WorldWideScience

Sample records for glycogen synthase gene

  1. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  2. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  3. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    OpenAIRE

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  4. Glycogen Phosphorylase and Glycogen Synthase: Gene Cloning and Expression Analysis Reveal Their Role in Trehalose Metabolism in the Brown Planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin

    2017-01-01

    RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  5. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  6. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  7. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...

  9. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Science.gov (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  10. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  11. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  12. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

    Directory of Open Access Journals (Sweden)

    Linjie Wang

    Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

  13. A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

    DEFF Research Database (Denmark)

    Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

    2017-01-01

    BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...

  14. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  15. Glycogen synthase kinase 3: more than a namesake.

    Science.gov (United States)

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  16. Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors

    Directory of Open Access Journals (Sweden)

    Daniela Hulcová

    2018-03-01

    Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.

  17. Glycogen synthase activation by sugars in isolated hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  18. Glycogen Synthase Kinase-3 is involved in glycogen metabolism control and embryogenesis of Rhodnius prolixus.

    Science.gov (United States)

    Mury, Flávia B; Lugon, Magda D; DA Fonseca, Rodrigo Nunes; Silva, Jose R; Berni, Mateus; Araujo, Helena M; Fontenele, Marcio Ribeiro; Abreu, Leonardo Araujo DE; Dansa, Marílvia; Braz, Glória; Masuda, Hatisaburo; Logullo, Carlos

    2016-10-01

    Rhodnius prolixus is a blood-feeding insect that transmits Trypanosoma cruzi and Trypanosoma rangeli to vertebrate hosts. Rhodnius prolixus is also a classical model in insect physiology, and the recent availability of R. prolixus genome has opened new avenues on triatomine research. Glycogen synthase kinase 3 (GSK-3) is classically described as a key enzyme involved in glycogen metabolism, also acting as a downstream component of the Wnt pathway during embryogenesis. GSK-3 has been shown to be highly conserved among several organisms, mainly in the catalytic domain region. Meanwhile, the role of GSK-3 during R. prolixus embryogenesis or glycogen metabolism has not been investigated. Here we show that chemical inhibition of GSK-3 by alsterpaullone, an ATP-competitive inhibitor of GSK3, does not affect adult survival rate, though it alters oviposition and egg hatching. Specific GSK-3 gene silencing by dsRNA injection in adult females showed a similar phenotype. Furthermore, bright field and 4'-6-diamidino-2-phenylindole (DAPI) staining analysis revealed that ovaries and eggs from dsGSK-3 injected females exhibited specific morphological defects. We also demonstrate that glycogen content was inversely related to activity and transcription levels of GSK-3 during embryogenesis. Lastly, after GSK-3 knockdown, we observed changes in the expression of the Wingless (Wnt) downstream target β-catenin as well as in members of other pathways such as the receptor Notch. Taken together, our results show that GSK-3 regulation is essential for R. prolixus oogenesis and embryogenesis.

  19. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3beta is implicated in the treatment of cervical carcinoma.

    Science.gov (United States)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3beta (GSK-3beta) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3beta(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3beta after transfection with GSK-3beta by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3beta (s9). Furthermore, we demonstrated GSK-3beta transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3beta was important to improve chemosensitization, indicating the significance of GSK-3beta-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  20. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Directory of Open Access Journals (Sweden)

    Wang Ze

    2010-02-01

    Full Text Available Abstract Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9 expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA, co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9. Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  1. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yuan [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shu, Yi Min [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Wang, Shu Fang [Department of Pathology, Baylor College of Medicine, Houston, TX 77030 (United States); Da, Bang Hong; Wang, Ze Hua [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Li, Hua Bin [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Department of Medicine, Feinberg Medical School, Northwestern University, Chicago, IL 60611 (United States)

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  2. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Science.gov (United States)

    2010-01-01

    Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy. PMID:20178594

  3. Expression of mismatch repair gene PMS2 in nasopharyngeal carcinoma and regulation by glycogen synthase kinase-3β in vivo and in vitro.

    Science.gov (United States)

    Fang, Jugao; Lei, Wenbin; Huang, Xiaoming; Li, Pingdong; Chen, Xiaohong; Zhu, Xiaolin; Wen, Weiping; Li, Huabin

    2012-02-01

    To evaluate the expression of mismatch repair gene PMS2 in human nasopharyngeal carcinoma (NPC) tissues and evaluate the effect of glycogen synthase kinase (GSK)-3β on PMS2 production in vivo and in vitro. The expression of PMS2 and inactivated phosphorylated GSK-3β(s9) was examined by immunohistochemical staining in 25 NPC tissues and the relation was determined by correlation analysis. The effect of GSK-3β transfection in CNE-2 cells on PMS2 production as well as cell apoptosis and chemosensitization were evaluated using small interference RNA (siRNA), immunoblotting and flow cytometric analysis in vitro. The expression of inactivated phosphorylated GSK-3β(s9) was found to negative correlated with PMS2 in vivo. And transfected GSK-3β was found to be able to enhance PMS2 production, and increase cell apoptosis in CNE-2 cells in combination with cisplatin administration in vitro. Inactivation of GSK-3β might be important for NPC tumorgenesis through negatively regulating PMS2 production, and enhanced PMS2 production by GSK-3β is beneficial for understanding the NPC tumorgenesis and developing potential strategy for future therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  4. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    International Nuclear Information System (INIS)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-01-01

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy

  5. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  6. Phosphorylation-dependent translocation of glycogen synthase to a novel structure during glycogen resynthesis

    DEFF Research Database (Denmark)

    Prats, Clara; Cadefau, Joan A; Cussó, Roser

    2005-01-01

    Glycogen metabolism has been the subject of extensive research, but the mechanisms by which it is regulated are still not fully understood. It is well accepted that the rate-limiting enzymes in glycogenesis and glycogenolysis are glycogen synthase (GS) and glycogen phosphorylase (GPh), respectively....... Both enzymes are regulated by reversible phosphorylation and by allosteric effectors. However, evidence in the literature indicates that changes in muscle GS and GPh intracellular distribution may constitute a new regulatory mechanism of glycogen metabolism. Already in the 1960s, it was proposed...... that glycogen was present in dynamic cellular organelles that were termed glycosomas but no such cellular entities have ever been demonstrated. The aim of this study was to characterize muscle GS and GPh intracellular distribution and to identify possible translocation processes of both enzymes. Using in situ...

  7. Processivity and Subcellular Localization of Glycogen Synthase Depend on a Non-catalytic High Affinity Glycogen-binding Site*

    OpenAIRE

    Díaz, Adelaida; Martínez-Pons, Carlos; Fita, Ignacio; Ferrer, Juan C.; Guinovart, Joan J.

    2011-01-01

    Glycogen synthase, a central enzyme in glucose metabolism, catalyzes the successive addition of α-1,4-linked glucose residues to the non-reducing end of a growing glycogen molecule. A non-catalytic glycogen-binding site, identified by x-ray crystallography on the surface of the glycogen synthase from the archaeon Pyrococcus abyssi, has been found to be functionally conserved in the eukaryotic enzymes. The disruption of this binding site in both the archaeal and the human muscle glycogen synth...

  8. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  9. Studies of gene expression and activity of hexokinase, phosphofructokinase and glycogen synthase in human skeletal muscle in states of altered insulin-stimulated glucose metabolism

    DEFF Research Database (Denmark)

    Vestergaard, H

    1999-01-01

    been reported to increase the basal concentration of muscle GS mRNA in NIDDM patients to a level similar to that seen in control subjects although insulin-stimulated glucose disposal rates remain reduced in NIDDM patients. In the insulin resistant states examined so far, basal and insulin-stimulated......When whole body insulin-stimulated glucose disposal rate is measured in man applying the euglycaemic, hyperinsulinaemic clamp technique it has been shown that approximately 75% of glucose is taken up by skeletal muscle. After the initial transport step, glucose is rapidly phosphorylated to glucose...... critical roles in glucose oxidation/glycolysis and glucose storage, respectively. Glucose transporters and glycogen synthase activities are directly and acutely stimulated by insulin whereas the activities of hexokinases and phosphofructokinase may primarily be allosterically regulated. The aim...

  10. Glycogen synthase kinase-3 regulation of urinary concentrating ability.

    Science.gov (United States)

    Rao, Reena

    2012-09-01

    Glycogen synthase kinase-3 (GSK3) is an enzyme that is gaining prominence as a critical signaling molecule in the epithelial cells of renal tubules. This review will focus on recent findings exploring the role of GSK3 in renal collecting ducts, especially its role in urine concentration involving vasopressin signaling. Recent studies using inhibition or tissue-specific gene deletion of GSK3 revealed the mechanism by which GSK3 regulates aquaporin 2 water channels via adenylate cyclase or the prostaglandin-E2 pathway. In other studies, postnatal treatment with lithium, an inhibitor of GSK3, increased cell proliferation and led to microcyst formation in rat kidneys. These studies suggest that loss of GSK3 activity could interfere with renal water transport at two levels. In the short term, it could disrupt vasopressin signaling in collecting duct cells and in the long term it could alter the structure of the collecting ducts, making them less responsive to the hydro-osmotic effects of vasopressin. Ongoing studies reveal the crucial role played by GSK3 in the regulation of vasopressin action in the renal collecting ducts and suggest a possible use of GSK3 inhibitors in disease conditions associated with disrupted vasopressin signaling.

  11. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Science.gov (United States)

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Science.gov (United States)

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Characterization of Function of the GlgA2 Glycogen/Starch Synthase in Cyanobacterium sp. Clg1 Highlights Convergent Evolution of Glycogen Metabolism into Starch Granule Aggregation.

    Science.gov (United States)

    Kadouche, Derifa; Ducatez, Mathieu; Cenci, Ugo; Tirtiaux, Catherine; Suzuki, Eiji; Nakamura, Yasunori; Putaux, Jean-Luc; Terrasson, Amandine Durand; Diaz-Troya, Sandra; Florencio, Francisco Javier; Arias, Maria Cecilia; Striebeck, Alexander; Palcic, Monica; Ball, Steven G; Colleoni, Christophe

    2016-07-01

    At variance with the starch-accumulating plants and most of the glycogen-accumulating cyanobacteria, Cyanobacterium sp. CLg1 synthesizes both glycogen and starch. We now report the selection of a starchless mutant of this cyanobacterium that retains wild-type amounts of glycogen. Unlike other mutants of this type found in plants and cyanobacteria, this mutant proved to be selectively defective for one of the two types of glycogen/starch synthase: GlgA2. This enzyme is phylogenetically related to the previously reported SSIII/SSIV starch synthase that is thought to be involved in starch granule seeding in plants. This suggests that, in addition to the selective polysaccharide debranching demonstrated to be responsible for starch rather than glycogen synthesis, the nature and properties of the elongation enzyme define a novel determinant of starch versus glycogen accumulation. We show that the phylogenies of GlgA2 and of 16S ribosomal RNA display significant congruence. This suggests that this enzyme evolved together with cyanobacteria when they diversified over 2 billion years ago. However, cyanobacteria can be ruled out as direct progenitors of the SSIII/SSIV ancestral gene found in Archaeplastida. Hence, both cyanobacteria and plants recruited similar enzymes independently to perform analogous tasks, further emphasizing the importance of convergent evolution in the appearance of starch from a preexisting glycogen metabolism network. © 2016 American Society of Plant Biologists. All Rights Reserved.

  14. Epinephrine-stimulated glycogen breakdown activates glycogen synthase and increases insulin-stimulated glucose uptake in epitrochlearis muscles

    DEFF Research Database (Denmark)

    Kolnes, Anders J; Birk, Jesper Bratz; Eilertsen, Einar

    2015-01-01

    Adrenaline increases glycogen synthase (GS) phosphorylation and decreases GS activity but also stimulates glycogen breakdown and low glycogen content normally activates GS. To test the hypothesis that glycogen content directly regulates GS phosphorylation, glycogen breakdown was stimulated...... in condition with decreased GS activation. Saline or adrenaline (0.02mg/100g rat) was injected subcutaneously in Wistar rats (~130 g) with low (24 h fasted), normal (normal diet) and high glycogen content (fasted-refed) and epitrochlearis muscles were removed after 3 h and incubated ex vivo eliminating...... adrenaline action. Adrenaline injection reduced glycogen content in epitrochlearis muscles with high (120.7±17.8 vs 204.6±14.5 mmol•kg(-1); pglycogen (89.5±7.6 vs 152.6±8.1 mmol•kg(-1); pglycogen (90.0±5.0 vs 102.8±7.8 mmol•kg(-1); p=0...

  15. Ketamine up-regulates a cluster of intronic miRNAs within the serotonin receptor 2C gene by inhibiting glycogen synthase kinase-3.

    Science.gov (United States)

    Grieco, Steven F; Velmeshev, Dmitry; Magistri, Marco; Eldar-Finkelman, Hagit; Faghihi, Mohammad A; Jope, Richard S; Beurel, Eleonore

    2017-09-01

    We examined mechanisms that contribute to the rapid antidepressant effect of ketamine in mice that is dependent on glycogen synthase kinase-3 (GSK3) inhibition. We measured serotonergic (5HT)-2C-receptor (5HTR2C) cluster microRNA (miRNA) levels in mouse hippocampus after administering an antidepressant dose of ketamine (10 mg/kg) in wild-type and GSK3 knockin mice, after GSK3 inhibition with L803-mts, and in learned helpless mice. Ketamine up-regulated cluster miRNAs 448-3p, 764-5p, 1264-3p, 1298-5p and 1912-3p (2- to 11-fold). This up-regulation was abolished in GSK3 knockin mice that express mutant constitutively active GSK3. The GSK3 specific inhibitor L803-mts was antidepressant in the learned helplessness and novelty suppressed feeding depression-like behaviours and up-regulated the 5HTR2C miRNA cluster in mouse hippocampus. After administration of the learned helplessness paradigm mice were divided into cohorts that were resilient (non-depressed) or were susceptible (depressed) to learned helplessness. The resilient, but not depressed, mice displayed increased hippocampal levels of miRNAs 448-3p and 1264-3p. Administration of an antagonist to miRNA 448-3p diminished the antidepressant effect of ketamine in the learned helplessness paradigm, indicating that up-regulation of miRNA 448-3p provides an antidepressant action. These findings identify a new outcome of GSK3 inhibition by ketamine that may contribute to antidepressant effects.

  16. Regulation of glycogen synthesis in rat skeletal muscle after glycogen-depleting contractile activity: effects of adrenaline on glycogen synthesis and activation of glycogen synthase and glycogen phosphorylase.

    OpenAIRE

    Franch, J; Aslesen, R; Jensen, J

    1999-01-01

    We investigated the effects of insulin and adrenaline on the rate of glycogen synthesis in skeletal muscles after electrical stimulation in vitro. The contractile activity decreased the glycogen concentration by 62%. After contractile activity, the glycogen stores were fully replenished at a constant and high rate for 3 h when 10 m-i.u./ml insulin was present. In the absence of insulin, only 65% of the initial glycogen stores was replenished. Adrenaline decreased insulin-stimulated glycogen s...

  17. Conditional ablation of glycogen synthase kinase 3β in postnatal mouse kidney.

    Science.gov (United States)

    Ge, Yan; Si, Jin; Tian, Li; Zhuang, Shougang; Dworkin, Lance D; Gong, Rujun

    2011-01-01

    Glycogen synthase kinase (GSK)3 is a ubiquitously expressed serine/threonine kinase existing in two isoforms, namely GSK3α and GSK3β. Aside from the long-recognized role in insulin signal transduction and glycogen biosynthesis, GSK3β has been recently coined as a master control molecule in nuclear factor-κB activation and inflammatory kidney injury. Nevertheless, previous studies are less conclusive because they relied greatly on small molecule inhibitors, which lack selectivity and barely distinguish between the GSK3 isoforms. In addition, early embryonic lethality after global knockout of GSK3β precludes interrogation of the biological role of GSK3β in the adult kidney. To circumvent these issues, the Cre/loxP system was used to generate a conditional knockout mouse model in which the GSK3β gene was specifically deleted in kidney cortical tubules at postnatal mature stage. Kidney-specific ablation of GSK3β resulted in a phenotype no different from control littermates. Knockout mice (KO) were viable and exhibited normal development and normal kidney physiology in terms of kidney function, urine albumin excretion, and urine-concentrating ability. It is noteworthy that apart from normal glomerular and tubulointerstitial morphology, the kidneys from KO demonstrated more glycogen accumulation in the renal cortical tubules as assessed by both periodic acid-Schiff staining for light microscopy and direct biochemical assay, consistent with an elevated glycogen synthetic activity as evidenced by diminished inhibitory phosphorylation of glycogen synthase that occurred subsequent to GSK3β ablation. This finding was further validated by electron microscopic observations of increased deposition of glycogen particles in the renal tubules of KO, suggesting that GSK3α could not fully compensate for the loss of GSK3β in regulating glycogen metabolism in the kidney. Collectively, our study suggests that kidney-specific ablation of GSK3β barely affects kidney function

  18. Hexokinase 2, glycogen synthase and phosphorylase play a key role in muscle glycogen supercompensation

    DEFF Research Database (Denmark)

    Irimia, José M; Rovira, Jordi; Nielsen, Jakob N

    2012-01-01

    Glycogen-depleting exercise can lead to supercompensation of muscle glycogen stores, but the biochemical mechanisms of this phenomenon are still not completely understood.......Glycogen-depleting exercise can lead to supercompensation of muscle glycogen stores, but the biochemical mechanisms of this phenomenon are still not completely understood....

  19. Glycogen synthase kinase-3 regulates inflammatory tolerance in astrocytes

    Science.gov (United States)

    Beurel, Eléonore; Jope, Richard S.

    2010-01-01

    Inflammatory tolerance is the down-regulation of inflammation upon repeated stimuli, which is well-established to occur in peripheral immune cells. However, less is known about inflammatory tolerance in the brain although it may provide an important protective mechanism from detrimental consequences of prolonged inflammation, which appears to occur in many psychiatric and neurodegenerative conditions. Array analysis of 308 inflammatory molecules produced by mouse primary astrocytes after two sequential stimulations with lipopolysaccharide (LPS) distinguished three classes, tolerant, sensitized and unaltered groups. For many of these inflammatory molecules, inhibition of glycogen synthase kinase-3 (GSK3) increased tolerance and reduced sensitization. Focusing on LPS-tolerance in interleukin-6 (IL-6) production, we found that microglia exhibited a strong tolerance response that matched that of macrophages, whereas astrocytes exhibited only partial tolerance. The astrocyte semi-tolerance was found to be regulated by GSK3. GSK3 inhibitors or knocking down GSK3 levels promoted LPS-tolerance and astrocytes expressing constitutively active GSK3 did not develop LPS-tolerance. These findings identify the critical role of GSK3 in counteracting IL-6 inflammatory tolerance in cells of the CNS, supporting the therapeutic potential of GSK3 inhibitors to reduce neuroinflammation by promoting tolerance. PMID:20553816

  20. Mechanism of activation of liver glycogen synthase by swelling

    NARCIS (Netherlands)

    Meijer, A. J.; Baquet, A.; Gustafson, L.; van Woerkom, G. M.; Hue, L.

    1992-01-01

    The mechanism linking the stimulation of liver glycogen synthesis to swelling induced either by amino acids or hypotonicity was studied in hepatocytes, in gel-filtered liver extracts, and in purified preparations of particulate glycogen to which glycogen-metabolizing enzymes are bound. High

  1. Neurodegeneration and functional impairments associated with glycogen synthase accumulation in a mouse model of Lafora disease.

    Science.gov (United States)

    Valles-Ortega, Jordi; Duran, Jordi; Garcia-Rocha, Mar; Bosch, Carles; Saez, Isabel; Pujadas, Lluís; Serafin, Anna; Cañas, Xavier; Soriano, Eduardo; Delgado-García, José M; Gruart, Agnès; Guinovart, Joan J

    2011-11-01

    Lafora disease (LD) is caused by mutations in either the laforin or malin gene. The hallmark of the disease is the accumulation of polyglucosan inclusions called Lafora Bodies (LBs). Malin knockout (KO) mice present polyglucosan accumulations in several brain areas, as do patients of LD. These structures are abundant in the cerebellum and hippocampus. Here, we report a large increase in glycogen synthase (GS) in these mice, in which the enzyme accumulates in LBs. Our study focused on the hippocampus where, under physiological conditions, astrocytes and parvalbumin-positive (PV(+)) interneurons expressed GS and malin. Although LBs have been described only in neurons, we found this polyglucosan accumulation in the astrocytes of the KO mice. They also had LBs in the soma and some processes of PV(+) interneurons. This phenomenon was accompanied by the progressive loss of these neuronal cells and, importantly, neurophysiological alterations potentially related to impairment of hippocampal function. Our results emphasize the relevance of the laforin-malin complex in the control of glycogen metabolism and highlight altered glycogen accumulation as a key contributor to neurodegeneration in LD. Copyright © 2011 EMBO Molecular Medicine.

  2. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    International Nuclear Information System (INIS)

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-01-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

  3. Regulation of glycogen synthase kinase-3 during bipolar mania treatment.

    Science.gov (United States)

    Li, Xiaohong; Liu, Min; Cai, Zhuoji; Wang, Gang; Li, Xiaohua

    2010-11-01

    Bipolar disorder is a debilitating psychiatric illness presenting with recurrent mania and depression. The pathophysiology of bipolar disorder is poorly understood, and molecular targets in the treatment of bipolar disorder remain to be identified. Preclinical studies have suggested that glycogen synthase kinase-3 (GSK3) is a potential therapeutic target in bipolar disorder, but evidence of abnormal GSK3 in human bipolar disorder and its response to treatment is still lacking. This study was conducted in acutely ill type I bipolar disorder subjects who were hospitalized for a manic episode. The protein level and the inhibitory serine phosphorylation of GSK3 in peripheral blood mononuclear cells of bipolar manic and healthy control subjects were compared, and the response of GSK3 to antimanic treatment was evaluated. The levels of GSK3α and GSK3β in this group of bipolar manic subjects were higher than healthy controls. Symptom improvement during an eight-week antimanic treatment with lithium, valproate, and atypical antipsychotics was accompanied by a significant increase in the inhibitory serine phosphorylation of GSK3, but not the total level of GSK3, whereas concomitant electroconvulsive therapy treatment during a manic episode appeared to dampen the response of GSK3 to pharmacological treatment. Results of this study suggest that GSK3 can be modified during the treatment of bipolar mania. This finding in human bipolar disorder is in agreement with preclinical data suggesting that inhibition of GSK3 by increasing serine phosphorylation is a response of GSK3 to psychotropics used in bipolar disorder, supporting the notion that GSK3 is a promising molecular target in the pharmacological treatment of bipolar disorder. © 2010 John Wiley and Sons A/S.

  4. Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.

    Science.gov (United States)

    Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul

    2016-01-01

    Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  5. Ursolic acid and luteolin-7-glucoside improve lipid profiles and increase liver glycogen content through glycogen synthase kinase-3.

    Science.gov (United States)

    Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina

    2010-06-01

    In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.

  6. Quantification of the glycogen cascade system: the ultrasensitive responses of liver glycogen synthase and muscle phosphorylase are due to distinctive regulatory designs

    Directory of Open Access Journals (Sweden)

    Venkatesh KV

    2005-05-01

    Full Text Available Abstract Background Signaling pathways include intricate networks of reversible covalent modification cycles. Such multicyclic enzyme cascades amplify the input stimulus, cause integration of multiple signals and exhibit sensitive output responses. Regulation of glycogen synthase and phosphorylase by reversible covalent modification cycles exemplifies signal transduction by enzyme cascades. Although this system for regulating glycogen synthesis and breakdown appears similar in all tissues, subtle differences have been identified. For example, phosphatase-1, a dephosphorylating enzyme of the system, is regulated quite differently in muscle and liver. Do these small differences in regulatory architecture affect the overall performance of the glycogen cascade in a specific tissue? We address this question by analyzing the regulatory structure of the glycogen cascade system in liver and muscle cells at steady state. Results The glycogen cascade system in liver and muscle cells was analyzed at steady state and the results were compared with literature data. We found that the cascade system exhibits highly sensitive switch-like responses to changes in cyclic AMP concentration and the outputs are surprisingly different in the two tissues. In muscle, glycogen phosphorylase is more sensitive than glycogen synthase to cyclic AMP, while the opposite is observed in liver. Furthermore, when the liver undergoes a transition from starved to fed-state, the futile cycle of simultaneous glycogen synthesis and degradation switches to reciprocal regulation. Under such a transition, different proportions of active glycogen synthase and phosphorylase can coexist due to the varying inhibition of glycogen-synthase phosphatase by active phosphorylase. Conclusion The highly sensitive responses of glycogen synthase in liver and phosphorylase in muscle to primary stimuli can be attributed to distinctive regulatory designs in the glycogen cascade system. The different

  7. Dual regulation of muscle glycogen synthase during exercise by activation and compartmentalization

    DEFF Research Database (Denmark)

    Prats, Clara; Helge, Jørn W; Nordby, Pernille

    2009-01-01

    Glycogen synthase (GS) is considered the rate-limiting enzyme in glycogenesis but still today there is a lack of understanding on its regulation. We have previously shown phosphorylation-dependent GS intracellular redistribution at the start of glycogen re-synthesis in rabbit skeletal muscle (Prats......, C., Cadefau, J. A., Cussó, R., Qvortrup, K., Nielsen, J. N., Wojtaszewki, J. F., Wojtaszewki, J. F., Hardie, D. G., Stewart, G., Hansen, B. F., and Ploug, T. (2005) J. Biol. Chem. 280, 23165-23172). In the present study we investigate the regulation of human muscle GS activity by glycogen, exercise......, and insulin. Using immunocytochemistry we investigate the existence and relevance of GS intracellular compartmentalization during exercise and during glycogen re-synthesis. The results show that GS intrinsic activity is strongly dependent on glycogen levels and that such regulation involves associated...

  8. Characterization of Function of the GlgA2 Glycogen/Starch Synthase in Cyanobacterium sp. Clg1 Highlights Convergent Evolution of Glycogen Metabolism into Starch Granule Aggregation1

    Science.gov (United States)

    Kadouche, Derifa; Arias, Maria Cecilia

    2016-01-01

    At variance with the starch-accumulating plants and most of the glycogen-accumulating cyanobacteria, Cyanobacterium sp. CLg1 synthesizes both glycogen and starch. We now report the selection of a starchless mutant of this cyanobacterium that retains wild-type amounts of glycogen. Unlike other mutants of this type found in plants and cyanobacteria, this mutant proved to be selectively defective for one of the two types of glycogen/starch synthase: GlgA2. This enzyme is phylogenetically related to the previously reported SSIII/SSIV starch synthase that is thought to be involved in starch granule seeding in plants. This suggests that, in addition to the selective polysaccharide debranching demonstrated to be responsible for starch rather than glycogen synthesis, the nature and properties of the elongation enzyme define a novel determinant of starch versus glycogen accumulation. We show that the phylogenies of GlgA2 and of 16S ribosomal RNA display significant congruence. This suggests that this enzyme evolved together with cyanobacteria when they diversified over 2 billion years ago. However, cyanobacteria can be ruled out as direct progenitors of the SSIII/SSIV ancestral gene found in Archaeplastida. Hence, both cyanobacteria and plants recruited similar enzymes independently to perform analogous tasks, further emphasizing the importance of convergent evolution in the appearance of starch from a preexisting glycogen metabolism network. PMID:27208262

  9. Effect of glycogen synthase overexpression on insulin-stimulated muscle glucose uptake and storage.

    Science.gov (United States)

    Fogt, Donovan L; Pan, Shujia; Lee, Sukho; Ding, Zhenping; Scrimgeour, Angus; Lawrence, John C; Ivy, John L

    2004-03-01

    Insulin-stimulated muscle glucose uptake is inversely associated with the muscle glycogen concentration. To investigate whether this association is a cause and effect relationship, we compared insulin-stimulated muscle glucose uptake in noncontracted and postcontracted muscle of GSL3-transgenic and wild-type mice. GSL3-transgenic mice overexpress a constitutively active form of glycogen synthase, which results in an abundant storage of muscle glycogen. Muscle contraction was elicited by in situ electrical stimulation of the sciatic nerve. Right gastrocnemii from GSL3-transgenic and wild-type mice were subjected to 30 min of electrical stimulation followed by hindlimb perfusion of both hindlimbs. Thirty minutes of contraction significantly reduced muscle glycogen concentration in wild-type (49%) and transgenic (27%) mice, although transgenic mice retained 168.8 +/- 20.5 micromol/g glycogen compared with 17.7 +/- 2.6 micromol/g glycogen for wild-type mice. Muscle of transgenic and wild-type mice demonstrated similar pre- (3.6 +/- 0.3 and 3.9 +/- 0.6 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) and postcontraction (7.9 +/- 0.4 and 7.0 +/- 0.4 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) insulin-stimulated glucose uptakes. However, the [14C]glucose incorporated into glycogen was greater in noncontracted (151%) and postcontracted (157%) transgenic muscle vs. muscle of corresponding wild-type mice. These results indicate that glycogen synthase activity is not rate limiting for insulin-stimulated glucose uptake in skeletal muscle and that the inverse relationship between muscle glycogen and insulin-stimulated glucose uptake is an association, not a cause and effect relationship.

  10. Pre- and posttranslational upregulation of muscle-specific glycogen synthase in athletes

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    Expression of muscle-specific glycogen synthase (GS) and phosphofructokinase (PFK) was analyzed in seven athletes and eight control subjects who were characterized using the euglycemic, hyperinsulinemic (2 mU.kg-1.min-1) clamp technique in combination with indirect calorimetry and biopsy sampling...

  11. Involvement of Glycogen Synthase Kinase-3 in the Mechanisms of Conditioned Food Aversion Memory Reconsolidation.

    Science.gov (United States)

    Nikitin, V P; Solntseva, S V; Kozyrev, S A

    2017-02-01

    Experiments were performed on the snails trained in conditioned food aversion for 3 days. Injection of TDZD-8 (glycogen synthase kinase-3 inhibitor, 2 mg/kg) in combination with reminder (presentation of a conditioned food stimulus) led to memory impairment developing 3 days after inhibitor/reminder exposure and followed by spontaneous recovery in 10 days. Injections of TDZD-8 in a dose of 4 or 20 mg/kg before reminder were shown to cause amnesia that persisted for more than 10 days. Memory recovery during repeated training was observed at the earlier period than after initial training. The impairment of memory reconsolidation by TDZD-8 after training of snails for 1 day was less pronounced than under standard training conditions (3 days). The effect of a glycogen synthase kinase-3 inhibitor during memory reconsolidation is probably followed by impairment of memory retrieval and/or partial loss, which can be compensated spontaneously or after repeated training.

  12. Dysregulation of muscle glycogen synthase in recovery from exercise in type 2 diabetes

    DEFF Research Database (Denmark)

    Pedersen, Andreas J T; Hingst, Janne Rasmuss; Friedrichsen, Martin

    2015-01-01

    AIMS/HYPOTHESIS: Insulin and exercise stimulate skeletal muscle glycogen synthase (GS) activity by dephosphorylation and changes in kinetic properties. The aim of this study was to investigate the effects of insulin, exercise and post-exercise insulin stimulation on GS phosphorylation, activity a...... and increased phosphorylation at sites 2 + 2a in type 2 diabetes in the recovery period imply an impaired response to exercise....

  13. Enantioselective synthesis of the novel chiral sulfoxide derivative as a glycogen synthase kinase 3beta inhibitor.

    Science.gov (United States)

    Saitoh, Morihisa; Kunitomo, Jun; Kimura, Eiji; Yamano, Toru; Itoh, Fumio; Kori, Masakuni

    2010-09-01

    Glycogen synthase kinase 3beta (GSK-3beta) inhibitors are expected to be attractive therapeutic agents for the treatment of Alzheimer's disease (AD). Recently we discovered sulfoxides (S)-1 as a novel GSK-3beta inhibitor having in vivo efficacy. We investigated practical asymmetric preparation methods for the scale-up synthesis of (S)-1. The highly enantioselective synthesis of (S)-1 (94% ee) was achieved by titanium-mediated oxidation with D-(-)-diethyl tartrate on gram scale.

  14. Glycogen synthase kinase-3β promotes cyst expansion in polycystic kidney disease.

    Science.gov (United States)

    Tao, Shixin; Kakade, Vijayakumar R; Woodgett, James R; Pandey, Pankaj; Suderman, Erin D; Rajagopal, Madhumitha; Rao, Reena

    2015-06-01

    Polycystic kidney diseases (PKDs) are inherited disorders characterized by the formation of fluid filled renal cysts. Elevated cAMP levels in PKDs stimulate progressive cyst enlargement involving cell proliferation and transepithelial fluid secretion often leading to end-stage renal disease. The glycogen synthase kinase-3 (GSK3) family of protein kinases consists of GSK3α and GSK3β isoforms and has a crucial role in multiple cellular signaling pathways. We previously found that GSK3β, a regulator of cell proliferation, is also crucial for cAMP generation and vasopressin-mediated urine concentration by the kidneys. However, the role of GSK3β in the pathogenesis of PKDs is not known. Here we found that GSK3β expression and activity were markedly upregulated and associated with cyst-lining epithelia in the kidneys of mice and humans with PKD. Renal collecting duct-specific gene knockout of GSK3β or pharmacological inhibition of GSK3 effectively slowed down the progression of PKD in mouse models of autosomal recessive or autosomal dominant PKD. GSK3 inactivation inhibited cAMP generation and cell proliferation resulting in reduced cyst expansion, improved renal function, and extended life span. GSK3β inhibition also reduced pERK, c-Myc, and cyclin-D1, known mitogens in proliferation of cystic epithelial cells. Thus, GSK3β has a novel functional role in PKD pathophysiology, and its inhibition may be therapeutically useful to slow down cyst expansion and progression of PKD.

  15. Nuclear glycogen synthase kinase-3 {beta} (GSK-3) in Rhipicephalus (Boophilus) microplus tick embryogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Mentzingen, Leticia; Andrade, Josiana G. de; Logullo, Carlos [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacazes, RJ (Brazil). Centro de Biociencias e Biotecnologia. Lab. de Quimica e Funcao de Proteinas e Peptideos (LQFPP); Andrade, Caroline P. de; Vaz Junior, Itabajara [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Centro de Biotecnologia

    2008-07-01

    Full text: Glycogen synthase kinase-3 (GSK3) is recognized as a key component of a large number of cellular processes and diseases. Several mechanisms play a part in controlling the actions of GSK3, including phosphorylation, protein complex formation, and subcellular distribution. Recent observations point to functions for phosphorylases several transcription factors in the nucleus. Also, GSK3b participate of the canonical W nt signalling pathway, which has been studied intensively in embryonic and cancer cells. Like in many other signaling pathways, most components in W nt signal transduction were highly conserved during the evolution. More than 40 proteins have been reported to be phosphorylated by GSK3, including over a dozen transcription factors. Although the mechanisms regulating GSK3 are not fully understood, precise control appears to be achieved by a combination of phosphorylation, localization, and interactions with GSK3-binding proteins. Although GSK3 is traditionally considered a cytosolic protein, it is also present in nuclei. Nuclear GSK3 is particularly interesting because of the many transcription factors that it regulates enabling GSK3 to influence many signaling pathways that converge on these transcription factors, thereby regulating the expression of many genes. Our group identified that GSK-3 {beta} could be detected in different stage eggs of R. micro plus. In this work we detected the GSK-3 in isolated nuclear fraction from the egg homogenates of R. micro plus by western-blot analysis, using anti-GSK- 3 {beta} antibodies. The enzyme activity was also detected radiochemically throughout embryogenesis in same fraction. The GSK-3 activity was inhibiting by using SB 216763 (selective molecule inhibitors of GSK-3). Taken together our results suggest that GSK-3 {beta} isoform probably is involved in gene transcription factors during R. micro plus embryo development.

  16. Lafora disease offers a unique window into neuronal glycogen metabolism.

    Science.gov (United States)

    Gentry, Matthew S; Guinovart, Joan J; Minassian, Berge A; Roach, Peter J; Serratosa, Jose M

    2018-05-11

    Lafora disease (LD) is a fatal, autosomal recessive, glycogen-storage disorder that manifests as severe epilepsy. LD results from mutations in the gene encoding either the glycogen phosphatase laforin or the E3 ubiquitin ligase malin. Individuals with LD develop cytoplasmic, aberrant glycogen inclusions in nearly all tissues that more closely resemble plant starch than human glycogen. This Minireview discusses the unique window into glycogen metabolism that LD research offers. It also highlights recent discoveries, including that glycogen contains covalently bound phosphate and that neurons synthesize glycogen and express both glycogen synthase and glycogen phosphorylase. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Identification of a Glycogen Synthase Kinase-3[beta] Inhibitor that Attenuates Hyperactivity in CLOCK Mutant Mice

    Energy Technology Data Exchange (ETDEWEB)

    Kozikowski, Alan P.; Gunosewoyo, Hendra; Guo, Songpo; Gaisina, Irina N.; Walter, Richard L.; Ketcherside, Ariel; McClung, Colleen A.; Mesecar, Andrew D.; Caldarone, Barbara (Psychogenics); (Purdue); (UIC); (UTSMC)

    2012-05-02

    Bipolar disorder is characterized by a cycle of mania and depression, which affects approximately 5 million people in the United States. Current treatment regimes include the so-called 'mood-stabilizing drugs', such as lithium and valproate that are relatively dated drugs with various known side effects. Glycogen synthase kinase-3{beta} (GSK-3{beta}) plays a central role in regulating circadian rhythms, and lithium is known to be a direct inhibitor of GSK-3{beta}. We designed a series of second generation benzofuran-3-yl-(indol-3-yl)maleimides containing a piperidine ring that possess IC{sub 50} values in the range of 4 to 680 nM against human GSK-3{beta}. One of these compounds exhibits reasonable kinase selectivity and promising preliminary absorption, distribution, metabolism, and excretion (ADME) data. The administration of this compound at doses of 10 to 25 mg kg{sup -1} resulted in the attenuation of hyperactivity in amphetamine/chlordiazepoxide-induced manic-like mice together with enhancement of prepulse inhibition, similar to the effects found for valproate (400 mg kg{sup -1}) and the antipsychotic haloperidol (1 mg kg{sup -1}). We also tested this compound in mice carrying a mutation in the central transcriptional activator of molecular rhythms, the CLOCK gene, and found that the same compound attenuates locomotor hyperactivity in response to novelty. This study further demonstrates the use of inhibitors of GSK-3{beta} in the treatment of manic episodes of bipolar/mood disorders, thus further validating GSK-3{beta} as a relevant therapeutic target in the identification of new therapies for bipolar patients.

  18. Glycogen synthase kinase 3α regulates urine concentrating mechanism in mice

    OpenAIRE

    Nørregaard, Rikke; Tao, Shixin; Nilsson, Line; Woodgett, James R.; Kakade, Vijayakumar; Yu, Alan S. L.; Howard, Christiana; Rao, Reena

    2015-01-01

    In mammals, glycogen synthase kinase (GSK)3 comprises GSK3α and GSK3β isoforms. GSK3β has been shown to play a role in the ability of kidneys to concentrate urine by regulating vasopressin-mediated water permeability of collecting ducts, whereas the role of GSK3α has yet to be discerned. To investigate the role of GSK3α in urine concentration, we compared GSK3α knockout (GSK3αKO) mice with wild-type (WT) littermates. Under normal conditions, GSK3αKO mice had higher water intake and urine outp...

  19. Glycogen synthase kinase 3β promotes liver innate immune activation by restraining AMP-activated protein kinase activation.

    Science.gov (United States)

    Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan

    2018-02-13

    Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection

  20. Inhibition of muscle glycogen synthase activity and non-oxidative glucose disposal during hypoglycaemia in normal man

    DEFF Research Database (Denmark)

    Ørskov, Lotte; Bak, Jens Friis; Abildgaard, Ulrik

    1996-01-01

    The purpose of the present study was to evaluate the role of muscle glycogen synthase activity in the reduction of glucose uptake during hypoglycaemia. Six healthy young men were examined twice; during 120 min of hyperinsulinaemic (1.5 mU.kg-1. min-1) euglycaemia followed by: 1)240 min of graded ...

  1. Inhibition of Glycogen Synthase Kinase-3ß Enhances Cognitive Recovery after Stroke: The Role of TAK1

    Science.gov (United States)

    Venna, Venugopal Reddy; Benashski, Sharon E.; Chauhan, Anjali; McCullough, Louise D.

    2015-01-01

    Memory deficits are common among stroke survivors. Identifying neuroprotective agents that can prevent memory impairment or improve memory recovery is a vital area of research. Glycogen synthase kinase-3ß (GSK-3ß) is involved in several essential intracellular signaling pathways. Unlike many other kinases, GSK-3ß is active only when…

  2. Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3.

    Science.gov (United States)

    Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian

    2010-10-01

    According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the

  3. Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Cortés-Vieyra Ricarda

    2012-06-01

    Full Text Available Abstract Glycogen synthase kinase 3β (GSK3β plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.

  4. Glycogen synthase kinase-3β in patients with bipolar I disorder

    DEFF Research Database (Denmark)

    Jacoby, Anne S; Munkholm, Klaus; Vinberg, Maj

    2016-01-01

    OBJECTIVES: The enzyme glycogen synthase kinase-3β (GSK3β) is involved in the mechanisms of action of lithium and may play a role in relation to affective states in bipolar disorder. The objectives of the present study were to compare the activity of GSK-3β (measured as levels of phosphorylated GSK......-3β [p-GSK-3β]) between patients with bipolar disorder in the euthymic state and healthy control subjects, and to investigate whether GSK-3β activity varies with affective states in patients with bipolar I disorder. METHODS: In a prospective 6-12-month follow-up study, we investigated state......-specific, intraindividual alterations in the activity of GSK-3β in 60 patients with bipolar I disorder with an acute severe manic index episode and in subsequent euthymic, depressive and manic states and compared this with repeated measurements in healthy control subjects. Data were analyzed using linear mixed...

  5. Lithium Impairs Kidney Development and Inhibits Glycogen Synthase Kinase-3β in Collecting Duct Principal Cells

    DEFF Research Database (Denmark)

    Kjærsgaard, Gitte; Madsen, Kirsten; Marcussen, Niels

    level significantly whereas total GSK-3β abundance was unaltered. Li+ treatment increased α-Smooth Muscle Actin (α-SMA) protein level significantly whereas E-cadherin expression was unaltered. In summary, Li+ treatment impairs postnatal development of the kidney cortex and outer medulla and increases pGSK......The postnatal rat kidney is highly susceptible to Lithium (Li+), which leads to significant tissue injury. We hypothesized that Li+ impairs development of the kidney through entry into epithelial cells of the distal nephron, inhibition of Glycogen Synthase Kinase-3β (GSK-3β) through phosphorylation...... on serine9 (pGSK-3β)and subsequent epithelial to mesenchymal dedifferentiation (EMT). GSK-3β immunoreactive protein was associated with collecting ducts in developing and adult human and rat kidney. Total GSK-3β protein abundance was stable in medulla while it decreased in cortex in the postnatal period...

  6. Glycogen synthase kinase 3 alpha phosphorylates and regulates the osteogenic activity of Osterix.

    Science.gov (United States)

    Li, Hongyan; Jeong, Hyung Min; Choi, You Hee; Lee, Sung Ho; Jeong, Hye Gwang; Jeong, Tae Cheon; Lee, Kwang Youl

    2013-05-10

    Osteoblast-specific transcription factor Osterix is a zinc-finger transcription factor that required for osteoblast differentiation and new bone formation. The function of Osterix can be modulated by post-translational modification. Glycogen synthase kinase 3 alpha (GSK3α) is a multifunctional serine/threonine protein kinase that plays a role in the Wnt signaling pathways and is implicated in the control of several regulatory proteins and transcription factors. In the present study, we investigated how GSK3α regulates Osterix during osteoblast differentiation. Wide type GSK3α up-regulated the protein level, protein stability and transcriptional activity of Osterix. These results suggest that GSK3α regulates osteogenic activity of Osterix. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens.

    Science.gov (United States)

    Cortés-Vieyra, Ricarda; Bravo-Patiño, Alejandro; Valdez-Alarcón, Juan J; Juárez, Marcos Cajero; Finlay, B Brett; Baizabal-Aguirre, Víctor M

    2012-06-12

    Glycogen synthase kinase 3β (GSK3β) plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB) activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.

  8. Glycogen synthase kinase 3 phosphorylates kinesin light chains and negatively regulates kinesin-based motility

    Science.gov (United States)

    Morfini, Gerardo; Szebenyi, Gyorgyi; Elluru, Ravindhra; Ratner, Nancy; Brady, Scott T.

    2002-01-01

    Membrane-bounded organelles (MBOs) are delivered to different domains in neurons by fast axonal transport. The importance of kinesin for fast antero grade transport is well established, but mechanisms for regulating kinesin-based motility are largely unknown. In this report, we provide biochemical and in vivo evidence that kinesin light chains (KLCs) interact with and are in vivo substrates for glycogen synthase kinase 3 (GSK3). Active GSK3 inhibited anterograde, but not retrograde, transport in squid axoplasm and reduced the amount of kinesin bound to MBOs. Kinesin microtubule binding and microtubule-stimulated ATPase activities were unaffected by GSK3 phosphorylation of KLCs. Active GSK3 was also localized preferentially to regions known to be sites of membrane delivery. These data suggest that GSK3 can regulate fast anterograde axonal transport and targeting of cargos to specific subcellular domains in neurons.

  9. Glycogen Synthase Kinase 3 Inhibitors in the Next Horizon for Alzheimer's Disease Treatment

    Directory of Open Access Journals (Sweden)

    Ana Martinez

    2011-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK-3, a proline/serine protein kinase ubiquitously expressed and involved in many cellular signaling pathways, plays a key role in the pathogenesis of Alzheimer's disease (AD being probably the link between β-amyloid and tau pathology. A great effort has recently been done in the discovery and development of different new molecules, of synthetic and natural origin, able to inhibit this enzyme, and several kinetics mechanisms of binding have been described. The small molecule called tideglusib belonging to the thiadiazolidindione family is currently on phase IIb clinical trials for AD. The potential risks and benefits of this new kind of disease modifying drugs for the future therapy of AD are discussed in this paper.

  10. Redox Switch for the Inhibited State of Yeast Glycogen Synthase Mimics Regulation by Phosphorylation

    Energy Technology Data Exchange (ETDEWEB)

    Mahalingan, Krishna K.; Baskaran†, Sulochanadevi; DePaoli-Roach, Anna A.; Roach, Peter J.; Hurley, Thomas D. (Indiana-Med)

    2017-01-10

    Glycogen synthase (GS) is the rate limiting enzyme in the synthesis of glycogen. Eukaryotic GS is negatively regulated by covalent phosphorylation and allosterically activated by glucose-6-phosphate (G-6-P). To gain structural insights into the inhibited state of the enzyme, we solved the crystal structure of yGsy2-R589A/R592A to a resolution of 3.3 Å. The double mutant has an activity ratio similar to the phosphorylated enzyme and also retains the ability to be activated by G-6-P. When compared to the 2.88 Å structure of the wild-type G-6-P activated enzyme, the crystal structure of the low-activity mutant showed that the N-terminal domain of the inhibited state is tightly held against the dimer-related interface thereby hindering acceptor access to the catalytic cleft. On the basis of these two structural observations, we developed a reversible redox regulatory feature in yeast GS by substituting cysteine residues for two highly conserved arginine residues. When oxidized, the cysteine mutant enzyme exhibits activity levels similar to the phosphorylated enzyme but cannot be activated by G-6-P. Upon reduction, the cysteine mutant enzyme regains normal activity levels and regulatory response to G-6-P activation.

  11. Expression of glycogen synthase and phosphofructokinase in muscle from type 1 (insulin-dependent) diabetic patients before and after intensive insulin treatment

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    The aim of the present study was to determine whether short-term appropriate insulinization of Type 1 (insulin-dependent) diabetic patients in long-term poor glycaemic control (HbA1C > 9.5%) was associated with an adaptive regulation of the activity and gene expression of key proteins in muscle...... glycogen storage and glycolysis: glycogen synthase and phosphofructokinase, respectively. In nine diabetic patients biopsies of quadriceps muscle were taken before and 24-h after intensified insulin therapy and compared to findings in eight control subjects. Subcutaneous injections of rapid acting insulin...... were given at 3-h intervals to improve glycaemic control in diabetic patients (fasting plasma glucose decreased from 20.8 +/- 0.8 to 8.7 +/- 0.8 mmol/l whereas fasting serum insulin increased from 59 +/- 8 to 173 +/- 3 pmol/l). Before intensified insulin therapy, analysis of muscle biopsies from...

  12. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  13. Platelet-derived growth factor-DD targeting arrests pathological angiogenesis by modulating glycogen synthase kinase-3beta phosphorylation.

    Science.gov (United States)

    Kumar, Anil; Hou, Xu; Lee, Chunsik; Li, Yang; Maminishkis, Arvydas; Tang, Zhongshu; Zhang, Fan; Langer, Harald F; Arjunan, Pachiappan; Dong, Lijin; Wu, Zhijian; Zhu, Linda Y; Wang, Lianchun; Min, Wang; Colosi, Peter; Chavakis, Triantafyllos; Li, Xuri

    2010-05-14

    Platelet-derived growth factor-DD (PDGF-DD) is a recently discovered member of the PDGF family. The role of PDGF-DD in pathological angiogenesis and the underlying cellular and molecular mechanisms remain largely unexplored. In this study, using different animal models, we showed that PDGF-DD expression was up-regulated during pathological angiogenesis, and inhibition of PDGF-DD suppressed both choroidal and retinal neovascularization. We also demonstrated a novel mechanism mediating the function of PDGF-DD. PDGF-DD induced glycogen synthase kinase-3beta (GSK3beta) Ser(9) phosphorylation and Tyr(216) dephosphorylation in vitro and in vivo, leading to increased cell survival. Consistently, GSK3beta activity was required for the antiangiogenic effect of PDGF-DD targeting. Moreover, PDGF-DD regulated the expression of GSK3beta and many other genes important for angiogenesis and apoptosis. Thus, we identified PDGF-DD as an important target gene for antiangiogenic therapy due to its pleiotropic effects on vascular and non-vascular cells. PDGF-DD inhibition may offer new therapeutic options to treat neovascular diseases.

  14. Phosphorylation of sites 3 and 2 in rabbit skeletal muscle glycogen synthase by a multifunctional protein kinase (ATP-citrate lyase kinase)

    International Nuclear Information System (INIS)

    Sheorain, V.S.; Ramakrishna, S.; Benjamin, W.B.; Soderling, T.R.

    1985-01-01

    A multifunctional protein kinase, purified from rat liver as ATP-citrate lyase kinase, has been identified as a glycogen synthase kinase. This kinase catalyzed incorporation of up to 1.5 mol of and]2number 2 PO 4 /mol of synthase subunit associated with a decrease in the glycogen synthase activity ratio from 0.85 to a value of 0.15. Approximately 65-70% of the 34 PO 4 was incorporated into site 3 and 30-35% into site 2 as determined by reverse phase high performance liquid chromatography. This multifunctional kinase was distinguished from glycogen synthase kinase-3 on the basis of nucleotide and protein substrate specificities. Since the phosphate contents in glycogen synthase of sites 3 and 2 are altered in diabetes and by insulin administration, the possible involvement of the multifunctional kinase was explored. Glycogen synthase purified from diabetic rabbits was phosphorylated in vitro by this multifunctional kinase at only 10% of the rate compared to synthase purified from control rabbits. Treatment of the diabetics with insulin restored the synthase to a form that was readily phosphorylated in vitro

  15. Effect of acute exercise on glycogen synthase in muscle from obese and diabetic subjects.

    Science.gov (United States)

    Jensen, Jørgen; Tantiwong, Puntip; Stuenæs, Jorid T; Molina-Carrion, Marjorie; DeFronzo, Ralph A; Sakamoto, Kei; Musi, Nicolas

    2012-07-01

    Insulin stimulates glycogen synthase (GS) through dephosphorylation of serine residues, and this effect is impaired in skeletal muscle from insulin-resistant [obese and type 2 diabetic (T2DM)] subjects. Exercise also increases GS activity, yet it is not known whether the ability of exercise to affect GS is impaired in insulin-resistant subjects. The objective of this study was to examine the effect of acute exercise on GS phosphorylation and enzyme kinetic properties in muscle from insulin-resistant individuals. Lean normal glucose-tolerant (NGT), obese NGT, and obese T2DM subjects performed 40 min of moderate-intensity cycle exercise (70% of Vo(2max)). GS kinetic properties and phosphorylation were measured in vastus lateralis muscle before exercise, immediately after exercise, and 3.5 h postexercise. In lean subjects, GS fractional activity increased twofold after 40 min of exercise, and it remained elevated after the 3.5-h rest period. Importantly, exercise also decreased GS K(m) for UDP-glucose from ≈0.5 to ≈0.2 mM. In lean subjects, exercise caused significant dephosphorylation of GS by 50-70% (Ser(641), Ser(645), and Ser(645,649,653,657)), and phosphorylation of these sites remained decreased after 3.5 h; Ser⁷ phosphorylation was not regulated by exercise. In obese NGT and T2DM subjects, exercise increased GS fractional activity, decreased K(m) for UDP-glucose, and decreased GS phosphorylation as effectively as in lean NGT subjects. We conclude that the molecular regulatory process by which exercise promotes glycogen synthesis in muscle is preserved in insulin-resistant subjects.

  16. The diabetic phenotype is conserved in myotubes established from diabetic subjects: evidence for primary defects in glucose transport and glycogen synthase activity

    DEFF Research Database (Denmark)

    Gaster, Michael; Petersen, Ingrid; Højlund, Kurt

    2002-01-01

    The most well-described defect in the pathophysiology of type 2 diabetes is reduced insulin-mediated glycogen synthesis in skeletal muscles. It is unclear whether this defect is primary or acquired secondary to dyslipidemia, hyperinsulinemia, or hyperglycemia. We determined the glycogen synthase...

  17. Glucose 6-phosphate compartmentation and the control of glycogen synthesis

    NARCIS (Netherlands)

    Meijer, Alfred

    2002-01-01

    Using adenovirus-mediated gene transfer into FTO-2B cells, a rat hepatoma cell line, we have overexpressed hexokinase I, (HK I), glucokinase (GK), liver glycogen synthase (LGS), muscle glycogen synthase (MGS), and combinations of each of the two glucose phosphorylating enzymes with each one of the

  18. The basal kinetic parameters of glycogen synthase in human myotube cultures are not affected by chronic high insulin exposure

    DEFF Research Database (Denmark)

    Gaster, M; Schrøder, H D; Handberg, A

    2001-01-01

    results show that chronic exposure of human myotubes to high insulin with or without high glucose did not affect the basal kinetic parameters but abolished the reactivity of GS to acute insulin stimulation. We suggest that insulin induced insulin resistance of GS is caused by a failure of acute insulin......There is no consensus regarding the results from in vivo and in vitro studies on the impact of chronic high insulin and/or high glucose exposure on acute insulin stimulation of glycogen synthase (GS) kinetic parameters in human skeletal muscle. The aim of this study was to evaluate the kinetic...... parameters of glycogen synthase activity in human myotube cultures at conditions of chronic high insulin combined or not with high glucose exposure, before and after a subsequent acute insulin stimulation. Acute insulin stimulation significantly increased the fractional activity (FV(0.1)) of GS, increased...

  19. Increased phosphorylation of skeletal muscle glycogen synthase at NH2-terminal sites during physiological hyperinsulinemia in type 2 diabetes

    DEFF Research Database (Denmark)

    Højlund, Kurt; Staehr, Peter; Hansen, Bo Falck

    2003-01-01

    In type 2 diabetes, insulin activation of muscle glycogen synthase (GS) is impaired. This defect plays a major role for the development of insulin resistance and hyperglycemia. In animal muscle, insulin activates GS by reducing phosphorylation at both NH(2)- and COOH-terminal sites......, but the mechanism involved in human muscle and the defect in type 2 diabetes remain unclear. We studied the effect of insulin at physiological concentrations on glucose metabolism, insulin signaling and phosphorylation of GS in skeletal muscle from type 2 diabetic and well-matched control subjects during euglycemic......-hyperinsulinemic clamps. Analysis using phospho-specific antibodies revealed that insulin decreases phosphorylation of sites 3a + 3b in human muscle, and this was accompanied by activation of Akt and inhibition of glycogen synthase kinase-3alpha. In type 2 diabetic subjects these effects of insulin were fully intact...

  20. Insulin Induces an Increase in Cytosolic Glucose Levels in 3T3-L1 Cells with Inhibited Glycogen Synthase Activation

    Directory of Open Access Journals (Sweden)

    Helena H. Chowdhury

    2014-10-01

    Full Text Available Glucose is an important source of energy for mammalian cells and enters the cytosol via glucose transporters. It has been thought for a long time that glucose entering the cytosol is swiftly phosphorylated in most cell types; hence the levels of free glucose are very low, beyond the detection level. However, the introduction of new fluorescence resonance energy transfer-based glucose nanosensors has made it possible to measure intracellular glucose more accurately. Here, we used the fluorescent indicator protein (FLIPglu-600µ to monitor cytosolic glucose dynamics in mouse 3T3-L1 cells in which glucose utilization for glycogen synthesis was inhibited. The results show that cells exhibit a low resting cytosolic glucose concentration. However, in cells with inhibited glycogen synthase activation, insulin induced a robust increase in cytosolic free glucose. The insulin-induced increase in cytosolic glucose in these cells is due to an imbalance between the glucose transported into the cytosol and the use of glucose in the cytosol. In untreated cells with sensitive glycogen synthase activation, insulin stimulation did not result in a change in the cytosolic glucose level. This is the first report of dynamic measurements of cytosolic glucose levels in cells devoid of the glycogen synthesis pathway.

  1. Imidazopyridine-based inhibitors of glycogen synthase kinase 3: synthesis and evaluation of amide isostere replacements of the carboxamide scaffold.

    Science.gov (United States)

    Yngve, Ulrika; Söderman, Peter; Svensson, Mats; Rosqvist, Susanne; Arvidsson, Per I

    2012-11-01

    In this study, we explored the effect of bioisostere replacement in a series of glycogen synthase kinase 3 (GSK3) inhibitors based on the imidazopyridine core. The synthesis and biological evaluation of a number of novel sulfonamide, 1,2,4-oxadiazole, and thiazole derivates as amide bioisosteres, as well as a computational rationalization of the obtained results are reported. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  2. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    International Nuclear Information System (INIS)

    Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.

    1986-01-01

    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor

  3. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  4. Inhibition of glycogen synthase kinase-3β attenuates glucocorticoid-induced suppression of myogenic differentiation in vitro.

    Directory of Open Access Journals (Sweden)

    Zhenyu Ma

    Full Text Available Glucocorticoids are the only therapy that has been demonstrated to alter the progress of Duchenne muscular dystrophy (DMD, the most common muscular dystrophy in children. However, glucocorticoids disturb skeletal muscle metabolism and hamper myogenesis and muscle regeneration. The mechanisms involved in the glucocorticoid-mediated suppression of myogenic differentiation are not fully understood. Glycogen synthase kinase-3β (GSK-3β is considered to play a central role as a negative regulator in myogenic differentiation. Here, we showed that glucocorticoid treatment during the first 48 h in differentiation medium decreased the level of phosphorylated Ser9-GSK-3β, an inactive form of GSK-3β, suggesting that glucocorticoids affect GSK-3β activity. We then investigated whether GSK-3β inhibition could regulate glucocorticoid-mediated suppression of myogenic differentiation in vitro. Two methods were employed to inhibit GSK-3β: pharmacological inhibition with LiCl and GSK-3β gene knockdown. We found that both methods resulted in enhanced myotube formation and increased levels of muscle regulatory factors and muscle-specific protein expression. Importantly, GSK-3β inhibition attenuated glucocorticoid-induced suppression of myogenic differentiation. Collectively, these data suggest the involvement of GSK-3β in the glucocorticoid-mediated impairment of myogenic differentiation. Therefore, the inhibition of GSK-3β may be a strategy for preventing glucocorticoid-induced muscle degeneration.

  5. Low birth weight and zygosity status is associated with defective muscle glycogen and glycogen synthase regulation in elderly twins

    DEFF Research Database (Denmark)

    Poulsen, Pernille; Wojtaszewski, Jørgen; Richter, Erik

    2007-01-01

    OBJECTIVE: An adverse intrauterine environment indicated by both low birth weight and monozygosity is associated with an age- or time-dependent reduction in glucose disposal and nonoxidative glucose metabolism in twins, suggesting impaired regulation of muscle glycogen synthesis. RESEARCH DESIGN ...

  6. Glycogen synthase kinase-3β ablation limits pancreatitis-induced acinar-to-ductal metaplasia.

    Science.gov (United States)

    Ding, Li; Liou, Geou-Yarh; Schmitt, Daniel M; Storz, Peter; Zhang, Jin-San; Billadeau, Daniel D

    2017-09-01

    Acinar-to-ductal metaplasia (ADM) is a reversible epithelial transdifferentiation process that occurs in the pancreas in response to acute inflammation. ADM can rapidly progress towards pre-malignant pancreatic intraepithelial neoplasia (PanIN) lesions in the presence of mutant KRas and ultimately pancreatic adenocarcinoma (PDAC). In the present work, we elucidate the role and related mechanism of glycogen synthase kinase-3beta (GSK-3β) in ADM development using in vitro 3D cultures and genetically engineered mouse models. We show that GSK-3β promotes TGF-α-induced ADM in 3D cultured primary acinar cells, whereas deletion of GSK-3β attenuates caerulein-induced ADM formation and PanIN progression in Kras G12D transgenic mice. Furthermore, we demonstrate that GSK-3β ablation influences ADM formation and PanIN progression by suppressing oncogenic KRas-driven cell proliferation. Mechanistically, we show that GSK-3β regulates proliferation by increasing the activation of S6 kinase. Taken together, these results indicate that GSK-3β participates in early pancreatitis-induced ADM and thus could be a target for the treatment of chronic pancreatitis and the prevention of PDAC progression. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  7. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Directory of Open Access Journals (Sweden)

    Hoseok Choi

    2016-04-01

    Full Text Available Assaying the glycogen synthase kinase-3 (GSK3 activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts.

  8. Glycogen synthase kinase-3: A promising therapeutic target for Fragile X Syndrome

    Directory of Open Access Journals (Sweden)

    Marjelo M. Mines

    2011-11-01

    Full Text Available Recent advances in understanding the pathophysiological mechanisms contributing to Fragile X Syndrome (FXS have increased optimism that drug interventions can provide significant therapeutic benefits. FXS results from inadequate expression of functional fragile X mental retardation protein (FMRP. FMRP may have several functions, but it is most well-established as an RNA-binding protein that regulates translation, and it is by this mechanism that FMRP is capable of affecting numerous cellular processes by selectively regulating protein levels. The multiple cellular functions regulated by FMRP suggest that multiple interventions may be required for reversing the effects of deficient FMRP. Evidence that inhibitors of glycogen synthase kinase-3 (GSK3 may contribute to the therapeutic treatment of FXS is reviewed here. In the mouse model of FXS, which lacks FMRP expression (FX mice, GSK3 is hyperactive in several brain regions. Furthermore, significant improvements in several FX-related phenotypes have been obtained in FX mice following the administration of lithium, and in some case other GSK3 inhibitors. These responses include normalization of heightened audiogenic seizure susceptibility and of hyperactive locomotor behavior, enhancement of passive avoidance learning retention and of sociability behaviors, and corrections of macroorchidism, neuronal spine density, and neural plasticity measured electrophysiologically as long term depression. A pilot clinical trial of lithium in FXS patients also found improvements in several measures of behavior. Taken together, these findings indicate that lithium and other inhibitors of GSK3 are promising candidate therapeutic agents for treating FXS.

  9. Glycogen Synthase Kinase 3β Inhibition as a Therapeutic Approach in the Treatment of Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Liang Ma

    2013-08-01

    Full Text Available Alternative strategies beyond current chemotherapy and radiation therapy regimens are needed in the treatment of advanced stage and recurrent endometrial cancers. There is considerable promise for biologic agents targeting the extracellular signal-regulated kinase (ERK pathway for treatment of these cancers. Many downstream substrates of the ERK signaling pathway, such as glycogen synthase kinase 3β (GSK3β, and their roles in endometrial carcinogenesis have not yet been investigated. In this study, we tested the importance of GSK3β inhibition in endometrial cancer cell lines and in vivo models. Inhibition of GSK3β by either lithium chloride (LiCl or specific GSK3β inhibitor VIII showed cytostatic and cytotoxic effects on multiple endometrial cancer cell lines, with little effect on the immortalized normal endometrial cell line. Flow cytometry and immunofluorescence revealed a G2/M cell cycle arrest in both type I (AN3CA, KLE, and RL952 and type II (ARK1 endometrial cancer cell lines. In addition, LiCl pre-treatment sensitized AN3CA cells to the chemotherapy agent paclitaxel. Administration of LiCl to AN3CA tumor-bearing mice resulted in partial or complete regression of some tumors. Thus, GSK3β activity is associated with endometrial cancer tumorigenesis and its pharmacologic inhibition reduces cell proliferation and tumor growth.

  10. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Science.gov (United States)

    Choi, Hoseok; Choi, Bomi; Seo, Ju Tae; Lee, Kyung Jin; Gye, Myung Chan; Kim, Young-Pil

    2016-01-01

    Assaying the glycogen synthase kinase-3 (GSK3) activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed) peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts. PMID:27092510

  11. Regulation of mouse brain glycogen synthase kinase-3 by atypical antipsychotics.

    Science.gov (United States)

    Li, Xiaohua; Rosborough, Kelley M; Friedman, Ari B; Zhu, Wawa; Roth, Kevin A

    2007-02-01

    Glycogen synthase kinase-3 (GSK3) has been recognized as an important enzyme that modulates many aspects of neuronal function. Accumulating evidence implicates abnormal activity of GSK3 in mood disorders and schizophrenia, and GSK3 is a potential protein kinase target for psychotropics used in these disorders. We previously reported that serotonin, a major neurotransmitter involved in mood disorders, regulates GSK3 by acutely increasing its N-terminal serine phosphorylation. The present study was undertaken to further determine if atypical antipsychotics, which have therapeutic effects in both mood disorders and schizophrenia, can regulate phospho-Ser-GSK3 and inhibit its activity. The results showed that acute treatment of mice with risperidone rapidly increased the level of brain phospho-Ser-GSK3 in the cortex, hippocampus, striatum, and cerebellum in a dose-dependent manner. Regulation of phospho-Ser-GSK3 was a shared effect among several atypical antipsychotics, including olanzapine, clozapine, quetiapine, and ziprasidone. In addition, combination treatment of mice with risperidone and a monoamine reuptake inhibitor antidepressant imipramine or fluoxetine elicited larger increases in brain phospho-Ser-GSK3 than each agent alone. Taken together, these results provide new information suggesting that atypical antipsychotics, in addition to mood stabilizers and antidepressants, can inhibit the activity of GSK3. These findings may support the pharmacological mechanisms of atypical antipsychotics in the treatment of mood disorders.

  12. Aberrant glycogen synthase kinase 3β in the development of pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Takeo Shimasaki

    2012-01-01

    Full Text Available Development and progression of pancreatic cancer involves general metabolic disorder, local chronic inflammation, and multistep activation of distinct oncogenic molecular pathways. These pathologic processes result in a highly invasive and metastatic tumor phenotype that is a major obstacle to curative surgical intervention, infusional gemcitabine-based chemotherapy, and radiation therapy. Many clinical trials with chemical compounds and therapeutic antibodies targeting growth factors, angiogenic factors, and matrix metalloproteinases have failed to demonstrate definitive therapeutic benefits to refractory pancreatic cancer patients. Glycogen synthase kinase 3β (GSK3β, a serine/threonine protein kinase, has emerged as a therapeutic target in common chronic and progressive diseases, including cancer. Here we review accumulating evidence for a pathologic role of GSK3β in promoting tumor cell survival, proliferation, invasion, and resistance to chemotherapy and radiation in pancreatic cancer. We also discuss the putative involvement of GSK3β in mediating metabolic disorder, local inflammation, and molecular alteration leading to pancreatic cancer development. Taken together, we highlight potential therapeutic as well as preventive effects of GSK3β inhibition in pancreatic cancer.

  13. Activation of GABAB receptors inhibits protein kinase B /Glycogen Synthase Kinase 3 signaling

    Directory of Open Access Journals (Sweden)

    Lu Frances Fangjia

    2012-11-01

    Full Text Available Abstract Accumulated evidence has suggested that potentiation of cortical GABAergic inhibitory neurotransmission may be a key mechanism in the treatment of schizophrenia. However, the downstream molecular mechanisms related to GABA potentiation remain unexplored. Recent studies have suggested that dopamine D2 receptor antagonists, which are used in the clinical treatment of schizophrenia, modulate protein kinase B (Akt/glycogen synthase kinase (GSK-3 signaling. Here we report that activation of GABAB receptors significantly inhibits Akt/GSK-3 signaling in a β-arrestin-dependent pathway. Agonist stimulation of GABAB receptors enhances the phosphorylation of Akt (Thr-308 and enhances the phosphorylation of GSK-3α (Ser-21/β (Ser-9 in both HEK-293T cells expressing GABAB receptors and rat hippocampal slices. Furthermore, knocking down the expression of β-arrestin2 using siRNA abolishes the GABAB receptor-mediated modulation of GSK-3 signaling. Our data may help to identify potentially novel targets through which GABAB receptor agents may exert therapeutic effects in the treatment of schizophrenia.

  14. AJS1669, a novel small-molecule muscle glycogen synthase activator, improves glucose metabolism and reduces body fat mass in mice

    Science.gov (United States)

    Nakano, Kazuhiro; Takeshita, Sen; Kawasaki, Noriko; Miyanaga, Wataru; Okamatsu, Yoriko; Dohi, Mizuki; Nakagawa, Tadakiyo

    2017-01-01

    Impaired glycogen synthesis and turnover are common in insulin resistance and type 2 diabetes. As glycogen synthase (GS) is a key enzyme involved in the synthetic process, it presents a promising therapeutic target for the treatment of type 2 diabetes. In the present study, we identified a novel, potent and orally available GS activator AJS1669 {sodium 2-[[5-[[4-(4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl]furan-2-carbonyl]-(2-furylmethyl)amino] acetate}. In vitro, we performed a glycogen synthase 1 (GYS1) activation assay for screening GS activators and identified that the activity of AJS1669 was further potentiated in the presence of glucose-6-phosphate (G6P). In vivo, we used ob/ob mice to evaluate the novel anti-diabetic effects of AJS1669 by measuring basal blood glucose levels, glucose tolerance and body fat mass index. Repeated administration of AJS1669 over 4 weeks reduced blood glucose and hemoglobin A1c (HbA1c) levels in ob/ob mice. AJS1669 also improved glucose tolerance in a dose-dependent manner, and decreased body fat mass. The mRNA levels of genes involved in mitochondrial fatty acid oxidation and mitochondrial biogenesis were elevated in skeletal muscle tissue following AJS1669 treatment. Hepatic tissue of treated mice also exhibited elevated expression of genes associated with fatty acid oxidation. In contrast to ob/ob mice, in C57Bl/6 mice AJS1669 administration did not alter body weight or reduce glucose levels. These results demonstrate that pharmacological agents that activate GYS1, the main GS subtype found in skeletal muscle, have potential for use as novel treatments for diabetes that improve glucose metabolism in skeletal muscle. PMID:28290602

  15. Morphological Analysis of CDC2 and Glycogen Synthase Kinase 3β Phosphorylation as Markers of G2 → M Transition in Glioma

    Directory of Open Access Journals (Sweden)

    José Javier Otero

    2011-01-01

    Full Text Available G2 → M transition is a strategic target for glioma chemotherapy. Key players in G2 → M transition include CDC2 and glycogen synthase kinase 3β (GSK3β, which are highly regulated by posttranslational phosphorylation. This report is a morphological analysis of CDC2 and GSK3β phosphorylation using immunohistochemistry in gliomas with different biological properties. GBM showed a 2.8-fold and 5.6-fold increase in number of cells positive for pThr161CDC2 and a 4.2- and 6.9-fold increase in number of cells positive for pTyr15CDC2 relative to oligodendroglioma and ependymoma, respectively. Elevated labeling for inhibited phospho-CDC2 (pTyr15CDC correlates with elevated levels of phosphorylated glycogen synthase kinase 3β (GSK3β. 71% of the GBM cases showed intermediate to high intensity staining for pSer9SGK3β 53% of oligodendroglioma, and 73% of ependymoma showed low intensity staining. CDC2 gene amplification correlates with increased survival in glioblastoma multiforme (GBM and astrocytoma WHO grades II-III, but not in oligodendroglioma WHO grades II-III.

  16. Regulation of Th1 cells and experimental autoimmune encephalomyelitis (EAE) by glycogen synthase kinase-3

    Science.gov (United States)

    Beurel, Eléonore; Kaidanovich-Beilin, Oksana; Yeh, Wen-I; Song, Ling; Palomo, Valle; Michalek, Suzanne M.; Woodgett, James R.; Harrington, Laurie E.; Eldar-Finkelman, Hagit; Martinez, Ana; Jope, Richard S.

    2013-01-01

    Experimental autoimmune encephalomyelitis (EAE) is a rodent model of multiple sclerosis (MS), a debilitating autoimmune disease of the central nervous system, for which only limited therapeutic interventions are available. Since MS is mediated in part by autoreactive T cells, particularly Th17 and Th1 cells, in the present study, we tested if inhibitors of glycogen synthase kinase-3 (GSK3), previously reported to reduce Th17 cell generation, also alter Th1 cell production or ameliorate EAE. GSK3 inhibitors were found to impede the production of Th1 cells by reducing STAT1 activation. Molecularly reducing the expression of either of the two GSK3 isoforms demonstrated that Th17 cell production was sensitive to reduced levels of GSK3β, and Th1 cell production was inhibited in GSK3α-deficient cells. Administration of the selective GSK3 inhibitors TDZD-8, VP2.51, VP0.7, or L803-mts, significantly reduced the clinical symptoms of MOG35-55-induced EAE in mice, nearly eliminating the chronic progressive phase, and reduced the number of Th17 and Th1 cells in the spinal cord. Administration of TDZD-8 or L803-mts after the initial disease episode ameliorated clinical symptoms in a relapsing/remitting model of PLP139-151-induced EAE. Furthermore, deletion of GSK3β specifically in T cells was sufficient to ameliorate MOG35-55-induced EAE. These results demonstrate isoform-selective effects of GSK3 on T cell generation, therapeutic effects of GSK3 inhibitors in EAE, and that GSK3 inhibition in T cells is sufficient to reduce the severity of EAE, suggesting that GSK3 may be a feasible target for developing new therapeutic interventions for MS. PMID:23606540

  17. Glycogen synthase kinase-3 levels and phosphorylation undergo large fluctuations in mouse brain during development

    Science.gov (United States)

    Beurel, Eléonore; Mines, Marjelo A; Song, Ling; Jope, Richard S

    2012-01-01

    Objectives Dysregulated glycogen synthase kinase-3 (GSK3) may contribute to the pathophysiology of mood disorders and other diseases, and appears to be a target of certain therapeutic drugs. The growing recognition of heightened vulnerability during development to many psychiatric diseases, including mood disorders, led us to test if there are developmental changes in mouse brain GSK3 and its regulation by phosphorylation and by therapeutic drugs. Methods GSK3 levels and phosphorylation were measured at seven ages of development in mouse cerebral cortex and hippocampus. Results Two periods of rapid transitions in GSK3 levels were identified, a large rise between postnatal day 1 and two to three weeks of age, where GSK3 levels were as high as four-fold adult mouse brain levels, and a rapid decline between two to four and eight weeks of age, when adult levels were reached. Inhibitory serine-phosphorylation of GSK3, particularly GSK3β, was extremely high in one-day postnatal mouse brain, and rapidly declined thereafter. These developmental changes in GSK3 were equivalent in male and female cerebral cortex, and differed from other signaling kinases, including Akt, ERK1/2, JNK, and p38 levels and phosphorylation. In contrast to adult mouse brain, where administration of lithium or fluoxetine rapidly and robustly increased serine-phosphorylation of GSK3, in young mice these responses were blunted or absent. Conclusions High brain levels of GSK3 and large fluctuations in its levels and phosphorylation in juvenile and adolescent mouse brain raise the possibility that they may contribute to destabilized mood regulation induced by environmental and genetic factors. PMID:23167932

  18. The Antimalarial Effect of Curcumin Is Mediated by the Inhibition of Glycogen Synthase Kinase-3β.

    Science.gov (United States)

    Ali, Amatul Hamizah; Sudi, Suhaini; Basir, Rusliza; Embi, Noor; Sidek, Hasidah Mohd

    2017-02-01

    Curcumin, a bioactive compound in Curcuma longa, exhibits various pharmacological activities, including antimalarial effects. In silico docking simulation studies suggest that curcumin possesses glycogen synthase kinase-3β (GSK3β)-inhibitory properties. The involvement of GSK3 in the antimalarial effects in vivo is yet to be demonstrated. In this study, we aimed to evaluate whether the antimalarial effects of curcumin involve phosphorylation of host GSK3β. Intraperitoneal administration of curcumin into Plasmodium berghei NK65-infected mice resulted in dose-dependent chemosuppression of parasitemia development. At the highest dose tested (30 mg/kg body weight), both therapeutic and prophylactic administrations of curcumin resulted in suppression exceeding 50% and improved median survival time of infected mice compared to control. Western analysis revealed a 5.5-fold (therapeutic group) and 1.8-fold (prophylactic group) increase in phosphorylation of Ser 9 GSK3β and 1.6-fold (therapeutic group) and 1.7-fold (prophylactic group) increase in Ser 473 Akt in liver of curcumin-treated infected animals. Following P. berghei infection, levels of pro- and anti-inflammatory cytokines, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, interleukin (IL)-10, and IL-4 were elevated by 7.5-, 35.0-, 33.0-, and 2.2-fold, respectively. Curcumin treatment (therapeutic) caused a significant decrease (by 6.0- and 2.0-fold, respectively) in serum TNF-α and IFN-γ level, while IL-10 and IL-4 were elevated (by 1.4- and 1.8-fold). Findings from the present study demonstrate for the first time that the antimalarial action of curcumin involved inhibition of GSK3β.

  19. Deleterious effects of neuronal accumulation of glycogen in flies and mice

    OpenAIRE

    Duran, Jordi; Tevy, María Florencia; Garcia-Rocha, Mar; Calbó, Joaquim; Milán, Marco; Guinovart, Joan J

    2012-01-01

    Under physiological conditions, most neurons keep glycogen synthase (GS) in an inactive form and do not show detectable levels of glycogen. Nevertheless, aberrant glycogen accumulation in neurons is a hallmark of patients suffering from Lafora disease or other polyglucosan disorders. Although these diseases are associated with mutations in genes involved in glycogen metabolism, the role of glycogen accumulation remains elusive. Here, we generated mouse and fly models expressing an active form...

  20. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  1. Eckmaxol, a Phlorotannin Extracted from Ecklonia maxima, Produces Anti-β-amyloid Oligomer Neuroprotective Effects Possibly via Directly Acting on Glycogen Synthase Kinase 3β.

    Science.gov (United States)

    Wang, Jialing; Zheng, Jiachen; Huang, Chunhui; Zhao, Jiaying; Lin, Jiajia; Zhou, Xuezhen; Naman, C Benjamin; Wang, Ning; Gerwick, William H; Wang, Qinwen; Yan, Xiaojun; Cui, Wei; He, Shan

    2018-04-10

    Alzheimer's disease is a progressive neurodegenerative disorder that mainly affects the elderly. Soluble β-amyloid oligomer, which can induce neurotoxicity, is generally regarded as the main neurotoxin in Alzheimer's disease. Here we report that eckmaxol, a phlorotannin extracted from the brown alga Ecklonia maxima, could produce neuroprotective effects in SH-SY5Y cells. Eckmaxol effectively prevented but did not rescue β-amyloid oligomer-induced neuronal apoptosis and increase of intracellular reactive oxygen species. Eckmaxol also significantly reversed the decreased expression of phospho-Ser9-glycogen synthase kinase 3β and increased expression of phospho-extracellular signal-regulated kinase, which was induced by Aβ oligomer. Moreover, both glycogen synthase kinase 3β and mitogen activated protein kinase inhibitors produced neuroprotective effects in SH-SY5Y cells. Furthermore, eckmaxol showed favorable interaction in the ATP binding site of glycogen synthase kinase 3β and mitogen activated protein kinase. These results suggested that eckmaxol might produce neuroprotective effects via concurrent inhibition of glycogen synthase kinase 3β and extracellular signal-regulated kinase pathways, possibly via directly acting on glycogen synthase kinase 3β and mitogen activated protein kinase. Based on the central role that β-amyloid oligomers play in the pathogenesis of Alzheimer's disease and the high annual production of Ecklonia maxima for alginate and other nutritional ingredients, this report represents a new candidate for the treatment of Alzheimer's disease, and also expands the potential application of Ecklonia maxima and its constituents in the field of pharmacology.

  2. Phosphoproteomics reveals that glycogen synthase kinase-3 phosphorylates multiple splicing factors and is associated with alternative splicing

    Science.gov (United States)

    Shinde, Mansi Y.; Sidoli, Simone; Kulej, Katarzyna; Mallory, Michael J.; Radens, Caleb M.; Reicherter, Amanda L.; Myers, Rebecca L.; Barash, Yoseph; Lynch, Kristen W.; Garcia, Benjamin A.; Klein, Peter S.

    2017-01-01

    Glycogen synthase kinase-3 (GSK-3) is a constitutively active, ubiquitously expressed protein kinase that regulates multiple signaling pathways. In vitro kinase assays and genetic and pharmacological manipulations of GSK-3 have identified more than 100 putative GSK-3 substrates in diverse cell types. Many more have been predicted on the basis of a recurrent GSK-3 consensus motif ((pS/pT)XXX(S/T)), but this prediction has not been tested by analyzing the GSK-3 phosphoproteome. Using stable isotope labeling of amino acids in culture (SILAC) and MS techniques to analyze the repertoire of GSK-3–dependent phosphorylation in mouse embryonic stem cells (ESCs), we found that ∼2.4% of (pS/pT)XXX(S/T) sites are phosphorylated in a GSK-3–dependent manner. A comparison of WT and Gsk3a;Gsk3b knock-out (Gsk3 DKO) ESCs revealed prominent GSK-3–dependent phosphorylation of multiple splicing factors and regulators of RNA biosynthesis as well as proteins that regulate transcription, translation, and cell division. Gsk3 DKO reduced phosphorylation of the splicing factors RBM8A, SRSF9, and PSF as well as the nucleolar proteins NPM1 and PHF6, and recombinant GSK-3β phosphorylated these proteins in vitro. RNA-Seq of WT and Gsk3 DKO ESCs identified ∼190 genes that are alternatively spliced in a GSK-3–dependent manner, supporting a broad role for GSK-3 in regulating alternative splicing. The MS data also identified posttranscriptional regulation of protein abundance by GSK-3, with ∼47 proteins (1.4%) whose levels increased and ∼78 (2.4%) whose levels decreased in the absence of GSK-3. This study provides the first unbiased analysis of the GSK-3 phosphoproteome and strong evidence that GSK-3 broadly regulates alternative splicing. PMID:28916722

  3. Hypothalamic glycogen synthase kinase 3β has a central role in the regulation of food intake and glucose metabolism

    OpenAIRE

    Benzler, Jonas; Ganjam, Goutham K.; Krüger, Manon; Pinkenburg, Olaf; Kutschke, Maria; Stöhr, Sigrid; Steger, Juliane; Koch, Christiane E.; Ölkrug, Rebecca; Schwartz, Michael W.; Shepherd, Peter R.; Grattan, David R.; Tups, Alexander

    2012-01-01

    GSK3β (glycogen synthase kinase 3β) is a ubiquitous kinase that plays a key role in multiple intracellular signalling pathways, and increased GSK3β activity is implicated in disorders ranging from cancer to Alzheimer’s disease. In the present study, we provide the first evidence of increased hypothalamic signalling via GSK3β in leptin-deficient Lepob/ob mice and show that intracerebroventricular injection of a GSK3β inhibitor acutely improves glucose tolerance in these mice. The beneficial ef...

  4. The role of glycogen synthase in the development of hyperglycemia in type 2 diabetes - 'To store or not to store glucose, that's the question'

    DEFF Research Database (Denmark)

    Beck-Nielsen, Henning

    2012-01-01

    This review deals with the role of glycogen storage in skeletal muscle for the development of insulin resistance and type 2 diabetes. Specifically, the role of the enzyme glycogen synthase, which seems to be locked in its hyperphosphorylated and inactivated state, is discussed. This defect seems ...... to be secondary to ectopic lipid disposition in the muscle cells. These molecular defects are discussed in the context of the overall pathophysiology of hyperglycemia in type 2 diabetic subjects. Copyright © 2012 John Wiley & Sons, Ltd....

  5. Lithium chloride ameliorates learning and memory ability and inhibits glycogen synthase kinase-3 beta activity in a mouse model of fragile X syndrome

    Institute of Scientific and Technical Information of China (English)

    Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi

    2011-01-01

    In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.

  6. Glycogen synthase kinase-3: a key kinase in retinal neuron apoptosis in early diabetic retinopathy

    Institute of Scientific and Technical Information of China (English)

    Li Zhaohui; Ma Ling; Chen Xiaodong; Li Yonghao; Li Shiyi; Zhang Jinglin; Lu Lin

    2014-01-01

    Background Diabetes-related pathogenic factors can cause retinal ganglion cell (RGC) apoptosis,but the specific mechanism is not very clear.The aim of this study is to investigate the correlation between glycogen synthase kinase-3 (GSK-3) activation and retinal neuron apoptosis.Methods In an in vitro experiment,the number of apoptotic RGC-5 cells differentiated by staurosporine was evaluated via flow cytometry and nuclei staining using Hoechst 33258.GSK-3 phosphorylation and caspase-3 activation in RGC-5 cells after serum deprivation were determined using Western blotting.Mitochondrial membrane potential was detected using the dye 5,5',6,6'-tetrachloro-1,1',3,3'-tetrethyl benzimidalyl carbocyanine iodide,and reactive oxygen species (ROS) levels were measured with dihydroethidium.In an in vivo experiment,the number of apoptotic retinal neurons was evaluated via terminal transferase dUTP nick-end labeling (TUNEL),and GSK-3 phosphorylation was determined using Western blotting,in the retinal nerve epithelial tissue of rats in which diabetes was induced by intravenous tail-vein injection of streptozotocin for 4 weeks.Results The levels of phosphorylated Ser21/9 in GSK-3α/β and p-T308/S473-AKT were lower and the cleaved caspase-3 levels were higher in the serum-deprived model (P <0.05).Lithium chloride treatment was associated with a slower rate of apoptosis,increased mitochondrial membrane potential,and decreased ROS levels in differentiated RGC-5 cells (P <0.05).The level of blood glucose and the number of TUNEL-positive cells in the whole-mounted retinas were higher (P <0.01),and the levels of phosphorylated Ser21/9 in GSK-3α/β and body weight were lower (P <0.05).However,the thickness of the retinal nerve epithelial layer was not significantly less in diabetic rats compared with control group.Lithium chloride intravitreal injection increased the levels of phosphorylated Ser21/9 in GSK-3α/β and decreased TUNEL-positive cells in the whole-mounted retinas

  7. Regulation of glycogen synthase kinase-3β (GSK-3β) after ionizing radiation

    International Nuclear Information System (INIS)

    Boehme, K.A.

    2006-12-01

    Glycogen Synthase Kinase-3β (GSK-3β) phosphorylates the Mdm2 protein in the central domain. This phosphorylation is absolutely required for p53 degradation. Ionizing radiation inactivates GSK-3β by phosphorylation at serine 9 and in consequence prevents Mdm2 mediated p53 degradation. During the work for my PhD I identified Akt/PKB as the kinase that phosphorylates GSK-3β at serine 9 after ionizing radiation. Ionizing radiation leads to phosphorylation of Akt/PKB at threonine 308 and serine 473. The PI3 Kinase inhibitor LY294002 completely abolished Akt/PKB serine 473 phosphorylation and prevented the induction of GSK-3β serine 9 phosphorylation after ionizing radiation. Interestingly, the most significant activation of Akt/PKB after ionizing radiation occurred in the nucleus while cytoplasmic Akt/PKB was only weakly activated after radiation. By using siRNA, I showed that Akt1/PKBa, but not Akt2/PKBβ, is required for phosphorylation of GSK- 3β at serine 9 after ionizing radiation. Phosphorylation and activation of Akt/PKB after ionizing radiation depends on the DNA dependent protein kinase (DNA-PK), a member of the PI3 Kinase family, that is activated by free DNA ends. Both, in cells from SCID mice and after knockdown of the catalytic subunit of DNA-PK by siRNA in osteosarcoma cells, phosphorylation of Akt/PKB at serine 473 and of GSK-3β at serine 9 was completely abolished. Consistent with the principle that phosphorylation of GSK-3 at serine 9 contributes to p53 stabilization after radiation, the accumulation of p53 in response to ionizing radiation was largely prevented by downregulation of DNA-PK. From these results I conclude, that ionizing radiation induces a signaling cascade that leads to Akt1/PKBa activation mediated by DNA-PK dependent phosphorylation of serine 473. After activation Akt1/PKBa phosphorylates and inhibits GSK-3β in the nucleus. The resulting hypophosphorylated form of Mdm2 protein is no longer able to degrade p53 which in

  8. The muscle-specific protein phosphatase PP1G/R(GL)(G(M))is essential for activation of glycogen synthase by exercise

    DEFF Research Database (Denmark)

    Aschenbach, W G; Suzuki, Y; Breeden, K

    2001-01-01

    In skeletal muscle both insulin and contractile activity are physiological stimuli for glycogen synthesis, which is thought to result in part from the dephosphorylation and activation of glycogen synthase (GS). PP1G/R(GL)(G(M)) is a glycogen/sarcoplasmic reticulum-associated type 1 phosphatase...... that was originally postulated to mediate insulin control of glycogen metabolism. However, we recently showed (Suzuki, Y., Lanner, C., Kim, J.-H., Vilardo, P. G., Zhang, H., Jie Yang, J., Cooper, L. D., Steele, M., Kennedy, A., Bock, C., Scrimgeour, A., Lawrence, J. C. Jr., L., and DePaoli-Roach, A. A. (2001) Mol....... Cell. Biol. 21, 2683-2694) that insulin activates GS in muscle of R(GL)(G(M)) knockout (KO) mice similarly to the wild type (WT). To determine whether PP1G is involved in glycogen metabolism during muscle contractions, R(GL) KO and overexpressors (OE) were subjected to two models of contraction...

  9. Long-term effects of rapamycin treatment on insulin mediated phosphorylation of Akt/PKB and glycogen synthase activity

    International Nuclear Information System (INIS)

    Varma, Shailly; Shrivastav, Anuraag; Changela, Sheena; Khandelwal, Ramji L.

    2008-01-01

    Protein kinase B (Akt/PKB) is a Ser/Thr kinase that is involved in the regulation of cell proliferation/survival through mammalian target of rapamycin (mTOR) and the regulation of glycogen metabolism through glycogen synthase kinase 3β (GSK-3β) and glycogen synthase (GS). Rapamycin is an inhibitor of mTOR. The objective of this study was to investigate the effects of rapamycin pretreatment on the insulin mediated phosphorylation of Akt/PKB phosphorylation and GS activity in parental HepG2 and HepG2 cells with overexpression of constitutively active Akt1/PKB-α (HepG2-CA-Akt/PKB). Rapamycin pretreatment resulted in a decrease (20-30%) in the insulin mediated phosphorylation of Akt1 (Ser 473) in parental HepG2 cells but showed an upregulation of phosphorylation in HepG2-CA-Akt/PKB cells. Rictor levels were decreased (20-50%) in parental HepG2 cells but were not significantly altered in the HepG2-CA-Akt/PKB cells. Furthermore, rictor knockdown decreased the phosphorylation of Akt (Ser 473) by 40-60% upon rapamycin pretreatment. GS activity followed similar trends as that of phosphorylated Akt and so with rictor levels in these cells pretreated with rapamycin; parental HepG2 cells showed a decrease in GS activity, whereas as HepG2-CA-Akt/PKB cells showed an increase in GS activity. The changes in the levels of phosphorylated Akt/PKB (Ser 473) correlated with GS and protein phoshatase-1 activity

  10. Mechanical unloading of the failing human heart fails to activate the protein kinase B/Akt/glycogen synthase kinase-3beta survival pathway.

    Science.gov (United States)

    Razeghi, Peter; Bruckner, Brian A; Sharma, Saumya; Youker, Keith A; Frazier, O H; Taegtmeyer, Heinrich

    2003-01-01

    Left ventricular assist device (LVAD) support of the failing human heart improves myocyte function and increases cell survival. One potential mechanism underlying this phenomenon is activation of the protein kinase B (PKB)/Akt/glycogen synthase kinase-3beta (GSK-3beta) survival pathway. Left ventricular tissue was obtained both at the time of implantation and explantation of the LVAD (n = 11). Six patients were diagnosed with idiopathic dilated cardiomyopathy, 4 patients with ischemic cardiomyopathy and 1 patient with peripartum cardiomyopathy. The mean duration of LVAD support was 205 +/- 35 days. Myocyte diameter and phosphorylation of ERK were used as indices for reverse remodeling. Transcript levels of genes required for the activation of PKB/Akt (insulin-like growth factor-1, insulin receptor substrate-1) were measured by quantitative RT-PCR. In addition, we measured the relative activity of PKB/Akt and GSK-3beta, and assayed for molecular and histological indices of PKB/Akt activation (cyclooxygenase mRNA levels and glycogen levels). Myocyte diameter and phosphorylation of ERK decreased with LVAD support. In contrast, none of the components of the PKB/Akt/GSK-3beta pathway changed significantly with mechanical unloading. The PKB/Akt/GSK-3beta pathway is not activated during LVAD support. Other signaling pathways must be responsible for the improvement of cellular function and cell survival during LVAD support. Copyright 2003 S. Karger AG, Basel

  11. Clinicopathological and biological significance of aberrant activation of glycogen synthase kinase-3 in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Fu Y

    2014-06-01

    Full Text Available Yunfeng Fu,1 Xinyu Wang,1 Xiaodong Cheng,1 Feng Ye,2 Xing Xie,1,2 Weiguo Lu1,2 1Department of Gynecologic Oncology, Women's Hospital, School of Medicine, Zhejiang University, 2Women's Reproduction and Health Laboratory of Zhejiang Province, Hangzhou, People's Republic of China Background: Glycogen synthase kinase-3 (GSK-3 plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/βTyr279/216 in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition can influence cell viability and tumor growth of ovarian cancer. Methods: Immunohistochemistry was used to examine expression of GSK-3α/β and pGSK-3α/βTyr279/216 in 71 human epithelial ovarian cancer tissues and correlations between protein expression, and clinicopathological factors were analyzed. Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay following exposure of ovarian carcinoma cells to pharmacological inhibitors of GSK-3 or GSK-3 small interfering RNA. In vivo validation of tumor growth inhibition was performed with xenograft mice. Results: The expression levels of GSK-3α/β and pGSK-3α/βTyr279/216 in ovarian cancers were significantly higher than those in benign tumors. High expression of GSK-3α/β was more likely to be found in patients with advanced International Federation of Gynecology and Obstetrics (FIGO stages and high serum cancer antigen 125. Higher expression of pGSK-3α/βTyr279/216 was associated with advanced FIGO stages, residual tumor mass, high serum cancer antigen 125, and poor chemoresponse. Worse overall survival was revealed by Kaplan–Meier survival curves in patients with high expression of GSK-3α/β or pGSK-3α/βTyr279/216. Multivariate analysis indicated that FIGO stage, GSK-3α/β expression, and pGSK-3α/βTyr279/216 expression were independent prognostic factors for overall

  12. The alpha2-5'AMP-activated protein kinase is a site 2 glycogen synthase kinase in skeletal muscle and is responsive to glucose loading

    DEFF Research Database (Denmark)

    Jørgensen, Sebastian B; Nielsen, Jakob N.; Birk, Jesper Bratz

    2004-01-01

    The 5'AMP-activated protein kinase (AMPK) is a potential antidiabetic drug target. Here we show that the pharmacological activation of AMPK by 5-aminoimidazole-1-beta-4-carboxamide ribofuranoside (AICAR) leads to inactivation of glycogen synthase (GS) and phosphorylation of GS at Ser 7 (site 2). ...

  13. Brain derived neurotrophic factor is involved in the regulation of glycogen synthase kinase 3β (GSK3β) signalling

    International Nuclear Information System (INIS)

    Gupta, Vivek; Chitranshi, Nitin; You, Yuyi; Gupta, Veer; Klistorner, Alexander; Graham, Stuart

    2014-01-01

    Highlights: • BDNF knockdown leads to activation of GSK3β in the neuronal cells. • BDNF knockdown can induce GSK3β activation beyond TrkB mediated effects. • BDNF impairment in vivo leads to age dependent activation of GSK3β in the retina. • Systemic treatment with TrkB agonist induces inhibition of retinal GSK3β. - Abstract: Glycogen synthase kinase 3β (GSK3β) is involved in several biochemical processes in neurons regulating cellular survival, gene expression, cell fate determination, metabolism and proliferation. GSK3β activity is inhibited through the phosphorylation of its Ser-9 residue. In this study we sought to investigate the role of BDNF/TrkB signalling in the modulation of GSK3β activity. BDNF/TrkB signalling regulates the GSK3β activity both in vivo in the retinal tissue as well as in the neuronal cells under culture conditions. We report here for the first time that BDNF can also regulate GSK3β activity independent of its effects through the TrkB receptor signalling. Knockdown of BDNF lead to a decline in GSK3β phosphorylation without having a detectable effect on the TrkB activity or its downstream effectors Akt and Erk1/2. Treatment with TrkB receptor agonist had a stimulating effect on the GSK3β phosphorylation, but the effect was significantly less pronounced in the cells in which BDNF was knocked down. The use of TrkB receptor antagonist similarly, manifested itself in the form of downregulation of GSK3β phosphorylation, but a combined TrkB inhibition and BDNF knockdown exhibited a much stronger negative effect. In vivo, we observed reduced levels of GSK3β phosphorylation in the retinal tissues of the BDNF +/− animals implicating critical role of BDNF in the regulation of the GSK3β activity. Concluding, BDNF/TrkB axis strongly regulates the GSK3β activity and BDNF also exhibits GSK3β regulatory effect independent of its actions through the TrkB receptor signalling

  14. Brain derived neurotrophic factor is involved in the regulation of glycogen synthase kinase 3β (GSK3β) signalling

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Vivek, E-mail: vivek.gupta@mq.edu.au [Australian School of Advanced Medicine, Macquarie University (Australia); Chitranshi, Nitin; You, Yuyi [Australian School of Advanced Medicine, Macquarie University (Australia); Gupta, Veer [School of Medical Sciences, Edith Cowan University, Perth (Australia); Klistorner, Alexander; Graham, Stuart [Australian School of Advanced Medicine, Macquarie University (Australia); Save Sight Institute, Sydney University, Sydney (Australia)

    2014-11-21

    Highlights: • BDNF knockdown leads to activation of GSK3β in the neuronal cells. • BDNF knockdown can induce GSK3β activation beyond TrkB mediated effects. • BDNF impairment in vivo leads to age dependent activation of GSK3β in the retina. • Systemic treatment with TrkB agonist induces inhibition of retinal GSK3β. - Abstract: Glycogen synthase kinase 3β (GSK3β) is involved in several biochemical processes in neurons regulating cellular survival, gene expression, cell fate determination, metabolism and proliferation. GSK3β activity is inhibited through the phosphorylation of its Ser-9 residue. In this study we sought to investigate the role of BDNF/TrkB signalling in the modulation of GSK3β activity. BDNF/TrkB signalling regulates the GSK3β activity both in vivo in the retinal tissue as well as in the neuronal cells under culture conditions. We report here for the first time that BDNF can also regulate GSK3β activity independent of its effects through the TrkB receptor signalling. Knockdown of BDNF lead to a decline in GSK3β phosphorylation without having a detectable effect on the TrkB activity or its downstream effectors Akt and Erk1/2. Treatment with TrkB receptor agonist had a stimulating effect on the GSK3β phosphorylation, but the effect was significantly less pronounced in the cells in which BDNF was knocked down. The use of TrkB receptor antagonist similarly, manifested itself in the form of downregulation of GSK3β phosphorylation, but a combined TrkB inhibition and BDNF knockdown exhibited a much stronger negative effect. In vivo, we observed reduced levels of GSK3β phosphorylation in the retinal tissues of the BDNF{sup +/−} animals implicating critical role of BDNF in the regulation of the GSK3β activity. Concluding, BDNF/TrkB axis strongly regulates the GSK3β activity and BDNF also exhibits GSK3β regulatory effect independent of its actions through the TrkB receptor signalling.

  15. Critical role of glycogen synthase kinase-3β in regulating the avian heterophil response to Salmonella enterica serovar Enteritidis

    Directory of Open Access Journals (Sweden)

    Michael eKogut

    2014-11-01

    Full Text Available A microarray-assisted gene expression screen of chicken heterophils revealed glycogen synthase kinase-3β (GSK-3β, a multifunctional Ser/Thr kinase, to be consistently up-regulated 30-180 min following stimulation with Salmonella enterica serovar Enteritidis (S. Enteritidis. The present study was designed to delineate the role of GSK-3β in regulating the innate function of chicken heterophils in response to S. Enteritidis exposure. Using a specific GSK-3β ELISA assay, 30 min after infection with S. Enteritidis, heterophils had a significant decrease in total GSK-3β, but a significant increase in phosphorylated GSK-3 (Ser9. By 60 min post-infection, there was no difference in the amount of phosphorylated GSK-3β (Ser9 in either the uninfected and infected heterophils. S. Enteritidis interaction with heterophils alters GSK-3 activity by stimulating phosphorylation at Ser9 and that peaks by 30 min post-infection. Further, inhibition of GSK3β with lithium chloride resulted in a significant decrease in NF-κB activation and expression of IL-6, but induces a significant increase in the expression of the anti-inflammatory cytokine, IL-10. Using a phospho-specific antibody array confirmed the phosphorylation of GSK-3β (Ser9 as well as the phosphorylation of the downstream cytokine-activated intracellular signaling pathway involved in stimulating immune responses, IκB, the IκB subunit IKK-β, and the NF-κB subunits p105, p65, and c-Rel. Our data revealed that the phosphorylation of GSK-3β (Ser9 is responsible for inducing and controlling an innate response to the bacteria. Our findings suggest that the repression of GSK-3 activity is beneficial to the host cell and may act as a target for treatment in controlling intestinal colonization in chickens. Further experiments will define the in vivo modulation of GSK-3 as a potential alternative to antibiotics in salmonella and other intestinal bacterial infections.

  16. Analysis of genes involved in glycogen degradation in Escherichia coli.

    Science.gov (United States)

    Strydom, Lindi; Jewell, Jonathan; Meier, Michael A; George, Gavin M; Pfister, Barbara; Zeeman, Samuel; Kossmann, Jens; Lloyd, James R

    2017-02-01

    Escherichia coli accumulate or degrade glycogen depending on environmental carbon supply. Glycogen phosphorylase (GlgP) and glycogen debranching enzyme (GlgX) are known to act on the glycogen polymer, while maltodextrin phosphorylase (MalP) is thought to remove maltodextrins released by GlgX. To examine the roles of these enzymes in more detail, single, double and triple mutants lacking all their activities were produced. GlgX and GlgP were shown to act directly on the glycogen polymer, while MalP most likely catabolised soluble malto-oligosaccharides. Interestingly, analysis of a triple mutant lacking all three enzymes indicates the presence of another enzyme that can release maltodextrins from glycogen. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  18. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  19. Tissue injury after lithium treatment in human and rat postnatal kidney involves glycogen synthase kinase 3β-positive epithelium

    DEFF Research Database (Denmark)

    Kjaersgaard, Gitte; Madsen, Kirsten; Marcussen, Niels

    2012-01-01

    plasma lithium concentration of 1.0 mmol/L. Kidneys from lithium-treated rat pups exhibited dilated distal nephron segments with microcysts. Stereological analysis showed reduced cortex and outer medullary volumes. Lithium increased pGSK-3β and the proliferation marker PCNA protein abundances in cortex...... concentration capacity and diminished outer medullary volume. Histological sections of nephrectomy samples and a biopsy from 3 long-term lithium-treated patients showed multiple cortical microcysts that originated from normally appearing tubules. Microcysts were lined by a cuboidal PCNA-, GSK-3β- and pGSK-3β......It was hypothesized that lithium causes accelerated and permanent injury to the postnatally developing kidney through entry into epithelial cells of the distal nephron and inhibition of glycogen synthase kinase-3β (GSK-3β). GSK-3β immunoreactivity was associated with glomeruli, thick ascending limb...

  20. Dysregulation of glycogen synthase COOH- and NH2-terminal phosphorylation by insulin in obesity and type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Højlund, Kurt; Birk, Jesper Bratz; Klein, Ditte Kjærsgaard

    2009-01-01

    Context: Insulin-stimulated glucose disposal is impaired in obesity and type 2 diabetes mellitus (T2DM) and is tightly linked to impaired skeletal muscle glucose uptake and storage. Impaired activation of glycogen synthase (GS) by insulin is a well-established defect in both obesity and T2DM....... The exaggerated insulin resistance in T2DM compared with obese subjects was not reflected by differences in site 3 phosphorylation but was accompanied by a significantly higher site 1b phosphorylation during insulin stimulation. Hyperphosphorylation of another Ca(2+)/calmodulin-dependent kinase-II target......, phospholamban-Thr17, was also evident in T2DM. Dephosphorylation of GS by phosphatase treatment fully restored GS activity in all groups. Conclusions: Dysregulation of GS phosphorylation plays a major role in impaired insulin regulation of GS in obesity and T2DM. In obesity, independent of T2DM...

  1. The consequences of long-term glycogen synthase kinase-3 inhibition on normal and insulin resistant rat hearts.

    Science.gov (United States)

    Flepisi, T B; Lochner, Amanda; Huisamen, Barbara

    2013-10-01

    Glycogen synthase kinase-3 (GSK-3) is a serine-threonine protein kinase, discovered as a regulator of glycogen synthase. GSK-3 may regulate the expression of SERCA-2a potentially affecting myocardial contractility. It is known to phosphorylate and inhibit IRS-1, thus disrupting insulin signalling. This study aimed to determine whether myocardial GSK-3 protein and its substrate proteins are dysregulated in obesity and insulin resistance, and whether chronic GSK-3 inhibition can prevent or reverse this. Weight matched male Wistar rats were rendered obese by hyperphagia using a special diet (DIO) for 16 weeks and compared to chow fed controls. Half of each group was treated with the GSK-3 inhibitor CHIR118637 (30 mg/kg/day) from week 12 to16 of the diet period. Biometric and biochemical parameters were measured and protein expression determined by Western blotting and specific antibodies. Ca(2+)ATPase activity was determined spectrophotometrically. Cardiomyocytes were prepared by collagenase perfusion and insulin stimulated 2-deoxy-glucose uptake determined. DIO rats were significantly heavier than controls, associated with increased intra-peritoneal fat and insulin resistance. GSK-3 inhibition did not affect weight but improved insulin resistance, also on cellular level. It had no effect on GSK-3 expression but elevated its phospho/total ratio and elevated IRS-2 expression. Obesity lowered SERCA-2a expression and activity while GSK-3 inhibition alleviated this. The phospho/total ratio of phospholamban underscored inhibition of SERCA-2a in obesity. In addition, signs of myocardial hypertrophy were observed in treated control rats. GSK-3 inhibition could not reverse all the detrimental effects of obesity but may be harmful in normal rat hearts. It regulates IRS-2, SERCA-2a and phospholamban expression but not IRS-1.

  2. [Inhibition of glycogen synthase kinase 3b activity regulates Toll-like receptor 4-mediated liver inflammation].

    Science.gov (United States)

    Ren, Feng; Zhang, Hai-yan; Piao, Zheng-fu; Zheng, Su-jun; Chen, Yu; Chen, De-xi; Duan, Zhong-ping

    2012-09-01

    To determine the mechanism underlying the therapeutic activities of glycogen synthase kinase 3b (GSK3b) against hepatic ischemia-reperfusion (H-IR) injury by investigating the inhibitive effects of GSK3b on inflammation mediated by Toll-like receptor 4 (TLR4). C57BL/6 male mice were subjected to 90 min of warm liver cephalad lobe ischemia, followed by reperfusion for various lengths of time. The mice were divided into three groups: the H-IR untreated model (control group), and the H-IR inflammation-induced models that received an intraperitoneal injection of purified lipopolysaccharide (LPS) endotoxin alone (inflammation group) or with pretreatment of the SB216763 GSK3b-specific inhibitor (intervention group). To create a parallel isolated cell system for detailed investigations of macrophages, marrow-derived stem cells were isolated from femurs of the H-IR control group of mice and used to derive primary macrophages. The cells were then divided into the same three groups as the whole mouse system: control, LPS-induced inflammation model, and inflammation model with SB216763 intervention. Differential expressions of inflammation-related proteins and genes were detected by Western blotting and real-time quantitative PCR, respectively. The phosphorylation levels of ERK, JNK and p38 MAPK were induced in liver at 1 h after reperfusion, but then steadily decreased and returned to baseline levels by 4 h after reperfusion. In addition, the phosphorylation levels of ERK and JNK were induced in macrophages at 15 min after LPS stimulation, while the phosphorylation level of p38 MAPK was induced at 1 h; SB216763 pretreatment suppressed the LPS-stimulated ERK, JNK and p38 phosphorylation in macrophages. In the mouse model, GSK3b activity was found to promote the gene expression of anti-inflammatory cytokine IL-10 (control: 0.21 ± 0.08, inflammation: 0.83 ± 0.21, intervention: 1.76 ± 0.67; F = 3.16, P = 0.027) but to significantly inhibit the gene expression of pro

  3. Glycogen Synthase Kinase 3 Inactivation Induces Cell Senescence through Sterol Regulatory Element Binding Protein 1-Mediated Lipogenesis in Chang Cells.

    Science.gov (United States)

    Kim, You-Mie; Song, Insun; Seo, Yong-Hak; Yoon, Gyesoon

    2013-12-01

    Enhanced lipogenesis plays a critical role in cell senescence via induction of expression of the mature form of sterol regulatory element binding protein 1 (SREBP1), which contributes to an increase in organellar mass, one of the indicators of senescence. We investigated the molecular mechanisms by which signaling molecules control SREBP1-mediated lipogenesis and senescence. We developed cellular models for stress-induced senescence, by exposing Chang cells, which are immortalized human liver cells, to subcytotoxic concentrations (200 µM) of deferoxamine (DFO) and H2O2. In this model of stress-induced cell senescence using DFO and H2O2, the phosphorylation profile of glycogen synthase kinase 3α (GSK3α) and β corresponded closely to the expression profile of the mature form of SREBP-1 protein. Inhibition of GSK3 with a subcytotoxic concentration of the selective GSK3 inhibitor SB415286 significantly increased mature SREBP1 expression, as well as lipogenesis and organellar mass. In addition, GSK3 inhibition was sufficient to induce senescence in Chang cells. Suppression of GSK3 expression with siRNAs specific to GSK3α and β also increased mature SREBP1 expression and induced senescence. Finally, blocking lipogenesis with fatty acid synthase inhibitors (cerulenin and C75) and siRNA-mediated silencing of SREBP1 and ATP citrate lyase (ACL) significantly attenuated GSK3 inhibition-induced senescence. GSK3 inactivation is an important upstream event that induces SREBP1-mediated lipogenesis and consequent cell senescence.

  4. Identification and Functional Characterization of the Glycogen Synthesis Related Gene Glycogenin in Pacific Oysters (Crassostrea gigas).

    Science.gov (United States)

    Li, Busu; Meng, Jie; Li, Li; Liu, Sheng; Wang, Ting; Zhang, Guofan

    2017-09-06

    High glycogen levels in the Pacific oyster (Crassostrea gigas) contribute to its flavor, quality, and hardiness. Glycogenin (CgGN) is the priming glucosyltransferase that initiates glycogen biosynthesis. We characterized the full sequence and function of C. gigas CgGN. Three CgGN isoforms (CgGN-α, β, and γ) containing alternative exon regions were isolated. CgGN expression varied seasonally in the adductor muscle and gonadal area and was the highest in the adductor muscle. Autoglycosylation of CgGN can interact with glycogen synthase (CgGS) to complete glycogen synthesis. Subcellular localization analysis showed that CgGN isoforms and CgGS were located in the cytoplasm. Additionally, a site-directed mutagenesis experiment revealed that the Tyr200Phe and Tyr202Phe mutations could affect CgGN autoglycosylation. This is the first study of glycogenin function in marine bivalves. These findings will improve our understanding of glycogen synthesis and accumulation mechanisms in mollusks. The data are potentially useful for breeding high-glycogen oysters.

  5. Akt2 influences glycogen synthase activity in human skeletal muscle through regulation of NH2-terminal (sites 2+2a) phosphorylation

    DEFF Research Database (Denmark)

    Friedrichsen, Martin; Birk, Jesper Bratz; Richter, Erik

    2013-01-01

    Type 2 diabetes is characterized by reduced muscle glycogen synthesis. The key enzyme in this process, glycogen synthase (GS), is activated via proximal insulin signaling, but the exact molecular events remain unknown. We previously demonstrated that phosphorylation of Threonine-308 on Akt (p......Akt-T308), Akt2 activity, and GS activity in muscle were positivity associated with insulin sensitivity. Now, in the same study population, we determined the influence of several upstream elements in the canonical PI3K signaling on muscle GS activation. 181 non-diabetic twins were examined...

  6. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  7. Inhibiting glycogen synthase kinase-3 and transforming growth factor-β signaling to promote epithelial transition of human adipose mesenchymal stem cells.

    Science.gov (United States)

    Setiawan, Melina; Tan, Xiao-Wei; Goh, Tze-Wei; Hin-Fai Yam, Gary; Mehta, Jodhbir S

    2017-09-02

    This study was aimed to investigate the epithelial differentiation of human adipose-derived mesenchymal stem cells (ADSCs) by inhibiting glycogen synthase kinase-3 (GSK3) and transforming growth factor β (TGFβ) signaling. STEMPRO human ADSCs at passage 2 were treated with CHIR99021 (GSK3 inhibitor), E-616452 (TGFβ1 receptor kinase inhibitor), A-83-01 (TGFβ type 1 receptor inhibitor), valproic acid (histone deacetylase inhibitor), tranylcypromine (monoamine oxidase inhibitor) and all-trans retinoic acid for 72 h. The mesenchymal-epithelial transition was shown by down-regulation of mesenchymal genes (Slug, Zinc Finger E-box Binding Homeobox 1 ZEB1, integrin α5 ITGA5 and vimentin VIM) and up-regulation of epithelial genes (E-cadherin, Epithelial Cell Adhesion Molecule EpCAM, Zonula Occludens-1 ZO-1, occludin, deltaN p63 δNp63, Transcription Factor 4 TCF4 and Twist Family bHLH Transcription Factor TWIST), compared to untreated ADSCs. Cell morphology and stress fiber pattern were examined and the treated cells became less migratory in scratch wound closure assay. The formation of cell junction complexes was observed under transmission electron microscopy. Global gene expression using GeneChip ® Human Genome U133 Array (Affymetrix) showed that the treatment up-regulated 540 genes (containing genes for cell cycle, cytoskeleton reorganization, chemotaxis, epithelium development and regulation of cell migration) and down-regulated 483 genes. Human ADSCs were transited to epithelial lineage by inhibiting GSK3 and TGFβ signaling. It can be an adult stem cell source for epithelial cell-based therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Glycogen synthase kinase-3 (GSK3) regulates TNF production and haemocyte phagocytosis in the immune response of Chinese mitten crab Eriocheir sinensis.

    Science.gov (United States)

    Li, Xiaowei; Jia, Zhihao; Wang, Weilin; Wang, Lingling; Liu, Zhaoqun; Yang, Bin; Jia, Yunke; Song, Xiaorui; Yi, Qilin; Qiu, Limei; Song, Linsheng

    2017-08-01

    Glycogen synthase kinase-3 (GSK3) is a serine/threonine protein kinase firstly identified as a regulator of glycogen synthesis. Recently, it has been proved to be a key regulator of the immune reaction. In the present study, a GSK3 homolog gene (designated as EsGSK3) was cloned from Chinese mitten crab, Eriocheir sinensis. The open reading frame (ORF) was 1824 bp, which encoded a predicted polypeptide of 607 amino acids. There was a conserved Serine/Threonine Kinase domain and a DNA binding domain found in EsGSK3. Phylogenetic analysis showed that EsGSK3 was firstly clustered with GSK3-β from oriental river prawn Macrobrachium nipponense in the invertebrate branch, while GSK3s from vertebrates formed the other distinct branch. EsGSK3 mRNA transcripts could be detected in all tested tissues of the crab including haepatopancreas, eyestalk, muscle, gonad, haemocytes and haematopoietic tissue with the highest expression level in haepatopancreas. And EsGSK3 protein was mostly detected in the cytoplasm of haemocyte by immunofluorescence analysis. The expression levels of EsGSK3 mRNA increased significantly at 6 h after Aeromonas hydrophila challenge (p level at 48 h (p > 0.05). The mRNA expression of lipopolysaccharide-induced tumor necrosis factor (TNF)-α factor (EsLITAF) was also induced by A. hydrophila challenge. However, the mRNA expression of EsLITAF and TNF-α production was significantly suppressed after EsGSK3 was blocked in vivo with specific inhibitor lithium, while the phagocytosis of crab haemocytes was significantly promoted. These results collectively demonstrated that EsGSK3 could regulate the innate immune responses of E. sinensis by promoting TNF-α production and inhibiting haemocyte phagocytosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Glycogen synthase kinase 3 (GSK3) in the heart: a point of integration in hypertrophic signalling and a therapeutic target? A critical analysis.

    Science.gov (United States)

    Sugden, P H; Fuller, S J; Weiss, S C; Clerk, A

    2008-03-01

    Glycogen synthase kinase 3 (GSK3, of which there are two isoforms, GSK3alpha and GSK3beta) was originally characterized in the context of regulation of glycogen metabolism, though it is now known to regulate many other cellular processes. Phosphorylation of GSK3alpha(Ser21) and GSK3beta(Ser9) inhibits their activity. In the heart, emphasis has been placed particularly on GSK3beta, rather than GSK3alpha. Importantly, catalytically-active GSK3 generally restrains gene expression and, in the heart, catalytically-active GSK3 has been implicated in anti-hypertrophic signalling. Inhibition of GSK3 results in changes in the activities of transcription and translation factors in the heart and promotes hypertrophic responses, and it is generally assumed that signal transduction from hypertrophic stimuli to GSK3 passes primarily through protein kinase B/Akt (PKB/Akt). However, recent data suggest that the situation is far more complex. We review evidence pertaining to the role of GSK3 in the myocardium and discuss effects of genetic manipulation of GSK3 activity in vivo. We also discuss the signalling pathways potentially regulating GSK3 activity and propose that, depending on the stimulus, phosphorylation of GSK3 is independent of PKB/Akt. Potential GSK3 substrates studied in relation to myocardial hypertrophy include nuclear factors of activated T cells, beta-catenin, GATA4, myocardin, CREB, and eukaryotic initiation factor 2Bvarepsilon. These and other transcription factor substrates putatively important in the heart are considered. We discuss whether cardiac pathologies could be treated by therapeutic intervention at the GSK3 level but conclude that any intervention would be premature without greater understanding of the precise role of GSK3 in cardiac processes.

  10. Hyperinsulinemia enhances interleukin-17-induced inflammation to promote prostate cancer development in obese mice through inhibiting glycogen synthase kinase 3-mediated phosphorylation and degradation of interleukin-17 receptor

    Science.gov (United States)

    Chen, Chong; Ge, Dongxia; Qu, Yine; Chen, Rongyi; Fan, Yi-Ming; Li, Nan; Tang, Wendell W.; Zhang, Wensheng; Zhang, Kun; Wang, Alun R.; Rowan, Brian G.; Hill, Steven M.; Sartor, Oliver; Abdel, Asim B.; Myers, Leann; Lin, Qishan; You, Zongbing

    2016-01-01

    Interleukin-17 (IL-17) plays important roles in inflammation, autoimmune diseases, and some cancers. Obese people are in a chronic inflammatory state with increased serum levels of IL-17, insulin, and insulin-like growth factor 1 (IGF1). How these factors contribute to the chronic inflammatory status that promotes development of aggressive prostate cancer in obese men is largely unknown. We found that, in obese mice, hyperinsulinemia enhanced IL-17-induced expression of downstream proinflammatory genes with increased levels of IL-17 receptor A (IL-17RA), resulting in development of more invasive prostate cancer. Glycogen synthase kinase 3 (GSK3) constitutively bound to and phosphorylated IL-17RA at T780, leading to ubiquitination and proteasome-mediated degradation of IL-17RA, thus inhibiting IL-17-mediated inflammation. IL-17RA phosphorylation was reduced, while the IL-17RA levels were increased in the proliferative human prostate cancer cells compared to the normal cells. Insulin and IGF1 enhanced IL-17-induced inflammatory responses through suppressing GSK3, which was shown in the cultured cell lines in vitro and obese mouse models of prostate cancer in vivo. These findings reveal a mechanism underlying the intensified inflammation in obesity and obesity-associated development of aggressive prostate cancer, suggesting that targeting GSK3 may be a potential therapeutic approach to suppress IL-17-mediated inflammation in the prevention and treatment of prostate cancer, particularly in obese men. PMID:26871944

  11. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  12. Presence of the glycogen synthase 1 (GYS1) mutation causing type 1 polysaccharide storage myopathy in continental European draught horse breeds.

    Science.gov (United States)

    Baird, J D; Valberg, S J; Anderson, S M; McCue, M E; Mickelson, J R

    2010-11-13

    The purpose of this study was to determine which continental European draught horse breeds harbour a mutation in the glycogen synthase 1 gene (GYS1) that is known to be responsible for type 1 polysaccharide storage myopathy in quarter horses and North American draught horses. Of a non-random selection of continental European draught horses belonging to 13 breeds, 62 per cent (250 of 403) tested were found to carry the mutant allele. The horses were located in Belgium, France, Germany, The Netherlands, Spain and Sweden. The mutation was identified in animals from each of the breeds examined. In the breeds in which more than 15 animals were available for testing, the highest percentages of GYS1-positive horses were found in the Belgian trekpaard (92 per cent; 35 of 38 horses tested), Comtois (80 per cent; 70 of 88), Netherlands trekpaard (74 per cent; 17 of 23), Rheinisch-Deutsches kaltblut (68 per cent; 30 of 44) and Breton (64 per cent; 32 of 51).

  13. Inhibition of glycogen synthase kinase-3 enhances the differentiation and reduces the proliferation of adult human olfactory epithelium neural precursors

    Energy Technology Data Exchange (ETDEWEB)

    Manceur, Aziza P. [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Tseng, Michael [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Holowacz, Tamara [Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Witterick, Ian [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Department of Otolaryngology, Head and Neck Surgery, University of Toronto, ON (Canada); Weksberg, Rosanna [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); McCurdy, Richard D. [The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); Warsh, Jerry J. [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Audet, Julie, E-mail: julie.audet@utoronto.ca [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada)

    2011-09-10

    The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.

  14. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  15. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  16. Up-regulation of insulin-like growth factor 2 by ketamine requires glycogen synthase kinase-3 inhibition

    Science.gov (United States)

    Grieco, Steven F.; Cheng, Yuyan; Eldar-Finkelman, Hagit; Jope, Richard S.; Beurel, Eléonore

    2016-01-01

    An antidepressant dose of the rapidly-acting ketamine inhibits glycogen synthase kinase-3 (GSK3) in mouse hippocampus, and this inhibition is required for the antidepressant effect of ketamine in learned helplessness depression-like behavior. Here we report that treatment with an antidepressant dose of ketamine (10 mg/kg) increased expression of insulin-like growth factor 2 (IGF2) in mouse hippocampus, an effect that required ketamine-induced inhibition of GSK3. Ketamine also inhibited hippocampal GSK3 and increased expression of hippocampal IGF2 in mice when administered after the induction of learned helplessness. Treatment with the specific GSK3 inhibitor L803-mts was sufficient to up-regulate hippocampal IGF2 expression. Administration of IGF2 siRNA reduced ketamine's antidepressant effect in the learned helplessness paradigm. Mice subjected to the learned helplessness paradigm were separated into two groups, those that were resilient (non-depressed) and those that were susceptible (depressed). Non-depressed resilient mice displayed higher expression of IGF2 than susceptible mice. These results indicate that IGF2 contributes to ketamine's antidepressant effect and that IGF2 may confer resilience to depression-like behavior. PMID:27542584

  17. Glycogen synthase kinase-3 inhibition by 3-anilino-4-phenylmaleimides: insights from 3D-QSAR and docking

    Science.gov (United States)

    Prasanna, Sivaprakasam; Daga, Pankaj R.; Xie, Aihua; Doerksen, Robert J.

    2009-02-01

    Glycogen synthase kinase-3, a serine/threonine kinase, has been implicated in a wide variety of pathological conditions such as diabetes, Alzheimer's disease, stroke, bipolar disorder, malaria and cancer. Herein we report 3D-QSAR analyses using CoMFA and CoMSIA and molecular docking studies on 3-anilino-4-phenylmaleimides as GSK-3α inhibitors, in order to better understand the mechanism of action and structure-activity relationship of these compounds. Comparison of the active site residues of GSK-3α and GSK-3β isoforms shows that all the key amino acids involved in polar interactions with the maleimides for the β isoform are the same in the α isoform, except that Asp133 in the β isoform is replaced by Glu196 in the α isoform. We prepared a homology model for GSK-3α, and showed that the change from Asp to Glu should not affect maleimide binding significantly. Docking studies revealed the binding poses of three subclasses of these ligands, namely anilino, N-methylanilino and indoline derivatives, within the active site of the β isoform, and helped to explain the difference in their inhibitory activity.

  18. Hypothalamic glycogen synthase kinase 3β has a central role in the regulation of food intake and glucose metabolism.

    Science.gov (United States)

    Benzler, Jonas; Ganjam, Goutham K; Krüger, Manon; Pinkenburg, Olaf; Kutschke, Maria; Stöhr, Sigrid; Steger, Juliane; Koch, Christiane E; Ölkrug, Rebecca; Schwartz, Michael W; Shepherd, Peter R; Grattan, David R; Tups, Alexander

    2012-10-01

    GSK3β (glycogen synthase kinase 3β) is a ubiquitous kinase that plays a key role in multiple intracellular signalling pathways, and increased GSK3β activity is implicated in disorders ranging from cancer to Alzheimer's disease. In the present study, we provide the first evidence of increased hypothalamic signalling via GSK3β in leptin-deficient Lep(ob/ob) mice and show that intracerebroventricular injection of a GSK3β inhibitor acutely improves glucose tolerance in these mice. The beneficial effect of the GSK3β inhibitor was dependent on hypothalamic signalling via PI3K (phosphoinositide 3-kinase), a key intracellular mediator of both leptin and insulin action. Conversely, neuron-specific overexpression of GSK3β in the mediobasal hypothalamus exacerbated the hyperphagia, obesity and impairment of glucose tolerance induced by a high-fat diet, while having little effect in controls fed standard chow. These results demonstrate that increased hypothalamic GSK3β signalling contributes to deleterious effects of leptin deficiency and exacerbates high-fat diet-induced weight gain and glucose intolerance.

  19. The canonical wnt signal restricts the glycogen synthase kinase 3/fbw7-dependent ubiquitination and degradation of eya1 phosphatase.

    Science.gov (United States)

    Sun, Ye; Li, Xue

    2014-07-01

    Haploinsufficiency of Eya1 causes the branchio-oto-renal (BOR) syndrome, and abnormally high levels of Eya1 are linked to breast cancer progression and poor prognosis. Therefore, regulation of Eya1 activity is key to its tissue-specific functions and oncogenic activities. Here, we show that Eya1 is posttranslationally modified by ubiquitin and that its ubiquitination level is self-limited to prevent premature degradation. Eya1 has an evolutionarily conserved CDC4 phosphodegron (CPD) signal, a target site of glycogen synthase kinase 3 (GSK3) kinase and Fbw7 ubiquitin ligase, which is required for Eya1 ubiquitination. Genetic deletion of Fbw7 and pharmacological inhibition of GSK3 significantly decrease Eya1 ubiquitination. Conversely, activation of the phosphatidylinositol 3-kinase (PI3K)/Akt and the canonical Wnt signal suppresses Eya1 ubiquitination. Compound Eya1(+/-); Wnt9b(+/-) mutants exhibit an increased penetrance of renal defect, indicating that they function in the same genetic pathway in vivo. Together, these findings reveal that the canonical Wnt and PI3K/Akt signal pathways restrain the GSK3/Fbw7-dependent Eya1 ubiquitination, and they further suggest that dysregulation of this novel axis contributes to tumorigenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  20. Maintaining glycogen synthase kinase-3 activity is critical for mTOR kinase inhibitors to inhibit cancer cell growth.

    Science.gov (United States)

    Koo, Junghui; Yue, Ping; Gal, Anthony A; Khuri, Fadlo R; Sun, Shi-Yong

    2014-05-01

    mTOR kinase inhibitors that target both mTORC1 and mTORC2 are being evaluated in cancer clinical trials. Here, we report that glycogen synthase kinase-3 (GSK3) is a critical determinant for the therapeutic response to this class of experimental drugs. Pharmacologic inhibition of GSK3 antagonized their suppressive effects on the growth of cancer cells similarly to genetic attenuation of GSK3. Conversely, expression of a constitutively activated form of GSK3β sensitized cancer cells to mTOR inhibition. Consistent with these findings, higher basal levels of GSK3 activity in a panel of human lung cancer cell lines correlated with more efficacious responses. Mechanistic investigations showed that mTOR kinase inhibitors reduced cyclin D1 levels in a GSK3β-dependent manner, independent of their effects on suppressing mTORC1 signaling and cap binding. Notably, selective inhibition of mTORC2 triggered proteasome-mediated cyclin D1 degradation, suggesting that mTORC2 blockade is responsible for GSK3-dependent reduction of cyclin D1. Silencing expression of the ubiquitin E3 ligase FBX4 rescued this reduction, implicating FBX4 in mediating this effect of mTOR inhibition. Together, our findings define a novel mechanism by which mTORC2 promotes cell growth, with potential implications for understanding the clinical action of mTOR kinase inhibitors. ©2014 AACR.

  1. Lithium chloride increases the production of amyloid-beta peptide independently from its inhibition of glycogen synthase kinase 3.

    Science.gov (United States)

    Feyt, Christine; Kienlen-Campard, Pascal; Leroy, Karelle; N'Kuli, Francisca; Courtoy, Pierre J; Brion, Jean-Pierre; Octave, Jean-Noël

    2005-09-30

    Glycogen synthase kinase 3 (GSK3) is able to phosphorylate tau at many sites that are found to be phosphorylated in paired helical filaments in Alzheimer disease. Lithium chloride (LiCl) efficiently inhibits GSK3 and was recently reported to also decrease the production of amyloid-beta peptide (Abeta) from its precursor, the amyloid precursor protein. Therefore, lithium has been proposed as a combined therapeutic agent, inhibiting both the hyperphosphorylation of tau and the production of Abeta. Here, we demonstrate that the inhibition of GSK3 by LiCl induced the nuclear translocation of beta-catenin in Chinese hamster ovary cells and rat cultured neurons, in which a decrease in tau phosphorylation was observed. In both cellular models, a nontoxic concentration of LiCl increased the production of Abeta by increasing the beta-cleavage of amyloid precursor protein, generating more substrate for an unmodified gamma-secretase activity. SB415286, another GSK3 inhibitor, induced the nuclear translocation of beta-catenin and slightly decreased Abeta production. It is concluded that the LiCl-mediated increase in Abeta production is not related to GSK3 inhibition.

  2. Inhibition of glycogen synthase kinase-3 enhances the differentiation and reduces the proliferation of adult human olfactory epithelium neural precursors

    International Nuclear Information System (INIS)

    Manceur, Aziza P.; Tseng, Michael; Holowacz, Tamara; Witterick, Ian; Weksberg, Rosanna; McCurdy, Richard D.; Warsh, Jerry J.; Audet, Julie

    2011-01-01

    The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.

  3. Possible Role of the Glycogen Synthase Kinase-3 Signaling Pathway in Trimethyltin-Induced Hippocampal Neurodegeneration in Mice

    Science.gov (United States)

    Kim, Sung-Ho; Kim, Jong-Choon; Wang, Hongbing; Shin, Taekyun; Moon, Changjong

    2013-01-01

    Trimethyltin (TMT) is an organotin compound with potent neurotoxic effects characterized by neuronal destruction in selective regions, including the hippocampus. Glycogen synthase kinase-3 (GSK-3) regulates many cellular processes, and is implicated in several neurodegenerative disorders. In this study, we evaluated the therapeutic effect of lithium, a selective GSK-3 inhibitor, on the hippocampus of adult C57BL/6 mice with TMT treatment (2.6 mg/kg, intraperitoneal [i.p.]) and on cultured hippocampal neurons (12 days in vitro) with TMT treatment (5 µM). Lithium (50 mg/kg, i.p., 0 and 24 h after TMT injection) significantly attenuated TMT-induced hippocampal cell degeneration, seizure, and memory deficits in mice. In cultured hippocampal neurons, lithium treatment (0–10 mM; 1 h before TMT application) significantly reduced TMT-induced cytotoxicity in a dose-dependent manner. Additionally, the dynamic changes in GSK-3/β-catenin signaling were observed in the mouse hippocampus and cultured hippocampal neurons after TMT treatment with or without lithium. Therefore, lithium inhibited the detrimental effects of TMT on the hippocampal neurons in vivo and in vitro, suggesting involvement of the GSK-3/β-catenin signaling pathway in TMT-induced hippocampal cell degeneration and dysfunction. PMID:23940567

  4. Role of Glycogen Synthase Kinase-3β in APP Hyperphosphorylation Induced by NMDA Stimulation in Cortical Neurons

    Directory of Open Access Journals (Sweden)

    Xanthi Antoniou

    2010-01-01

    Full Text Available The phosphorylation of Amyloid Precursor Protein (APP at Thr668 plays a key role in APP metabolism that is highly relevant to AD. The c-Jun-N-terminal kinase (JNK, glycogen synthase kinase-3β (GSK-3β and cyclin-dependent kinase 5 (Cdk5 can all be responsible for this phosphorylation. These kinases are activated by excitotoxic stimuli fundamental hallmarks of AD. The exposure of cortical neurons to a high dose of NMDA (100 μM for 30’-45’ led to an increase of P-APP Thr668. During NMDA stimulation APP hyperphosphorylation has to be assigned to GSK-3β activity, since addition of L803-mts, a substrate competitive inhibitor of GSK-3β reduced APP phosphorylation induced by NMDA. On the contrary, inhibition of JNK and Cdk5 with D-JNKI1 and Roscovitine respectively did not prevent NMDA-induced P-APP increase. These data show a tight connection, in excitotoxic conditions, between APP metabolism and the GSK-3β signaling pathway.

  5. Identification of differentially expressed genes in chickens differing in muscle glycogen content and meat quality

    Directory of Open Access Journals (Sweden)

    Marthey Sylvain

    2011-02-01

    Full Text Available Abstract Background The processing ability of poultry meat is highly related to its ultimate pH, the latter being mainly determined by the amount of glycogen in the muscle at death. The genetic determinism of glycogen and related meat quality traits has been established in the chicken but the molecular mechanisms involved in variations in these traits remain to be fully described. In this study, Chicken Genome Arrays (20 K were used to compare muscle gene expression profiles of chickens from Fat (F and Lean (L lines that exhibited high and low muscle glycogen content, respectively, and of individuals exhibiting extremely high (G+ or low (G- muscle glycogen content originating from the F2 cross between the Fat and Lean lines. Real-time RT-PCR was subsequently performed to validate the differential expression of genes either selected from the microarray analysis or whose function in regulating glycogen metabolism was well known. Results Among the genes found to be expressed in chicken P. major muscle, 197 and 254 transcripts appeared to be differentially expressed on microarrays for the F vs. L and the G+ vs. G- comparisons, respectively. Some involved particularly in lipid and carbohydrate metabolism were selected for further validation studies by real-time RT-PCR. We confirmed that, as in mammals, the down-regulation of CEBPB and RGS2 coincides with a decrease in peripheral adiposity in the chicken, but these genes are also suggested to affect muscle glycogen turnover through their role in the cAMP-dependent signalling pathway. Several other genes were suggested to have roles in the regulation of glycogen storage in chicken muscle. PDK4 may act as a glycogen sensor in muscle, UGDH may compete for glycogen synthesis by using UDP-glucose for glucoronidation, and PRKAB1, PRKAG2, and PHKD may impact on glycogen turnover in muscle, through AMP-activated signalling pathways. Conclusions This study is the first stage in the understanding of molecular

  6. Inhibition of glycogen synthase kinase 3beta ameliorates triptolide-induced acute cardiac injury by desensitizing mitochondrial permeability transition

    International Nuclear Information System (INIS)

    Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin; Fu, Xinlu; Shen, Feihai; Huang, Zhiying

    2016-01-01

    Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.

  7. Glycogen synthase kinase 3β in the basolateral amygdala is critical for the reconsolidation of cocaine reward memory.

    Science.gov (United States)

    Wu, Ping; Xue, Yan-Xue; Ding, Zeng-Bo; Xue, Li-Fen; Xu, Chun-Mei; Lu, Lin

    2011-07-01

    Exposure to cocaine-associated conditioned stimuli elicits craving and increases the probability of cocaine relapse in cocaine users even after extended periods of abstinence. Recent evidence indicates that cocaine seeking can be inhibited by disrupting the reconsolidation of the cocaine cue memories and that basolateral amygdala (BLA) neuronal activity plays a role in this effect. Previous studies demonstrated that glycogen synthase kinase 3β (GSK-3β) plays a role in the reconsolidation of fear memory. Here, we used a conditioned place preference procedure to examine the role of GSK-3β in the BLA in the reconsolidation of cocaine cue memories. GSK-3β activity in the BLA, but not central amygdala (CeA), in rats that acquired cocaine (10 mg/kg)-induced conditioned place preference increased after re-exposure to a previously cocaine-paired chamber (i.e., a memory reactivation procedure). Systemic injections of the GSK-3β inhibitor lithium chloride after memory reactivation impaired the reconsolidation of cocaine cue memories and inhibited subsequent cue-induced GSK-3β activity in the BLA. Basolateral amygdala, but not central amygdala, injections of SB216763, a selective inhibitor of GSK-3β, immediately after the reactivation of cocaine cue memories also disrupted cocaine cue memory reconsolidation and prevented cue-induced increases in GSK-3β activity in the BLA. The effect of SB216763 on the reconsolidation of cocaine cue memories lasted at least 2 weeks and was not recovered by a cocaine priming injection. These results indicate that GSK-3β activity in the BLA mediates the reconsolidation of cocaine cue memories. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

  8. Inhibition of glycogen synthase kinase 3beta ameliorates triptolide-induced acute cardiac injury by desensitizing mitochondrial permeability transition

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Fu, Xinlu [Laboratory Animals Center, Sun Yat-sen University, Guangzhou 510006 (China); Shen, Feihai, E-mail: shenfh3@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Huang, Zhiying, E-mail: hzhiying@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China)

    2016-12-15

    Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.

  9. Aberrant glycogen synthase kinase 3β is involved in pancreatic cancer cell invasion and resistance to therapy.

    Directory of Open Access Journals (Sweden)

    Ayako Kitano

    Full Text Available BACKGROUND AND PURPOSE: The major obstacles to treatment of pancreatic cancer are the highly invasive capacity and resistance to chemo- and radiotherapy. Glycogen synthase kinase 3β (GSK3β regulates multiple cellular pathways and is implicated in various diseases including cancer. Here we investigate a pathological role for GSK3β in the invasive and treatment resistant phenotype of pancreatic cancer. METHODS: Pancreatic cancer cells were examined for GSK3β expression, phosphorylation and activity using Western blotting and in vitro kinase assay. The effects of GSK3β inhibition on cancer cell survival, proliferation, invasive ability and susceptibility to gemcitabine and radiation were examined following treatment with a pharmacological inhibitor or by RNA interference. Effects of GSK3β inhibition on cancer cell xenografts were also examined. RESULTS: Pancreatic cancer cells showed higher expression and activity of GSK3β than non-neoplastic cells, which were associated with changes in its differential phosphorylation. Inhibition of GSK3β significantly reduced the proliferation and survival of cancer cells, sensitized them to gemcitabine and ionizing radiation, and attenuated their migration and invasion. These effects were associated with decreases in cyclin D1 expression and Rb phosphorylation. Inhibition of GSK3β also altered the subcellular localization of Rac1 and F-actin and the cellular microarchitecture, including lamellipodia. Coincident with these changes were the reduced secretion of matrix metalloproteinase-2 (MMP-2 and decreased phosphorylation of focal adhesion kinase (FAK. The effects of GSK3β inhibition on tumor invasion, susceptibility to gemcitabine, MMP-2 expression and FAK phosphorylation were observed in tumor xenografts. CONCLUSION: The targeting of GSK3β represents an effective strategy to overcome the dual challenges of invasiveness and treatment resistance in pancreatic cancer.

  10. Impairments in cognition and neural precursor cell proliferation in mice expressing constitutively active glycogen synthase kinase-3

    Directory of Open Access Journals (Sweden)

    Marta ePardo

    2015-03-01

    Full Text Available ABSTRACTBrain glycogen synthase kinase-3 (GSK3 is hyperactive in several neurological conditions that involve impairments in both cognition and neurogenesis. This raises the hypotheses that hyperactive GSK3 may directly contribute to impaired cognition, and that this may be related to deficiencies in neural precursor cells (NPC. To study the effects of hyperactive GSK3 in the absence of disease influences, we compared adult hippocampal NPC proliferation and performance in three cognitive tasks in male and female wild-type mice and GSK3 knockin mice, which express constitutively active GSK3. NPC proliferation was ~40% deficient in both male and female GSK3 knockin mice compared with wild-type mice. Environmental enrichment (EE increased NPC proliferation in male, but not female, GSK3 knockin mice and wild-type mice. Male and female GSK3 knockin mice exhibited impairments in novel object recognition, temporal order memory, and coordinate spatial processing compared with gender-matched wild-type mice. EE restored impaired novel object recognition and temporal ordering in both sexes of GSK3 knockin mice, indicating that this repair was not dependent on NPC proliferation, which was not increased by EE in female GSK3 knockin mice. Acute 1 hr pretreatment with the GSK3 inhibitor TDZD-8 also improved novel object recognition and temporal ordering in male and female GSK3 knockin mice. These findings demonstrate that hyperactive GSK3 is sufficient to impair adult hippocampal NPC proliferation and to impair performance in three cognitive tasks in both male and female mice, but these changes in NPC proliferation do not directly regulate novel object recognition and temporal ordering tasks.

  11. Glycogen synthase kinase-3 inhibition sensitizes human induced pluripotent stem cells to thiol-containing antioxidants induced apoptosis.

    Science.gov (United States)

    Tu, Chengyi; Xu, Robert; Koleti, Meghana; Zoldan, Janet

    2017-08-01

    Inhibition of glycogen synthase kinase 3 (GSK3) is an extensively used strategy to activate Wnt pathway for pluripotent stem cell (PSC) differentiation. However, the effects of such inhibition on PSCs, besides upregulating the Wnt pathway, have rarely been investigated despite that GSK3 is broadly involved in other cellular activities such as insulin signaling and cell growth/survival regulation. Here we describe a previously unknown synergistic effect between GSK3 inhibition (e.g., Chir99021 and LY2090314) and various normally non-toxic thiol-containing antioxidants (e.g., N-acetylcysteine, NAC) on the induction of apoptosis in human induced pluripotent stem cells (iPSCs). Neither Chir99021 nor the antioxidants individually induced significant apoptosis, whereas their combined treatment resulted in rapid and extensive apoptosis, with substantial caspase 3 activity observed within 3h and over 90% decrease in cell viability after 24h. We confirmed the generality of this phenomenon with multiple independent iPSCs lines, various thiol-based antioxidants and distinct GSK3 inhibitors. Mechanistically, we demonstrated that rapamycin treatment could substantially reduce cell death, suggesting the critical role of mammalian target of rapamycin (mTOR). Akt dysregulation was also found to partially contribute to cell apoptosis but was not the primary cause. Further, this coordinated proapoptotic effect was not detected in mouse ESCs but was present in another human cells line: a breast cancer cell line (MDA-MB-231). Given the wide use of GSK3 inhibition in biomedical research: from iPSC differentiation to cancer intervention and the treatment of neuronal diseases, researchers can potentially take advantage of or avoid this synergistic effect for improved experimental or clinical outcome. Copyright © 2017. Published by Elsevier B.V.

  12. Glycogen synthase kinase-3 inhibition attenuates fibroblast activation and development of fibrosis following renal ischemia-reperfusion in mice

    Directory of Open Access Journals (Sweden)

    Shailendra P. Singh

    2015-08-01

    Full Text Available Glycogen synthase kinase-3β (GSK3β is a serine/threonine protein kinase that plays an important role in renal tubular injury and regeneration in acute kidney injury. However, its role in the development of renal fibrosis, often a long-term consequence of acute kidney injury, is unknown. Using a mouse model of renal fibrosis induced by ischemia-reperfusion injury, we demonstrate increased GSK3β expression and activity in fibrotic kidneys, and its presence in myofibroblasts in addition to tubular epithelial cells. Pharmacological inhibition of GSK3 using TDZD-8 starting before or after ischemia-reperfusion significantly suppressed renal fibrosis by reducing the myofibroblast population, collagen-1 and fibronectin deposition, inflammatory cytokines, and macrophage infiltration. GSK3 inhibition in vivo reduced TGF-β1, SMAD3 activation and plasminogen activator inhibitor-1 levels. Consistently in vitro, TGF-β1 treatment increased GSK3β expression and GSK3 inhibition abolished TGF-β1-induced SMAD3 activation and α-smooth muscle actin (α-SMA expression in cultured renal fibroblasts. Importantly, overexpression of constitutively active GSK3β stimulated α-SMA expression even in the absence of TGF-β1 treatment. These results suggest that TGF-β regulates GSK3β, which in turn is important for TGF-β–SMAD3 signaling and fibroblast-to-myofibroblast differentiation. Overall, these studies demonstrate that GSK3 could promote renal fibrosis by activation of TGF-β signaling and the use of GSK3 inhibitors might represent a novel therapeutic approach for progressive renal fibrosis that develops as a consequence of acute kidney injury.

  13. Calcineurin B homologous protein 3 negatively regulates cardiomyocyte hypertrophy via inhibition of glycogen synthase kinase 3 phosphorylation.

    Science.gov (United States)

    Kobayashi, Soushi; Nakamura, Tomoe Y; Wakabayashi, Shigeo

    2015-07-01

    Cardiac hypertrophy is a leading cause of serious heart diseases. Although many signaling molecules are involved in hypertrophy, the functions of some proteins in this process are still unknown. Calcineurin B homologous protein 3 (CHP3)/tescalcin is an EF-hand Ca(2+)-binding protein that is abundantly expressed in the heart; however, the function of CHP3 is unclear. Here, we aimed to identify the cardiac functions of CHP3. CHP3 was expressed in hearts at a wide range of developmental stages and was specifically detected in neonatal rat ventricular myocytes (NRVMs) but not in cardiac fibroblasts in culture. Moreover, knockdown of CHP3 expression using adenoviral-based RNA interference in NRVMs resulted in enlargement of cardiomyocyte size, concomitant with increased expression of a pathological hypertrophy marker ANP. This same treatment elevated glycogen synthase kinase (GSK3α/β) phosphorylation, which is known to inhibit GSK3 function. In contrast, CHP3 overexpression blocked the insulin-induced phosphorylation of GSK3α/β without affecting the phosphorylation of Akt, which is an upstream kinase of GSK3α/β, in HEK293 cells, and it inhibited both IGF-1-induced phosphorylation of GSK3β and cardiomyocyte hypertrophy in NRVMs. Co-immunoprecipitation experiments revealed that GSK3β interacted with CHP3. However, a Ca(2+)-binding-defective mutation of CHP3 (CHP3-D123A) also interacted with GSK3β and had the same inhibitory effect on GSK3α/β phosphorylation, suggesting that the action of CHP3 was independent of Ca(2+). These findings suggest that CHP3 functions as a novel negative regulator of cardiomyocyte hypertrophy via inhibition of GSK3α/β phosphorylation and subsequent enzymatic activation of GSK3α/β. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of AMPA receptor signaling

    Science.gov (United States)

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-01-01

    Objectives Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. Methods In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Results Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. Conclusions These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. PMID:27687706

  15. Glycogen Synthase Kinase-3 Modulates Hyperosmotic-Induced Urea Transporter A1 Relocation in the Inner Medullary Collecting Duct Cells.

    Science.gov (United States)

    Li, Yong-Xia; Huang, Yun; Liu, Song; Mao, Yan; Yuan, Cheng-Yan; Yang, Xiao; Yao, Li-Jun

    2016-01-01

    Glycogen synthase kinase 3 (GSK3) regulates urine concentration by mediating the vasopressin-induced aquaporin 2 expression and water permeability, although it is unknown whether GSK3 also mediates the accumulation of the urea transporter A1 (UT-A1). The aim of this study is to investigate the effect of GSK3 on UT-A1 distribution. Mouse inner medullary collecting duct 3 cells were transfected with UT-A1-GFP construct. The stable transfected cells were cultured under hypertonic conditions, treated with GSK3 inhibitor lithium chloride, GSK3 activator, lysosome or proteasome inhibitor. The expression levels of UT-A1, GSK3, and phospho-GSK3 were analyzed using western blot. The interaction between UT-A1 and the Golgi apparatus was examined using confocal immunofluorescence microscope. The UT-A1 trafficking was examined using the biotinylation of surface membranes. UT-A1 dissociated away from the Golgi apparatus and translocated to the plasma membrane under hypertonic-NaCl and NaCl plus urea stimulation. This movement was accompanied by the increased phosphorylation of GSK3 and its localization on the cellular membrane. Moreover, these results were duplicated by treating the cells with the GSK3 inhibitor, and by contrast, were partially reversed by the GSK3 activator. Treating cells with a lysosome or proteasome inhibitor failed to attenuate the effects of hypertonic stimulus, indicating that the loss of UT-A1 from the Golgi was not due to degradation. Our results suggest that GSK3 may in part modulate the hypertonic-induced intracellular UT-A1 redistribution and its accumulation on the plasma membrane, which may constitute another mechanism by which GSK3 modulates urine concentration. © 2016 S. Karger AG, Basel.

  16. Two structurally distinct inhibitors of glycogen synthase kinase 3 induced centromere positive micronuclei in human lymphoblastoid TK6 cells.

    Science.gov (United States)

    Mishima, Masayuki; Tanaka, Kenji; Takeiri, Akira; Harada, Asako; Kubo, Chiyomi; Sone, Sachiko; Nishimura, Yoshikazu; Tachibana, Yukako; Okazaki, Makoto

    2008-08-25

    Glycogen synthase kinase 3 (GSK3) is an attractive novel pharmacological target. Inhibition of GSK3 is recently regarded as one of the viable approaches to therapy for Alzheimer's disease, cancer, diabetes mellitus, osteoporosis, and bipolar mood disorder. Here, we have investigated the aneugenic potential of two potent and highly specific inhibitors of GSK3 by using an in vitro micronucleus test with human lymphoblastoid TK6 cells. One inhibitor was a newly synthesized maleimide derivative and the other was a previously known aminopyrimidine derivative. Both compounds elicited statistically significant and concentration-dependent increases in micronucleated cells. One hundred micronuclei (MN) of each were analyzed using centromeric DNA staining with fluorescence in situ hybridization. Both the two structurally distinct compounds induced centromere-positive micronuclei (CMN). Calculated from the frequency of MN cells and the percentage of CMN, CMN cell incidence after treatment with the maleimide compound at 1.2 microM, 2.4 microM, and 4.8 microM was 11.6, 27.7, and 56.3 per 1000 cells, respectively; the negative control was 4.5. CMN cell incidence after the treatment with the aminopyrimidine compound at 1.8 microM, 3.6 microM, and 5.4 microM was 6.7, 9.8 and 17.2 per 1000 cells, respectively. Both compounds exhibited concentration-dependent increase in the number of mitotic cells. The frequency of CMN cells correlated well with mitotic cell incidence after treatment with either compound. Furthermore, both inhibitors induced abnormal mitotic cells with asymmetric mitotic spindles and lagging anaphase chromosomes. These results lend further support to the hypothesis that the inhibition of GSK3 activity affects microtubule function and exhibits an aneugenic mode of action.

  17. Inhibition of glycogen synthase kinase-3 reduces extension of the axonal leading process by destabilizing microtubules in cerebellar granule neurons.

    Science.gov (United States)

    Inami, Yoshihiro; Omura, Mitsuru; Kubota, Kenta; Konishi, Yoshiyuki

    2018-07-01

    Recent studies have uncovered various molecules that play key roles in neuronal morphogenesis. Nevertheless, the mechanisms underlying the neuron-type-dependent regulation of morphogenesis remain unknown. We have previously reported that inhibition of glycogen synthase kinase-3 (GSK3) markedly reduced axonal length of cerebellar granule neurons (CGNs) in a neuron-type-dependent manner. In the present study, we investigated the mechanisms by which the growth of CGN axons was severely suppressed upon GSK3 inhibition. Using time-lapse imaging of cultured CGNs at early morphogenesis, we found that extension of the leading process was severely inhibited by the pharmacological inhibition of GSK3. The rate of somal migration was also reduced with a GSK3 inhibitor in dissociated culture as well as in microexplant culture. In addition, CGNs ectopically expressed with a catalytically inactive mutant of GSK3 exhibited a migration defect in vivo. In axonal leading processes of CGNs, detyrosination and acetylation of α-tubulin, which are known to correlate with microtubule stability, were decreased by GSK3 inhibition. A photoconversion analysis found that inhibition of GSK3 increases the turnover of microtubules. Furthermore, in the presence of paclitaxel, a microtubule-stabilizing reagent, inhibition of GSK3 recovered the axonal leading process extension that was reduced by paclitaxel. Our results suggest that GSK3 supports the extension of axonal processes by stabilizing microtubules, contrary to its function in other neuron-types, lending mechanical insight into neuron-type-dependent morphological regulation. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  19. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  20. Structure determination of glycogen synthase kinase-3 from Leishmania major and comparative inhibitor structure-activity relationships with Trypanosoma brucei GSK-3

    Energy Technology Data Exchange (ETDEWEB)

    Ojo, Kayode K; Arakaki, Tracy L; Napuli, Alberto J; Inampudi, Krishna K; Keyloun, Katelyn R; Zhang, Li; Hol, Wim G.J.; Verlind, Christophe L.M.J.; Merritt, Ethan A; Van Voorhis, Wesley C [UWASH

    2012-04-24

    Glycogen synthase kinase-3 (GSK-3) is a drug target under intense investigation in pharmaceutical companies and constitutes an attractive piggyback target for eukaryotic pathogens. Two different GSKs are found in trypanosomatids, one about 150 residues shorter than the other. GSK-3 short (GeneDB: Tb927.10.13780) has previously been validated genetically as a drug target in Trypanosoma brucei by RNAi induced growth retardation; and chemically by correlation between enzyme and in vitro growth inhibition. Here, we report investigation of the equivalent GSK-3 short enzymes of L. major (LmjF18.0270) and L. infantum (LinJ18_V3.0270, identical in amino acid sequences to LdonGSK-3 short) and a crystal structure of LmajGSK-3 short at 2 Å resolution. The inhibitor structure-activity relationships (SARs) of L. major and L. infantum are virtually identical, suggesting that inhibitors could be useful for both cutaneous and visceral leishmaniasis. Leishmania spp. GSK-3 short has different inhibitor SARs than TbruGSK-3 short, which can be explained mostly by two variant residues in the ATP-binding pocket. Indeed, mutating these residues in the ATP-binding site of LmajGSK-3 short to the TbruGSK-3 short equivalents results in a mutant LmajGSK-3 short enzyme with SAR more similar to that of TbruGSK-3 short. The differences between human GSK-3β (HsGSK-3β) and LmajGSK-3 short SAR suggest that compounds which selectively inhibit LmajGSK-3 short may be found.

  1. Glycogen synthase kinase 3β regulation of nuclear factor of activated T-cells isoform c1 in the vascular smooth muscle cell response to injury

    International Nuclear Information System (INIS)

    Chow Winsion; Hou Guangpei; Bendeck, Michelle P.

    2008-01-01

    The migration and proliferation of vascular smooth muscle cells (vSMCs) are critical events in neointima formation during atherosclerosis and restenosis. The transcription factor nuclear factor of activated T-cells-isoform c1 (NFATc1) is regulated by atherogenic cytokines, and has been implicated in the migratory and proliferative responses of vSMCs through the regulation of gene expression. In T-cells, calcineurin de-phosphorylates NFATc1, leading to its nuclear import, while glycogen synthase kinase 3 β (GSK3β) phosphorylates NFATc1 and promotes its nuclear export. However, the relationship between NFATc1 and GSK3β has not been studied during SMC migration and proliferation. We investigated this by scrape wounding vSMCs in vitro, and studying wound repair. NFATc1 protein was transiently increased, reaching a peak at 8 h after wounding. Cell fractionation and immunocytochemistry revealed that NFATc1 accumulation in the nucleus was maximal at 4 h after injury, and this was coincident with a significant 9 fold increase in transcriptional activity. Silencing NFATc1 expression with siRNA or inhibition of NFAT with cyclosporin A (CsA) attenuated wound closure by vSMCs. Phospho-GSK3β (inactive) increased to a peak at 30 min after injury, preceding the nuclear accumulation of NFATc1. Overexpression of a constitutively active mutant of GSK3β delayed the nuclear accumulation of NFATc1, caused a 50% decrease in NFAT transcriptional activity, and attenuated vSMC wound repair. We conclude that NFATc1 promotes the vSMC response to injury, and that inhibition of GSK3β is required for the activation of NFAT during wound repair

  2. Regulation of glycogen synthase kinase-3{beta} (GSK-3{beta}) after ionizing radiation; Regulation der Glykogen Synthase Kinase-3{beta} (GSK-3{beta}) nach ionisierender Strahlung

    Energy Technology Data Exchange (ETDEWEB)

    Boehme, K.A.

    2006-12-15

    Glycogen Synthase Kinase-3{beta} (GSK-3{beta}) phosphorylates the Mdm2 protein in the central domain. This phosphorylation is absolutely required for p53 degradation. Ionizing radiation inactivates GSK-3{beta} by phosphorylation at serine 9 and in consequence prevents Mdm2 mediated p53 degradation. During the work for my PhD I identified Akt/PKB as the kinase that phosphorylates GSK-3{beta} at serine 9 after ionizing radiation. Ionizing radiation leads to phosphorylation of Akt/PKB at threonine 308 and serine 473. The PI3 Kinase inhibitor LY294002 completely abolished Akt/PKB serine 473 phosphorylation and prevented the induction of GSK-3{beta} serine 9 phosphorylation after ionizing radiation. Interestingly, the most significant activation of Akt/PKB after ionizing radiation occurred in the nucleus while cytoplasmic Akt/PKB was only weakly activated after radiation. By using siRNA, I showed that Akt1/PKBa, but not Akt2/PKB{beta}, is required for phosphorylation of GSK- 3{beta} at serine 9 after ionizing radiation. Phosphorylation and activation of Akt/PKB after ionizing radiation depends on the DNA dependent protein kinase (DNA-PK), a member of the PI3 Kinase family, that is activated by free DNA ends. Both, in cells from SCID mice and after knockdown of the catalytic subunit of DNA-PK by siRNA in osteosarcoma cells, phosphorylation of Akt/PKB at serine 473 and of GSK-3{beta} at serine 9 was completely abolished. Consistent with the principle that phosphorylation of GSK-3 at serine 9 contributes to p53 stabilization after radiation, the accumulation of p53 in response to ionizing radiation was largely prevented by downregulation of DNA-PK. From these results I conclude, that ionizing radiation induces a signaling cascade that leads to Akt1/PKBa activation mediated by DNA-PK dependent phosphorylation of serine 473. After activation Akt1/PKBa phosphorylates and inhibits GSK-3{beta} in the nucleus. The resulting hypophosphorylated form of Mdm2 protein is no longer

  3. Deleterious effects of neuronal accumulation of glycogen in flies and mice.

    Science.gov (United States)

    Duran, Jordi; Tevy, María Florencia; Garcia-Rocha, Mar; Calbó, Joaquim; Milán, Marco; Guinovart, Joan J

    2012-08-01

    Under physiological conditions, most neurons keep glycogen synthase (GS) in an inactive form and do not show detectable levels of glycogen. Nevertheless, aberrant glycogen accumulation in neurons is a hallmark of patients suffering from Lafora disease or other polyglucosan disorders. Although these diseases are associated with mutations in genes involved in glycogen metabolism, the role of glycogen accumulation remains elusive. Here, we generated mouse and fly models expressing an active form of GS to force neuronal accumulation of glycogen. We present evidence that the progressive accumulation of glycogen in mouse and Drosophila neurons leads to neuronal loss, locomotion defects and reduced lifespan. Our results highlight glycogen accumulation in neurons as a direct cause of neurodegeneration. Copyright © 2012 EMBO Molecular Medicine.

  4. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  5. Role of Maltose Enzymes in Glycogen Synthesis by Escherichia coli▿

    Science.gov (United States)

    Park, Jong-Tae; Shim, Jae-Hoon; Tran, Phuong Lan; Hong, In-Hee; Yong, Hwan-Ung; Oktavina, Ershita Fitria; Nguyen, Hai Dang; Kim, Jung-Wan; Lee, Tae Soo; Park, Sung-Hoon; Boos, Winfried; Park, Kwan-Hwa

    2011-01-01

    Mutants with deletion mutations in the glg and mal gene clusters of Escherichia coli MC4100 were used to gain insight into glycogen and maltodextrin metabolism. Glycogen content, molecular mass, and branch chain distribution were analyzed in the wild type and in ΔmalP (encoding maltodextrin phosphorylase), ΔmalQ (encoding amylomaltase), ΔglgA (encoding glycogen synthase), and ΔglgA ΔmalP derivatives. The wild type showed increasing amounts of glycogen when grown on glucose, maltose, or maltodextrin. When strains were grown on maltose, the glycogen content was 20 times higher in the ΔmalP strain (0.97 mg/mg protein) than in the wild type (0.05 mg/mg protein). When strains were grown on glucose, the ΔmalP strain and the wild type had similar glycogen contents (0.04 mg/mg and 0.03 mg/mg protein, respectively). The ΔmalQ mutant did not grow on maltose but showed wild-type amounts of glycogen when grown on glucose, demonstrating the exclusive function of GlgA for glycogen synthesis in the absence of maltose metabolism. No glycogen was found in the ΔglgA and ΔglgA ΔmalP strains grown on glucose, but substantial amounts (0.18 and 1.0 mg/mg protein, respectively) were found when they were grown on maltodextrin. This demonstrates that the action of MalQ on maltose or maltodextrin can lead to the formation of glycogen and that MalP controls (inhibits) this pathway. In vitro, MalQ in the presence of GlgB (a branching enzyme) was able to form glycogen from maltose or linear maltodextrins. We propose a model of maltodextrin utilization for the formation of glycogen in the absence of glycogen synthase. PMID:21421758

  6. Glycogen synthase kinase 3 has a limited role in cell cycle regulation of cyclin D1 levels.

    Science.gov (United States)

    Yang, Ke; Guo, Yang; Stacey, William C; Harwalkar, Jyoti; Fretthold, Jonathan; Hitomi, Masahiro; Stacey, Dennis W

    2006-08-30

    The expression level of cyclin D1 plays a vital role in the control of proliferation. This protein is reported to be degraded following phosphorylation by glycogen synthase kinase 3 (GSK3) on Thr-286. We recently showed that phosphorylation of Thr-286 is responsible for a decline in cyclin D1 levels during S phase, an event required for efficient DNA synthesis. These studies were undertaken to test the possibility that phosphorylation by GSK3 is responsible for the S phase specific decline in cyclin D1 levels, and that this event is regulated by the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway which controls GSK3. We found, however, that neither PI3K, AKT, GSK3, nor proliferative signaling activity in general is responsible for the S phase decline in cyclin D1 levels. In fact, the activity of these signaling kinases does not vary through the cell cycle of proliferating cells. Moreover, we found that GSK3 activity has little influence over cyclin D1 expression levels during any cell cycle phase. Inhibition of GSK3 activity by siRNA, LiCl, or other chemical inhibitors failed to influence cyclin D1 phosphorylation on Thr-286, even though LiCl efficiently blocked phosphorylation of beta-catenin, a known substrate of GSK3. Likewise, the expression of a constitutively active GSK3 mutant protein failed to influence cyclin D1 phosphorylation or total protein expression level. Because we were unable to identify any proliferative signaling molecule or pathway which is regulated through the cell cycle, or which is able to influence cyclin D1 levels, we conclude that the suppression of cyclin D1 levels during S phase is regulated by cell cycle position rather than signaling activity. We propose that this mechanism guarantees the decline in cyclin D1 levels during each S phase; and that in so doing it reduces the likelihood that simple over expression of cyclin D1 can lead to uncontrolled cell growth.

  7. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    OpenAIRE

    E. Ruchti; P.J. Roach; A.A. DePaoli-Roach; P.J. Magistretti; I. Allaman

    2016-01-01

    The storage and use of glycogen, the main energy reserve in the brain, is a metabolic feature of astrocytes. Glycogen synthesis is regulated by Protein Targeting to Glycogen (PTG), a member of specific glycogen-binding subunits of protein phosphatase-1 (PPP1). It positively regulates glycogen synthesis through de-phosphorylation of both glycogen synthase (activation) and glycogen phosphorylase (inactivation). In cultured astrocytes, PTG mRNA levels were previously shown to be enhanced by the ...

  8. The Glycogen Synthase Kinase 3α and β Isoforms Differentially Regulates Interleukin-12p40 Expression in Endothelial Cells Stimulated with Peptidoglycan from Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Ricarda Cortés-Vieyra

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutively active regulatory enzyme that is important in cancer, diabetes, and cardiovascular, neurodegenerative, and psychiatric diseases. While GSK3α is usually important in neurodegenerative and psychiatric diseases GSK3β is fundamental in the inflammatory response caused by bacterial components. Peptidoglycan (PGN, one of the most abundant cell-wall structures of Gram-positive bacteria, is an important inducer of inflammation. To evaluate whether inhibition of GSK3α and GSK3β activity in bovine endothelial cells (BEC regulates the expression of the pro-inflammatory cytokine IL-12p40, we treated BEC with SDS-purified PGN from Staphylococcus aureus. We found that PGN triggered a TLR2/PI3K/Akt-dependent phosphorylation of GSK3α at Ser21, GSK3β at Ser9, and NF-κB p65 subunit (p65 at Ser536, and the phosphorylation of GSK3α was consistently higher than that of GSK3β. The expression of IL-12p40 was inhibited in BEC stimulated with PGN and pre-treated with a specific neutralizing anti-TLR2 antibody that targets the extracellular domain of TLR2 or by the addition of Akt-i IV (an Akt inhibitor. Inhibition of GSK3α and GSK3β with LiCl or SB216763 induced an increase in IL-12p40 mRNA and protein. The effect of each isoform on IL-12p40 expression was evaluated by siRNA-gene expression silencing of GSK3α and GSK3β. GSK3α gene silencing resulted in a marked increase in IL-12p40 mRNA and protein while GSK3β gene silencing had the opposite effect on IL-12p40 expression. These results indicate that the TLR2/PI3K/Akt-dependent inhibition of GSK3α activity also plays an important role in the inflammatory response caused by stimulation of BEC with PGN from S. aureus.

  9. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  10. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  11. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  12. Abnormal metabolism of glycogen phosphate as a cause for Lafora disease.

    Science.gov (United States)

    Tagliabracci, Vincent S; Girard, Jean Marie; Segvich, Dyann; Meyer, Catalina; Turnbull, Julie; Zhao, Xiaochu; Minassian, Berge A; Depaoli-Roach, Anna A; Roach, Peter J

    2008-12-05

    Lafora disease is a progressive myoclonus epilepsy with onset in the teenage years followed by neurodegeneration and death within 10 years. A characteristic is the widespread formation of poorly branched, insoluble glycogen-like polymers (polyglucosan) known as Lafora bodies, which accumulate in neurons, muscle, liver, and other tissues. Approximately half of the cases of Lafora disease result from mutations in the EPM2A gene, which encodes laforin, a member of the dual specificity protein phosphatase family that is able to release the small amount of covalent phosphate normally present in glycogen. In studies of Epm2a(-/-) mice that lack laforin, we observed a progressive change in the properties and structure of glycogen that paralleled the formation of Lafora bodies. At three months, glycogen metabolism remained essentially normal, even though the phosphorylation of glycogen has increased 4-fold and causes altered physical properties of the polysaccharide. By 9 months, the glycogen has overaccumulated by 3-fold, has become somewhat more phosphorylated, but, more notably, is now poorly branched, is insoluble in water, and has acquired an abnormal morphology visible by electron microscopy. These glycogen molecules have a tendency to aggregate and can be recovered in the pellet after low speed centrifugation of tissue extracts. The aggregation requires the phosphorylation of glycogen. The aggregrated glycogen sequesters glycogen synthase but not other glycogen metabolizing enzymes. We propose that laforin functions to suppress excessive glycogen phosphorylation and is an essential component of the metabolism of normally structured glycogen.

  13. Influence of pre-exercise muscle glycogen content on exercise-induced transcriptional regulation of metabolic genes

    DEFF Research Database (Denmark)

    Pilegaard, Henriette; Keller, Charlotte; Steensberg, Adam

    2002-01-01

    Transcription of metabolic genes is transiently induced during recovery from exercise in skeletal muscle of humans. To determine whether pre-exercise muscle glycogen content influences the magnitude and/or duration of this adaptive response, six male subjects performed one-legged cycling exercise...... to lower muscle glycogen content in one leg and then, the following day, completed 2.5 h low intensity two-legged cycling exercise. Nuclei and mRNA were isolated from biopsies obtained from the vastus lateralis muscle of the control and reduced glycogen (pre-exercise glycogen = 609 +/- 47 and 337 +/- 33...... mmol kg(-1) dry weight, respectively) legs before and after 0, 2 and 5 h of recovery. Exercise induced a significant (P glycogen leg only. Although PDK4...

  14. Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the β-Catenin/TCF/LEF-1 pathway in gastric cancer cells.

    Science.gov (United States)

    Tang, Xiaoli; Zheng, Dong; Hu, Ping; Zeng, Zongyue; Li, Ming; Tucker, Lynne; Monahan, Renee; Resnick, Murray B; Liu, Manran; Ramratnam, Bharat

    2014-03-01

    Glycogen synthase kinase 3 beta (GSK3β) is a critical protein kinase that phosphorylates numerous proteins in cells and thereby impacts multiple pathways including the β-Catenin/TCF/LEF-1 pathway. MicroRNAs (miRs) are a class of noncoding small RNAs of ∼22 nucleotides in length. Both GSK3β and miR play myriad roles in cell functions including stem cell development, apoptosis, embryogenesis and tumorigenesis. Here we show that GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway. Knockout of GSK3β in mouse embryonic fibroblast cells increases expression of miR-96, miR-182 and miR-183, coinciding with increases in the protein level and nuclear translocation of β-Catenin. In addition, overexpression of β-Catenin enhances the expression of miR-96, miR-182 and miR-183 in human gastric cancer AGS cells. GSK3β protein levels are decreased in human gastric cancer tissue compared with surrounding normal gastric tissue, coinciding with increases of β-Catenin protein, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster (pri-miR-183). Furthermore, suppression of miR-183-96-182 cluster with miRCURY LNA miR inhibitors decreases the proliferation and migration of AGS cells. Knockdown of GSK3β with siRNA increases the proliferation of AGS cells. Mechanistically, we show that β-Catenin/TCF/LEF-1 binds to the promoter of miR-183-96-182 cluster gene and thereby activates the transcription of the cluster. In summary, our findings identify a novel role for GSK3β in the regulation of miR-183-96-182 biogenesis through β-Catenin/TCF/LEF-1 pathway in gastric cancer cells.

  15. Systemic Correction of Murine Glycogen Storage Disease Type IV by an AAV-Mediated Gene Therapy.

    Science.gov (United States)

    Yi, Haiqing; Zhang, Quan; Brooks, Elizabeth D; Yang, Chunyu; Thurberg, Beth L; Kishnani, Priya S; Sun, Baodong

    2017-03-01

    Deficiency of glycogen branching enzyme (GBE) causes glycogen storage disease type IV (GSD IV), which is characterized by the accumulation of a less branched, poorly soluble form of glycogen called polyglucosan (PG) in multiple tissues. This study evaluates the efficacy of gene therapy with an adeno-associated viral (AAV) vector in a mouse model of adult form of GSD IV (Gbe1 ys/ys ). An AAV serotype 9 (AAV9) vector containing a human GBE expression cassette (AAV-GBE) was intravenously injected into 14-day-old Gbe1 ys/ys mice at a dose of 5 × 10 11 vector genomes per mouse. Mice were euthanized at 3 and 9 months of age. In the AAV-treated mice at 3 months of age, GBE enzyme activity was highly elevated in heart, which is consistent with the high copy number of the viral vector genome detected. GBE activity also increased significantly in skeletal muscles and the brain, but not in the liver. The glycogen content was reduced to wild-type levels in muscles and significantly reduced in the liver and brain. At 9 months of age, though GBE activity was only significantly elevated in the heart, glycogen levels were significantly reduced in the liver, brain, and skeletal muscles of the AAV-treated mice. In addition, the AAV treatment resulted in an overall decrease in plasma activities of alanine transaminase, aspartate transaminase, and creatine kinase, and a significant increase in fasting plasma glucose concentration at 9 months of age. This suggests an alleviation of damage and improvement of function in the liver and muscles by the AAV treatment. This study demonstrated a long-term benefit of a systemic injection of an AAV-GBE vector in Gbe1 ys/ys mice.

  16. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... Ginkgo biloba is one of the oldest living plant species and often referred to as “a .... GbGGDPS were analyzed and the sequence comparison was conducted ... function of plant GGDPS genes (Zhu et al., 1997) and human and.

  17. The anthocyanidin synthase gene from sweetpotato [Ipomoea ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... The tissue expression profiles of IbANS indicated that it could be expressed in all tissues but at different ... al., 1997). Likewise, transcripts of the apple ANS gene are detected ... electrophoresis (EC250-90, E-C Apparatus Corporation) and ... Instruments Inc.) analyses and the RNA samples were stored in a.

  18. Discovery of novel 2-(4-aryl-2-methylpiperazin-1-yl)-pyrimidin-4-ones as glycogen synthase kinase-3β inhibitors.

    Science.gov (United States)

    Kohara, Toshiyuki; Nakayama, Kazuki; Watanabe, Kazutoshi; Kusaka, Shin-Ichi; Sakai, Daiki; Tanaka, Hiroshi; Fukunaga, Kenji; Sunada, Shinji; Nabeno, Mika; Saito, Ken-Ichi; Eguchi, Jun-Ichi; Mori, Akiko; Tanaka, Shinji; Bessho, Tomoko; Takiguchi-Hayashi, Keiko; Horikawa, Takashi

    2017-08-15

    We herein describe the results of further evolution of glycogen synthase kinase (GSK)-3β inhibitors from our promising compounds containing a 3-methylmorpholine moiety. Transformation of the morpholine moiety into a piperazine moiety resulted in potent GSK-3β inhibitors. SAR studies focused on the nitrogen atom of the piperazine moiety revealed that a phenyl group afforded potent inhibitory activity toward GSK-3β. Docking studies indicated that the phenyl group on the piperazine nitrogen atom and the methyl group on the piperazine make cation-π and CH-π interactions with GSK-3β respectively. 4-Methoxyphenyl analogue 29 showed most potent inhibitory activity toward GSK-3β with good in vitro and in vivo pharmacokinetic profiles, and 29 demonstrated a significant decrease in tau phosphorylation after oral administration in mice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. An efficient nonviral gene-delivery vector based on hyperbranched cationic glycogen derivatives

    Directory of Open Access Journals (Sweden)

    Liang X

    2014-01-01

    Full Text Available Xuan Liang,1,* Xianyue Ren,2,* Zhenzhen Liu,1 Yingliang Liu,1 Jue Wang,2 Jingnan Wang,2 Li-Ming Zhang,1 David YB Deng,2 Daping Quan,1 Liqun Yang1 1Institute of Polymer Science, School of Chemistry and Chemical Engineering, Key Laboratory of Designed Synthesis and Application of Polymer Material, Key Laboratory for Polymeric Composite and Functional Materials of Ministry of Education, Sun Yat-Sen University, Guangzhou, People's Republic of China; 2Research Center of Translational Medicine, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, People's Republic of China *Both these authors contributed equally to this work Background: The purpose of this study was to synthesize and evaluate hyperbranched cationic glycogen derivatives as an efficient nonviral gene-delivery vector. Methods: A series of hyperbranched cationic glycogen derivatives conjugated with 3-(dimethylamino-1-propylamine (DMAPA-Glyp and 1-(2-aminoethyl piperazine (AEPZ-Glyp residues were synthesized and characterized by Fourier-transform infrared and hydrogen-1 nuclear magnetic resonance spectroscopy. Their buffer capacity was assessed by acid–base titration in aqueous NaCl solution. Plasmid deoxyribonucleic acid (pDNA condensation ability and protection against DNase I degradation of the glycogen derivatives were assessed using agarose gel electrophoresis. The zeta potentials and particle sizes of the glycogen derivative/pDNA complexes were measured, and the images of the complexes were observed using atomic force microscopy. Blood compatibility and cytotoxicity were evaluated by hemolysis assay and MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay, respectively. pDNA transfection efficiency mediated by the cationic glycogen derivatives was evaluated by flow cytometry and fluorescence microscopy in the 293T (human embryonic kidney and the CNE2 (human nasopharyngeal carcinoma cell lines. In vivo delivery of pDNA in model animals (Sprague Dawley

  20. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  1. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  2. Phosphorylations of Serines 21/9 in Glycogen Synthase Kinase 3α/β Are Not Required for Cell Lineage Commitment or WNT Signaling in the Normal Mouse Intestine.

    Directory of Open Access Journals (Sweden)

    Fiona Hey

    Full Text Available The WNT signalling pathway controls many developmental processes and plays a key role in maintenance of intestine renewal and homeostasis. Glycogen Synthase Kinase 3 (GSK3 is an important component of the WNT pathway and is involved in regulating β-catenin stability and expression of WNT target genes. The mechanisms underpinning GSK3 regulation in this context are not completely understood, with some evidence suggesting this occurs through inhibitory N-terminal serine phosphorylation in a similar way to GSK3 inactivation in insulin signaling. To investigate this in a physiologically relevant context, we have analysed the intestinal phenotype of GSK3 knockin mice in which N-terminal serines 21/9 of GSK3α/β have been mutated to non-phosphorylatable alanine residues. We show that these knockin mutations have very little effect on overall intestinal integrity, cell lineage commitment, β-catenin localization or WNT target gene expression although a small increase in apoptosis at villi tips is observed. Our results provide in vivo evidence that GSK3 is regulated through mechanisms independent of N-terminal serine phosphorylation in order for β-catenin to be stabilised.

  3. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Science.gov (United States)

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  4. Interaction of human biliverdin reductase with Akt/protein kinase B and phosphatidylinositol-dependent kinase 1 regulates glycogen synthase kinase 3 activity: a novel mechanism of Akt activation.

    Science.gov (United States)

    Miralem, Tihomir; Lerner-Marmarosh, Nicole; Gibbs, Peter E M; Jenkins, Jermaine L; Heimiller, Chelsea; Maines, Mahin D

    2016-08-01

    Biliverdin reductase A (BVR) and Akt isozymes have overlapping pleiotropic functions in the insulin/PI3K/MAPK pathway. Human BVR (hBVR) also reduces the hemeoxygenase activity product biliverdin to bilirubin and is directly activated by insulin receptor kinase (IRK). Akt isoenzymes (Akt1-3) are downstream of IRK and are activated by phosphatidylinositol-dependent kinase 1 (PDK1) phosphorylating T(308) before S(473) autophosphorylation. Akt (RxRxxSF) and PDK1 (RFxFPxFS) binding motifs are present in hBVR. Phosphorylation of glycogen synthase kinase 3 (GSK3) isoforms α/β by Akts inhibits their activity; nonphosphorylated GSK3β inhibits activation of various genes. We examined the role of hBVR in PDK1/Akt1/GSK3 signaling and Akt1 in hBVR phosphorylation. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. hBVR and Akt1 coimmunoprecipitated, and in-cell Förster resonance energy transfer (FRET) and glutathione S-transferase pulldown analyses identified Akt1 pleckstrin homology domain as the interactive domain. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. Site-directed mutagenesis, mass spectrometry, and kinetic analyses identified S(230) in hBVR (225)RNRYLSF sequence as the Akt1 target. Underlined amino acids are the essential residues of the signaling motifs. In cells, hBVR-activated Akt1 increased both GSK3α/β and forkhead box of the O class transcription class 3 (FoxO3) phosphorylation and inhibited total GSK3 activity; depletion of hBVR released inhibition and stimulated glucose uptake. Immunoprecipitation analysis showed that PDK1 and hBVR interact through hBVR's PDK1 binding (161)RFGFPAFS motif and formation of the PDK1/hBVR/Akt1 complex. sihBVR blocked complex formation. Findings identify hBVR as a previously unknown coactivator of Akt1 and as a key mediator of Akt1/GSK3 pathway, as well as define a key role for hBVR in Akt1 activation by PDK1.-Miralem, T., Lerner

  5. Swelling of rat hepatocytes stimulates glycogen synthesis

    NARCIS (Netherlands)

    Baquet, A.; Hue, L.; Meijer, A. J.; van Woerkom, G. M.; Plomp, P. J.

    1990-01-01

    In hepatocytes from fasted rats, several amino acids are known to stimulate glycogen synthesis via activation of glycogen synthase. The hypothesis that an increase in cell volume resulting from amino acid uptake may be involved in the stimulation of glycogen synthesis is supported by the following

  6. Quantitative Phosphoproteomic Study Reveals that Protein Kinase A Regulates Neural Stem Cell Differentiation Through Phosphorylation of Catenin Beta-1 and Glycogen Synthase Kinase 3β.

    Science.gov (United States)

    Wang, Shuxin; Li, Zheyi; Shen, Hongyan; Zhang, Zhong; Yin, Yuxin; Wang, Qingsong; Zhao, Xuyang; Ji, Jianguo

    2016-08-01

    Protein phosphorylation is central to the understanding of multiple cellular signaling pathways responsible for regulating the self-renewal and differentiation of neural stem cells (NSCs). Here we performed a large-scale phosphoproteomic analysis of rat fetal NSCs using strong cation exchange chromatography prefractionation and citric acid-assisted two-step enrichment with TiO2 strategy followed by nanoLC-MS/MS analysis. Totally we identified 32,546 phosphosites on 5,091 phosphoproteins, among which 23,945 were class I phosphosites, and quantified 16,000 sites during NSC differentiation. More than 65% of class I phosphosites were novel when compared with PhosphoSitePlus database. Quantification results showed that the early and late stage of NSC differentiation differ greatly. We mapped 69 changed phosphosites on 20 proteins involved in Wnt signaling pathway, including S552 on catenin beta-1 (Ctnnb1) and S9 on glycogen synthase kinase 3β (Gsk3β). Western blotting and real-time PCR results proved that Wnt signaling pathway plays critical roles in NSC fate determination. Furthermore, inhibition and activation of PKA dramatically affected the phosphorylation state of Ctnnb1 and Gsk3β, which regulates the differentiation of NSCs. Our data provides a valuable resource for studying the self-renewal and differentiation of NSCs. Stem Cells 2016;34:2090-2101. © 2016 AlphaMed Press.

  7. Attenuation of ischemia-reperfusion injury by sevoflurane postconditioning involves protein kinase B and glycogen synthase kinase 3 beta activation in isolated rat hearts.

    Science.gov (United States)

    Fang, Neng-Xin; Yao, Yun-Tai; Shi, Chun-Xia; Li, Li-Huan

    2010-12-01

    Volatile anesthetic ischemic postconditioning reduces infarct size following ischemia/reperfusion. Whether phosphorylation of protein kinase B (PKB/Akt) and glycogen synthase kinase 3 beta (GSK3β) is causal for cardioprotection by postconditioning is controversial. We therefore investigated the impact of PKB/Akt and GSK3β in isolated perfused rat hearts subjected to 40 min of ischemia followed by 1 h of reperfusion. 2.0% sevoflurane (1.0 minimum alveolar concentration) was administered at the onset of reperfusion in 15 min as postconditioning. Western blot analysis was used to determine phosphorylation of PKB/Akt and its downstream target GSK3β after 1 h of reperfusion. Mitochondrial and cytosolic content of cytochrome C checked by western blot served as a marker for mitochondrial permeability transition pore opening. Sevoflurane postconditioning significantly improved functional cardiac recovery and decreased infarct size in isolated rat hearts. Compared with unprotected hearts, sevoflurane postconditioning-induced phosphorylation of PKB/Akt and GSK3β were significantly increased. Increase of cytochrome C in mitochondria and decrease of it in cytosol is significant when compared with unprotected ones which have reversal effects on cytochrome C. The current study presents evidence that sevoflurane-induced cardioprotection at the onset of reperfusion are partly through activation of PKB/Akt and GSK3β.

  8. Synthesis and biological evaluation of glycogen synthase kinase 3 (GSK-3) inhibitors: an fast and atom efficient access to 1-aryl-3-benzylureas.

    Science.gov (United States)

    Monte, Fabio Lo; Kramer, Thomas; Boländer, Alexander; Plotkin, Batya; Eldar-Finkelman, Hagit; Fuertes, Ana; Dominguez, Juan; Schmidt, Boris

    2011-09-15

    The glycogen synthase kinase 3 (GSK-3) is implicated in multiple cellular processes and has been linked to the pathogenesis of Alzheimer's disease (AD). In the course of our research topic we synthesized a library of potent GSK-3 inhibitors. We utilized the urea scaffold present in the potent and highly selective GSK-3 inhibitor AR-A014418 (AstraZeneca). This moiety suits both (a) a convergent approach utilizing readily accessible building blocks and (b) a divergent approach based on a microwave heating assisted Suzuki coupling. We established a chromatography-free purification method to generate products with sufficient purity for the biological assays. The structure-activity relationship of the library provided the rationale for the synthesis of the benzothiazolylurea 66 (IC(50)=140 nM) and the pyridylurea 62 (IC(50)=98 nM), which displayed two to threefold enhanced activity versus the reference compound 18 (AR-A014418: IC(50)=330 nM) in our assays. Copyright © 2011. Published by Elsevier Ltd.

  9. Hypoxic inactivation of glycogen synthase kinase-3β promotes gastric tumor growth and angiogenesis by facilitating hypoxia-inducible factor-1 signaling.

    Science.gov (United States)

    Ko, Young San; Cho, Sung Jin; Park, Jinju; Choi, Yiseul; Lee, Jae-Seon; Youn, Hong-Duk; Kim, Woo Ho; Kim, Min A; Park, Jong-Wan; Lee, Byung Lan

    2016-09-01

    Since the molecular mechanism of hypoxic adaptation in cancer cells is cell-type specific, we investigated whether glycogen synthase kinase-3β (GSK-3β) activation is involved in hypoxia-induced gastric tumor promotion. Stable gastric cancer cell lines (SNU-638, SNU-484, MKN1, and MKN45) were cultured under hypoxic conditions. Cells overexpressing wild-type GSK-3β (WT-GSK-3β) or kinase-dead mutant of GSK-3β (KD-GSK-3β) were generated and used for cell culture and animal studies. In cell culture experiments, hypoxia decreased GSK-3β activation in gastric cancer cells. Cell viability and the expressions of HIF-1α protein and VEGF mRNA in gastric cancer cells were higher in KD-GSK-3β transfectants than in WT-GSK-3β transfectants under hypoxic conditions, but not under normoxic conditions. Gastric cancer xenografts showed that tumor growth, microvessel area, HIF-1α activation, and VEGF expression were higher in KD-GSK-3β tumors than in WT-GSK-3β tumors in vivo. In addition, the expression of hypoxia-induced HIF-1α protein was regulated by GSK-3β at the translational level. Our data suggest that GSK-3β is involved in hypoxic adaptation of gastric cancer cells as an inhibitory upstream regulator of the HIF-1α/VEGF signaling pathway. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  10. Fisetin Confers Cardioprotection against Myocardial Ischemia Reperfusion Injury by Suppressing Mitochondrial Oxidative Stress and Mitochondrial Dysfunction and Inhibiting Glycogen Synthase Kinase 3β Activity

    Directory of Open Access Journals (Sweden)

    Karthi Shanmugam

    2018-01-01

    Full Text Available Acute myocardial infarction (AMI is the leading cause of morbidity and mortality worldwide. Timely reperfusion is considered an optimal treatment for AMI. Paradoxically, the procedure of reperfusion can itself cause myocardial tissue injury. Therefore, a strategy to minimize the reperfusion-induced myocardial tissue injury is vital for salvaging the healthy myocardium. Herein, we investigated the cardioprotective effects of fisetin, a natural flavonoid, against ischemia/reperfusion (I/R injury (IRI using a Langendorff isolated heart perfusion system. I/R produced significant myocardial tissue injury, which was characterized by elevated levels of lactate dehydrogenase and creatine kinase in the perfusate and decreased indices of hemodynamic parameters. Furthermore, I/R resulted in elevated oxidative stress, uncoupling of the mitochondrial electron transport chain, increased mitochondrial swelling, a decrease of the mitochondrial membrane potential, and induction of apoptosis. Moreover, IRI was associated with a loss of the mitochondrial structure and decreased mitochondrial biogenesis. However, when the animals were pretreated with fisetin, it significantly attenuated the I/R-induced myocardial tissue injury, blunted the oxidative stress, and restored the structure and function of mitochondria. Mechanistically, the fisetin effects were found to be mediated via inhibition of glycogen synthase kinase 3β (GSK3β, which was confirmed by a biochemical assay and molecular docking studies.

  11. Fisetin Confers Cardioprotection against Myocardial Ischemia Reperfusion Injury by Suppressing Mitochondrial Oxidative Stress and Mitochondrial Dysfunction and Inhibiting Glycogen Synthase Kinase 3β Activity.

    Science.gov (United States)

    Shanmugam, Karthi; Ravindran, Sriram; Kurian, Gino A; Rajesh, Mohanraj

    2018-01-01

    Acute myocardial infarction (AMI) is the leading cause of morbidity and mortality worldwide. Timely reperfusion is considered an optimal treatment for AMI. Paradoxically, the procedure of reperfusion can itself cause myocardial tissue injury. Therefore, a strategy to minimize the reperfusion-induced myocardial tissue injury is vital for salvaging the healthy myocardium. Herein, we investigated the cardioprotective effects of fisetin, a natural flavonoid, against ischemia/reperfusion (I/R) injury (IRI) using a Langendorff isolated heart perfusion system. I/R produced significant myocardial tissue injury, which was characterized by elevated levels of lactate dehydrogenase and creatine kinase in the perfusate and decreased indices of hemodynamic parameters. Furthermore, I/R resulted in elevated oxidative stress, uncoupling of the mitochondrial electron transport chain, increased mitochondrial swelling, a decrease of the mitochondrial membrane potential, and induction of apoptosis. Moreover, IRI was associated with a loss of the mitochondrial structure and decreased mitochondrial biogenesis. However, when the animals were pretreated with fisetin, it significantly attenuated the I/R-induced myocardial tissue injury, blunted the oxidative stress, and restored the structure and function of mitochondria. Mechanistically, the fisetin effects were found to be mediated via inhibition of glycogen synthase kinase 3 β (GSK3 β ), which was confirmed by a biochemical assay and molecular docking studies.

  12. Protective Effects of Kaempferol against Myocardial Ischemia/Reperfusion Injury in Isolated Rat Heart via Antioxidant Activity and Inhibition of Glycogen Synthase Kinase-3β

    Science.gov (United States)

    Zhou, Mingjie; Ren, Huanhuan; Wang, Wenjuan; Zheng, Qiusheng; Wang, Dong

    2015-01-01

    Objective. This study aimed to evaluate the protective effect of kaempferol against myocardial ischemia/reperfusion (I/R) injury in rats. Method. Left ventricular developed pressure (LVDP) and its maximum up/down rate (±dp/dt max) were recorded as myocardial function. Infarct size was detected with 2,3,5-triphenyltetrazolium chloride staining. Cardiomyocyte apoptosis was determined using terminal deoxynucleotidyl nick-end labeling (TUNEL). The levels of creatine kinase (CK), lactate dehydrogenase (LDH), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione/glutathione disulfide (GSH/GSSG) ratio, and tumor necrosis factor-alpha (TNF-α) were determined using enzyme linked immunosorbent assay (ELISA). Moreover, total glycogen synthase kinase-3β (GSK-3β), phospho-GSK-3β (P-GSK-3β), precaspase-3, cleaved caspase-3, and cytoplasm cytochrome C were assayed using Western blot analysis. Results. Pretreatment with kaempferol significantly improved the recovery of LVDP and ±dp/dt max, as well as increased the levels of SOD and P-GSK-3β and GSH/GSSG ratio. However, the pretreatment reduced myocardial infarct size and TUNEL-positive cell rate, as well as decreased the levels of cleaved caspase-3, cytoplasm cytochrome C, CK, LDH, MDA, and TNF-α. Conclusion. These results suggested that kaempferol provides cardioprotection via antioxidant activity and inhibition of GSK-3β activity in rats with I/R. PMID:26265983

  13. Lithium ameliorates open-field and elevated plus maze behaviors, and brain phospho-glycogen synthase kinase 3-beta expression in fragile X syndrome model mice.

    Science.gov (United States)

    Chen, Xi; Sun, Weiwen; Pan, Ying; Yang, Quan; Cao, Kaiyi; Zhang, Jin; Zhang, Yizhi; Chen, Mincong; Chen, Feidi; Huang, Yueling; Dai, Lijun; Chen, Shengqiang

    2013-10-01

    To investigate whether lithium modifies open-field and elevated plus maze behavior, and brain phospho-glycogen synthase kinase 3 (P-GSK3beta) expression in Fmr1 knockout mice. One hundred and eighty FVB mice, including knockout and wild type, with an age of 30 days were used. An open-field and elevated plus maze was utilized to test behavior, while western blot was used to measure the P-GSK3beta expression. Six groups were formed: control (saline), lithium chloride 30, 60, 90, 120, and 200 mg/kg. The experiments were carried out in the Institute of Neuroscience, Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China between January and June 2012. Lithium significantly decreased total distance, crossing, central area time, and center entry in the open-field test (popen-arm tracking, open-arm entry, and open-arm time in the elevated plus maze (popen-field and elevated plus maze behaviors of Fmr1 knockout mice. This effect may be related to its enhancement of P-GSK3beta expression. Our findings suggest that lithium might have a therapeutic effect in fragile X syndrome.

  14. Insulin like growth factor-1 prevents 1-mentyl-4-phenylphyridinium-induced apoptosis in PC12 cells through activation of glycogen synthase kinase-3beta

    International Nuclear Information System (INIS)

    Sun, Xin; Huang, Luqi; Zhang, Min; Sun, Shenggang; Wu, Yan

    2010-01-01

    Dopaminergic neurons are lost mainly through apoptosis in Parkinson's disease. Insulin like growth factor-1 (IGF-1) inhibits apoptosis in a wide variety of tissues. Here we have shown that IGF-1 protects PC12 cells from toxic effects of 1-methyl-4-phenylpyridiniumion (MPP + ). Treatment of PC12 cells with recombinant human IGF-1 significantly decreased apoptosis caused by MPP + as measured by acridine orange/ethidium bromide staining. IGF-1 treatment induced sustained phosphorylation of glycogen synthase kinase-3beta (GSK-3beta) as shown by western blot analysis. The anti-apoptotic effect of IGF-1 was abrogated by LY294002, which indirectly inhibits phosphorylation of GSK-3beta. Lithium chloride (LiCl), a known inhibitor of GSK-3beta, also blocked MPP + -induced apoptosis. Finally, although IGF-1 enhanced phosphorylation of extracellular signal-regulated kinases ERK1 and 2 (ERK1/2), PD98059, a specific inhibitor of ERK1/2, did not alter the survival effect of IGF-1. Thus, our findings indicate that IGF-1 protects PC12 cells exposed to MPP + from apoptosis via the GSK-3beta signaling pathway.

  15. Defective insulin signaling pathway and increased glycogen synthase kinase-3 activity in the brain of diabetic mice: parallels with Alzheimer's disease and correction by insulin.

    Science.gov (United States)

    Jolivalt, C G; Lee, C A; Beiswenger, K K; Smith, J L; Orlov, M; Torrance, M A; Masliah, E

    2008-11-15

    We have evaluated the effect of peripheral insulin deficiency on brain insulin pathway activity in a mouse model of type 1 diabetes, the parallels with Alzheimer's disease (AD), and the effect of treatment with insulin. Nine weeks of insulin-deficient diabetes significantly impaired the learning capacity of mice, significantly reduced insulin-degrading enzyme protein expression, and significantly reduced phosphorylation of the insulin-receptor and AKT. Phosphorylation of glycogen synthase kinase-3 (GSK3) was also significantly decreased, indicating increased GSK3 activity. This evidence of reduced insulin signaling was associated with a concomitant increase in tau phosphorylation and amyloid beta protein levels. Changes in phosphorylation levels of insulin receptor, GSK3, and tau were not observed in the brain of db/db mice, a model of type 2 diabetes, after a similar duration (8 weeks) of diabetes. Treatment with insulin from onset of diabetes partially restored the phosphorylation of insulin receptor and of GSK3, partially reduced the level of phosphorylated tau in the brain, and partially improved learning ability in insulin-deficient diabetic mice. Our data indicate that mice with systemic insulin deficiency display evidence of reduced insulin signaling pathway activity in the brain that is associated with biochemical and behavioral features of AD and that it can be corrected by insulin treatment.

  16. Maintained activity of glycogen synthase kinase-3β despite of its phosphorylation at serine-9 in okadaic acid-induced neurodegenerative model

    International Nuclear Information System (INIS)

    Lim, Yong-Whan; Yoon, Seung-Yong; Choi, Jung-Eun; Kim, Sang-Min; Lee, Hui-Sun; Choe, Han; Lee, Seung-Chul; Kim, Dong-Hou

    2010-01-01

    Glycogen synthase kinase-3β (GSK3β) is recognized as one of major kinases to phosphorylate tau in Alzheimer's disease (AD), thus lots of AD drug discoveries target GSK3β. However, the inactive form of GSK3β which is phosphorylated at serine-9 is increased in AD brains. This is also inconsistent with phosphorylation status of other GSK3β substrates, such as β-catenin and collapsin response mediator protein-2 (CRMP2) since their phosphorylation is all increased in AD brains. Thus, we addressed this paradoxical condition of AD in rat neurons treated with okadaic acid (OA) which inhibits protein phosphatase-2A (PP2A) and induces tau hyperphosphorylation and cell death. Interestingly, OA also induces phosphorylation of GSK3β at serine-9 and other substrates including tau, β-catenin and CRMP2 like in AD brains. In this context, we observed that GSK3β inhibitors such as lithium chloride and 6-bromoindirubin-3'-monoxime (6-BIO) reversed those phosphorylation events and protected neurons. These data suggest that GSK3β may still have its kinase activity despite increase of its phosphorylation at serine-9 in AD brains at least in PP2A-compromised conditions and that GSK3β inhibitors could be a valuable drug candidate in AD.

  17. Carbon Monoxide Protects against Hepatic Ischemia/Reperfusion Injury via ROS-Dependent Akt Signaling and Inhibition of Glycogen Synthase Kinase 3β

    Directory of Open Access Journals (Sweden)

    Hyo Jeong Kim

    2013-01-01

    Full Text Available Carbon monoxide (CO may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3 and phosphatidylinositol 3-kinase (PI3K-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.

  18. Carbon monoxide protects against hepatic ischemia/reperfusion injury via ROS-dependent Akt signaling and inhibition of glycogen synthase kinase 3β.

    Science.gov (United States)

    Kim, Hyo Jeong; Joe, Yeonsoo; Kong, Jin Sun; Jeong, Sun-Oh; Cho, Gyeong Jae; Ryter, Stefan W; Chung, Hun Taeg

    2013-01-01

    Carbon monoxide (CO) may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R) injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3) and phosphatidylinositol 3-kinase (PI3K)-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β) in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.

  19. Glycogen synthase kinase-3β facilitates cell apoptosis induced by high fluence low-power laser irradiation through acceleration of Bax translocation

    Science.gov (United States)

    Huang, Lei; Wu, Shengnan; Xing, Da

    2011-03-01

    Glycogen synthase kinase-3β (GSK-3β) is a critical activator of cell apoptosis induced by a diverse array of insults. However, the effects of GSK-3β on the human lung adenocarcinoma cell (ASTC-a-1) apoptosis induced by high fluence low-power laser irradiation (HF-LPLI) are not clear. Here, we showed that GSK-3β was constantly translocated from cytoplasm to nucleus and activated during HF-LPLI-induced cell apoptosis. In addition, we found that co-overexpression of YFP-GSK-3β and CFP-Bax in ASTC-a-1 cells accelerated both Bax translocations to mitochondria and cell apoptosis, compared to the cells expressed CFP-Bax only under HF-LPLI treatment, indicating that GSK-3β facilitated ASTC-a-1 cells apoptosis through acceleration mitochondrial translocation of Bax. Our results demonstrate that GSK-3β exerts some of its pro-apoptotic effects in ASTC-a-1 cells by regulating the mitochondrial localization of Bax, a key component of the intrinsic apoptotic cascade.

  20. Glycogen synthase kinase-3beta (GSK3beta) negatively regulates PTTG1/human securin protein stability, and GSK3beta inactivation correlates with securin accumulation in breast tumors.

    Science.gov (United States)

    Mora-Santos, Mar; Limón-Mortés, M Cristina; Giráldez, Servando; Herrero-Ruiz, Joaquín; Sáez, Carmen; Japón, Miguel Á; Tortolero, Maria; Romero, Francisco

    2011-08-26

    PTTG1, also known as securin, is an inactivating partner of separase, the major effector for chromosome segregation during mitosis. At the metaphase-to-anaphase transition, securin is targeted for proteasomal destruction by the anaphase-promoting complex or cyclosome, allowing activation of separase. In addition, securin is overexpressed in metastatic or genomically instable tumors, suggesting a relevant role for securin in tumor progression. Stability of securin is regulated by phosphorylation; some phosphorylated forms are degraded out of mitosis, by the action of the SKP1-CUL1-F-box protein (SCF) complex. The kinases targeting securin for proteolysis have not been identified, and mechanistic insight into the cause of securin accumulation in human cancers is lacking. Here, we demonstrate that glycogen synthase kinase-3β (GSK3β) phosphorylates securin to promote its proteolysis via SCF(βTrCP) E3 ubiquitin ligase. Importantly, a strong correlation between securin accumulation and GSK3β inactivation was observed in breast cancer tissues, indicating that GSK3β inactivation may account for securin accumulation in breast cancers.

  1. Chronic inhibition of glycogen synthase kinase-3 protects against rotenone-induced cell death in human neuron-like cells by increasing BDNF secretion.

    Science.gov (United States)

    Giménez-Cassina, Alfredo; Lim, Filip; Díaz-Nido, Javier

    2012-12-07

    Mitochondrial dysfunction is a common feature of many neurodegenerative disorders. Likewise, activation of glycogen synthase kinase-3 (GSK-3) has been proposed to play an important role in neurodegeneration. This multifunctional protein kinase is involved in a number of cellular functions and we previously showed that chronic inhibition of GSK-3 protects neuronal cells against mitochondrial dysfunction-elicited cell death, through a mechanism involving increased glucose metabolism and the translocation of hexokinase II (HKII) to mitochondria. Here, we sought to gain deeper insight into the molecular basis of this neuroprotection. We found that chronic inhibition of GSK-3, either genetically or pharmacologically, elicited a marked increase in brain-derived neurotrophic factor (BDNF) secretion, which in turn conferred resistance to mitochondrial dysfunction through subcellular re-distribution of HKII. These results define a molecular pathway through which chronic inhibition of GSK-3 may protect neuronal cells from death. Moreover, they highlight the potential benefits of enhanced neurotrophic factor secretion as a therapeutic approach to treat neurodegenerative diseases. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  2. Glycogen synthase kinase-3beta and the p25 activator of cyclin dependent kinase 5 increase pausing of mitochondria in neurons.

    Science.gov (United States)

    Morel, M; Authelet, M; Dedecker, R; Brion, J P

    2010-06-02

    The complex bi-directional axoplasmic transport of mitochondria is essential for proper metabolic functioning of neurons and is controlled by phosphorylation. We have investigated by time-lapse imaging the effects of increased expression of glycogen synthase kinase-3beta (GSK-3beta) and of the p25 activator of cyclin dependent kinase 5 on mitochondria movements in mammalian cortical neurons and in PC12 cells. Both GSK-3beta and p25 increased the stationary behaviour of mitochondria in PC12 and in neurons, decreased their anterograde transport but did not affect the intrinsic velocities of mitochondria. The microtubule-associated tau proteins were more phosphorylated in GSK-3beta and p25 transfected neurons, but ultrastructural observation showed that these cells still contained microtubules and nocodazole treatment further reduced residual mitochondria movements in GSK-3beta or p25 transfected neurons, indicating that microtubule disruption was not the primary cause of increased mitochondrial stationary behaviour in GSK-3beta or p25 transfected neurons. Our results suggest that increased expression of GSK-3beta and p25 acted rather by decreasing the frequency of mitochondrial movements driven by molecular motors and that GSK-3beta and p25 might regulate these transports by controlling the time that mitochondria spend pausing, rather than their velocities. Copyright 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

  3. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  4. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  5. Cell swelling and glycogen metabolism in hepatocytes from fasted rats

    NARCIS (Netherlands)

    Gustafson, L. A.; Jumelle-Laclau, M. N.; van Woerkom, G. M.; van Kuilenburg, A. B.; Meijer, A. J.

    1997-01-01

    Cell swelling is known to increase net glycogen production from glucose in hepatocytes from fasted rats by activating glycogen synthase. Since both active glycogen synthase and phosphorylase are present in hepatocytes, suppression of flux through phosphorylase may also contribute to the net increase

  6. Sugar versus fat: elimination of glycogen storage improves lipid accumulation in Yarrowia lipolytica.

    Science.gov (United States)

    Bhutada, Govindprasad; Kavšcek, Martin; Ledesma-Amaro, Rodrigo; Thomas, Stéphane; Rechberger, Gerald N; Nicaud, Jean-Marc; Natter, Klaus

    2017-05-01

    Triacylglycerol (TAG) and glycogen are the two major metabolites for carbon storage in most eukaryotic organisms. We investigated the glycogen metabolism of the oleaginous Yarrowia lipolytica and found that this yeast accumulates up to 16% glycogen in its biomass. Assuming that elimination of glycogen synthesis would result in an improvement of lipid accumulation, we characterized and deleted the single gene coding for glycogen synthase, YlGSY1. The mutant was grown under lipogenic conditions with glucose and glycerol as substrates and we obtained up to 60% improvement in TAG accumulation compared to the wild-type strain. Additionally, YlGSY1 was deleted in a background that was already engineered for high lipid accumulation. In this obese background, TAG accumulation was also further increased. The highest lipid content of 52% was found after 3 days of cultivation in nitrogen-limited glycerol medium. Furthermore, we constructed mutants of Y. lipolytica and Saccharomyces cerevisiae that are deleted for both glycogen and TAG synthesis, demonstrating that the ability to store carbon is not essential. Overall, this work showed that glycogen synthesis is a competing pathway for TAG accumulation in oleaginous yeasts and that deletion of the glycogen synthase has beneficial effects on neutral lipid storage. © FEMS 2017.

  7. Glucose dependence of glycogen synthase activity regulation by GSK3 and MEK/ERK inhibitors and angiotensin-(1-7) action on these pathways in cultured human myotubes.

    Science.gov (United States)

    Montori-Grau, Marta; Tarrats, Núria; Osorio-Conles, Oscar; Orozco, Anna; Serrano-Marco, Lucía; Vázquez-Carrera, Manuel; Gómez-Foix, Anna M

    2013-05-01

    Glycogen synthase (GS) is activated by glucose/glycogen depletion in skeletal muscle cells, but the contributing signaling pathways, including the chief GS regulator GSK3, have not been fully defined. The MEK/ERK pathway is known to regulate GSK3 and respond to glucose. The aim of this study was to elucidate the GSK3 and MEK/ERK pathway contribution to GS activation by glucose deprivation in cultured human myotubes. Moreover, we tested the glucose-dependence of GSK3 and MEK/ERK effects on GS and angiotensin (1-7) actions on these pathways. We show that glucose deprivation activated GS, but did not change phospho-GS (Ser640/1), GSK3β activity or activity-activating phosphorylation of ERK1/2. We then treated glucose-replete and -depleted cells with SB415286, U0126, LY294 and rapamycin to inhibit GSK3, MEK1/2, PI3K and mTOR, respectively. SB415286 activated GS and decreased the relative phospho-GS (Ser640/1) level, more in glucose-depleted than -replete cells. U0126 activated GS and reduced the phospho-GS (Ser640/1) content significantly in glucose-depleted cells, while GSK3β activity tended to increase. LY294 inactivated GS in glucose-depleted cells only, without affecting relative phospho-GS (Ser640/1) level. Rapamycin had no effect on GS activation. Angiotensin-(1-7) raised phospho-ERK1/2 but not phospho-GSK3β (Ser9) content, while it inactivated GS and increased GS phosphorylation on Ser640/1, in glucose-replete cells. In glucose-depleted cells, angiotensin-(1-7) effects on ERK1/2 and GS were reverted, while relative phospho-GSK3β (Ser9) content decreased. In conclusion, activation of GS by glucose deprivation is not due to GS Ser640/1 dephosphorylation, GSK3β or ERK1/2 regulation in cultured myotubes. However, glucose depletion enhances GS activation/Ser640/1 dephosphorylation due to both GSK3 and MEK/ERK inhibition. Angiotensin-(1-7) inactivates GS in glucose-replete cells in association with ERK1/2 activation, not with GSK3 regulation, and glucose

  8. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  9. Glycogen synthase kinase-3β inhibition in the medial prefrontal cortex mediates paradoxical amphetamine action in a mouse model of ADHD

    Directory of Open Access Journals (Sweden)

    Yi-Chun eYen

    2015-03-01

    Full Text Available Psychostimulants show therapeutic efficacy in the treatment of attention-deficit hyperactivity disorder (ADHD. It is generally assumed that they ameliorate ADHD symptoms via interfering with monoaminergic signaling. We combined behavioral pharmacology, neurochemistry and molecular analyses to identify mechanisms underlying the paradoxical calming effect of amphetamine in low trait anxiety behavior (LAB mice, a novel multigenetic animal model of ADHD. Amphetamine (1 mg/kg and methylphenidate (10 mg/kg elicited similar dopamine and norepinephrine release in the medial prefrontal cortex (mPFC and in the striatum of LAB mice. In contrast, amphetamine decreased, while methylphenidate increased locomotor activity. This argues against changes in dopamine and/or norepinephrine release as mediators of amphetamine paradoxical effects. Instead, the calming activity of amphetamine corresponded to the inhibition of glycogen synthase kinase3β (GSK3β activity, specifically in the mPFC. Accordingly, not only systemic administration of the GSK3β inhibitor TDZD-8 (20 mg/kg, but also local microinjections of TDZD-8 and amphetamine into the mPFC, but not into the striatum, decreased locomotor activity in LAB mice. Amphetamine effects seem to depend on NMDA receptor signaling, since pre- or co-treatment with MK-801 (0.3 mg/kg abolished the effects of amphetamine (1 mg/kg on the locomotion and on the phosphorylation of GSK3β at the level of the mPFC. Taken together, the paradoxical calming effect of amphetamine in hyperactive LAB mice concurs with a decreased GSK3β activity in the mPFC. This effect appears to be independent of dopamine or norepinephrine release, but contingent on NMDA receptor signaling.

  10. Low concentrations of methylmercury inhibit neural progenitor cell proliferation associated with up-regulation of glycogen synthase kinase 3β and subsequent degradation of cyclin E in rats

    Energy Technology Data Exchange (ETDEWEB)

    Fujimura, Masatake, E-mail: fujimura@nimd.go.jp [Department of Basic Medical Science, National Institute for Minamata Disease, Kumamoto (Japan); Usuki, Fusako [Department of Clinical Medicine, National Institute for Minamata Disease, Kumamoto (Japan)

    2015-10-01

    Methylmercury (MeHg) is an environmental neurotoxicant. The developing nervous system is susceptible to low concentrations of MeHg; however, the effect of MeHg on neural progenitor cell (NPC) proliferation, a key stage of neurogenesis during development, remains to be clarified. In this study, we investigated the effect of low concentrations of MeHg on NPCs by using a primary culture system developed using the embryonic rat cerebral cortex. NPC proliferation was suppressed 48 h after exposure to 10 nM MeHg, but cell death was not observed. Western blot analyses for cyclins A, B, D1, and E demonstrated that MeHg down-regulated cyclin E, a promoter of the G1/S cell cycle transition. Cyclin E has been shown to be degraded following the phosphorylation by glycogen synthase kinase 3β (GSK-3β). The time course study showed that GSK-3β was up-regulated 3 h after exposure to 10 nM MeHg, and cyclin E degradation 48 h after MeHg exposure. We further demonstrated that GSK-3β inhibitors, lithium and SB-415286, suppressed MeHg-induced inhibition of NPC proliferation by preventing cyclin E degradation. These results suggest that the inhibition of NPC proliferation induced by low concentration of MeHg was associated with up-regulation of GSK-3β at the early stage and subsequent degeneration of cyclin E. - Highlights: • NPC proliferation was suppressed by 10 nM MeHg, but cell death was not observed. • MeHg induced down-regulation of cyclin E, a promoter of cell cycle progression. • GSK-3β was up-regulated by 10 nM MeHg, leading to cyclin E degradation. • GSK-3β inhibitors suppressed MeHg-induced degradation of cyclin E.

  11. Inhibition of glycogen synthase kinase-3β counteracts ligand-independent activity of the androgen receptor in castration resistant prostate cancer.

    Directory of Open Access Journals (Sweden)

    Stefanie V Schütz

    Full Text Available In order to generate genomic signals, the androgen receptor (AR has to be transported into the nucleus upon androgenic stimuli. However, there is evidence from in vitro experiments that in castration-resistant prostate cancer (CRPC cells the AR is able to translocate into the nucleus in a ligand-independent manner. The recent finding that inhibition of the glycogen-synthase-kinase 3β (GSK-3β induces a rapid nuclear export of the AR in androgen-stimulated prostate cancer cells prompted us to analyze the effects of a GSK-3β inhibition in the castration-resistant LNCaP sublines C4-2 and LNCaP-SSR. Both cell lines exhibit high levels of nuclear AR in the absence of androgenic stimuli. Exposure of these cells to the maleimide SB216763, a potent GSK-3β inhibitor, resulted in a rapid nuclear export of the AR even under androgen-deprived conditions. Moreover, the ability of C4-2 and LNCaP-SSR cells to grow in the absence of androgens was diminished after pharmacological inhibition of GSK-3β in vitro. The ability of SB216763 to modulate AR signalling and function in CRPC in vivo was additionally demonstrated in a modified chick chorioallantoic membrane xenograft assay after systemic delivery of SB216763. Our data suggest that inhibition of GSK-3β helps target the AR for export from the nucleus thereby diminishing the effects of mislocated AR in CRPC cells. Therefore, inhibition of GSK-3β could be an interesting new strategy for the treatment of CRPC.

  12. Regulatory role of tumor necrosis factor receptor-associated factor 6 in breast cancer by activating the protein kinase B/glycogen synthase kinase 3β signaling pathway.

    Science.gov (United States)

    Shen, Hongyu; Li, Liangpeng; Yang, Sujin; Wang, Dandan; Zhou, Siying; Chen, Xiu; Tang, Jinhai

    2017-08-01

    Tumor necrosis factor receptor-associated factor 6 (TRAF6) is an endogenous adaptor of innate and adaptive immune responses, and serves a crucial role in tumor necrosis factor receptor and toll‑like/interleukin‑1 receptor signaling. Although studies have demonstrated that TRAF6 has oncogenic activity, its potential contributions to breast cancer in human remains largely uninvestigated. The present study examined the expression levels and function of TRAF6 in breast carcinoma (n=32) and adjacent healthy (n=25) tissue samples. Compared with adjacent healthy tissues, TRAF6 protein expression levels were significantly upregulated in breast cancer tissues. Reverse transcription‑quantitative polymerase chain reaction analysis revealed a significant upregulation of the cellular proliferative marker Ki‑67 and proliferation cell nuclear antigen expression levels in breast carcinoma specimens. Furthermore, protein expression levels of the accessory molecule, transforming growth factor β‑activated kinase 1 (TAK1), were significantly increased in breast cancer patients, as detected by western blot analysis. As determined by MTT assay, TRAF6 exerted profoundly proliferative effects in the MCF‑7 breast cancer cell line; however, these detrimental effects were ameliorated by TAK1 inhibition. Notably, protein kinase B (AKT)/glycogen synthase kinase (GSK)3β phosphorylation levels were markedly upregulated in breast cancer samples, compared with adjacent healthy tissues. In conclusion, an altered TRAF6‑TAK1 axis and its corresponding downstream AKT/GSK3β signaling molecules may contribute to breast cancer progression. Therefore, TRAF6 may represent a potential therapeutic target for the treatment of breast cancer.

  13. Focal adhesion kinase-mediated activation of glycogen synthase kinase 3β regulates IL-33 receptor internalization and IL-33 signaling.

    Science.gov (United States)

    Zhao, Jing; Wei, Jianxin; Bowser, Rachel K; Traister, Russell S; Fan, Ming-Hui; Zhao, Yutong

    2015-01-15

    IL-33, a relatively new member of the IL-1 cytokine family, plays a crucial role in allergic inflammation and acute lung injury. Long form ST2 (ST2L), the receptor for IL-33, is expressed on immune effector cells and lung epithelia and plays a critical role in triggering inflammation. We have previously shown that ST2L stability is regulated by the ubiquitin-proteasome system; however, its upstream internalization has not been studied. In this study, we demonstrate that glycogen synthase kinase 3β (GSK3β) regulates ST2L internalization and IL-33 signaling. IL-33 treatment induced ST2L internalization, and an effect was attenuated by inhibition or downregulation of GSK3β. GSK3β was found to interact with ST2L on serine residue 446 in response to IL-33 treatment. GSK3β binding site mutant (ST2L(S446A)) and phosphorylation site mutant (ST2L(S442A)) are resistant to IL-33-induced ST2L internalization. We also found that IL-33 activated focal adhesion kinase (FAK). Inhibition of FAK impaired IL-33-induced GSK3β activation and ST2L internalization. Furthermore, inhibition of ST2L internalization enhanced IL-33-induced cytokine release in lung epithelial cells. These results suggest that modulation of the ST2L internalization by FAK/GSK3β might serve as a unique strategy to lessen pulmonary inflammation. Copyright © 2015 by The American Association of Immunologists, Inc.

  14. Convergence of the mammalian target of rapamycin complex 1- and glycogen synthase kinase 3-β-signaling pathways regulates the innate inflammatory response.

    Science.gov (United States)

    Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S; Greenway, Terrance; Martin, Michael

    2011-05-01

    The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin's ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3.

  15. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor signaling.

    Science.gov (United States)

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-09-01

    Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Convergence of the Mammalian Target of Rapamycin Complex 1- and Glycogen Synthase Kinase 3-β–Signaling Pathways Regulates the Innate Inflammatory Response

    Science.gov (United States)

    Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A.; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S.; Greenway, Terrance; Martin, Michael

    2011-01-01

    The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin’s ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3. PMID:21422248

  17. Pleiotropy of Glycogen Synthase Kinase-3 Inhibition by CHIR99021 Promotes Self-Renewal of Embryonic Stem Cells from Refractory Mouse Strains

    Science.gov (United States)

    Ye, Shoudong; Tan, Li; Yang, Rongqing; Fang, Bo; Qu, Su; Schulze, Eric N.; Song, Houyan; Ying, Qilong; Li, Ping

    2012-01-01

    Background Inhibition of glycogen synthase kinase-3 (GSK-3) improves the efficiency of embryonic stem (ES) cell derivation from various strains of mice and rats, as well as dramatically promotes ES cell self-renewal potential. β-catenin has been reported to be involved in the maintenance of self-renewal of ES cells through TCF dependent and independent pathway. But the intrinsic difference between ES cell lines from different species and strains has not been characterized. Here, we dissect the mechanism of GSK-3 inhibition by CHIR99021 in mouse ES cells from refractory mouse strains. Methodology/Principal Findings We found that CHIR99021, a GSK-3 specific inhibitor, promotes self-renewal of ES cells from recalcitrant C57BL/6 (B6) and BALB/c mouse strains through stabilization of β-catenin and c-Myc protein levels. Stabilized β-catenin promoted ES self-renewal through two mechanisms. First, β-catenin translocated into the nucleus to maintain stem cell pluripotency in a lymphoid-enhancing factor/T-cell factor–independent manner. Second, β-catenin binds plasma membrane-localized E-cadherin, which ensures a compact, spherical morphology, a hallmark of ES cells. Further, elevated c-Myc protein levels did not contribute significantly to CH-mediated ES cell self-renewal. Instead, the role of c-Myc is dependent on its transformation activity and can be replaced by N-Myc but not L-Myc. β-catenin and c-Myc have similar effects on ES cells derived from both B6 and BALB/c mice. Conclusions/Significance Our data demonstrated that GSK-3 inhibition by CH promotes self-renewal of mouse ES cells with non-permissive genetic backgrounds by regulation of multiple signaling pathways. These findings would be useful to improve the availability of normally non-permissive mouse strains as research tools. PMID:22540008

  18. Glycogen synthase kinase 3 beta alters anxiety-, depression-, and addiction-related behaviors and neuronal activity in the nucleus accumbens shell

    Science.gov (United States)

    Crofton, Elizabeth J.; Nenov, Miroslav N.; Zhang, Yafang; Scala, Federico; Page, Sean A.; McCue, David L.; Li, Dingge; Hommel, Jonathan D.; Laezza, Fernanda; Green, Thomas A.

    2017-01-01

    Psychiatric disorders such as anxiety, depression and addiction are often comorbid brain pathologies thought to share common mechanistic biology. As part of the cortico-limbic circuit, the nucleus accumbens shell (NAcSh) plays a fundamental role in integrating information in the circuit, such that modulation of NAcSh circuitry alters anxiety, depression, and addiction-related behaviors. Intracellular kinase cascades in the NAcSh have proven important mediators of behavior. To investigate glycogen-synthase kinase 3 (GSK3) beta signaling in the NAcSh in vivo we knocked down GSK3beta expression with a novel adeno-associated viral vector (AAV2) and assessed changes in anxiety- and depression-like behavior and cocaine self-administration in GSK3beta knockdown rats. GSK3beta knockdown reduced anxiety-like behavior while increasing depression-like behavior and cocaine self-administration. Correlative electrophysiological recordings in acute brain slices were used to assess the effect of AAV-shGSK3beta on spontaneous firing and intrinsic excitability of tonically active interneurons (TANs), cells required for input and output signal integration in the NAcSh and for processing reward-related behaviors. Loose-patch recordings showed that TANs transduced by AAV-shGSK3beta exhibited reduction in tonic firing and increased spike half width. When assessed by whole-cell patch clamp recordings these changes were mirrored by reduction in action potential firing and accompanied by decreased hyperpolarization-induced depolarizing sag potentials, increased action potential current threshold, and decreased maximum rise time. These results suggest that silencing of GSK3beta in the NAcSh increases depression- and addiction-related behavior, possibly by decreasing intrinsic excitability of TANs. However, this study does not rule out contributions from other neuronal sub-types. PMID:28126496

  19. Up-Regulation of Excitatory Amino Acid Transporters EAAT3 and EAAT4 by Lithium Sensitive Glycogen Synthase Kinase GSK3ß

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab

    2016-12-01

    Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.

  20. Glycogen phosphorylation and Lafora disease.

    Science.gov (United States)

    Roach, Peter J

    2015-12-01

    Covalent phosphorylation of glycogen, first described 35 years ago, was put on firm ground through the work of the Whelan laboratory in the 1990s. But glycogen phosphorylation lay fallow until interest was rekindled in the mid 2000s by the finding that it could be removed by a glycogen-binding phosphatase, laforin, and that mutations in laforin cause a fatal teenage-onset epilepsy, called Lafora disease. Glycogen phosphorylation is due to phosphomonoesters at C2, C3 and C6 of glucose residues. Phosphate is rare, ranging from 1:500 to 1:5000 phosphates/glucose depending on the glycogen source. The mechanisms of glycogen phosphorylation remain under investigation but one hypothesis to explain C2 and perhaps C3 phosphate is that it results from a rare side reaction of the normal synthetic enzyme glycogen synthase. Lafora disease is likely caused by over-accumulation of abnormal glycogen in insoluble deposits termed Lafora bodies in neurons. The abnormality in the glycogen correlates with elevated phosphorylation (at C2, C3 and C6), reduced branching, insolubility and an enhanced tendency to aggregate and become insoluble. Hyperphosphorylation of glycogen is emerging as an important feature of this deadly childhood disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Recent development and gene therapy for glycogen storage disease type Ia.

    Science.gov (United States)

    Chou, Janice Y; Kim, Goo-Young; Cho, Jun-Ho

    2017-09-01

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive metabolic disorder caused by a deficiency in glucose-6-phosphatase-α (G6Pase-α or G6PC) that is expressed primarily in the liver, kidney, and intestine. G6Pase-α catalyzes the hydrolysis of glucose-6-phosphate (G6P) to glucose and phosphate in the terminal step of gluconeogenesis and glycogenolysis, and is a key enzyme for endogenous glucose production. The active site of G6Pase-α is inside the endoplasmic reticulum (ER) lumen. For catalysis, the substrate G6P must be translocated from the cytoplasm into the ER lumen by a G6P transporter (G6PT). The functional coupling of G6Pase-α and G6PT maintains interprandial glucose homeostasis. Dietary therapies for GSD-Ia are available, but cannot prevent the long-term complication of hepatocellular adenoma that may undergo malignant transformation to hepatocellular carcinoma. Animal models of GSD-Ia are now available and are being exploited to both delineate the disease more precisely and develop new treatment approaches, including gene therapy.

  2. Glycogen synthase kinase-3 inhibitors suppress the AR-V7-mediated transcription and selectively inhibit cell growth in AR-V7-positive prostate cancer cells.

    Science.gov (United States)

    Nakata, Daisuke; Koyama, Ryokichi; Nakayama, Kazuhide; Kitazawa, Satoshi; Watanabe, Tatsuya; Hara, Takahito

    2017-06-01

    Recent evidence suggests that androgen receptor (AR) splice variants, including AR-V7, play a pivotal role in resistance to androgen blockade in prostate cancer treatment. The development of new therapeutic agents that can suppress the transcriptional activities of AR splice variants has been anticipated as the next generation treatment of castration-resistant prostate cancer. High-throughput screening of AR-V7 signaling inhibitors was performed using an AR-V7 reporter system. The effects of a glycogen synthase kinase-3 (GSK3) inhibitor, LY-2090314, on endogenous AR-V7 signaling were evaluated in an AR-V7-positive cell line, JDCaP-hr, by quantitative reverse transcription polymerase chain reaction. The relationship between AR-V7 signaling and β-catenin signaling was assessed using RNA interference. The effect of LY-2090314 on cell growth in various prostate cancer cell lines was also evaluated. We identified GSK3 inhibitors as transcriptional suppressors of AR-V7 using a high-throughput screen with an AR-V7 reporter system. LY-2090314 suppressed the reporter activity and endogenous AR-V7 activity in JDCaP-hr cells. Because silencing of β-catenin partly rescued the suppression, it was evident that the suppression was mediated, at least partially, via the activation of β-catenin signaling. AR-V7 signaling and β-catenin signaling reciprocally regulate each other in JDCaP-hr cells, and therefore, GSK3 inhibition can repress AR-V7 transcriptional activity by accumulating intracellular β-catenin. Notably, LY-2090314 selectively inhibited the growth of AR-V7-positive prostate cancer cells in vitro. Our findings demonstrate the potential of GSK3 inhibitors in treating advanced prostate cancer driven by AR splice variants. In vivo evaluation of AR splice variant-positive prostate cancer models will help illustrate the overall significance of GSK3 inhibitors in treating prostate cancer. © 2017 Wiley Periodicals, Inc.

  3. Glycogen synthase kinase-3 inhibition disrupts nuclear factor-kappaB activity in pancreatic cancer, but fails to sensitize to gemcitabine chemotherapy

    Directory of Open Access Journals (Sweden)

    Mamaghani Shadi

    2009-04-01

    Full Text Available Abstract Background Aberrant activation NF-kappaB has been proposed as a mechanism of drug resistance in pancreatic cancer. Recently, inhibition of glycogen synthase kinase-3 has been shown to exert anti-tumor effects on pancreatic cancer cells by suppressing NF-kappaB. Consequently, we investigated whether inhibition of GSK-3 sensitizes pancreatic cancer cells to the chemotherapeutic agent gemcitabine. Methods GSK-3 inhibition was achieved using the pharmacological agent AR-A014418 or siRNA against GSK-3 alpha and beta isoforms. Cytotoxicity was measured using a Sulphorhodamine B assay and clonogenic survival following exposure of six different pancreatic cancer cell lines to a range of doses of either gemcitabine, AR-A014418 or both for 24, 48 and 72 h. We measured protein expression levels by immunoblotting. Basal and TNF-alpha induced activity of NF-kappaB was assessed using a luciferase reporter assay in the presence or absence of GSK-3 inhibition. Results GSK-3 inhibition reduced both basal and TNF-alpha induced NF-kappaB luciferase activity. Knockdown of GSK-3 beta reduced nuclear factor kappa B luciferase activity to a greater extent than GSK-3 alpha, and the greatest effect was seen with dual knockdown of both GSK-3 isoforms. GSK-3 inhibition also resulted in reduction of the NF-kappaB target proteins XIAP, Bcl-XL, and cyclin D1, associated with growth inhibition and decreased clonogenic survival. In all cell lines, treatment with either AR-A014418, or gemcitabine led to growth inhibition in a dose- and time-dependent manner. However, with the exception of PANC-1 where drug synergy occurred with some dose schedules, the inhibitory effect of combined drug treatment was additive, sub-additive, or even antagonistic. Conclusion GSK-3 inhibition has anticancer effects against pancreatic cancer cells with a range of genetic backgrounds associated with disruption of NF-kappaB, but does not significantly sensitize these cells to the standard

  4. Glycogen synthase kinase-3 inhibition disrupts nuclear factor-kappaB activity in pancreatic cancer, but fails to sensitize to gemcitabine chemotherapy

    International Nuclear Information System (INIS)

    Mamaghani, Shadi; Patel, Satish; Hedley, David W

    2009-01-01

    Aberrant activation NF-kappaB has been proposed as a mechanism of drug resistance in pancreatic cancer. Recently, inhibition of glycogen synthase kinase-3 has been shown to exert anti-tumor effects on pancreatic cancer cells by suppressing NF-kappaB. Consequently, we investigated whether inhibition of GSK-3 sensitizes pancreatic cancer cells to the chemotherapeutic agent gemcitabine. GSK-3 inhibition was achieved using the pharmacological agent AR-A014418 or siRNA against GSK-3 alpha and beta isoforms. Cytotoxicity was measured using a Sulphorhodamine B assay and clonogenic survival following exposure of six different pancreatic cancer cell lines to a range of doses of either gemcitabine, AR-A014418 or both for 24, 48 and 72 h. We measured protein expression levels by immunoblotting. Basal and TNF-alpha induced activity of NF-kappaB was assessed using a luciferase reporter assay in the presence or absence of GSK-3 inhibition. GSK-3 inhibition reduced both basal and TNF-alpha induced NF-kappaB luciferase activity. Knockdown of GSK-3 beta reduced nuclear factor kappa B luciferase activity to a greater extent than GSK-3 alpha, and the greatest effect was seen with dual knockdown of both GSK-3 isoforms. GSK-3 inhibition also resulted in reduction of the NF-kappaB target proteins XIAP, Bcl-X L , and cyclin D1, associated with growth inhibition and decreased clonogenic survival. In all cell lines, treatment with either AR-A014418, or gemcitabine led to growth inhibition in a dose- and time-dependent manner. However, with the exception of PANC-1 where drug synergy occurred with some dose schedules, the inhibitory effect of combined drug treatment was additive, sub-additive, or even antagonistic. GSK-3 inhibition has anticancer effects against pancreatic cancer cells with a range of genetic backgrounds associated with disruption of NF-kappaB, but does not significantly sensitize these cells to the standard chemotherapy agent gemcitabine. This lack of synergy might be

  5. Inhibition of Glycogen Synthase Kinase or the Apoptotic Protein p53 Lowers the Threshold of Helium Cardioprotection In Vivo: The Role of Mitochondrial Permeability Transition

    Science.gov (United States)

    Pagel, Paul S.; Krolikowski, John G.; Pratt, Phillip F.; Shim, Yon Hee; Amour, Julien; Warltier, David C.; Weihrauch, Dorothee

    2008-01-01

    BACKGROUND Prosurvival signaling kinases inhibit glycogen synthase kinase-3β (GSK-3β) activity and stimulate apoptotic protein p53 degradation. Helium produces cardioprotection by activating prosurvival kinases, but whether GSK and p53 inhibition mediate this process is unknown. We tested the hypothesis that inhibition of GSK or p53 lowers the threshold of helium cardioprotection via a mitochondrial permeability transition pore (mPTP)-dependent mechanism. METHODS Rabbits (n = 85) instrumented for hemodynamic measurement and subjected to a 30 min left anterior descending coronary artery (LAD) occlusion and 3 h reperfusion received 0.9% saline (control), or 1, 3, or 5 cycles of 70% helium-30% oxygen administered for 5 min interspersed with 5 min of an air-oxygen mixture (fraction of inspired oxygen concentration = 0.30) before LAD occlusion. Other rabbits received the GSK inhibitor SB 216763 (SB21; 0.2 or 0.6 mg/kg), the p53 inhibitor pifithrin-α (PIF; 1.5 or 3.0 mg/kg), or SB21 (0.2 mg/kg) or PIF (1.5 mg/kg) plus helium (1 cycle) before LAD occlusion in the presence or absence of the mPTP opener atractyloside (5 mg/kg). RESULTS Helium reduced (P < 0.05) myocardial infarct size (35 ± 6 [n = 7], 25 ± 4 [n = 7], and 20 ± 3% [n = 6] of area at risk, 1, 3, and 5 cycles, respectively) compared with control (44 ± 6% [n = 7]). SB21 (0.6 [n = 7] but not 0.2 mg/kg [n = 6]) and PIF (3.0 [n = 6] but not 1.5 mg/kg [n = 7]) also reduced necrosis. SB21 (0.2 mg/kg) or 1.5 mg/kg PIF (1.5 mg/kg) plus helium (1 cycle; n = 6 per group) decreased infarct size to an equivalent degree as three cycles of helium alone, and this cardioprotection was blocked by atractyloside (n = 7 per group). CONCLUSIONS Inhibition of GSK or p53 lowers the threshold of helium-induced preconditioning via a mPTP-dependent mechanism in vivo. PMID:18713881

  6. Human stem cell osteoblastogenesis mediated by novel glycogen synthase kinase 3 inhibitors induces bone formation and a unique bone turnover biomarker profile in rats

    International Nuclear Information System (INIS)

    Gilmour, Peter S.; O'Shea, Patrick J.; Fagura, Malbinder; Pilling, James E.; Sanganee, Hitesh; Wada, Hiroki; Courtney, Paul F.; Kavanagh, Stefan; Hall, Peter A.; Escott, K. Jane

    2013-01-01

    Wnt activation by inhibiting glycogen synthase kinase 3 (GSK-3) causes bone anabolism in rodents making GSK-3 a potential therapeutic target for osteoporotic and osteolytic metastatic bone disease. To understand the wnt pathway related to human disease translation, the ability of 3 potent inhibitors of GSK-3 (AZD2858, AR79, AZ13282107) to 1) drive osteoblast differentiation and mineralisation using human adipose-derived stem cells (hADSC) in vitro; and 2) stimulate rat bone formation in vivo was investigated. Bone anabolism/resorption was determined using clinically relevant serum biomarkers as indicators of bone turnover and bone formation assessed in femurs by histopathology and pQCT/μCT imaging. GSK-3 inhibitors caused β-catenin stabilisation in human and rat mesenchymal stem cells, stimulated hADSC commitment towards osteoblasts and osteogenic mineralisation in vitro. AZD2858 produced time-dependent changes in serum bone turnover biomarkers and increased bone mass over 28 days exposure in rats. After 7 days, AZD2858, AR79 or AZ13282107 exposure increased the bone formation biomarker P1NP, and reduced the resorption biomarker TRAcP-5b, indicating increased bone anabolism and reduced resorption in rats. This biomarker profile was differentiated from anabolic agent PTH 1–34 or the anti-resorptive Alendronate-induced changes. Increased bone formation in cortical and cancellous bone as assessed by femur histopathology supported biomarker changes. 14 day AR79 treatment increased bone mineral density and trabecular thickness, and decreased trabecular number and connectivity assessed by pQCT/μCT. GSK-3 inhibition caused hADSC osteoblastogenesis and mineralisation in vitro. Increased femur bone mass associated with changes in bone turnover biomarkers confirmed in vivo bone formation and indicated uncoupling of bone formation and resorption. - Highlights: • Wnt modulation with 3 novel GSK-3 inhibitors alters bone growth. • Human stem cell osteoblastogenesis and

  7. Human stem cell osteoblastogenesis mediated by novel glycogen synthase kinase 3 inhibitors induces bone formation and a unique bone turnover biomarker profile in rats

    Energy Technology Data Exchange (ETDEWEB)

    Gilmour, Peter S., E-mail: Peter.Gilmour@astrazeneca.com [New Opportunities Innovative Medicines group, AstraZeneca R and D, Alderley Park, Cheshire SK10 4TF (United Kingdom); O' Shea, Patrick J.; Fagura, Malbinder [New Opportunities Innovative Medicines group, AstraZeneca R and D, Alderley Park, Cheshire SK10 4TF (United Kingdom); Pilling, James E. [Discovery Sciences, AstraZeneca R and D, Alderley Park, Cheshire SK10 4TF (United Kingdom); Sanganee, Hitesh [New Opportunities Innovative Medicines group, AstraZeneca R and D, Alderley Park, Cheshire SK10 4TF (United Kingdom); Wada, Hiroki [R and I IMed, AstraZeneca R and D, Molndal (Sweden); Courtney, Paul F. [DMPK, AstraZeneca R and D, Alderley Park, Cheshire SK10 4TF (United Kingdom); Kavanagh, Stefan; Hall, Peter A. [Safety Assessment, AstraZeneca R and D, Alderley Park, Cheshire SK10 4TF (United Kingdom); Escott, K. Jane [New Opportunities Innovative Medicines group, AstraZeneca R and D, Alderley Park, Cheshire SK10 4TF (United Kingdom)

    2013-10-15

    Wnt activation by inhibiting glycogen synthase kinase 3 (GSK-3) causes bone anabolism in rodents making GSK-3 a potential therapeutic target for osteoporotic and osteolytic metastatic bone disease. To understand the wnt pathway related to human disease translation, the ability of 3 potent inhibitors of GSK-3 (AZD2858, AR79, AZ13282107) to 1) drive osteoblast differentiation and mineralisation using human adipose-derived stem cells (hADSC) in vitro; and 2) stimulate rat bone formation in vivo was investigated. Bone anabolism/resorption was determined using clinically relevant serum biomarkers as indicators of bone turnover and bone formation assessed in femurs by histopathology and pQCT/μCT imaging. GSK-3 inhibitors caused β-catenin stabilisation in human and rat mesenchymal stem cells, stimulated hADSC commitment towards osteoblasts and osteogenic mineralisation in vitro. AZD2858 produced time-dependent changes in serum bone turnover biomarkers and increased bone mass over 28 days exposure in rats. After 7 days, AZD2858, AR79 or AZ13282107 exposure increased the bone formation biomarker P1NP, and reduced the resorption biomarker TRAcP-5b, indicating increased bone anabolism and reduced resorption in rats. This biomarker profile was differentiated from anabolic agent PTH{sub 1–34} or the anti-resorptive Alendronate-induced changes. Increased bone formation in cortical and cancellous bone as assessed by femur histopathology supported biomarker changes. 14 day AR79 treatment increased bone mineral density and trabecular thickness, and decreased trabecular number and connectivity assessed by pQCT/μCT. GSK-3 inhibition caused hADSC osteoblastogenesis and mineralisation in vitro. Increased femur bone mass associated with changes in bone turnover biomarkers confirmed in vivo bone formation and indicated uncoupling of bone formation and resorption. - Highlights: • Wnt modulation with 3 novel GSK-3 inhibitors alters bone growth. • Human stem cell osteoblastogenesis

  8. Proteasome inhibition-induced p38 MAPK/ERK signaling regulates autophagy and apoptosis through the dual phosphorylation of glycogen synthase kinase 3β

    International Nuclear Information System (INIS)

    Choi, Cheol-Hee; Lee, Byung-Hoon; Ahn, Sang-Gun; Oh, Seon-Hee

    2012-01-01

    Highlights: ► MG132 induces the phosphorylation of GSK3β Ser9 and, to a lesser extent, of GSK3β Thr390 . ► MG132 induces dephosphorylation of p70S6K Thr389 and phosphorylation of p70S6K Thr421/Ser424 . ► Inactivation of p38 dephosphorylates GSK3β Ser9 and phosphorylates GSK3β Thr390 . ► Inactivation of p38 phosphorylates p70S6K Thr389 and increases the phosphorylation of p70S6K Thr421/Ser424 . ► Inactivation of p38 decreases autophagy and increases apoptosis induced by MG132. -- Abstract: Proteasome inhibition is a promising approach for cancer treatment; however, the underlying mechanisms involved have not been fully elucidated. Here, we show that proteasome inhibition-induced p38 mitogen-activated protein kinase regulates autophagy and apoptosis by modulating the phosphorylation status of glycogen synthase kinase 3β (GSK3β) and 70 kDa ribosomal S6 kinase (p70S6K). The treatment of MDA-MB-231 cells with MG132 induced endoplasmic reticulum stress through the induction of ATF6a, PERK phosphorylation, and CHOP, and apoptosis through the cleavage of Bax and procaspase-3. MG132 caused the phosphorylation of GSK3β at Ser 9 and, to a lesser extent, Thr 390 , the dephosphorylation of p70S6K at Thr 389 , and the phosphorylation of p70S6K at Thr 421 and Ser 424 . The specific p38 inhibitor SB203080 reduced the p-GSK3β Ser9 and autophagy through the phosphorylation of p70S6K Thr389 ; however, it augmented the levels of p-ERK, p-GSK3β Thr390 , and p-70S6K Thr421/Ser424 induced by MG132, and increased apoptotic cell death. The GSK inhibitor SB216763, but not lithium, inhibited the MG132-induced phosphorylation of p38, and the downstream signaling pathway was consistent with that in SB203580-treated cells. Taken together, our data show that proteasome inhibition regulates p38/GSK Ser9 /p70S6K Thr380 and ERK/GSK3β Thr390 /p70S6K Thr421/Ser424 kinase signaling, which is involved in cell survival and cell death.

  9. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    Science.gov (United States)

    Vadrot, Nathalie; Ghanem, Sarita; Braut, Françoise; Gavrilescu, Laura; Pilard, Nathalie; Mansouri, Abdellah; Moreau, Richard; Reyl-Desmars, Florence

    2012-01-01

    During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α) targets hepatocytes and induces abnormal reactive oxygen species (ROS) production responsible for mitochondrial DNA (mtDNA) alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β) plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR) we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC) was used to measure the rapid (10 min) and transient TNF-α induced increase in ROS production (168±15%). A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM). In addition, mitochondrial D-loop immunoprecipitation (mtDIP) revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15)p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  10. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    Directory of Open Access Journals (Sweden)

    Nathalie Vadrot

    Full Text Available During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α targets hepatocytes and induces abnormal reactive oxygen species (ROS production responsible for mitochondrial DNA (mtDNA alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC was used to measure the rapid (10 min and transient TNF-α induced increase in ROS production (168±15%. A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM. In addition, mitochondrial D-loop immunoprecipitation (mtDIP revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  11. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  12. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  13. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    KAUST Repository

    Ruchti, E.

    2016-10-08

    The storage and use of glycogen, the main energy reserve in the brain, is a metabolic feature of astrocytes. Glycogen synthesis is regulated by Protein Targeting to Glycogen (PTG), a member of specific glycogen-binding subunits of protein phosphatase-1 (PPP1). It positively regulates glycogen synthesis through de-phosphorylation of both glycogen synthase (activation) and glycogen phosphorylase (inactivation). In cultured astrocytes, PTG mRNA levels were previously shown to be enhanced by the neurotransmitter noradrenaline. To achieve further insight into the role of PTG in the regulation of astrocytic glycogen, its levels of expression were manipulated in primary cultures of mouse cortical astrocytes using adenovirus-mediated overexpression of tagged-PTG or siRNA to downregulate its expression. Infection of astrocytes with adenovirus led to a strong increase in PTG expression and was associated with massive glycogen accumulation (>100 fold), demonstrating that increased PTG expression is sufficient to induce glycogen synthesis and accumulation. In contrast, siRNA-mediated downregulation of PTG resulted in a 2-fold decrease in glycogen levels. Interestingly, PTG downregulation strongly impaired long-term astrocytic glycogen synthesis induced by insulin or noradrenaline. Finally, these effects of PTG downregulation on glycogen metabolism could also be observed in cultured astrocytes isolated from PTG-KO mice. Collectively, these observations point to a major role of PTG in the regulation of glycogen synthesis in astrocytes and indicate that conditions leading to changes in PTG expression will directly impact glycogen levels in this cell type.

  14. Muscle glycogen synthesis before and after exercise.

    Science.gov (United States)

    Ivy, J L

    1991-01-01

    The importance of carbohydrates as a fuel source during endurance exercise has been known for 60 years. With the advent of the muscle biopsy needle in the 1960s, it was determined that the major source of carbohydrate during exercise was the muscle glycogen stores. It was demonstrated that the capacity to exercise at intensities between 65 to 75% VO2max was related to the pre-exercise level of muscle glycogen, i.e. the greater the muscle glycogen stores, the longer the exercise time to exhaustion. Because of the paramount importance of muscle glycogen during prolonged, intense exercise, a considerable amount of research has been conducted in an attempt to design the best regimen to elevate the muscle's glycogen stores prior to competition and to determine the most effective means of rapidly replenishing the muscle glycogen stores after exercise. The rate-limiting step in glycogen synthesis is the transfer of glucose from uridine diphosphate-glucose to an amylose chain. This reaction is catalysed by the enzyme glycogen synthase which can exist in a glucose-6-phosphate-dependent, inactive form (D-form) and a glucose-6-phosphate-independent, active form (I-form). The conversion of glycogen synthase from one form to the other is controlled by phosphorylation-dephosphorylation reactions. The muscle glycogen concentration can vary greatly depending on training status, exercise routines and diet. The pattern of muscle glycogen resynthesis following exercise-induced depletion is biphasic. Following the cessation of exercise and with adequate carbohydrate consumption, muscle glycogen is rapidly resynthesised to near pre-exercise levels within 24 hours. Muscle glycogen then increases very gradually to above-normal levels over the next few days. Contributing to the rapid phase of glycogen resynthesis is an increase in the percentage of glycogen synthase I, an increase in the muscle cell membrane permeability to glucose, and an increase in the muscle's sensitivity to insulin

  15. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  16. Estradiol stimulates glycogen synthesis whereas progesterone promotes glycogen catabolism in the uterus of the American mink (Neovison vison).

    Science.gov (United States)

    Bowman, Kole; Rose, Jack

    2017-01-01

    Glycogen synthesis by mink uterine glandular and luminal epithelia (GE and LE) is stimulated by estradiol (E 2 ) during estrus. Subsequently, the glycogen deposits are mobilized to near completion to meet the energy requirements of pre-embryonic development and implantation by as yet undetermined mechanisms. We hypothesized that progesterone (P 4 ) was responsible for catabolism of uterine glycogen reserves as one of its actions to ensure reproductive success. Mink were treated with E 2 , P 4 or vehicle (controls) for 3 days and uteri collected 24 h (E 2 , P 4 and vehicle) and 96 h (E 2 ) later. To evaluate E 2 priming, mink were treated with E 2 for 3 days, then P 4 for an additional 3 days (E 2 →P 4 ) and uteri collected 24 h later. Percent glycogen content of uterine epithelia was greater at E 2 + 96 h (GE = 5.71 ± 0.55; LE = 11.54 ± 2.32) than E 2 +24 h (GE = 3.63 ± 0.71; LE = 2.82 ± 1.03), and both were higher than controls (GE = 0.27 ± 0.15; LE = 0.54 ± 0.30; P glycogen content (GE = 0.61 ± 0.16; LE = 0.51 ± 0.13), to levels not different from controls, while concomitantly increasing catabolic enzyme (glycogen phosphorylase m and glucose-6-phosphatase) gene expression and amount of phospho-glycogen synthase protein (inactive) in uterine homogenates. Interestingly, E 2 →P 4 increased glycogen synthase 1 messenger RNA (mRNA) and hexokinase 1mRNA and protein. Our findings suggest to us that while E 2 promotes glycogen accumulation by the mink uterus during estrus and pregnancy, it is P 4 that induces uterine glycogen catabolism, releasing the glucose that is essential to support pre-embryonic survival and implantation. © 2016 Japanese Society of Animal Science.

  17. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  18. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  19. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  20. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  1. Proteasome inhibition-induced p38 MAPK/ERK signaling regulates autophagy and apoptosis through the dual phosphorylation of glycogen synthase kinase 3{beta}

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Cheol-Hee [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Department of Pharmacology, College of Medicine, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Lee, Byung-Hoon [College of Pharmacy and Multiscreening Center for Drug Development, Seoul National University, Seoul 151-742 (Korea, Republic of); Ahn, Sang-Gun [Department of Pathology, College of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of); Oh, Seon-Hee, E-mail: oshccw@hanmail.net [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of)

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer MG132 induces the phosphorylation of GSK3{beta}{sup Ser9} and, to a lesser extent, of GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer MG132 induces dephosphorylation of p70S6K{sup Thr389} and phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 dephosphorylates GSK3{beta}{sup Ser9} and phosphorylates GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer Inactivation of p38 phosphorylates p70S6K{sup Thr389} and increases the phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 decreases autophagy and increases apoptosis induced by MG132. -- Abstract: Proteasome inhibition is a promising approach for cancer treatment; however, the underlying mechanisms involved have not been fully elucidated. Here, we show that proteasome inhibition-induced p38 mitogen-activated protein kinase regulates autophagy and apoptosis by modulating the phosphorylation status of glycogen synthase kinase 3{beta} (GSK3{beta}) and 70 kDa ribosomal S6 kinase (p70S6K). The treatment of MDA-MB-231 cells with MG132 induced endoplasmic reticulum stress through the induction of ATF6a, PERK phosphorylation, and CHOP, and apoptosis through the cleavage of Bax and procaspase-3. MG132 caused the phosphorylation of GSK3{beta} at Ser{sup 9} and, to a lesser extent, Thr{sup 390}, the dephosphorylation of p70S6K at Thr{sup 389}, and the phosphorylation of p70S6K at Thr{sup 421} and Ser{sup 424}. The specific p38 inhibitor SB203080 reduced the p-GSK3{beta}{sup Ser9} and autophagy through the phosphorylation of p70S6K{sup Thr389}; however, it augmented the levels of p-ERK, p-GSK3{beta}{sup Thr390}, and p-70S6K{sup Thr421/Ser424} induced by MG132, and increased apoptotic cell death. The GSK inhibitor SB216763, but not lithium, inhibited the MG132-induced phosphorylation of p38, and the downstream signaling pathway was consistent with that in SB203580-treated cells. Taken together, our

  2. Glycogen Synthase Kinase 3α Is the Main Isoform That Regulates the Transcription Factors Nuclear Factor-Kappa B and cAMP Response Element Binding in Bovine Endothelial Cells Infected with Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Octavio Silva-García

    2018-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutive enzyme implicated in the regulation of cytokine expression and the inflammatory response during bacterial infections. Mammals have two GSK3 isoforms named GSK3α and GSK3β that plays different but often overlapping functions. Although the role of GSK3β in cytokine regulation during the inflammatory response caused by bacteria is well described, GSK3α has not been found to participate in this process. Therefore, we tested if GSK3α may act as a regulatory isoform in the cytokine expression by bovine endothelial cells infected with Staphylococcus aureus because this bacterium is one of the major pathogens that cause tissue damage associated with inflammatory dysfunction. Interestingly, although both isoforms were phosphorylated–inactivated, we consistently observed a higher phosphorylation of GSK3α at Ser21 than that of GSK3β at Ser9 after bacterial challenge. During a temporal course of infection, we characterized a molecular switch from pro-inflammatory cytokine expression (IL-8, promoted by nuclear factor-kappa B (NF-κB, at an early stage (2 h to an anti-inflammatory cytokine expression (IL-10, promoted by cAMP response element binding (CREB, at a later stage (6 h. We observed an indirect effect of GSK3α activity on NF-κB activation that resulted in a low phosphorylation of CREB at Ser133, a decreased interaction between CREB and the co-activator CREB-binding protein (CBP, and a lower expression level of IL-10. Gene silencing of GSK3α and GSK3β with siRNA indicated that GSK3α knockout promoted the interaction between CREB and CBP that, in turn, increased the expression of IL-10, reduced the interaction of NF-κB with CBP, and reduced the expression of IL-8. These results indicate that GSK3α functions as the primary isoform that regulates the expression of IL-10 in endothelial cells infected with S. aureus.

  3. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  4. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Putative role of glycogen as a peripheral biomarker of GSK3β activity.

    Science.gov (United States)

    Frizzo, Marcos Emilio

    2013-09-01

    Glycogen synthase kinase 3-β (GSK3β) has a pivotal role in several intracellular signaling cascades that are involved in gene transcription, cytoskeletal reorganization, energy metabolism, cell cycle regulation, and apoptosis. This kinase has pleiotropic functions, and the importance of its activity has recently been shown in neurons and platelets. In addition to its regulatory function in several physiological events, changes in GSK3β activity have been associated with many psychiatric and neurodegenerative illnesses, such as Alzheimer's disease, schizophrenia and autism-spectrum disorders. Beside the reports of its involvement in several pathologies, it has become increasingly apparent that GSK3β might be a common therapeutic target for different classes of psychiatric drugs, and also that the GSK3β ratio may be a useful parameter to determine the biochemical changes that might occur during antidepressant treatment. Although GSK3β is commonly described as a key enzyme in a plethora of signaling cascades, originally it was identified as playing an important role in the regulation of glycogen synthesis, given its ability to inactivate glycogen synthase (GS) by phosphorylation. Acting as a constitutively active kinase, GSK3β phosphorylates GS, which results in a decrease of glycogen production. GSK3β phosphorylation increases glycogen synthesis and storage, while its dephosphorylation decreases glycogen synthesis. Inactivation of GSK3β leads to dephosphorylation of GS and increase in glycogen synthesis in the adipose tissue, muscle and liver. Glycogen levels are reduced by antidepressant treatment, and this effect seems to be related to an effect of drugs on GSK3β activity. Peripherally, glycogen is also abundantly found in platelets, where it is considered a major energy source, required for a variety of its functions, including the release reaction. Recently, analysis of platelets from patients with late-life major depression showed that active forms of

  6. The nutritional status of Methanosarcina acetivorans regulates glycogen metabolism and gluconeogenesis and glycolysis fluxes.

    Science.gov (United States)

    Santiago-Martínez, Michel Geovanni; Encalada, Rusely; Lira-Silva, Elizabeth; Pineda, Erika; Gallardo-Pérez, Juan Carlos; Reyes-García, Marco Antonio; Saavedra, Emma; Moreno-Sánchez, Rafael; Marín-Hernández, Alvaro; Jasso-Chávez, Ricardo

    2016-05-01

    Gluconeogenesis is an essential pathway in methanogens because they are unable to use exogenous hexoses as carbon source for cell growth. With the aim of understanding the regulatory mechanisms of central carbon metabolism in Methanosarcina acetivorans, the present study investigated gene expression, the activities and metabolic regulation of key enzymes, metabolite contents and fluxes of gluconeogenesis, as well as glycolysis and glycogen synthesis/degradation pathways. Cells were grown with methanol as a carbon source. Key enzymes were kinetically characterized at physiological pH/temperature. Active consumption of methanol during exponential cell growth correlated with significant methanogenesis, gluconeogenic flux and steady glycogen synthesis. After methanol exhaustion, cells reached the stationary growth phase, which correlated with the rise in glycogen consumption and glycolytic flux, decreased methanogenesis, negligible acetate production and an absence of gluconeogenesis. Elevated activities of carbon monoxide dehydrogenase/acetyl-CoA synthetase complex and pyruvate: ferredoxin oxidoreductase suggested the generation of acetyl-CoA and pyruvate for glycogen synthesis. In the early stationary growth phase, the transcript contents and activities of pyruvate phosphate dikinase, fructose 1,6-bisphosphatase and glycogen synthase decreased, whereas those of glycogen phosphorylase, ADP-phosphofructokinase and pyruvate kinase increased. Therefore, glycogen and gluconeogenic metabolites were synthesized when an external carbon source was provided. Once such a carbon source became depleted, glycolysis and methanogenesis fed by glycogen degradation provided the ATP supply. Weak inhibition of key enzymes by metabolites suggested that the pathways evaluated were mainly transcriptionally regulated. Because glycogen metabolism and glycolysis/gluconeogenesis are not present in all methanogens, the overall data suggest that glycogen storage might represent an environmental

  7. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  8. Glycogen Storage Disease Type IV

    DEFF Research Database (Denmark)

    Bendroth-Asmussen, Lisa; Aksglaede, Lise; Gernow, Anne B

    2016-01-01

    molecular genetic analyses confirmed glycogen storage disease Type IV with the finding of compound heterozygosity for 2 mutations (c.691+2T>C and c.1570C>T, p.R524X) in the GBE1 gene. We conclude that glycogen storage disease Type IV can cause early miscarriage and that diagnosis can initially be made...

  9. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  10. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  11. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  12. The metabolic trinity, glucose-glycogen-lactate, links astrocytes and neurons in brain energetics, signaling, memory, and gene expression.

    Science.gov (United States)

    Dienel, Gerald A

    2017-01-10

    Glucose, glycogen, and lactate are traditionally identified with brain energetics, ATP turnover, and pathophysiology. However, recent studies extend their roles to include involvement in astrocytic signaling, memory consolidation, and gene expression. Emerging roles for these brain fuels and a readily-diffusible by-product are linked to differential fluxes in glycolytic and oxidative pathways, astrocytic glycogen dynamics, redox shifts, neuron-astrocyte interactions, and regulation of astrocytic activities by noradrenaline released from the locus coeruleus. Disproportionate utilization of carbohydrate compared with oxygen during brain activation is influenced by catecholamines, but its physiological basis is not understood and its magnitude may be affected by technical aspects of metabolite assays. Memory consolidation and gene expression are impaired by glycogenolysis blockade, and prevention of these deficits by injection of abnormally-high concentrations of lactate was interpreted as a requirement for astrocyte-to-neuron lactate shuttling in memory and gene expression. However, lactate transport was not measured and evidence for presumed shuttling is not compelling. In fact, high levels of lactate used to preserve memory consolidation and induce gene expression are sufficient to shut down neuronal firing via the HCAR1 receptor. In contrast, low lactate levels activate a receptor in locus coeruleus that stimulates noradrenaline release that may activate astrocytes throughout brain. Physiological relevance of exogenous concentrations of lactate used to mimic and evaluate metabolic, molecular, and behavioral effects of lactate requires close correspondence with the normal lactate levels, the biochemical and cellular sources and sinks, and specificity of lactate delivery to target cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Glycogen synthesis in glycogenin 1-deficient patients

    DEFF Research Database (Denmark)

    Krag, Thomas O.; Ruiz-Ruiz, Cristina; Vissing, John

    2017-01-01

    Context: Glycogen storage disease (GSD) type XV is a rare disease caused by mutations in the GYG1 gene that codes for the core molecule of muscle glycogen, glycogenin 1. Nonetheless, glycogen is present in muscles of glycogenin 1-deficient patients, suggesting an alternative for glycogen buildup....... A likely candidate is glycogenin 2, an isoform expressed in the liver and heart but not in healthy skeletal muscle. Objective: We wanted to investigate the formation of glycogen and changes in glycogen metabolism in patients with GSD type XV. Design, Setting, and Patients: Two patients with mutations...... in the GYG1 gene were investigated for histopathology, ultrastructure, and expression of proteins involved in glycogen synthesis and metabolism. Results: Apart from occurrence of polyglucosan (PG) bodies in few fibers, glycogen appeared normal in most cells, and the concentration was normal in patients...

  14. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  15. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  16. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  17. Impaired insulin activation and dephosphorylation of glycogen synthase in skeletal muscle of women with polycystic ovary syndrome is reversed by pioglitazone treatment

    DEFF Research Database (Denmark)

    Glintborg, Dorte; Højlund, Kurt; Andersen, Nicoline Resen

    2008-01-01

    CONTEXT: Insulin resistance is a major risk factor for type 2 diabetes in women with polycystic ovary syndrome (PCOS). The molecular mechanisms underlying reduced insulin-mediated glycogen synthesis in skeletal muscle of patients with PCOS have not been established. SUBJECTS AND METHODS: We...... metabolically characterized by euglycemic-hyperinsulinemic clamps and indirect calorimetry. RESULTS: Reduced insulin-mediated glucose disposal (P .... No significant abnormalities in GSK-3alpha or -3beta were found in PCOS subjects. Pioglitazone treatment improved insulin-stimulated glucose metabolism and GS activity in PCOS (all P

  18. Glycogen and its metabolism: some new developments and old themes

    Science.gov (United States)

    Roach, Peter J.; Depaoli-Roach, Anna A.; Hurley, Thomas D.; Tagliabracci, Vincent S.

    2016-01-01

    Glycogen is a branched polymer of glucose that acts as a store of energy in times of nutritional sufficiency for utilization in times of need. Its metabolism has been the subject of extensive investigation and much is known about its regulation by hormones such as insulin, glucagon and adrenaline (epinephrine). There has been debate over the relative importance of allosteric compared with covalent control of the key biosynthetic enzyme, glycogen synthase, as well as the relative importance of glucose entry into cells compared with glycogen synthase regulation in determining glycogen accumulation. Significant new developments in eukaryotic glycogen metabolism over the last decade or so include: (i) three-dimensional structures of the biosynthetic enzymes glycogenin and glycogen synthase, with associated implications for mechanism and control; (ii) analyses of several genetically engineered mice with altered glycogen metabolism that shed light on the mechanism of control; (iii) greater appreciation of the spatial aspects of glycogen metabolism, including more focus on the lysosomal degradation of glycogen; and (iv) glycogen phosphorylation and advances in the study of Lafora disease, which is emerging as a glycogen storage disease. PMID:22248338

  19. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  20. Brain glycogen in health and disease.

    Science.gov (United States)

    Duran, Jordi; Guinovart, Joan J

    2015-12-01

    Glycogen is present in the brain at much lower concentrations than in muscle or liver. However, by characterizing an animal depleted of brain glycogen, we have shown that the polysaccharide plays a key role in learning capacity and in activity-dependent changes in hippocampal synapse strength. Since glycogen is essentially found in astrocytes, the diverse roles proposed for this polysaccharide in the brain have been attributed exclusively to these cells. However, we have demonstrated that neurons have an active glycogen metabolism that contributes to tolerance to hypoxia. However, these cells can store only minute amounts of glycogen, since the progressive accumulation of this molecule leads to neuronal loss. Loss-of-function mutations in laforin and malin cause Lafora disease. This condition is characterized by the presence of high numbers of insoluble polyglucosan bodies, known as Lafora bodies, in neuronal cells. Our findings reveal that the accumulation of this aberrant glycogen accounts for the neurodegeneration and functional consequences, as well as the impaired autophagy, observed in models of this disease. Similarly glycogen synthase is responsible for the accumulation of corpora amylacea, which are polysaccharide-based aggregates present in the neurons of aged human brains. Our findings change the current view of the role of glycogen in the brain and reveal that endogenous neuronal glycogen metabolism is important under stress conditions and that neuronal glycogen accumulation contributes to neurodegenerative diseases and to aging-related corpora amylacea formation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

    International Nuclear Information System (INIS)

    Rothenberg, M.; Hanson, M.R.

    1988-01-01

    A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

  2. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Directory of Open Access Journals (Sweden)

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  3. Long-term safety and efficacy of AAV gene therapy in the canine model of glycogen storage disease type Ia.

    Science.gov (United States)

    Lee, Young Mok; Conlon, Thomas J; Specht, Andrew; Coleman, Kirsten E; Brown, Laurie M; Estrella, Ana M; Dambska, Monika; Dahlberg, Kathryn R; Weinstein, David A

    2018-05-25

    Viral mediated gene therapy has progressed after overcoming early failures, and gene therapy has now been approved for several conditions in Europe and the USA. Glycogen storage disease (GSD) type Ia, caused by a deficiency of glucose-6-phosphatase-α, has been viewed as an outstanding candidate for gene therapy. This follow-up report describes the long-term outcome for the naturally occurring GSD-Ia dogs treated with rAAV-GPE-hG6PC-mediated gene therapy. A total of seven dogs were treated with rAAV-GPE-hG6PC-mediated gene therapy. The first four dogs were treated at birth, and three dogs were treated between 2 and 6 months of age to assess the efficacy and safety in animals with mature livers. Blood and urine samples, radiographic studies, histological evaluation, and biodistribution were assessed. Gene therapy improved survival in the GSD-Ia dogs. With treatment, the biochemical studies normalized for the duration of the study (up to 7 years). None of the rAAV-GPE-hG6PC-treated dogs had focal hepatic lesions or renal abnormalities. Dogs treated at birth required a second dose of rAAV after 2-4 months; gene therapy after hepatic maturation resulted in improved efficacy after a single dose. rAAV-GPE-hG6PC treatment in GSD-Ia dogs was found to be safe and efficacious. GSD-Ia is an attractive target for human gene therapy since it is a monogenic disorder with limited tissue involvement. Blood glucose and lactate monitoring can be used to assess effectiveness and as a biomarker of success. GSD-Ia can also serve as a model for other hepatic monogenic disorders.

  4. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  5. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  6. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  7. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    Science.gov (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  8. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated ... specific human leukocyte antigen alleles that seem to be ... prevents the contractions of the uterine myometrium directly or by an ... an anatomical factor, to avoid this possible bias all candidates.

  9. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  10. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.

  11. Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.

  12. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  13. Dysfunctional Muscle and Liver Glycogen Metabolism in mdx Dystrophic Mice

    Science.gov (United States)

    Stapleton, David I.; Lau, Xianzhong; Flores, Marcelo; Trieu, Jennifer; Gehrig, Stefan M.; Chee, Annabel; Naim, Timur; Lynch, Gordon S.; Koopman, René

    2014-01-01

    Background Duchenne muscular dystrophy (DMD) is a severe, genetic muscle wasting disorder characterised by progressive muscle weakness. DMD is caused by mutations in the dystrophin (dmd) gene resulting in very low levels or a complete absence of the dystrophin protein, a key structural element of muscle fibres which is responsible for the proper transmission of force. In the absence of dystrophin, muscle fibres become damaged easily during contraction resulting in their degeneration. DMD patients and mdx mice (an animal model of DMD) exhibit altered metabolic disturbances that cannot be attributed to the loss of dystrophin directly. We tested the hypothesis that glycogen metabolism is defective in mdx dystrophic mice. Results Dystrophic mdx mice had increased skeletal muscle glycogen (79%, (Pglycogen synthesis is initiated by glycogenin, the expression of which was increased by 50% in mdx mice (PGlycogen synthase activity was 12% higher (Pglycogen branching enzyme activity was 70% lower (Pglycogen breakdown, glycogen phosphorylase, had 62% lower activity (Pglycogen debranching enzyme expression was 50% higher (Pglycogen (Pglycogen metabolism in mdx mice identified reduced glycogenin protein expression (46% less; Pglycogen but reduced amounts of liver glycogen. PMID:24626262

  14. Reduced plasma adiponectin concentrations may contribute to impaired insulin activation of glycogen synthase in skeletal muscle of patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Højlund, K.; Frystyk, J.; Levin, K.

    2006-01-01

    AIMS/HYPOTHESIS: Circulating levels of adiponectin are negatively associated with multiple indices of insulin resistance, and the concentration is reduced in humans with insulin resistance and type 2 diabetes. However, the mechanisms by which adiponectin improves insulin sensitivity remain unclear...... (ten lean, 21 obese and 20 with type 2 diabetes). RESULTS: Plasma adiponectin was significantly reduced in type 2 diabetic compared with obese and lean subjects. In lean and obese subjects, insulin significantly reduced plasma adiponectin, but this response was blunted in patients with type 2 diabetes...... by improving the capacity to switch from lipid to glucose oxidation and to store glucose as glycogen in response to insulin, and that low adiponectin may contribute to impaired insulin activation of GS in skeletal muscle of patients with type 2 diabetes....

  15. Brain glycogen

    DEFF Research Database (Denmark)

    Obel, Linea Lykke Frimodt; Müller, Margit S; Walls, Anne B

    2012-01-01

    Glycogen is a complex glucose polymer found in a variety of tissues, including brain, where it is localized primarily in astrocytes. The small quantity found in brain compared to e.g., liver has led to the understanding that brain glycogen is merely used during hypoglycemia or ischemia....... In this review evidence is brought forward highlighting what has been an emerging understanding in brain energy metabolism: that glycogen is more than just a convenient way to store energy for use in emergencies-it is a highly dynamic molecule with versatile implications in brain function, i.e., synaptic...... activity and memory formation. In line with the great spatiotemporal complexity of the brain and thereof derived focus on the basis for ensuring the availability of the right amount of energy at the right time and place, we here encourage a closer look into the molecular and subcellular mechanisms...

  16. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  17. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  18. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    Science.gov (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  19. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  20. Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2017-08-09

    Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

  1. Cordycepin (3'-deoxyadenosine) inhibits the growth of B16-BL6 mouse melanoma cells through the stimulation of adenosine A3 receptor followed by glycogen synthase kinase-3beta activation and cyclin D1 suppression.

    Science.gov (United States)

    Yoshikawa, Noriko; Yamada, Shizuo; Takeuchi, Chihiro; Kagota, Satomi; Shinozuka, Kazumasa; Kunitomo, Masaru; Nakamura, Kazuki

    2008-06-01

    Cordyceps sinensis, a parasitic fungus on the larvae of Lepidoptera, has been used as a traditional Chinese medicine. We previously reported that the growth of B16-BL6 mouse melanoma (B16-BL6) cells was inhibited by cordycepin (3'-deoxyadenosine), an active ingredient of C. sinensis, and its effect was antagonized by MRS1191, a selective adenosine A3 receptor antagonist. In this study, the radioligand binding assay using [125I]-AB-MECA (a selective adenosine A3 receptor agonist) has shown that B16-BL6 cells express adenosine A3 receptors and that cordycepin binds to these receptors. We also confirmed the involvement of adenosine A3 receptors in the action of cordycepin using MRS1523 and MRS1220, specific adenosine A3 receptor antagonists. Next, indirubin, a glycogen synthase kinase-3beta (GSK-3beta) inhibitor, antagonized the growth suppression induced by cordycepin. Furthermore, the level of cyclin D1 protein in B16-BL6 cells was decreased by cordycepin using Western blot analysis. In conclusion, this study demonstrated that cordycepin inhibits the proliferation of B16-BL6 cells by stimulating adenosine A3 receptors followed by the Wnt signaling pathway, including GSK-3beta activation and cyclin D1 inhibition.

  2. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  3. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Biomarker for Glycogen Storage Diseases

    Science.gov (United States)

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  5. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

    Science.gov (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

    2018-04-01

    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  7. Exercise Training-Induced Adaptations Associated with Increases in Skeletal Muscle Glycogen Content

    Science.gov (United States)

    Manabe, Yasuko; Gollisch, Katja S.C.; Holton, Laura; Kim, Young–Bum; Brandauer, Josef; Fujii, Nobuharu L.; Hirshman, Michael F.; Goodyear, Laurie J.

    2012-01-01

    Chronic exercise training results in numerous skeletal muscle adaptations, including increases in insulin sensitivity and glycogen content. To understand the mechanism for increased muscle glycogen, we studied the effects of exercise training on glycogen regulatory proteins in rat skeletal muscle. Female Sprague Dawley rats performed voluntary wheel running for 1, 4, or 7 weeks. After 7 weeks of training, insulin-stimulated glucose uptake was increased in epitrochlearis muscle. Compared to sedentary control rats, muscle glycogen did not change after 1 week of training, but increased significantly after 4 and 7 weeks. The increases in muscle glycogen were accompanied by elevated glycogen synthase activity and protein expression. To assess the regulation of glycogen synthase, we examined its major activator, protein phosphatase 1 (PP1), and its major deactivator, glycogen synthase kinase 3 (GSK3). Consistent with glycogen synthase activity, PP1 activity was unchanged after 1 week of training but significantly increased after 4 and 7 weeks of training. Protein expression of RGL(GM), another regulatory PP1 subunit, significantly decreased after 4 and 7 weeks of training. Unlike PP1, GSK3 phosphorylation did not follow the pattern of glycogen synthase activity. The ~40% decrease in GSK-3α phosphorylation after 1 week of exercise training persisted until 7 weeks and may function as a negative feedback to elevated glycogen. Our findings suggest that exercise training-induced increases in muscle glycogen content could be regulated by multiple mechanisms including enhanced insulin sensitivity, glycogen synthase expression, allosteric activation of glycogen synthase and PP1activity. PMID:23206309

  8. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  9. Brain insulin action augments hepatic glycogen synthesis without suppressing glucose production or gluconeogenesis in dogs

    Science.gov (United States)

    Ramnanan, Christopher J.; Saraswathi, Viswanathan; Smith, Marta S.; Donahue, E. Patrick; Farmer, Ben; Farmer, Tiffany D.; Neal, Doss; Williams, Philip E.; Lautz, Margaret; Mari, Andrea; Cherrington, Alan D.; Edgerton, Dale S.

    2011-01-01

    In rodents, acute brain insulin action reduces blood glucose levels by suppressing the expression of enzymes in the hepatic gluconeogenic pathway, thereby reducing gluconeogenesis and endogenous glucose production (EGP). Whether a similar mechanism is functional in large animals, including humans, is unknown. Here, we demonstrated that in canines, physiologic brain hyperinsulinemia brought about by infusion of insulin into the head arteries (during a pancreatic clamp to maintain basal hepatic insulin and glucagon levels) activated hypothalamic Akt, altered STAT3 signaling in the liver, and suppressed hepatic gluconeogenic gene expression without altering EGP or gluconeogenesis. Rather, brain hyperinsulinemia slowly caused a modest reduction in net hepatic glucose output (NHGO) that was attributable to increased net hepatic glucose uptake and glycogen synthesis. This was associated with decreased levels of glycogen synthase kinase 3β (GSK3β) protein and mRNA and with decreased glycogen synthase phosphorylation, changes that were blocked by hypothalamic PI3K inhibition. Therefore, we conclude that the canine brain senses physiologic elevations in plasma insulin, and that this in turn regulates genetic events in the liver. In the context of basal insulin and glucagon levels at the liver, this input augments hepatic glucose uptake and glycogen synthesis, reducing NHGO without altering EGP. PMID:21865644

  10. Glycogen and Glucose Metabolism Are Essential for Early Embryonic Development of the Red Flour Beetle Tribolium castaneum

    Science.gov (United States)

    Fraga, Amanda; Ribeiro, Lupis; Lobato, Mariana; Santos, Vitória; Silva, José Roberto; Gomes, Helga; da Cunha Moraes, Jorge Luiz; de Souza Menezes, Jackson

    2013-01-01

    Control of energy metabolism is an essential process for life. In insects, egg formation (oogenesis) and embryogenesis is dependent on stored molecules deposited by the mother or transcribed later by the zygote. In oviparous insects the egg becomes an isolated system after egg laying with all energy conversion taking place during embryogenesis. Previous studies in a few vector species showed a strong correlation of key morphogenetic events and changes in glucose metabolism. Here, we investigate glycogen and glucose metabolism in the red flour beetle Tribolium castaneum, an insect amenable to functional genomic studies. To examine the role of the key enzymes on glycogen and glucose regulation we cloned and analyzed the function of glycogen synthase kinase 3 (GSK-3) and hexokinase (HexA) genes during T. castaneum embryogenesis. Expression analysis via in situ hybridization shows that both genes are expressed only in the embryonic tissue, suggesting that embryonic and extra-embryonic cells display different metabolic activities. dsRNA adult female injection (parental RNAi) of both genes lead a reduction in egg laying and to embryonic lethality. Morphological analysis via DAPI stainings indicates that early development is impaired in Tc-GSK-3 and Tc-HexA1 RNAi embryos. Importantly, glycogen levels are upregulated after Tc-GSK-3 RNAi and glucose levels are upregulated after Tc-HexA1 RNAi, indicating that both genes control metabolism during embryogenesis and oogenesis, respectively. Altogether our results show that T. castaneum embryogenesis depends on the proper control of glucose and glycogen. PMID:23750237

  11. Lack of Glycogenin Causes Glycogen Accumulation and Muscle Function Impairment.

    Science.gov (United States)

    Testoni, Giorgia; Duran, Jordi; García-Rocha, Mar; Vilaplana, Francisco; Serrano, Antonio L; Sebastián, David; López-Soldado, Iliana; Sullivan, Mitchell A; Slebe, Felipe; Vilaseca, Marta; Muñoz-Cánoves, Pura; Guinovart, Joan J

    2017-07-05

    Glycogenin is considered essential for glycogen synthesis, as it acts as a primer for the initiation of the polysaccharide chain. Against expectations, glycogenin-deficient mice (Gyg KO) accumulate high amounts of glycogen in striated muscle. Furthermore, this glycogen contains no covalently bound protein, thereby demonstrating that a protein primer is not strictly necessary for the synthesis of the polysaccharide in vivo. Strikingly, in spite of the higher glycogen content, Gyg KO mice showed lower resting energy expenditure and less resistance than control animals when subjected to endurance exercise. These observations can be attributed to a switch of oxidative myofibers toward glycolytic metabolism. Mice overexpressing glycogen synthase in the muscle showed similar alterations, thus indicating that this switch is caused by the excess of glycogen. These results may explain the muscular defects of GSD XV patients, who lack glycogenin-1 and show high glycogen accumulation in muscle. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  13. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  14. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  15. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

    Science.gov (United States)

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

    2015-03-31

    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  16. A splice mutation in the PHKG1 gene causes high glycogen content and low meat quality in pig skeletal muscle.

    Directory of Open Access Journals (Sweden)

    Junwu Ma

    2014-10-01

    Full Text Available Glycolytic potential (GP in skeletal muscle is economically important in the pig industry because of its effect on pork processing yield. We have previously mapped a major quantitative trait loci (QTL for GP on chromosome 3 in a White Duroc × Erhualian F2 intercross. We herein performed a systems genetic analysis to identify the causal variant underlying the phenotype QTL (pQTL. We first conducted genome-wide association analyses in the F2 intercross and an F19 Sutai pig population. The QTL was then refined to an 180-kb interval based on the 2-LOD drop method. We then performed expression QTL (eQTL mapping using muscle transcriptome data from 497 F2 animals. Within the QTL interval, only one gene (PHKG1 has a cis-eQTL that was colocolizated with pQTL peaked at the same SNP. The PHKG1 gene encodes a catalytic subunit of the phosphorylase kinase (PhK, which functions in the cascade activation of glycogen breakdown. Deep sequencing of PHKG1 revealed a point mutation (C>A in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon. The aberrant transcript induces nonsense-mediated decay, leading to lower protein level and weaker enzymatic activity in affected animals. The mutation causes an increase of 43% in GP and a decrease of>20% in water-holding capacity of pork. These effects were consistent across the F2 and Sutai populations, as well as Duroc × (Landrace × Yorkshire hybrid pigs. The unfavorable allele exists predominantly in Duroc-derived pigs. The findings provide new insights into understanding risk factors affecting glucose metabolism, and would greatly contribute to the genetic improvement of meat quality in Duroc related pigs.

  17. A splice mutation in the PHKG1 gene causes high glycogen content and low meat quality in pig skeletal muscle.

    Science.gov (United States)

    Ma, Junwu; Yang, Jie; Zhou, Lisheng; Ren, Jun; Liu, Xianxian; Zhang, Hui; Yang, Bin; Zhang, Zhiyan; Ma, Huanban; Xie, Xianhua; Xing, Yuyun; Guo, Yuanmei; Huang, Lusheng

    2014-10-01

    Glycolytic potential (GP) in skeletal muscle is economically important in the pig industry because of its effect on pork processing yield. We have previously mapped a major quantitative trait loci (QTL) for GP on chromosome 3 in a White Duroc × Erhualian F2 intercross. We herein performed a systems genetic analysis to identify the causal variant underlying the phenotype QTL (pQTL). We first conducted genome-wide association analyses in the F2 intercross and an F19 Sutai pig population. The QTL was then refined to an 180-kb interval based on the 2-LOD drop method. We then performed expression QTL (eQTL) mapping using muscle transcriptome data from 497 F2 animals. Within the QTL interval, only one gene (PHKG1) has a cis-eQTL that was colocolizated with pQTL peaked at the same SNP. The PHKG1 gene encodes a catalytic subunit of the phosphorylase kinase (PhK), which functions in the cascade activation of glycogen breakdown. Deep sequencing of PHKG1 revealed a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon. The aberrant transcript induces nonsense-mediated decay, leading to lower protein level and weaker enzymatic activity in affected animals. The mutation causes an increase of 43% in GP and a decrease of>20% in water-holding capacity of pork. These effects were consistent across the F2 and Sutai populations, as well as Duroc × (Landrace × Yorkshire) hybrid pigs. The unfavorable allele exists predominantly in Duroc-derived pigs. The findings provide new insights into understanding risk factors affecting glucose metabolism, and would greatly contribute to the genetic improvement of meat quality in Duroc related pigs.

  18. The Mechanisms of Pharmacological Preconditioning of the Brain and the Comparative Efficacy of the Drugs — Direct- and Indirect-Acting Glycogen Synthase Kinase-3β Inhibitors: Experimental Study

    Directory of Open Access Journals (Sweden)

    V. V. Likhvantsev

    2012-01-01

    Full Text Available Objective: to investigate the activity of sevoflurane, dalargin, and lithium chloride in protecting the rat brain from total ischemia/reperfusion and to define whether the GSK=3^ deposphorylation contributes to the mechanism of pharmacological preconditioning. Materials and methods. Experiments were carried out on 80 male albino rats in which temporary circulatory arrest (CA was simulated by ligating the cardiovascular fascicle for 10 and 20 minutes. The animals were revived by mechanical ventilation external cardiac massage, and the intratracheal injection of adrenaline (epinephrine, Moscow Endocrinology Plant at a dose of 0.1 mg/kg. Animals were divided into 9 groups and sevorane (sevoflurane, Abbott Laboratories, dalargin (Microgen Research-and-Production Association, or lithium chloride (Sigma Chemical Co. were separately given with and without CA. Brain tissue homogenate specimens were obtained from euthanized animals. The concentration of total glycogen synthase kinase-3^ (GSK-3^ was colorimetrically determined using a Hitachi-557 spectrophotometer (Hitachi Ltd., Japan. The content of phosphorylated GSK-3/3 (pGSK-3^ in brain homogenate was estimated by Western blotting. Results. The total level of GSK-3^ in each group was similar (80—90 relative units and remained unchanged throughout each experiment. Twenty-minute ischemia maximally activated GSK-30 through dephosphorylation. Ten-minute ischemia elevated pGSK-3^ levels by more than 5 times as compared to the baseline value revealing the «training» effect. The quantity of pGSK-3^ was unchanged in the ischemia/perfusion group during sevoflurane insufflation and was decreased by 27% during dalargin administration. Conclusion. The experimental model of total ischemia provided evidence that the test drugs had a pharmacological preconditioning effect on brain neurons. According to their increasing effect, the drugs were arranged in the following order: dalargin < sevoflurane < lithium

  19. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  20. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  1. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  2. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Pathogenesis of growth failure and partial reversal with gene therapy in murine and canine Glycogen Storage Disease type Ia.

    Science.gov (United States)

    Brooks, Elizabeth Drake; Little, Dianne; Arumugam, Ramamani; Sun, Baodong; Curtis, Sarah; Demaster, Amanda; Maranzano, Michael; Jackson, Mark W; Kishnani, Priya; Freemark, Michael S; Koeberl, Dwight D

    2013-06-01

    Glycogen Storage Disease type Ia (GSD-Ia) in humans frequently causes delayed bone maturation, decrease in final adult height, and decreased growth velocity. This study evaluates the pathogenesis of growth failure and the effect of gene therapy on growth in GSD-Ia affected dogs and mice. Here we found that homozygous G6pase (-/-) mice with GSD-Ia have normal growth hormone (GH) levels in response to hypoglycemia, decreased insulin-like growth factor (IGF) 1 levels, and attenuated weight gain following administration of GH. Expression of hepatic GH receptor and IGF 1 mRNAs and hepatic STAT5 (phospho Y694) protein levels are reduced prior to and after GH administration, indicating GH resistance. However, restoration of G6Pase expression in the liver by treatment with adeno-associated virus 8 pseudotyped vector expressing G6Pase (AAV2/8-G6Pase) corrected body weight, but failed to normalize plasma IGF 1 in G6pase (-/-) mice. Untreated G6pase (-/-) mice also demonstrated severe delay of growth plate ossification at 12 days of age; those treated with AAV2/8-G6Pase at 14 days of age demonstrated skeletal dysplasia and limb shortening when analyzed radiographically at 6 months of age, in spite of apparent metabolic correction. Moreover, gene therapy with AAV2/9-G6Pase only partially corrected growth in GSD-Ia affected dogs as detected by weight and bone measurements and serum IGF 1 concentrations were persistently low in treated dogs. We also found that heterozygous GSD-Ia carrier dogs had decreased serum IGF 1, adult body weights and bone dimensions compared to wild-type littermates. In sum, these findings suggest that growth failure in GSD-Ia results, at least in part, from hepatic GH resistance. In addition, gene therapy improved growth in addition to promoting long-term survival in dogs and mice with GSD-Ia. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose.

    Science.gov (United States)

    Parrou, J L; Teste, M A; François, J

    1997-06-01

    It is well known that glycogen and trehalose accumulate in yeast under nutrient starvation or entering into the stationary phase of growth, and that high levels of trehalose are found in heat-shocked cells. However, effects of various types of stress on trehalose, and especially on glycogen, are poorly documented. Taking into account that almost all genes encoding the enzymes involved in the metabolism of these two reserve carbohydrates contain between one and several copies of the stress-responsive element (STRE), an investigation was made of the possibility of a link between the potential transcriptional induction of these genes and the accumulation of glycogen and trehalose under different stress conditions. Using transcriptional fusions, it was found that all these genes were induced in a similar fashion, although to various extents, by temperature, osmotic and oxidative stresses. Experiments performed with an msn2/msn4 double mutant proved that the transcriptional induction of the genes encoding glycogen synthase (GSY2) and trehalose-6-phosphate synthase (TPS1) was needed for the small increase in glycogen and trehalose upon exposure to a mild heat stress and salt shock. However, the extent of transcriptional activation of these genes upon stresses in wild-type strains was not correlated with a proportional rise in either glycogen or trehalose. The major explanation for this lack of correlation comes from the fact that genes encoding the enzymes of the biosynthetic and of the biodegradative pathways were almost equally induced. Hence, trehalose and glycogen accumulated to much higher levels in cells lacking neutral trehalose or glycogen phosphorylase exposed to stress conditions, which suggested that one of the major effects of stress in yeast is to induce a wasteful expenditure of energy by increasing the recycling of these molecules. We also found that transcriptional induction of STRE-controlled genes was abolished at temperatures above 40 degree C, while

  6. Regulation of glycogen metabolism by the CRE-1, RCO-1 and RCM-1 proteins in Neurospora crassa. The role of CRE-1 as the central transcriptional regulator.

    Science.gov (United States)

    Cupertino, Fernanda Barbosa; Virgilio, Stela; Freitas, Fernanda Zanolli; Candido, Thiago de Souza; Bertolini, Maria Célia

    2015-04-01

    The transcription factor CreA/Mig1/CRE-1 is a repressor protein that regulates the use of alternative carbon sources via a mechanism known as Carbon Catabolite Repression (CCR). In Saccharomyces cerevisiae, Mig1 recruits the complex Ssn6-Tup1, the Neurospora crassa RCM-1 and RCO-1 orthologous proteins, respectively, to bind to promoters of glucose-repressible genes. We have been studying the regulation of glycogen metabolism in N. crassa and the identification of the RCO-1 corepressor as a regulator led us to investigate the regulatory role of CRE-1 in this process. Glycogen content is misregulated in the rco-1(KO), rcm-1(RIP) and cre-1(KO) strains, and the glycogen synthase phosphorylation is decreased in all strains, showing that CRE-1, RCO-1 and RCM-1 proteins are involved in glycogen accumulation and in the regulation of GSN activity by phosphorylation. We also confirmed the regulatory role of CRE-1 in CCR and its nuclear localization under repressing condition in N. crassa. The expression of all glycogenic genes is misregulated in the cre-1(KO) strain, suggesting that CRE-1 also controls glycogen metabolism by regulating gene expression. The existence of a high number of the Aspergillus nidulans CreA motif (5'-SYGGRG-3') in the glycogenic gene promoters led us to analyze the binding of CRE-1 to some DNA motifs both in vitro by DNA gel shift and in vivo by ChIP-qPCR analysis. CRE-1 bound in vivo to all motifs analyzed demonstrating that it down-regulates glycogen metabolism by controlling gene expression and GSN phosphorylation. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Synthesis of glycogen from fructose in the presence of elevated levels of glycogen phosphorylase a in rat hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Massagué, J; Salavert, A; Guinovart, J J

    1980-03-20

    Incubation of hepatocytes with glucose promoted the increase in the glycogen synthase (-glucose 6-phosphate/+glucose 6-phosphate) activity ratio, the decrease in the levels of phosphorylase a and a marked increase in the intracellular glycogen level. Incubation with fructose alone promoted the simultaneous activation of glycogen synthase and increase in the levels of phosphorylase a. Strikingly, glycogen deposition occurred in spite of the elevated levels of phosphorylase a. When glucose and fructose were added to the media the activation of glycogen synthase was always higher than when the hexoses were added separately. On the other hand the effects on glycogen phosphorylase were a function of the relative concentrations of both sugars. Inactivation of glycogen phosphorylase occurred when the fructose to glucose ratio was low while activation took place when the ratio was high. The simultaneous presence of glucose and fructose resulted, in all cases, in an enhancement in the deposition of glycogen. The effects described were not limited to fructose as D-glyceraldehyde, dihydroxyacetone, L-sorbose, D-tagatose and sorbitol, compounds metabolically related to fructose, provoked the same behaviour.

  8. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  9. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  10. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  11. Convergence of glycogen synthase kinase 3β and GR signaling in response to fluoxetine treatment in chronically stressed female and male rats.

    Science.gov (United States)

    Mitic, Milos; Brkic, Zeljka; Lukic, Iva; Adzic, Miroslav

    2017-08-30

    Accumulating evidence strongly suggest that impaired glucocorticoid receptor (GR) signaling is involved in stress-related mood disorders, and nominate GR as a potential target for antidepressants (ADs). It is known that different classes of ADs affects the GR action via modifying its phosphorylation, while the mechanism through which ADs alter GR phosphorylation targeted by GSK3β, a kinase modulated via serotonin neurotransmission, are unclear. On this basis, we investigated whether GSK3β-GR signaling could be a convergence point of fluoxetine action on brain function and behavior, by examining its effect on GSK3β targeted-GR phosphorylation on threonine 171 (pGR171), and expression of GR-regulated genes in the hippocampus of female and male rats exposed to chronic isolation stress. Stress induced sex-specific GSK3β-targeted phosphorylation of pGR171 in the nucleus of the hippocampus of stressed animals. Namely, while in females stress triggered coupled action of GSK3β-pGR171 signaling, in males changes in pGR171 levels did not correspond to GSK3β activity. On the other hand, fluoxetine managed to up-regulate this pathway in sex-unbiased manner. Furthermore, fluoxetine reverted stress-induced changes in most of the analyzed genes in males, CRH, 5-HT1a and p11, while in females its effect was limited to CRH. These data further suggest that pGR171 signaling affects cellular localization of GR in response to chronic stress and fluoxetine in both sexes. Collectively, our results describe a novel convergence point between GR signaling and GSK3β pathway in rat hippocampus in response to stress and fluoxetine in both sexes and its involvement in fluoxetine-regulated brain function in males. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Activating the Wnt/β-Catenin Pathway for the Treatment of Melanoma--Application of LY2090314, a Novel Selective Inhibitor of Glycogen Synthase Kinase-3.

    Directory of Open Access Journals (Sweden)

    Jennifer M Atkinson

    Full Text Available It has previously been observed that a loss of β-catenin expression occurs with melanoma progression and that nuclear β-catenin levels are inversely proportional to cellular proliferation, suggesting that activation of the Wnt/β-catenin pathway may provide benefit for melanoma patients. In order to further probe this concept we tested LY2090314, a potent and selective small-molecule inhibitor with activity against GSK3α and GSK3β isoforms. In a panel of melanoma cell lines, nM concentrations of LY2090314 stimulated TCF/LEF TOPFlash reporter activity, stabilized β-catenin and elevated the expression of Axin2, a Wnt responsive gene and marker of pathway activation. Cytotoxicity assays revealed that melanoma cell lines are very sensitive to LY2090314 in vitro (IC50 ~10 nM after 72hr of treatment in contrast to other solid tumor cell lines (IC50 >10 uM as evidenced by caspase activation and PARP cleavage. Cell lines harboring mutant B-RAF or N-RAS were equally sensitive to LY2090314 as were those with acquired resistance to the BRAF inhibitor Vemurafenib. shRNA studies demonstrated that β-catenin stabilization is required for apoptosis following treatment with the GSK3 inhibitor since the sensitivity of melanoma cell lines to LY290314 could be overcome by β-catenin knockdown. We further demonstrate that in vivo, LY2090314 elevates Axin2 gene expression after a single dose and produces tumor growth delay in A375 melanoma xenografts with repeat dosing. The activity of LY2090314 in preclinical models suggests that the role of Wnt activators for the treatment of melanoma should be further explored.

  13. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  15. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  16. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  17. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Exposures to arsenite and methylarsonite produce insulin resistance and impair insulin-dependent glycogen metabolism in hepatocytes.

    Science.gov (United States)

    Zhang, Chongben; Fennel, Emily M J; Douillet, Christelle; Stýblo, Miroslav

    2017-12-01

    Environmental exposure to inorganic arsenic (iAs) has been shown to disturb glucose homeostasis, leading to diabetes. Previous laboratory studies have suggested several mechanisms that may underlie the diabetogenic effects of iAs exposure, including (i) inhibition of insulin signaling (leading to insulin resistance) in glucose metabolizing peripheral tissues, (ii) inhibition of insulin secretion by pancreatic β cells, and (iii) dysregulation of the methylation or expression of genes involved in maintenance of glucose or insulin metabolism and function. Published studies have also shown that acute or chronic iAs exposures may result in depletion of hepatic glycogen stores. However, effects of iAs on pathways and mechanisms that regulate glycogen metabolism in the liver have never been studied. The present study examined glycogen metabolism in primary murine hepatocytes exposed in vitro to arsenite (iAs 3+ ) or its methylated metabolite, methylarsonite (MAs 3+ ). The results show that 4-h exposures to iAs 3+ and MAs 3+ at concentrations as low as 0.5 and 0.2 µM, respectively, decreased glycogen content in insulin-stimulated hepatocytes by inhibiting insulin-dependent activation of glycogen synthase (GS) and by inducing activity of glycogen phosphorylase (GP). Further investigation revealed that both iAs 3+ and MAs 3+ inhibit insulin-dependent phosphorylation of protein kinase B/Akt, one of the mechanisms involved in the regulation of GS and GP by insulin. Thus, inhibition of insulin signaling (i.e., insulin resistance) is likely responsible for the dysregulation of glycogen metabolism in hepatocytes exposed to iAs 3+ and MAs 3+ . This study provides novel information about the mechanisms by which iAs exposure impairs glucose homeostasis, pointing to hepatic metabolism of glycogen as one of the targets.

  19. Glycogen metabolism in brain and neurons - astrocytes metabolic cooperation can be altered by pre- and neonatal lead (Pb) exposure.

    Science.gov (United States)

    Baranowska-Bosiacka, Irena; Falkowska, Anna; Gutowska, Izabela; Gąssowska, Magdalena; Kolasa-Wołosiuk, Agnieszka; Tarnowski, Maciej; Chibowska, Karina; Goschorska, Marta; Lubkowska, Anna; Chlubek, Dariusz

    2017-09-01

    Lead (Pb) is an environmental neurotoxin which particularly affects the developing brain but the molecular mechanism of its neurotoxicity still needs clarification. The aim of this paper was to examine whether pre- and neonatal exposure to Pb (concentration of Pb in rat offspring blood below the "threshold level") may affect the brain's energy metabolism in neurons and astrocytes via the amount of available glycogen. We investigated the glycogen concentration in the brain, as well as the expression of the key enzymes involved in glycogen metabolism in brain: glycogen synthase 1 (Gys1), glycogen phosphorylase (PYGM, an isoform active in astrocytes; and PYGB, an isoform active in neurons) and phosphorylase kinase β (PHKB). Moreover, the expression of connexin 43 (Cx43) was evaluated to analyze whether Pb poisoning during the early phase of life may affect the neuron-astrocytes' metabolic cooperation. This work shows for the first time that exposure to Pb in early life can impair brain energy metabolism by reducing the amount of glycogen and decreasing the rate of its metabolism. This reduction in brain glycogen level was accompanied by a decrease in Gys1 expression. We noted a reduction in the immunoreactivity and the gene expression of both PYGB and PYGM isoform, as well as an increase in the expression of PHKB in Pb-treated rats. Moreover, exposure to Pb induced decrease in connexin 43 immunoexpression in all the brain structures analyzed, both in astrocytes as well as in neurons. Our data suggests that exposure to Pb in the pre- and neonatal periods results in a decrease in the level of brain glycogen and a reduction in the rate of its metabolism, thereby reducing glucose availability, which as a further consequence may lead to the impairment of brain energy metabolism and the metabolic cooperation between neurons and astrocytes. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Leptin promotes osteoblast differentiation and mineralization of primary cultures of vascular smooth muscle cells by inhibiting glycogen synthase kinase (GSK)-3{beta}

    Energy Technology Data Exchange (ETDEWEB)

    Zeadin, Melec G.; Butcher, Martin K.; Shaughnessy, Stephen G. [Department of Medicine, McMaster University, Hamilton, ON (Canada); Thrombosis and Atherosclerosis Research Institute, Hamilton, ON (Canada); Werstuck, Geoff H., E-mail: Geoff.Werstuck@taari.ca [Department of Medicine, McMaster University, Hamilton, ON (Canada); Thrombosis and Atherosclerosis Research Institute, Hamilton, ON (Canada)

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer Leptin promotes osteoblast differentiation of primary smooth muscle cells. Black-Right-Pointing-Pointer Leptin regulates the expression of genes involved in osteoblast differentiation. Black-Right-Pointing-Pointer Constitutively active GSK-3{beta} attenuates leptin-induced osteoblast differentiation. Black-Right-Pointing-Pointer This suggests that leptin signals through GSK-3{beta} to promote osteoblast differentiation. -- Abstract: In this study, we begin to investigate the underlying mechanism of leptin-induced vascular calcification. We found that treatment of cultured bovine aortic smooth muscle cells (BASMCs) with leptin (0.5-4 {mu}g/ml) induced osteoblast differentiation in a dose-dependent manner. Furthermore, we found that leptin significantly increased the mRNA expression of osteopontin and bone sialoprotein, while down-regulating matrix gla protein (MGP) expression in BASMCs. Key factors implicated in osteoblast differentiation, including members of the Wnt signaling pathway, were examined. Exposure to leptin enhanced phosphorylation of GSK-3{beta} on serine-9 thereby inhibiting activity and promoting the nuclear accumulation of {beta}-catenin. Transfection of BASMCs with an adenovirus that expressed constitutively active GSK-3{beta} (Ad-GSK-3{beta} S9A) resulted in a >2-fold increase in GSK-3{beta} activity and a significant decrease in leptin-induced alkaline phosphatase (ALP) activity. In addition, qRT-PCR analysis showed that GSK-3{beta} activation resulted in a significant decrease in the expression of osteopontin and bone sialoprotein, but a marked increase in MGP mRNA expression. When taken together, our results suggest a mechanism by which leptin promotes osteoblast differentiation and vascular calcification in vivo.

  1. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  2. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    Science.gov (United States)

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  3. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

    Science.gov (United States)

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

    2016-11-01

    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

    Science.gov (United States)

    Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

    2007-10-01

    Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

  6. Determination of the Glycogen Content in Cyanobacteria.

    Science.gov (United States)

    De Porcellinis, Alice; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

    2017-07-17

    Cyanobacteria accumulate glycogen as a major intracellular carbon and energy storage during photosynthesis. Recent developments in research have highlighted complex mechanisms of glycogen metabolism, including the diel cycle of biosynthesis and catabolism, redox regulation, and the involvement of non-coding RNA. At the same time, efforts are being made to redirect carbon from glycogen to desirable products in genetically engineered cyanobacteria to enhance product yields. Several methods are used to determine the glycogen contents in cyanobacteria, with variable accuracies and technical complexities. Here, we provide a detailed protocol for the reliable determination of the glycogen content in cyanobacteria that can be performed in a standard life science laboratory. The protocol entails the selective precipitation of glycogen from the cell lysate and the enzymatic depolymerization of glycogen to generate glucose monomers, which are detected by a glucose oxidase-peroxidase (GOD-POD) enzyme coupled assay. The method has been applied to Synechocystis sp. PCC 6803 and Synechococcus sp. PCC 7002, two model cyanobacterial species that are widely used in metabolic engineering. Moreover, the method successfully showed differences in the glycogen contents between the wildtype and mutants defective in regulatory elements or glycogen biosynthetic genes.

  7. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang

    2018-01-01

    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  8. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  9. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  10. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  11. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  12. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    Science.gov (United States)

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  13. Neuronal glycogen synthesis contributes to physiological aging.

    Science.gov (United States)

    Sinadinos, Christopher; Valles-Ortega, Jordi; Boulan, Laura; Solsona, Estel; Tevy, Maria F; Marquez, Mercedes; Duran, Jordi; Lopez-Iglesias, Carmen; Calbó, Joaquim; Blasco, Ester; Pumarola, Marti; Milán, Marco; Guinovart, Joan J

    2014-10-01

    Glycogen is a branched polymer of glucose and the carbohydrate energy store for animal cells. In the brain, it is essentially found in glial cells, although it is also present in minute amounts in neurons. In humans, loss-of-function mutations in laforin and malin, proteins involved in suppressing glycogen synthesis, induce the presence of high numbers of insoluble polyglucosan bodies in neuronal cells. Known as Lafora bodies (LBs), these deposits result in the aggressive neurodegeneration seen in Lafora's disease. Polysaccharide-based aggregates, called corpora amylacea (CA), are also present in the neurons of aged human brains. Despite the similarity of CA to LBs, the mechanisms and functional consequences of CA formation are yet unknown. Here, we show that wild-type laboratory mice also accumulate glycogen-based aggregates in the brain as they age. These structures are immunopositive for an array of metabolic and stress-response proteins, some of which were previously shown to aggregate in correlation with age in the human brain and are also present in LBs. Remarkably, these structures and their associated protein aggregates are not present in the aged mouse brain upon genetic ablation of glycogen synthase. Similar genetic intervention in Drosophila prevents the accumulation of glycogen clusters in the neuronal processes of aged flies. Most interestingly, targeted reduction of Drosophila glycogen synthase in neurons improves neurological function with age and extends lifespan. These results demonstrate that neuronal glycogen accumulation contributes to physiological aging and may therefore constitute a key factor regulating age-related neurological decline in humans. © 2014 The Authors. Aging cell published by the Anatomical Society and John Wiley & Sons Ltd.

  14. Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Lin-Hui Gao

    2018-01-01

    Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

  15. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

    Science.gov (United States)

    Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

    2008-08-01

    Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

  16. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  17. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Science.gov (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  18. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  19. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  20. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  1. The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

    Science.gov (United States)

    Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

    2018-05-11

    Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

  2. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  3. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  4. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  5. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  6. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    International Nuclear Information System (INIS)

    Ge Shimei; Xie Baoen; Chen Sanfeng

    2006-01-01

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

  7. Muscle Glycogen Remodeling and Glycogen Phosphate Metabolism following Exhaustive Exercise of Wild Type and Laforin Knockout Mice*

    Science.gov (United States)

    Irimia, Jose M.; Tagliabracci, Vincent S.; Meyer, Catalina M.; Segvich, Dyann M.; DePaoli-Roach, Anna A.; Roach, Peter J.

    2015-01-01

    Glycogen, the repository of glucose in many cell types, contains small amounts of covalent phosphate, of uncertain function and poorly understood metabolism. Loss-of-function mutations in the laforin gene cause the fatal neurodegenerative disorder, Lafora disease, characterized by increased glycogen phosphorylation and the formation of abnormal deposits of glycogen-like material called Lafora bodies. It is generally accepted that the phosphate is removed by the laforin phosphatase. To study the dynamics of skeletal muscle glycogen phosphorylation in vivo under physiological conditions, mice were subjected to glycogen-depleting exercise and then monitored while they resynthesized glycogen. Depletion of glycogen by exercise was associated with a substantial reduction in total glycogen phosphate and the newly resynthesized glycogen was less branched and less phosphorylated. Branching returned to normal on a time frame of days, whereas phosphorylation remained suppressed over a longer period of time. We observed no change in markers of autophagy. Exercise of 3-month-old laforin knock-out mice caused a similar depletion of glycogen but no loss of glycogen phosphate. Furthermore, remodeling of glycogen to restore the basal branching pattern was delayed in the knock-out animals. From these results, we infer that 1) laforin is responsible for glycogen dephosphorylation during exercise and acts during the cytosolic degradation of glycogen, 2) excess glycogen phosphorylation in the absence of laforin delays the normal remodeling of the branching structure, and 3) the accumulation of glycogen phosphate is a relatively slow process involving multiple cycles of glycogen synthesis-degradation, consistent with the slow onset of the symptoms of Lafora disease. PMID:26216881

  8. Lack of liver glycogen causes hepatic insulin resistance and steatosis in mice.

    Science.gov (United States)

    Irimia, Jose M; Meyer, Catalina M; Segvich, Dyann M; Surendran, Sneha; DePaoli-Roach, Anna A; Morral, Nuria; Roach, Peter J

    2017-06-23

    Disruption of the Gys2 gene encoding the liver isoform of glycogen synthase generates a mouse strain (LGSKO) that almost completely lacks hepatic glycogen, has impaired glucose disposal, and is pre-disposed to entering the fasted state. This study investigated how the lack of liver glycogen increases fat accumulation and the development of liver insulin resistance. Insulin signaling in LGSKO mice was reduced in liver, but not muscle, suggesting an organ-specific defect. Phosphorylation of components of the hepatic insulin-signaling pathway, namely IRS1, Akt, and GSK3, was decreased in LGSKO mice. Moreover, insulin stimulation of their phosphorylation was significantly suppressed, both temporally and in an insulin dose response. Phosphorylation of the insulin-regulated transcription factor FoxO1 was somewhat reduced and insulin treatment did not elicit normal translocation of FoxO1 out of the nucleus. Fat overaccumulated in LGSKO livers, showing an aberrant distribution in the acinus, an increase not explained by a reduction in hepatic triglyceride export. Rather, when administered orally to fasted mice, glucose was directed toward hepatic lipogenesis as judged by the activity, protein levels, and expression of several fatty acid synthesis genes, namely, acetyl-CoA carboxylase, fatty acid synthase, SREBP1c, chREBP, glucokinase, and pyruvate kinase. Furthermore, using cultured primary hepatocytes, we found that lipogenesis was increased by 40% in LGSKO cells compared with controls. Of note, the hepatic insulin resistance was not associated with increased levels of pro-inflammatory markers. Our results suggest that loss of liver glycogen synthesis diverts glucose toward fat synthesis, correlating with impaired hepatic insulin signaling and glucose disposal. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Glycogen metabolism in humans

    OpenAIRE

    Adeva-Andany, María M.; González-Lucán, Manuel; Donapetry-García, Cristóbal; Fernández-Fernández, Carlos; Ameneiros-Rodríguez, Eva

    2016-01-01

    In the human body, glycogen is a branched polymer of glucose stored mainly in the liver and the skeletal muscle that supplies glucose to the blood stream during fasting periods and to the muscle cells during muscle contraction. Glycogen has been identified in other tissues such as brain, heart, kidney, adipose tissue, and erythrocytes, but glycogen function in these tissues is mostly unknown. Glycogen synthesis requires a series of reactions that include glucose entrance into the cell through...

  10. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  11. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

    Directory of Open Access Journals (Sweden)

    Marcelo Paschoalete Carlin

    2013-01-01

    Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  12. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  13. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  14. POLYMORPHISMS OF ENDOTHELIAL NITRIC OXIDE SYNTHASE GENE AS PREDICTORS OF WOLFF-PARKINSON-WHITE SYNDROME

    Directory of Open Access Journals (Sweden)

    G. V. Matyushin

    2017-01-01

    Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

  15. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  16. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  17. Investigation and management of the hepatic glycogen storage diseases.

    Science.gov (United States)

    Bhattacharya, Kaustuv

    2015-07-01

    The glycogen storage diseases (GSD) comprise a group of disorders that involve the disruption of metabolism of glycogen. Glycogen is stored in various organs including skeletal muscle, the kidneys and liver. The liver stores glycogen to supply the rest of the body with glucose when required. Therefore, disruption of this process can lead to hypoglycaemia. If glycogen is not broken down effectively, this can lead to hepatomegaly. Glycogen synthase deficiency leads to impaired glycogen synthesis and consequently the liver is small. Glycogen brancher deficiency can lead to abnormal glycogen being stored in the liver leading to a quite different disorder of progressive liver dysfunction. Understanding the physiology of GSD I, III, VI and IX guides dietary treatments and the provision of appropriate amounts and types of carbohydrates. There has been recent re-emergence in the literature of the use of ketones in therapy, either in the form of the salt D,L-3-hydroxybutyrate or medium chain triglyceride (MCT). High protein diets have also been advocated. Alternative waxy maize based starches seem to show promising early data of efficacy. There are many complications of each of these disorders and they need to be prospectively surveyed and managed. Liver and kidney transplantation is still indicated in severe refractory disease.

  18. Abnormal Glycogen Storage by Retinal Neurons in Diabetes.

    Science.gov (United States)

    Gardiner, Tom A; Canning, Paul; Tipping, Nuala; Archer, Desmond B; Stitt, Alan W

    2015-12-01

    It is widely held that neurons of the central nervous system do not store glycogen and that accumulation of the polysaccharide may cause neurodegeneration. Since primary neural injury occurs in diabetic retinopathy, we examined neuronal glycogen status in the retina of streptozotocin-induced diabetic and control rats. Glycogen was localized in eyes of streptozotocin-induced diabetic and control rats using light microscopic histochemistry and electron microscopy, and correlated with immunohistochemical staining for glycogen phosphorylase and phosphorylated glycogen synthase (pGS). Electron microscopy of 2-month-old diabetic rats (n = 6) showed massive accumulations of glycogen in the perinuclear cytoplasm of many amacrine neurons. In 4-month-old diabetic rats (n = 11), quantification of glycogen-engorged amacrine cells showed a mean of 26 cells/mm of central retina (SD ± 5), compared to 0.5 (SD ± 0.2) in controls (n = 8). Immunohistochemical staining for glycogen phosphorylase revealed strong expression in amacrine and ganglion cells of control retina, and increased staining in cell processes of the inner plexiform layer in diabetic retina. In control retina, the inactive pGS was consistently sequestered within the cell nuclei of all retinal neurons and the retinal pigment epithelium (RPE), but in diabetics nuclear pGS was reduced or lost in all classes of retinal cell except the ganglion cells and cone photoreceptors. The present study identifies a large population of retinal neurons that normally utilize glycogen metabolism but show pathologic storage of the polysaccharide during uncontrolled diabetes.

  19. Molecular Basis of Impaired Glycogen Metabolism during Ischemic Stroke and Hypoxia

    Science.gov (United States)

    Hossain, Mohammed Iqbal; Roulston, Carli Lorraine; Stapleton, David Ian

    2014-01-01

    Background Ischemic stroke is the combinatorial effect of many pathological processes including the loss of energy supplies, excessive intracellular calcium accumulation, oxidative stress, and inflammatory responses. The brain's ability to maintain energy demand through this process involves metabolism of glycogen, which is critical for release of stored glucose. However, regulation of glycogen metabolism in ischemic stroke remains unknown. In the present study, we investigate the role and regulation of glycogen metabolizing enzymes and their effects on the fate of glycogen during ischemic stroke. Results Ischemic stroke was induced in rats by peri-vascular application of the vasoconstrictor endothelin-1 and forebrains were collected at 1, 3, 6 and 24 hours post-stroke. Glycogen levels and the expression and activity of enzymes involved in glycogen metabolism were analyzed. We found elevated glycogen levels in the ipsilateral hemispheres compared with contralateral hemispheres at 6 and 24 hours (25% and 39% increase respectively; PGlycogen synthase activity and glycogen branching enzyme expression were found to be similar between the ipsilateral, contralateral, and sham control hemispheres. In contrast, the rate-limiting enzyme for glycogen breakdown, glycogen phosphorylase, had 58% lower activity (Pglycogen debranching enzyme expression 24 hours post-stroke was 77% (Pglycogen phosphorylase activity and increased glycogen accumulation but did not alter glycogen synthase activity. Furthermore, elevated glycogen levels provided metabolic support to astrocytes during hypoxia. Conclusion Our study has identified that glycogen breakdown is impaired during ischemic stroke, the molecular basis of which includes reduced glycogen debranching enzyme expression level together with reduced glycogen phosphorylase and PKA activity. PMID:24858129

  20. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  1. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    Science.gov (United States)

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  3. Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.

    Science.gov (United States)

    Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E

    2016-11-01

    Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  4. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

    Science.gov (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

    2001-09-01

    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  5. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  6. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  7. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  8. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

  9. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  10. Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population.

    Science.gov (United States)

    Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja

    2017-07-01

    The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  12. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  13. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  14. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  15. Novel method for detection of glycogen in cells.

    Science.gov (United States)

    Skurat, Alexander V; Segvich, Dyann M; DePaoli-Roach, Anna A; Roach, Peter J

    2017-05-01

    Glycogen, a branched polymer of glucose, functions as an energy reserve in many living organisms. Abnormalities in glycogen metabolism, usually excessive accumulation, can be caused genetically, most often through mutation of the enzymes directly involved in synthesis and degradation of the polymer leading to a variety of glycogen storage diseases (GSDs). Microscopic visualization of glycogen deposits in cells and tissues is important for the study of normal glycogen metabolism as well as diagnosis of GSDs. Here, we describe a method for the detection of glycogen using a renewable, recombinant protein which contains the carbohydrate-binding module (CBM) from starch-binding domain containing protein 1 (Stbd1). We generated a fusion protein containing g lutathione S-transferase, a cM c eptitope and the tbd1 BM (GYSC) for use as a glycogen-binding probe, which can be detected with secondary antibodies against glutathione S-transferase or cMyc. By enzyme-linked immunosorbent assay, we demonstrate that GYSC binds glycogen and two other polymers of glucose, amylopectin and amylose. Immunofluorescence staining of cultured cells indicate a GYSC-specific signal that is co-localized with signals obtained with anti-glycogen or anti-glycogen synthase antibodies. GYSC-positive staining inside of lysosomes is observed in individual muscle fibers isolated from mice deficient in lysosomal enzyme acid alpha-glucosidase, a well-characterized model of GSD II (Pompe disease). Co-localized GYSC and glycogen signals are also found in muscle fibers isolated from mice deficient in malin, a model for Lafora disease. These data indicate that GYSC is a novel probe that can be used to study glycogen metabolism under normal and pathological conditions. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  16. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

    Science.gov (United States)

    Oberding, Lisa K; Gieg, Lisa M

    2018-01-01

    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  17. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

  18. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  19. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    Science.gov (United States)

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  1. Glycogen depletion and resynthesis during 14 days of chronic low-frequency stimulation of rabbit muscle

    DEFF Research Database (Denmark)

    Prats, C; Bernal, C; Cadefau, J A

    2002-01-01

    Electro-stimulation alters muscle metabolism and the extent of this change depends on application intensity and duration. The effect of 14 days of chronic electro-stimulation on glycogen turnover and on the regulation of glycogen synthase in fast-twitch muscle was studied. The results showed that...

  2. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

    Science.gov (United States)

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-09-06

    Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

  3. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  4. Glycogen supercompensation in rat soleus muscle during recovery from nonweight bearing

    Science.gov (United States)

    Henriksen, Erik J.; Kirby, Christopher R.; Tischler, Marc E.

    1989-01-01

    Events leading to the normalization of the glycogen metabolism in the soleus muscle of rat, altered by 72-h three days of hind-limb suspension, were investigated during the 72-h recovery period when the animals were allowed to bear weight on all four limbs. Relative importance of the factors affecting glycogen metabolism in skeletal muscle during the recovery period was also examined. Glycogen concentration was found to decrease within 15 min and up to 2 h of recovery, while muscle glucose 6-phosphate, and the fractional activities of glycogen phosphorylase and glycogen synthase increased. From 2 to 4 h, when the glycogen synthase activity remained elevated and the phosphorylase activity declined, glycogen concentration increased, until it reached maximum values at about 24 h, after which it started to decrease, reaching control values by 72 h. At 12 and 24 h, the inverse relationship between glycogen concentration and the synthase activity ratio was lost, indicating that the reloading transiently uncoupled glycogen control of this enzyme.

  5. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Glycogen and glucose metabolism are essential for early embryonic development of the red flour beetle Tribolium castaneum.

    Directory of Open Access Journals (Sweden)

    Amanda Fraga

    Full Text Available Control of energy metabolism is an essential process for life. In insects, egg formation (oogenesis and embryogenesis is dependent on stored molecules deposited by the mother or transcribed later by the zygote. In oviparous insects the egg becomes an isolated system after egg laying with all energy conversion taking place during embryogenesis. Previous studies in a few vector species showed a strong correlation of key morphogenetic events and changes in glucose metabolism. Here, we investigate glycogen and glucose metabolism in the red flour beetle Tribolium castaneum, an insect amenable to functional genomic studies. To examine the role of the key enzymes on glycogen and glucose regulation we cloned and analyzed the function of glycogen synthase kinase 3 (GSK-3 and hexokinase (HexA genes during T. castaneum embryogenesis. Expression analysis via in situ hybridization shows that both genes are expressed only in the embryonic tissue, suggesting that embryonic and extra-embryonic cells display different metabolic activities. dsRNA adult female injection (parental RNAi of both genes lead a reduction in egg laying and to embryonic lethality. Morphological analysis via DAPI stainings indicates that early development is impaired in Tc-GSK-3 and Tc-HexA1 RNAi embryos. Importantly, glycogen levels are upregulated after Tc-GSK-3 RNAi and glucose levels are upregulated after Tc-HexA1 RNAi, indicating that both genes control metabolism during embryogenesis and oogenesis, respectively. Altogether our results show that T. castaneum embryogenesis depends on the proper control of glucose and glycogen.

  7. Glycogen metabolism in the glucose-sensing and supply-driven β-cell.

    Science.gov (United States)

    Andersson, Lotta E; Nicholas, Lisa M; Filipsson, Karin; Sun, Jiangming; Medina, Anya; Al-Majdoub, Mahmoud; Fex, Malin; Mulder, Hindrik; Spégel, Peter

    2016-12-01

    Glycogen metabolism in β-cells may affect downstream metabolic pathways controlling insulin release. We examined glycogen metabolism in human islets and in the rodent-derived INS-1 832/13 β-cells and found them to express the same isoforms of key enzymes required for glycogen metabolism. Our findings indicate that glycogenesis is insulin-independent but influenced by extracellular glucose concentrations. Levels of glycogen synthase decrease with increasing glucose concentrations, paralleling accumulation of glycogen. We did not find cAMP-elicited glycogenolysis and insulin secretion to be causally related. In conclusion, our results reveal regulated glycogen metabolism in human islets and insulin-secreting cells. Whether glycogen metabolism affects insulin secretion under physiological conditions remains to be determined. © 2016 Federation of European Biochemical Societies.

  8. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  9. Molecular cloning of a novel GSK3/shaggy-like gene from Triticum ...

    African Journals Online (AJOL)

    The deduced amino acid sequence showed a high homology with shaggy-like kinases from Triticum aestivum, Zea mays, Trifolium repens, Nicotine tabacum, Medicago sativa and Arabidopsis thaliana; therefore, the gene was named TmGSK1 (Triticum monococcum Glycogen Synthase Kinase 1,GenBank Accession No.

  10. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

  11. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    OpenAIRE

    Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  12. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  13. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  14. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    Science.gov (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

    2008-01-01

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  17. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  18. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)

    uwerhiavwe

    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  19. Factors influencing gene silencing of granule-bound starch synthase in potato

    NARCIS (Netherlands)

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

  20. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.

    2004-01-01

    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  1. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  2. An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

    Science.gov (United States)

    Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

  3. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

    NARCIS (Netherlands)

    Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

    2000-01-01

    The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

  4. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  5. A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105

    Directory of Open Access Journals (Sweden)

    Hiroaki Iwasaka

    2018-04-01

    Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.

  6. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  7. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

    2014-01-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  8. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  9. Variations in Glycogen Synthesis in Human Pluripotent Stem Cells with Altered Pluripotent States

    Science.gov (United States)

    Chen, Richard J.; Zhang, Guofeng; Garfield, Susan H.; Shi, Yi-Jun; Chen, Kevin G.; Robey, Pamela G.; Leapman, Richard D.

    2015-01-01

    Human pluripotent stem cells (hPSCs) represent very promising resources for cell-based regenerative medicine. It is essential to determine the biological implications of some fundamental physiological processes (such as glycogen metabolism) in these stem cells. In this report, we employ electron, immunofluorescence microscopy, and biochemical methods to study glycogen synthesis in hPSCs. Our results indicate that there is a high level of glycogen synthesis (0.28 to 0.62 μg/μg proteins) in undifferentiated human embryonic stem cells (hESCs) compared with the glycogen levels (0 to 0.25 μg/μg proteins) reported in human cancer cell lines. Moreover, we found that glycogen synthesis was regulated by bone morphogenetic protein 4 (BMP-4) and the glycogen synthase kinase 3 (GSK-3) pathway. Our observation of glycogen bodies and sustained expression of the pluripotent factor Oct-4 mediated by the potent GSK-3 inhibitor CHIR-99021 reveals an altered pluripotent state in hPSC culture. We further confirmed glycogen variations under different naïve pluripotent cell growth conditions based on the addition of the GSK-3 inhibitor BIO. Our data suggest that primed hPSCs treated with naïve growth conditions acquire altered pluripotent states, similar to those naïve-like hPSCs, with increased glycogen synthesis. Furthermore, we found that suppression of phosphorylated glycogen synthase was an underlying mechanism responsible for altered glycogen synthesis. Thus, our novel findings regarding the dynamic changes in glycogen metabolism provide new markers to assess the energetic and various pluripotent states in hPSCs. The components of glycogen metabolic pathways offer new assays to delineate previously unrecognized properties of hPSCs under different growth conditions. PMID:26565809

  10. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound....

  11. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  12. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  13. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    Science.gov (United States)

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

  14. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  15. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

    2017-11-03

    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  16. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  17. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    Science.gov (United States)

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  19. Rerouting of carbon flux in a glycogen mutant of cyanobacteria assessed via isotopically non-stationary 13 C metabolic flux analysis.

    Science.gov (United States)

    Hendry, John I; Prasannan, Charulata; Ma, Fangfang; Möllers, K Benedikt; Jaiswal, Damini; Digmurti, Madhuri; Allen, Doug K; Frigaard, Niels-Ulrik; Dasgupta, Santanu; Wangikar, Pramod P

    2017-10-01

    Cyanobacteria, which constitute a quantitatively dominant phylum, have attracted attention in biofuel applications due to favorable physiological characteristics, high photosynthetic efficiency and amenability to genetic manipulations. However, quantitative aspects of cyanobacterial metabolism have received limited attention. In the present study, we have performed isotopically non-stationary 13 C metabolic flux analysis (INST- 13 C-MFA) to analyze rerouting of carbon in a glycogen synthase deficient mutant strain (glgA-I glgA-II) of the model cyanobacterium Synechococcus sp. PCC 7002. During balanced photoautotrophic growth, 10-20% of the fixed carbon is stored in the form of glycogen via a pathway that is conserved across the cyanobacterial phylum. Our results show that deletion of glycogen synthase gene orchestrates cascading effects on carbon distribution in various parts of the metabolic network. Carbon that was originally destined to be incorporated into glycogen gets partially diverted toward alternate storage molecules such as glucosylglycerol and sucrose. The rest is partitioned within the metabolic network, primarily via glycolysis and tricarboxylic acid cycle. A lowered flux toward carbohydrate synthesis and an altered distribution at the glucose-1-phosphate node indicate flexibility in the network. Further, reversibility of glycogen biosynthesis reactions points toward the presence of futile cycles. Similar redistribution of carbon was also predicted by Flux Balance Analysis. The results are significant to metabolic engineering efforts with cyanobacteria where fixed carbon needs to be re-routed to products of interest. Biotechnol. Bioeng. 2017;114: 2298-2308. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

    Science.gov (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

    2005-06-01

    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  1. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  2. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hansen, K.; Szabo, Peter

    2003-01-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3...... broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. (C) 2003 Wiley Periodicals, Inc....

  3. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline

    2011-01-01

    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  4. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  5. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  6. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.)

    Science.gov (United States)

    Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.

    2006-01-01

    Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870

  7. Functional consequences of brain glycogen deficiency on the sleep-wake cycle regulation in PTG-KO mice

    KAUST Repository

    Burlet-Godinot, S.

    2017-12-31

    Introduction: In the CNS, glycogen is mainly localized in astrocytes where its levels are linked to neuronal activity. Astrocytic glycogen synthesis is regulated by glycogen synthase (GS) activity that is positively controlled by protein targeting to glycogen (PTG) expression levels. Although the role of glycogen in sleep/wake regulation is still poorly understood, we have previously demonstrated that, following a 6 hour gentle sleep deprivation (GSD), PTG mRNA expression and GS activity increased in the brain in mice while glycogen levels were paradoxically maintained and not affected. In order to gain further insight on the role of PTG in this process, we studied the sleep/wake cycle parameters in PTG knockout (PTG-KO) mice under baseline conditions and after a 6 hour GSD. Glycogen levels as well as mRNAs expression of genes related to energy metabolism were also determined in several brain areas. Materials and methods: Adult male C57BL/6J (WT) and PTG-KO mice were sleep-recorded under baseline conditions (24 h recordings, 12 h light/dark cycle) and following 6 hours GSD from ZT00 to ZT06. Vigilance states were visually scored (4 s temporal window). Spectral analysis of the EEG signal was performed using a discrete Fourier transformation. Glycogen measurements and gene expression analysis were assessed using a biochemical assay and quantitative RT-PCR respectively, on separate cohorts in WT vs PTG-KO mice at the end of the 6 hours GSD or in control animals (CTL) in different brain structures. Results: Quantitative analysis of the sleep/wake cycle under baseline conditions did not reveal major differences between the WT and the PTG-KO mice. However, during the dark period, the PTG-KO mice showed a significant increase in the number of wake and slow wave sleep episodes (respectively +26.5±8% and +26.1±8%; p< 0.05) together with a significant shortening in their duration (-21.6±7.2% and -14.3±2.8%; p< 0.01). No such quantitative changes were observed during

  8. Overexpression of the Anthocyanidin Synthase Gene in Strawberry Enhances Antioxidant Capacity and Cytotoxic Effects on Human Hepatic Cancer Cells.

    Science.gov (United States)

    Giampieri, Francesca; Gasparrini, Massimiliano; Forbes-Hernandez, Tamara Y; Mazzoni, Luca; Capocasa, Franco; Sabbadini, Silvia; Alvarez-Suarez, Josè M; Afrin, Sadia; Rosati, Carlo; Pandolfini, Tiziana; Molesini, Barbara; Sánchez-Sevilla, José F; Amaya, Iraida; Mezzetti, Bruno; Battino, Maurizio

    2018-01-24

    Food fortification through the increase and/or modulation of bioactive compounds has become a major goal for preventing several diseases, including cancer. Here, strawberry lines of cv. Calypso transformed with a construct containing an anthocyanidin synthase (ANS) gene were produced to study the effects on anthocyanin biosynthesis, metabolism, and transcriptome. Three strawberry ANS transgenic lines (ANS L5, ANS L15, and ANS L18) were analyzed for phytochemical composition and total antioxidant capacity (TAC), and their fruit extracts were assessed for cytotoxic effects on hepatocellular carcinoma. ANS L18 fruits had the highest levels of total phenolics and flavonoids, while those of ANS L15 had the highest anthocyanin concentration; TAC positively correlated with total polyphenol content. Fruit transcriptome was also specifically affected in the polyphenol biosynthesis and in other related metabolic pathways. Fruit extracts of all lines exerted cytotoxic effects in a dose/time-dependent manner, increasing cellular apoptosis and free radical levels and impairing mitochondrial functionality.

  9. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  10. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  11. A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension.

    Science.gov (United States)

    Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun

    2017-09-01

    Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.

  12. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  13. SEQUENCE OF THE STRUCTURAL GENE FOR GRANULE-BOUND STARCH SYNTHASE OF POTATO (SOLANUM-TUBEROSUM L) AND EVIDENCE FOR A SINGLE POINT DELETION IN THE AMF ALLELE

    NARCIS (Netherlands)

    van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem

    The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type

  14. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  15. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

    DEFF Research Database (Denmark)

    Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

    2014-01-01

    BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

  16. Structural mechanism of laforin function in glycogen dephosphorylation and lafora disease.

    Science.gov (United States)

    Raththagala, Madushi; Brewer, M Kathryn; Parker, Matthew W; Sherwood, Amanda R; Wong, Brian K; Hsu, Simon; Bridges, Travis M; Paasch, Bradley C; Hellman, Lance M; Husodo, Satrio; Meekins, David A; Taylor, Adam O; Turner, Benjamin D; Auger, Kyle D; Dukhande, Vikas V; Chakravarthy, Srinivas; Sanz, Pascual; Woods, Virgil L; Li, Sheng; Vander Kooi, Craig W; Gentry, Matthew S

    2015-01-22

    Glycogen is the major mammalian glucose storage cache and is critical for energy homeostasis. Glycogen synthesis in neurons must be tightly controlled due to neuronal sensitivity to perturbations in glycogen metabolism. Lafora disease (LD) is a fatal, congenital, neurodegenerative epilepsy. Mutations in the gene encoding the glycogen phosphatase laforin result in hyperphosphorylated glycogen that forms water-insoluble inclusions called Lafora bodies (LBs). LBs induce neuronal apoptosis and are the causative agent of LD. The mechanism of glycogen dephosphorylation by laforin and dysfunction in LD is unknown. We report the crystal structure of laforin bound to phosphoglucan product, revealing its unique integrated tertiary and quaternary structure. Structure-guided mutagenesis combined with biophysical and biochemical analyses reveal the basis for normal function of laforin in glycogen metabolism. Analyses of LD patient mutations define the mechanism by which subsets of mutations disrupt laforin function. These data provide fundamental insights connecting glycogen metabolism to neurodegenerative disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Evolution and functional insights of different ancestral orthologous clades of chitin synthase genes in the fungal tree of life

    Directory of Open Access Journals (Sweden)

    Mu eLi

    2016-02-01

    Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene

  18. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  19. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

    Science.gov (United States)

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2017-07-01

    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  20. Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

    Science.gov (United States)

    Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

    2017-07-01

    Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

  1. Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

    Science.gov (United States)

    Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

    2016-12-01

    To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

  2. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy

    2008-01-01

    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  3. Enzymatic regulation of seasonal glycogen cycling in the freeze-tolerant wood frog, Rana sylvatica.

    Science.gov (United States)

    do Amaral, M Clara F; Lee, Richard E; Costanzo, Jon P

    2016-12-01

    Liver glycogen is an important energy store in vertebrates, and in the freeze-tolerant wood frog, Rana sylvatica, this carbohydrate also serves as a major source of the cryoprotectant glucose. We investigated how variation in the levels of the catalytic subunit of protein kinase A (PKAc), glycogen phosphorylase (GP), and glycogen synthase (GS) relates to seasonal glycogen cycling in a temperate (Ohioan) and subarctic (Alaskan) populations of this species. In spring, Ohioan frogs had reduced potential for glycogen synthesis, as evidenced by low GS activity and high PKAc protein levels. In addition, glycogen levels in spring were the lowest of four seasonal samples, as energy input was likely directed towards metabolism and somatic growth during this period. Near-maximal glycogen levels were reached by mid-summer, and remained unchanged in fall and winter, suggesting that glycogenesis was curtailed during this period. Ohioan frogs had a high potential for glycogenolysis and glycogenesis in winter, as evidenced by large glycogen reserves, high levels of GP and GS proteins, and high GS activity, which likely allows for rapid mobilization of cryoprotectant during freezing and replenishing of glycogen reserves during thawing. Alaskan frogs also achieved a near-maximal liver glycogen concentration by summer and displayed high glycogenic and glycogenolytic potential in winter, but, unlike Ohioan frogs, started replenishing their energy reserves early in spring. We conclude that variation in levels of both glycogenolytic and glycogenic enzymes likely happens in response to seasonal changes in energetic strategies and demands, with winter survival being a key component to understanding the regulation of glycogen cycling in this species.

  4. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

    Science.gov (United States)

    Xiang, Lin; Zhao, Kaige; Chen, Longqing

    2010-01-01

    Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  5. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  6. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  7. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  8. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  9. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  10. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  11. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  12. Novel cystathionine β-synthase gene mutations in a Filipino patient with classic homocystinuria.

    Science.gov (United States)

    Silao, Catherine Lynn T; Fabella, Terence Diane F; Rama, Kahlil Izza D; Estrada, Sylvia C

    2015-10-01

    Classic homocystinuria due to cystathionine β-synthase (CBS) deficiency is an autosomal recessive disorder of sulfur metabolism. Clinical manifestations include mental retardation, dislocation of the optic lens (ectopia lentis), skeletal abnormalities and a tendency to thromboembolic episodes. We present the first mutational analysis of CBS in a Filipino patient with classic homocystinuria. Genomic DNA was extracted from peripheral blood collected from a diagnosed Filipino patient with classic homocystinuria. The entire coding region of CBS (17 exons) was amplified using polymerase chain reaction and bidirectionally sequenced using standard protocols. The patient was found to be compound heterozygous for two novel mutations, g.13995G>A [c.982G>A; p.D328K] and g.15860-15868dupGCAGGAGCT [c.1083-1091dupGCAGGAGCT; p. Q362-L364dupQEL]. Four known single-nucleotide polymorphisms (rs234706, rs1801181, rs706208 and rs706209) were also detected in the present patient's CBS. The patient was heterozygous for all the identified alleles. This is the first mutational analysis of CBS done in a Filipino patient with classic homocystinuria who presented with a novel duplication mutation and a novel missense mutation. Homocystinuria due to CBS deficiency is a heterogeneous disorder at the molecular level. © 2015 Japan Pediatric Society.

  13. A GYS1 gene mutation is highly associated with polysaccharide storage myopathy in Cob Normand draught horses.

    Science.gov (United States)

    Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G

    2009-02-01

    Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.

  14. A whole-body model for glycogen regulation reveals a critical role for substrate cycling in maintaining blood glucose homeostasis.

    Directory of Open Access Journals (Sweden)

    Ke Xu

    2011-12-01

    Full Text Available Timely, and sometimes rapid, metabolic adaptation to changes in food supply is critical for survival as an organism moves from the fasted to the fed state, and vice versa. These transitions necessitate major metabolic changes to maintain energy homeostasis as the source of blood glucose moves away from ingested carbohydrates, through hepatic glycogen stores, towards gluconeogenesis. The integration of hepatic glycogen regulation with extra-hepatic energetics is a key aspect of these adaptive mechanisms. Here we use computational modeling to explore hepatic glycogen regulation under fed and fasting conditions in the context of a whole-body model. The model was validated against previous experimental results concerning glycogen phosphorylase a (active and glycogen synthase a dynamics. The model qualitatively reproduced physiological changes that occur during transition from the fed to the fasted state. Analysis of the model reveals a critical role for the inhibition of glycogen synthase phosphatase by glycogen phosphorylase a. This negative regulation leads to high levels of glycogen synthase activity during fasting conditions, which in turn increases substrate (futile cycling, priming the system for a rapid response once an external source of glucose is restored. This work demonstrates that a mechanistic understanding of the design principles used by metabolic control circuits to maintain homeostasis can benefit from the incorporation of mathematical descriptions of these networks into "whole-body" contextual models that mimic in vivo conditions.

  15. Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease.

    Science.gov (United States)

    Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor

    2018-04-01

    Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  17. Phenotype commitment in vascular smooth muscle cells derived from coronary atherosclerotic plaques: differential gene expression of endothelial Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    ML Rossi

    2009-06-01

    Full Text Available Unstable angina and myocardial infarction are the clinical manifestations of the abrupt thrombotic occlusion of an epicardial coronary artery as a result of spontaneous atherosclerotic plaque rupture or fissuring, and the exposure of highly thrombogenic material to blood. It has been demonstrated that the proliferation of vascular smooth muscle cells (VSMCs and impaired bioavailabilty of nitric oxide (NO are among the most important mechanisms involved in the progression of atherosclerosis. It has also been suggested that a NO imbalance in coronary arteries may be involved in myocardial ischemia as a result of vasomotor dysfunction triggering plaque rupture and the thrombotic response. We used 5’ nuclease assays (TaqMan™ PCRs to study gene expression in coronary plaques collected by means of therapeutic directional coronary atherectomy from 15 patients with stable angina (SA and 15 with acute coronary syndromes (ACS without ST elevation. Total RNA was extracted from the 30 plaques and the cDNA was amplified in order to determine endothelial nitric oxide synthase (eNOS gene expression. Analysis of the results showed that the expression of eNOS was significantly higher (p<0.001 in the plaques from the ACS patients. Furthermore, isolated VSMCs from ACS and SA plaques confirmed the above pattern even after 25 plating passages. In situ RT-PCR was also carried out to co-localize the eNOS messengers and the VSMC phenotype.

  18. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    Science.gov (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  19. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

    Science.gov (United States)

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

    2017-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive