rapeseed, seed 20 Rice, grain 0.1 Rice, wild, grain 0.1 Rose apple 0.2 Safflower, seed 85 Salal 0.2 Sapodilla 0.2 Sapote, black 0.2 Sapote, mamey 0.2 Sapote, white 0.2 Sesame, seed 0.1...

  17. Metallic complexes with glyphosate: a review

    OpenAIRE

    Coutinho, Cláudia F. B.; Mazo, Luiz Henrique

    2005-01-01

    We present studies involving metallic ions and the herbicide glyphosate. The metallic complexes of Cu(II), Zn(II), Mn(II), Ni(II), Cd(II), Pb(II), Cr(III), Fe(III), Co(III), ammonium, sodium, Ag(I), alkaline earth metals and of some lanthanides ions are described. The complexes are discussed in terms of their synthesis, identification, stability and structural properties, based on data from the current literature.

  18. Metallic complexes with glyphosate: a review

    International Nuclear Information System (INIS)

    Coutinho, Claudia F.B.; Mazo, Luiz Henrique

    2005-01-01

    We present studies involving metallic ions and the herbicide glyphosate. The metallic complexes of Cu(II), Zn(II), Mn(II), Ni(II), Cd(II), Pb(II), Cr(III), Fe(III), Co(III), ammonium, sodium, Ag(I), alkaline earth metals and of some lanthanides ions are described. The complexes are discussed in terms of their synthesis, identification, stability and structural properties, based on data from the current literature. (author)

  19. Glyphosate rodent carcinogenicity bioassay expert panel review.

    Science.gov (United States)

    Williams, Gary M; Berry, Colin; Burns, Michele; de Camargo, Joao Lauro Viana; Greim, Helmut

    2016-09-01

    Glyphosate has been rigorously and extensively tested for carcinogenicity by administration to mice (five studies) and to rats (nine studies). Most authorities have concluded that the evidence does not indicate a cancer risk to humans. The International Agency for Research on Cancer (IARC), however, evaluated some of the available data and concluded that glyphosate probably is carcinogenic to humans. The expert panel convened by Intertek assessed the findings used by IARC, as well as the full body of evidence and found the following: (1) the renal neoplastic effects in males of one mouse study are not associated with glyphosate exposure, because they lack statistical significance, strength, consistency, specificity, lack a dose-response pattern, plausibility, and coherence; (2) the strength of association of liver hemangiosarcomas in a different mouse study is absent, lacking consistency, and a dose-response effect and having in high dose males only a significant incidence increase which is within the historical control range; (3) pancreatic islet-cell adenomas (non-significant incidence increase), in two studies of male SD rats did not progress to carcinomas and lacked a dose-response pattern (the highest incidence is in the low dose followed by the high dose); (4) in one of two studies, a non-significant positive trend in the incidence of hepatocellular adenomas in male rats did not lead to progression to carcinomas; (5) in one of two studies, the non-significant positive trend in the incidence of thyroid C-cell adenomas in female rats was not present and there was no progression of adenomas to carcinomas at the end of the study. Application of criteria for causality considerations to the above mentioned tumor types and given the overall weight-of-evidence (WoE), the expert panel concluded that glyphosate is not a carcinogen in laboratory animals.

  20. Utilizing soybean milk to culture soybean pathogens

    Science.gov (United States)

    Liquid and semi-solid culture media are used to maintain and proliferate bacteria, fungi, and Oomycetes for research in microbiology and plant pathology. In this study, a comparison was made between soybean milk medium, also referred to as soymilk, and media traditionally used for culturing soybean ...

  1. Glyphosate accumulation, translocation, and biological effects in Coffea arabica after single and multiple exposures

    DEFF Research Database (Denmark)

    Schrübbers, Lars Christoph; Valverde, Bernal E.; Strobel, Bjarne W.

    2016-01-01

    In perennial crops like coffee, glyphosate drift exposure can occur multiple times during its commercial life span. Due to limited glyphosate degradation in higher plants, a potential accumulation of glyphosate could lead to increased biological effects with increased exposure frequency....... In this study, we investigated glyphosate translocation over time, and its concentration and biological effects after single and multiple simulated spray-drift exposures. Additionally, shikimic acid/glyphosate ratios were used as biomarkers for glyphosate binding to its target enzyme.Four weeks after...... the exposure, glyphosate was continuously translocated. Shikimic acid levels were lin-ear correlated with glyphosate levels. After two months, however, glyphosate appeared to have reduced activity. In the greenhouse, multiple applications resulted in higher internal glyphosate concentrations.The time...

  2. The effect of glyphosate application on soil microbial activities in ...

    African Journals Online (AJOL)

    In this study, glyphosate effects as N, P and C nutrient sources on microbial population and the effect of different concentration of it on dehydrogenease activity and soil respiration were investigated. The results show that in a soil with a long historical use of glyphosate (soil 1), the hetrotrophic bacterial population was ...

  3. Dissipation of glyphosate from grapevine soils in Sonora, Mexico

    Directory of Open Access Journals (Sweden)

    Norma J. Salazar López

    2016-10-01

    Full Text Available Grapevine is one of the important crops in Sonora, due to revenue generation from its export to foreign countries. Among the most widely used herbicides for this crop is glyphosate, which is considered moderately toxic and persistent. The present research evaluates the dissipation of glyphosate in grapevine planted soil at three depths (5, 30 and 60 cm. Sampling was carried out before glyphosate application, and 5, 10, 18, 27, and 65 days after. Glyphosate was extracted from soil samples using ammonium hydroxide. The derivate extracts were partitioned with dichloromethane and analyzed using gas chromatography with pulsed flame photometric detector (PFPD. The results showed that average glyphosate residues are significantly greater at 5 cm (0.09 mg kg-1 than the other depths (30 and 60 cm, having a difference of 0.078 mg kg-1 between them (P < 0.03. Glyphosate concentration time profiles were similar; it reached maximum soil concentration in a range of 10 to 18 days after application. The half-life of glyphosate in soil has an average of 39 days at all depths. Our data suggests that the release in soil of glyphosate applied to weeds delays its transference to soil by 14 days, and extends residue half life to 55 days after application. These results could be the basis for further research, including more environmental parameters that could affect the dissipation or degradation process in soil.

  4. Physiological responses to glyphosate are dependent on Eucalyptus urograndis genotype

    Science.gov (United States)

    Two experiments were conducted to evaluate the response of Eucalyptus urograndis genotypes (C219 and GG100) to glyphosate in growth chambers. As glyphosate dose increased (18 up to 720 g ae ha-1), CO2 assimilation rate, transpiration rate, and stomatal conductance decreased fastest and strongest in ...

  5. Uses of glyphosate in German arable farming – operational aspects

    Directory of Open Access Journals (Sweden)

    Wiese, Armin

    2016-02-01

    Full Text Available Glyphosate is the most frequently used herbicide active ingredient in Germany. Studies regarding its usage in non-GMO arable farming are still rare even though it plays an important role in several agronomic situations. Therefore, we conducted a comprehensive survey, which was carried out among conventional German farms in Winter 2014/2015. Based on the results of this survey we analyzed via cluster analysis how types of farms differ in terms of glyphosate usage. An illustration of seven clusters allows deep insights into arable farm structures. The farm types can be distinguished regarding their tillage system and similar to this differentiation also concerning their intensity of glyphosate application. Furthermore, it becomes obvious that farm clusters with a higher level of glyphosate usage are characterized by a lower number of labourers per hectare, more arable land and/or enhanced cover cropping. Moreover, groups of farmers who rely more on glyphosate are more likely to state that they need glyphosate for herbicide resistance management. Farmers’ assessments of the economic importance of glyphosate usage vary depending on the type of farm. By means of the farm clusters, the most important situations of glyphosate usage can be further analyzed economically and scenarios for impact assessments can be made.

  6. Symbiotic effectiveness of acid-tolerant Bradyrhizobium strains with ...

    African Journals Online (AJOL)

    Symbiotic effectiveness of acid-tolerant Bradyrhizobium strains with soybean in low pH soil. C Appunu, B Dhar. Abstract. Eight acid tolerant strains of Bradyrhizobium isolated from soybean plants grown on acid soils in Madhya Pradesh, India, were examined for their ability to survive in soil and YEMB at low pH levels. All the ...

  7. Effects of additives on glyphosate activity in purple nutsedge

    International Nuclear Information System (INIS)

    Rungsit Suwanketnikom

    1998-01-01

    Effects of additives on 14 C-glyphosate penetration into purple nutsedge leaves were examined in the laboratory and efficacy of glyphosate for purple nutsedge control was studied in the greenhouse and field. The addition of (NH 4 ) 2 SO 4 at 1.0% (v/v) + diesel oil at 1,0% (v/v) + Tendal at 1.0% (v/v) increased 14 C-glyphosate penetration into nutsedge leaves more than the addition of either one alone. (NH 4 ) 2 SO 4 at 1.0% + diesel oil at 1.0% + Tendal at 0.12 or 0.25% increased the phytotoxicity of glyphosate at 0.5 and 0.75 kg, a.e./ha on nutsedge plants in the greenhouse but not in the field. Additives did not enhance glyphosate activity by reducing the number of nutsedae tubers. (author)

  8. Molecular basis of glyphosate resistance: Different approaches through protein engineering

    Science.gov (United States)

    Pollegioni, Loredano; Schonbrunn, Ernst; Siehl, Daniel

    2011-01-01

    Glyphosate (N-phosphonomethyl-glycine) is the most-used herbicide in the world: glyphosate-based formulations exhibit broad-spectrum herbicidal activity with minimal human and environmental toxicity. The extraordinary success of this simple small molecule is mainly due to the high specificity of glyphosate towards the plant enzyme enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway leading to biosynthesis of aromatic amino acids. Starting in 1996, transgenic glyphosate-resistant plants were introduced thus allowing the application of the herbicide to the crop (post-emergence) to remove emerged weeds without crop damage. This review focuses on the evolution of mechanisms of resistance to glyphosate as obtained through natural diversity, the gene shuffling approach to molecular evolution, and a rational, structure-based approach to protein engineering. In addition, we offer rationale for the means by which the modifications made have had their intended effect. PMID:21668647

  9. Interaction of Heterodera glycines and Glomus mosseae on Soybean.

    Science.gov (United States)

    Todd, T C; Winkler, H E; Wilson, G W

    2001-12-01

    The effects of the arbuscular mycorrhizal (AM) fungus Glomus mosseae on Heterodera glycines-soybean interactions were investigated in greenhouse experiments. Mycorrhizal and nonmycorrhizal soybean cultivars that were either resistant or susceptible to H. glycines were exposed to initial nematode population densities (Pi) of 0, 100, 1,000, or 10,000 eggs and infective juveniles. Soybean growth, nematode reproduction, and AM fungal colonization were determined after 35 (experiment I) and 83 (experiment II) days. Soybean shoot and root weights were reduced an average 29% across H. glycines Pi but were 36% greater overall in the presence of G. mosseae. Analyses of variance indicated that root colonization and stimulation of soybean growth by G. mosseae were inhibited at high H. glycines Pi, while the combined effects of the nematode and fungus on soybean growth were best described as additive in linear regression models. No evidence for increased nematode tolerance of mycorrhizal soybean plants was observed. Nematode population densities and reproduction were lower on a nematode-resistant soybean cultivar than on a susceptible cultivar, but reproduction was comparable on mycorrhizal and nonmycorrhizal plants. Root colonization by G. mosseae was reduced at high nematode Pi. The results suggest that nematode antagonism to the mycorrhizal symbiosis is a more likely consequence of interactions between H. glycines and AM fungi on soybean than is nematode suppression by the fungus.

  10. DISPERSION OF GLYPHOSATE IN SOILS UNDERGOING EROSION

    Directory of Open Access Journals (Sweden)

    Gorana Todorovic Rampazzo

    2010-08-01

    Full Text Available Different physical, chemical and biological processes influence the behaviour of organic contaminants in soils. A better understanding of the organic pollutant behaviour in soils would improve the environmental protection. One possible way for better attenuation of the risk of pollution in agriculture can be achieved through ta better-specified pesticide management based on the adaptation of the pesticide type and application rates to the specific environmental characteristics of the area of application. Nowadays, one of the actually most applied herbicide world wide is glyphosate. Glyphosate is highly water soluble and traces have been found in surface and groundwater systems. For a better understanding of the natural influence of erosion processes on glyphosate behaviour and dispersion under heavy rain conditions after application in the field, two erosion simulation experiments were conducted on two different locations in Austria with completely different soil types in September 2008. The results of the experiments showed that under normal practical conditions (e.g. no rainfall is expected immediatly after application, the potential adsorption capacity of the Kirchberg soil (Stagnic Cambisol, with about 16.000 ppm Fe-oxides is confirmed compared to the low adsorption Chernosem soil (about 8.000 ppm pedogenic Fe-oxides.  Considering the enormous difference in the run-off amounts between the two sites Pixendorf and Kirchberg soils it can be concluded how important the soil structural conditions and vegetation type and cover are for the risks of erosion and, as a consequence, pollution of neighbouring waters. In the rainfall experiments under comparable simulation conditions, the amount of run-off was about 10 times higher at Kirchberg, owing to its better infiltration rate, than at the Pixendorf site. Moreover, the total loss of glyphosate (NT+CT through run-off at the Kirchberg site was more than double that at Pixendorf, which confirms the

  11. Subtle impacts of repeated glyphosate use on wheat-associated bacteria are small and depend on glyphosate use history

    Science.gov (United States)

    Glyphosate (Roundup) is the most widely used herbicide in the world and a critical tool for weed control in no-till wheat cropping systems. However, there are persistent concerns about non-target impacts of long-term glyphosate use on soil communities. We investigated the impacts of repeated glyphos...

  12. Impact of glyphosate resistant corn, glyphosate applications, and tillage on soil nutrient ratios, exoenzyme activities, and nutrient acquisition ratios

    Science.gov (United States)

    We report results of the last two years of a 7-year (2008-2014) field experiment designed to test the null hypothesis that applications of glyphosate on glyphosate resistant corn (Zea mays L.) as a routine weed control practice under both conventional and reduced tillage practices would have no effe...

  13. Genotoxicity Expert Panel review: weight of evidence evaluation of the genotoxicity of glyphosate, glyphosate-based formulations, and aminomethylphosphonic acid.

    Science.gov (United States)

    Brusick, David; Aardema, Marilyn; Kier, Larry; Kirkland, David; Williams, Gary

    2016-09-01

    In 2015, the International Agency for Research on Cancer (IARC) published a monograph concluding there was strong evidence for genotoxicity of glyphosate and glyphosate formulations and moderate evidence for genotoxicity of the metabolite aminomethylphosphonic acid (AMPA). These conclusions contradicted earlier extensive reviews supporting the lack of genotoxicity of glyphosate and glyphosate formulations. The IARC Monograph concluded there was strong evidence of induction of oxidative stress by glyphosate, glyphosate formulations, and AMPA. The Expert Panel reviewed the genotoxicity and oxidative stress data considered in the IARC Monograph, together with other available data not considered by IARC. The Expert Panel defined and used a weight of evidence (WoE) approach that included ranking of studies and endpoints by the strength of their linkage to events associated with carcinogenic mechanisms. Importantly, the Expert Panel concluded that there was sufficient information available from a very large number of regulatory genotoxicity studies that should have been considered by IARC. The WoE approach, the inclusion of all relevant regulatory studies, and some differences in interpretation of individual studies led to significantly different conclusions by the Expert Panel compared with the IARC Monograph. The Expert Panel concluded that glyphosate, glyphosate formulations, and AMPA do not pose a genotoxic hazard and the data do not support the IARC Monograph genotoxicity evaluation. With respect to carcinogenicity classification and mechanism, the Expert Panel concluded that evidence relating to an oxidative stress mechanism of carcinogenicity was largely unconvincing and that the data profiles were not consistent with the characteristics of genotoxic carcinogens.

  14. Lethal and sublethal effects of glyphosate (roundup active) to embryos of colombian anurans

    International Nuclear Information System (INIS)

    Triana Velasquez, Teofila Maria; Montes Rojas, Claudia; Bernal Bautista, Manuel Hernando

    2013-01-01

    Glyphosate is an herbicide widely used in agriculture, which may affect non-target species. the aim of this study was to determine the lethal (median lethal concentration - LC 5 0) and sublethal effects (changes on body size and development) of glyphosate (roundup active) to embryos of four anuran species, exposed during 96 hours under laboratory and microcosm tests. under laboratory conditions, engystomops pustulosus was the most tolerant species (LC 5 0 = 3033,18 ?g a.e./L) and rhinella marina was the most sensitive (lc50 = 1421,46 ?g a.e./L), which also showed a delayed development and significantly reduced body size. The other species had an intermediate LC50 (Rhinella humboldti = 2899.54 ?g a.e./L; hypsiboas crepitans = 2151,88 ?g a.e./L). In all cases, the laboratory LC 5 0 was lower than the concentration used in field (5392.92 ?g a.e./L), indicating a high toxic effect. In the microcosm tests, embryos of e. pustulosus were the most tolerant (LC 5 0 = 19,41 kg a.e./ha), while R. humboldti were the most sensitive (LC 5 0 = 10,61 kg a.e./ha). In this case, all four study species had a higher LC 5 0 than the concentration sprayed in field (3,69 kg a.e./ ha), so a lower lethal effect, and there were no significant differences in body size and development. This result shows that the glyphosate, as the commercial presentation roundup active, produce a moderate mortality on anuran embryos.

  15. Glyphosate in Irish adults - A pilot study in 2017.

    Science.gov (United States)

    Connolly, Alison; Leahy, Michelle; Jones, Kate; Kenny, Laura; Coggins, Marie A

    2018-05-02

    Glyphosate is the highest volume herbicide used globally and has recently been classified as a 2 A 'probably carcinogenic to humans' by the International Agency for Research on Cancer (IARC). There is limited data to evaluate the public health impacts from glyphosate exposure. The objective of this study is to conduct an exploratory glyphosate exposure assessment study among Irish adults, who were non-occupational users of glyphosate. A convenient sampling method was used, collecting one first morning void spot urine sample from each participant. A biomonitoring survey involving the collection and analysis of 20 ml spot urine samples from 50 Irish adults was conducted in June 2017. Participants completed a short questionnaire to collect information on demographics, dietary habits and lifestyle. Glyphosate was extracted using solid phase extraction (SPE) and analysed by liquid chromatography tandem mass spectrometry (LC-MC/MS). Of the 50 urine samples analysed, 10 (20%) contained detectable levels of glyphosate (0.80-1.35 µg L -1 ). Exposure concentrations are higher than those reported in comparable studies of European and American adults. Glyphosate was detectable in 20% of the samples collected from Irish adults. The low proportion of detectable glyphosate levels could be due to lower localised use of pesticides, having a small sample size or the higher analytical detection limit used in this study (0.5 µg L -1 ), which could underestimate the true exposure and warrants further investigation. Given the widespread use of glyphosate, further information on population exposure is required to advance our understanding of the relationship between chronic low dose exposure to glyphosate and human health risk. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Non-antibiotic selection systems for soybean somatic embryos: the lysine analog aminoethyl-cysteine as a selection agent

    Directory of Open Access Journals (Sweden)

    Kwanyuen Prachuab

    2009-11-01

    Full Text Available Abstract Background In soybean somatic embryo transformation, the standard selection agent currently used is hygromycin. It may be preferable to avoid use of antibiotic resistance genes in foods. The objective of these experiments was to develop a selection system for producing transgenic soybean somatic embryos without the use of antibiotics such as hygromycin. Results When tested against different alternate selection agents our studies show that 0.16 μg/mL glufosinate, 40 mg/L isopropylamine-glyphosate, 0.5 mg/mL (S-(2 aminoethyl-L-cysteine (AEC and the acetolactate synthase (ALS inhibitors Exceed® and Synchrony® both at 150 μg/mL inhibited soybean somatic embryo growth. Even at the concentration of 2 mg/mL, lysine+threonine (LT were poor selection agents. The use of AEC may be preferable since it is a natural compound. Unlike the plant enzyme, dihydrodipicolinate synthase (DHPS from E. coli is not feed-back inhibited by physiological concentrations of lysine. The dapA gene which codes for E. coli DHPS was expressed in soybean somatic embryos under the control of the CaMV 35S promoter. Following introduction of the construct into embryogenic tissue of soybean, transgenic events were recovered by incubating the tissue in liquid medium containing AEC at a concentration of 5 mM. Only transgenic soybeans were able to grow at this concentration of AEC; no escapes were observed. Conclusion Genetically engineered soybeans expressing a lysine insensitive DHPS gene can be selected with the non-antibiotic selection agent AEC. We also report here the inhibitory effects of glufosinate, (isopropylamine-glyphosate (Roundup®, AEC and the ALS inhibitors Exceed® and Synchrony® against different tissues of soybean

  17. Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

    Science.gov (United States)

    Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

    2018-07-01

    The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

  18. Association mapping of soybean seed germination under salt stress.

    Science.gov (United States)

    Kan, Guizhen; Zhang, Wei; Yang, Wenming; Ma, Deyuan; Zhang, Dan; Hao, Derong; Hu, Zhenbin; Yu, Deyue

    2015-12-01

    Soil salinity is a serious threat to agriculture sustainability worldwide. Seed germination is a critical phase that ensures the successful establishment and productivity of soybeans in saline soils. However, little information is available regarding soybean salt tolerance at the germination stage. The objective of this study was to identify the genetic mechanisms of soybean seed germination under salt stress. One natural population consisting of 191 soybean landraces was used in this study. Soybean seeds produced in four environments were used to evaluate the salt tolerance at their germination stage. Using 1142 single-nucleotide polymorphisms (SNPs), the molecular markers associated with salt tolerance were detected by genome-wide association analysis. Eight SNP-trait associations and 13 suggestive SNP-trait associations were identified using a mixed linear model and the TASSEL 4.0 software. Eight SNPs or suggestive SNPs were co-associated with two salt tolerance indices, namely (1) the ratio of the germination index under salt conditions to the germination index under no-salt conditions (ST-GI) and (2) the ratio of the germination rate under salt conditions to the germination rate under no-salt conditions (ST-GR). One SNP (BARC-021347-04042) was significantly associated with these two traits (ST-GI and ST-GR). In addition, nine possible candidate genes were located in or near the genetic region where the above markers were mapped. Of these, five genes, Glyma08g12400.1, Glyma08g09730.1, Glyma18g47140.1, Glyma09g00460.1, and Glyma09g00490.3, were verified in response to salt stress at the germination stage. The SNPs detected could facilitate a better understanding of the genetic basis of soybean salt tolerance at the germination stage, and the marker BARC-021347-04042 could contribute to future breeding for soybean salt tolerance by marker-assisted selection.

  19. Resposta de plantas de beterraba (Beta vulgaris e de cenoura (Daucus carota à deriva simulada de glyphosate e clomazone Response of beetroot (Beta vulgaris and carrot (Daucus carota to simulated glyphosate and clomazone drift

    Directory of Open Access Journals (Sweden)

    R.P. Rogoli

    2008-06-01

    Full Text Available Várias espécies de hortaliças são de muita importância para a alimentação humana e tornam-se alvos da deriva de herbicidas, pois comumente são cultivadas nas proximidades de culturas como arroz, soja e milho, pulverizadas com esses produtos. Neste trabalho, objetivou-se verificar possíveis efeitos de doses reduzidas dos herbicidas glyphosate e clomazone sobre plantas de beterraba (Beta vulgaris e de cenoura (Daucus carota, em diferentes fases de desenvolvimento. As doses avaliadas dos herbicidas foram de 0, 5, 10, 15 e 20% da dose recomendada, equivalentes a 0, 63, 126, 189 e 252 g ha-1 de glyphosate e 0, 14,4, 28,8, 43,2 e 57,6 g ha-1 de clomazone, respectivamente, aplicadas aos 20, 30 e 40 dias após a emergência das culturas. Observou-se aumento no percentual de fitotoxicidade do glyphosate com o incremento na dose do herbicida, e a maior suscetibilidade ocorreu com a deriva nos estádios mais precoces, em ambas as espécies. As doses de clomazone não causaram qualquer sintoma detectável visualmente para as plantas de beterraba e de cenoura. Os resultados sugerem que o herbicida glyphosate causa injúrias às plantas de beterraba e cenoura, independentemente do estádio em que ocorre a interceptação do produto. No entanto, o herbicida clomazone não interfere no desenvolvimento inicial de plantas de beterraba e cenoura.Herbicide drift over horticultural crops is a common problem in the state of Rio Grande do Sul, mainly in areas near rice, soybean and corn fields. The objective of this research was to evaluate glyphosate and clomazone drift effects on beetroot (Beta vulgaris and carrot (Daucus carota plants. The herbicides were sprayed at three different growth stages: 20, 30 and 40 days after seedling emergence. Herbicide rates evaluated were 0, 5, 10, 15, and 20% of the label rate. The sprayed rates were 0, 63, 126, 189 and 252 g ha-1 of glyphosate and 0.0, 14.4, 28.8, 43.2 and 57.6 g ha-1 of clomazone. Glyphosate injury to

  20. Manejo de herbicidas na cultura da soja Roundup Ready® Herbicide management in Roundup Ready® soybean crop

    Directory of Open Access Journals (Sweden)

    F.A. Petter

    2007-09-01

    entre os sistemas de aplicação de herbicidas, porém todos resultaram em produtividade superior ao da testemunha. O cultivar TMG 108 apresentou maior produtividade de grãos em todos os sistemas de aplicação de herbicidas, inclusive nas parcelas da testemunha, mas não diferindo do cultivar P98R91, nos "sistemas 1, 3 e 4" de aplicação de herbicidas e na testemunha, e do cultivar M-SOY 8585, no "sistema 3".This study was carried out to evaluate the effectiveness of different herbicide management systems in weed control and the development and yield of different Roundup Ready® soybean cultivars. A randomized block experimental design with four replicates was used under a 5x5 factorial scheme, using five herbicide application systems: [(1 glyphosate (1.080 g ha-1 + 2.4-D (241.8 g ha-1 at 14 days before sowing (DAS, paraquat + diuron (400 + 200 g ha-1 at the sowing day, and glyphosate (960 g ha-1 at 35 days after crop emergence (DAE; (2 glyphosate (1.080 g ha-1 + 2.4-D (241.8 g ha-1 at 14 DAS, paraquat + diuron (400 + 200 g ha-1 at the sowing day, and glyphosate (480 g ha-1 17 at DAE; (3 glyphosate (1.080 g ha-1 + 2.4-D (241.8 g ha-1 at 14 DAS, and glyphosate (960 g ha-1 at 35 DAE; (4 glyphosate (1.080 g ha-1 + 2.4-D (241.8 g ha-1 at 14 DAS and glyphosate (480 g ha-1 at 17 days after plant emergence; and (5 control - glyphosate (1.080 g ha-1 + 2.4-D (241.8 g ha-1 at 14 DAS, without herbicide application at post-emergence] combined with five RR® soybean varieties (M-SOY 8585, P98R91, Valiosa, CD 219 and TMG 108,comprising 25 treatments. All herbicide application systems controlled the weed species Chamaesyce hirta, Alternanthera tenella, Euphorbia heterophylla, Spermacoce latifolia and Tridax procumbens. This control was superior to that without herbicide application at post-emergence, being thus efficient in controlling those species. "System 3" showed a lower control level of the species Spermacoce latifolia, Tridax procumbens and Chamaesyce hirta, the last one

  1. Uptake, Translocation, Metabolism, and Distribution of Glyphosate in Nontarget Tea Plant (Camellia sinensis L.).

    Science.gov (United States)

    Tong, Mengmeng; Gao, Wanjun; Jiao, Weiting; Zhou, Jie; Li, Yeyun; He, Lili; Hou, Ruyan

    2017-09-06

    The uptake, translocation, metabolism, and distribution behavior of glyphosate in nontarget tea plant were investigated. The negative effects appeared to grown tea saplings when the nutrient solution contained glyphosate above 200 mg L -1 . Glyphosate was highest in the roots of the tea plant, where it was also metabolized to aminomethyl phosphonic acid (AMPA). The glyphosate and AMPA in the roots were transported through the xylem or phloem to the stems and leaves. The amount of AMPA in the entire tea plant was less than 6.0% of the amount of glyphosate. The glyphosate level in fresh tea shoots was less than that in mature leaves at each day. These results indicated that free glyphosate in the soil can be continuously absorbed by, metabolized in, and transported from the roots of the tea tree into edible leaves, and therefore, free glyphosate residues in the soil should be controlled to produce teas free of glyphosate.

  2. Genetically Modified Herbicide-Tolerant Crops, Weeds, and Herbicides: Overview and Impact

    Science.gov (United States)

    Bonny, Sylvie

    2016-01-01

    Genetically modified (GM) crops have been and continue to be a subject of controversy despite their rapid adoption by farmers where approved. For the last two decades, an important matter of debate has been their impact on pesticide use, particularly for herbicide-tolerant (HT) crops. Some claim that these crops bring about a decrease in herbicide use, while others claim the opposite. In fact, since 1996, most cultivated GMOs have been GMHT crops, which involve the use of an associated herbicide, generally glyphosate. In their very first years of adoption, HT crops often led to some decrease in herbicide use. However, the repetition of glyphosate-tolerant crops and of glyphosate only applications in the same fields without sufficient alternation and herbicide diversity has contributed to the appearance of glyphosate-resistant weeds. These weeds have resulted in a rise in the use of glyphosate and other herbicides. This article explores this situation and the impacts of herbicide-resistant weeds, using an interdisciplinary approach and drawing on recent data. The paper analyzes the spread of GMHT crops worldwide and their consequences on herbicide use in the USA in particular. It then addresses the global development of glyphosate-resistant weeds and their impact, particularly focusing on the USA. Finally, the last section explores how industry, farmers, and weed scientists are coping with the spread of resistant weeds. The concluding comments deal more widely with trends in GM crops.

  3. Degradation of 14C-glyphosate in compost amended soils.

    Science.gov (United States)

    Alexa, E; Bragea, M; Sumalan, R; Negrea, M; Lazureanu, A

    2009-01-01

    Glyphosate (N-phosphonomethyl-glycine), the active ingredient in several herbicide formulations, is a non-selective, post-emergent herbicide used in a variety of crop and non-crop situations. Glyphosate is a non-volatile herbicide that is relatively immobile in soil. Its degradation is due to microbiological processes and most laboratory studies have been conducted with 14C-glyphosate with the rate of 14CO2 evolution being used as an indication of herbicide breakdown. In this paper we have studied the glyphosate degradation in compost amendment soils using Scientilator Liquid TRIATHLER and Glyphosate-phosphonomethyl-14C-labeled with specific activity 2,2mCi/mmol. Four types of soils have been taken under study: Black Chernozem, Vertisol, Gleysol and Phaeozem with different characteristics. For the each type of soil have been realized four experimental variants (glyphosate blind sample with 1,5 ppm, concentration, autoclaved soil, soil with glyphosate and addition of compost in field concentration of 40 t/ha, respectively 60 t/ha. The mineralization curves of 14CO2 accumulated were compared during of 40 days. All the mineralization curves for the soils exhibited same patterns, with only two phases, the initial rapid phase of degradation, for about 20 days, attributed to microbial action on the free glyphosate and the second slow phase, when the curves attained plateaus. Compost applied with different concentrations to Vertisol and Black Chernozem did not appear to stimulate the microbial degradation of glyphosate. In Gleysol and Phaeozem with lower humus content, the mineralization curve of 14C indicate the increase degradation capacity, expressed as accumulated 14CO2 as % total 14C, with the increase of compost concentration.

  4. Glyphosate and aminomethylphosphonic acid are not detectable in human milk.

    Science.gov (United States)

    McGuire, Michelle K; McGuire, Mark A; Price, William J; Shafii, Bahman; Carrothers, Janae M; Lackey, Kimberly A; Goldstein, Daniel A; Jensen, Pamela K; Vicini, John L

    2016-05-01

    Although animal studies have shown that exposure to glyphosate (a commonly used herbicide) does not result in glyphosate bioaccumulation in tissues, to our knowledge there are no published data on whether it is detectable in human milk and therefore consumed by breastfed infants. We sought to determine whether glyphosate and its metabolite aminomethylphosphonic acid (AMPA) could be detected in milk and urine produced by lactating women and, if so, to quantify typical consumption by breastfed infants. We collected milk (n = 41) and urine (n = 40) samples from healthy lactating women living in and around Moscow, Idaho and Pullman, Washington. Milk and urine samples were analyzed for glyphosate and AMPA with the use of highly sensitive liquid chromatography-tandem mass spectrometry methods validated for and optimized to each sample matrix. Our milk assay, which was sensitive down to 1 μg/L for both analytes, detected neither glyphosate nor AMPA in any milk sample. Mean ± SD glyphosate and AMPA concentrations in urine were 0.28 ± 0.38 and 0.30 ± 0.33 μg/L, respectively. Because of the complex nature of milk matrixes, these samples required more dilution before analysis than did urine, thus decreasing the sensitivity of the assay in milk compared with urine. No difference was found in urine glyphosate and AMPA concentrations between subjects consuming organic compared with conventionally grown foods or between women living on or near a farm/ranch and those living in an urban or suburban nonfarming area. Our data provide evidence that glyphosate and AMPA are not detectable in milk produced by women living in this region of the US Pacific Northwest. By extension, our results therefore suggest that dietary glyphosate exposure is not a health concern for breastfed infants. This study was registered at clinicaltrials.gov as NCT02670278. © 2016 American Society for Nutrition.

  5. Soil compaction and fertilization in soybean productivity

    Directory of Open Access Journals (Sweden)

    Beutler Amauri Nelson

    2004-01-01

    Full Text Available Soil compaction and fertilization affect soybean development. This study evaluated the effects of soil compaction and fertilization on soybean (Glycine max cv. Embrapa 48 productivity in a Typic Haplustox under field conditions in Jaboticabal, SP, Brazil. A completely randomized design with a 5 x 2 factorial layout (compaction vs. fertilization, with four replications in each treatment, was employed. Each experimental unit (replicate consisted of a 3.6 m² useful area. After the soil was prepared by cultivation, an 11 Mg tractor passed over it a variable number of times to create five levels of compaction. Treatments were: T0= no compaction, T1= one tractor pass, T2= two, T4= four, and T6= six passes, and no fertilizer and fertilizer to give soybean yields of 2.5 to 2.9 Mg ha-1. Soil was sampled at depths of 0.02-0.05, 0.07-0.10, and 0.15-0.18 m to determine macro and microporosity, penetration resistance (PR, and bulk density (Db. After 120 days growing under these conditions, the plants were analyzed in terms of development (plant height, number of pods, shoot dry matter per plant and weight of 100 seeds and seed productivity per hectare. Soil compaction decreased soybean development and productivity, but this effect was decreased by soil fertilization, showing that such fertilization increased soybean tolerance to soil compaction.

  6. Drought stress responses in soybean roots and nodules

    Directory of Open Access Journals (Sweden)

    Karl Kunert

    2016-07-01

    Full Text Available Drought is considered to be a major threat to soybean production worldwide and yet our current understanding of the effects of drought on soybean productively is largely based on studies on above-ground traits. Although the roots and root nodules are important sensors of drought, the responses of these crucial organs and their drought tolerance features remain poorly characterized. The symbiotic interaction between soybean and rhizobia facilitates atmospheric nitrogen fixation, a process that provides essential nitrogen to support plant growth and development. Symbiotic nitrogen fixation is important for sustainable agriculture, as it sustains plant growth on nitrogen-poor soils and limits fertilizer use for crop nitrogen nutrition. Recent developments have been made in our understanding of the drought impact on soybean root architecture and nodule traits, as well as underpinning transcriptome, proteome and also emerging metabolome information, with a view to improve the selection of more drought-tolerant soybean cultivars and rhizobia in the future. We conclude that the direct screening of root and nodule traits in the field as well as identification of genes, proteins and also metabolites involved in such traits will be essential in order to gain a better understanding of the regulation of root architecture, bacteroid development and lifespan in relation to drought tolerance in soybean.

  7. Drought Stress Responses in Soybean Roots and Nodules.

    Science.gov (United States)

    Kunert, Karl J; Vorster, Barend J; Fenta, Berhanu A; Kibido, Tsholofelo; Dionisio, Giuseppe; Foyer, Christine H

    2016-01-01

    Drought is considered to be a major threat to soybean production worldwide and yet our current understanding of the effects of drought on soybean productively is largely based on studies on above-ground traits. Although the roots and root nodules are important sensors of drought, the responses of these crucial organs and their drought tolerance features remain poorly characterized. The symbiotic interaction between soybean and rhizobia facilitates atmospheric nitrogen fixation, a process that provides essential nitrogen to support plant growth and development. Symbiotic nitrogen fixation is important for sustainable agriculture, as it sustains plant growth on nitrogen-poor soils and limits fertilizer use for crop nitrogen nutrition. Recent developments have been made in our understanding of the drought impact on soybean root architecture and nodule traits, as well as underpinning transcriptome, proteome and also emerging metabolome information, with a view to improve the selection of more drought-tolerant soybean cultivars and rhizobia in the future. We conclude that the direct screening of root and nodule traits in the field as well as identification of genes, proteins and also metabolites involved in such traits will be essential in order to gain a better understanding of the regulation of root architecture, bacteroid development and lifespan in relation to drought tolerance in soybean.

  8. The herbicide Glyphosate affects nitrification in the Elbe estuary, Germany

    Science.gov (United States)

    Sanders, Tina; Lassen, Stephan

    2015-04-01

    The Elbe River is one of the biggest European rivers discharging into the North Sea. It also transports high amounts of nutrients and pollutants like pesticides. Important source regions of both nutrients and pollutants are located within the river catchment, which is dominated by agricultural land-use. From these agricultural soils, pesticides can be carried via the river and estuary into the North Sea. Glyphosate (N-(phosphonomethyl) glycine) is the most commonly used herbicide worldwide and mainly used to regulate unwanted plant growth and for the expedition of crop ripening. In Germany, ~ 6000 tons of glyphosate are applied yearly in agriculture and private use. Glyphosate is degradable by microorganisms and has a half-life in water of 35 to 60 days. This herbicide specifically inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), an enzyme that catalyzes the biosynthesis of essential aromatic amino acids in plants, fungi, and bacteria. Nitrifying bacteria, which play an important role in the internal nitrogen cycling in the Elbe estuary, also possess this enzyme. The aim of our study was to quantify the concentration of glyphosate in water and sediment samples of the Elbe to get an overview about relevant environmental levels and to assess the impact of glyphosate on inhibition of nitrifying activities. To quantify the effect of glyphosate on nitrification activity, natural samples as well as pure cultures of Nitrosomonas europea (strain Nm50) were incubated with different concentrations of glyphosate over a period of some weeks. The nitrifying activity was determined according to changes of the nitrite and nitrate concentration as well as the cell number. Glyphosate was detectable in water and sediment samples in the Elbe estuary with up to 5 ppb mainly in the Port of Hamburg region. In both incubation experiments an inhibiting effect of glyphosate on nitrification could be shown. The incubated natural water sample was affected by a glyphosate

  9. Soybean diseases in Poland

    Directory of Open Access Journals (Sweden)

    J. Marcinkowska

    2013-12-01

    Full Text Available Field observations on the occurrence of soybean diseases were undertaken in the southern and central regions of Poland in the period 1976-1980. Most prevalent were foliage diseases caused by Peronospora manshurica, Pseudomonas syrinqae pv. glycinea and soybean mosaic virus (SMV. Sclerotinia sclerotiorum and Ascochyta sojaecola were reported as pathogens of local importance. The following pathogenic fungi: Botrytis cinerea, Fusarium culmorum, F. oxysporum and Rhizoctonia solani were also isolated from soybean.

  10. Do agrochemicals used during soybean flowering affect the visits of Apis mellifera L.?

    Energy Technology Data Exchange (ETDEWEB)

    Fagúndez, G.A.; Blettler, D.C.; Krumrick, C.G.; Bertos, M.A.; Trujillo, C.G.

    2016-11-01

    In the Pampa region of Argentina, most beehives are situated near to soybean [Glycine max (L.) Merr.] crop and honey bees (Apis mellifera L.) use its floral resources. Soybean is often sprayed with pesticides but very little is known about their repellent action against bees. This study evaluates the visit of honey bees to crop after the application of agrochemicals aiming to check for repellency of them and estimate the possible impact on crop pollination. For this, six treatments were used (glyphosate + cypermethrin; glyphosate; cypermethrin; lambda-cyhalothrin; methoxyfenocide; Bacillus thuringiensis) and developed on plots of 625 m2, located in Oro Verde (Argentina), applying two sprays during the crop flowering. The bees were captured using entomological net every 4 days in three different times from the day after the first spraying and up the end of crop flowering. The results showed very little or no repellent action of pesticides on A. mellifera, noting that it foraged on soybean flowers regardless of the temporal proximity and the type of product used in sprays. Possible causes are discussed and the need for larger studies is evident in field conditions related to pesticides repellency and mixtures. Also, further evaluation of the effects of the different chemical formulations available on the market and used regionally where the subspecies A. mellifera can be found. Simultaneously some management practices that could help minimize the risk of contamination are mentioned; the use of defensive crop products of biological origin is encouraged as well as further research in this topic. (Author)

  11. Seletividade de herbicidas pós-emergentes aplicados na soja geneticamente modificada Selectivity of post-emergence herbicides applied on genetically modified soybeans

    Directory of Open Access Journals (Sweden)

    M.E.F. Neto

    2009-06-01

    pelo fato de o herbicida ser registrado para controle em pré-emergência e ter sido aplicado em pós-emergência. Nenhum dos tratamentos influenciou significativamente a produção de grãos da cultura da soja. A aplicação única ou a complementação com aplicação sequencial de glyphosate promoveram excelente controle de Commelina benghalensis e Ipomoea triloba.The experiment was carried out in a Roundup Ready® commercial soybean field in the Pontal do Paranapanema region in Euclides da Cunha Paulista-SP, located 20º 43' 11'' S and 50º 10' 20'' W, 270 m altitude. The experimental phase was carried out from December 2006 to April 2007, under no-tillage system. The soil classification is sandy clay loam Argisol. This work aimed to evaluate the efficiency of Roundup Transorb® glyphosate formulation selectivity associated with the herbicides diclosulam, cloransulam-methyl, flumioxazina and S-metolachlor under two spray modalities (single, with glyphosate associated to the herbicides and sequential, with only glyphosate in tropical Spiderwort (Commelina benghalensis and little bell (Ipomoea triloba management during soybean cultivation. The experiment was arranged in a randomized block design, with 12 treatments and 4 replications. Treatments were distributed in a factorial scheme + 2 controls (no control and clean field. The factorial scheme 2 x 5 comprises two herbicide sprays (single and sequential and five herbicides (glyphosate, glyphosate + diclosulam, glyphosate + cloransulam-methyl, glyphosate + flumioxazin and glyphosate + S-metolachlor. Under the conditions and time the herbicides were used as well as spray dosage, the results showed that glyphosate sprayed in a single dose or sequentially, in combination with diclosulan and cloransulam-methyl in the first spray did not cause phyto-intoxication in the soybean plants. The flumioxazin and S-metolachlor combination promoted delay in the growing plants as well as in the complete formation of the culture due

  12. Efeitos de diferentes formulações comerciais de glyphosate sobre estirpes de Bradyrhizobium Effects of different glyphosate commercial formulations on Bradyrhizobium strains

    Directory of Open Access Journals (Sweden)

    J.B. Santos

    2004-06-01

    the strains were inoculated in yeast extract manitol (YM. Herbicide effect on the growth of the Bradyrhizobium strains was assessed by optic density reading in a spectrophotometer. Twenty seven treatments arranged in a factorial design were evaluated and consisted of one strain of B. japonicum: SEMIA 5079; and two strains of B. elkanii: SEMIA 5019 and SEMIA 587, under the effect of nine glyphosate formulations: Zapp QI®, Roundup®, Roundup Multiação®, Roundup Transorb®, Roundup WG®, Trop®, Agrisato®, technical glyphosate [N-(phosphonomethyl glycine] and control without herbicide addition (as the strain control treatment, with six replications. A growth curve was established for each strain. It could be observed that the different glyphosate formulations Zapp Qi, Roundup, Roundup Multiação, Roundup transorb, Roundup WG, Trop and Agrisato caused differentiated effects on the strains of Bradyrhizobium SEMIA 5019, SEMIA 5079 and SEMIA 587. It was verified that the Zapp Qi formulation was the least toxic to the strains. The highest toxicity was observed for Roundup Transorb, which reduced growth over 94% for all the strains assessed. Correlation was not observed among the type of salt, isopropylamine, ammonium or potassic, present in the formulation herbicides, and the toxicity degree to the strains. The strain SEMIA 587 was the least tolerant to most formulations while SEMIA 5019 was the most sensitive to the control treatment N- (phosphonomethyl glycine, without salts or other additives.

  13. The effect of glyphosate application on soil microbial activities in ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... bacterial populations in the presence of glyphosate as P source was significantly (p<0.01) higher than N ... bes by transferring hydrogen or electrons from substrates .... of utilizing GP as carbon or other nutrient sources.

  14. Biodegradation of glyphosate herbicide in vitro using bacterial ...

    African Journals Online (AJOL)

    USER

    2010-06-28

    Jun 28, 2010 ... Full Length Research Paper ... Glyphosate is a compound used as herbicide in the control and/or killing of grasses and herbaceous plants. ... Because of its toxicity to non-target organisms, there is need to decontaminate.

  15. Biokinetic Analysis and Metabolic Fate of 2,4-D in 2,4-D-Resistant Soybean (Glycine max).

    Science.gov (United States)

    Skelton, Joshua J; Simpson, David M; Peterson, Mark A; Riechers, Dean E

    2017-07-26

    The Enlist weed control system allows the use of 2,4-D in soybean but slight necrosis in treated leaves may be observed in the field. The objectives of this research were to measure and compare uptake, translocation, and metabolism of 2,4-D in Enlist (E, resistant) and non-AAD-12 transformed (NT, sensitive) soybeans. The adjuvant from the Enlist Duo herbicide formulation (ADJ) increased 2,4-D uptake (36%) and displayed the fastest rate of uptake (U 50 = 0.2 h) among treatments. E soybean demonstrated a faster rate of 2,4-D metabolism (M 50 = 0.2 h) compared to NT soybean, but glyphosate did not affect 2,4-D metabolism. Metabolites of 2,4-D in E soybean were qualitatively different than NT. Applying 2,4-D-ethylhexyl ester instead of 2,4-D choline (a quaternary ammonium salt) eliminated visual injury to E soybean, likely due to the time required for initial de-esterification and bioactivation. Excessive 2,4-D acid concentrations in E soybean resulting from ADJ-increased uptake may significantly contribute to foliar injury.

  16. Removal of glyphosate herbicide from water using biopolymer membranes.

    Science.gov (United States)

    Carneiro, Rafael T A; Taketa, Thiago B; Gomes Neto, Reginaldo J; Oliveira, Jhones L; Campos, Estefânia V R; de Moraes, Mariana A; da Silva, Camila M G; Beppu, Marisa M; Fraceto, Leonardo F

    2015-03-15

    Enormous amounts of pesticides are manufactured and used worldwide, some of which reach soils and aquatic systems. Glyphosate is a non-selective herbicide that is effective against all types of weeds and has been used for many years. It can therefore be found as a contaminant in water, and procedures are required for its removal. This work investigates the use of biopolymeric membranes prepared with chitosan (CS), alginate (AG), and a chitosan/alginate combination (CS/AG) for the adsorption of glyphosate present in water samples. The adsorption of glyphosate by the different membranes was investigated using the pseudo-first order and pseudo-second order kinetic models, as well as the Langmuir and Freundlich isotherm models. The membranes were characterized regarding membrane solubility, swelling, mechanical, chemical and morphological properties. The results of kinetics experiments showed that adsorption equilibrium was reached within 4 h and that the CS membrane presented the best adsorption (10.88 mg of glyphosate/g of membrane), followed by the CS/AG bilayer (8.70 mg of glyphosate/g of membrane). The AG membrane did not show any adsorption capacity for this herbicide. The pseudo-second order model provided good fits to the glyphosate adsorption data on CS and CS/AG membranes, with high correlation coefficient values. Glyphosate adsorption by the membranes could be fitted by the Freundlich isotherm model. There was a high affinity between glyphosate and the CS membrane and moderate affinity in the case of the CS/AG membrane. Physico-chemical characterization of the membranes showed low values of solubility in water, indicating that the membranes are stable and not soluble in water. The SEM and AFM analysis showed evidence of the presence of glyphosate on CS membranes and on chitosan face on CS/AG membranes. The results showed that the glyphosate herbicide can be adsorbed by chitosan membranes and the proposed membrane-based methodology was successfully used to

  17. Comparison of Salt Tolerance in Soja Based on Metabolomics of Seedling Roots

    Directory of Open Access Journals (Sweden)

    Mingxia Li

    2017-06-01

    Full Text Available Soybean is an important economic crop that is continually threatened by abiotic stresses, especially salt stress. Wild soybean is an important germplasm resource for the breeding of cultivated soybean. The root system plays a very important role in plant salt tolerance. To explore the salt tolerance-related mechanisms among Soja, we have demonstrated the seedling roots' growth and metabolomics in wild soybean, semi-wild soybean, and cultivated soybean under two types of salt stress by using gas chromatography-mass spectrometry. We characterized 47 kinds of differential metabolites under neutral salt stress, and isoleucine, serine, l-allothreonine, glutamic acid, phenylalanine, asparagines, aspartic acid, pentadecanoic acid, lignoceric acid, oleic acid, galactose, tagatose, d-arabitol, dihydroxyacetone, 3-hydroxybutyric acid, and glucuronic acid increased significantly in the roots of wild soybean seedlings. However, these metabolites were suppressed in semi-wild and cultivated soybeans. Amino acid, fatty acid, sugars, and organic acid synthesis and the secondary metabolism of antioxidants increased significantly in the roots of wild soybean seedling. Under alkaline salt stress, wild soybean contained significantly higher amounts of proline, glutamic acid, aspartic acid, l-allothreonine, isoleucine, serine, alanine, arachidic acid, oleic acid, cis-gondoic acid, fumaric acid, l-malic acid, citric acid, malonic acid, gluconic acid, 5-methoxytryptamine, salicylic acid, and fluorene than semi-wild and cultivated soybeans. Our study demonstrated that carbon and nitrogen metabolism, and the tricarboxylic acid (TCA cycle and receiver operating characteristics (especially the metabolism of phenolic substances of the seedling roots were important to resisting salt stress and showed a regular decreasing trend from wild soybean to cultivated soybean. The metabolomics's changes were critical factors in the evolution of salt tolerance among Soja. This study

  18. Pool of resistance mechanisms to glyphosate in Digitaria insularis.

    Science.gov (United States)

    de Carvalho, Leonardo Bianco; Alves, Pedro Luis da Costa Aguiar; González-Torralva, Fidel; Cruz-Hipolito, Hugo Enrique; Rojano-Delgado, Antonia María; De Prado, Rafael; Gil-Humanes, Javier; Barro, Francisco; de Castro, María Dolores Luque

    2012-01-18

    Digitaria insularis biotypes resistant to glyphosate have been detected in Brazil. Studies were carried out in controlled conditions to determine the role of absorption, translocation, metabolism, and gene mutation as mechanisms of glyphosate resistance in D. insularis. The susceptible biotype absorbed at least 12% more (14)C-glyphosate up to 48 h after treatment (HAT) than resistant biotypes. High differential (14)C-glyphosate translocation was observed at 12 HAT, so that >70% of the absorbed herbicide remained in the treated leaf in resistant biotypes, whereas 42% remained in the susceptible biotype at 96 HAT. Glyphosate was degraded to aminomethylphosphonic acid (AMPA), glyoxylate, and sarcosine by >90% in resistant biotypes, whereas a small amount of herbicide (up to 11%) was degraded by the susceptible biotype up to 168 HAT. Two amino acid changes were found at positions 182 and 310 in EPSPS, consisting of a proline to threonine and a tyrosine to cysteine substitution, respectively, in resistant biotypes. Therefore, absorption, translocation, metabolism, and gene mutation play an important role in the D. insularis glyphosate resistance.

  19. Root-Zone Glyphosate Exposure Adversely Affects Two Ditch Species

    Directory of Open Access Journals (Sweden)

    Lyndsay E. Saunders

    2013-12-01

    Full Text Available Glyphosate, one of the most applied herbicides globally, has been extensively studied for its effects on non-target organisms. In the field, following precipitation, glyphosate runs off into agricultural ditches where it infiltrates into the soil and thus may encounter the roots of vegetation. These edge-of-field ditches share many characteristics with wetlands, including the ability to reduce loads of anthropogenic chemicals through uptake, transformation, and retention. Different species within the ditches may have a differential sensitivity to exposure of the root zone to glyphosate, contributing to patterns of abundance of ruderal species. The present laboratory experiment investigated whether two species commonly found in agricultural ditches in southcentral United States were affected by root zone glyphosate in a dose-dependent manner, with the objective of identifying a sublethal concentration threshold. The root zone of individuals of Polygonum hydropiperoides and Panicum hemitomon were exposed to four concentrations of glyphosate. Leaf chlorophyll content was measured, and the ratio of aboveground biomass to belowground biomass and survival were quantified. The findings from this study showed that root zone glyphosate exposure negatively affected both species including dose-dependent reductions in chlorophyll content. P. hydropiperdoides showed the greatest negative response, with decreased belowground biomass allocation and total mortality at the highest concentrations tested.

  20. A glyphosate-based pesticide impinges on transcription

    International Nuclear Information System (INIS)

    Marc, Julie; Le Breton, Magali; Cormier, Patrick; Morales, Julia; Belle, Robert; Mulner-Lorillon, Odile

    2005-01-01

    Widely spread chemicals used for human benefits may exert adverse effects on health or the environment, the identification of which are a major challenge. The early development of the sea urchin constitutes an appropriate model for the identification of undesirable cellular and molecular targets of pollutants. The widespread glyphosate-based pesticide affected sea urchin development by impeding the hatching process at millimolar range concentration of glyphosate. Glyphosate, the active herbicide ingredient of Roundup, by itself delayed hatching as judged from the comparable effect of different commercial glyphosate-based pesticides and from the effect of pure glyphosate addition to a threshold concentration of Roundup. The surfactant polyoxyethylene amine (POEA), the major component of commercial Roundup, was found to be highly toxic to the embryos when tested alone and therefore could contribute to the inhibition of hatching. Hatching, a landmark of early development, is a transcription-dependent process. Correlatively, the herbicide inhibited the global transcription, which follows fertilization at the 16-cell stage. Transcription inhibition was dose-dependent in the millimolar glyphosate range concentration. A 1257-bp fragment of the hatching enzyme transcript from Sphaerechinus granularis was cloned and sequenced; its transcription was delayed by 2 h in the pesticide-treated embryos. Because transcription is a fundamental basic biological process, the pesticide may be of health concern by inhalation near herbicide spraying at a concentration 25 times the adverse transcription concentration in the sprayed microdroplets

  1. Epidemiologic studies of glyphosate and cancer: a review.

    Science.gov (United States)

    Mink, Pamela J; Mandel, Jack S; Sceurman, Bonnielin K; Lundin, Jessica I

    2012-08-01

    The United States Environmental Protection Agency and other regulatory agencies around the world have registered glyphosate as a broad-spectrum herbicide for use on multiple food and non-food use crops. Glyphosate is widely considered by regulatory authorities and scientific bodies to have no carcinogenic potential, based primarily on results of carcinogenicity studies of rats and mice. To examine potential cancer risks in humans, we reviewed the epidemiologic literature to evaluate whether exposure to glyphosate is associated causally with cancer risk in humans. We also reviewed relevant methodological and biomonitoring studies of glyphosate. Seven cohort studies and fourteen case-control studies examined the association between glyphosate and one or more cancer outcomes. Our review found no consistent pattern of positive associations indicating a causal relationship between total cancer (in adults or children) or any site-specific cancer and exposure to glyphosate. Data from biomonitoring studies underscore the importance of exposure assessment in epidemiologic studies, and indicate that studies should incorporate not only duration and frequency of pesticide use, but also type of pesticide formulation. Because generic exposure assessments likely lead to exposure misclassification, it is recommended that exposure algorithms be validated with biomonitoring data. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. EVALUATION OF CASSAVA/SOYBEAN INTERCROPPING SYSTEM ...

    African Journals Online (AJOL)

    Soybean plants were taller when intercropped with NR 8212 or with TMS 30572 than in sole soybean, which had similar height with soybean in soybean/TMS 91934 mixture. The soybean canopy diameter, number of leaves per plant and LAI were higher with sole soybean. Within the soybean intercrops, canopy diameter, ...

  3. Glyphosate Effects on Plant Mineral Nutrition, Crop Rhizosphere Microbiota, and Plant Disease in Glyphosate-Resistant Crops

    Science.gov (United States)

    2012-01-01

    Claims have been made recently that glyphosate-resistant (GR) crops sometimes have mineral deficiencies and increased plant disease. This review evaluates the literature that is germane to these claims. Our conclusions are: (1) although there is conflicting literature on the effects of glyphosate on mineral nutrition on GR crops, most of the literature indicates that mineral nutrition in GR crops is not affected by either the GR trait or by application of glyphosate; (2) most of the available data support the view that neither the GR transgenes nor glyphosate use in GR crops increases crop disease; and (3) yield data on GR crops do not support the hypotheses that there are substantive mineral nutrition or disease problems that are specific to GR crops. PMID:23013354

  4. The effect of Saccharomyces cerevisiae on the stability of the herbicide glyphosate during bread leavening.

    Science.gov (United States)

    Low, F L; Shaw, I C; Gerrard, J A

    2005-01-01

    To investigate the ability of baker's yeast (Saccharomyces cerevisiae) to degrade the herbicide glyphosate during the fermentation cycle of the breadmaking process. Aqueous glyphosate was added to bread ingredients and kneaded by commercially available breadmaking equipment into dough cultures. Cultures were incubated in the breadmaker throughout the fermentation cycle. The recovery of glyphosate levels following fermentation was determined, thus allowing an estimation of glyphosate degradation by yeast. It was shown, for the first time, that S. cerevisiae plays a role in metabolizing glyphosate during the fermentation stages of breadmaking. Approximately 21% was degraded within 1 h. As a result of projected increases in the glyphosate use on wheat and the role of bread as a dietary staple, this may contribute to more informed decisions being made relating to the use of glyphosate on glyphosate-resistant wheat, from a public health/regulatory perspective.

  5. Carfentrazone-ethyl, isolado e associado a duas formulações de glyphosate no controle de duas espécies de trapoeraba Carfentrazone-ethyl isolated and in mixture with two glyphosate formulations on the control of two dayflower species

    Directory of Open Access Journals (Sweden)

    C.P. Ronchi

    2002-04-01

    parte aérea provocada pelos herbicidas.This research was conducted to evaluate the effectiveness of carfentrazone-ethyl, isolated and in mixture with to glyphosate or glyphosate-potassium salt, on controlling two dayflower species, Commelina diffusa and C. benghalensis. These species were grown from stem segments in 12 L pots filled with soil, during 120 days. A complete randomized block design with four replicates was performed for each species. The treatments were carfentrazone-ethyl (0, 10, 20, 30, 40 and 50 g ha-1, isolated and in mixture with glyphosate or glyphosate-potassium salt, these being applied at doses of 720 g ha-1. The percentages of weed control and shoot fresh weight (SFW were evaluated. C. diffusa was more tolerant to carfentrazone-ethyl alone or combined with both glyphosate and glyphosate-potassium salt than C. benghalensis. Both glyphosate and glyphosate-potassium salt were inefficient (control below 30% when applied isolated, regardless of the species. The efficiency of controlling herbicide mixtures was greater than their single applications, except for the carfentrazone-ethyl in doses above 30 g ha-1, with C. benghalensis, in which control was similar to the employed mixtures. Despite the reasonable control (from 71 to 80% for C. diffusa and the very good control (above 81% for C. benghalensis, obtained with carfentrazone-ethyl + glyphosate or carfentrazone-ethyl + glyphosate-potassium salt mixtures, a sole application did not decisively control Commelina spp. In effect, recovery of plants as seen through SFW evaluation took place irrespective of the species; moreover, for C. benghalensis, reinfestation from underground seeds that became viable after the shoot's death, due to herbicide application, was also found.

  6. Degradation of the Phosphonate Herbicide Glyphosate by Arthrobacter atrocyaneus ATCC 13752

    OpenAIRE

    Pipke, Rüdiger; Amrhein, Nikolaus

    1988-01-01

    Of nine authentic Arthrobacter strains tested, only A. atrocyaneus ATCC 13752 was capable of using the herbicide glyphosate [N-(phosphonomethyl)glycine] as its sole source of phosphorus. Contrary to the previously isolated Arthrobacter sp. strain GLP-1, which degrades glyphosate via sarcosine, A. atrocyaneus metabolized glyphosate to aminomethylphosphonic acid. The carbon of aminomethylphosphonic acid was entirely converted to CO2. This is the first report on glyphosate degradation by a bacte...

  7. Integrating soil conservation practices and glyphosate-resistant crops: impacts on soil.

    Science.gov (United States)

    Locke, Martin A; Zablotowicz, Robert M; Reddy, Krishna N

    2008-04-01

    Conservation practices often associated with glyphosate-resistant crops, e.g. limited tillage and crop cover, improve soil conditions, but only limited research has evaluated their effects on soil in combination with glyphosate-resistant crops. It is assumed that conservation practices have similar benefits to soil whether or not glyphosate-resistant crops are used. This paper reviews the impact on soil of conservation practices and glyphosate-resistant crops, and presents data from a Mississippi field trial comparing glyphosate-resistant and non-glyphosate-resistant maize (Zea mays L.) and cotton (Gossypium hirsutum L.) under limited tillage management. Results from the reduced-tillage study indicate differences in soil biological and chemical properties owing to glyphosate-resistant crops. Under continuous glyphosate-resistant maize, soils maintained greater soil organic carbon and nitrogen as compared with continuous non-glyphosate-resistant maize, but no differences were measured in continuous cotton or in cotton rotated with maize. Soil microbial community structure based on total fatty acid methyl ester analysis indicated a significant effect of glyphosate-resistant crop following 5 years of continuous glyphosate-resistant crop as compared with the non-glyphosate-resistant crop system. Results from this study, as well as the literature review, indicate differences attributable to the interaction of conservation practices and glyphosate-resistant crop, but many are transient and benign for the soil ecosystem. Glyphosate use may result in minor effects on soil biological/chemical properties. However, enhanced organic carbon and plant residues in surface soils under conservation practices may buffer potential effects of glyphosate. Long-term field research established under various cropping systems and ecological regions is needed for critical assessment of glyphosate-resistant crop and conservation practice interactions. Copyright (c) 2008 by John Wiley & Sons

  8. Phytotoxicity of glyphosate in the germination of and its effect on germinated seedlings

    Directory of Open Access Journals (Sweden)

    Subinoy Mondal

    2017-08-01

    Full Text Available The present study evaluated the effects of glyphosate on Pisum sativum germination as well as its effect on the physiology and biochemistry of germinated seedlings. Different physico-chemical biomarkers, viz., chlorophyll, root and shoot length, total protein and soluble sugar, along with sodium and potassium concentration, were investigated in germinated seedlings at different glyphosate concentrations. This study reports the influence of different concentrations of glyphosate on pea seeds and seedlings. Physicochemical biomarkers were significantly changed by glyphosate exposure after 15 days. The germination of seedlings under control conditions (0 mg/L was 100% after 3 days of treatment but at 3 and 4 mg/L glyphosate, germination was reduced to 55 and 40%, respectively. Physiological parameters like root and shoot length decreased monotonically with increasing glyphosate concentration, at 14 days of observation. Average root and shoot length (n=30 in three replicates were reduced to 14.7 and 17.6%, respectively, at 4 mg/L glyphosate. Leaf chlorophyll content also decreased, with a similar trend to root and shoot length, but the protein content initially decreased and then increased with an increase in glyphosate concentration to 3 mg/L. The study suggests that glyphosate reduces the soluble sugar content significantly, by 21.6% (v/v. But internal sodium and potassium tissue concentrations were significantly altered by glyphosate exposure with increasing concentrations of glyphosate. Biochemical and physiological analysis also supports the inhibitory effect of glyphosate on seed germination and biochemical effects on seedlings.

  9. Utilization of glyphosate as phosphate source: biochemistry and genetics of bacterial carbon-phosphorous lyase

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Zechel, David L; Jochimsen, Bjarne

    2014-01-01

    After several decades of use of glyphosate, the active ingredient in weed killers such as Roundup, in fields, forests, and gardens, the biochemical pathway of transformation of glyphosate phosphorus to a useful phosphorus source for microorganisms has been disclosed. Glyphosate is a member of a l...

  10. Early detection of crop injury from herbicide glyphosate by leaf biochemical parameter inversion

    Science.gov (United States)

    Early detection of crop injury from glyphosate is of significant importance in crop management. In this paper, we attempt to detect glyphosate-induced crop injury by PROSPECT (leaf optical PROperty SPECTra model) inversion through leaf hyperspectral reflectance measurements for non-Glyphosate-Resist...

  11. The induction of proteinases in corn and soybean by anoxia

    International Nuclear Information System (INIS)

    VanToai, T.; Hwang, Shihying

    1989-01-01

    This study characterized the anaerobic changes in proteinase activities in corn and soybean roots and to investigate the possibility that these changes might contribute to the differential anaerobiosis tolerance of the two species. After 24 h of anoxia, crude protein extracts from H60 corn and Keller soybean root tips (10cm) were assayed for proteinase activities at pH range from 4.5 to 9.5. Turnover of aberrant proteins was studied in seedlings labelled with 3 H-leucine for 12 h under: (a) puromycin (0.64 mM) in air, (b) ethanol (1%) in air, (c) nitrogen and (d) air. After the treatment, the labelled proteins remaining in roots were determined every 2 h for 6 h. In both corn and soybean, activities of alkali proteinases increased, and activities of acid proteinases declined under anoxia. Neutral proteinases increase in anoxic corn roots, but decline in anoxic soybean roots. The protein turnover rate in corn treated with puromycin, ethanol and nitrogen was much higher than in control roots. The protein turnover rate in soybean roots treated with puromycin, ethanol was similar to the rate of the control. The results indicated that: (a) anoxic corn can degrade aberrant proteins, but anoxic soybean cannot, (b) the degradation of aberrant proteins in anoxic corn is accomplished by neutral proteinases, and (c) the accumulation of aberrant proteins in soybean might contribute to the susceptibility of this species to anoxia

  12. Facts and Fallacies in the Debate on Glyphosate Toxicity

    Directory of Open Access Journals (Sweden)

    Robin Mesnage

    2017-11-01

    Full Text Available The safety profile of the herbicide glyphosate and its commercial formulations is controversial. Reviews have been published by individuals who are consultants and employees of companies commercializing glyphosate-based herbicides in support of glyphosate’s reapproval by regulatory agencies. These authors conclude that glyphosate is safe at levels below regulatory permissible limits. In contrast, reviews conducted by academic scientists independent of industry report toxic effects below regulatory limits, as well as shortcomings of the current regulatory evaluation of risks associated with glyphosate exposures. Two authors in particular (Samsel and Seneff have published a series of commentaries proposing that long-term exposure to glyphosate is responsible for many chronic diseases (including cancers, diabetes, neuropathies, obesity, asthma, infections, osteoporosis, infertility, and birth defects. The aim of this review is to examine the evidential basis for these claimed negative health effects and the mechanisms that are alleged to be at their basis. We found that these authors inappropriately employ a deductive reasoning approach based on syllogism. We found that their conclusions are not supported by the available scientific evidence. Thus, the mechanisms and vast range of conditions proposed to result from glyphosate toxicity presented by Samsel and Seneff in their commentaries are at best unsubstantiated theories, speculations, or simply incorrect. This misrepresentation of glyphosate’s toxicity misleads the public, the scientific community, and regulators. Although evidence exists that glyphosate-based herbicides are toxic below regulatory set safety limits, the arguments of Samsel and Seneff largely serve to distract rather than to give a rational direction to much needed future research investigating the toxicity of these pesticides, especially at levels of ingestion that are typical for human populations.

  13. Facts and Fallacies in the Debate on Glyphosate Toxicity

    Science.gov (United States)

    Mesnage, Robin; Antoniou, Michael N.

    2017-01-01

    The safety profile of the herbicide glyphosate and its commercial formulations is controversial. Reviews have been published by individuals who are consultants and employees of companies commercializing glyphosate-based herbicides in support of glyphosate’s reapproval by regulatory agencies. These authors conclude that glyphosate is safe at levels below regulatory permissible limits. In contrast, reviews conducted by academic scientists independent of industry report toxic effects below regulatory limits, as well as shortcomings of the current regulatory evaluation of risks associated with glyphosate exposures. Two authors in particular (Samsel and Seneff) have published a series of commentaries proposing that long-term exposure to glyphosate is responsible for many chronic diseases (including cancers, diabetes, neuropathies, obesity, asthma, infections, osteoporosis, infertility, and birth defects). The aim of this review is to examine the evidential basis for these claimed negative health effects and the mechanisms that are alleged to be at their basis. We found that these authors inappropriately employ a deductive reasoning approach based on syllogism. We found that their conclusions are not supported by the available scientific evidence. Thus, the mechanisms and vast range of conditions proposed to result from glyphosate toxicity presented by Samsel and Seneff in their commentaries are at best unsubstantiated theories, speculations, or simply incorrect. This misrepresentation of glyphosate’s toxicity misleads the public, the scientific community, and regulators. Although evidence exists that glyphosate-based herbicides are toxic below regulatory set safety limits, the arguments of Samsel and Seneff largely serve to distract rather than to give a rational direction to much needed future research investigating the toxicity of these pesticides, especially at levels of ingestion that are typical for human populations. PMID:29226121

  14. Resposta de cultivares de algodoeiro a subdoses de glyphosate Response of cotton cultivars to reduced rates of glyphosate

    Directory of Open Access Journals (Sweden)

    O.M. Yamashita

    2005-12-01

    Full Text Available Avaliou-se a resposta de nove cultivares de algodoeiro, de importância econômica no Estado do Mato Grosso, quanto à intoxicação causada por subdoses de glyphosate. Os cultivares de algodoeiro utilizados foram Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal, BRS Facual, Antares e Coodetec 407. As plantas foram cultivadas em tubetes preenchidos com substrato de solo e mantidas em casa telada, tendo recebido a aplicação do glyphosate aos 20 dias após a emergência, época em que apresentavam quatro folhas verdadeiras. As subdoses de glyphosate, simulando deriva, foram de 270 e 540 g ha-1. Também foi utilizada testemunha, sem aplicação do herbicida, para efeito de comparação. Foram realizadas avaliações semanais até 42 dias após a aplicação dos tratamentos (DAA, período em que também foi tomada a altura das plantas. Os sintomas visuais de intoxicação iniciaram-se aos 3 DAA, caracterizados pelo amarelecimento das pontas das folhas mais novas, seguido de murchamento do ápice das plantas. Na dose de 270 g ha-1 esses sintomas foram de baixa intensidade, mas a 540 g ha-1 causaram, na maioria dos casos, toxidez "preocupante" a "muito alta". Os cultivares BRS Facual e FM 986 mostraram-se os mais suscetíveis. A altura das plantas foi mais afetada quando se aplicou a menor dose de glyphosate. Houve recuperação de todos os cultivares tratados com 270 g ha-1 de glyphosate até os 42 DAA. Quando tratados com 540 g ha-1 de glyphosate, os cultivares Fabrika, Coodetec 407, BRS-Facual e ITA-90 foram mais sensíveis, apresentando redução de altura entre 84 e 90% aos 42 DAA. Os cultivares menos sensíveis na dose de 270 g ha-1 de glyphosate não foram os mesmos para a dose de 540 g ha-1.The response of nine cotton cultivars economically important in the state of Mato Grosso was evaluated in relation to the toxicity caused by reduced rates of glyphosate. The cotton cultivars used were Fabrika, Makina, ITA-90, FM 986, FM 966, Delta Opal

  15. Seasonal soybean crop reflectance

    Science.gov (United States)

    Lemaster, E. W. (Principal Investigator); Chance, J. E.

    1983-01-01

    Data are presented from field measurements of 1980 including 5 acquisitions of handheld radiometer reflectance measurements, 7 complete sets of parameters for implementing the Suits mode, and other biophysical parameters to characterize the soybean canopy. LANDSAT calculations on the simulated Brazilian soybean reflectance are included along with data collected during the summer and fall on 1981 on soybean single leaf optical parameters for three irrigation treatments. Tests of the Suits vegetative canopy reflectance model for the full hemisphere of observer directions as well as the nadir direction show moderate agreement for the visible channels of the MSS and poor agreement in the near infrared channel. Temporal changes in the spectral characteristics of the single leaves were seen to occur as a function of maturity which demonstrates that the absorptance of a soybean single leaf is more a function of thetransmittancee characteristics than the seasonally consistent single leaf reflectance.

  16. Ncl Synchronously Regulates Na+, K+, and Cl- in Soybean and Greatly Increases the Grain Yield in Saline Field Conditions.

    Science.gov (United States)

    Do, Tuyen Duc; Chen, Huatao; Hien, Vu Thi Thu; Hamwieh, Aladdin; Yamada, Tetsuya; Sato, Tadashi; Yan, Yongliang; Cong, Hua; Shono, Mariko; Suenaga, Kazuhiro; Xu, Donghe

    2016-01-08

    Salt stress inhibits soybean growth and reduces gain yield. Genetic improvement of salt tolerance is essential for sustainable soybean production in saline areas. In this study, we isolated a gene (Ncl) that could synchronously regulate the transport and accumulation of Na(+), K(+), and Cl(-) from a Brazilian soybean cultivar FT-Abyara using map-based cloning strategy. Higher expression of the salt tolerance gene Ncl in the root resulted in lower accumulations of Na(+), K(+), and Cl(-) in the shoot under salt stress. Transfer of Ncl with the Agrobacterium-mediated transformation method into a soybean cultivar Kariyutaka significantly enhanced its salt tolerance. Introgression of the tolerance allele into soybean cultivar Jackson, using DNA marker-assisted selection (MAS), produced an improved salt tolerance line. Ncl could increase soybean grain yield by 3.6-5.5 times in saline field conditions. Using Ncl in soybean breeding through gene transfer or MAS would contribute to sustainable soybean production in saline-prone areas.

  17. 40 CFR 180.609 - Fluoxastrobin; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... subgroup 4B 4.0 Peanut 0.010 Peanut, hay 20.0 Peanut, refined oil 0.030 Soybean, forage 9.0 Soybean, hay 1... Vegetable, tuberous and corm, subgroup 1C 0.010 (2) Tolerances are established for residues of fluoxastrobin... Vegetable, foliage of legume, group 7 0.050 [74 FR 67113, Dec. 18, 2009] ...

  18. DIFFERENTIAL RESPONSE OF CLONES OF EUCALYPT TO GLYPHOSATE1

    Directory of Open Access Journals (Sweden)

    Leonardo Bianco de Carvalho

    2015-02-01

    Full Text Available Weed control is commonly performed by the inter-row mechanical weeding associated to intrarow glyphosate directed spraying, causing a risk for drift or accidental herbicide application, that can affect the crop of interest. The objective was to evaluate the response of clones C219, GG100, I144, and I224 of eucalypt (Eucalyptus grandis x E. urophylla to glyphosate doses of 0, 18, 36, 72, 180, 360, and 720 g of acid equivalent per hectare. The clones showed different growth patterns with regard to height, leaf number, stem dry weight, relative growth rate, net assimilation rate, and relative leaf growth rate. The clones I144 and GG100 were more susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 113.4 and 119.6 g acid equivalent per hectare, respectively. The clones C219 and I224 were less susceptible to glyphosate, showing the doses required to reduce dry weight by 50% of 237.5 and 313.5 g acid equivalent per hectare, respectively. Eucalyptus clones respond differently to glyphosate exposure, so that among I224, C219, GG100, and I144, the susceptibility to the herbicide is increasing.

  19. Herbicide-resistant weed management: focus on glyphosate.

    Science.gov (United States)

    Beckie, Hugh J

    2011-09-01

    This review focuses on proactive and reactive management of glyphosate-resistant (GR) weeds. Glyphosate resistance in weeds has evolved under recurrent glyphosate usage, with little or no diversity in weed management practices. The main herbicide strategy for proactively or reactively managing GR weeds is to supplement glyphosate with herbicides of alternative modes of action and with soil-residual activity. These herbicides can be applied in sequences or mixtures. Proactive or reactive GR weed management can be aided by crop cultivars with alternative single or stacked herbicide-resistance traits, which will become increasingly available to growers in the future. Many growers with GR weeds continue to use glyphosate because of its economical broad-spectrum weed control. Government farm policies, pesticide regulatory policies and industry actions should encourage growers to adopt a more proactive approach to GR weed management by providing the best information and training on management practices, information on the benefits of proactive management and voluntary incentives, as appropriate. Results from recent surveys in the United States indicate that such a change in grower attitudes may be occurring because of enhanced awareness of the benefits of proactive management and the relative cost of the reactive management of GR weeds. Copyright © 2011 Society of Chemical Industry.

  20. Eficácia de glyphosate em plantas de cobertura Efficacy of glyphosate in cover crops

    Directory of Open Access Journals (Sweden)

    P.C. Timossi

    2006-09-01

    Full Text Available Objetivou-se comparar a eficácia de três dosagens do herbicida glyphosate para a dessecação de Brachiaria decumbens, B. brizantha cv. Marandu e vegetação espontânea, visando a adoção do sistema plantio direto. Utilizou-se delineamento experimental de blocos ao acaso, num esquema fatorial 3 x 3, com quatro repetições. Testaram-se três tipos de cobertura vegetal e três dosagens de glyphosate (1,44, 2,16 e 2,88 kg ha-1. Aos 7, 14, 21 e 28 dias após a aplicação (DAA, foram feitas avaliações visuais da porcentagem de controle das coberturas vegetais e, aos 45 DAA, avaliações visuais da porcentagem de reinfestação da área. Conclui-se que, para as espécies que compunham a vegetação espontânea, o uso de 1,44 kg ha-1 proporcionou bom controle, sem no entanto evitar rebrotes de Digitaria insularis. Para as braquiárias, a mesma taxa de controle foi observada a partir de 2,16 kg ha-1. A camada de palha das braquiárias sobre o solo não foi capaz de suprimir a emergência de Cyperus rotundus, Alternanthera tenella, Raphanus raphanistrum, Bidens pilosa e Euphorbia heterophylla.This work aimed to compare rates of glyphosate to desiccate Brachiaria decumbens, B. brizantha cv. Marandu and spontaneous plants (weeds, aiming to adopt the no-tillage system. A randomized block experimental design in a factorial scheme was used (3x3, with four replications. The factors consisted of three species of cover crops and three rates of glyphosate (1.44, 2.16 and 2.88 kg ha-1. At 7, 14, 21 and 28 days after application of the herbicide, visual evaluations of the percentage of cover crop control were carried out and at 45 days of the reinfestation percentage of the area. It was concluded that the spontaneous plants presented a good control at 1.44 kg ha-1, without, however, preventing Digitaria insularis sprouts. The same control rate starting at 2.16 kg ha-1 was observed for the Brachiaria species. The straw layer of these cover crops on the soil

  1. How glyphosate affects plant disease development: it is more than enhanced susceptibility.

    Science.gov (United States)

    Hammerschmidt, Ray

    2018-05-01

    Glyphosate has been shown to affect the development of plant disease in several ways. Plants utilize phenolic and other shikimic acid pathway-derived compounds as part of their defense against pathogens, and glyphosate inhibits the biosynthesis of these compounds via its mode of action. Several studies have shown a correlation between enhanced disease and suppression of phenolic compound production after glyphosate. Glyphosate-resistant crop plants have also been studied for changes in resistance as a result of carrying the glyphosate resistance trait. The evidence indicates that neither the resistance trait nor application of glyphosate to glyphosate-resistant plants increases susceptibility to disease. The only exceptions to this are cases where glyphosate has been shown to reduce rust diseases on glyphosate-resistant crops, supporting a fungicidal role for this chemical. Finally, glyphosate treatment of weeds or volunteer crops can cause a temporary increase in soil-borne pathogens that may result in disease development if crops are planted too soon after glyphosate application. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  2. High permeation rates in liposome systems explain rapid glyphosate biodegradation associated with strong isotope fractionation.

    Science.gov (United States)

    Ehrl, Benno; Mogusu, Emmanuel O; Kim, Kyoungtea; Hofstetter, Heike; Pedersen, Joel A; Elsner, Martin

    2018-05-23

    Bacterial uptake of charged organic pollutants such as the widely used herbicide glyphosate is typically attributed to active transporters, whereas passive membrane permeation as an uptake pathway is usually neglected. For 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) liposomes, pH-dependent membrane permeation coefficients (Papp) of glyphosate, determined by nuclear magnetic resonance (NMR) spectroscopy, varied from Papp(pH 7.0) = 3.7 (+/-0.3) × 10-7 m∙s-1 to Papp(pH 4.1) = 4.2 (+/-0.1) × 10-6 m∙s-1. This surprisingly rapid membrane permeation depended on glyphosate speciation and was, at physiological pH, in the range of polar, non-charged molecules suggesting that passive membrane permeation is a potential uptake pathway during glyphosate biodegradation. To test this hypothesis, a Gram-negative glyphosate degrader, Ochrobactrum sp. FrEM, was isolated from glyphosate-treated soil and glyphosate permeation rates inferred from the liposome model were compared to bacterial degradation rates. Estimated maximum permeation rates were, indeed, two orders of magnitudes higher than glyphosate degradation rates. Moreover, biodegradation of millimolar glyphosate concentrations gave rise to pronounced carbon isotope fractionation with an apparent kinetic isotope effect of AKIEcarbon= 1.014 ± 0.003. This value is consistent with unmasked enzymatic isotope fractionation demonstrating that glyphosate biodegradation was little mass transfer-limited and glyphosate exchange across the cell membrane was rapid relative to enzymatic turnover.

  3. Acute toxicity and sublethal effects of the mixture glyphosate (Roundup® Active and Cosmo-Flux®411F to anuran embryos and tadpoles of four Colombian species

    Directory of Open Access Journals (Sweden)

    Liliana Marcela Henao Muñoz

    2015-03-01

    Full Text Available Glyphosate is the most widely used herbicide in the world with application in agriculture, forestry, industrial weed control, garden and aquatic environments. However, its use is highly controversial for the possible impact on not-target organisms, such as amphibians, which are vanishing at an alarming and rapid rate. Due to the high solubility in water and ionic nature, the glyphosate requires of surfactants to increase activity. In addition, for the control of coca (Erythroxylum coca and agricultural weeds in Colombia, formulated glyphosate is mixed and sprayed with the adjuvant Cosmo-Flux®411F to increase the penetration and activity of the herbicide. This study evaluates the acute toxic and sublethal effects (embryonic development, tadpole body size, tadpole swimming performance of the mixture of the formulated glyphosate Roundup® Active and Cosmo-Flux®411F to anuran embryos and tadpoles of four Colombian species under 96h laboratory standard tests and microcosms, which are more similar to field conditions as they include soil, sand and macrophytes. In the laboratory, embryos and tadpoles of Engystomops pustulosus were the most tolerant (LC50=3 904µg a.e./L; LC50=2 799µg a.e./L, respectively, while embryos and tadpoles of Hypsiboas crepitans (LC50=2 203µg a.e./L; LC50=1 424µg a.e./L, respectively were the most sensitive. R. humboldti and R. marina presented an intermediate toxicity. Embryos were significantly more tolerant to the mixture than tadpoles, which could be likely attributed to the exclusion of chemicals by the embryonic membranes and the lack of organs, such as gills, which are sensitive to surfactants. Sublethal effects were observed for the tadpole body size, but not for the embryonic development and tadpole swimming performance. In microcosms, no toxicity (LC50 could not be estimated, or sublethal responses were observed at concentrations up to fourfold (14.76kg glyphosate a.e./ha the highest field application rate of 3

  4. Glyphosate Use and Cancer Incidence in the Agricultural Health Study.

    Science.gov (United States)

    Andreotti, Gabriella; Koutros, Stella; Hofmann, Jonathan N; Sandler, Dale P; Lubin, Jay H; Lynch, Charles F; Lerro, Catherine C; De Roos, Anneclaire J; Parks, Christine G; Alavanja, Michael C; Silverman, Debra T; Beane Freeman, Laura E

    2018-05-01

    Glyphosate is the most commonly used herbicide worldwide, with both residential and agricultural uses. In 2015, the International Agency for Research on Cancer classified glyphosate as "probably carcinogenic to humans," noting strong mechanistic evidence and positive associations for non-Hodgkin lymphoma (NHL) in some epidemiologic studies. A previous evaluation in the Agricultural Health Study (AHS) with follow-up through 2001 found no statistically significant associations with glyphosate use and cancer at any site. The AHS is a prospective cohort of licensed pesticide applicators from North Carolina and Iowa. Here, we updated the previous evaluation of glyphosate with cancer incidence from registry linkages through 2012 (North Carolina)/2013 (Iowa). Lifetime days and intensity-weighted lifetime days of glyphosate use were based on self-reported information from enrollment (1993-1997) and follow-up questionnaires (1999-2005). We estimated incidence rate ratios (RRs) and 95% confidence intervals (CIs) using Poisson regression, controlling for potential confounders, including use of other pesticides. All statistical tests were two-sided. Among 54 251 applicators, 44 932 (82.8%) used glyphosate, including 5779 incident cancer cases (79.3% of all cases). In unlagged analyses, glyphosate was not statistically significantly associated with cancer at any site. However, among applicators in the highest exposure quartile, there was an increased risk of acute myeloid leukemia (AML) compared with never users (RR = 2.44, 95% CI = 0.94 to 6.32, Ptrend = .11), though this association was not statistically significant. Results for AML were similar with a five-year (RRQuartile 4 = 2.32, 95% CI = 0.98 to 5.51, Ptrend = .07) and 20-year exposure lag (RRTertile 3 = 2.04, 95% CI = 1.05 to 3.97, Ptrend = .04). In this large, prospective cohort study, no association was apparent between glyphosate and any solid tumors or lymphoid malignancies overall, including NHL and

  5. Intermolecular interaction studies of glyphosate with water

    Science.gov (United States)

    Manon, Priti; Juglan, K. C.; Kaur, Kirandeep; Sethi, Nidhi; Kaur, J. P.

    2017-07-01

    The density (ρ), viscosity (η) and ultrasonic velocity (U) of glyphosate with water have been measured on different ultrasonic frequency ranges from 1MHz, 2MHz, 3MHz & 5MHz by varying concentrations (0.05%, 0.10%, 0.15%, 0.20%, 0.25%, 0.30%, 0.35%, & 0.40%) at 30°C. The specific gravity bottle, Ostwald's viscometer and quartz crystal interferometer were used to determine density (ρ), viscosity (η) and ultrasonic velocity (U). These three factors contribute in evaluating the other parameters as acoustic impedance (Z), adiabatic compressibility (β), relaxation time (τ), intermolecular free length (Lf), free volume (Vf), ultrasonic attenuation (α/f2), Rao's constant (R), Wada's constant (W) and relative strength (R). Solute-solvent interaction is confirmed by ultrasonic velocity and viscosity values, which increases with increase in concentration indicates stronger association between solute and solvent molecules. With rise in ultrasonic frequency the interaction between the solute and solvent particles decreases. The linear variations in Rao's constant and Wada's constant suggest the absence of complex formation.

  6. Photodegradation of glyphosate in the ferrioxalate system

    Energy Technology Data Exchange (ETDEWEB)

    Chen Yong [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China); Wu Feng [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China)], E-mail: fengwu@whu.edu.cn; Lin Yixin; Deng Nansheng [School of Resources and Environmental Science, Wuhan University, Wuhan 430079 (China); Bazhin, Nikolai; Glebov, Evgeni [Institute of Chemical Kinetics and Combustion, 3 Institutskaya St., Novosibirsk 630090 (Russian Federation)

    2007-09-05

    The photoinduced degradation of glyphosate (GLP) in the ferrioxalate system was investigated under irradiation with a 250 W metal halide lamp ({lambda} {>=} 365 nm). The efficiency of orthophosphates release, representing the photodegradation efficiency of GLP, increased with decreasing the initial concentrations of GLP and Fe(III)/oxalate ratios. At acidic pH value in the range of 3.5-5.0, higher efficiency of orthophosphates release up to 60.6% was achieved, while the efficiency dropped to 42.1% at pH 6.0. The photochemical process mainly involved the predominant species of iron(III), namely Fe(C{sub 2}O{sub 4}){sub 2}{sup -} and Fe(C{sub 2}O{sub 4}){sub 3}{sup 3-}, which lead to the formation of hydroxyl radicals in the presence of dissolved oxygen under UV-vis irradiation. Also, the complexation of GLP with Fe(III) obviously increased the light absorption of GLP and facilitated its degradation by direct photolysis. The ninhydrin test for primary amines showed that the GLP was attacked by hydroxyl radicals with C-N cleavage to yield aminomethylphosphonic acid (AMPA) and C-P cleavage to yield sarcosine. The photodegradation may be enhanced by the decomposition of reactive radicals produced through ligand-to-metal charge transfer (LMCT) of ferric-GLP complexes.

  7. Gene expression profiling of the green seed problem in Soybean.

    Science.gov (United States)

    Teixeira, Renake N; Ligterink, Wilco; França-Neto, José de B; Hilhorst, Henk W M; da Silva, Edvaldo A A

    2016-02-01

    Due to the climate change of the past few decades, some agricultural areas in the world are now experiencing new climatic extremes. For soybean, high temperatures and drought stress can potentially lead to the "green seed problem", which is characterized by chlorophyll retention in mature seeds and is associated with lower oil and seed quality, thus negatively impacting the production of soybean seeds. Here we show that heat and drought stress result in a "mild" stay-green phenotype and impaired expression of the STAY-GREEN 1 and STAY-GREEN 2 (D1, D2), PHEOPHORBIDASE 2 (PPH2) and NON-YELLOW COLORING 1 (NYC1_1) genes in soybean seeds of a susceptible soybean cultivar. We suggest that the higher expression of these genes in fully mature seeds of a tolerant cultivar allows these seeds to cope with stressful conditions and complete chlorophyll degradation. The gene expression results obtained in this study represent a significant advance in understanding chlorophyll retention in mature soybean seeds produced under stressful conditions. This will open new research possibilities towards finding molecular markers for breeding programs to produce cultivars which are less susceptible to chlorophyll retention under the hot and dry climate conditions which are increasingly common in the largest soybean production areas of the world.

  8. Flora and Fauna in Roundup Tolerant Fodder Beet Fields

    DEFF Research Database (Denmark)

    Elmegaard, N.; Pedersen, Marianne Bruus

    English and Danish summary. Foreword: For demonstration purposes Monsanto, DLF-Trifolium, and Danisco Seed, in collaboration with The Danish Agricultural Advisory Centre, established field plots with glyphosate tolerant fodder beets on a number of farms all over Denmark in 1999 and 2000. The Nati......English and Danish summary. Foreword: For demonstration purposes Monsanto, DLF-Trifolium, and Danisco Seed, in collaboration with The Danish Agricultural Advisory Centre, established field plots with glyphosate tolerant fodder beets on a number of farms all over Denmark in 1999 and 2000...... tilfælde øges ved at reducere doseringen, uden at det går ud over roeudbyttet. Sprøjtning med insekticid forringer imidlertid vilkårene for faunaen og kan derved ophæve de fordele, der kan være ved dyrkning af RR-roer. Udenlandske undersøgelser tyder dog på, at der er mindre behov...

  9. Facilitated transport of diuron and glyphosate in high copper vineyard soils.

    Science.gov (United States)

    Dousset, Sylvie; Jacobson, Astrid R; Dessogne, Jean-Baptiste; Guichard, Nathalie; Baveye, Philippe C; Andreux, Francis

    2007-12-01

    The fate of organic herbicides applied to agricultural fields may be affected by other soil amendments, such as copper applied as a fungicide. The effect of copper on the leaching of diuron and glyphosate through a granitic and a calcareous soil was studied in the laboratory using sieved-soil columns. Each soil was enriched with copper sulfate to obtain soil copper concentrations of 125, 250, 500, and 1000 mg kg(-1). Glyphosate leaching was influenced by soil pH and copper concentration, whereas diuron leaching was not. In the calcareous soil, glyphosate leaching decreased as copper levels increased from 17 mg kg(-1) (background) to 500 mg kg(-1). In the granitic soil, glyphosate leaching increased as copper levels increased from 34 mg kg(-1) (background) to 500 mg kg(-1). The shapes of the copper elution curves in presence of glyphosate were similar to shapes of the glyphosate curves, suggesting the formation of Cu-glyphosate complexes that leach through the soil. Soil copper concentration does not influence diuron leaching. In contrast, increasing copper concentrations reduces glyphosate leaching through calcareous soils, and conversely, increases glyphosate leaching through granitic soils. Our findings suggest that the risk of groundwater contamination by glyphosate increases in granitic soils with elevated copper concentrations.

  10. Sorption and desorption of glyphosate in Mollisols and Ultisols soils of Argentina.

    Science.gov (United States)

    Gómez Ortiz, Ana Maria; Okada, Elena; Bedmar, Francisco; Costa, José Luis

    2017-10-01

    In Argentina, glyphosate use has increased exponentially in recent years as a result of the widespread adoption of no-till management combined with genetically modified glyphosate-resistant crops. This massive use of glyphosate has created concern about its potential environmental impact. Sorption-desorption of glyphosate was studied in 3 Argentinean soils with contrasting characteristics. Glyphosate sorption isotherms were modeled using the Freundlich equation to estimate the sorption coefficient (K f ). Glyphosate sorption was high, and the K f varied from 115.6 to 1612 mg 1-1/n L 1/n /kg. Cerro Azul soil had the highest glyphosate sorption capacity as a result of a combination of factors such as higher clay content, cation exchange capacity, total iron, and aluminum oxides, and lower available phosphorus and pH. Desorption isotherms were also modeled using the Freundlich equation. In general, desorption was very low (glyphosate strongly sorbs to the soils and that it is almost an irreversible process. Anguil soil had a significantly higher desorption coefficient (K fd ) than the other soils, associated with its lower clay content and higher pH and phosphorus. Glyphosate high sorption and low desorption to the studied soils may prevent groundwater contamination. However, it may also affect its bioavailability, increasing its persistence and favoring its accumulation in the environment. The results of the present study contribute to the knowledge and characterization of glyphosate retention in different soils. Environ Toxicol Chem 2017;36:2587-2592. © 2017 SETAC. © 2017 SETAC.

  11. Interactions of glyphosate use with farm characteristics and cropping patterns in Central Europe.

    Science.gov (United States)

    Wiese, Armin; Schulte, Michael; Theuvsen, Ludwig; Steinmann, Horst-Henning

    2018-05-01

    Although glyphosate is the most widely used herbicide in the European Union, little is known about the patterns of its usage in arable farming. Therefore, a nationwide survey of 2026 German farmers was analysed to obtain further knowledge about glyphosate applications in conventional European arable farming. Given its broad range of agri-environmental and farm-type conditions, Germany can be regarded as a suitable study region to represent Central European farming. The growing season 2013/2014 was set as a reference. Farmers who participated in the survey employ diverse patterns of glyphosate use. While 23% stated that they did not use glyphosate in the season in question, others applied glyphosate to their total arable area. However, most applications occurred on specific parts of the farm. Application patterns of oilseed rape, winter wheat, maize and sugar beet were studied in detail, and U-shaped distributions of glyphosate use intensity were observed. The effects of farm type and management practices on glyphosate use patterns were mixed in the various crops. Motivation for glyphosate use differs widely within the farming community. Agricultural researchers, extension services and policy makers are recommended to mitigate vulnerabilities associated with glyphosate use, such as routine spraying and practices that increase selection pressure for the evolution of glyphosate-resistant weeds. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  13. PVP capped silver nanocubes assisted removal of glyphosate from water-A photoluminescence study.

    Science.gov (United States)

    Sarkar, Sumit; Das, Ratan

    2017-10-05

    Glyphosate [N-phosphono-methylglycine (PMG)] is the most used herbicide worldwide and it has been reported very recently that Glyphosate is very harmful and can produce lots of diseases such as alzheimer and parkinson's disease, depression, cancer, infertility including genotoxic effects. As it is mostly present in stable water body and ground water system, its detection and removal is very important. Here, we have shown a fluorescence technique for the removal of glyphosate from water using chemically synthesized polyvinylpyrrolidone (PVP) silver nanocrystals. Transmission Electron Microscopy (TEM) study shows the average size of silver nanocrystals of 100nm approximately with a morphology of cubic shape. Glyphosate does not show absorption in the visible region. But both glyphosate and silver nanocrystals show strong fluorescence in the visible region. So, photoluminescence study has been successfully utilized to detect the glyphosate in water samples and on treating the glyphosate contaminated water sample with silver nanocrystals, the sample shows no emission peak of glyphosate at 458nm. Thus, this approach is a promising and very rapid method for the detection and removal of glyphosate from water samples on treatment with silver nanocubes. NMR spectra further confirms that the silver nanocrystals treated contaminated water samples are glyphosate free. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. PsMPK7, a stress-associated mitogen-activated protein kinase (MAPK) in Phytophthora sojae, is required for stress tolerance, reactive oxygenated species detoxification, cyst germination, sexual reproduction and infection of soybean.

    Science.gov (United States)

    Gao, Jian; Cao, Mingna; Ye, Wenwu; Li, Haiyang; Kong, Liang; Zheng, Xiaobo; Wang, Yuanchao

    2015-01-01

    The sensing of stress signals and their transduction into appropriate responses are crucial for the adaptation, survival and infection of phytopathogenic fungi and oomycetes. Amongst evolutionarily conserved pathways, mitogen-activated protein kinase (MAPK) cascades function as key signal transducers that use phosphorylation to convey information. In this study, we identified a gene, designated PsMPK7, one of 14 predicted genes encoding MAPKs in Phytophthora sojae. PsMPK7 was highly transcribed in each tested stage, but was up-regulated in the zoospore, cyst and cyst germination stages. Silencing of PsMPK7 affected the growth of germinated cysts, oospore production and the pathogenicity of soybean. PsMPK7 transcription was induced by stresses from sorbitol, NaCl and hydrogen peroxide. Transformants in which PsMPK7 expression was silenced (PsMPK7-silenced) were significantly more sensitive to osmotic and oxidative stress. Aniline blue and diaminobenzidine staining revealed that the silenced lines did not suppress the host reactive oxygen species (ROS) burst, indicating that either the inoculated plants activated stronger defence responses to the transformants and/or the PsMPK7-silenced transformants failed to overcome plant defences. In addition, extracellular secretion of laccase decreased in the silenced lines. Overall, our results indicate that the PsMPK7 gene encodes a stress-associated MAPK in P. sojae that is important not only for responses to various stresses, but also for ROS detoxification, cyst germination, sexual oospore production and infection of soybean. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  15. Toxicity assessment of glyphosate on honey bee (Apis mellifera) spermatozoa

    Science.gov (United States)

    During 2016-2017, 33.2% of managed honey bee colonies in the U.S. were lost due to Colony Collapse Disorder (CCD). Commonly used pesticides are among the suspected reasons for bee mortality. N-(phosphonomethyl)glycine (glyphosate) is a widely used herbicide in the U.S. and has previously been shown ...

  16. Glyphosate resistant weeds - a threat to conservation agriculture

    Science.gov (United States)

    Glyphosate-resistant weeds are now present throughout the Southeast. Hundreds of thousands of conservation tillage cotton acres, some currently under USDA Natural Resources Conservation Service (NRCS) conservation program contracts, are at risk of being converted to higher-intensity tillage systems....

  17. Mycostimulation in a glyphosate treated arable soil: implications on ...

    African Journals Online (AJOL)

    Mycostimulation in a glyphosate treated arable soil: implications on the yield and agronomic characters of Talinum fruticosum (L.) Juss. ... If properly managed and stimulated, fungi can contribute significantly to improving soil health, thus improving food security in a sustainable manner. Keywords: Mycoaugmentation ...

  18. Effects of glyphosate acid and the glyphosate-commercial formulation (Roundup) on Dimorphandra wilsonii seed germination: Interference of seed respiratory metabolism.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; da Silva Cruz, Fernanda Vieira; Bicalho, Elisa Monteze; Borges, Felipe Viègas; Fonseca, Marcia Bacelar; Juneau, Philippe; Garcia, Queila Souza

    2017-01-01

    Glyphosate-formulations are widely used in the Brazilian Cerrado (neotropical savanna) with little or no control, threatening population of the endangered species Dimorphandra wilsonii. We investigated the toxicity of different concentrations (0, 5, 25 and 50 mg l -1 ) of glyphosate acid and one of its formulations (Roundup ® ) on seed germination in D. wilsonii. Glyphosate acid and Roundup drastically decreased seed germination by decreasing seed respiration rates. The activation of antioxidant enzymes, ascorbate peroxidase and catalase assure no hydrogen peroxide accumulation in exposed seeds. Glyphosate acid and the Roundup-formulation negatively affected the activities of enzymes associated with the mitochondrial electron transport chain (ETC), with Complex III as its precise target. The toxicity of Roundup-formulation was greater than that of glyphosate acid due to its greater effects on respiration. The herbicide glyphosate must impair D. wilsonii seed germination by disrupting the mitochondrial ETC, resulting in decreased energy (ATP) production. Our results therefore indicate the importance of avoiding (or closely regulating) the use of glyphosate-based herbicides in natural Cerrado habitats of D. wilsonni as they are toxic to seed germination and therefore threaten conservation efforts. It will likewise be important to investigate the effects of glyphosate on the seeds of other species and to investigate the impacts of these pesticides elsewhere in the world. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Civility in scientific publishing: The glyphosate paper.

    Science.gov (United States)

    Blaylock, Russell Lane

    2015-01-01

    In recent years, we have witnessed a decline in civility in the public arena when various socially sensitive issues are being presented. Those of us engaged in the publishing of scientific papers and in our comments on these papers, need to be cognizant of the social graces, courteous demeanor, and chivalry. Debates are essential to our learning and in being able to ferret out the essentials of various scientific issues that are of value. Because of the amount of time and effort connected with analyzing the complex problems and the years invested in such endeavors, we often resort to the behavior, that is, contentious and at times even quite insulting to our opponents during our defense. This is the part of human nature but as civilized human beings, we must strive to maintain the courtesy and a calm demeanor during such discussions and debates. I have yielded to such temptations myself but am striving to repent of my sins. The medical and scientific history should have taught us that in defending our ideas we learn and sometimes come to the realization that our paradigm or hypothesis is wrong, either in part or whole. Such debates allow us to fine tune our ideas and correct our errors in thinking, which are easily, consciously, or subconsciously sublimated by our enthusiasm. The glyphosate papers presented ideas that, while well supported by the scientific studies and logical conclusions, also contained some possible errors in its suppositions. Dr. Miguel Faria challenged some of these concepts and was met with some degree of derision by one of the authors. This editorial comment is in response to these issues.

  20. Glyphosate, other herbicides, and transformation products in Midwestern streams, 2002

    Science.gov (United States)

    Battaglin, W.A.; Kolpin, D.W.; Scribner, E.A.; Kuivila, K.M.; Sandstrom, M.W.

    2005-01-01

    The use of glyphosate has increased rapidly, and there is limited understanding of its environmental fate. The objective of this study was to document the occurrence of glyphosate and the transformation product aminomethylphosphonic acid (AMPA) in Midwestern streams and to compare their occurrence with that of more commonly measured herbicides such as acetochlor, atrazine, and metolachlor. Water samples were collected at sites on 51 streams in nine Midwestern states in 2002 during three runoff events: after the application of pre-emergence herbicides, after the application of post-emergence herbicides, and during harvest season. All samples were analyzed for glyphosate and 20 other herbicides using gas chromatography/mass spectrometry or high performance liquid chromatography/mass spectrometry. The frequency of glyphosate and AMPA detection, range of concentrations in runoff samples, and ratios of AMPA to glyphosate concentrations did not vary throughout the growing season as substantially as for other herbicides like atrazine, probably because of different seasonal use patterns. Glyphosate was detected at or above 0.1 μg/1 in 35 percent of pre-emergence, 40 percent of post-emergence, and 31 percent of harvest season samples, with a maximum concentration of 8.7 μg/1. AMPA was detected at or above 0.1 μg/1 in 53 percent of pre-emergence, 83 percent of post-emergence, and 73 percent of harvest season samples, with a maximum concentration of 3.6 μg/1. Glyphosate was not detected at a concentration at or above the U.S. Environmental Protection Agency's maximum contamination level (MCL) of 700 μg/1 in any sample. Atrazine was detected at or above 0.1 μg/1 in 94 percent of pre-emergence, 96 percent of post-emergence, and 57 percent of harvest season samples, with a maximum concentration of 55 μg/1. Atrazine was detected at or above its MCL (3 μg/1) in 57 percent of pre-emergence and 33 percent of post-emergence samples

  1. Glyphosate in the general population and in applicators: a critical review of studies on exposures.

    Science.gov (United States)

    Solomon, Keith R

    2016-09-01

    The recent classification of glyphosate as a probable human carcinogen by the International Agency for Research on Cancer (IARC) was arrived at without a detailed assessment of exposure. Glyphosate is widely used as an herbicide, which might result in exposures of the general public and applicators. Exposures were estimated from information in the open literature and unpublished reports provided by Monsanto Company. Based on the maximum measured concentration in air, an exposure dose of 1.04 × 10  -   6  mg/kg body mass (b.m.)/d was estimated. Assuming consumption of surface water without treatment, the 90th centile measured concentration would result in a consumed dose of 2.25 × 10  -   5  mg/kg b.m./d. Estimates by the Food and Agriculture Organization of the United Nations (FAO) of consumed doses in food provided a median exposure of 0.005 mg/kg b.m./d (range 0.002-0.013). Based on tolerance levels, the conservative estimate by the US Environmental Protection Agency (US EPA) for exposure of the general population via food and water was 0.088 mg/kg b.m./d (range 0.058-0.23). For applicators, 90th centiles for systemic exposures based on biomonitoring and dosimetry (normalized for penetration through the skin) were 0.0014 and 0.021 mg/kg b.m./d, respectively. All of these exposures are less than the reference dose and the acceptable daily intakes proposed by several regulatory agencies, thus supporting a conclusion that even for these highly exposed populations the exposures were within regulatory limits.

  2. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    Directory of Open Access Journals (Sweden)

    Prata Fábio

    2003-01-01

    Full Text Available The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with KH2PO4 at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha-1 of P2O5, which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L-1, with a 14C radioactivity of 0.233 kBq mL-1. Four steps of the desorption procedure with CaCl2 0.01 mol L-1 and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L-1. Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm-3. Moreover, a small amount of applied glyphosate was extracted (<10%, and the extraction increased with increasing soil phosphorus content.

  3. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    International Nuclear Information System (INIS)

    Prata, Fabio; Cardinali, Vanessa Camponez do Brasil; Tornisielo, Valdemar Luiz; Regitano, Jussara Borges; Lavorenti, Arquimedes

    2003-01-01

    The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with Kh 2 PO 4 at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha -1 of P 2 O 5 , which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L -1 ), with a 14 C radioactivity of 0.233 kBq mL -1 . Four steps of the desorption procedures withCaCl 2 0.01 mol L -1 and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L -1 ). Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm -3 . Moreover, a small amount of applied glyphosate was extracted (<10%), and the extraction increased with increasing soil phosphorus content. (author)

  4. Glyphosate sorption and desorption in soils with distinct phosphorus levels

    Energy Technology Data Exchange (ETDEWEB)

    Prata, Fabio [BIOAGRI Labs., Piracicaba, SP (Brazil). Div. de Quimica. Lab. de Radioquimica; Cardinali, Vanessa Camponez do Brasil; Tornisielo, Valdemar Luiz; Regitano, Jussara Borges [Sao Paulo Univ., Piracicaba, SP (Brazil). Escola Superior de Agricultura Luiz de Queiroz. Dept. de Ciencias Exatas; Lavorenti, Arquimedes [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil). Secao de Toxicologia

    2003-03-01

    The sorption of glyphosate by soils occurs due to the inner sphere complex formation with metals of soil oxides, which are related to the soil phosphate adsorption capacity. The aim of this study was to evaluate the effects of increasing rates of phosphorus on sorption and desorption of glyphosate in three soils with different mineralogical attributes. Soils were a Rhodic Kandiudalf, an Anionic Acrudox and a Typic Humaquept. Soil samples were amended with Kh{sub 2}PO{sub 4} at equivalent rates of 0; 1,000; 5,000; 20,000 and 50,000 kg ha{sup -1} of P{sub 2}O{sub 5}, which are high from the agricultural point of view, but necessary in order to perform sorption and desorption studies. The experimental design consisted of a completely randomized factorial: 2 soils x 5 phosphorus rates and 3 replicates. For the sorption experiments, five glyphosate solutions were employed (0.42; 0.84; 1.68; 3.36 and 6.72 mg L{sup -1}), with a {sup 14}C radioactivity of 0.233 kBq mL{sup -1}. Four steps of the desorption procedures withCaCl{sub 2} 0.01 mol L{sup -1} and one extraction with Mehlich 3 were performed only at one concentration (0.84 mol L{sup -1}). Soil samples were afterwards biologically oxidized to establish the radioactive balance. Glyphosate competes with phosphorus for specific sorption sites, but this competition becomes important when phosphorus is present at rates higher than 1,000 mg dm{sup -3}. Moreover, a small amount of applied glyphosate was extracted (<10%), and the extraction increased with increasing soil phosphorus content. (author)

  5. Germination test as a fast method to detect glyphosate-resistant sourgrass

    Directory of Open Access Journals (Sweden)

    Marcos Altomani Neves Dias

    2015-01-01

    Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

  6. Germination test as a fast method to detect glyphosate-resistant sourgrass

    Directory of Open Access Journals (Sweden)

    Marcos Altomani Neves Dias

    2015-09-01

    Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

  7. REVIEW - Advances on molecular studies of the interaction soybean - Asian rust

    Directory of Open Access Journals (Sweden)

    Aguida Maria Alves Pereira Morales

    2012-01-01

    Full Text Available Effective management practices are essential for controlling rust outbreaks. The main control methodused is the application of fungicides, which increases substantially the cost of production and is harmful to theenvironment. Prevention is still the best way to avoid more significant losses in soybean yields. Alternatives,such as planting resistant varieties to the fungus, are also important. The use of resistant or tolerant varietiesis the most promising method for controlling Asian soybean rust. Recently, five dominant genes resistant to soybean rust were described: Rpp1, Rpp2, Rpp3, Rpp4 and Rpp5. However, little is known about the molecular interaction among soybean plant and soybean rust and on the molecular pathway triggered by pathogen recognition. Understanding the molecular mechanisms involved in defense responses is of primary importance for planning strategies to control stress and, consequently, to increase plant adaptation to limiting conditions

  8. Phytotoxicity of glyphosate in the germination of Pisum sativum and its effect on germinated seedlings

    OpenAIRE

    Mondal, Subinoy; Kumar, Mousumi; Haque, Smaranya; Kundu, Debajyoti

    2017-01-01

    The present study evaluated the effects of glyphosate on Pisum sativum germination as well as its effect on the physiology and biochemistry of germinated seedlings. Different physico-chemical biomarkers, viz., chlorophyll, root and shoot length, total protein and soluble sugar, along with sodium and potassium concentration, were investigated in germinated seedlings at different glyphosate concentrations. This study reports the influence of different concentrations of glyphosate on pea seeds a...

  9. Effects of Formulated Glyphosate and Adjuvant Tank Mixes on Atomization from Aerial Application Flat Fan Nozzles

    Science.gov (United States)

    2012-01-01

    Bradley K. Fritz,1 W. Clint Hoffmann,1 and W. E. Bagley2 Effects of Formulated Glyphosate and Adjuvant Tank Mixes on Atomization from Aerial...Application Flat Fan Nozzles REFERENCE: Fritz, Bradley K., Hoffmann, W. Clint, and Bagley, W. E., “Effects of Formulated Glyphosate and Adjuvant Tank Mixes on...factors. Twelve spray-solution treatments were evaluated, ten of which contained a formulated glyphosate product and nine of these con- tained an

  10. Degradation of the Herbicide Glyphosate by Members of the Family Rhizobiaceae

    OpenAIRE

    Liu, C.-M.; McLean, P. A.; Sookdeo, C. C.; Cannon, F. C.

    1991-01-01

    Several strains of the family Rhizobiaceae were tested for their ability to degrade the phosphonate herbicide glyphosate (isopropylamine salt of N-phosphonomethylglycine). All organisms tested (seven Rhizobium meliloti strains, Rhizobium leguminosarum, Rhizobium galega, Rhizobium trifolii, Agrobacterium rhizogenes, and Agrobacterium tumefaciens) were able to grow on glyphosate as the sole source of phosphorus in the presence of the aromatic amino acids, although growth on glyphosate was not a...

  11. Glyphosate Shapes a Dinoflagellate-Associated Bacterial Community While Supporting Algal Growth as Sole Phosphorus Source

    Directory of Open Access Journals (Sweden)

    Cong Wang

    2017-12-01

    Full Text Available Glyphosate is a widely used herbicide that can potentially be a phosphorus (P source for phytoplankton and microbes when discharged into the coastal ocean. In contrast to bacteria, few eukaryotic phytoplankton species appear capable of directly utilizing glyphosate. In this study, we observed, after a long delay (>60 days, Prorocentrum donghaiense, a dinoflagellate known to cause major harmful algal blooms in the East China Sea, could grow in a medium with glyphosate as the sole P source; suggesting that P. donghaiense growth was through bacterial mediation. To understand how the bacteria community might respond to glyphosate, we analyzed the 16S rRNA genes of the microbial community present in P. donghaiense cultures when grown under lower (36 μM and higher (360 μM glyphosate concentrations. Based on both Sanger and Illumina high throughput sequencing, we obtained more than 55,323 good-quality sequences, which were classified into six phyla. As the concentration of glyphosate rose, our results showed a significant increase in the phyla Proteobacteria and Firmicutes and a decrease in the phylum Bacteroidetes. Further qPCR (Quantitative PCR analysis showed higher abundances of two specific phylotypes in the higher-glyphosate P. donghaiense cultures when compared to the lower-glyphosate and no-glyphosate cultures. Correspondingly, qPCR displayed the same trend for the abundance of a gammaproteobacterial type of phnJ, a gene encoding Alpha-D-ribose 1-methylphosphonate 5-phosphate C-P lyase, which is responsible for phosphonate degradation. In addition, Tax4Fun analysis based on our 16S rRNA gene sequences results in higher predicted abundances of phosphonate metabolizing genes in glyphosate-treated cultures. This study demonstrates that glyphosate could selectively promote the growth of particular groups of bacteria within an algal culture and in glyphosate enriched coastal waters, this interaction may potentially further facilitate the growth of

  12. Cancer Incidence among Glyphosate-Exposed Pesticide Applicators in the Agricultural Health Study

    OpenAIRE

    De Roos, Anneclaire J.; Blair, Aaron; Rusiecki, Jennifer A.; Hoppin, Jane A.; Svec, Megan; Dosemeci, Mustafa; Sandler, Dale P.; Alavanja, Michael C.

    2004-01-01

    Glyphosate is a broad-spectrum herbicide that is one of the most frequently applied pesticides in the world. Although there has been little consistent evidence of genotoxicity or carcinogenicity from in vitro and animal studies, a few epidemiologic reports have indicated potential health effects of glyphosate. We evaluated associations between glyphosate exposure and cancer incidence in the Agricultural Health Study (AHS), a prospective cohort study of 57,311 licensed pesticide applicators in...

  13. Transgenic soybeans and soybean protein analysis: an overview.

    Science.gov (United States)

    Natarajan, Savithiry; Luthria, Devanand; Bae, Hanhong; Lakshman, Dilip; Mitra, Amitava

    2013-12-04

    To meet the increasing global demand for soybeans for food and feed consumption, new high-yield varieties with improved quality traits are needed. To ensure the safety of the crop, it is important to determine the variation in seed proteins along with unintended changes that may occur in the crop as a result various stress stimuli, breeding, and genetic modification. Understanding the variation of seed proteins in the wild and cultivated soybean cultivars is useful for determining unintended protein expression in new varieties of soybeans. Proteomic technology is useful to analyze protein variation due to various stimuli. This short review discusses transgenic soybeans, different soybean proteins, and the approaches used for protein analysis. The characterization of soybean protein will be useful for researchers, nutrition professionals, and regulatory agencies dealing with soy-derived food products.

  14. EPSPS gene amplification conferring resistance to glyphosate in windmill grass (Chloris truncata) in Australia.

    Science.gov (United States)

    Ngo, The D; Malone, Jenna M; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

    2018-05-01

    Five glyphosate-resistant populations of Chloris truncata originally collected from New South Wales were compared with one susceptible (S) population from South Australia to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the amounts of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in five populations of C. truncata (A536, A528, T27, A534 and A535.1). GR plants were 2.4-8.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. There was no difference in glyphosate absorption and translocation between GR and S plants. The EPSPS gene did not contain any point mutation that had previously been associated with resistance to glyphosate. The resistant plants (A528 and A536) contained up to 32-48 more copies of the EPSPS gene than the susceptible plants. This study has identified EPSPS gene amplification contributing to glyphosate resistance in C. truncata. In addition, a Glu-91-Ala mutation within EPSPS was identified that may contribute to glyphosate resistance in this species. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. Glyphosate Utilization as the Source of Carbon: Isolation and Identification of new Bacteria

    Directory of Open Access Journals (Sweden)

    M. Mohsen Nourouzi

    2011-01-01

    Full Text Available Mixed bacteria from oil palm plantation soil (OPS were isolated to investigate their ability to utilize glyphosate as carbon source. Results showed that approximately all of the glyphosate was converted to aminomethyl-phosphonic acid (AMPA (99.5%. It is worthy to note that mixed bacteria were able to degrade only 2% of AMPA to further metabolites. Two bacterial strains i.e. Stenotrophomonas maltophilia and Providencia alcalifaciens were obtained from enrichment culture. Bacterial isolates were cultured individually on glyphosate as a sole carbon source. It was observed that both isolates were able to convert glyphosate to AMPA.

  16. Differential effects of glyphosate and aminomethylphosphonic acid (AMPA) on photosynthesis and chlorophyll metabolism in willow plants.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; Le Manac'h, Sarah Gingras; Maccario, Sophie; Labrecque, Michel; Lucotte, Marc; Juneau, Philippe

    2016-06-01

    We used a willow species (Salix miyabeana cultivar SX64) to examine the differential secondary-effects of glyphosate and aminomethylphosphonic acid (AMPA), the principal glyphosate by-product, on chlorophyll metabolism and photosynthesis. Willow plants were treated with different concentrations of glyphosate (equivalent to 0, 1.4, 2.1 and 2.8kgha(-1)) and AMPA (equivalent to 0, 0.28, 1.4 and 2.8kgha(-1)) and evaluations of pigment contents, chlorophyll fluorescence, and oxidative stress markers (hydrogen peroxide content and antioxidant enzyme activities) in leaves were performed after 12h of exposure. We observed that AMPA and glyphosate trigger different mechanisms leading to decreases in chlorophyll content and photosynthesis rates in willow plants. Both chemicals induced ROS accumulation in willow leaves although only glyphosate-induced oxidative damage through lipid peroxidation. By disturbing chlorophyll biosynthesis, AMPA induced decreases in chlorophyll contents, with consequent effects on photosynthesis. With glyphosate, ROS increases were higher than the ROS-sensitive threshold, provoking chlorophyll degradation (as seen by pheophytin accumulation) and invariable decreases in photosynthesis. Peroxide accumulation in both AMPA and glyphosate-treated plants was due to the inhibition of antioxidant enzyme activities. The different effects of glyphosate on chlorophyll contents and photosynthesis as described in the literature may be due to various glyphosate:AMPA ratios in those plants. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents

    OpenAIRE

    Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J. Christopher; Ugarte, Ricardo; Antoniou, Michael N.

    2017-01-01

    The safety, including endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBl...

  18. Glyphosate contaminated soil remediation by atmospheric pressure dielectric barrier discharge plasma and its residual toxicity evaluation.

    Science.gov (United States)

    Wang, Tiecheng; Ren, Jingyu; Qu, Guangzhou; Liang, Dongli; Hu, Shibin

    2016-12-15

    Glyphosate was one of the most widely used herbicides in the world. Remediation of glyphosate-contaminated soil was conducted using atmospheric pressure dielectric barrier discharge (DBD) plasma. The feasibility of glyphosate degradation in soil was explored, and the soil leachate toxicity after remediation was assessed via a seed germination test. The experimental results showed that approximately 93.9% of glyphosate was degraded within 45min of DBD plasma treatment with an energy yield of 0.47gkWh -1 , and the degradation process fitted the first-order kinetic model. Increasing the discharge voltage and decreasing the organic matter content of the soil were both found to facilitate glyphosate degradation. There existed appropriate soil moisture to realize high glyphosate degradation efficiency. Glyphosate mineralization was confirmed by changes of total organic carbon (TOC), chemical oxygen demand (COD), PO 4 3- and NO 3 - . The degradation intermediates including glycine, aminomethylphosphonic acid, acetic acid, formic acid, PO 4 3- and NO 3 - , CO 2 and CO were observed. A possible pathway for glyphosate degradation in the soil using this system was proposed. Based on the soil leachate toxicity test using wheat seed germination, the soil did not exhibit any hazardous effects following high-efficiency glyphosate degradation. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Kommentarer til opdateret risikovurdering og ansøgning. Gossypium hirsutum (281-24-236/3006-210-23), Insect resistance by Bt-toxin (lepidoptera) X Insect resistance by Bt-toxin (coleoptera); herbicide tolerance to glyphosate. Modtaget 03-04-2006, deadline 02-05-2006, svar 07-04-2006

    DEFF Research Database (Denmark)

    Kjellsson, Gøsta; Strandberg, Morten Tune; Christensen, Christian Dam

    2006-01-01

    tolerante over for insektangreb fra larver af forskellige sommerfuglearter. Desuden indeholder bomulden et gen, der gør den tolerant overfor glufosinat-ammonium herbicider. Bomulden søges kun godkendt til import af frø samt forarbejdning og anvendelse til dyrefoder og fødevarer, men ikke til dyrkning eller...

  20. Simulating changes in cropping practices in conventional and glyphosate-resistant maize. II. Weed impacts on crop production and biodiversity.

    Science.gov (United States)

    Colbach, Nathalie; Darmency, Henri; Fernier, Alice; Granger, Sylvie; Le Corre, Valérie; Messéan, Antoine

    2017-05-01

    Overreliance on the same herbicide mode of action leads to the spread of resistant weeds, which cancels the advantages of herbicide-tolerant (HT) crops. Here, the objective was to quantify, with simulations, the impact of glyphosate-resistant (GR) weeds on crop production and weed-related wild biodiversity in HT maize-based cropping systems differing in terms of management practices. We (1) simulated current conventional and probable HT cropping systems in two European regions, Aquitaine and Catalonia, with the weed dynamics model FLORSYS; (2) quantified how much the presence of GR weeds contributed to weed impacts on crop production and biodiversity; (3) determined the effect of cultural practices on the impact of GR weeds and (4) identified which species traits most influence weed-impact indicators. The simulation study showed that during the analysed 28 years, the advent of glyphosate resistance had little effect on plant biodiversity. Glyphosate-susceptible populations and species were replaced by GR ones. Including GR weeds only affected functional biodiversity (food offer for birds, bees and carabids) and weed harmfulness when weed effect was initially low; when weed effect was initially high, including GR weeds had little effect. The GR effect also depended on cultural practices, e.g. GR weeds were most detrimental for species equitability when maize was sown late. Species traits most harmful for crop production and most beneficial for biodiversity were identified, using RLQ analyses. None of the species presenting these traits belonged to a family for which glyphosate resistance was reported. An advice table was built; the effects of cultural practices on crop production and biodiversity were synthesized, explained, quantified and ranked, and the optimal choices for each management technique were identified.

  1. Polyoxyethylene Tallow Amine, a Glyphosate Formulation Adjuvant: Soil Adsorption Characteristics, Degradation Profile, and Occurrence on Selected Soils from Agricultural Fields in Iowa, Illinois, Indiana, Kansas, Mississippi, and Missouri.

    Science.gov (United States)

    Tush, Daniel; Meyer, Michael T

    2016-06-07

    Polyoxyethylene tallow amine (POEA) is an inert ingredient added to formulations of glyphosate, the most widely applied agricultural herbicide. POEA has been shown to have toxic effects to some aquatic organisms making the potential transport of POEA from the application site into the environment an important concern. This study characterized the adsorption of POEA to soils and assessed its occurrence and homologue distribution in agricultural soils from six states. Adsorption experiments of POEA to selected soils showed that POEA adsorbed much stronger than glyphosate; calcium chloride increased the binding of POEA; and the binding of POEA was stronger in low pH conditions. POEA was detected on a soil sample from an agricultural field near Lawrence, Kansas, but with a loss of homologues that contain alkenes. POEA was also detected on soil samples collected between February and early March from corn and soybean fields from ten different sites in five other states (Iowa, Illinois, Indiana, Missouri, Mississippi). This is the first study to characterize the adsorption of POEA to soil, the potential widespread occurrence of POEA on agricultural soils, and the persistence of the POEA homologues on agricultural soils into the following growing season.

  2. Glyphosate toxicity and carcinogenicity: a review of the scientific basis of the European Union assessment and its differences with IARC

    OpenAIRE

    Tarazona, Jose V.; Court-Marques, Daniele; Tiramani, Manuela; Reich, Hermine; Pfeil, Rudolf; Istace, Frederique; Crivellente, Federica

    2017-01-01

    Glyphosate is the most widely used herbicide worldwide. It is a broad spectrum herbicide and its agricultural uses increased considerably after the development of glyphosate-resistant genetically modified (GM) varieties. Since glyphosate was introduced in 1974, all regulatory assessments have established that glyphosate has low hazard potential to mammals, however, the International Agency for Research on Cancer (IARC) concluded in March 2015 that it is probably carcinogenic. The IARC conclus...

  3. INTERCROPPING OF BRAQUIARIA WITH SOYBEAN

    OpenAIRE

    Castagnara, Deise Dalazen; Bulegon, Lucas Guilherme; Zoz, Tiago [UNESP; Rossol, Charles Douglas; Berte, Luiz Neri; Rabello de Oliveira, Paulo Sergio; Neres, Marcela Abbado

    2014-01-01

    The objective of this work was to study the intercropping of Brachiaria brizantha. Marandu with soybeans. The experiment has been planted in a 3 year prevailing area with no-tillage, in eutrophic Oxisol at Maripa - PR. The experimental design was a randomized block with five replications. For the forage study, four treatments were performed which consisted of seeding times brachiaria [early ( seven days before planting soybeans) joint (same day of soybean planting) and after (at stages V-3 an...

  4. Mutation breeding in soybean

    International Nuclear Information System (INIS)

    Baradjanegara, A.A.

    1983-01-01

    In Indonesia, soybean is one of the important crop after rice. It is generally cultivated in the lowlands and rarely in the highlands. Seeds of soybean variety ORBA were treated with various doses of fast neutrons, gamma rays, EMS and NaN 3 with the aims of studying the mutagen effects in M-1 and M-2 generations and also to select mutants adapted to highland conditions. D-50 doses for gamma rays, fast neutrons and EMS were around 23 krad, 2,300 rad, 0.3%, respectively. Much higher chlorophyll mutation frequency was observed in EMS treatment of 0.3%. Seven mutants were shorter and four early mutants matured from 4 to 20 days earlier than the control plants. Two early mutants were quite adaptable in both the low and highlands and produced better yields than the parental material. (author)

  5. Yield of glyphosate-resistant sugar beets and efficiency of weed management systems with glyphosate and conventional herbicides under German and Polish crop production.

    Science.gov (United States)

    Nichterlein, Henrike; Matzk, Anja; Kordas, Leszek; Kraus, Josef; Stibbe, Carsten

    2013-08-01

    In sugar beet production, weed control is one of the most important and most expensive practices to ensure yield. Since glyphosate-resistant sugar beets are not yet approved for cultivation in the EU, little commercial experience exists with these sugar beets in Europe. Experimental field trials were conducted at five environments (Germany, Poland, 2010, 2011) to compare the effects of glyphosate with the effects of conventional weed control programs on the development of weeds, weed control efficiency and yield. The results show that the glyphosate weed control programs compared to the conventional methods decreased not only the number of herbicide applications but equally in magnitude decreased the dosage of active ingredients. The results also showed effective weed control with glyphosate when the weed covering was greater and sugar beets had a later growth stage of four true leaves. Glyphosate-resistant sugar beets applied with the glyphosate herbicide two or three times had an increase in white sugar yield from 4 to 18 % in comparison to the high dosage conventional herbicide systems. In summary, under glyphosate management sugar beets can positively contribute to the increasingly demanding requirements regarding efficient sugar beet cultivation and to the demands by society and politics to reduce the use of chemical plant protection products in the environment.

  6. Genome-wide identification of soybean WRKY transcription factors in response to salt stress.

    Science.gov (United States)

    Yu, Yanchong; Wang, Nan; Hu, Ruibo; Xiang, Fengning

    2016-01-01

    Members of the large family of WRKY transcription factors are involved in a wide range of developmental and physiological processes, most particularly in the plant response to biotic and abiotic stress. Here, an analysis of the soybean genome sequence allowed the identification of the full complement of 188 soybean WRKY genes. Phylogenetic analysis revealed that soybean WRKY genes were classified into three major groups (I, II, III), with the second group further categorized into five subgroups (IIa-IIe). The soybean WRKYs from each group shared similar gene structures and motif compositions. The location of the GmWRKYs was dispersed over all 20 soybean chromosomes. The whole genome duplication appeared to have contributed significantly to the expansion of the family. Expression analysis by RNA-seq indicated that in soybean root, 66 of the genes responded rapidly and transiently to the imposition of salt stress, all but one being up-regulated. While in aerial part, 49 GmWRKYs responded, all but two being down-regulated. RT-qPCR analysis showed that in the whole soybean plant, 66 GmWRKYs exhibited distinct expression patterns in response to salt stress, of which 12 showed no significant change, 35 were decreased, while 19 were induced. The data present here provide critical clues for further functional studies of WRKY gene in soybean salt tolerance.

  7. Consequences of phosphate application on glyphosate uptake by roots: Impacts for environmental management practices.

    Science.gov (United States)

    Gomes, Marcelo Pedrosa; Maccario, Sophie; Lucotte, Marc; Labrecque, Michel; Juneau, Philippe

    2015-12-15

    Phosphate (PO4(3-)) fertilization is a common practice in agricultural fields also targets for glyphosate application. Due to their chemical similarities, PO4(3-) and glyphosate compete for soil adsorbing sites, with PO4(3-) fertilization increasing glyphosate bioavailability in the soil solution. After PO4(3-) fertilization, its concentration will be elevated in the soil solution and both PO4(3-) and glyphosate will be readily available for runoff into aquatic ecosystems. In this context, man-made riparian buffer strips (RBS) at the interface of agricultural lands and waterways can be used as a green technology to mitigate water contamination. The plants used in RBS form a barrier to agricultural wastes that can limit runoff, and the ability of these plants to take up these compounds through their roots plays an important role in RBS efficacy. However, the implications of PO4(3-) for glyphosate uptake by roots are not yet clearly demonstrated. Here, we addressed this problem by hydroponically cultivating willow plants in nutrient solutions amended with glyphosate and different concentrations of PO4(3-), assuring full availability of both chemicals to the roots. Using a phosphate carrier inhibitor (phosphonophormic acid-PFA), we found that part of the glyphosate uptake is mediated by PO4(3-) transporters. We observed, however, that PO4(3-) increased glyphosate uptake by roots, an effect that was related to increased root cell membrane stability. Our results indicate that PO4(3-) has an important role in glyphosate physiological effects. Under agricultural conditions, PO4(3-) fertilization can amplify glyphosate efficiency by increasing its uptake by the roots of undesired plants. On the other hand, since simultaneous phosphate and glyphosate runoffs are common, non-target species found near agricultural fields can be affected. Copyright © 2015. Published by Elsevier B.V.

  8. Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance

    Science.gov (United States)

    Samsel, Anthony

    2013-01-01

    Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the active ingredient in the herbicide, Roundup®, is the most important causal factor in this epidemic. Fish exposed to glyphosate develop digestive problems that are reminiscent of celiac disease. Celiac disease is associated with imbalances in gut bacteria that can be fully explained by the known effects of glyphosate on gut bacteria. Characteristics of celiac disease point to impairment in many cytochrome P450 enzymes, which are involved with detoxifying environmental toxins, activating vitamin D3, catabolizing vitamin A, and maintaining bile acid production and sulfate supplies to the gut. Glyphosate is known to inhibit cytochrome P450 enzymes. Deficiencies in iron, cobalt, molybdenum, copper and other rare metals associated with celiac disease can be attributed to glyphosate's strong ability to chelate these elements. Deficiencies in tryptophan, tyrosine, methionine and selenomethionine associated with celiac disease match glyphosate's known depletion of these amino acids. Celiac disease patients have an increased risk to non-Hodgkin's lymphoma, which has also been implicated in glyphosate exposure. Reproductive issues associated with celiac disease, such as infertility, miscarriages, and birth defects, can also be explained by glyphosate. Glyphosate residues in wheat and other crops are likely increasing recently due to the growing practice of crop desiccation just prior to the harvest. We argue that the practice of “ripening” sugar cane with glyphosate may explain the recent

  9. Circular RNA expression profiles in hippocampus from mice with perinatal glyphosate exposure.

    Science.gov (United States)

    Yu, Ning; Tong, Yun; Zhang, Danni; Zhao, Shanshan; Fan, Xinli; Wu, Lihui; Ji, Hua

    2018-05-19

    Glyphosate is the active ingredient in numerous herbicide formulations. The roles of glyphosate in embryo-toxicity and neurotoxicity have been reported in human and animal models. Recently, several studies have reported evidence linking neurodevelopmental disorders (NDDs) with gestational glyphosate exposure. However, the role of glyphosate in neuronal development is still not fully understood. Our previous study found that perinatal glyphosate exposure resulted in differential microRNA expression in the prefrontal cortex of mouse offspring. However, the mechanism of glyphosate-induced neurotoxicity in the developing brain is still not fully understood. Considering the pivotal role of Circular RNAs (circRNAs) in the regulation of gene expression, a circRNA microarray method was used in this study to investigate circRNA expression changes in the hippocampus of mice with perinatal glyphosate exposure. The circRNA microarrays revealed that 663 circRNAs were significantly altered in the perinatal glyphosate exposure group compared with the control group. Among them, 330 were significantly upregulated, and the other 333 were downregulated. Furthermore, the relative expression levels of mmu-circRNA-014015, mmu-circRNA-28128 and mmu-circRNA-29837 were verified using quantitative real-time polymerase chain reaction (qRT-PCR). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses demonstrated that stress-associated steroid metabolism pathways, such as aldosterone synthesis and secretion pathways, may be involved in the neurotoxicity of glyphosate. These results showed that circRNAs are aberrantly expressed in the hippocampus of mice with perinatal glyphosate exposure and play potential roles in glyphosate-induced neurotoxicity. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Research on the weed control degree and glyphosate soil biodegradation in apple plantations (Pioneer variety

    Directory of Open Access Journals (Sweden)

    Ersilia ALEXA

    2010-05-01

    Full Text Available In this study we follow control degree of glyphosate herbicide on weeds in apple plantations (Pioneer variety of the Research Station Timisoara. It was also followed glyphosate biodegradation capacity in the soil by determining the amount of CO2 released by the action of microorganisms on C14 glyphosate marked isotope. Laboratory analysis of glyphosate residues in soil was made using a Liquid Scintillation TRIATHLER. Glyphosate biodegradation ability in the presence of soil microorganisms is high, so glyphosate residues remaining in soil, in terms of its use in weed combating, are minimal. Study of glyphosate biodegradation capacity in the experimental field indicates that the CO2 fraction accumulated after 50 days is 28.02% for samples exposed in the experimental field. Weather conditions, especially temperature variations between day and night, influences the activity of soilmicroorganisms and affect biodegraded glyphosate percentage.Chemical method of weed control consisted in: herbicide used was Roundup 3 l/ha (glyphosate isopropyl amine salt 360 g/l and are based on chemical application on weeds, on the rows of trees, on their uptake and translocation in their organs having as principal scope the total destruction of weeds. The experimental results obtained reveal a weed combat degree of 82.98% , in the case of chemical variant, compared with control variant. The species combated mainly due to glyphosate herbicide, which is no longer found in the final mapping are: Capsella bursa-pastoris, Chenopodium album, Echinochloa crus-galli, Plantago major, Polygonum aviculare. Total combated weeds /m2 with glyphosate is 126.67.

  11. Glyphosate, pathways to modern diseases II: Celiac sprue and gluten intolerance.

    Science.gov (United States)

    Samsel, Anthony; Seneff, Stephanie

    2013-12-01

    Celiac disease, and, more generally, gluten intolerance, is a growing problem worldwide, but especially in North America and Europe, where an estimated 5% of the population now suffers from it. Symptoms include nausea, diarrhea, skin rashes, macrocytic anemia and depression. It is a multifactorial disease associated with numerous nutritional deficiencies as well as reproductive issues and increased risk to thyroid disease, kidney failure and cancer. Here, we propose that glyphosate, the active ingredient in the herbicide, Roundup(®), is the most important causal factor in this epidemic. Fish exposed to glyphosate develop digestive problems that are reminiscent of celiac disease. Celiac disease is associated with imbalances in gut bacteria that can be fully explained by the known effects of glyphosate on gut bacteria. Characteristics of celiac disease point to impairment in many cytochrome P450 enzymes, which are involved with detoxifying environmental toxins, activating vitamin D3, catabolizing vitamin A, and maintaining bile acid production and sulfate supplies to the gut. Glyphosate is known to inhibit cytochrome P450 enzymes. Deficiencies in iron, cobalt, molybdenum, copper and other rare metals associated with celiac disease can be attributed to glyphosate's strong ability to chelate these elements. Deficiencies in tryptophan, tyrosine, methionine and selenomethionine associated with celiac disease match glyphosate's known depletion of these amino acids. Celiac disease patients have an increased risk to non-Hodgkin's lymphoma, which has also been implicated in glyphosate exposure. Reproductive issues associated with celiac disease, such as infertility, miscarriages, and birth defects, can also be explained by glyphosate. Glyphosate residues in wheat and other crops are likely increasing recently due to the growing practice of crop desiccation just prior to the harvest. We argue that the practice of "ripening" sugar cane with glyphosate may explain the recent

  12. 40 CFR 180.303 - Oxamyl; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.303... methyl N,N-dimethyl-N-hydroxy-1-thiooxamimidate calculated as oxamyl in or on the following food..., nonbell 5.0 Pineapple 1 Pineapple, process residue 2.0 Pumpkin 2.0 Soybean, seed 0.1 Spearmint, tops 10.0...

  13. DLLME-spectrophotometric determination of glyphosate residue in legumes.

    Science.gov (United States)

    Çetin, Emine; Şahan, Serkan; Ülgen, Ahmet; Şahin, Uğur

    2017-09-01

    A new separation and pre-concentration method for spectrophotometric determination of glyphosate herbicide was developed. Glyphosate was converted into dithiocarbamic acid with CS 2 , followed by copper in the presence of ammonia to promote complex formation. This complex was collected in a CH 2 Cl 2 organic drop and absorbance measured at 435nm. The analytical parameters, such as the amount of NH 3 , Cu(II) and CS 2 , type of extraction solutions, and the ratio of dispersive and organic liquids were optimized. The calibration curve was linear in the range 0.5-10mgl -1 . The limits of detection and quantification were calculated from 3s to 10s criterions as 0.21mgl -1 and 0.70mgl -1 , respectively. The developed method was applied to legume samples with the satisfactory recovery values of 98±4-102±3%. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Toxicity of roundup (a glyphosate product) to fingerlings of Clarias ...

    African Journals Online (AJOL)

    Acute static renewal bioassays were conducted on fingerling and adult of Clarias gariepinus (mean weight, 1.22 ± 0.6g; mean total length, 5.25 ± 1.25 cm) using the herbicide, Roundup (glyphosate). In the acute study, fingerlings were exposed in triplicate to 0.0, 14.0, 16.0, 18.0, 20.0 22.0, and 24.0 mg/l of the herbicide for ...

  15. Soybean growth and yield after single tillage and species mixture of cover plants

    Directory of Open Access Journals (Sweden)

    Gislaine Piccolo de Lima

    2012-10-01

    Full Text Available The use of cover crops is important for the agricultural crop and soil management in order to improve the system and, consequently, to increase yield. Therefore, the present study analyzed the effect of crop residues of black oat (Avena strigosa Schreb. (BO and a cocktail (CO of BO, forage turnip (Raphanus sativus L. (FT and common vetch (Vicia sativa L. (V on the emergence speed index (ESI, seedling emergence speed (SES plant height and soybean yield in different intervals between cover crop desiccation with glyphosate 480 (3 L ha-1 and BRS 232 cultivar sowing. Plots of 5 x 2.5 m with 1 m of border received four treatments with BO cover crops and four with CO as well as a control for each cover crop, at random, with five replications. The plots were desiccated in intervals of 1, 10, 20 and 30 days before soybean seeding. The harvest was manual while yield was adjusted to 13% of moisture content. The experimental design was completely randomized with splitplots and means compared by the Scott and Knott test at 5% of significance. The results showed that CO of cover crops can be recommended for soybean to obtain a more vigorous seedling emergence, from 10 days after cover crop desiccation.

  16. ANALYSIS IMPORT POLICY OF SOYBEAN ON ECONOMICS PERFORMANCE OF INDONESIAN SOYBEAN

    Directory of Open Access Journals (Sweden)

    Muthiah Abda Azizah

    2015-11-01

    Full Text Available Trade liberalization is closely related to the opening of market access for Indonesian products to the world and vice versa. Since the soybean trade out of BULOG control began in 1998, soybean imports increased very rapidly (Sudaryanto and Swastika, 2007. This research aims to determine the general picture of soybean economy, factors analyses that influence the economic performance of Indonesian soybean and findings the alternative of policies that can reduce soybean imports in Indonesia. Methods of data analysis are descriptive analysis, 2SLS simultaneous equations, and simulation of policy alternatives. Results of the analysis of the factors that affect the economic performance of Indonesian soybean, consists of 1 The area of soybean harvest is influenced significantly by the price of domestic soybean and domestic prices of corn, 2 Productivity soybean influenced significantly by the domestic prices of soybean and fertilizer prices, 3 soybean demand influenced significantly by population, domestic prices of soybean, 4 domestic prices of soybean significantly affected by world prices of soybean, exchange rates, and soybean supply, 5 Imports of soybean influenced significantly by the domestic demand of soybean and soybean production. Therefore, policy scenarios should be made to reduce soybean imports, including by carrying out the expansion of soybean harvest policy, the policy of increasing the productivity of soybean, the policy of subsidizing the price of fertilizer.

  17. Voltammetric Quantification of Paraquat and Glyphosate in Surface Waters

    Directory of Open Access Journals (Sweden)

    William Roberto Alza-Camacho

    2016-09-01

    Full Text Available The indiscriminate use of pesticides on crops has a negative environmental impact that affects organisms, soil and water resources, essential for life. Therefore, it is necessary to evaluate the residual effect of these substances in water sources. A simple, affordable and accessible electrochemical method for Paraquat and Glyphosate quantification in water was developed. The study was conducted using as supporting electrolyte Britton-Robinson buffer solution, working electrode of glassy carbon, Ag/AgCl as the reference electrode, and platinum as auxiliary electrode. Differential pulse voltammetry (VDP method for both compounds were validated. Linearity of the methods presented a correlation coefficient of 0.9949 and 0.9919 and the limits of detection and quantification were 130 and 190 mg/L for Paraquat and 40 and 50 mg/L for glyphosate. Comparison with the reference method showed that the electrochemical method provides superior results in quantification of analytes. Of the samples tested, a value of Paraquat was between 0,011 to 1,572 mg/L and for glyphosate it was between 0.201 to 2.777 mg/L, indicating that these compounds are present in water sources and that those may be causing serious problems to human health.

  18. SOYBEAN PRODUCTION AND ECONOMIC OF INDONESIA

    Directory of Open Access Journals (Sweden)

    Sulistiya

    2014-01-01

    Full Text Available Indonesian soybean production almost never moved, even tended to decrease. Indonesia does not have a specific area of land for planting soybeans. Soybean are generally just a byproduct of plant or land filling vacant after farmers grow rice. In addition soybean price fluctuations that affect tofu and tempe entrepreneurs, it turns soybean farmers are often losers. Policy biased to the consumer sector than soybean production, cause national soybean production declining. The decrease occurred primarily because of the narrowing of soybean plantation land owned by farmers, this happens because soy is less interesting than the business side so that the farmers based on rationality, farmers prefer the other commodities, especially rice. Increasing decline in domestic soybean production resulted in the growing dependence on imports which would deplete foreign exchange. Procurement policies of national soybean stocks through imports is easy to do but its adverse implications for the development of domestic agricultural production, especially soybeans, very bad.

  19. [Mutual Effect on Determination of Gibberellins and Glyphosate in Groundwater by Spectrophotometry].

    Science.gov (United States)

    Zhang, Li; Chen, Liang; Liu, Fei

    2015-04-01

    In the present study, a spectrophotometry method for the simultaneous determination of gibberellins (GA3) and glyphosate in groundwater was established and optimized. In addition, the mutual effect on simultaneous determination of GA3 and glyphosate was studied. Based on the experiment, good linearity (R2 > 0.99) was obtained for GA3 in the range of 0-20 and 0-100 µg and for glyphosate in the range of 0-8 and 5-15 µg. The method's detection limit (MDL) of GA3 and glyphosate was 0.48 and 0.82 µg, respectively; and the recovery rates of 15 to 150 µg GA3 and 3 to 10 µg glyphosate in all samples at a spiked level were 71.3% ± 1.9% and 98.4% ± 8.1%, respectively. No obvious influence of glyphosate (0-100 mg · L(-1)) on the recovery rates of GA3 was observed, but the presence of glyphosate could cause slight determination precision decrease of GA3. Meanwhile, adding 2 mg · L(-1) GA3 can increase the recovery rate of glyphosate.

  20. Glyphosate: environmental contamination, toxicity and potential risks to human health via food contamination.

    Science.gov (United States)

    Bai, Shahla Hosseini; Ogbourne, Steven M

    2016-10-01

    Glyphosate has been the most widely used herbicide during the past three decades. The US Environmental Protection Agency (EPA) classifies glyphosate as 'practically non-toxic and not an irritant' under the acute toxicity classification system. This classification is based primarily on toxicity data and due to its unique mode of action via a biochemical pathway that only exists in a small number of organisms that utilise the shikimic acid pathway to produce amino acids, most of which are green plants. This classification is supported by the majority of scientific literature on the toxic effects of glyphosate. However, in 2005, the Food and Agriculture Organisation (FAO) reported that glyphosate and its major metabolite, aminomethylphosphonic acid (AMPA), are of potential toxicological concern, mainly as a result of accumulation of residues in the food chain. The FAO further states that the dietary risk of glyphosate and AMPA is unlikely if the maximum daily intake of 1 mg kg(-1) body weight (bw) is not exceeded. Research has now established that glyphosate can persist in the environment, and therefore, assessments of the health risks associated with glyphosate are more complicated than suggested by acute toxicity data that relate primarily to accidental high-rate exposure. We have used recent literature to assess the possible risks associated with the presence of glyphosate residues in food and the environment.

  1. Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

    Science.gov (United States)

    This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

  2. Glyphosate sorption/desorption on biochars - interactions of physical and chemical processes.

    Science.gov (United States)

    Hall, Kathleen E; Spokas, Kurt A; Gamiz, Beatriz; Cox, Lucia; Papiernik, Sharon K; Koskinen, William C

    2018-05-01

    Biochar, a carbon-rich product of biomass pyrolysis, could limit glyphosate transport in soil and remediate contaminated water. The present study investigates the sorption/desorption behavior of glyphosate on biochars prepared from different hardwoods at temperatures ranging from 350 to 900 °C to elucidate fundamental mechanisms. Glyphosate (1 mg L -1 ) sorption on biochars increased with pyrolysis temperature and was highest on 900 °C biochars; however, total sorption was low on a mass basis (glyphosate in soils, did not alter biochar sorption capacities. Glyphosate did not desorb from biochar with CaCl 2 solution; however, up to 86% of the bound glyphosate was released with a K 2 HPO 4 solution. Results from this study suggest a combined impact of surface chemistry and physical constraints on glyphosate sorption/desorption on biochar. Based on the observed phosphate-induced desorption of glyphosate, the addition of P-fertilizer to biochar-amended soils can remobilize the herbicide and damage non-target plants; therefore, improved understanding of this risk is necessary. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  3. Goss’s wilt incidence in sweet corn is independent of transgenic traits and glyphosate

    Science.gov (United States)

    Recently claims have been made that the use of glyphosate and transgenic crop traits increases the risk of plant diseases. Transgenic traits used widely for years in dent corn are now available in commercial sweet corn cultivars, specifically, the combination of glyphosate resistance (GR) and Lepid...

  4. Distribution of glyphosate and aminomethylphosphonic acid (AMPA) in Agricultural topsoils of the European Union

    NARCIS (Netherlands)

    Felix Da Graca Silva, V.A.; Montanarella, L.; Jones, Arwyn; Fernandez-Ugalde, Oihane; Mol, J.G.J.; Ritsema, C.J.; Geissen, V.

    2018-01-01

    Approval for glyphosate-based herbicides in the European Union (EU) is under intense debate due to concern about their effects on the environment and human health. The occurrence of glyphosate residues in European water bodies is rather well documented whereas only few, fragmented and outdated

  5. The different behaviors of glyphosate and AMPA in compost-amended soil.

    Science.gov (United States)

    Erban, Tomas; Stehlik, Martin; Sopko, Bruno; Markovic, Martin; Seifrtova, Marcela; Halesova, Tatana; Kovaricek, Pavel

    2018-05-04

    The broad-spectrum herbicide glyphosate is one of the most widely used pesticides. Both glyphosate and its major metabolite, aminomethylphosphonic acid (AMPA), persist in waters; thus, their environmental fates are of interest. We investigated the influence of compost dose, sampling depth, moisture and saturated hydraulic conductivity (K s ) on the persistence of these substances. The amounts of AMPA quantified by triple quadrupole liquid chromatography-mass spectrometry (LC-QqQ-MS/MS) using isotopically labeled extraction standards were higher than those of glyphosate and differed among the samples. Both glyphosate and AMPA showed gradually decreasing concentrations with soil depth, and bootstrapped ANOVA showed significant differences between the contents of glyphosate and AMPA and their behavior related to different compost dosages and sampling depths. However, the compost dose alone did not cause significant differences among samples. Bayesian statistics revealed that the amounts of glyphosate and AMPA were both dependent on the sampling depth and compost dose, but differences were found when considering the physical factors of K s and moisture. Glyphosate was influenced by moisture but not K s , whereas AMPA was influenced by K s but not moisture. Importantly, we found behavioral differences between glyphosate and its major metabolite, AMPA, related to the physical properties of K s and moisture. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Short-term transport of glyphosate with erosion in Chinese loess soil - a flume experiment

    NARCIS (Netherlands)

    Yang, X.; Wang, Fei; Martins Bento, Celia; Xue, Sha; Gai, L.; Dam, van R.C.J.; Mol, J.G.J.; Ritsema, C.J.; Geissen, V.

    2015-01-01

    Repeated applications of glyphosate may contaminate the soil and water and threaten their quality both within the environmental system and beyond it through water erosion related processes and leaching. In this study, we focused on the transport of glyphosate and its metabolite aminomethylphosphonic

  7. Annual glyphosate treatments alter growth of unaffected bentgrass (Agrostis weeds and plant community composition.

    Directory of Open Access Journals (Sweden)

    Collin W Ahrens

    Full Text Available Herbicide resistance is becoming more common in weed ecotypes and crop species including turfgrasses, but current gaps in knowledge limit predictive ecological risk assessments and risk management plans. This project examined the effect of annual glyphosate applications on the vegetative growth and reproductive potential of two weedy bentgrasses, creeping bentgrass (CB and redtop (RT, where the glyphosate resistance (GR trait was mimicked by covering the bentgrass plants during glyphosate application. Five field plots were studied in habitats commonly inhabited by weedy bentgrasses including an agricultural hayfield, natural meadow, and wasteland. Results showed that annual glyphosate treatment improved bentgrass survivorship, vegetative growth, and reproductive potential compared with bentgrass in unsprayed subplots. In the second year of growth, RT plants had an 86-fold increase in flower number in glyphosate-treated subplots versus controls, while CB plants had a 20-fold increase. At the end of the three year study, plant community composition had changed in glyphosate-treated subplots in hayfield and meadow plots compared to controls. Soils in subplots receiving glyphosate had higher nitrate concentrations than controls. This is the first study to mimic the GR trait in bentgrass plants with the goal of quantifying bentgrass response to glyphosate selection pressure and understanding the impacts on surrounding plant communities.

  8. Correlation of leaf damage with uptake and translocation of glyphosate in velvetleaf (Abutilon theophrasti)

    International Nuclear Information System (INIS)

    Feng, P.C.C.; Ryerse, J.S.; Sammons, R.D.

    1998-01-01

    Uptake and translocation of glyphosate in three commercial formulations were examined in velvetleaf, a dicotyledonous weed that is commonly treated with glyphosate. The formulations included Roundup(R) (MON35085), Roundup Ultra, and Touchdown(R) as sold in Canada. A minimal amount of 14C-glyphosate was spiked into a lethal rate of each formulation, and the short-term (3 to 72 h) uptake into the treated leaf and subsequent translocation into the plant were measured. Time-course studies showed very rapid uptake and translocation of glyphosate in the Ultra formulation. In comparison, the uptake and translocation of glyphosate in Touchdown was much slower but continued throughout the 72-h period. Glyphosate in the Roundup formulation showed intermediate uptake and translocation. Tissue necrosis at the application sites of Ultra and Roundup was visible within 24 h after treatment. Examinations using stereo and fluorescence microscopy revealed extensive cell death and tissue disruption. Tissue necrosis from Ultra and Roundup was also observed in blank formulations containing no glyphosate and therefore was likely caused by the surfactants. In contrast, the application sites of Touchdown produced little to no leaf damage. Our results demonstrated a direct correlation between tissue necrosis and rapid rates of glyphosate uptake and translocation. (author)

  9. Effects of glyphosate exposure on sperm concentration in rodents: A systematic review and meta-analysis.

    Science.gov (United States)

    Cai, Wenyan; Ji, Ying; Song, Xianping; Guo, Haoran; Han, Lei; Zhang, Feng; Liu, Xin; Zhang, Hengdong; Zhu, Baoli; Xu, Ming

    2017-10-01

    Correlation between exposure to glyphosate and sperm concentrations is important in reproductive toxicity risk assessment for male reproductive functions. Many studies have focused on reproductive toxicity on glyphosate, however, results are still controversial. We conducted a systematic review of epidemiological studies on the association between glyphosate exposure and sperm concentrations of rodents. The aim of this study is to explore the potential adverse effects of glyphosate on reproductive function of male rodents. Systematic and comprehensive literature search was performed in MEDLINE, TOXLINE, Embase, WANFANG and CNKI databases with different combinations of glyphosate exposure and sperm concentration. 8 studies were eventually identified and random-effect model was conducted. Heterogeneity among study results was calculated via chi-square tests. Ten independent experimental datasets from these eight studies were acquired to synthesize the random-effect model. A decrease in sperm concentrations was found with mean difference of sperm concentrations(MDsperm)=-2.774×10 6 /sperm/g/testis(95%CI=-0.969 to -4.579) in random-effect model after glyphosate exposure. There was also a significant decrease after fitting the random-effect model: MDsperm=-1.632×10 6 /sperm/g/testis (95%CI=-0.662 to -2.601). The results of meta-analysis support the hypothesis that glyphosate exposure decreased sperm concentration in rodents. Therefore, we conclude that glyphosate is toxic to male rodent's reproductive system. Copyright © 2017. Published by Elsevier B.V.

  10. Plant growth responses of apple and pear trees to doses of glyphosate

    Science.gov (United States)

    Glyphosate is commonly used for intra-row weed management in perennial plantations, where unintended crop exposure to this herbicide can cause growth reduction. The objective of this research was to analyze the initial plant growth behavior of young apple and pear plants exposed to glyphosate. Glyph...

  11. Glyphosate sorption/desorption on biochars – Interactions of physical and chemical processes

    Science.gov (United States)

    BACKGROUND: Biochar, a carbon-rich product of biomass pyrolysis, could limit glyphosate transport in soil and remediate contaminated water. The present study investigates the sorption/desorption behavior of glyphosate on biochars prepared from different hardwoods at temperatures ranging from 350°C t...

  12. Decay characteristics and erosion-related transport of glyphosate in Chinese loess soil under field conditions

    NARCIS (Netherlands)

    Yang, X.; Wang, Fei; Martins Bento, Celia; Meng, L.; Dam, van R.C.J.; Mol, J.G.J.; Liu, Guobin; Ritsema, C.J.; Geissen, V.

    2015-01-01

    The decay characteristics and erosion-related transport of glyphosate and aminomethylphosphonic acid (AMPA) were monitored for 35 d at different slope gradients and rates of application in plots with loess soil on the Loess Plateau, China. The initial glyphosate decayed rapidly (half-life of 3.5 d)

  13. Biodegradation of glyphosate herbicide by Salinicoccus spp isolated from Qom Hoze-soltan lake, Iran

    Directory of Open Access Journals (Sweden)

    Yaser Sharifi

    2015-01-01

    Full Text Available Background: Glyphosate (N-phosphonomethyl Glycine is an organophosphorus pesticide with dangerous effects on the environment. In this study, the biodegradation of glyphosate herbicide by halophilic bacteria isolated from Qom Hoze-Soltan Lake has been investigated. Methods: After sampling and bacterial isolation, native halophilic strains grown in the presence of glyphosate at a wavelength of 660 nm and also the disappearance of the glyphosate in the plates at a wavelength of 220 nm were determined and the dominant bacteria were isolated. Biochemical, molecular (according to the 16S rRNA sequence, antibiotic, and the Minimum Inhibitory Concentration (MIC test was performed for the dominant bacteria. Analysis of the remaining glyphosate herbicide was performed by HPLC analysis after derivation with FMOC-Cl. Results: According to the results of the biochemical, antibiotic and molecular 16S rRNA tests, the native halophilic isolates with the ability to biodegrade glyphosate were gram positive cocci very similar to Salinicoccusspp. The results of HPLC showed that Salinicoccusspp is able to biodegrade glyphosate herbicide. Conclusion: The native bacteria in Qom Hoze-soltanlake, Iran can be used for biodegradation of glyphosate herbicide.

  14. Fate of glyphosate and degradates in cover crop residues and underlying soil: A laboratory study

    International Nuclear Information System (INIS)

    Cassigneul, A.; Benoit, P.; Bergheaud, V.; Dumeny, V.; Etiévant, V.; Goubard, Y.; Maylin, A.; Justes, E.; Alletto, L.

    2016-01-01

    The increasing use of cover crops (CC) may lead to an increase in glyphosate application for their destruction. Sorption and degradation of "1"4C-glyphosate on and within 4 decaying CC-amended soils were compared to its fate in a bare soil. "1"4C-Glyphosate and its metabolites distribution between mineralized, water-soluble, NH_4OH-soluble and non-extractable fractions was determined at 5 dates during a 20 °C/84-d period. The presence of CC extends "1"4C-glyphosate degradation half-life from 7 to 28 days depending on the CC. "1"4C-Glyphosate dissipation occurred mainly through mineralization in soils and through mineralization and bound residue formation in decaying CC. Differences in sorption and degradation levels were attributed to differences in composition and availability to microorganisms. CC- and soil-specific dissipation patterns were established with the help of explicit relationships between extractability and microbial activity. - Highlights: • Glyphosate sorption on cover crop residues increases with their decomposition degree. • Glyphosate degradation and mineralization are lower in mulch than in soil. • Nonextractable residue formation is one of the main dissipation pathways of glyphosate in cover crop mulch.

  15. Glyphosate and AMPA distribution in wind-eroded sediment derived from loess soil

    NARCIS (Netherlands)

    Martins Bento, Celia; Goossens, Dirk; Rezaei, Mahrooz; Riksen, M.J.P.M.; Mol, J.G.J.; Ritsema, C.J.; Geissen, V.

    2017-01-01

    Glyphosate is one of the most used herbicides in agricultural lands worldwide. Wind-eroded sediment and dust, as an environmental transport pathway of glyphosate and of its main metabolite aminomethylphosphonic acid (AMPA), can result in environmental- and human exposure far beyond the agricultural

  16. UV-Vis Spectrophotometric Analysis and Quantification of Glyphosate for an Interdisciplinary Undergraduate Laboratory

    Science.gov (United States)

    Felton, Daniel E.; Ederer, Martina; Steffens, Timothy; Hartzell, Patricia L.; Waynant, Kristopher V.

    2018-01-01

    Glyphosate (N-(phosphonomethyl)glycine) is the most widely used herbicide on earth. A simple assay to quantify glyphosate concentrations in environmental samples was developed as part of an interdisciplinary effort linking introductory laboratory courses in chemistry, biology, and microbiology. In this 3 h laboratory experiment, students used…

  17. Fate of glyphosate and degradates in cover crop residues and underlying soil: A laboratory study

    Energy Technology Data Exchange (ETDEWEB)

    Cassigneul, A. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France); INRA, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Benoit, P.; Bergheaud, V.; Dumeny, V.; Etiévant, V. [INRA, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Goubard, Y. [AgroParisTech, UMR 1402 ECOSYS, 78850 Thiverval-Grignon (France); Maylin, A. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France); Justes, E. [INRA, UMR 1248 AGIR Auzeville — BP 52 627, 31 326, Castanet-Tolosan cedex (France); Alletto, L. [Université de Toulouse — École d' ingénieurs de Purpan, UMR 1248 AGIR — 75, Voie du TOEC BP 57 611, 31 076, Toulouse cedex 3 (France)

    2016-03-01

    The increasing use of cover crops (CC) may lead to an increase in glyphosate application for their destruction. Sorption and degradation of {sup 14}C-glyphosate on and within 4 decaying CC-amended soils were compared to its fate in a bare soil. {sup 14}C-Glyphosate and its metabolites distribution between mineralized, water-soluble, NH{sub 4}OH-soluble and non-extractable fractions was determined at 5 dates during a 20 °C/84-d period. The presence of CC extends {sup 14}C-glyphosate degradation half-life from 7 to 28 days depending on the CC. {sup 14}C-Glyphosate dissipation occurred mainly through mineralization in soils and through mineralization and bound residue formation in decaying CC. Differences in sorption and degradation levels were attributed to differences in composition and availability to microorganisms. CC- and soil-specific dissipation patterns were established with the help of explicit relationships between extractability and microbial activity. - Highlights: • Glyphosate sorption on cover crop residues increases with their decomposition degree. • Glyphosate degradation and mineralization are lower in mulch than in soil. • Nonextractable residue formation is one of the main dissipation pathways of glyphosate in cover crop mulch.

  18. Alteration of plant physiology by glyphosate and its by-product aminomethylphosphonic acid: an overview.

    Science.gov (United States)

    Gomes, Marcelo P; Smedbol, Elise; Chalifour, Annie; Hénault-Ethier, Louise; Labrecque, Michel; Lepage, Laurent; Lucotte, Marc; Juneau, Philippe

    2014-09-01

    It is generally claimed that glyphosate kills undesired plants by affecting the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) enzyme, disturbing the shikimate pathway. However, the mechanisms leading to plant death may also be related to secondary or indirect effects of glyphosate on plant physiology. Moreover, some plants can metabolize glyphosate to aminomethylphosphonic acid (AMPA) or be exposed to AMPA from different environmental matrices. AMPA is a recognized phytotoxin, and its co-occurrence with glyphosate could modify the effects of glyphosate on plant physiology. The present review provides an overall picture of alterations of plant physiology caused by environmental exposure to glyphosate and its metabolite AMPA, and summarizes their effects on several physiological processes. It particularly focuses on photosynthesis, from photochemical events to C assimilation and translocation, as well as oxidative stress. The effects of glyphosate and AMPA on several plant physiological processes have been linked, with the aim of better understanding their phytotoxicity and glyphosate herbicidal effects. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. Inheritance of Evolved Glyphosate Resistance in a North Carolina Palmer Amaranth (Amaranthus palmeri Biotype

    Directory of Open Access Journals (Sweden)

    Aman Chandi

    2012-01-01

    Full Text Available Inheritance of glyphosate resistance in a Palmer amaranth biotype from North Carolina was studied. Glyphosate rates for 50% survival of glyphosate-resistant (GR and glyphosate-susceptible (GS biotypes were 1288 and 58 g ha−1, respectively. These values for F1 progenies obtained from reciprocal crosses (GR×GS and GS×GR were 794 and 501 g ha−1, respectively. Dose response of F1 progenies indicated that resistance was not fully dominant over susceptibility. Lack of significant differences between dose responses for reciprocal F1 families suggested that genetic control of glyphosate resistance was governed by nuclear genome. Analysis of F1 backcross (BC1F1 families showed that 10 and 8 BC1F1 families out of 15 fitted monogenic inheritance at 2000 and 3000 g ha−1 glyphosate, respectively. These results indicate that inheritance of glyphosate resistance in this biotype is incompletely dominant, nuclear inherited, and might not be consistent with a single gene mechanism of inheritance. Relative 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS copy number varied from 22 to 63 across 10 individuals from resistant biotype. This suggested that variable EPSPS copy number in the parents might be influential in determining if inheritance of glyphosate resistance is monogenic or polygenic in this biotype.

  20. Glyphosate detection with ammonium nitrate and humic acids as potential interfering substances by pulsed voltammetry technique.

    Science.gov (United States)

    Martínez Gil, Pablo; Laguarda-Miro, Nicolas; Camino, Juan Soto; Peris, Rafael Masot

    2013-10-15

    Pulsed voltammetry has been used to detect and quantify glyphosate on buffered water in presence of ammonium nitrate and humic substances. Glyphosate is the most widely used herbicide active ingredient in the world. It is a non-selective broad spectrum herbicide but some of its health and environmental effects are still being discussed. Nowadays, glyphosate pollution in water is being monitored but quantification techniques are slow and expensive. Glyphosate wastes are often detected in countryside water bodies where organic substances and fertilizers (commonly based on ammonium nitrate) may also be present. Glyphosate also forms complexes with humic acids so these compounds have also been taken into consideration. The objective of this research is to study the interference of these common pollutants in glyphosate measurements by pulsed voltammetry. The statistical treatment of the voltammetric data obtained lets us discriminate glyphosate from the other studied compounds and a mathematical model has been built to quantify glyphosate concentrations in a buffer despite the presence of humic substances and ammonium nitrate. In this model, the coefficient of determination (R(2)) is 0.977 and the RMSEP value is 2.96 × 10(-5) so the model is considered statistically valid. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Improving hybrid seed production in corn with glyphosate-mediated male sterility.

    Science.gov (United States)

    Feng, Paul C C; Qi, Youlin; Chiu, Tommy; Stoecker, Martin A; Schuster, Christopher L; Johnson, Scott C; Fonseca, Augustine E; Huang, Jintai

    2014-02-01

    Hybrid corn varieties exhibit benefits associated with heterosis and account for most of the corn acreage in the USA. Hybrid seed corn is produced by crossing a female parent which is male-sterile and therefore incapable of self-pollination with a male parent as the pollen donor. The majority of hybrid seed corn is produced by mechanical detasseling which involves physically removing the tassel, a process that is laborious and costly. Glyphosate-resistant corn was developed via expression of a glyphosate insensitive 5-enolpyruvyl-shikimate 3-phosphate synthase enzyme (CP4-EPSPS). Experimentation with molecular expression elements resulted in selective reduction of CP4-EPSPS expression in male reproductive tissues. The resulting plant demonstrated sterile tassel following glyphosate application with little to no injury to the rest of the plant. Using (14)C-glyphosate as a marker, we also examined the translocation of glyphosate to the tassel via spray application in a track sprayer to simulate field application. The results allowed optimization of spray parameters such as dose, spray timing and target to maximize tassel delivery of glyphosate for efficient sterilization. The Roundup hybridization system (RHS) is a novel process for hybrid seed production based on glyphosate-mediated male sterility. RHS replaces mechanical detasseling with glyphosate spray and greatly simplifies the process of hybrid seed corn production. © 2013 Society of Chemical Industry.

  2. Glyphosate toxicity and the effects of long-term vegetation control on soil microbial communities

    Science.gov (United States)

    Matt D. Busse; Alice W. Ratcliff; Carol J. Stestak; Robert F. Powers

    2001-01-01

    We assessed the direct and indirect effect of the herbicide glyphosate on soil microbial communities from soil bioassays at glyphosate concentrations up to 100-fold greater than expected following a single field application. Indirect effects on microbial biomass, respiration, and metabolic diversity (Biolog and catabolic response profile) were compared seasonally after...

  3. Adsorção de glifosato sobre solos e minerais Adsorption of glyphosate on soils and minerals

    Directory of Open Access Journals (Sweden)

    Luís R. M. Toni

    2006-07-01

    Full Text Available Glyphosate, an enzyme inhibitor herbicide, has been widely used around the world in agriculture. Dr. John Franz from Monsanto Corporation (USA discovered glyphosate in 1970. It has been showed that glyphosate is strongly adsorbed by inorganic soil components especially aluminium and iron oxides, and the phosphate group is involved in this interaction. The inactivation of glyphosate in soils can last for days or even months depending on soil characteristics. The addition of phosphate from fertilizers can displace glyphosate from the soils and this could be the cause of decreased productivity of some crops.

  4. Influence of glyphosate in planktonic and biofilm growth of Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Ilana Schneider Lima

    2014-09-01

    Full Text Available This study evaluated the impact of different concentrations of glyphosate (Rondup® on planktonic and biofilm growth of P. aeruginosa. Aerobic and anaerobic cultures of P. aeruginosa ATCC®15442 inoculated in MHB + glyphosate (0.845 ppm, 1.690 ppm, 8.45 ppm, 16.90 ppm, 84.50 ppm, 169 ppm, 845 ppm, and 1690 ppm and cultured in normoxia and anoxia, following their OD560nm every hour for 24 h. Biofilms of adapted cells were formed in the presence of glyphosate (0.845 to 1690 ppm in normoxia and anoxia for 36 h. Glyphosate at concentrations higher than 84.5 ppm reduces the cell density of planktonic aerobic cultures (p 0.05, and more pronounced over 169 ppm. Anaerobic biofilms have their growth more readily favored (p < 0.05, regardless of concentration. In a concentration-dependent manner, glyphosate interferes with the growth ability of P. aeruginosa ATCC®15442.

  5. Monitoring glyphosate and AMPA concentrations in wells and drains using the sorbicell passive sampler

    DEFF Research Database (Denmark)

    Vendelboe, Anders Lindblad; de Jonge, Hubert; Møldrup, Per

    2012-01-01

    Glyphosate is one of the world’s most extensively used weed control agents. Glyphosate, and its metabolite aminomethylphosphonic acid (AMPA), are suspected to be hazardous to human health and the aquatic environment. In Denmark, the extensive use has resulted in an increasing number of occurrences......Cell, will decrease the workload and number of samples freeing up funds for larger monitoring programs. When installed in a well the SorbiCell will continuously sample the water giving either a flux-weighed or time-weighted average measurement of the glyphosate/AMPA concentration throughout the sampling period....... It may therefore be possible to measure lower concentrations as the glyphosate/AMPA sorbed in the SorbiCell is an accumulated measurement. Also, glyphosate/AMPA associated with sudden flush events will be detected by the SorbiCells, while such events may pass between two consecutive grab samples...

  6. Is the growth stimulation by low doses of glyphosate sustained over time?

    International Nuclear Information System (INIS)

    Cedergreen, Nina

    2008-01-01

    The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha -1 , corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses -1 . This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time

  7. Is the growth stimulation by low doses of glyphosate sustained over time?

    Energy Technology Data Exchange (ETDEWEB)

    Cedergreen, Nina [Department of Agricultural Sciences, Faculty of Life Science, University of Copenhagen, Hojbakkegard Alle 13, 2630 Tastrup (Denmark)], E-mail: ncf@life.ku.dk

    2008-12-15

    The herbicide, glyphosate, has been shown to stimulate growth in a range of species when applied at doses of 5-60 g a.e. ha{sup -1}, corresponding to realistic spray drift events. This study investigates growth of shoot parameters over time to detect whether the glyphosate induced growth increase was sustained and had a final effect on reproduction. The results showed that an actual biomass growth rate increase took place within the first week after spraying with glyphosate doses <60 g a.e. ha{sup -1}. This initial growth boost kept treated plants larger than untreated plants for up to six weeks, but at harvest there was no significant difference between control plants and treated plants. Possible effects of glyphosate hormesis on the competitive ability of spray drift affected plants are discussed. - Glyphosate induced hormesis in barley is not sustained over time.

  8. On the International Agency for Research on Cancer classification of glyphosate as a probable human carcinogen.

    Science.gov (United States)

    Tarone, Robert E

    2018-01-01

    The recent classification by International Agency for Research on Cancer (IARC) of the herbicide glyphosate as a probable human carcinogen has generated considerable discussion. The classification is at variance with evaluations of the carcinogenic potential of glyphosate by several national and international regulatory bodies. The basis for the IARC classification is examined under the assumptions that the IARC criteria are reasonable and that the body of scientific studies determined by IARC staff to be relevant to the evaluation of glyphosate by the Monograph Working Group is sufficiently complete. It is shown that the classification of glyphosate as a probable human carcinogen was the result of a flawed and incomplete summary of the experimental evidence evaluated by the Working Group. Rational and effective cancer prevention activities depend on scientifically sound and unbiased assessments of the carcinogenic potential of suspected agents. Implications of the erroneous classification of glyphosate with respect to the IARC Monograph Working Group deliberative process are discussed.

  9. Additive effects of the herbicide glyphosate and elevated temperature on the branched coral Acropora formosa in Nha Trang, Vietnam.

    Science.gov (United States)

    Amid, C; Olstedt, M; Gunnarsson, J S; Le Lan, H; Tran Thi Minh, H; Van den Brink, P J; Hellström, M; Tedengren, M

    2018-05-01

    The combined effects of the herbicide glyphosate and elevated temperature were studied on the tropical staghorn coral Acropora formosa, in Nha Trang bay, Vietnam. The corals were collected from two different reefs, one close to a polluted fish farm and one in a marine-protected area (MPA). In the laboratory, branches of the corals were exposed to the herbicide glyphosate at ambient (28 °C) and at 3 °C elevated water temperatures (31 °C). Effects of herbicide and elevated temperature were studied on coral bleaching using photography and digital image analysis (new colorimetric method developed here based on grayscale), chlorophyll a analysis, and symbiotic dinoflagellate (Symbiodinium, referred to as zooxanthellae) counts. All corals from the MPA started to bleach in the laboratory before they were exposed to the treatments, indicating that they were very sensitive, as opposed to the corals collected from the more polluted site, which were more tolerant and showed no bleaching response to temperature increase or herbicide alone. However, the combined exposure to the stressors resulted in significant loss of color, proportional to loss in chlorophyll a and zooxanthellae. The difference in sensitivity of the corals collected from the polluted site versus the MPA site could be explained by different symbiont types: the resilient type C3u and the stress-sensitive types C21 and C23, respectively. The additive effect of elevated temperatures and herbicides adds further weight to the notion that the bleaching of coral reefs is accelerated in the presence of multiple stressors. These results suggest that the corals in Nha Trang bay have adapted to the ongoing pollution to become more tolerant to anthropogenic stressors, and that multiple stressors hamper this resilience. The loss of color and decrease of chlorophyll a suggest that bleaching is related to concentration of chloro-pigments. The colorimetric method could be further fine-tuned and used as a precise, non

  10. Influence of foliar fertilization with manganese on germination, vigor and storage time of RR soybean seeds

    Directory of Open Access Journals (Sweden)

    Vanessa Leonardo Ignácio

    2015-10-01

    Full Text Available ABSTRACTThis study aimed to evaluate the influence of foliar fertilizer doses containing Mn of phenological stages of suggested application in RR soybeans, to recover management damages with glyphosate at postemergence application on seed vigor in post-harvest and post six months storage. The seeds originated from a field experiment conducted , which included two applications of glyphosate, concomitant with foliar fertilizer in growth stages V4 and V6, with 0.00, 113.50 and 227.00 mg ha-1doses of Mn2+. Germination, GSI (Germination Speed Index, electrical conductivity tests and the first count of seeds were conducted. The application of Mn did not affect the physiological quality of RR soy in postharvest. However, in post-storage, higher doses of Mn had a negative effect on tests of abnormal seedlings, GSI and electrical conductivity. The applications of Mn, regardless of the developmental stage, did not interfere in the germination and first count tests, with and without storage. The electrical conductivity test showed a higher correlation with the seed germination test in the post-harvest treatment.

  11. Nutritional requirements for soybean cyst nematode

    Science.gov (United States)

    Soybeans [Glycine max] are the second largest cash crop in US Agriculture, but the soybean yield is compromised by infections from Heterodera glycines, also known as Soybean Cyst Nematodes [SCN]. SCN are the most devastating pathogen or plant disease soybean producers confront. This obligate parasi...

  12. Assessment of the levels of N- (Phosphonomethyl) glycine glyphosate in selected glyphosate-based herbicides on the Ghanaian market

    International Nuclear Information System (INIS)

    Iddrisu, Adisatu

    2016-07-01

    Sixty one (61) samples of Glyphosate based herbicides were collected from the central commercial hub of Kumasi (Kejetia) and ware houses of importers in Ashanti and Greater Accra regions of Ghana and analyzed using high performance liquid chromatography (HPLC). Information about the efficacy of the numerous Glyphosate herbicides on the market was also collected by way of questionnaire. Results of the analysis indicated that only ten (16.4 %) out of the sixty one samples met the Environmental Protection Agency’s requirement of ±5 % of the stated active ingredient concentration and 51 samples representing 83.6 % were all out of the acceptable range. Active ingredient was either understated or overstated. About 21.6 % of the samples that failed to meet requirements were overstated and 78.4 % were understated. Apart from a few of the samples that had concentrations higher than stated label claims with 69 g/L (19.2 %) highest, most samples were generally lower than stated label claims. Some (G09, G18 and G44) samples contained virtually no active ingredient with shortfalls as high as 98.6%. Some of these shortfalls explained findings from the field investigations where some respondents complained of Glyphosate not being efficacious. Farmers may follow the application and safety instructions but this only holds true as long as the herbicides provide efficient control of weed. This can only be achieved with products of consistently high quality. This study also discovered that, there was no possibility of adulteration of the herbicide along the value chain as results for products picked from ware houses of importers did not differ much from those picked from the open market. Results from the other method employed in Glyphosate determination was UV/VIV spectroscopy, this method is simpler and faster and readily available in most laboratories in Ghana. Results from UV/VIS were comparable to that of the HPLC with generally lower values for UV/VIS readings. It is therefore

  13. Legumes and forage species sole or intercropped with corn in soybean-corn succession in midwestern Brazil

    Directory of Open Access Journals (Sweden)

    Gessí Ceccon

    2013-02-01

    Full Text Available The feasibility of no-tillage in the Cerrado (Savanna-like vegetation of Brazil depends on the production of sufficient above-ground crop residue, which can be increased by corn-forage intercropping. This study evaluated how above-ground crop residue production and yields of soybean and late-season corn in a soybean-corn rotation were influenced by the following crops in the year before soybean: corn (Zea mays L. intercropped with Brachiaria (Urochloa brizantha cv. Marandu, B. decumbens cv. Basilisk, B. ruziziensis, cv. comum., Panicummaximum cv. Tanzânia, sunn hemp (Crotalaria juncea L., pigeon pea [Cajanus cajan (L. Millsp]; sole corn, forage sorghum [Sorghum bicolor (L. Moench (cv. Santa Elisa], and ruzi grass. In March 2005, corn and forage species were planted in alternate rows spaced 0.90 m apart, and sole forage species were planted in rows spaced 0.45 m apart. In October 2005, the forages were killed with glyphosate and soybean was planted. After the soybean harvest in March 2006, sole late-season corn was planted in the entire experimental area. Corn grain and stover yields were unaffected by intercropping. Above-ground crop residue was greater when corn was intercropped with Tanzania grass (10.7 Mg ha-1, Marandu (10.1 Mg ha-1, and Ruzi Grass (9.8 Mg ha-1 than when corn was not intercropped (4.0 Mg ha-1. The intercropped treatments increased the percentage of soil surface covered with crop residue. Soybean and corn grain yields were higher after sole ruzi grass and intercropped ruzi grass than after other crops. The intercropping corn with Brachiaria spp. and corn with Panicum spp. increases above-ground crop residue production and maintains nutrients in the soil without reducing late-season corn yield and the viability of no-till in the midwestern region of Brazil.

  14. APPLICATION OF MOLECULAR METHODS IN SOYBEAN BREEDING PROGRAM AT THE AGRICULTURAL INSTITUTE OSIJEK (CROATIA

    Directory of Open Access Journals (Sweden)

    Aleksandra Sudarić

    2008-09-01

    Full Text Available The soybean breeding work at the Agricultural Institute Osijek has focused on the permanently development of high-yielding cultivars with genetic yield potential of 5-6 t/ha, satisfactory grain quality (protein and oil content, high tolerance to the principal diseases (Peronospora manshurica, Sclerotinia sclerotiorum, Diaporthe/Phomopsis complex, high resistance to lodging, stress conditions over vegetation and pod shattering as well as satisfactory stability in level and quality of grain and wide adaptability. Results of this continued and intensive breeding work are 36 registered cultivars which significantly contributed and contribute to the development, improving and increasing of soybean production in Republic of Croatia. Further genetic improvement of soybean cultivars is based on the modern breeding strategies including combination of conventional breeding methods and recent chemical, biochemical, phytopathology and molecular analyses. Regarding to molecular analyses, in recent years, in the frame of the soybean breeding program has initiated by application of molecular markers technology as criterion for estimation genetic diversity for both soybean germplasm and pathogens from Diaporthe/Phomopsis complex on soybean, as well. The initial fingerprinting of several OS soybean genotypes has performed in collaboration with the University of Guelph (Canada in their biomolecular laboratory using simple sequence repeats (SSR. The obtained results enabled new access in choosing parental pairs. Combining molecular markers technique with pedigree information, phenotypic markers and statistical procedure has provided a useful tool for more accurate and complete evaluation of genetic diversity and its more effective utilization into current soybean breeding program. The detection of pathogens from Diaporthe/Phomopsis complex on soybean on molecular level has performed in collaboration with the Istituto Sperimentale per la Patologia Vegetale (Rome

  15. Soybean biomass produced in Argentina

    DEFF Research Database (Denmark)

    Semino, Stella Maris; Paul, Helena; Tomei, Julia

    2009-01-01

    Soybean biomass for biodiesel, produced in Argentina amongst other places, is considered by some to reduce greenhouse gas emissions and mitigate climate change when compared with fossil fuel. To ensure that the production of biofuels is ‘sustainable', EU institutions and national governments...... are currently designing certification schemes for the sustainable production of biomass. This paper questions the validity of proposed environmental standards, using the production of Argentine soybean as a case study. The production of soybean production is associated with profound environmental impacts...

  16. Evaluation of high yielding soybean germplasm under water limitation.

    Science.gov (United States)

    Prince, Silvas J; Murphy, Mackensie; Mutava, Raymond N; Zhang, Zhengzhi; Nguyen, Na; Kim, Yoon Ha; Pathan, Safiullah M; Shannon, Grover J; Valliyodan, Babu; Nguyen, Henry T

    2016-05-01

    Limited information is available for soybean root traits and their plasticity under drought stress. To date, no studies have focused on examining diverse soybean germplasm for regulation of shoot and root response under water limited conditions across varying soil types. In this study, 17 genetically diverse soybean germplasm lines were selected to study root response to water limited conditions in clay (trial 1) and sandy soil (trial 2) in two target environments. Physiological data on shoot traits was measured at multiple crop stages ranging from early vegetative to pod filling. The phenotypic root traits, and biomass accumulation data are collected at pod filling stage. In trial 1, the number of lateral roots and forks were positively correlated with plot yield under water limitation and in trial 2, lateral root thickness was positively correlated with the hill plot yield. Plant Introduction (PI) 578477A and 088444 were found to have higher later root number and forks in clay soil with higher yield under water limitation. In sandy soil, PI458020 was found to have a thicker lateral root system and higher yield under water limitation. The genotypes identified in this study could be used to enhance drought tolerance of elite soybean cultivars through improved root traits specific to target environments. © 2015 Institute of Botany, Chinese Academy of Sciences.

  17. Detection of genetically modified soybean in crude soybean oil.

    Science.gov (United States)

    Nikolić, Zorica; Vasiljević, Ivana; Zdjelar, Gordana; Ðorđević, Vuk; Ignjatov, Maja; Jovičić, Dušica; Milošević, Dragana

    2014-02-15

    In order to detect presence and quantity of Roundup Ready (RR) soybean in crude oil extracted from soybean seed with a different percentage of GMO seed two extraction methods were used, CTAB and DNeasy Plant Mini Kit. The amplifications of lectin gene, used to check the presence of soybean DNA, were not achieved in all CTAB extracts of DNA, while commercial kit gave satisfactory results. Comparing actual and estimated GMO content between two extraction methods, root mean square deviation for kit is 0.208 and for CTAB is 2.127, clearly demonstrated superiority of kit over CTAB extraction. The results of quantification evidently showed that if the oil samples originate from soybean seed with varying percentage of RR, it is possible to monitor the GMO content at the first stage of processing crude oil. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Glyphosate efficacy on sourgrass biotypes with suspected resistance collected in GR-crop fields

    Directory of Open Access Journals (Sweden)

    Hellen Martins da Silveira

    2017-11-01

    Full Text Available In Brazil, infestations of crop areas with glyphosate-resistant (GR sourgrass (Digitaria insularis (L. Fedde biotypes has risen significantly, increasing crop production costs. Glyphosate efficacy on three biotypes (GO, BA and MT of sourgrass with suspected resistance was evaluated. A susceptible biotype (MG was used as the control. The results confirmed that the MG and GO biotypes were susceptible to glyphosate (control > 90%. The MG biotype exhibited growth reduction and mortality by 50% (GR50 and LD50, respectively with mean glyphosate doses of 243.7 and 431.6 g ae ha-1. The resistance index of the biotypes with suspected resistance ranged from 2.8 to 6.1 in relation to GR50 and between 1.4 to 26.7 in relation to LD50. The glyphosate susceptibility ranking of the sourgrass biotypes was MG < GO < MT < BA. The MT and BA biotypes demonstrated high glyphosate resistance levels, and the GO biotype had a high potential to develop resistance. Farmers should avoid the application of glyphosate overdoses to minimize the selection pressure on weeds.

  19. Effects of glyphosate herbicide on the gastrointestinal microflora of Hawaiian green turtles (Chelonia mydas) Linnaeus.

    Science.gov (United States)

    Kittle, Ronald P; McDermid, Karla J; Muehlstein, Lisa; Balazs, George H

    2018-02-01

    In Hawaii, glyphosate-based herbicides frequently sprayed near shorelines may be affecting non-target marine species. Glyphosate inhibits aromatic amino acid biosynthesis (shikimate pathway), and is toxic to beneficial gut bacteria in cattle and chickens. Effects of glyphosate on gut bacteria in marine herbivorous turtles were assessed in vitro. When cultures of mixed bacterial communities from gastrointestinal tracts of freshly euthanized green turtles (Chelonia mydas), were exposed for 24h to six glyphosate concentrations (plus deionized water control), bacterial density was significantly lower at glyphosate concentrations≥2.2×10 -4 gL -1 (absorbance measured at 600nm wavelength). Using a modified Kirby-Bauer disk diffusion assay, the growth of four bacterial isolates (Pantoea, Proteus, Shigella, and Staphylococcus) was significantly inhibited by glyphosate concentrations≥1.76×10 -3 gL -1 . Reduced growth or lower survival of gut bacteria in green turtles exposed to glyphosate could have adverse effects on turtle digestion and overall health. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Glyphosate (Ab)sorption by Shoots and Rhizomes of Native versus Hybrid Cattail (Typha).

    Science.gov (United States)

    Zheng, Tianye; Sutton, Nora B; de Jager, Pim; Grosshans, Richard; Munira, Sirajum; Farenhorst, Annemieke

    2017-11-01

    Wetlands in the Prairie Pothole Region of North America are integrated with farmland and contain mixtures of herbicide contaminants. Passive nonfacilitated diffusion is how most herbicides can move across plant membranes, making this perhaps an important process by which herbicide contaminants are absorbed by wetland vegetation. Prairie wetlands are dominated by native cattail (Typha latifolia) and hybrid cattail (Typha x glauca). The objective of this batch equilibrium study was to compare glyphosate absorption by the shoots and rhizomes of native versus hybrid cattails. Although it has been previously reported for some pesticides that passive diffusion is greater for rhizome than shoot components, this is the first study to demonstrate that the absorption capacity of rhizomes is species dependent, with the glyphosate absorption being significantly greater for rhizomes than shoots in case of native cattails, but with no significant differences in glyphosate absorption between rhizomes and shoots in case of hybrid cattails. Most importantly, glyphosate absorption by native rhizomes far exceeded that of the absorption occurring for hybrid rhizomes, native shoots and hybrid shoots. Glyphosate has long been used to manage invasive hybrid cattails in wetlands in North America, but hybrid cattail expansions continue to occur. Since our results showed limited glyphosate absorption by hybrid shoots and rhizomes, this lack of sorption may partially explain the poorer ability of glyphosate to control hybrid cattails in wetlands.

  1. [Study of the effect of occupational exposure to glyphosate on hepatorenal function].

    Science.gov (United States)

    Zhang, F; Pan, L P; Ding, E M; Ge, Q J; Zhang, Z H; Xu, J N; Zhang, L; Zhu, B L

    2017-07-06

    Objective: To explore the effect of occupational exposure to glyphosate on hepatorenal function. Methods: 526 workers who were occupationally exposed to glyphosate from 5 glyphosate-producing factories were selected as cases; and another 442 administrative staffs who were not exposed to glyphosate were selected as controls from April to November, 2014. All the subjects accepted occupational health examination. The concentration level of glyphosate in the air of workshop was detected and the time weighted average concentration (TWA) was calculated. And analyze the difference of hepatorenal fuction between case group and control group. Result: The age of the subjects in the case and control groups were separately (35.6±10.3), (34.3±9.7) years old, with the length of working for (6.5±5.7), (7.7±6.8) years. The TWA of glyphosate in the case group was between Glyphosate can affect the hepatic and renal function among occupational exposure population, and there was an association between the effect and the exposure dose.

  2. Identification of glyphosate resistance in Salsola tragus in north-eastern Oregon.

    Science.gov (United States)

    Barroso, Judit; Gourlie, Jennifer A; Lutcher, Larry K; Liu, Mingyang; Mallory-Smith, Carol A

    2018-05-01

    Farmers in the low-rainfall region of eastern Oregon rely on repeated applications of non-selective herbicides, predominately glyphosate, to control Salsola tragus in no-till fallow systems. Reports of poor glyphosate effectiveness have increased in recent years. Reduced efficacy is often attributed to dust, water stress, or generally poor growing conditions during application. Inadequate control also may be the result of the evolution of glyphosate resistance. Therefore, studies were undertaken to determine if glyphosate-resistant S. tragus populations occur in Oregon. Results from dose-response studies confirmed glyphosate resistance in three of 10 Oregon Salsola tragus populations. The ratio I 50R /I 50S from dose-response curves was, on average, 3.1 for the relative dry biomass per plant and 3.2 for the % of surviving plants per pot in these three populations. Plant mortality at recommended glyphosate doses for the resistant populations was less than 30% 3 weeks after treatment. Glyphosate resistance in S. tragus highlights the imperative need to diversify weed control strategies to preserve the longevity and sustainability of herbicides in semi-arid cropping systems of the Pacific Northwest. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  3. Is it time to reassess current safety standards for glyphosate-based herbicides?

    Science.gov (United States)

    Vandenberg, Laura N; Blumberg, Bruce; Antoniou, Michael N; Benbrook, Charles M; Carroll, Lynn; Colborn, Theo; Everett, Lorne G; Hansen, Michael; Landrigan, Philip J; Lanphear, Bruce P; Mesnage, Robin; Vom Saal, Frederick S; Welshons, Wade V; Myers, John Peterson

    2017-06-01

    Use of glyphosate-based herbicides (GBHs) increased ∼100-fold from 1974 to 2014. Additional increases are expected due to widespread emergence of glyphosate-resistant weeds, increased application of GBHs, and preharvest uses of GBHs as desiccants. Current safety assessments rely heavily on studies conducted over 30 years ago. We have considered information on GBH use, exposures, mechanisms of action, toxicity and epidemiology. Human exposures to glyphosate are rising, and a number of in vitro and in vivo studies challenge the basis for the current safety assessment of glyphosate and GBHs. We conclude that current safety standards for GBHs are outdated and may fail to protect public health or the environment. To improve safety standards, the following are urgently needed: (1) human biomonitoring for glyphosate and its metabolites; (2) prioritisation of glyphosate and GBHs for hazard assessments, including toxicological studies that use state-of-the-art approaches; (3) epidemiological studies, especially of occupationally exposed agricultural workers, pregnant women and their children and (4) evaluations of GBHs in commercially used formulations, recognising that herbicide mixtures likely have effects that are not predicted by studying glyphosate alone. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  4. Transfer of glyphosate and its degradate AMPA to surface waters through urban sewerage systems.

    Science.gov (United States)

    Botta, Fabrizio; Lavison, Gwenaëlle; Couturier, Guillaume; Alliot, Fabrice; Moreau-Guigon, Elodie; Fauchon, Nils; Guery, Bénédicte; Chevreuil, Marc; Blanchoud, Hélène

    2009-09-01

    A study of glyphosate and aminomethyl phosphonic acid (AMPA) transfer in the Orge watershed (France) was carried out during 2007 and 2008. Water samples were collected in surface water, wastewater sewer, storm sewer and wastewater treatment plant (WWTP). These two molecules appeared to be the most frequently detected ones in the rivers and usually exceeded the European quality standard concentrations of 0.1microg L(-1) for drinking water. The annual glyphosate estimated load was 1.9 kg year(-1) upstream (agricultural zone) and 179.5 kg year(-1) at the catchment outlet (urban zone). This result suggests that the contamination of this basin by glyphosate is essentially from urban origin (road and railway applications). Glyphosate reached surface water prevalently through storm sewer during rainfall event. Maximum concentrations were detected in storm sewer just after a rainfall event (75-90 microg L(-1)). High concentrations of glyphosate in surface water during rainfall events reflected urban runoff impact. AMPA was always detected in the sewerage system. This molecule reached surface water mainly via WWTP effluent and also through storm sewer. Variations in concentrations of AMPA during hydrological episodes were minor compared to glyphosate variations. Our study highlights that AMPA and glyphosate origins in urban area are different. During dry period, detergent degradation seemed to be the major AMPA source in wastewater.

  5. Occurrence and fate of the herbicide glyphosate and its degradate aminomethylphosphonic acid in the atmosphere

    Science.gov (United States)

    Chang, Feng-Chih; Simcik, M.F.; Capel, P.D.

    2011-01-01

    This is the first report on the ambient levels of glyphosate, the most widely used herbicide in the United States, and its major degradation product, aminomethylphosphonic acid (AMPA), in air and rain. Concurrent, weekly integrated air particle and rain samples were collected during two growing seasons in agricultural areas in Mississippi and Iowa. Rain was also collected in Indiana in a preliminary phase of the study. The frequency of glyphosate detection ranged from 60 to 100% in both air and rain. The concentrations of glyphosate ranged from 3 and from <0.1 to 2.5 µg/L in air and rain samples, respectively. The frequency of detection and median and maximum concentrations of glyphosate in air were similar or greater to those of the other high-use herbicides observed in the Mississippi River basin, whereas its concentration in rain was greater than the other herbicides. It is not known what percentage of the applied glyphosate is introduced into the air, but it was estimated that up to 0.7% of application is removed from the air in rainfall. Glyphosate is efficiently removed from the air; it is estimated that an average of 97% of the glyphosate in the air is removed by a weekly rainfall ≥30 mm.

  6. Questions concerning the potential impact of glyphosate-based herbicides on amphibians.

    Science.gov (United States)

    Wagner, Norman; Reichenbecher, Wolfram; Teichmann, Hanka; Tappeser, Beatrix; Lötters, Stefan

    2013-08-01

    Use of glyphosate-based herbicides is increasing worldwide. The authors review the available data related to potential impacts of these herbicides on amphibians and conduct a qualitative meta-analysis. Because little is known about environmental concentrations of glyphosate in amphibian habitats and virtually nothing is known about environmental concentrations of the substances added to the herbicide formulations that mainly contribute to adverse effects, glyphosate levels can only be seen as approximations for contamination with glyphosate-based herbicides. The impact on amphibians depends on the herbicide formulation, with different sensitivity of taxa and life stages. Effects on development of larvae apparently are the most sensitive endpoints to study. As with other contaminants, costressors mainly increase adverse effects. If and how glyphosate-based herbicides and other pesticides contribute to amphibian decline is not answerable yet due to missing data on how natural populations are affected. Amphibian risk assessment can only be conducted case-specifically, with consideration of the particular herbicide formulation. The authors recommend better monitoring of both amphibian populations and contamination of habitats with glyphosate-based herbicides, not just glyphosate, and suggest including amphibians in standardized test batteries to study at least dermal administration. Copyright © 2013 SETAC.

  7. Molecular approaches for genetic improvement of seed quality and characterization of genetic diversity in soybean: a critical review.

    Science.gov (United States)

    Tripathi, Niraj; Khare, Dhirendra

    2016-10-01

    Soybean is an economically important leguminous crop. Genetic improvements of soybeans have focused on enhancement of seed and oil yield, development of varieties suited to different cropping systems, and breeding resistant/tolerant varieties for various biotic and abiotic stresses. Plant breeders have used conventional breeding techniques for the improvement of these traits in soybean. The conventional breeding process can be greatly accelerated through the application of molecular and genomic approaches. Molecular markers have proved to be a new tool in soybean breeding by enhancing selection efficiency in a rapid and time-bound manner. An overview of molecular approaches for the genetic improvement of soybean seed quality parameters, considering recent applications of marker-assisted selection and 'omics' research, is provided in this article.

  8. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  9. Performance of broiler chickens fed diets containing DAS-68416-4 soybean meal.

    Science.gov (United States)

    Herman, Rod A; Dunville, Christina M; Juberg, Daland R; Fletcher, Dale W; Cromwell, Gary L

    2011-01-01

    Broiler chickens are a fast growing monogastric animal commonly used to evaluate the equivalence between transgenic and non-transgenic grains as part of the human safety assessment process. While commonly viewed like other livestock feeding trials, such studies are performed with transgenic crops with input traits (that are not designed to improve nutrition) to aid regulatory authorities in evaluating safety. Studies of this type are actually more similar to toxicology studies in purpose, with sensitive endpoints like growth used to detect metabolic perturbations. DAS-68416-4 soybean expresses the aryloxyalkanoate dioxygenase-12 (AAD-12) enzyme which inactivates 2,4-diclorophenoxyacetic acid (2,4-D) and provides DAS-68416-4 soybeans tolerance to this herbicide. DAS-68416-4 also expresses the phosphinothricin acetyltransferase (PAT) enzyme from Streptomyces viridochromogenes which confers tolerance to glufosinate-ammonium herbicides. A 6-week broiler study was conducted with diets containing toasted DAS-68416-4 soybean meal (40, 36, and 32% in starter, grower and finisher diets, respectively) to evaluate nutritional wholesomeness and safety compared with conventional comparators. Toasting soybean meal is required to inactivate endogenous antinutrients making soybean suitable for consumption by monogastric animals like broiler chickens. Toasting was found to denature both the AAD-12 and PAT proteins rendering them non-detectable by enzyme linked immunosorbent assays. Broiler growth and performance parameters were measured over a 6-week period of exposure to diets containing different sources of toasted soybean meal, and results indicate that DAS-68416-4 soybean is nutritionally equivalent to non-transgenic soybean.

  10. Circadian response of annual weeds to glyphosate and glufosinate.

    Science.gov (United States)

    Martinson, Krishona B; Sothern, Robert B; Koukkari, Willard L; Durgan, Beverly R; Gunsolus, Jeffrey L

    2002-03-01

    Five field experiments were conducted in 1998 and 1999 in Minnesota to examine the influence of time of day efficacy of glyphosate [N-(phosphonomethyl)glycine] and glufosinate [2-amino-4-(hydroxymethyl-phosphinyl)butanoic acid] applications on the control of annual weeds. Each experiment was designed to be a randomized complete block with four replications using plot sizes of 3 x 9 m. Glyphosate and glufosinate were applied at rates of 0.421 kg ae/ha and 0.292 kg ai/ha, respectively, with and without an additional adjuvant that consisted of 20% nonionic surfactant and 80% ammonium sulfate. All treatments were applied with water at 94 L/ha. Times of day for the application of herbicide were 06:00h, 09:00h, 12:00h, 15:00h, 18:00h, 21:00h, and 24:00h. Efficacy was evaluated 14 d after application by visual ratings. At 14 d, a circadian response to each herbicide was found, with greatest annual weed control observed with an application occurring between 09:00h and 18:00h and significantly less weed control observed with an application at 06:00h, 21:00h, or 24:00h. The addition of an adjuvant to both herbicides increased overall efficacy, but did not overcome the rhythmic time of day effect. Results of the multiple regression analysis showed that after environmental temperature, time of day was the second most important predictor of percent weed kill. Thus, circadian timing of herbicide application significantly influenced weed control with both glyphosate and glufosinate.

  11. Effect of glyphosate on the microbial activity of two Romanian soils.

    Science.gov (United States)

    Sumalan, R M; Alexa, E; Negrea, M; Sumalan, R L; Doncean, A; Pop, G

    2010-01-01

    Glyphosate applied to soils potentially affect microbial activity. A series of field and laboratory experiments assessed the effect of this herbicide on soil microorganisms. The aim of experiments was to evaluate the effect of glyphosate application on the soil microbial community structure, function and their activity. We studied "in vitro", changes in the microbial activity of typical Chernozem and Gleysol soils, with and without applied glyphosate. The herbicide was applied at a rate of 2, respectively 4 mg kg(-1) of soil and microbial activity were measured by fluorescein diacetate (FDA) hydrolysis. We found an increase of 9 to 13% in FDA hydrolyses in the presence of glyphosate in rate of 2 mg kg (-1) compared with the same type of soil which had never received herbicide. The double quantity of glyphosate decrease soil microbial activity; the amount of hydrolyzed fluorescein is lower than the addition of 2 ppm. The greater decrease was observed in the Gleysol type where the fluorescein hydrolyzed is with 4, 85% lower than version control without glyphosate. Chemical characters of soil, influence soil biological activity when herbicide is added. In Chemozem case, rich in humus, whose predominant micro flora is represented by actinomycetes through glyphosate treatment these organisms growths of as major producers of antibiotics actinomycetes determine an inhibitory effect on eubacteria and micromycetes growth, which is highlighted by estimating a relatively small number of them. After 10 days, once with decreasing of glyphosate content in soil, decreases the number of active actinomycetes, therefore we are witnessing to a numerical growth of bacterial population. In Gleysol type the indigenous micro flora is represented by eubacteria, so when the glyphosate is added it was registered a high growth of these organisms fraction.

  12. Effect of foliar treatments on distribution of 14C-glyphosate in Convolvulus arvensis L

    International Nuclear Information System (INIS)

    Lauridson, T.C.

    1986-01-01

    Field bindweed is a perennial weed which produces shoots from buds on its roots. Herbicides, such as glyphosate [N-(phosphonomethyl)glycine] used for control of field bindweed usually do not kill all shoot buds on the roots, thus field bindweed often reinfests areas within 3 to 6 weeks of treatment. This dissertation deals with the development of a technique to change glyphosate distribution in field bindweed roots and could result in less shoot regrowth after glyphosate application. In field studies eight plant growth regulators were applied in September, 3 days before 2.24 kg/ha of 2.4-D[(2,4-dichlorophenoxy) acetic acid] or 1.68 kg/ha of glyphosate. Eight months later, regrowth of shoots was least where glyphosate was applied at 0.028 kg/ha as a pretreatment, followed by a standard rate of 1.68 kg/ha. In subsequent greenhouse studies, typical patterns of shoot growth and 14 C-glyphosate distribution in isolated root sections taken from 15-week-old intact plants were determined. In subsequent growth chamber studies, plants were decapitated to observe the effect of shoot apical dominance on 14 C-glyphosate translocation. After 14 C-glyphosate was applied, intact plants had about twice as much 14 C in distal root sections as in proximal or middle root sections. Decapitated plants had more 14 C in proximal and middle root sections than in distal sections, and about twice as much 14 C was translocated to roots of decapitated plants than intact plants. Eight concentrations of 2,4,-D or glyphosate from 1 to 5000 ppm were applied in logarithmic series to 6-week old plants

  13. Phytoplankton growth and PSII efficiency sensitivity to a glyphosate-based herbicide (Factor 540®).

    Science.gov (United States)

    Smedbol, Élise; Lucotte, Marc; Labrecque, Michel; Lepage, Laurent; Juneau, Philippe

    2017-11-01

    The use of glyphosate-based herbicides in agriculture has increased steadily since the mid 90's and there is now evidence of glyphosate leaching and contamination of aquatic ecosystems. The aim of this study was to evaluate the effects of a glyphosate-based herbicide (Factor 540 ® ) on growth and photosynthetic capacity of algae and cyanobacteria. Six algal and three cyanobacterial species/strains, of three different taxonomic groups, were exposed to five glyphosate concentrations (10, 50, 100, 500 and 1000μgl -1 ) during 48h. All species have significant growth inhibition at concentrations varying between 50 and 500μgl -1 . The photosynthetic response, after glyphosate exposure, varied among species, but a general pattern has emerged. There was an increase in the amount of photons absorbed (ABS/RC), in dissipated (DI O /RC) and trapped (TR O /RC) energy in the photosystem II reaction centers, along with a decreased of the maximum photosystem II quantum yield (F V /F M ) and electron transport per reaction center (ET O /RC). The EC 50 and LOEC values for growth and photosynthesis were calculated and established that growth was the most affected parameter by glyphosate-based herbicide, while parameter TR O /RC was the least affected. All species showed reduced growth at glyphosate concentrations lower than the Canadian standard for the protection of aquatic life, set at 800μgl -1 or the American aquatic life benchmark for acute toxicity in non vascular plants of 12 100μgl -1 questioning the validity of these thresholds in assessing the risks related to the presence of glyphosate and glyphosate-based herbicides in aquatic systems. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  14. Cancer incidence among glyphosate-exposed pesticide applicators in the Agricultural Health Study.

    Science.gov (United States)

    De Roos, Anneclaire J; Blair, Aaron; Rusiecki, Jennifer A; Hoppin, Jane A; Svec, Megan; Dosemeci, Mustafa; Sandler, Dale P; Alavanja, Michael C

    2005-01-01

    Glyphosate is a broad-spectrum herbicide that is one of the most frequently applied pesticides in the world. Although there has been little consistent evidence of genotoxicity or carcinogenicity from in vitro and animal studies, a few epidemiologic reports have indicated potential health effects of glyphosate. We evaluated associations between glyphosate exposure and cancer incidence in the Agricultural Health Study (AHS), a prospective cohort study of 57,311 licensed pesticide applicators in Iowa and North Carolina. Detailed information on pesticide use and other factors was obtained from a self-administered questionnaire completed at time of enrollment (1993-1997). Among private and commercial applicators, 75.5% reported having ever used glyphosate, of which > 97% were men. In this analysis, glyphosate exposure was defined as a) ever personally mixed or applied products containing glyphosate; b) cumulative lifetime days of use, or "cumulative exposure days" (years of use times days/year); and c) intensity-weighted cumulative exposure days (years of use times days/year times estimated intensity level). Poisson regression was used to estimate exposure-response relations between glyphosate and incidence of all cancers combined and 12 relatively common cancer subtypes. Glyphosate exposure was not associated with cancer incidence overall or with most of the cancer subtypes we studied. There was a suggested association with multiple myeloma incidence that should be followed up as more cases occur in the AHS. Given the widespread use of glyphosate, future analyses of the AHS will allow further examination of long-term health effects, including less common cancers.

  15. Evaluation of estrogen receptor alpha activation by glyphosate-based herbicide constituents.

    Science.gov (United States)

    Mesnage, Robin; Phedonos, Alexia; Biserni, Martina; Arno, Matthew; Balu, Sucharitha; Corton, J Christopher; Ugarte, Ricardo; Antoniou, Michael N

    2017-10-01

    The safety, including the endocrine disruptive capability, of glyphosate-based herbicides (GBHs) is a matter of intense debate. We evaluated the estrogenic potential of glyphosate, commercial GBHs and polyethoxylated tallowamine adjuvants present as co-formulants in GBHs. Glyphosate (≥10,000 μg/L or 59 μM) promoted proliferation of estrogen-dependent MCF-7 human breast cancer cells. Glyphosate also increased the expression of an estrogen response element-luciferase reporter gene (ERE-luc) in T47D-KBluc cells, which was blocked by the estrogen antagonist ICI 182,780. Commercial GBH formulations or their adjuvants alone did not exhibit estrogenic effects in either assay. Transcriptomics analysis of MCF-7 cells treated with glyphosate revealed changes in gene expression reflective of hormone-induced cell proliferation but did not overlap with an ERα gene expression biomarker. Calculation of glyphosate binding energy to ERα predicts a weak and unstable interaction (-4.10 kcal mol -1 ) compared to estradiol (-25.79 kcal mol -1 ), which suggests that activation of this receptor by glyphosate is via a ligand-independent mechanism. Induction of ERE-luc expression by the PKA signalling activator IBMX shows that ERE-luc is responsive to ligand-independent activation, suggesting a possible mechanism of glyphosate-mediated activation. Our study reveals that glyphosate, but not other components present in GBHs, can activate ERα in vitro, albeit at relatively high concentrations. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

    Energy Technology Data Exchange (ETDEWEB)

    Albers, Christian N., E-mail: calbers@ruc.d [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark); Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Banta, Gary T. [Dept. of Environmental, Social and Spatial Change, Roskilde University, DK-4000 Roskilde (Denmark); Hansen, Poul Erik [Dept. of Science, Systems and Models, Roskilde University, DK-4000 Roskilde (Denmark); Jacobsen, Ole S. [Dept. of Geochemistry, Geological Survey of Denmark and Greenland, DK-1350 Copenhagen (Denmark)

    2009-10-15

    Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, approx40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only approx10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

  17. The influence of organic matter on sorption and fate of glyphosate in soil - Comparing different soils and humic substances

    International Nuclear Information System (INIS)

    Albers, Christian N.; Banta, Gary T.; Hansen, Poul Erik; Jacobsen, Ole S.

    2009-01-01

    Soil organic matter (SOM) is generally believed not to influence the sorption of glyphosate in soil. To get a closer look on the dynamics between glyphosate and SOM, we used three approaches: I. Sorption studies with seven purified soil humic fractions showed that these could sorb glyphosate and that the aromatic content, possibly phenolic groups, seems to aid the sorption. II. Sorption studies with six whole soils and with SOM removed showed that several soil parameters including SOM are responsible for the strong sorption of glyphosate in soils. III. After an 80 day fate experiment, ∼40% of the added glyphosate was associated with the humic and fulvic acid fractions in the sandy soils, while this was the case for only ∼10% of the added glyphosate in the clayey soils. Glyphosate sorbed to humic substances in the natural soils seemed to be easier desorbed than glyphosate sorbed to amorphous Fe/Al-oxides. - Glyphosate was sorbed by purified humic substances and a significant amount of glyphosate was found to be associated with soil organic matter in whole soils.

  18. Metabolic and Transcriptional Reprogramming in Developing Soybean (Glycine max Embryos

    Directory of Open Access Journals (Sweden)

    Ruth Grene

    2013-05-01

    Full Text Available Soybean (Glycine max seeds are an important source of seed storage compounds, including protein, oil, and sugar used for food, feed, chemical, and biofuel production. We assessed detailed temporal transcriptional and metabolic changes in developing soybean embryos to gain a systems biology view of developmental and metabolic changes and to identify potential targets for metabolic engineering. Two major developmental and metabolic transitions were captured enabling identification of potential metabolic engineering targets specific to seed filling and to desiccation. The first transition involved a switch between different types of metabolism in dividing and elongating cells. The second transition involved the onset of maturation and desiccation tolerance during seed filling and a switch from photoheterotrophic to heterotrophic metabolism. Clustering analyses of metabolite and transcript data revealed clusters of functionally related metabolites and transcripts active in these different developmental and metabolic programs. The gene clusters provide a resource to generate predictions about the associations and interactions of unknown regulators with their targets based on “guilt-by-association” relationships. The inferred regulators also represent potential targets for future metabolic engineering of relevant pathways and steps in central carbon and nitrogen metabolism in soybean embryos and drought and desiccation tolerance in plants.

  19. Placental passage of benzoic acid, caffeine, and glyphosate in an ex vivo human perfusion system

    DEFF Research Database (Denmark)

    Mose, Tina; Kjaerstad, Mia Birkhoej; Mathiesen, Line

    2008-01-01

    group of compounds. Benzoic acid, caffeine, and glyphosate were chosen as model compounds because they are small molecules with large differences in physiochemical properties. Caffeine crossed the placenta by passive diffusion. The initial transfer rate of benzoic acid was more limited in the first part...... of the perfusion compared to caffeine, but reached the same steady-state level by the end of perfusion. The transfer of glyphosate was restricted throughout perfusion, with a lower permeation rate, and only around 15% glyphosate in maternal circulation crossed to the fetal circulation during the study period....

  20. Glyphosate Accumulation and Detrimental Effects on Coffea Arabica

    DEFF Research Database (Denmark)

    Schrübbers, Lars Christoph

    and the MS/MS system provided a limit of quantification (LOQ) below 0.1 mg/kg; the commonly used maximum residue limit (MRL) for glyphosate in plant derived food products. Glyphosate was found in all samples analyzed from different coffee fields, regardless of management practices. AMPA was not detected......Coffee is one of the most popular beverages worldwide and a highly traded commodity. In order to maintain a high yield of the perennial crop, weed competition for resources needs to be reduced. For this purpose herbicides are commonly applied, with glyphosate being one of the most prominent...

  1. Temporal Patterns of Glyphosate Leaching at a Loamy Agricultural Field in Denmark

    DEFF Research Database (Denmark)

    Nørgaard, Trine; Møldrup, Per; Olsen, Preben

    2013-01-01

    applications in combination with the effect of precipitation events, drain water runoff, soil water content at 25 cm soil depth, management, and particle leaching patterns, and compares this with monitored field-scale glyphosate and AMPA leaching to a tile drainage system. Preliminary findings indicate...... that there is an accumulation of glyphosate and AMPA in the soil after the successive applications of glyphosate, as the level of the peaking concentrations right after applications increases. Furthermore, large precipitation events with subsequent high drain water runoff together with management, especially plowing...

  2. Leaching of Glyphosate and Aminomethylphosphonic Acid from an Agricultural Field over a Twelve-Year Period

    DEFF Research Database (Denmark)

    Norgaard, Trine; Moldrup, Per; Ferré, Ty P A

    2014-01-01

    content at the time of application and the level of the groundwater table relative to the drain depth was essential for whether solutes were detected in the drainage runoff. We present a leaching risk chart to illustrate the dependence of glyphosate, AMPA, and soil particle leaching based on precipitation......, and particles. Glyphosate and AMPA leaching were highly event driven, controlled by the time and intensity of the first precipitation event after glyphosate application. A high similarity in time-accumulated curves for drainage and leached pesticide masses suggests near-constant drainage and leaching rates...

  3. Efecto de la dosis de glifosato sobre la biomasa de malezas de barbecho al estado vegetativo y reproductivo Glyphosate dose effect on weed biomass at the vegetative and reproductive stage

    Directory of Open Access Journals (Sweden)

    E. Puricelli

    2009-06-01

    Full Text Available Los experimentos se condujeron en el campo experimental de la Facultad de Ciencias Agrarias ubicado en Zavalla (Argentina durante 2005 y 2006. El objetivo de este trabajo fue estudiar la eficacia de glifosato aplicado al estado vegetativo y reproductivo de Convolvulus arvensis, Oenothera indecora, Iresine diffusa, Parietaria debilis, Rumex paraguayensis y Trifolium repens. El diseño del experimento fue completamente al azar con un arreglo factorial: año, especies, estado reproductivo y vegetativo y dosis de glifosato 48% (4X, 2X, 1X, 1/2X, 1/4X, 0X siendo X la dosis recomendada 1200 g i.a. ha-1. Se estableció la relación entre la dosis de glifosato y el control de la biomasa de las malezas a través de curvas de dosis respuesta con un modelo log-logístico. Se comparó el grado de tolerancia por medio de la DL50. En ambos estados de las malezas, la mayor DL50 obtenida para I. diffusa indica que de las especies estudiadas ésta es la más tolerante a glifosato. El número de especies tolerantes al glifosato es menor al estado vegetativo que al reproductivo.Experiments were conducted at the University of Rosario Experimental Farm, Zavalla in 2005 and 2006 to study the effect of glyphosate on the control of Convolvulus arvensis, Oenothera indecora, Iresine diffusa, Parietaria debilis, Rumex paraguayensis and Trifolium repens at the vegetative and reproductive stage. The experiments were established in a complete randomized design with the following factorial arrangement of treatments: year, species, vegetative and reproductive growth stages and glyphosate 48% (4X, 2X, 1X, 1/2X, 1/4X, 0X being 1X the recommended dose (1,200 g a.i. ha-1. The relationship between glyphosate dose and weed biomass control was established with a log-logistic model. The degree of tolerance was compared by LD50. In both stages, the higher LD50 was obtained for I. diffusa indicating that this is the species most tolerant to glyphosate among those studied. The number of

  4. Nematode pests threatening soybean production in South Africa, with reference to Meloidogyne

    Directory of Open Access Journals (Sweden)

    Hendrika Fourie

    2015-09-01

    Full Text Available The area planted to soybean in South Africa has increased by 54% since the 2009 growing season, mainly as a result of the increasing demand for protein-rich food and fodder sources. Moreover, the introduction of advanced technology, namely the availability of genetically modified herbicide tolerant soybean cultivars also contributed towards increased soybean production. The omnipresence of plant-parasitic nematodes in local agricultural soils, however, poses a threat to the sustainable expansion and production of soybean and other rotation crops. Meloidogyne incognita and M. javanica are the predominant nematode pests in local soybean production areas and those where other grain-, legume- and/or vegetable crops are grown. The lack of registered nematicides for soybean locally, crop production systems that are conducive to nematode pest build-ups as well as the limited availability of genetic host plant resistance to root-knot nematode pests, complicate their management. Research aimed at various aspects related to soybean-nematode research, namely, audits of nematode assemblages associated with the crop, identification of genetic host plant resistance in soybean germplasm to M. incognita and M. javanica, the use of molecular markers that are linked to such genetic resistance traits as well as agronomic performance of pre-released cultivars that can be valuable to producers and the industry are accentuated in this review. Evaluation of synthetically-derived as well as biological-control agents are also discussed as complementary management tactics. It is important that lessons learned through extensive research on soybean-nematode interactions in South Africa be shared with researchers and industries in other countries as they might experience or expect similar problems and/or challenges.

  5. Dig1 protects against cell death provoked by glyphosate-based herbicides in human liver cell lines

    Directory of Open Access Journals (Sweden)

    Travert Carine

    2010-10-01

    Full Text Available Abstract Background Worldwide used pesticides containing different adjuvants like Roundup formulations, which are glyphosate-based herbicides, can provoke some in vivo toxicity and in human cells. These pesticides are commonly found in the environment, surface waters and as food residues of Roundup tolerant genetically modified plants. In order to know their effects on cells from liver, a major detoxification organ, we have studied their mechanism of action and possible protection by precise medicinal plant extracts called Dig1. Methods The cytotoxicity pathways of four formulations of glyphosate-based herbicides were studied using human hepatic cell lines HepG2 and Hep3B, known models to study xenobiotic effects. We monitored mitochondrial succinate dehydrogenase activity and caspases 3/7 for cell mortality and protection by Dig1, as well as cytochromes P450 1A1, 1A2, 3A4 and 2C9 and glutathione-S-transferase to approach the mechanism of actions. Results All the four Roundup formulations provoke liver cell death, with adjuvants having stronger effects than glyphosate alone. Hep3B are 3-5 times more sensitive over 48 h. Caspases 3/7 are greatly activated in HepG2 by Roundup at non-cytotoxic levels, and some apoptosis induction by Roundup is possible together with necrosis. CYP3A4 is specifically enhanced by Roundup at doses 400 times less than used in agriculture (2%. CYP1A2 is increased to a lesser extent together with glutathione-S-transferase (GST down-regulation. Dig 1, non cytotoxic and not inducing caspases by itself, is able to prevent Roundup-induced cell death in a time-dependant manner with an important efficiency of up to 89%, within 48 h. In addition, we evidenced that it prevents Caspases 3/7 activation and CYP3A4 enhancement, and not GST reduction, but in turn it slightly inhibited CYP2C9 when added before Roundup. Conclusion Roundup is able to provoke intracellular disruption in hepatic cell lines at different levels, but a

  6. Nutritional value of raw soybeans, extruded soybeans, roasted soybeans and tallow as fat sources in early lactating dairy cows.

    Science.gov (United States)

    Amanlou, H; Maheri-Sis, N; Bassiri, S; Mirza-Aghazadeh, A; Salamatdust, R; Moosavi, A; Karimi, V

    2012-01-01

    Thirty multiparous Holstein cows (29.8 ± 4.01days in milk; 671.6 ± 31.47 kg of body weight) were used in a completely randomized design to compare nutritional value of four fat sources including tallow, raw soybeans, extruded soybeans and roasted soybeans for 8 weeks. Experimental diets were a control containing 27.4 % alfalfa silage, 22.5% corn silage, and 50.1% concentrate, and four diets with either tallow, raw soybean, extruded soybean, or roasted soybean added to provide 1.93% supplemental fat. Dry matter and NEL intakes were similar among treatments, while cows fed fat diets had significantly (Pfat. Supplemental fat, whether tallow or full fat soybeans increased milk production (1.89-2.45 kg/d; PMilk fat yield and percentage of cows fed fat-supplemented diets were significantly (Pfat-supplemented diets, roasted soybean caused highest milk fat yield and extruded soybean caused lowest milk fat yield. There was no significant effect of supplemental fat on the milk protein and lactose content and yield. Feed efficiency of fat-supplemented diets was significantly (Pfat sources on production response of cows, fat originating from heat-treated soybean help to minimize imported RUP (rumen undegradable protein) sources level as fish meal in comparison with tallow and raw soybean oil. In the Current study, there was no statistical significance among nutritional values of oil from extruded soybeans and roasted soybeans.

  7. Glyphosate behavior at soil and mineral-water interfaces

    International Nuclear Information System (INIS)

    Pessagno, Romina C.; Torres Sanchez, Rosa M.; Santos Afonso, Maria dos

    2008-01-01

    Adsorption isotherms and surface coverage of glyphosate, N-phosphonomethylglycine (PMG), in aqueous suspensions of three Argentine soils with different mineralogical composition were measured as a function of PMG concentration and pH. Zeta potential curves for PMG/soils system were also determined. Montmorillonite and soil sample surface charges were negative and increased as the amount of adsorbed PMG increased, showing that the surface complexes are more negative than those formed during the surface protonation. PMG adsorption on soils were described using Langmuir isotherms and the affinity constants, and the maximum surface coverage was estimated at pH 4 and 7 using a two-term Langmuir isotherm, the mineralogical composition percentages, and maximum surface coverage and Langmuir constants for pure minerals. The influence of organic matter (OM) and iron content of soils on the PMG adsorption was evaluated. The surface coverage of PMG decreased when the OM and iron content decreased for minerals and soils. - Adsorption isotherms, surface coverage and zeta potential curves of glyphosate in aqueous suspensions of montmorillonite and three Argentine soils were measured as a function of PMG concentration and pH

  8. Glyphosate behavior at soil and mineral-water interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Pessagno, Romina C. [INQUIMAE and Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria Pabellon II, (C1428EHA) Buenos Aires (Argentina)], E-mail: rpessagno@qi.fcen.uba.ar; Torres Sanchez, Rosa M. [CETMIC, CC 49, (B1896ZCA) M.B. Gonnet, Buenos Aires Province (Argentina)], E-mail: rosats@cetmic.unlp.edu.ar; Santos Afonso, Maria dos [INQUIMAE and Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria Pabellon II, (C1428EHA) Buenos Aires (Argentina)], E-mail: dosantos@qi.fcen.uba.ar

    2008-05-15

    Adsorption isotherms and surface coverage of glyphosate, N-phosphonomethylglycine (PMG), in aqueous suspensions of three Argentine soils with different mineralogical composition were measured as a function of PMG concentration and pH. Zeta potential curves for PMG/soils system were also determined. Montmorillonite and soil sample surface charges were negative and increased as the amount of adsorbed PMG increased, showing that the surface complexes are more negative than those formed during the surface protonation. PMG adsorption on soils were described using Langmuir isotherms and the affinity constants, and the maximum surface coverage was estimated at pH 4 and 7 using a two-term Langmuir isotherm, the mineralogical composition percentages, and maximum surface coverage and Langmuir constants for pure minerals. The influence of organic matter (OM) and iron content of soils on the PMG adsorption was evaluated. The surface coverage of PMG decreased when the OM and iron content decreased for minerals and soils. - Adsorption isotherms, surface coverage and zeta potential curves of glyphosate in aqueous suspensions of montmorillonite and three Argentine soils were measured as a function of PMG concentration and pH.

  9. Glyphosate: useful, dangerous? To license or to phase out?

    Directory of Open Access Journals (Sweden)

    Karl Ernst v. Mühlendahl, Matthias Otto

    2016-12-01

    Full Text Available Glyphosate, a herbicide blocking an enzyme essential for all plants, but not for animals and humans, has certain advantages as compared to other plant protection products. It is not persistent. Due to the production and application of more than 700.000 tons per year, large portions of mankind are exposed. The International Agency on Research on Cancer (IARC of the World Health Organisation (WHO has looked more closely on glyphosate and has classified it as “probably carcinogenic for humans (2A” The German Bundesamt für Risikobewertung (BfR and the European Food Safety Authority (EFSA have analysed the data and contradict the IARC classification. In this paper, the process of decision finding and essential arguments for the contradictory classification are commented. In the ensuing public discussions, conflicts could have been rationalized if the BfR and the EFSA had offered more transparency regarding their evaluation and had restricted their opinions and their proposals to their genuine task: to propose regulations concerning the risks (which follow from possible hazards.

  10. Crescimento em vasos, de cultivares de soja e de trigo em função da saturação de alumínio Tolerance of soybean and wheat varieties in sub-soil high in exchangeable aluminum

    Directory of Open Access Journals (Sweden)

    H.A.A. Mascarenhas

    1995-08-01

    Full Text Available Um dos problemas que a acidez do solo causa às plantas é concentrar alguns elementos químicos em nível tóxico, como por exemplo de alumínio (Al e manganês. Visando estudar esse aspecto, foi conduzido um experimento em casa de vegetação, utilizando-se amostra de subsolo, classificado como Latossolo Vermelho Amarelo fase rasa, de extrema acidez e alto teor de Al trocáveL A acidez do substrato foi neutralizada com doses de hidróxido de cálcio, no intuito de reduzir a saturação de Al originalmente de 67 para 45, 30, e 15%. As incubações e os cultivos foram feitos em vasos contendo 6 kg daquele subsolo. Inicialmente foi testada a soja variedades Biloxi, Davis e Santa Rosa, com medições de: altura das plantas, número de nós, tamanho dos internódios, número de folhas trifoliadas, produção de matéria seca da parte aérea e das raízes. Imediatamente após, o sub-solo foi cultivado com trigo variedades BH-1146 e Siete Cerros, sendo medido o comprimento dos seus sistemas radiculares. Verificou-se para a soja que não houve diferenças significativas dentro de cada variedade para as saturações de Al estudadas, evidenciando que todas foram tolerantes ao AL As raízes do trigo BH-1146 não mostraram redução no desenvolvimento em quaisquer saturações de Al. Por outro lado, as da v. Siete Cerros mostraram menor comprimento à medida que se aumentou a saturação de Al, provando sua suscetibilidade a esse elemento.A pot experiment was installed in a greenhouse using an acid sub-soil, classified as a Red Yellow Latosol, shallow phase, high hi aluminum and very low in phosphorus availabilities. The soil acidity was neutralized using calcium hidroxide to reduce the original aluminum saturation of 67 to 45, 30 and 15%. The quantity of subsoil used per pot was 6 kg and 60 kg/ha of P2O5 were applied hi the form of superphosphate. The varieties of soybeans utilized were Biloxi, Davis and Santa Rosa. The results showed that whichever

  11. Differential content of glyphosate and its metabolites in Digitaria insularis biotypes

    Directory of Open Access Journals (Sweden)

    Leonardo Bianco de Carvalho

    2013-07-01

    Full Text Available Experiments were carried out in controlled conditions to analyze the role of metabolism of glyphosate in Digitaria insularis (sourgrass biotypes with differential response to the herbicide. Contents of glyphosate, aminomethylphosphonic acid (AMPA, glyoxylate, and sarcosine was detected in leaf tissues by using reversed-polarity capillarity electrophoresis. Glyphosate content in the A biotype increased from 19.7 up to 65.5 µg g fresh weight-1, whereas decreasing from 19.9 down to 5.0 µg g fresh weight-1 in the B biotype, from 48 up to 168 hours after treatment. At 168 hours after treatment, percentage of the sum of AMPA, glyoxylate, and sarcosine was > 56% in the B biotype, whereas a small percentage of metabolites (< 10% was found in the A biotype. Thus, the faster herbicide degradation in the B biotype is evidence that a differential metabolism of glyphosate can be conferring its lesser susceptibility to the herbicide.

  12. Glyphosate herbicide affects belowground interactions between earthworms and symbiotic mycorrhizal fungi in a model ecosystem

    Science.gov (United States)

    Zaller, Johann G.; Heigl, Florian; Ruess, Liliane; Grabmaier, Andrea

    2014-01-01

    Herbicides containing glyphosate are widely used in agriculture and private gardens, however, surprisingly little is known on potential side effects on non-target soil organisms. In a greenhouse experiment with white clover we investigated, to what extent a globally-used glyphosate herbicide affects interactions between essential soil organisms such as earthworms and arbuscular mycorrhizal fungi (AMF). We found that herbicides significantly decreased root mycorrhization, soil AMF spore biomass, vesicles and propagules. Herbicide application and earthworms increased soil hyphal biomass and tended to reduce soil water infiltration after a simulated heavy rainfall. Herbicide application in interaction with AMF led to slightly heavier but less active earthworms. Leaching of glyphosate after a simulated rainfall was substantial and altered by earthworms and AMF. These sizeable changes provide impetus for more general attention to side-effects of glyphosate-based herbicides on key soil organisms and their associated ecosystem services. PMID:25005713

  13. The effect of glyphosate on import into a sink leaf of sugar beet

    International Nuclear Information System (INIS)

    Shieh, Wenjang; Geiger, D.R.

    1990-01-01

    The basis for glyphosate inducted limitation of carbon import into developing leaves was studied in sugar beet. To separate the effects of the herbicide on export from those on import, glyphosate was supplied to a developing leaf from two exporting source leaves which fed the sink leaf. Carbon import into the sink leaf was determined by supplying 14 CO 2 to a third source leaf which also supplies carbon to the monitored sink leaf. Import into the sink leaf decreased within 2 to 3 h after glyphosate application, even though photosynthesis and export in the source leaf supplying 14 C were unaffected. Reduced import into the sink leaf was accompanied by increased import by the tap root. Elongation of the sink leaf was only slightly decreased following arrival of glyphosate. Photosynthesis by the sink leaf was not inhibited. The results to data support the view that import is slowed by the inhibition of synthesis of structural or storage compounds in the developing leaves

  14. Influence of palm oil on the efficacy of glyphosate in the control of Cyperus rotondus L

    International Nuclear Information System (INIS)

    Mohamad, R.B.; Dzolkhifli Omar

    1998-01-01

    The influence of the addition of palm oil to the formulation on the efficacy of glyphosate for the control of Cyperus rotundus was evaluated in the laboratory, glass-house and field. Triton X-100 failed to maintain a stable emulsion of palm oil in the formulation 10 minutes after mixing. In glass-house experiments adding mineral oil and palm oil to the glyphosate spray mixture did not increase the herbicidal efficacy. In general, glyphosate was more effective when sprayed at the volume application rate of 100 L/ha than at 400 L/ha. In contrast to the glass-house studies, in the field trial the addition of palm oil increased the efficacy of glyphosate. (author)

  15. Stimulation of bacteria and protists in rhizosphere of glyphosate-treated barley

    DEFF Research Database (Denmark)

    Imparato, Valentina; Santos, Susana; Johansen, Anders

    2016-01-01

    and protist communities to foliar application of glyphosate, we measured bacterial and protist abundance, diversity and physiological status, as well as soil organic carbon. Foliar application of glyphosate doubled bacterial abundance of the culturable fraction present in the rhizosphere compared to the other...... treatments with no effect on total abundance. Also the abundance of culturable protists increased as an effect of glyphosate and the bacterial genetic diversity as revealed by 16S rDNA DGGE analysis was affected. Overall, the results indicate that when barley leaves are treated with glyphosate......, the availability of organic carbon in the rhizosphere of the dying roots is altered, which in turn may alter the bacterial and protist communities and their interactions. This can have implications for general soil carbon turnover processes and CO2 release in arable systems....

  16. Potential use of Lemna minor for the phytoremediation of isoproturon and glyphosate.

    Science.gov (United States)

    Dosnon-Olette, Rachel; Couderchet, Michel; Oturan, Mehmet A; Oturan, Nihal; Eullaffroy, Philippe

    2011-07-01

    Pesticides are being detected in water bodies on an increasingly frequent basis. The present study focused on toxicity and phytoremediation potential of aquatic plants to remove phytosanitary products from contaminated water. We investigated the capacity of Lemna minor (L. minor) to eliminate two herbicides isoproturon and glyphosate from their medium. Since phytoremediation relies on healthy plants, pesticide toxicity was evaluated by exposing plants to 5 concentrations (0-20 microg L(-1) for isoproturon and 0-120 microg L(-1) for glyphosate) in culture media for 4 d using growth rate and chlorophyll a fluorescence as endpoints. At exposure concentrations of 10 microg x L(-1) for isoproturon and 80 microg x L(-1) for glyphosate, effects on growth rate and chlorophyll fluorescence were minor (isoproturon and glyphosate, respectively.

  17. Glyphosate-Induced Specific and Widespread Perturbations in the Metabolome of Soil Pseudomonas Species

    Directory of Open Access Journals (Sweden)

    Ludmilla Aristilde

    2017-06-01

    Full Text Available Previous studies have reported adverse effects of glyphosate on crop-beneficial soil bacterial species, including several soil Pseudomonas species. Of particular interest is the elucidation of the metabolic consequences of glyphosate toxicity in these species. Here we investigated the growth and metabolic responses of soil Pseudomonas species grown on succinate, a common root exudate, and glyphosate at different concentrations. We conducted our experiments with one agricultural soil isolate, P. fluorescens RA12, and three model species, P. putida KT2440, P. putida S12, and P. protegens Pf-5. Our results demonstrated both species- and strain-dependent growth responses to glyphosate. Following exposure to a range of glyphosate concentrations (up to 5 mM, the growth rate of both P. protegens Pf-5 and P. fluorescens RA12 remained unchanged whereas the two P. putida strains exhibited from 0 to 100% growth inhibition. We employed a 13C-assisted metabolomics approach using liquid chromatography-mass spectrometry to monitor disruptions in metabolic homeostasis and fluxes. Profiling of the whole-cell metabolome captured deviations in metabolite levels involved in the tricarboxylic acid cycle, ribonucleotide biosynthesis, and protein biosynthesis. Altered metabolite levels specifically in the biosynthetic pathway of aromatic amino acids (AAs, the target of toxicity for glyphosate in plants, implied the same toxicity target in the soil bacterium. Kinetic flux experiments with 13C-labeled succinate revealed that biosynthetic fluxes of the aromatic AAs were not inhibited in P. fluorescens Pf-5 in the presence of low and high glyphosate doses but these fluxes were inhibited by up to 60% in P. putida KT2440, even at sub-lethal glyphosate exposure. Notably, the greatest inhibition was found for the aromatic AA tryptophan, an important precursor to secondary metabolites. When the growth medium was supplemented with aromatic AAs, P. putida S12 exposed to a lethal

  18. Glyphosate and AMPA in U.S. streams, groundwater, precipitation and soils

    Science.gov (United States)

    Battaglin, William A.; Meyer, Michael T.; Kuivila, Kathryn; Dietze, Julie E.

    2014-01-01

    Herbicides containing glyphosate are used in more than 130 countries on more than 100 crops. In the United States (U.S.), agricultural use of glyphosate [N-(phosphonomethyl)glycine] has increased from less than 10,000 metric tons per year (active ingredient) in 1993 to more than 70,000 metric tons per year in 2006. In 2006, glyphosate accounted for about 20 percent of all herbicide use (by weight of active ingredient). Glyphosate formulations such as Roundup® are used in homes and in agriculture. Part of the reason for the popularity of glyphosate is the perception that it is an “environmentally benign” herbicide that has low toxicity and little mobility or persistence in the environment. The U.S. Geological Survey developed an analytical method using liquid chromatography/tandem mass spectrometry that can detect small amounts of glyphosate and its primary degradation product aminomethylphosphonic acid (AMPA) in water and sediment. Results from more than 2,000 samples collected from locations distributed across the U.S. indicate that glyphosate is more mobile and occurs more widely in the environment than was previously thought. Glyphosate and AMPA were detected (reporting limits between 0.1 and 0.02 micrograms per liter) in samples collected from surface water, groundwater, rainfall, soil water, and soil, at concentrations from less than 0.1 to more than 100 micrograms per liter. Glyphosate was detected more frequently in rain (86%), ditches and drains (71%), and soil (63%); and less frequently in groundwater (3%) and large rivers (18%). AMPA was detected more frequently in rain (86%), soil (82%), and large rivers (78%); and less frequently in groundwater (8%) and wetlands or vernal pools (37%). Most observed concentrations of glyphosate were well below levels of concern for humans or wildlife, and none exceeded the U.S. Environmental Protection Agency’s Maximum Contaminant Level of 700 micrograms per liter. However, the ecosystem effects of chronic low

  19. Early transcriptional response of soybean contrasting accessions to root dehydration.

    Directory of Open Access Journals (Sweden)

    José Ribamar Costa Ferreira Neto

    Full Text Available Drought is a significant constraint to yield increase in soybean. The early perception of water deprivation is critical for recruitment of genes that promote plant tolerance. DeepSuperSAGE libraries, including one control and a bulk of six stress times imposed (from 25 to 150 min of root dehydration for drought-tolerant and sensitive soybean accessions, allowed to identify new molecular targets for drought tolerance. The survey uncovered 120,770 unique transcripts expressed by the contrasting accessions. Of these, 57,610 aligned with known cDNA sequences, allowing the annotation of 32,373 unitags. A total of 1,127 unitags were up-regulated only in the tolerant accession, whereas 1,557 were up-regulated in both as compared to their controls. An expression profile concerning the most representative Gene Ontology (GO categories for the tolerant accession revealed the expression "protein binding" as the most represented for "Molecular Function", whereas CDPK and CBL were the most up-regulated protein families in this category. Furthermore, particular genes expressed different isoforms according to the accession, showing the potential to operate in the distinction of physiological behaviors. Besides, heat maps comprising GO categories related to abiotic stress response and the unitags regulation observed in the expression contrasts covering tolerant and sensitive accessions, revealed the unitags potential for plant breeding. Candidate genes related to "hormone response" (LOX, ERF1b, XET, "water response" (PUB, BMY, "salt stress response" (WRKY, MYB and "oxidative stress response" (PER figured among the most promising molecular targets. Additionally, nine transcripts (HMGR, XET, WRKY20, RAP2-4, EREBP, NAC3, PER, GPX5 and BMY validated by RT-qPCR (four different time points confirmed their differential expression and pointed that already after 25 minutes a transcriptional reorganization started in response to the new condition, with important

  20. Effect of surfactants on the penetration of 14C-glyphosate in Cyperus rotundus in Pakistani agroclimatic conditions

    International Nuclear Information System (INIS)

    Jamil Qureshi, M.; Anwarul Haq; Uzma Maqbool

    1998-01-01

    The penetration of 14 C-glyphosate was studied in Cyperus rotundus with three nonionic surfactants. Among the three surfactants Synperonic A20 was more effective than A2 and A7 in enhancing penetration of glyphosate 24 hours after treatment both in dry and wet seasons. The addition of diesel oil to Synperonic A20 further increased penetration of glyphosate in both seasons. (author)

  1. Glyphosate and glufosinate-ammonium runoff from a corn-growing area in Italy

    OpenAIRE

    Screpanti , Claudio; Accinelli , Cesare; Vicari , Alberto; Catizone , Pietro

    2005-01-01

    International audience; The main objective of this experiment was to estimate field-scale runoff losses of glyphosate and glufosinate-ammonium under natural rainfall conditions. Investigations were carried out at the Runoff Monitoring Station of the University of Bologna (Italy). Glyphosate and glufosinate-ammonium were applied as pre-emergence herbicides on 350-m2 field plots characterized by a uniform slope of 15%. Field plots were cultivated with corn. The persistence and sorption isotherm...

  2. Evaluation of genetic damage induced by glyphosate isopropylamine salt using Tradescantia bioassays

    OpenAIRE

    Alvarez-Moya, Carlos; Reynoso Silva, Mónica; Villalobos Arámbula, Alma Rosa; Islas Sandoval, Alfonso; Castañeda Vasquez, Hugo; González Montes, Rosa María

    2010-01-01

    Glyphosate is noted for being non-toxic in fishes, birds and mammals (including humans). Nevertheless, the degree of genotoxicity is seriously controversial. In this work, various concentrations of a glyphosate isopropylamine salt were tested using two methods of genotoxicity assaying, viz., the pink mutation assay with Tradescantia (4430) and the comet assay with nuclei from staminal cells of the same plant. Staminal nuclei were studied in two different forms, namely nuclei from exposed plan...

  3. Epidemiological studies on glyphosate - No new findings for the European risk assessment

    OpenAIRE

    German Federal Institute for Risk Assessment

    2016-01-01

    The assessment of epidemiological studies on the health effects of glyphosate is currently being discussed in the media. In this context, BfR evaluated a so-called expert opinion on epidemiological studies prepared by non-government organisations and concludes that no new findings are being reported for the joint European assessment of the active substance glyphosate. The accusations brought forth in the so-called expert opinion of scientific deception by the assessment authorities are c...

  4. Nitrogen loss in Brachiaria decumbens after application of glyphosate or glufosinate-ammonium

    OpenAIRE

    Damin,Virginia; Franco,Henrique Coutinho Junqueira; Moraes,Milton Ferreira; Franco,Ademir; Trivelin,Paulo Cesar Ocheuze

    2008-01-01

    Nitrogen losses from the soil-plant system may be influenced by herbicide applications. In order to evaluate N loss in brachiaria (Brachiaria decumbens) after application of the herbicides glyphosate and glufosinate-ammonium, an experiment was carried out in a greenhouse as a completely randomized design, with three treatments and six replicates. Treatments were as follows: i) desiccation of brachiaria-plants with glyphosate; ii) desiccation of brachiaria-plants with glufosinate-ammonium; and...

  5. Clinical characteristics of soybean allergy in Europe

    DEFF Research Database (Denmark)

    Ballmer-Weber, Barbara K; Holzhauser, Thomas; Scibilia, Joseph

    2007-01-01

    Soybean is a relevant allergenic food, but little is known about individual threshold doses in soy allergy.......Soybean is a relevant allergenic food, but little is known about individual threshold doses in soy allergy....

  6. Spectral Detection of Soybean Aphid (Hemiptera: Aphididae) and Confounding Insecticide Effects in Soybean

    Science.gov (United States)

    Alves, Tavvs Micael

    Soybean aphid, Aphis glycines (Hemiptera: Aphididae) is the primary insect pest of soybean in the northcentral United States. Soybean aphid may cause stunted plants, leaf discoloration, plant death, and decrease soybean yield by 40%. Sampling plans have been developed for supporting soybean aphid management. However, growers' perception about time involved in direct insect counts has been contributing to a lower adoption of traditional pest scouting methods and may be associated with the use of prophylactic insecticide applications in soybean. Remote sensing of plant spectral (light-derived) responses to soybean aphid feeding is a promising alternative to estimate injury without direct insect counts and, thus, increase adoption and efficiency of scouting programs. This research explored the use of remote sensing of soybean reflectance for detection of soybean aphids and showed that foliar insecticides may have implications for subsequent use of soybean spectral reflectance for pest detection. (Abstract shortened by ProQuest.).

  7. Clastogenic Effects of Glyphosate in Bone Marrow Cells of Swiss Albino Mice

    International Nuclear Information System (INIS)

    Prasad, S.; Srivastava, S.; Singh, M.; Shukla, Y.

    2009-01-01

    Glyphosate (N-(phosphonomethyl) glycine, C 3 H 8 NO 5 P), a herbicide, used to control unwanted annual and perennial plants all over the world. Nevertheless, occupational and environmental exposure to pesticides can pose a threat to nontarget species including human beings. Therefore, in the present study, genotoxic effects of the herbicide glyphosate were analyzed by measuring chromosomal aberrations (CAs) and micronuclei (MN) in bone marrow cells of Swiss albino mice. A single dose of glyphosate was given intraperitoneally (i.p) to the animals at a concentration of 25 and 50 mg/kg b.wt. Animals of positive control group were injected i.p. benzo(a)pyrene (100 mg/kg b.wt., once only), whereas, animals of control (vehicle) group were injected i.p. dimethyl sulfoxide (0.2 mL). Animals from all the groups were sacrificed at sampling times of 24, 48, and 72 hours and their bone marrow was analyzed for cytogenetic and chromosomal damage. Glyphosate treatment significantly increases CAs and MN induction at both treatments and time compared with the vehicle control (P<.05). The cytotoxic effects of glyphosate were also evident, as observed by significant decrease in mitotic index (MI). The present results indicate that glyphosate is clastogenic and cytotoxic to mouse bone marrow.

  8. Adsorption-desorption, mobility and degradation of 14C-Glyphosate in two soil series

    International Nuclear Information System (INIS)

    Ismail, B. S.; Zaifah Abdul Kadir; Khairiah Jusoh; Nashriyah Mat

    2002-01-01

    The adsorption desorption and degradation of glyphosate (Roundup) have been studied using 14 C glyphosate in two soils, namely Serdang Series and Sungai Buloh Series. The percentage of adsorption was not significantly different (p 14 C- glyphosate was detected in 0-10 cm zone of the two soils studied. However, in Sungai Buloh Series, a significant amount of 14 C-glyphosate was detected in the 10-20 cm zone. A small amount of 14 C radioactivity was also detected in the leachate of the two soils. The percentage of degradation in the Sungai Buloh and Serdang Series soils was higher at 10 μg/ml and 50 μg/ml, concentration, respectively. At 50 μg/ml concentration the Sungai Buloh Series soil showed higher glyphosate residue (83%) as compared to Serdang Series (48%). In contrast, the glyphosate residue was found to be higher in the Serdang Series (73916) as compared to the Sungai Buloh Series (30%) at 10 μg/ml concentration. (Author)

  9. Effect of light conditions and chemical characteristics of water on dissipation of glyphosate in aqueous medium.

    Science.gov (United States)

    Yadav, Veena; Kaur, Pervinder; Kaur, Paawan

    2017-11-06

    The present study was conducted to determine the effect of light conditions and chemical properties of water on dissipation of glyphosate. The residues of glyphosate and aminomethylphosphonic acid (AMPA) were quantified using fluorescence spectrophotometer after derivatization with 9-fluoroenylmethoxycarbonyl chloride (FMOC-Cl) and orthopthaldehyde (OPA). Average percent recoveries of glyphosate and AMPA from distilled, tap, and ground water ranged from 87.5 to 94.9, 87.3 to 93.7, and 80.6 to 92.0, respectively, with relative standard deviation less than 10%. The limit of detection and limit of quantification of glyphosate and AMPA from different water matrices ranged from 0.001 to 0.03 μg mL -1 and 0.003 to 0.01 μg mL -1 , respectively. The dissipation of glyphosate followed the first-order kinetics, and half-life varied from 1.56 to 14.47 and 13.14 to 42.38 days under UV and sunlight, respectively. The pH and electrical conductivity (EC) of water has differential influence on dissipation of glyphosate, and it increased with increase in pH and EC.

  10. Analysis of glyphosate residues in cereals using liquid chromatography-mass spectrometry (LC-MS/MS)

    DEFF Research Database (Denmark)

    Granby, Kit; Johannesen, S.; Gabrielsen, Martin Vahl

    2003-01-01

    A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean-up) in ser......A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean...... monitored m/z 168--> 150 (glyphosate) and 170-->152 (internal standard 2- 13 (CN)-N-15-glyphosate) for quantification. The mean recovery was 85% ( n =32) at spiking levels from 0.03 to 0.33 mg kg(-1) . From 1998 to 2001, from the analysis of about 50 samples per annum, a reduction in the glyphosate residues...... was observed owing to a Danish trade decision not to use grain with glyphosate residues for milling or bread production....

  11. Characterization of Eleusine indica with gene mutation or amplification in EPSPS to glyphosate.

    Science.gov (United States)

    Chen, Jingchao; Jiang, Cuilan; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Huimin; Zhao, Dandan; Zhang, Chaoxian

    2017-11-01

    The evolution of weed-resistant species threatens the sustainable use of glyphosate, which is the most important herbicide widely used in agriculture worldwide. Moreover, the high glyphosate resistance (>180-fold based on LD 50 ) of Eleusine indica found in Malaysia, which carries a double mutation in its 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), made the control of this species more difficult. By contrast, the same species carrying the same double mutation in EPSPS (T102I+P106S) but found in China only shows a resistance level of not more than 14-fold based on GR 50 . The resistance level of this population is four times higher than that of the population carrying a single mutation (P106L). Although the members of this population survive under a high glyphosate dosage of 10,080gaeha -1 , their growth was significantly inhibited by glyphosate under the recommend dose (840gaeha -1 ), where in the fresh weight was 85.4% of the control. EPSPS expression, relative copy number, and EPSPS activity in this population were similar to those of the susceptible population. In addition, the expression of two glutathione transferase (GST) genes (GST-U8 and GST-23) and the enzyme activity of the GST in this population did not significantly differ from those of the susceptible population. This finding is important in elucidating the resistance of the naturally evolved glyphosate-resistant (GR) weed species carrying a double mutation in EPSPS to glyphosate. Copyright © 2017. Published by Elsevier Inc.

  12. Target-site mutations conferring resistance to glyphosate in feathertop Rhodes grass (Chloris virgata) populations in Australia.

    Science.gov (United States)

    Ngo, The D; Krishnan, Mahima; Boutsalis, Peter; Gill, Gurjeet; Preston, Christopher

    2018-05-01

    Chloris virgata is a warm-season, C 4 , annual grass weed affecting field crops in northern Australia that has become an emerging weed in southern Australia. Four populations with suspected resistance to glyphosate were collected in South Australia, Queensland and New South Wales, Australia, and compared with one susceptible (S) population to confirm glyphosate resistance and elucidate possible mechanisms of resistance. Based on the rate of glyphosate required to kill 50% of treated plants (LD 50 ), glyphosate resistance (GR) was confirmed in four populations of C. virgata (V12, V14.2, V14.16 and V15). GR plants were 2-9.7-fold more resistant and accumulated less shikimate after glyphosate treatment than S plants. GR and S plants did not differ in glyphosate absorption and translocation. Target-site EPSPS mutations corresponding to Pro-106-Leu (V14.2) and Pro-106-Ser (V15, V14.16 and V12) substitutions were found in GR populations. The population with Pro-106-Leu substitution was 2.9-4.9-fold more resistant than the three other populations with Pro-106-Ser substitution. This report confirms glyphosate resistance in C. virgata and shows that target-site EPSPS mutations confer resistance to glyphosate in this species. The evolution of glyphosate resistance in C. virgata highlights the need to identify alternative control tactics. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  13. Use of Fe/Al drinking water treatment residuals as amendments for enhancing the retention capacity of glyphosate in agricultural soils.

    Science.gov (United States)

    Zhao, Yuanyuan; Wendling, Laura A; Wang, Changhui; Pei, Yuansheng

    2015-08-01

    Fe/Al drinking water treatment residuals (WTRs), ubiquitous and non-hazardous by-products of drinking water purification, are cost-effective adsorbents for glyphosate. Given that repeated glyphosate applications could significantly decrease glyphosate retention by soils and that the adsorbed glyphosate is potentially mobile, high sorption capacity and stability of glyphosate in agricultural soils are needed to prevent pollution of water by glyphosate. Therefore, we investigated the feasibility of reusing Fe/Al WTR as a soil amendment to enhance the retention capacity of glyphosate in two agricultural soils. The results of batch experiments showed that the Fe/Al WTR amendment significantly enhanced the glyphosate sorption capacity of both soils (pretention capacity in soils. Copyright © 2015. Published by Elsevier B.V.

  14. Transformation of multiple soybean cultivars by infecting ...

    African Journals Online (AJOL)

    Transformation of multiple soybean cultivars by infecting cotyledonary-node with Agrobacterium tumefaciens. ... In our study, the combination of Nannong88-1 with EHA105 is the optimum selection for explant and bacterial inoculum in soybean transformation, which could be applied in future functional study of soybean ...

  15. Genotoxicity of diuron and glyphosate in oyster spermatozoa and embryos.

    Science.gov (United States)

    Akcha, F; Spagnol, C; Rouxel, J

    2012-01-15

    We investigated the effects of genotoxicant exposure in gametes and embryos to find a possible link between genotoxicity and reproduction/developmental impairment, and explore the impact of chemical genotoxicity on population dynamics. Our study focused on the genotoxic effects of two herbicides on oyster gametes and embryos: glyphosate (both as an active substance and in the Roundup formulation) and diuron. France is Europe's leading consumer of agrochemical substances and as such, contamination of France's coastal waters by pesticides is a major concern. Glyphosate and diuron are among the most frequently detected herbicides in oyster production areas; as oyster is a specie with external reproduction, its gametes and embryos are in direct contact with the surrounding waters and are hence particularly exposed to these potentially dangerous substances. In the course of this study, differences in genotoxic and embryotoxic responses were observed in the various experiments, possibly due to differences in pollutant sensitivity between the tested genitor lots. Glyphosate and Roundup had no effect on oyster development at the concentrations tested, whereas diuron significantly affected embryo-larval development from the lowest tested concentration of 0.05 μg L⁻¹, i.e. an environmentally realistic concentration. Diuron may therefore have a significant impact on oyster recruitment rates in the natural environment. Our spermiotoxicity study revealed none of the tested herbicides to be cytotoxic for oyster spermatozoa. However, the alkaline comet assay showed diuron to have a significant genotoxic effect on oyster spermatozoa at concentrations of 0.05 μg L⁻¹ upwards. Conversely, no effects due to diuron exposure were observed on sperm mitochondrial function or acrosomal membrane integrity. Although our initial results showed no negative effect on sperm function, the possible impact on fertilization rate and the consequences of the transmission of damaged DNA for

  16. Phosphoproteomics reveals the effect of ethylene in soybean root under flooding stress.

    Science.gov (United States)

    Yin, Xiaojian; Sakata, Katsumi; Komatsu, Setsuko

    2014-12-05

    Flooding has severe negative effects on soybean growth. To explore the flooding-responsive mechanisms in early-stage soybean, a phosphoproteomic approach was used. Two-day-old soybean plants were treated without or with flooding for 3, 6, 12, and 24 h, and root tip proteins were then extracted and analyzed at each time point. After 3 h of flooding exposure, the fresh weight of soybeans increased, whereas the ATP content of soybean root tips decreased. Using a gel-free proteomic technique, a total of 114 phosphoproteins were identified in the root tip samples, and 34 of the phosphoproteins were significantly changed with respect to phosphorylation status after 3 h of flooding stress. Among these phosphoproteins, eukaryotic translation initiation factors were dephosphorylated, whereas several protein synthesis-related proteins were phosphorylated. The mRNA expression levels of sucrose phosphate synthase 1F and eukaryotic translation initiation factor 4 G were down-regulated, whereas UDP-glucose 6-dehydrogenase mRNA expression was up-regulated during growth but down-regulated under flooding stress. Furthermore, bioinformatic protein interaction analysis of flooding-responsive proteins based on temporal phosphorylation patterns indicated that eukaryotic translation initiation factor 4 G was located in the center of the network during flooding. Soybean eukaryotic translation initiation factor 4 G has homology to programmed cell death 4 protein and is implicated in ethylene signaling. The weight of soybeans was increased with treatment by an ethylene-releasing agent under flooding condition, but it was decreased when plants were exposed to an ethylene receptor antagonist. These results suggest that the ethylene signaling pathway plays an important role, via the protein phosphorylation, in mechanisms of plant tolerance to the initial stages of flooding stress in soybean root tips.

  17. Responses of Soybean Mutant Lines to Aluminium under In Vitro and In Vivo Condition

    International Nuclear Information System (INIS)

    Yuliasti; Sudarsono

    2011-01-01

    The main limited factors of soybean plants expansion in acid soil are Aluminium (Al) toxicity and low pH. The best approach to solve this problem is by using Al tolerance variety. In vitro or in vivo selections using selective media containing AlCl 3 and induced callus embryonic of mutant lines are reliable methods to develop a new variety. The objectives of this research are to evaluate response of soybean genotypes against AlCl 3 under in vitro and in vivo condition. Addition of 15 part per million (ppm) AlCl 3 into in vitro and in vivo media severely affected plant growth. G3 soybean mutant line was identified as more tolerant than the control soybean cultivar Tanggamus. This mutant line was able to survive under more severe AlCl 3 concentrations (15 ppm) under in vitro conditions. Under in vivo conditions, G1 and G4 mutants were also identified as more tolerant than Tanggamus since they produced more pods and higher dry seed weigh per plant. Moreover, G4 mutant line also produced more dry seed weight per plant than Tanggamus when they were grown on soil containing high Al concentration 8.1 me/100 gr = 81 ppm Al +3 . (author)

  18. Glyphosate and Roundup® alter morphology and behavior in zebrafish.

    Science.gov (United States)

    Bridi, Daiane; Altenhofen, Stefani; Gonzalez, Jonas Brum; Reolon, Gustavo Kellermann; Bonan, Carla Denise

    2017-12-01

    Glyphosate has become the most widely used herbicide in the world, due to the wide scale adoption of transgenic glyphosate resistant crops after its introduction in 1996. Glyphosate may be used alone, but it is commonly applied as an active ingredient of the herbicide Roundup ® . This pesticide contains several adjuvants, which may promote an unknown toxicity. The indiscriminate application poses numerous problems, both for the health of the applicators and consumers, and for the environment, contaminating the soil, water and leading to the death of plants and animals. Zebrafish (Danio rerio) is quickly gaining popularity in behavioral research, because of physiological similarity to mammals, sensitivity to pharmacological factors, robust performance, low cost, short spawning intervals, external fertilization, transparency of embryos through larval stages, and rapid development. The aim of this study was evaluate the effects of glyphosate and Roundup ® on behavioral and morphological parameters in zebrafish larvae and adults. Zebrafish larvae at 3days post-fertilization and adults were exposed to glyphosate (0.01, 0.065, and 0.5mg/L) or Roundup ® (0.01, 0.065, and 0.5mg/L) for 96h. Immediately after the exposure, we performed the analysis of locomotor activity, aversive behavior, and morphology for the larvae and exploratory behavior, aggression and inhibitory avoidance memory for adult zebrafish. In zebrafish larvae, there were significant differences in the locomotor activity and aversive behavior after glyphosate or Roundup ® exposure when compared to the control group. Our findings demonstrated that exposure to glyphosate at the concentration of 0.5mg/L, Roundup ® at 0.065 or 0.5mg/L reduced the distance traveled, the mean speed and the line crossings in adult zebrafish. A decreased ocular distance was observed for larvae exposed at 0.5mg/L of glyphosate. We verified that at 0.5mg/L of Roundup ® -treated adult zebrafish demonstrated a significant

  19. Comparative Genomic Analysis of Soybean Flowering Genes

    Science.gov (United States)

    Jung, Chol-Hee; Wong, Chui E.; Singh, Mohan B.; Bhalla, Prem L.

    2012-01-01

    Flowering is an important agronomic trait that determines crop yield. Soybean is a major oilseed legume crop used for human and animal feed. Legumes have unique vegetative and floral complexities. Our understanding of the molecular basis of flower initiation and development in legumes is limited. Here, we address this by using a computational approach to examine flowering regulatory genes in the soybean genome in comparison to the most studied model plant, Arabidopsis. For this comparison, a genome-wide analysis of orthologue groups was performed, followed by an in silico gene expression analysis of the identified soybean flowering genes. Phylogenetic analyses of the gene families highlighted the evolutionary relationships among these candidates. Our study identified key flowering genes in soybean and indicates that the vernalisation and the ambient-temperature pathways seem to be the most variant in soybean. A comparison of the orthologue groups containing flowering genes indicated that, on average, each Arabidopsis flowering gene has 2-3 orthologous copies in soybean. Our analysis highlighted that the CDF3, VRN1, SVP, AP3 and PIF3 genes are paralogue-rich genes in soybean. Furthermore, the genome mapping of the soybean flowering genes showed that these genes are scattered randomly across the genome. A paralogue comparison indicated that the soybean genes comprising the largest orthologue group are clustered in a 1.4 Mb region on chromosome 16 of soybean. Furthermore, a comparison with the undomesticated soybean (Glycine soja) revealed that there are hundreds of SNPs that are associated with putative soybean flowering genes and that there are structural variants that may affect the genes of the light-signalling and ambient-temperature pathways in soybean. Our study provides a framework for the soybean flowering pathway and insights into the relationship and evolution of flowering genes between a short-day soybean and the long-day plant, Arabidopsis. PMID:22679494

  20. Crafting tolerance

    DEFF Research Database (Denmark)

    Kirchner, Antje; Freitag, Markus; Rapp, Carolin

    2011-01-01

    Ongoing changes in social structures, orientation, and value systems confront us with the growing necessity to address and understand transforming patterns of tolerance as well as specific aspects, such as social tolerance. Based on hierarchical analyses of the latest World Values Survey (2005......–08) and national statistics for 28 countries, we assess both individual and contextual aspects that influence an individual's perception of different social groupings. Using a social tolerance index that captures personal attitudes toward these groupings, we present an institutional theory of social tolerance. Our...

  1. Effects of mixtures of dicamba and glyphosate on nontarget plants

    Science.gov (United States)

    New technologies are being developed using mixtures of herbicides to manage a broader variety of weeds in multiple herbicide resistant crops such as soybean and cotton. As part of its regulation of pesticides, the US Environmental Protection Agency considers environmental risks,...

  2. THE PERFORMANCE OF SOYBEAN (c.v. Americana ESTABLISHED BY ZERO TILLAGE TECHNIQUE IN IMPERATA FIELD CONTROLLED BY HERBICIDES

    Directory of Open Access Journals (Sweden)

    S. TJITROSEMITO

    1989-01-01

    Full Text Available A field experiment was conducted to investigate the performance of soybean (c.v. Americana when established with zero tillage technique on Imperata dominated area. Four different techniques of alang-alang control i.e. imazapyr (20 kg ai/ha, glyphosate (25 kg ai/ha, glufosinate (3.0 kg ai/ha and manual cultivation were arranged factorially with time of plantings i.e. 1,2 and 3 months after treatments. The alang-alang damages varied with herbicides and times, imazapyr (20 kg ai/ha showed slow appearance of damage at 3 months after application it was only 69%, while that of glufosinate was already down to 48% due to regrowth. No phytotoxicity was recorded, but the yield was low.

  3. Effects of interactions between Collembola and soil microbial community on the degradation of glyphosate-based herbicide

    Science.gov (United States)

    Wee, J.; Lee, Y. S.; Son, J.; Kim, Y.; Nam, T. H.; Cho, K.

    2017-12-01

    Glyphosate is the most widely used herbicide because of its broad spectrum activity and effectiveness, however, little is known about adverse effects on non-target species and their interactions. Therefore, in this study, we investigated the effects of glyphosate on interactions between Collembola and soil microbial community and the effect of Collembola on degradation of glyphosate. The experiment carried out in PS container filled with 30g of soil according to OECD 232 guidelines. Investigating the effects of soil microbial community and Collembola on degradation of glyphosate, we prepared defaunated field soil (only maintaining soil microbial community, sampling in May and September, 2016.) and autoclaved soil with 0, 10, 30 adults of Paronychiurus kimi (Collembola) respectively. Survived adults and hatched juveniles of P. kimi were counted after 28-day exposures in both soils spiked with 100 mg/kg of glyphosate. Glyphosate in soil of 7, 14, 21, 28 days after spiking of glyphosate based herbicide was analyzed by spectrophotometer (Jan et al., 2009). Also soil microbial community structure was investigated using phospholipid fatty acids (PLFAs) composition analysis of soils following the procedures given by the Sherlock Microbial Identification System (MIDI Inc., Newark, DE). Glyphosate (100mg/kg soil) has no effects on reproduction and survival of P. kimi in any soils. Also, glyphosate in soils with Collembola was more rapidly degraded. Rapid increase of soil microbial biomass(PLFAs) was shown in soil with Collembola addition. This result showed that glyphosate affected interactions between Collembola and soil microorganisms, and also soil microbial community affected by Collembola changed degradation of glyphosate.

  4. The fate of glyphosate in water hyacinth and its physiological and biochemical influences on growth of algae

    International Nuclear Information System (INIS)

    Tsai, Baolong.

    1989-01-01

    Absorption, translocation, distribution, exudation, and guttation of 14 C-glyphosate in water hyacinth (Eichhornia crassipes) were studied. Glyphosphate entered the plant by foliage and solution treatment. Plants were harvested and separated into the following parts: treated leaf blade, treated leaf petiole, young leaf blade, young leaf petiole, old leak blade, old leaf petiole, and root. Each part was extracted with methanol. Treated leaves, which exist only in foliage treatment, were washed with water and chloroform to remove the glyphosate residues. All 14 C counting was made by liquid scintillation spectrometry. Autoradiography was used to locate 14 C-glyphosate after foliage treatment. Results indicated that glyphosate can be absorbed from the leaf surface and translocated rapidly through phloem tissues into the whole plant body. The roots of water hyacinth absorbed glyphosate without vertical transport. Guttation of glyphosate occurred in treated leaf tips. Exudation of glyphosate from roots of water hyacinth occurred within 8 hr after foliage treatment. Chlorella vulgaris, Chlamydomonas reihardii, Anabaena cylindrica, and Chroococcus turgidus were used to explore the physiological and biochemical effects of glyphosate on algae. Spectrophotometric assays were performed for algal growth, chlorophyll, carotenoids, phycobiliprotein, carbohydrate, and protein. TLC procedures and an image analyzer were used to detect the metabolites of glyphosate inside algal cells. The common visible symptom of glyphosate toxicity in all algal cells were bleaching effect and reduction of contents of carbohydrate, protein, and pigments. The results highly suggested that glyphosate injured the algal cells by destruction of photosynthetic pigments and resulted in lowering the contents of carbohydrate and protein in algal cells

  5. The intensity of non-target site mechanisms influences the level of resistance of sourgrass to glyphosate

    Directory of Open Access Journals (Sweden)

    Flávia Regina da Costa

    2014-02-01

    Full Text Available Non-target site mechanisms are involved in the resistance of sourgrass (Digitaria insularis to g