WorldWideScience

Sample records for glycogen synthase gene

  1. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    OpenAIRE

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  2. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  3. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  4. A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

    DEFF Research Database (Denmark)

    Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

    2017-01-01

    BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...

  5. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  6. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Glycogen synthase activation by sugars in isolated hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  8. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  9. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  10. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Science.gov (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  11. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  12. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  13. Glycogen Phosphorylase and Glycogen Synthase: Gene Cloning and Expression Analysis Reveal Their Role in Trehalose Metabolism in the Brown Planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin

    2017-01-01

    RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  14. Processivity and Subcellular Localization of Glycogen Synthase Depend on a Non-catalytic High Affinity Glycogen-binding Site*

    OpenAIRE

    Díaz, Adelaida; Martínez-Pons, Carlos; Fita, Ignacio; Ferrer, Juan C.; Guinovart, Joan J.

    2011-01-01

    Glycogen synthase, a central enzyme in glucose metabolism, catalyzes the successive addition of α-1,4-linked glucose residues to the non-reducing end of a growing glycogen molecule. A non-catalytic glycogen-binding site, identified by x-ray crystallography on the surface of the glycogen synthase from the archaeon Pyrococcus abyssi, has been found to be functionally conserved in the eukaryotic enzymes. The disruption of this binding site in both the archaeal and the human muscle glycogen synth...

  15. Glycogen synthase kinase 3: more than a namesake.

    Science.gov (United States)

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  16. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

    Directory of Open Access Journals (Sweden)

    Linjie Wang

    Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

  17. Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors

    Directory of Open Access Journals (Sweden)

    Daniela Hulcová

    2018-03-01

    Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.

  18. Quantification of the glycogen cascade system: the ultrasensitive responses of liver glycogen synthase and muscle phosphorylase are due to distinctive regulatory designs

    Directory of Open Access Journals (Sweden)

    Venkatesh KV

    2005-05-01

    Full Text Available Abstract Background Signaling pathways include intricate networks of reversible covalent modification cycles. Such multicyclic enzyme cascades amplify the input stimulus, cause integration of multiple signals and exhibit sensitive output responses. Regulation of glycogen synthase and phosphorylase by reversible covalent modification cycles exemplifies signal transduction by enzyme cascades. Although this system for regulating glycogen synthesis and breakdown appears similar in all tissues, subtle differences have been identified. For example, phosphatase-1, a dephosphorylating enzyme of the system, is regulated quite differently in muscle and liver. Do these small differences in regulatory architecture affect the overall performance of the glycogen cascade in a specific tissue? We address this question by analyzing the regulatory structure of the glycogen cascade system in liver and muscle cells at steady state. Results The glycogen cascade system in liver and muscle cells was analyzed at steady state and the results were compared with literature data. We found that the cascade system exhibits highly sensitive switch-like responses to changes in cyclic AMP concentration and the outputs are surprisingly different in the two tissues. In muscle, glycogen phosphorylase is more sensitive than glycogen synthase to cyclic AMP, while the opposite is observed in liver. Furthermore, when the liver undergoes a transition from starved to fed-state, the futile cycle of simultaneous glycogen synthesis and degradation switches to reciprocal regulation. Under such a transition, different proportions of active glycogen synthase and phosphorylase can coexist due to the varying inhibition of glycogen-synthase phosphatase by active phosphorylase. Conclusion The highly sensitive responses of glycogen synthase in liver and phosphorylase in muscle to primary stimuli can be attributed to distinctive regulatory designs in the glycogen cascade system. The different

  19. Phosphorylation-dependent translocation of glycogen synthase to a novel structure during glycogen resynthesis

    DEFF Research Database (Denmark)

    Prats, Clara; Cadefau, Joan A; Cussó, Roser

    2005-01-01

    Glycogen metabolism has been the subject of extensive research, but the mechanisms by which it is regulated are still not fully understood. It is well accepted that the rate-limiting enzymes in glycogenesis and glycogenolysis are glycogen synthase (GS) and glycogen phosphorylase (GPh), respectively....... Both enzymes are regulated by reversible phosphorylation and by allosteric effectors. However, evidence in the literature indicates that changes in muscle GS and GPh intracellular distribution may constitute a new regulatory mechanism of glycogen metabolism. Already in the 1960s, it was proposed...... that glycogen was present in dynamic cellular organelles that were termed glycosomas but no such cellular entities have ever been demonstrated. The aim of this study was to characterize muscle GS and GPh intracellular distribution and to identify possible translocation processes of both enzymes. Using in situ...

  20. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    International Nuclear Information System (INIS)

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-01-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

  1. Characterization of Function of the GlgA2 Glycogen/Starch Synthase in Cyanobacterium sp. Clg1 Highlights Convergent Evolution of Glycogen Metabolism into Starch Granule Aggregation.

    Science.gov (United States)

    Kadouche, Derifa; Ducatez, Mathieu; Cenci, Ugo; Tirtiaux, Catherine; Suzuki, Eiji; Nakamura, Yasunori; Putaux, Jean-Luc; Terrasson, Amandine Durand; Diaz-Troya, Sandra; Florencio, Francisco Javier; Arias, Maria Cecilia; Striebeck, Alexander; Palcic, Monica; Ball, Steven G; Colleoni, Christophe

    2016-07-01

    At variance with the starch-accumulating plants and most of the glycogen-accumulating cyanobacteria, Cyanobacterium sp. CLg1 synthesizes both glycogen and starch. We now report the selection of a starchless mutant of this cyanobacterium that retains wild-type amounts of glycogen. Unlike other mutants of this type found in plants and cyanobacteria, this mutant proved to be selectively defective for one of the two types of glycogen/starch synthase: GlgA2. This enzyme is phylogenetically related to the previously reported SSIII/SSIV starch synthase that is thought to be involved in starch granule seeding in plants. This suggests that, in addition to the selective polysaccharide debranching demonstrated to be responsible for starch rather than glycogen synthesis, the nature and properties of the elongation enzyme define a novel determinant of starch versus glycogen accumulation. We show that the phylogenies of GlgA2 and of 16S ribosomal RNA display significant congruence. This suggests that this enzyme evolved together with cyanobacteria when they diversified over 2 billion years ago. However, cyanobacteria can be ruled out as direct progenitors of the SSIII/SSIV ancestral gene found in Archaeplastida. Hence, both cyanobacteria and plants recruited similar enzymes independently to perform analogous tasks, further emphasizing the importance of convergent evolution in the appearance of starch from a preexisting glycogen metabolism network. © 2016 American Society of Plant Biologists. All Rights Reserved.

  2. Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.

    Science.gov (United States)

    Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul

    2016-01-01

    Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  3. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Science.gov (United States)

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Conditional ablation of glycogen synthase kinase 3β in postnatal mouse kidney.

    Science.gov (United States)

    Ge, Yan; Si, Jin; Tian, Li; Zhuang, Shougang; Dworkin, Lance D; Gong, Rujun

    2011-01-01

    Glycogen synthase kinase (GSK)3 is a ubiquitously expressed serine/threonine kinase existing in two isoforms, namely GSK3α and GSK3β. Aside from the long-recognized role in insulin signal transduction and glycogen biosynthesis, GSK3β has been recently coined as a master control molecule in nuclear factor-κB activation and inflammatory kidney injury. Nevertheless, previous studies are less conclusive because they relied greatly on small molecule inhibitors, which lack selectivity and barely distinguish between the GSK3 isoforms. In addition, early embryonic lethality after global knockout of GSK3β precludes interrogation of the biological role of GSK3β in the adult kidney. To circumvent these issues, the Cre/loxP system was used to generate a conditional knockout mouse model in which the GSK3β gene was specifically deleted in kidney cortical tubules at postnatal mature stage. Kidney-specific ablation of GSK3β resulted in a phenotype no different from control littermates. Knockout mice (KO) were viable and exhibited normal development and normal kidney physiology in terms of kidney function, urine albumin excretion, and urine-concentrating ability. It is noteworthy that apart from normal glomerular and tubulointerstitial morphology, the kidneys from KO demonstrated more glycogen accumulation in the renal cortical tubules as assessed by both periodic acid-Schiff staining for light microscopy and direct biochemical assay, consistent with an elevated glycogen synthetic activity as evidenced by diminished inhibitory phosphorylation of glycogen synthase that occurred subsequent to GSK3β ablation. This finding was further validated by electron microscopic observations of increased deposition of glycogen particles in the renal tubules of KO, suggesting that GSK3α could not fully compensate for the loss of GSK3β in regulating glycogen metabolism in the kidney. Collectively, our study suggests that kidney-specific ablation of GSK3β barely affects kidney function

  5. Characterization of Function of the GlgA2 Glycogen/Starch Synthase in Cyanobacterium sp. Clg1 Highlights Convergent Evolution of Glycogen Metabolism into Starch Granule Aggregation1

    Science.gov (United States)

    Kadouche, Derifa; Arias, Maria Cecilia

    2016-01-01

    At variance with the starch-accumulating plants and most of the glycogen-accumulating cyanobacteria, Cyanobacterium sp. CLg1 synthesizes both glycogen and starch. We now report the selection of a starchless mutant of this cyanobacterium that retains wild-type amounts of glycogen. Unlike other mutants of this type found in plants and cyanobacteria, this mutant proved to be selectively defective for one of the two types of glycogen/starch synthase: GlgA2. This enzyme is phylogenetically related to the previously reported SSIII/SSIV starch synthase that is thought to be involved in starch granule seeding in plants. This suggests that, in addition to the selective polysaccharide debranching demonstrated to be responsible for starch rather than glycogen synthesis, the nature and properties of the elongation enzyme define a novel determinant of starch versus glycogen accumulation. We show that the phylogenies of GlgA2 and of 16S ribosomal RNA display significant congruence. This suggests that this enzyme evolved together with cyanobacteria when they diversified over 2 billion years ago. However, cyanobacteria can be ruled out as direct progenitors of the SSIII/SSIV ancestral gene found in Archaeplastida. Hence, both cyanobacteria and plants recruited similar enzymes independently to perform analogous tasks, further emphasizing the importance of convergent evolution in the appearance of starch from a preexisting glycogen metabolism network. PMID:27208262

  6. Epinephrine-stimulated glycogen breakdown activates glycogen synthase and increases insulin-stimulated glucose uptake in epitrochlearis muscles

    DEFF Research Database (Denmark)

    Kolnes, Anders J; Birk, Jesper Bratz; Eilertsen, Einar

    2015-01-01

    Adrenaline increases glycogen synthase (GS) phosphorylation and decreases GS activity but also stimulates glycogen breakdown and low glycogen content normally activates GS. To test the hypothesis that glycogen content directly regulates GS phosphorylation, glycogen breakdown was stimulated...... in condition with decreased GS activation. Saline or adrenaline (0.02mg/100g rat) was injected subcutaneously in Wistar rats (~130 g) with low (24 h fasted), normal (normal diet) and high glycogen content (fasted-refed) and epitrochlearis muscles were removed after 3 h and incubated ex vivo eliminating...... adrenaline action. Adrenaline injection reduced glycogen content in epitrochlearis muscles with high (120.7±17.8 vs 204.6±14.5 mmol•kg(-1); pglycogen (89.5±7.6 vs 152.6±8.1 mmol•kg(-1); pglycogen (90.0±5.0 vs 102.8±7.8 mmol•kg(-1); p=0...

  7. Glycogen Synthase Kinase-3 is involved in glycogen metabolism control and embryogenesis of Rhodnius prolixus.

    Science.gov (United States)

    Mury, Flávia B; Lugon, Magda D; DA Fonseca, Rodrigo Nunes; Silva, Jose R; Berni, Mateus; Araujo, Helena M; Fontenele, Marcio Ribeiro; Abreu, Leonardo Araujo DE; Dansa, Marílvia; Braz, Glória; Masuda, Hatisaburo; Logullo, Carlos

    2016-10-01

    Rhodnius prolixus is a blood-feeding insect that transmits Trypanosoma cruzi and Trypanosoma rangeli to vertebrate hosts. Rhodnius prolixus is also a classical model in insect physiology, and the recent availability of R. prolixus genome has opened new avenues on triatomine research. Glycogen synthase kinase 3 (GSK-3) is classically described as a key enzyme involved in glycogen metabolism, also acting as a downstream component of the Wnt pathway during embryogenesis. GSK-3 has been shown to be highly conserved among several organisms, mainly in the catalytic domain region. Meanwhile, the role of GSK-3 during R. prolixus embryogenesis or glycogen metabolism has not been investigated. Here we show that chemical inhibition of GSK-3 by alsterpaullone, an ATP-competitive inhibitor of GSK3, does not affect adult survival rate, though it alters oviposition and egg hatching. Specific GSK-3 gene silencing by dsRNA injection in adult females showed a similar phenotype. Furthermore, bright field and 4'-6-diamidino-2-phenylindole (DAPI) staining analysis revealed that ovaries and eggs from dsGSK-3 injected females exhibited specific morphological defects. We also demonstrate that glycogen content was inversely related to activity and transcription levels of GSK-3 during embryogenesis. Lastly, after GSK-3 knockdown, we observed changes in the expression of the Wingless (Wnt) downstream target β-catenin as well as in members of other pathways such as the receptor Notch. Taken together, our results show that GSK-3 regulation is essential for R. prolixus oogenesis and embryogenesis.

  8. Phosphorylation of sites 3 and 2 in rabbit skeletal muscle glycogen synthase by a multifunctional protein kinase (ATP-citrate lyase kinase)

    International Nuclear Information System (INIS)

    Sheorain, V.S.; Ramakrishna, S.; Benjamin, W.B.; Soderling, T.R.

    1985-01-01

    A multifunctional protein kinase, purified from rat liver as ATP-citrate lyase kinase, has been identified as a glycogen synthase kinase. This kinase catalyzed incorporation of up to 1.5 mol of and]2number 2 PO 4 /mol of synthase subunit associated with a decrease in the glycogen synthase activity ratio from 0.85 to a value of 0.15. Approximately 65-70% of the 34 PO 4 was incorporated into site 3 and 30-35% into site 2 as determined by reverse phase high performance liquid chromatography. This multifunctional kinase was distinguished from glycogen synthase kinase-3 on the basis of nucleotide and protein substrate specificities. Since the phosphate contents in glycogen synthase of sites 3 and 2 are altered in diabetes and by insulin administration, the possible involvement of the multifunctional kinase was explored. Glycogen synthase purified from diabetic rabbits was phosphorylated in vitro by this multifunctional kinase at only 10% of the rate compared to synthase purified from control rabbits. Treatment of the diabetics with insulin restored the synthase to a form that was readily phosphorylated in vitro

  9. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  10. Glucose 6-phosphate compartmentation and the control of glycogen synthesis

    NARCIS (Netherlands)

    Meijer, Alfred

    2002-01-01

    Using adenovirus-mediated gene transfer into FTO-2B cells, a rat hepatoma cell line, we have overexpressed hexokinase I, (HK I), glucokinase (GK), liver glycogen synthase (LGS), muscle glycogen synthase (MGS), and combinations of each of the two glucose phosphorylating enzymes with each one of the

  11. Effect of glycogen synthase overexpression on insulin-stimulated muscle glucose uptake and storage.

    Science.gov (United States)

    Fogt, Donovan L; Pan, Shujia; Lee, Sukho; Ding, Zhenping; Scrimgeour, Angus; Lawrence, John C; Ivy, John L

    2004-03-01

    Insulin-stimulated muscle glucose uptake is inversely associated with the muscle glycogen concentration. To investigate whether this association is a cause and effect relationship, we compared insulin-stimulated muscle glucose uptake in noncontracted and postcontracted muscle of GSL3-transgenic and wild-type mice. GSL3-transgenic mice overexpress a constitutively active form of glycogen synthase, which results in an abundant storage of muscle glycogen. Muscle contraction was elicited by in situ electrical stimulation of the sciatic nerve. Right gastrocnemii from GSL3-transgenic and wild-type mice were subjected to 30 min of electrical stimulation followed by hindlimb perfusion of both hindlimbs. Thirty minutes of contraction significantly reduced muscle glycogen concentration in wild-type (49%) and transgenic (27%) mice, although transgenic mice retained 168.8 +/- 20.5 micromol/g glycogen compared with 17.7 +/- 2.6 micromol/g glycogen for wild-type mice. Muscle of transgenic and wild-type mice demonstrated similar pre- (3.6 +/- 0.3 and 3.9 +/- 0.6 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) and postcontraction (7.9 +/- 0.4 and 7.0 +/- 0.4 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) insulin-stimulated glucose uptakes. However, the [14C]glucose incorporated into glycogen was greater in noncontracted (151%) and postcontracted (157%) transgenic muscle vs. muscle of corresponding wild-type mice. These results indicate that glycogen synthase activity is not rate limiting for insulin-stimulated glucose uptake in skeletal muscle and that the inverse relationship between muscle glycogen and insulin-stimulated glucose uptake is an association, not a cause and effect relationship.

  12. Dual regulation of muscle glycogen synthase during exercise by activation and compartmentalization

    DEFF Research Database (Denmark)

    Prats, Clara; Helge, Jørn W; Nordby, Pernille

    2009-01-01

    Glycogen synthase (GS) is considered the rate-limiting enzyme in glycogenesis but still today there is a lack of understanding on its regulation. We have previously shown phosphorylation-dependent GS intracellular redistribution at the start of glycogen re-synthesis in rabbit skeletal muscle (Prats......, C., Cadefau, J. A., Cussó, R., Qvortrup, K., Nielsen, J. N., Wojtaszewki, J. F., Wojtaszewki, J. F., Hardie, D. G., Stewart, G., Hansen, B. F., and Ploug, T. (2005) J. Biol. Chem. 280, 23165-23172). In the present study we investigate the regulation of human muscle GS activity by glycogen, exercise......, and insulin. Using immunocytochemistry we investigate the existence and relevance of GS intracellular compartmentalization during exercise and during glycogen re-synthesis. The results show that GS intrinsic activity is strongly dependent on glycogen levels and that such regulation involves associated...

  13. Pre- and posttranslational upregulation of muscle-specific glycogen synthase in athletes

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    Expression of muscle-specific glycogen synthase (GS) and phosphofructokinase (PFK) was analyzed in seven athletes and eight control subjects who were characterized using the euglycemic, hyperinsulinemic (2 mU.kg-1.min-1) clamp technique in combination with indirect calorimetry and biopsy sampling...

  14. Ursolic acid and luteolin-7-glucoside improve lipid profiles and increase liver glycogen content through glycogen synthase kinase-3.

    Science.gov (United States)

    Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina

    2010-06-01

    In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.

  15. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...

  16. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Science.gov (United States)

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Deleterious effects of neuronal accumulation of glycogen in flies and mice

    OpenAIRE

    Duran, Jordi; Tevy, María Florencia; Garcia-Rocha, Mar; Calbó, Joaquim; Milán, Marco; Guinovart, Joan J

    2012-01-01

    Under physiological conditions, most neurons keep glycogen synthase (GS) in an inactive form and do not show detectable levels of glycogen. Nevertheless, aberrant glycogen accumulation in neurons is a hallmark of patients suffering from Lafora disease or other polyglucosan disorders. Although these diseases are associated with mutations in genes involved in glycogen metabolism, the role of glycogen accumulation remains elusive. Here, we generated mouse and fly models expressing an active form...

  18. Neurodegeneration and functional impairments associated with glycogen synthase accumulation in a mouse model of Lafora disease.

    Science.gov (United States)

    Valles-Ortega, Jordi; Duran, Jordi; Garcia-Rocha, Mar; Bosch, Carles; Saez, Isabel; Pujadas, Lluís; Serafin, Anna; Cañas, Xavier; Soriano, Eduardo; Delgado-García, José M; Gruart, Agnès; Guinovart, Joan J

    2011-11-01

    Lafora disease (LD) is caused by mutations in either the laforin or malin gene. The hallmark of the disease is the accumulation of polyglucosan inclusions called Lafora Bodies (LBs). Malin knockout (KO) mice present polyglucosan accumulations in several brain areas, as do patients of LD. These structures are abundant in the cerebellum and hippocampus. Here, we report a large increase in glycogen synthase (GS) in these mice, in which the enzyme accumulates in LBs. Our study focused on the hippocampus where, under physiological conditions, astrocytes and parvalbumin-positive (PV(+)) interneurons expressed GS and malin. Although LBs have been described only in neurons, we found this polyglucosan accumulation in the astrocytes of the KO mice. They also had LBs in the soma and some processes of PV(+) interneurons. This phenomenon was accompanied by the progressive loss of these neuronal cells and, importantly, neurophysiological alterations potentially related to impairment of hippocampal function. Our results emphasize the relevance of the laforin-malin complex in the control of glycogen metabolism and highlight altered glycogen accumulation as a key contributor to neurodegeneration in LD. Copyright © 2011 EMBO Molecular Medicine.

  19. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  20. Lafora disease offers a unique window into neuronal glycogen metabolism.

    Science.gov (United States)

    Gentry, Matthew S; Guinovart, Joan J; Minassian, Berge A; Roach, Peter J; Serratosa, Jose M

    2018-05-11

    Lafora disease (LD) is a fatal, autosomal recessive, glycogen-storage disorder that manifests as severe epilepsy. LD results from mutations in the gene encoding either the glycogen phosphatase laforin or the E3 ubiquitin ligase malin. Individuals with LD develop cytoplasmic, aberrant glycogen inclusions in nearly all tissues that more closely resemble plant starch than human glycogen. This Minireview discusses the unique window into glycogen metabolism that LD research offers. It also highlights recent discoveries, including that glycogen contains covalently bound phosphate and that neurons synthesize glycogen and express both glycogen synthase and glycogen phosphorylase. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Glycogen synthase kinase 3β promotes liver innate immune activation by restraining AMP-activated protein kinase activation.

    Science.gov (United States)

    Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan

    2018-02-13

    Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection

  2. Eckmaxol, a Phlorotannin Extracted from Ecklonia maxima, Produces Anti-β-amyloid Oligomer Neuroprotective Effects Possibly via Directly Acting on Glycogen Synthase Kinase 3β.

    Science.gov (United States)

    Wang, Jialing; Zheng, Jiachen; Huang, Chunhui; Zhao, Jiaying; Lin, Jiajia; Zhou, Xuezhen; Naman, C Benjamin; Wang, Ning; Gerwick, William H; Wang, Qinwen; Yan, Xiaojun; Cui, Wei; He, Shan

    2018-04-10

    Alzheimer's disease is a progressive neurodegenerative disorder that mainly affects the elderly. Soluble β-amyloid oligomer, which can induce neurotoxicity, is generally regarded as the main neurotoxin in Alzheimer's disease. Here we report that eckmaxol, a phlorotannin extracted from the brown alga Ecklonia maxima, could produce neuroprotective effects in SH-SY5Y cells. Eckmaxol effectively prevented but did not rescue β-amyloid oligomer-induced neuronal apoptosis and increase of intracellular reactive oxygen species. Eckmaxol also significantly reversed the decreased expression of phospho-Ser9-glycogen synthase kinase 3β and increased expression of phospho-extracellular signal-regulated kinase, which was induced by Aβ oligomer. Moreover, both glycogen synthase kinase 3β and mitogen activated protein kinase inhibitors produced neuroprotective effects in SH-SY5Y cells. Furthermore, eckmaxol showed favorable interaction in the ATP binding site of glycogen synthase kinase 3β and mitogen activated protein kinase. These results suggested that eckmaxol might produce neuroprotective effects via concurrent inhibition of glycogen synthase kinase 3β and extracellular signal-regulated kinase pathways, possibly via directly acting on glycogen synthase kinase 3β and mitogen activated protein kinase. Based on the central role that β-amyloid oligomers play in the pathogenesis of Alzheimer's disease and the high annual production of Ecklonia maxima for alginate and other nutritional ingredients, this report represents a new candidate for the treatment of Alzheimer's disease, and also expands the potential application of Ecklonia maxima and its constituents in the field of pharmacology.

  3. AJS1669, a novel small-molecule muscle glycogen synthase activator, improves glucose metabolism and reduces body fat mass in mice

    Science.gov (United States)

    Nakano, Kazuhiro; Takeshita, Sen; Kawasaki, Noriko; Miyanaga, Wataru; Okamatsu, Yoriko; Dohi, Mizuki; Nakagawa, Tadakiyo

    2017-01-01

    Impaired glycogen synthesis and turnover are common in insulin resistance and type 2 diabetes. As glycogen synthase (GS) is a key enzyme involved in the synthetic process, it presents a promising therapeutic target for the treatment of type 2 diabetes. In the present study, we identified a novel, potent and orally available GS activator AJS1669 {sodium 2-[[5-[[4-(4,5-difluoro-2-methylsulfanyl-phenyl) phenoxy] methyl]furan-2-carbonyl]-(2-furylmethyl)amino] acetate}. In vitro, we performed a glycogen synthase 1 (GYS1) activation assay for screening GS activators and identified that the activity of AJS1669 was further potentiated in the presence of glucose-6-phosphate (G6P). In vivo, we used ob/ob mice to evaluate the novel anti-diabetic effects of AJS1669 by measuring basal blood glucose levels, glucose tolerance and body fat mass index. Repeated administration of AJS1669 over 4 weeks reduced blood glucose and hemoglobin A1c (HbA1c) levels in ob/ob mice. AJS1669 also improved glucose tolerance in a dose-dependent manner, and decreased body fat mass. The mRNA levels of genes involved in mitochondrial fatty acid oxidation and mitochondrial biogenesis were elevated in skeletal muscle tissue following AJS1669 treatment. Hepatic tissue of treated mice also exhibited elevated expression of genes associated with fatty acid oxidation. In contrast to ob/ob mice, in C57Bl/6 mice AJS1669 administration did not alter body weight or reduce glucose levels. These results demonstrate that pharmacological agents that activate GYS1, the main GS subtype found in skeletal muscle, have potential for use as novel treatments for diabetes that improve glucose metabolism in skeletal muscle. PMID:28290602

  4. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    International Nuclear Information System (INIS)

    Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.

    1986-01-01

    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor

  5. Involvement of Glycogen Synthase Kinase-3 in the Mechanisms of Conditioned Food Aversion Memory Reconsolidation.

    Science.gov (United States)

    Nikitin, V P; Solntseva, S V; Kozyrev, S A

    2017-02-01

    Experiments were performed on the snails trained in conditioned food aversion for 3 days. Injection of TDZD-8 (glycogen synthase kinase-3 inhibitor, 2 mg/kg) in combination with reminder (presentation of a conditioned food stimulus) led to memory impairment developing 3 days after inhibitor/reminder exposure and followed by spontaneous recovery in 10 days. Injections of TDZD-8 in a dose of 4 or 20 mg/kg before reminder were shown to cause amnesia that persisted for more than 10 days. Memory recovery during repeated training was observed at the earlier period than after initial training. The impairment of memory reconsolidation by TDZD-8 after training of snails for 1 day was less pronounced than under standard training conditions (3 days). The effect of a glycogen synthase kinase-3 inhibitor during memory reconsolidation is probably followed by impairment of memory retrieval and/or partial loss, which can be compensated spontaneously or after repeated training.

  6. Dysregulation of muscle glycogen synthase in recovery from exercise in type 2 diabetes

    DEFF Research Database (Denmark)

    Pedersen, Andreas J T; Hingst, Janne Rasmuss; Friedrichsen, Martin

    2015-01-01

    AIMS/HYPOTHESIS: Insulin and exercise stimulate skeletal muscle glycogen synthase (GS) activity by dephosphorylation and changes in kinetic properties. The aim of this study was to investigate the effects of insulin, exercise and post-exercise insulin stimulation on GS phosphorylation, activity a...... and increased phosphorylation at sites 2 + 2a in type 2 diabetes in the recovery period imply an impaired response to exercise....

  7. Glycogen synthase kinase-3 regulation of urinary concentrating ability.

    Science.gov (United States)

    Rao, Reena

    2012-09-01

    Glycogen synthase kinase-3 (GSK3) is an enzyme that is gaining prominence as a critical signaling molecule in the epithelial cells of renal tubules. This review will focus on recent findings exploring the role of GSK3 in renal collecting ducts, especially its role in urine concentration involving vasopressin signaling. Recent studies using inhibition or tissue-specific gene deletion of GSK3 revealed the mechanism by which GSK3 regulates aquaporin 2 water channels via adenylate cyclase or the prostaglandin-E2 pathway. In other studies, postnatal treatment with lithium, an inhibitor of GSK3, increased cell proliferation and led to microcyst formation in rat kidneys. These studies suggest that loss of GSK3 activity could interfere with renal water transport at two levels. In the short term, it could disrupt vasopressin signaling in collecting duct cells and in the long term it could alter the structure of the collecting ducts, making them less responsive to the hydro-osmotic effects of vasopressin. Ongoing studies reveal the crucial role played by GSK3 in the regulation of vasopressin action in the renal collecting ducts and suggest a possible use of GSK3 inhibitors in disease conditions associated with disrupted vasopressin signaling.

  8. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    OpenAIRE

    E. Ruchti; P.J. Roach; A.A. DePaoli-Roach; P.J. Magistretti; I. Allaman

    2016-01-01

    The storage and use of glycogen, the main energy reserve in the brain, is a metabolic feature of astrocytes. Glycogen synthesis is regulated by Protein Targeting to Glycogen (PTG), a member of specific glycogen-binding subunits of protein phosphatase-1 (PPP1). It positively regulates glycogen synthesis through de-phosphorylation of both glycogen synthase (activation) and glycogen phosphorylase (inactivation). In cultured astrocytes, PTG mRNA levels were previously shown to be enhanced by the ...

  9. The diabetic phenotype is conserved in myotubes established from diabetic subjects: evidence for primary defects in glucose transport and glycogen synthase activity

    DEFF Research Database (Denmark)

    Gaster, Michael; Petersen, Ingrid; Højlund, Kurt

    2002-01-01

    The most well-described defect in the pathophysiology of type 2 diabetes is reduced insulin-mediated glycogen synthesis in skeletal muscles. It is unclear whether this defect is primary or acquired secondary to dyslipidemia, hyperinsulinemia, or hyperglycemia. We determined the glycogen synthase...

  10. Synthesis of glycogen from fructose in the presence of elevated levels of glycogen phosphorylase a in rat hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Massagué, J; Salavert, A; Guinovart, J J

    1980-03-20

    Incubation of hepatocytes with glucose promoted the increase in the glycogen synthase (-glucose 6-phosphate/+glucose 6-phosphate) activity ratio, the decrease in the levels of phosphorylase a and a marked increase in the intracellular glycogen level. Incubation with fructose alone promoted the simultaneous activation of glycogen synthase and increase in the levels of phosphorylase a. Strikingly, glycogen deposition occurred in spite of the elevated levels of phosphorylase a. When glucose and fructose were added to the media the activation of glycogen synthase was always higher than when the hexoses were added separately. On the other hand the effects on glycogen phosphorylase were a function of the relative concentrations of both sugars. Inactivation of glycogen phosphorylase occurred when the fructose to glucose ratio was low while activation took place when the ratio was high. The simultaneous presence of glucose and fructose resulted, in all cases, in an enhancement in the deposition of glycogen. The effects described were not limited to fructose as D-glyceraldehyde, dihydroxyacetone, L-sorbose, D-tagatose and sorbitol, compounds metabolically related to fructose, provoked the same behaviour.

  11. Deleterious effects of neuronal accumulation of glycogen in flies and mice.

    Science.gov (United States)

    Duran, Jordi; Tevy, María Florencia; Garcia-Rocha, Mar; Calbó, Joaquim; Milán, Marco; Guinovart, Joan J

    2012-08-01

    Under physiological conditions, most neurons keep glycogen synthase (GS) in an inactive form and do not show detectable levels of glycogen. Nevertheless, aberrant glycogen accumulation in neurons is a hallmark of patients suffering from Lafora disease or other polyglucosan disorders. Although these diseases are associated with mutations in genes involved in glycogen metabolism, the role of glycogen accumulation remains elusive. Here, we generated mouse and fly models expressing an active form of GS to force neuronal accumulation of glycogen. We present evidence that the progressive accumulation of glycogen in mouse and Drosophila neurons leads to neuronal loss, locomotion defects and reduced lifespan. Our results highlight glycogen accumulation in neurons as a direct cause of neurodegeneration. Copyright © 2012 EMBO Molecular Medicine.

  12. Expression of glycogen synthase and phosphofructokinase in muscle from type 1 (insulin-dependent) diabetic patients before and after intensive insulin treatment

    DEFF Research Database (Denmark)

    Vestergaard, H; Andersen, P H; Lund, S

    1994-01-01

    The aim of the present study was to determine whether short-term appropriate insulinization of Type 1 (insulin-dependent) diabetic patients in long-term poor glycaemic control (HbA1C > 9.5%) was associated with an adaptive regulation of the activity and gene expression of key proteins in muscle...... glycogen storage and glycolysis: glycogen synthase and phosphofructokinase, respectively. In nine diabetic patients biopsies of quadriceps muscle were taken before and 24-h after intensified insulin therapy and compared to findings in eight control subjects. Subcutaneous injections of rapid acting insulin...... were given at 3-h intervals to improve glycaemic control in diabetic patients (fasting plasma glucose decreased from 20.8 +/- 0.8 to 8.7 +/- 0.8 mmol/l whereas fasting serum insulin increased from 59 +/- 8 to 173 +/- 3 pmol/l). Before intensified insulin therapy, analysis of muscle biopsies from...

  13. Exercise Training-Induced Adaptations Associated with Increases in Skeletal Muscle Glycogen Content

    Science.gov (United States)

    Manabe, Yasuko; Gollisch, Katja S.C.; Holton, Laura; Kim, Young–Bum; Brandauer, Josef; Fujii, Nobuharu L.; Hirshman, Michael F.; Goodyear, Laurie J.

    2012-01-01

    Chronic exercise training results in numerous skeletal muscle adaptations, including increases in insulin sensitivity and glycogen content. To understand the mechanism for increased muscle glycogen, we studied the effects of exercise training on glycogen regulatory proteins in rat skeletal muscle. Female Sprague Dawley rats performed voluntary wheel running for 1, 4, or 7 weeks. After 7 weeks of training, insulin-stimulated glucose uptake was increased in epitrochlearis muscle. Compared to sedentary control rats, muscle glycogen did not change after 1 week of training, but increased significantly after 4 and 7 weeks. The increases in muscle glycogen were accompanied by elevated glycogen synthase activity and protein expression. To assess the regulation of glycogen synthase, we examined its major activator, protein phosphatase 1 (PP1), and its major deactivator, glycogen synthase kinase 3 (GSK3). Consistent with glycogen synthase activity, PP1 activity was unchanged after 1 week of training but significantly increased after 4 and 7 weeks of training. Protein expression of RGL(GM), another regulatory PP1 subunit, significantly decreased after 4 and 7 weeks of training. Unlike PP1, GSK3 phosphorylation did not follow the pattern of glycogen synthase activity. The ~40% decrease in GSK-3α phosphorylation after 1 week of exercise training persisted until 7 weeks and may function as a negative feedback to elevated glycogen. Our findings suggest that exercise training-induced increases in muscle glycogen content could be regulated by multiple mechanisms including enhanced insulin sensitivity, glycogen synthase expression, allosteric activation of glycogen synthase and PP1activity. PMID:23206309

  14. Lithium chloride ameliorates learning and memory ability and inhibits glycogen synthase kinase-3 beta activity in a mouse model of fragile X syndrome

    Institute of Scientific and Technical Information of China (English)

    Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi

    2011-01-01

    In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.

  15. Glycogen synthase kinase 3α regulates urine concentrating mechanism in mice

    OpenAIRE

    Nørregaard, Rikke; Tao, Shixin; Nilsson, Line; Woodgett, James R.; Kakade, Vijayakumar; Yu, Alan S. L.; Howard, Christiana; Rao, Reena

    2015-01-01

    In mammals, glycogen synthase kinase (GSK)3 comprises GSK3α and GSK3β isoforms. GSK3β has been shown to play a role in the ability of kidneys to concentrate urine by regulating vasopressin-mediated water permeability of collecting ducts, whereas the role of GSK3α has yet to be discerned. To investigate the role of GSK3α in urine concentration, we compared GSK3α knockout (GSK3αKO) mice with wild-type (WT) littermates. Under normal conditions, GSK3αKO mice had higher water intake and urine outp...

  16. Inhibition of muscle glycogen synthase activity and non-oxidative glucose disposal during hypoglycaemia in normal man

    DEFF Research Database (Denmark)

    Ørskov, Lotte; Bak, Jens Friis; Abildgaard, Ulrik

    1996-01-01

    The purpose of the present study was to evaluate the role of muscle glycogen synthase activity in the reduction of glucose uptake during hypoglycaemia. Six healthy young men were examined twice; during 120 min of hyperinsulinaemic (1.5 mU.kg-1. min-1) euglycaemia followed by: 1)240 min of graded ...

  17. Cell swelling and glycogen metabolism in hepatocytes from fasted rats

    NARCIS (Netherlands)

    Gustafson, L. A.; Jumelle-Laclau, M. N.; van Woerkom, G. M.; van Kuilenburg, A. B.; Meijer, A. J.

    1997-01-01

    Cell swelling is known to increase net glycogen production from glucose in hepatocytes from fasted rats by activating glycogen synthase. Since both active glycogen synthase and phosphorylase are present in hepatocytes, suppression of flux through phosphorylase may also contribute to the net increase

  18. Morphological Analysis of CDC2 and Glycogen Synthase Kinase 3β Phosphorylation as Markers of G2 → M Transition in Glioma

    Directory of Open Access Journals (Sweden)

    José Javier Otero

    2011-01-01

    Full Text Available G2 → M transition is a strategic target for glioma chemotherapy. Key players in G2 → M transition include CDC2 and glycogen synthase kinase 3β (GSK3β, which are highly regulated by posttranslational phosphorylation. This report is a morphological analysis of CDC2 and GSK3β phosphorylation using immunohistochemistry in gliomas with different biological properties. GBM showed a 2.8-fold and 5.6-fold increase in number of cells positive for pThr161CDC2 and a 4.2- and 6.9-fold increase in number of cells positive for pTyr15CDC2 relative to oligodendroglioma and ependymoma, respectively. Elevated labeling for inhibited phospho-CDC2 (pTyr15CDC correlates with elevated levels of phosphorylated glycogen synthase kinase 3β (GSK3β. 71% of the GBM cases showed intermediate to high intensity staining for pSer9SGK3β 53% of oligodendroglioma, and 73% of ependymoma showed low intensity staining. CDC2 gene amplification correlates with increased survival in glioblastoma multiforme (GBM and astrocytoma WHO grades II-III, but not in oligodendroglioma WHO grades II-III.

  19. Insulin Induces an Increase in Cytosolic Glucose Levels in 3T3-L1 Cells with Inhibited Glycogen Synthase Activation

    Directory of Open Access Journals (Sweden)

    Helena H. Chowdhury

    2014-10-01

    Full Text Available Glucose is an important source of energy for mammalian cells and enters the cytosol via glucose transporters. It has been thought for a long time that glucose entering the cytosol is swiftly phosphorylated in most cell types; hence the levels of free glucose are very low, beyond the detection level. However, the introduction of new fluorescence resonance energy transfer-based glucose nanosensors has made it possible to measure intracellular glucose more accurately. Here, we used the fluorescent indicator protein (FLIPglu-600µ to monitor cytosolic glucose dynamics in mouse 3T3-L1 cells in which glucose utilization for glycogen synthesis was inhibited. The results show that cells exhibit a low resting cytosolic glucose concentration. However, in cells with inhibited glycogen synthase activation, insulin induced a robust increase in cytosolic free glucose. The insulin-induced increase in cytosolic glucose in these cells is due to an imbalance between the glucose transported into the cytosol and the use of glucose in the cytosol. In untreated cells with sensitive glycogen synthase activation, insulin stimulation did not result in a change in the cytosolic glucose level. This is the first report of dynamic measurements of cytosolic glucose levels in cells devoid of the glycogen synthesis pathway.

  20. Estradiol stimulates glycogen synthesis whereas progesterone promotes glycogen catabolism in the uterus of the American mink (Neovison vison).

    Science.gov (United States)

    Bowman, Kole; Rose, Jack

    2017-01-01

    Glycogen synthesis by mink uterine glandular and luminal epithelia (GE and LE) is stimulated by estradiol (E 2 ) during estrus. Subsequently, the glycogen deposits are mobilized to near completion to meet the energy requirements of pre-embryonic development and implantation by as yet undetermined mechanisms. We hypothesized that progesterone (P 4 ) was responsible for catabolism of uterine glycogen reserves as one of its actions to ensure reproductive success. Mink were treated with E 2 , P 4 or vehicle (controls) for 3 days and uteri collected 24 h (E 2 , P 4 and vehicle) and 96 h (E 2 ) later. To evaluate E 2 priming, mink were treated with E 2 for 3 days, then P 4 for an additional 3 days (E 2 →P 4 ) and uteri collected 24 h later. Percent glycogen content of uterine epithelia was greater at E 2 + 96 h (GE = 5.71 ± 0.55; LE = 11.54 ± 2.32) than E 2 +24 h (GE = 3.63 ± 0.71; LE = 2.82 ± 1.03), and both were higher than controls (GE = 0.27 ± 0.15; LE = 0.54 ± 0.30; P glycogen content (GE = 0.61 ± 0.16; LE = 0.51 ± 0.13), to levels not different from controls, while concomitantly increasing catabolic enzyme (glycogen phosphorylase m and glucose-6-phosphatase) gene expression and amount of phospho-glycogen synthase protein (inactive) in uterine homogenates. Interestingly, E 2 →P 4 increased glycogen synthase 1 messenger RNA (mRNA) and hexokinase 1mRNA and protein. Our findings suggest to us that while E 2 promotes glycogen accumulation by the mink uterus during estrus and pregnancy, it is P 4 that induces uterine glycogen catabolism, releasing the glucose that is essential to support pre-embryonic survival and implantation. © 2016 Japanese Society of Animal Science.

  1. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Science.gov (United States)

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  2. Sugar versus fat: elimination of glycogen storage improves lipid accumulation in Yarrowia lipolytica.

    Science.gov (United States)

    Bhutada, Govindprasad; Kavšcek, Martin; Ledesma-Amaro, Rodrigo; Thomas, Stéphane; Rechberger, Gerald N; Nicaud, Jean-Marc; Natter, Klaus

    2017-05-01

    Triacylglycerol (TAG) and glycogen are the two major metabolites for carbon storage in most eukaryotic organisms. We investigated the glycogen metabolism of the oleaginous Yarrowia lipolytica and found that this yeast accumulates up to 16% glycogen in its biomass. Assuming that elimination of glycogen synthesis would result in an improvement of lipid accumulation, we characterized and deleted the single gene coding for glycogen synthase, YlGSY1. The mutant was grown under lipogenic conditions with glucose and glycerol as substrates and we obtained up to 60% improvement in TAG accumulation compared to the wild-type strain. Additionally, YlGSY1 was deleted in a background that was already engineered for high lipid accumulation. In this obese background, TAG accumulation was also further increased. The highest lipid content of 52% was found after 3 days of cultivation in nitrogen-limited glycerol medium. Furthermore, we constructed mutants of Y. lipolytica and Saccharomyces cerevisiae that are deleted for both glycogen and TAG synthesis, demonstrating that the ability to store carbon is not essential. Overall, this work showed that glycogen synthesis is a competing pathway for TAG accumulation in oleaginous yeasts and that deletion of the glycogen synthase has beneficial effects on neutral lipid storage. © FEMS 2017.

  3. Increased phosphorylation of skeletal muscle glycogen synthase at NH2-terminal sites during physiological hyperinsulinemia in type 2 diabetes

    DEFF Research Database (Denmark)

    Højlund, Kurt; Staehr, Peter; Hansen, Bo Falck

    2003-01-01

    In type 2 diabetes, insulin activation of muscle glycogen synthase (GS) is impaired. This defect plays a major role for the development of insulin resistance and hyperglycemia. In animal muscle, insulin activates GS by reducing phosphorylation at both NH(2)- and COOH-terminal sites......, but the mechanism involved in human muscle and the defect in type 2 diabetes remain unclear. We studied the effect of insulin at physiological concentrations on glucose metabolism, insulin signaling and phosphorylation of GS in skeletal muscle from type 2 diabetic and well-matched control subjects during euglycemic......-hyperinsulinemic clamps. Analysis using phospho-specific antibodies revealed that insulin decreases phosphorylation of sites 3a + 3b in human muscle, and this was accompanied by activation of Akt and inhibition of glycogen synthase kinase-3alpha. In type 2 diabetic subjects these effects of insulin were fully intact...

  4. Role of Maltose Enzymes in Glycogen Synthesis by Escherichia coli▿

    Science.gov (United States)

    Park, Jong-Tae; Shim, Jae-Hoon; Tran, Phuong Lan; Hong, In-Hee; Yong, Hwan-Ung; Oktavina, Ershita Fitria; Nguyen, Hai Dang; Kim, Jung-Wan; Lee, Tae Soo; Park, Sung-Hoon; Boos, Winfried; Park, Kwan-Hwa

    2011-01-01

    Mutants with deletion mutations in the glg and mal gene clusters of Escherichia coli MC4100 were used to gain insight into glycogen and maltodextrin metabolism. Glycogen content, molecular mass, and branch chain distribution were analyzed in the wild type and in ΔmalP (encoding maltodextrin phosphorylase), ΔmalQ (encoding amylomaltase), ΔglgA (encoding glycogen synthase), and ΔglgA ΔmalP derivatives. The wild type showed increasing amounts of glycogen when grown on glucose, maltose, or maltodextrin. When strains were grown on maltose, the glycogen content was 20 times higher in the ΔmalP strain (0.97 mg/mg protein) than in the wild type (0.05 mg/mg protein). When strains were grown on glucose, the ΔmalP strain and the wild type had similar glycogen contents (0.04 mg/mg and 0.03 mg/mg protein, respectively). The ΔmalQ mutant did not grow on maltose but showed wild-type amounts of glycogen when grown on glucose, demonstrating the exclusive function of GlgA for glycogen synthesis in the absence of maltose metabolism. No glycogen was found in the ΔglgA and ΔglgA ΔmalP strains grown on glucose, but substantial amounts (0.18 and 1.0 mg/mg protein, respectively) were found when they were grown on maltodextrin. This demonstrates that the action of MalQ on maltose or maltodextrin can lead to the formation of glycogen and that MalP controls (inhibits) this pathway. In vitro, MalQ in the presence of GlgB (a branching enzyme) was able to form glycogen from maltose or linear maltodextrins. We propose a model of maltodextrin utilization for the formation of glycogen in the absence of glycogen synthase. PMID:21421758

  5. Inhibition of Glycogen Synthase Kinase-3ß Enhances Cognitive Recovery after Stroke: The Role of TAK1

    Science.gov (United States)

    Venna, Venugopal Reddy; Benashski, Sharon E.; Chauhan, Anjali; McCullough, Louise D.

    2015-01-01

    Memory deficits are common among stroke survivors. Identifying neuroprotective agents that can prevent memory impairment or improve memory recovery is a vital area of research. Glycogen synthase kinase-3ß (GSK-3ß) is involved in several essential intracellular signaling pathways. Unlike many other kinases, GSK-3ß is active only when…

  6. Glycogen and its metabolism: some new developments and old themes

    Science.gov (United States)

    Roach, Peter J.; Depaoli-Roach, Anna A.; Hurley, Thomas D.; Tagliabracci, Vincent S.

    2016-01-01

    Glycogen is a branched polymer of glucose that acts as a store of energy in times of nutritional sufficiency for utilization in times of need. Its metabolism has been the subject of extensive investigation and much is known about its regulation by hormones such as insulin, glucagon and adrenaline (epinephrine). There has been debate over the relative importance of allosteric compared with covalent control of the key biosynthetic enzyme, glycogen synthase, as well as the relative importance of glucose entry into cells compared with glycogen synthase regulation in determining glycogen accumulation. Significant new developments in eukaryotic glycogen metabolism over the last decade or so include: (i) three-dimensional structures of the biosynthetic enzymes glycogenin and glycogen synthase, with associated implications for mechanism and control; (ii) analyses of several genetically engineered mice with altered glycogen metabolism that shed light on the mechanism of control; (iii) greater appreciation of the spatial aspects of glycogen metabolism, including more focus on the lysosomal degradation of glycogen; and (iv) glycogen phosphorylation and advances in the study of Lafora disease, which is emerging as a glycogen storage disease. PMID:22248338

  7. Glycogen supercompensation in rat soleus muscle during recovery from nonweight bearing

    Science.gov (United States)

    Henriksen, Erik J.; Kirby, Christopher R.; Tischler, Marc E.

    1989-01-01

    Events leading to the normalization of the glycogen metabolism in the soleus muscle of rat, altered by 72-h three days of hind-limb suspension, were investigated during the 72-h recovery period when the animals were allowed to bear weight on all four limbs. Relative importance of the factors affecting glycogen metabolism in skeletal muscle during the recovery period was also examined. Glycogen concentration was found to decrease within 15 min and up to 2 h of recovery, while muscle glucose 6-phosphate, and the fractional activities of glycogen phosphorylase and glycogen synthase increased. From 2 to 4 h, when the glycogen synthase activity remained elevated and the phosphorylase activity declined, glycogen concentration increased, until it reached maximum values at about 24 h, after which it started to decrease, reaching control values by 72 h. At 12 and 24 h, the inverse relationship between glycogen concentration and the synthase activity ratio was lost, indicating that the reloading transiently uncoupled glycogen control of this enzyme.

  8. Hexokinase 2, glycogen synthase and phosphorylase play a key role in muscle glycogen supercompensation

    DEFF Research Database (Denmark)

    Irimia, José M; Rovira, Jordi; Nielsen, Jakob N

    2012-01-01

    Glycogen-depleting exercise can lead to supercompensation of muscle glycogen stores, but the biochemical mechanisms of this phenomenon are still not completely understood.......Glycogen-depleting exercise can lead to supercompensation of muscle glycogen stores, but the biochemical mechanisms of this phenomenon are still not completely understood....

  9. The basal kinetic parameters of glycogen synthase in human myotube cultures are not affected by chronic high insulin exposure

    DEFF Research Database (Denmark)

    Gaster, M; Schrøder, H D; Handberg, A

    2001-01-01

    results show that chronic exposure of human myotubes to high insulin with or without high glucose did not affect the basal kinetic parameters but abolished the reactivity of GS to acute insulin stimulation. We suggest that insulin induced insulin resistance of GS is caused by a failure of acute insulin......There is no consensus regarding the results from in vivo and in vitro studies on the impact of chronic high insulin and/or high glucose exposure on acute insulin stimulation of glycogen synthase (GS) kinetic parameters in human skeletal muscle. The aim of this study was to evaluate the kinetic...... parameters of glycogen synthase activity in human myotube cultures at conditions of chronic high insulin combined or not with high glucose exposure, before and after a subsequent acute insulin stimulation. Acute insulin stimulation significantly increased the fractional activity (FV(0.1)) of GS, increased...

  10. Muscle glycogen synthesis before and after exercise.

    Science.gov (United States)

    Ivy, J L

    1991-01-01

    The importance of carbohydrates as a fuel source during endurance exercise has been known for 60 years. With the advent of the muscle biopsy needle in the 1960s, it was determined that the major source of carbohydrate during exercise was the muscle glycogen stores. It was demonstrated that the capacity to exercise at intensities between 65 to 75% VO2max was related to the pre-exercise level of muscle glycogen, i.e. the greater the muscle glycogen stores, the longer the exercise time to exhaustion. Because of the paramount importance of muscle glycogen during prolonged, intense exercise, a considerable amount of research has been conducted in an attempt to design the best regimen to elevate the muscle's glycogen stores prior to competition and to determine the most effective means of rapidly replenishing the muscle glycogen stores after exercise. The rate-limiting step in glycogen synthesis is the transfer of glucose from uridine diphosphate-glucose to an amylose chain. This reaction is catalysed by the enzyme glycogen synthase which can exist in a glucose-6-phosphate-dependent, inactive form (D-form) and a glucose-6-phosphate-independent, active form (I-form). The conversion of glycogen synthase from one form to the other is controlled by phosphorylation-dephosphorylation reactions. The muscle glycogen concentration can vary greatly depending on training status, exercise routines and diet. The pattern of muscle glycogen resynthesis following exercise-induced depletion is biphasic. Following the cessation of exercise and with adequate carbohydrate consumption, muscle glycogen is rapidly resynthesised to near pre-exercise levels within 24 hours. Muscle glycogen then increases very gradually to above-normal levels over the next few days. Contributing to the rapid phase of glycogen resynthesis is an increase in the percentage of glycogen synthase I, an increase in the muscle cell membrane permeability to glucose, and an increase in the muscle's sensitivity to insulin

  11. Swelling of rat hepatocytes stimulates glycogen synthesis

    NARCIS (Netherlands)

    Baquet, A.; Hue, L.; Meijer, A. J.; van Woerkom, G. M.; Plomp, P. J.

    1990-01-01

    In hepatocytes from fasted rats, several amino acids are known to stimulate glycogen synthesis via activation of glycogen synthase. The hypothesis that an increase in cell volume resulting from amino acid uptake may be involved in the stimulation of glycogen synthesis is supported by the following

  12. Platelet-derived growth factor-DD targeting arrests pathological angiogenesis by modulating glycogen synthase kinase-3beta phosphorylation.

    Science.gov (United States)

    Kumar, Anil; Hou, Xu; Lee, Chunsik; Li, Yang; Maminishkis, Arvydas; Tang, Zhongshu; Zhang, Fan; Langer, Harald F; Arjunan, Pachiappan; Dong, Lijin; Wu, Zhijian; Zhu, Linda Y; Wang, Lianchun; Min, Wang; Colosi, Peter; Chavakis, Triantafyllos; Li, Xuri

    2010-05-14

    Platelet-derived growth factor-DD (PDGF-DD) is a recently discovered member of the PDGF family. The role of PDGF-DD in pathological angiogenesis and the underlying cellular and molecular mechanisms remain largely unexplored. In this study, using different animal models, we showed that PDGF-DD expression was up-regulated during pathological angiogenesis, and inhibition of PDGF-DD suppressed both choroidal and retinal neovascularization. We also demonstrated a novel mechanism mediating the function of PDGF-DD. PDGF-DD induced glycogen synthase kinase-3beta (GSK3beta) Ser(9) phosphorylation and Tyr(216) dephosphorylation in vitro and in vivo, leading to increased cell survival. Consistently, GSK3beta activity was required for the antiangiogenic effect of PDGF-DD targeting. Moreover, PDGF-DD regulated the expression of GSK3beta and many other genes important for angiogenesis and apoptosis. Thus, we identified PDGF-DD as an important target gene for antiangiogenic therapy due to its pleiotropic effects on vascular and non-vascular cells. PDGF-DD inhibition may offer new therapeutic options to treat neovascular diseases.

  13. The muscle-specific protein phosphatase PP1G/R(GL)(G(M))is essential for activation of glycogen synthase by exercise

    DEFF Research Database (Denmark)

    Aschenbach, W G; Suzuki, Y; Breeden, K

    2001-01-01

    In skeletal muscle both insulin and contractile activity are physiological stimuli for glycogen synthesis, which is thought to result in part from the dephosphorylation and activation of glycogen synthase (GS). PP1G/R(GL)(G(M)) is a glycogen/sarcoplasmic reticulum-associated type 1 phosphatase...... that was originally postulated to mediate insulin control of glycogen metabolism. However, we recently showed (Suzuki, Y., Lanner, C., Kim, J.-H., Vilardo, P. G., Zhang, H., Jie Yang, J., Cooper, L. D., Steele, M., Kennedy, A., Bock, C., Scrimgeour, A., Lawrence, J. C. Jr., L., and DePaoli-Roach, A. A. (2001) Mol....... Cell. Biol. 21, 2683-2694) that insulin activates GS in muscle of R(GL)(G(M)) knockout (KO) mice similarly to the wild type (WT). To determine whether PP1G is involved in glycogen metabolism during muscle contractions, R(GL) KO and overexpressors (OE) were subjected to two models of contraction...

  14. Regulation of glycogen synthesis in rat skeletal muscle after glycogen-depleting contractile activity: effects of adrenaline on glycogen synthesis and activation of glycogen synthase and glycogen phosphorylase.

    OpenAIRE

    Franch, J; Aslesen, R; Jensen, J

    1999-01-01

    We investigated the effects of insulin and adrenaline on the rate of glycogen synthesis in skeletal muscles after electrical stimulation in vitro. The contractile activity decreased the glycogen concentration by 62%. After contractile activity, the glycogen stores were fully replenished at a constant and high rate for 3 h when 10 m-i.u./ml insulin was present. In the absence of insulin, only 65% of the initial glycogen stores was replenished. Adrenaline decreased insulin-stimulated glycogen s...

  15. Long-term effects of rapamycin treatment on insulin mediated phosphorylation of Akt/PKB and glycogen synthase activity

    International Nuclear Information System (INIS)

    Varma, Shailly; Shrivastav, Anuraag; Changela, Sheena; Khandelwal, Ramji L.

    2008-01-01

    Protein kinase B (Akt/PKB) is a Ser/Thr kinase that is involved in the regulation of cell proliferation/survival through mammalian target of rapamycin (mTOR) and the regulation of glycogen metabolism through glycogen synthase kinase 3β (GSK-3β) and glycogen synthase (GS). Rapamycin is an inhibitor of mTOR. The objective of this study was to investigate the effects of rapamycin pretreatment on the insulin mediated phosphorylation of Akt/PKB phosphorylation and GS activity in parental HepG2 and HepG2 cells with overexpression of constitutively active Akt1/PKB-α (HepG2-CA-Akt/PKB). Rapamycin pretreatment resulted in a decrease (20-30%) in the insulin mediated phosphorylation of Akt1 (Ser 473) in parental HepG2 cells but showed an upregulation of phosphorylation in HepG2-CA-Akt/PKB cells. Rictor levels were decreased (20-50%) in parental HepG2 cells but were not significantly altered in the HepG2-CA-Akt/PKB cells. Furthermore, rictor knockdown decreased the phosphorylation of Akt (Ser 473) by 40-60% upon rapamycin pretreatment. GS activity followed similar trends as that of phosphorylated Akt and so with rictor levels in these cells pretreated with rapamycin; parental HepG2 cells showed a decrease in GS activity, whereas as HepG2-CA-Akt/PKB cells showed an increase in GS activity. The changes in the levels of phosphorylated Akt/PKB (Ser 473) correlated with GS and protein phoshatase-1 activity

  16. Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose.

    Science.gov (United States)

    Parrou, J L; Teste, M A; François, J

    1997-06-01

    It is well known that glycogen and trehalose accumulate in yeast under nutrient starvation or entering into the stationary phase of growth, and that high levels of trehalose are found in heat-shocked cells. However, effects of various types of stress on trehalose, and especially on glycogen, are poorly documented. Taking into account that almost all genes encoding the enzymes involved in the metabolism of these two reserve carbohydrates contain between one and several copies of the stress-responsive element (STRE), an investigation was made of the possibility of a link between the potential transcriptional induction of these genes and the accumulation of glycogen and trehalose under different stress conditions. Using transcriptional fusions, it was found that all these genes were induced in a similar fashion, although to various extents, by temperature, osmotic and oxidative stresses. Experiments performed with an msn2/msn4 double mutant proved that the transcriptional induction of the genes encoding glycogen synthase (GSY2) and trehalose-6-phosphate synthase (TPS1) was needed for the small increase in glycogen and trehalose upon exposure to a mild heat stress and salt shock. However, the extent of transcriptional activation of these genes upon stresses in wild-type strains was not correlated with a proportional rise in either glycogen or trehalose. The major explanation for this lack of correlation comes from the fact that genes encoding the enzymes of the biosynthetic and of the biodegradative pathways were almost equally induced. Hence, trehalose and glycogen accumulated to much higher levels in cells lacking neutral trehalose or glycogen phosphorylase exposed to stress conditions, which suggested that one of the major effects of stress in yeast is to induce a wasteful expenditure of energy by increasing the recycling of these molecules. We also found that transcriptional induction of STRE-controlled genes was abolished at temperatures above 40 degree C, while

  17. Akt2 influences glycogen synthase activity in human skeletal muscle through regulation of NH2-terminal (sites 2+2a) phosphorylation

    DEFF Research Database (Denmark)

    Friedrichsen, Martin; Birk, Jesper Bratz; Richter, Erik

    2013-01-01

    Type 2 diabetes is characterized by reduced muscle glycogen synthesis. The key enzyme in this process, glycogen synthase (GS), is activated via proximal insulin signaling, but the exact molecular events remain unknown. We previously demonstrated that phosphorylation of Threonine-308 on Akt (p......Akt-T308), Akt2 activity, and GS activity in muscle were positivity associated with insulin sensitivity. Now, in the same study population, we determined the influence of several upstream elements in the canonical PI3K signaling on muscle GS activation. 181 non-diabetic twins were examined...

  18. Enantioselective synthesis of the novel chiral sulfoxide derivative as a glycogen synthase kinase 3beta inhibitor.

    Science.gov (United States)

    Saitoh, Morihisa; Kunitomo, Jun; Kimura, Eiji; Yamano, Toru; Itoh, Fumio; Kori, Masakuni

    2010-09-01

    Glycogen synthase kinase 3beta (GSK-3beta) inhibitors are expected to be attractive therapeutic agents for the treatment of Alzheimer's disease (AD). Recently we discovered sulfoxides (S)-1 as a novel GSK-3beta inhibitor having in vivo efficacy. We investigated practical asymmetric preparation methods for the scale-up synthesis of (S)-1. The highly enantioselective synthesis of (S)-1 (94% ee) was achieved by titanium-mediated oxidation with D-(-)-diethyl tartrate on gram scale.

  19. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3beta is implicated in the treatment of cervical carcinoma.

    Science.gov (United States)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3beta (GSK-3beta) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3beta(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3beta after transfection with GSK-3beta by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3beta (s9). Furthermore, we demonstrated GSK-3beta transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3beta was important to improve chemosensitization, indicating the significance of GSK-3beta-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  20. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yuan [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shu, Yi Min [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Wang, Shu Fang [Department of Pathology, Baylor College of Medicine, Houston, TX 77030 (United States); Da, Bang Hong; Wang, Ze Hua [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Li, Hua Bin [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Department of Medicine, Feinberg Medical School, Northwestern University, Chicago, IL 60611 (United States)

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  1. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    International Nuclear Information System (INIS)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-01-01

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy

  2. Identification and Functional Characterization of the Glycogen Synthesis Related Gene Glycogenin in Pacific Oysters (Crassostrea gigas).

    Science.gov (United States)

    Li, Busu; Meng, Jie; Li, Li; Liu, Sheng; Wang, Ting; Zhang, Guofan

    2017-09-06

    High glycogen levels in the Pacific oyster (Crassostrea gigas) contribute to its flavor, quality, and hardiness. Glycogenin (CgGN) is the priming glucosyltransferase that initiates glycogen biosynthesis. We characterized the full sequence and function of C. gigas CgGN. Three CgGN isoforms (CgGN-α, β, and γ) containing alternative exon regions were isolated. CgGN expression varied seasonally in the adductor muscle and gonadal area and was the highest in the adductor muscle. Autoglycosylation of CgGN can interact with glycogen synthase (CgGS) to complete glycogen synthesis. Subcellular localization analysis showed that CgGN isoforms and CgGS were located in the cytoplasm. Additionally, a site-directed mutagenesis experiment revealed that the Tyr200Phe and Tyr202Phe mutations could affect CgGN autoglycosylation. This is the first study of glycogenin function in marine bivalves. These findings will improve our understanding of glycogen synthesis and accumulation mechanisms in mollusks. The data are potentially useful for breeding high-glycogen oysters.

  3. Mechanism of activation of liver glycogen synthase by swelling

    NARCIS (Netherlands)

    Meijer, A. J.; Baquet, A.; Gustafson, L.; van Woerkom, G. M.; Hue, L.

    1992-01-01

    The mechanism linking the stimulation of liver glycogen synthesis to swelling induced either by amino acids or hypotonicity was studied in hepatocytes, in gel-filtered liver extracts, and in purified preparations of particulate glycogen to which glycogen-metabolizing enzymes are bound. High

  4. Expression of mismatch repair gene PMS2 in nasopharyngeal carcinoma and regulation by glycogen synthase kinase-3β in vivo and in vitro.

    Science.gov (United States)

    Fang, Jugao; Lei, Wenbin; Huang, Xiaoming; Li, Pingdong; Chen, Xiaohong; Zhu, Xiaolin; Wen, Weiping; Li, Huabin

    2012-02-01

    To evaluate the expression of mismatch repair gene PMS2 in human nasopharyngeal carcinoma (NPC) tissues and evaluate the effect of glycogen synthase kinase (GSK)-3β on PMS2 production in vivo and in vitro. The expression of PMS2 and inactivated phosphorylated GSK-3β(s9) was examined by immunohistochemical staining in 25 NPC tissues and the relation was determined by correlation analysis. The effect of GSK-3β transfection in CNE-2 cells on PMS2 production as well as cell apoptosis and chemosensitization were evaluated using small interference RNA (siRNA), immunoblotting and flow cytometric analysis in vitro. The expression of inactivated phosphorylated GSK-3β(s9) was found to negative correlated with PMS2 in vivo. And transfected GSK-3β was found to be able to enhance PMS2 production, and increase cell apoptosis in CNE-2 cells in combination with cisplatin administration in vitro. Inactivation of GSK-3β might be important for NPC tumorgenesis through negatively regulating PMS2 production, and enhanced PMS2 production by GSK-3β is beneficial for understanding the NPC tumorgenesis and developing potential strategy for future therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  5. The role of glycogen synthase in the development of hyperglycemia in type 2 diabetes - 'To store or not to store glucose, that's the question'

    DEFF Research Database (Denmark)

    Beck-Nielsen, Henning

    2012-01-01

    This review deals with the role of glycogen storage in skeletal muscle for the development of insulin resistance and type 2 diabetes. Specifically, the role of the enzyme glycogen synthase, which seems to be locked in its hyperphosphorylated and inactivated state, is discussed. This defect seems ...... to be secondary to ectopic lipid disposition in the muscle cells. These molecular defects are discussed in the context of the overall pathophysiology of hyperglycemia in type 2 diabetic subjects. Copyright © 2012 John Wiley & Sons, Ltd....

  6. Abnormal metabolism of glycogen phosphate as a cause for Lafora disease.

    Science.gov (United States)

    Tagliabracci, Vincent S; Girard, Jean Marie; Segvich, Dyann; Meyer, Catalina; Turnbull, Julie; Zhao, Xiaochu; Minassian, Berge A; Depaoli-Roach, Anna A; Roach, Peter J

    2008-12-05

    Lafora disease is a progressive myoclonus epilepsy with onset in the teenage years followed by neurodegeneration and death within 10 years. A characteristic is the widespread formation of poorly branched, insoluble glycogen-like polymers (polyglucosan) known as Lafora bodies, which accumulate in neurons, muscle, liver, and other tissues. Approximately half of the cases of Lafora disease result from mutations in the EPM2A gene, which encodes laforin, a member of the dual specificity protein phosphatase family that is able to release the small amount of covalent phosphate normally present in glycogen. In studies of Epm2a(-/-) mice that lack laforin, we observed a progressive change in the properties and structure of glycogen that paralleled the formation of Lafora bodies. At three months, glycogen metabolism remained essentially normal, even though the phosphorylation of glycogen has increased 4-fold and causes altered physical properties of the polysaccharide. By 9 months, the glycogen has overaccumulated by 3-fold, has become somewhat more phosphorylated, but, more notably, is now poorly branched, is insoluble in water, and has acquired an abnormal morphology visible by electron microscopy. These glycogen molecules have a tendency to aggregate and can be recovered in the pellet after low speed centrifugation of tissue extracts. The aggregation requires the phosphorylation of glycogen. The aggregrated glycogen sequesters glycogen synthase but not other glycogen metabolizing enzymes. We propose that laforin functions to suppress excessive glycogen phosphorylation and is an essential component of the metabolism of normally structured glycogen.

  7. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Directory of Open Access Journals (Sweden)

    Wang Ze

    2010-02-01

    Full Text Available Abstract Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9 expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA, co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9. Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  8. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Science.gov (United States)

    2010-01-01

    Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy. PMID:20178594

  9. Glycogen synthase kinase 3 alpha phosphorylates and regulates the osteogenic activity of Osterix.

    Science.gov (United States)

    Li, Hongyan; Jeong, Hyung Min; Choi, You Hee; Lee, Sung Ho; Jeong, Hye Gwang; Jeong, Tae Cheon; Lee, Kwang Youl

    2013-05-10

    Osteoblast-specific transcription factor Osterix is a zinc-finger transcription factor that required for osteoblast differentiation and new bone formation. The function of Osterix can be modulated by post-translational modification. Glycogen synthase kinase 3 alpha (GSK3α) is a multifunctional serine/threonine protein kinase that plays a role in the Wnt signaling pathways and is implicated in the control of several regulatory proteins and transcription factors. In the present study, we investigated how GSK3α regulates Osterix during osteoblast differentiation. Wide type GSK3α up-regulated the protein level, protein stability and transcriptional activity of Osterix. These results suggest that GSK3α regulates osteogenic activity of Osterix. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Glycogen Synthase Kinase 3 Inhibitors in the Next Horizon for Alzheimer's Disease Treatment

    Directory of Open Access Journals (Sweden)

    Ana Martinez

    2011-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK-3, a proline/serine protein kinase ubiquitously expressed and involved in many cellular signaling pathways, plays a key role in the pathogenesis of Alzheimer's disease (AD being probably the link between β-amyloid and tau pathology. A great effort has recently been done in the discovery and development of different new molecules, of synthetic and natural origin, able to inhibit this enzyme, and several kinetics mechanisms of binding have been described. The small molecule called tideglusib belonging to the thiadiazolidindione family is currently on phase IIb clinical trials for AD. The potential risks and benefits of this new kind of disease modifying drugs for the future therapy of AD are discussed in this paper.

  11. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    KAUST Repository

    Ruchti, E.

    2016-10-08

    The storage and use of glycogen, the main energy reserve in the brain, is a metabolic feature of astrocytes. Glycogen synthesis is regulated by Protein Targeting to Glycogen (PTG), a member of specific glycogen-binding subunits of protein phosphatase-1 (PPP1). It positively regulates glycogen synthesis through de-phosphorylation of both glycogen synthase (activation) and glycogen phosphorylase (inactivation). In cultured astrocytes, PTG mRNA levels were previously shown to be enhanced by the neurotransmitter noradrenaline. To achieve further insight into the role of PTG in the regulation of astrocytic glycogen, its levels of expression were manipulated in primary cultures of mouse cortical astrocytes using adenovirus-mediated overexpression of tagged-PTG or siRNA to downregulate its expression. Infection of astrocytes with adenovirus led to a strong increase in PTG expression and was associated with massive glycogen accumulation (>100 fold), demonstrating that increased PTG expression is sufficient to induce glycogen synthesis and accumulation. In contrast, siRNA-mediated downregulation of PTG resulted in a 2-fold decrease in glycogen levels. Interestingly, PTG downregulation strongly impaired long-term astrocytic glycogen synthesis induced by insulin or noradrenaline. Finally, these effects of PTG downregulation on glycogen metabolism could also be observed in cultured astrocytes isolated from PTG-KO mice. Collectively, these observations point to a major role of PTG in the regulation of glycogen synthesis in astrocytes and indicate that conditions leading to changes in PTG expression will directly impact glycogen levels in this cell type.

  12. Imidazopyridine-based inhibitors of glycogen synthase kinase 3: synthesis and evaluation of amide isostere replacements of the carboxamide scaffold.

    Science.gov (United States)

    Yngve, Ulrika; Söderman, Peter; Svensson, Mats; Rosqvist, Susanne; Arvidsson, Per I

    2012-11-01

    In this study, we explored the effect of bioisostere replacement in a series of glycogen synthase kinase 3 (GSK3) inhibitors based on the imidazopyridine core. The synthesis and biological evaluation of a number of novel sulfonamide, 1,2,4-oxadiazole, and thiazole derivates as amide bioisosteres, as well as a computational rationalization of the obtained results are reported. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  13. Glycogen synthase kinase-3β promotes cyst expansion in polycystic kidney disease.

    Science.gov (United States)

    Tao, Shixin; Kakade, Vijayakumar R; Woodgett, James R; Pandey, Pankaj; Suderman, Erin D; Rajagopal, Madhumitha; Rao, Reena

    2015-06-01

    Polycystic kidney diseases (PKDs) are inherited disorders characterized by the formation of fluid filled renal cysts. Elevated cAMP levels in PKDs stimulate progressive cyst enlargement involving cell proliferation and transepithelial fluid secretion often leading to end-stage renal disease. The glycogen synthase kinase-3 (GSK3) family of protein kinases consists of GSK3α and GSK3β isoforms and has a crucial role in multiple cellular signaling pathways. We previously found that GSK3β, a regulator of cell proliferation, is also crucial for cAMP generation and vasopressin-mediated urine concentration by the kidneys. However, the role of GSK3β in the pathogenesis of PKDs is not known. Here we found that GSK3β expression and activity were markedly upregulated and associated with cyst-lining epithelia in the kidneys of mice and humans with PKD. Renal collecting duct-specific gene knockout of GSK3β or pharmacological inhibition of GSK3 effectively slowed down the progression of PKD in mouse models of autosomal recessive or autosomal dominant PKD. GSK3 inactivation inhibited cAMP generation and cell proliferation resulting in reduced cyst expansion, improved renal function, and extended life span. GSK3β inhibition also reduced pERK, c-Myc, and cyclin-D1, known mitogens in proliferation of cystic epithelial cells. Thus, GSK3β has a novel functional role in PKD pathophysiology, and its inhibition may be therapeutically useful to slow down cyst expansion and progression of PKD.

  14. Glycogen synthase kinase-3β in patients with bipolar I disorder

    DEFF Research Database (Denmark)

    Jacoby, Anne S; Munkholm, Klaus; Vinberg, Maj

    2016-01-01

    OBJECTIVES: The enzyme glycogen synthase kinase-3β (GSK3β) is involved in the mechanisms of action of lithium and may play a role in relation to affective states in bipolar disorder. The objectives of the present study were to compare the activity of GSK-3β (measured as levels of phosphorylated GSK......-3β [p-GSK-3β]) between patients with bipolar disorder in the euthymic state and healthy control subjects, and to investigate whether GSK-3β activity varies with affective states in patients with bipolar I disorder. METHODS: In a prospective 6-12-month follow-up study, we investigated state......-specific, intraindividual alterations in the activity of GSK-3β in 60 patients with bipolar I disorder with an acute severe manic index episode and in subsequent euthymic, depressive and manic states and compared this with repeated measurements in healthy control subjects. Data were analyzed using linear mixed...

  15. Lack of liver glycogen causes hepatic insulin resistance and steatosis in mice.

    Science.gov (United States)

    Irimia, Jose M; Meyer, Catalina M; Segvich, Dyann M; Surendran, Sneha; DePaoli-Roach, Anna A; Morral, Nuria; Roach, Peter J

    2017-06-23

    Disruption of the Gys2 gene encoding the liver isoform of glycogen synthase generates a mouse strain (LGSKO) that almost completely lacks hepatic glycogen, has impaired glucose disposal, and is pre-disposed to entering the fasted state. This study investigated how the lack of liver glycogen increases fat accumulation and the development of liver insulin resistance. Insulin signaling in LGSKO mice was reduced in liver, but not muscle, suggesting an organ-specific defect. Phosphorylation of components of the hepatic insulin-signaling pathway, namely IRS1, Akt, and GSK3, was decreased in LGSKO mice. Moreover, insulin stimulation of their phosphorylation was significantly suppressed, both temporally and in an insulin dose response. Phosphorylation of the insulin-regulated transcription factor FoxO1 was somewhat reduced and insulin treatment did not elicit normal translocation of FoxO1 out of the nucleus. Fat overaccumulated in LGSKO livers, showing an aberrant distribution in the acinus, an increase not explained by a reduction in hepatic triglyceride export. Rather, when administered orally to fasted mice, glucose was directed toward hepatic lipogenesis as judged by the activity, protein levels, and expression of several fatty acid synthesis genes, namely, acetyl-CoA carboxylase, fatty acid synthase, SREBP1c, chREBP, glucokinase, and pyruvate kinase. Furthermore, using cultured primary hepatocytes, we found that lipogenesis was increased by 40% in LGSKO cells compared with controls. Of note, the hepatic insulin resistance was not associated with increased levels of pro-inflammatory markers. Our results suggest that loss of liver glycogen synthesis diverts glucose toward fat synthesis, correlating with impaired hepatic insulin signaling and glucose disposal. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. The alpha2-5'AMP-activated protein kinase is a site 2 glycogen synthase kinase in skeletal muscle and is responsive to glucose loading

    DEFF Research Database (Denmark)

    Jørgensen, Sebastian B; Nielsen, Jakob N.; Birk, Jesper Bratz

    2004-01-01

    The 5'AMP-activated protein kinase (AMPK) is a potential antidiabetic drug target. Here we show that the pharmacological activation of AMPK by 5-aminoimidazole-1-beta-4-carboxamide ribofuranoside (AICAR) leads to inactivation of glycogen synthase (GS) and phosphorylation of GS at Ser 7 (site 2). ...

  17. Glycogen synthase kinase-3 regulates inflammatory tolerance in astrocytes

    Science.gov (United States)

    Beurel, Eléonore; Jope, Richard S.

    2010-01-01

    Inflammatory tolerance is the down-regulation of inflammation upon repeated stimuli, which is well-established to occur in peripheral immune cells. However, less is known about inflammatory tolerance in the brain although it may provide an important protective mechanism from detrimental consequences of prolonged inflammation, which appears to occur in many psychiatric and neurodegenerative conditions. Array analysis of 308 inflammatory molecules produced by mouse primary astrocytes after two sequential stimulations with lipopolysaccharide (LPS) distinguished three classes, tolerant, sensitized and unaltered groups. For many of these inflammatory molecules, inhibition of glycogen synthase kinase-3 (GSK3) increased tolerance and reduced sensitization. Focusing on LPS-tolerance in interleukin-6 (IL-6) production, we found that microglia exhibited a strong tolerance response that matched that of macrophages, whereas astrocytes exhibited only partial tolerance. The astrocyte semi-tolerance was found to be regulated by GSK3. GSK3 inhibitors or knocking down GSK3 levels promoted LPS-tolerance and astrocytes expressing constitutively active GSK3 did not develop LPS-tolerance. These findings identify the critical role of GSK3 in counteracting IL-6 inflammatory tolerance in cells of the CNS, supporting the therapeutic potential of GSK3 inhibitors to reduce neuroinflammation by promoting tolerance. PMID:20553816

  18. Redox Switch for the Inhibited State of Yeast Glycogen Synthase Mimics Regulation by Phosphorylation

    Energy Technology Data Exchange (ETDEWEB)

    Mahalingan, Krishna K.; Baskaran†, Sulochanadevi; DePaoli-Roach, Anna A.; Roach, Peter J.; Hurley, Thomas D. (Indiana-Med)

    2017-01-10

    Glycogen synthase (GS) is the rate limiting enzyme in the synthesis of glycogen. Eukaryotic GS is negatively regulated by covalent phosphorylation and allosterically activated by glucose-6-phosphate (G-6-P). To gain structural insights into the inhibited state of the enzyme, we solved the crystal structure of yGsy2-R589A/R592A to a resolution of 3.3 Å. The double mutant has an activity ratio similar to the phosphorylated enzyme and also retains the ability to be activated by G-6-P. When compared to the 2.88 Å structure of the wild-type G-6-P activated enzyme, the crystal structure of the low-activity mutant showed that the N-terminal domain of the inhibited state is tightly held against the dimer-related interface thereby hindering acceptor access to the catalytic cleft. On the basis of these two structural observations, we developed a reversible redox regulatory feature in yeast GS by substituting cysteine residues for two highly conserved arginine residues. When oxidized, the cysteine mutant enzyme exhibits activity levels similar to the phosphorylated enzyme but cannot be activated by G-6-P. Upon reduction, the cysteine mutant enzyme regains normal activity levels and regulatory response to G-6-P activation.

  19. Glycogen phosphorylation and Lafora disease.

    Science.gov (United States)

    Roach, Peter J

    2015-12-01

    Covalent phosphorylation of glycogen, first described 35 years ago, was put on firm ground through the work of the Whelan laboratory in the 1990s. But glycogen phosphorylation lay fallow until interest was rekindled in the mid 2000s by the finding that it could be removed by a glycogen-binding phosphatase, laforin, and that mutations in laforin cause a fatal teenage-onset epilepsy, called Lafora disease. Glycogen phosphorylation is due to phosphomonoesters at C2, C3 and C6 of glucose residues. Phosphate is rare, ranging from 1:500 to 1:5000 phosphates/glucose depending on the glycogen source. The mechanisms of glycogen phosphorylation remain under investigation but one hypothesis to explain C2 and perhaps C3 phosphate is that it results from a rare side reaction of the normal synthetic enzyme glycogen synthase. Lafora disease is likely caused by over-accumulation of abnormal glycogen in insoluble deposits termed Lafora bodies in neurons. The abnormality in the glycogen correlates with elevated phosphorylation (at C2, C3 and C6), reduced branching, insolubility and an enhanced tendency to aggregate and become insoluble. Hyperphosphorylation of glycogen is emerging as an important feature of this deadly childhood disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Brain insulin action augments hepatic glycogen synthesis without suppressing glucose production or gluconeogenesis in dogs

    Science.gov (United States)

    Ramnanan, Christopher J.; Saraswathi, Viswanathan; Smith, Marta S.; Donahue, E. Patrick; Farmer, Ben; Farmer, Tiffany D.; Neal, Doss; Williams, Philip E.; Lautz, Margaret; Mari, Andrea; Cherrington, Alan D.; Edgerton, Dale S.

    2011-01-01

    In rodents, acute brain insulin action reduces blood glucose levels by suppressing the expression of enzymes in the hepatic gluconeogenic pathway, thereby reducing gluconeogenesis and endogenous glucose production (EGP). Whether a similar mechanism is functional in large animals, including humans, is unknown. Here, we demonstrated that in canines, physiologic brain hyperinsulinemia brought about by infusion of insulin into the head arteries (during a pancreatic clamp to maintain basal hepatic insulin and glucagon levels) activated hypothalamic Akt, altered STAT3 signaling in the liver, and suppressed hepatic gluconeogenic gene expression without altering EGP or gluconeogenesis. Rather, brain hyperinsulinemia slowly caused a modest reduction in net hepatic glucose output (NHGO) that was attributable to increased net hepatic glucose uptake and glycogen synthesis. This was associated with decreased levels of glycogen synthase kinase 3β (GSK3β) protein and mRNA and with decreased glycogen synthase phosphorylation, changes that were blocked by hypothalamic PI3K inhibition. Therefore, we conclude that the canine brain senses physiologic elevations in plasma insulin, and that this in turn regulates genetic events in the liver. In the context of basal insulin and glucagon levels at the liver, this input augments hepatic glucose uptake and glycogen synthesis, reducing NHGO without altering EGP. PMID:21865644

  1. Identification of differentially expressed genes in chickens differing in muscle glycogen content and meat quality

    Directory of Open Access Journals (Sweden)

    Marthey Sylvain

    2011-02-01

    Full Text Available Abstract Background The processing ability of poultry meat is highly related to its ultimate pH, the latter being mainly determined by the amount of glycogen in the muscle at death. The genetic determinism of glycogen and related meat quality traits has been established in the chicken but the molecular mechanisms involved in variations in these traits remain to be fully described. In this study, Chicken Genome Arrays (20 K were used to compare muscle gene expression profiles of chickens from Fat (F and Lean (L lines that exhibited high and low muscle glycogen content, respectively, and of individuals exhibiting extremely high (G+ or low (G- muscle glycogen content originating from the F2 cross between the Fat and Lean lines. Real-time RT-PCR was subsequently performed to validate the differential expression of genes either selected from the microarray analysis or whose function in regulating glycogen metabolism was well known. Results Among the genes found to be expressed in chicken P. major muscle, 197 and 254 transcripts appeared to be differentially expressed on microarrays for the F vs. L and the G+ vs. G- comparisons, respectively. Some involved particularly in lipid and carbohydrate metabolism were selected for further validation studies by real-time RT-PCR. We confirmed that, as in mammals, the down-regulation of CEBPB and RGS2 coincides with a decrease in peripheral adiposity in the chicken, but these genes are also suggested to affect muscle glycogen turnover through their role in the cAMP-dependent signalling pathway. Several other genes were suggested to have roles in the regulation of glycogen storage in chicken muscle. PDK4 may act as a glycogen sensor in muscle, UGDH may compete for glycogen synthesis by using UDP-glucose for glucoronidation, and PRKAB1, PRKAG2, and PHKD may impact on glycogen turnover in muscle, through AMP-activated signalling pathways. Conclusions This study is the first stage in the understanding of molecular

  2. Molecular Basis of Impaired Glycogen Metabolism during Ischemic Stroke and Hypoxia

    Science.gov (United States)

    Hossain, Mohammed Iqbal; Roulston, Carli Lorraine; Stapleton, David Ian

    2014-01-01

    Background Ischemic stroke is the combinatorial effect of many pathological processes including the loss of energy supplies, excessive intracellular calcium accumulation, oxidative stress, and inflammatory responses. The brain's ability to maintain energy demand through this process involves metabolism of glycogen, which is critical for release of stored glucose. However, regulation of glycogen metabolism in ischemic stroke remains unknown. In the present study, we investigate the role and regulation of glycogen metabolizing enzymes and their effects on the fate of glycogen during ischemic stroke. Results Ischemic stroke was induced in rats by peri-vascular application of the vasoconstrictor endothelin-1 and forebrains were collected at 1, 3, 6 and 24 hours post-stroke. Glycogen levels and the expression and activity of enzymes involved in glycogen metabolism were analyzed. We found elevated glycogen levels in the ipsilateral hemispheres compared with contralateral hemispheres at 6 and 24 hours (25% and 39% increase respectively; PGlycogen synthase activity and glycogen branching enzyme expression were found to be similar between the ipsilateral, contralateral, and sham control hemispheres. In contrast, the rate-limiting enzyme for glycogen breakdown, glycogen phosphorylase, had 58% lower activity (Pglycogen debranching enzyme expression 24 hours post-stroke was 77% (Pglycogen phosphorylase activity and increased glycogen accumulation but did not alter glycogen synthase activity. Furthermore, elevated glycogen levels provided metabolic support to astrocytes during hypoxia. Conclusion Our study has identified that glycogen breakdown is impaired during ischemic stroke, the molecular basis of which includes reduced glycogen debranching enzyme expression level together with reduced glycogen phosphorylase and PKA activity. PMID:24858129

  3. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  4. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  5. Hypothalamic glycogen synthase kinase 3β has a central role in the regulation of food intake and glucose metabolism

    OpenAIRE

    Benzler, Jonas; Ganjam, Goutham K.; Krüger, Manon; Pinkenburg, Olaf; Kutschke, Maria; Stöhr, Sigrid; Steger, Juliane; Koch, Christiane E.; Ölkrug, Rebecca; Schwartz, Michael W.; Shepherd, Peter R.; Grattan, David R.; Tups, Alexander

    2012-01-01

    GSK3β (glycogen synthase kinase 3β) is a ubiquitous kinase that plays a key role in multiple intracellular signalling pathways, and increased GSK3β activity is implicated in disorders ranging from cancer to Alzheimer’s disease. In the present study, we provide the first evidence of increased hypothalamic signalling via GSK3β in leptin-deficient Lepob/ob mice and show that intracerebroventricular injection of a GSK3β inhibitor acutely improves glucose tolerance in these mice. The beneficial ef...

  6. Studies of gene expression and activity of hexokinase, phosphofructokinase and glycogen synthase in human skeletal muscle in states of altered insulin-stimulated glucose metabolism

    DEFF Research Database (Denmark)

    Vestergaard, H

    1999-01-01

    been reported to increase the basal concentration of muscle GS mRNA in NIDDM patients to a level similar to that seen in control subjects although insulin-stimulated glucose disposal rates remain reduced in NIDDM patients. In the insulin resistant states examined so far, basal and insulin-stimulated......When whole body insulin-stimulated glucose disposal rate is measured in man applying the euglycaemic, hyperinsulinaemic clamp technique it has been shown that approximately 75% of glucose is taken up by skeletal muscle. After the initial transport step, glucose is rapidly phosphorylated to glucose...... critical roles in glucose oxidation/glycolysis and glucose storage, respectively. Glucose transporters and glycogen synthase activities are directly and acutely stimulated by insulin whereas the activities of hexokinases and phosphofructokinase may primarily be allosterically regulated. The aim...

  7. Dysfunctional Muscle and Liver Glycogen Metabolism in mdx Dystrophic Mice

    Science.gov (United States)

    Stapleton, David I.; Lau, Xianzhong; Flores, Marcelo; Trieu, Jennifer; Gehrig, Stefan M.; Chee, Annabel; Naim, Timur; Lynch, Gordon S.; Koopman, René

    2014-01-01

    Background Duchenne muscular dystrophy (DMD) is a severe, genetic muscle wasting disorder characterised by progressive muscle weakness. DMD is caused by mutations in the dystrophin (dmd) gene resulting in very low levels or a complete absence of the dystrophin protein, a key structural element of muscle fibres which is responsible for the proper transmission of force. In the absence of dystrophin, muscle fibres become damaged easily during contraction resulting in their degeneration. DMD patients and mdx mice (an animal model of DMD) exhibit altered metabolic disturbances that cannot be attributed to the loss of dystrophin directly. We tested the hypothesis that glycogen metabolism is defective in mdx dystrophic mice. Results Dystrophic mdx mice had increased skeletal muscle glycogen (79%, (Pglycogen synthesis is initiated by glycogenin, the expression of which was increased by 50% in mdx mice (PGlycogen synthase activity was 12% higher (Pglycogen branching enzyme activity was 70% lower (Pglycogen breakdown, glycogen phosphorylase, had 62% lower activity (Pglycogen debranching enzyme expression was 50% higher (Pglycogen (Pglycogen metabolism in mdx mice identified reduced glycogenin protein expression (46% less; Pglycogen but reduced amounts of liver glycogen. PMID:24626262

  8. Neuronal glycogen synthesis contributes to physiological aging.

    Science.gov (United States)

    Sinadinos, Christopher; Valles-Ortega, Jordi; Boulan, Laura; Solsona, Estel; Tevy, Maria F; Marquez, Mercedes; Duran, Jordi; Lopez-Iglesias, Carmen; Calbó, Joaquim; Blasco, Ester; Pumarola, Marti; Milán, Marco; Guinovart, Joan J

    2014-10-01

    Glycogen is a branched polymer of glucose and the carbohydrate energy store for animal cells. In the brain, it is essentially found in glial cells, although it is also present in minute amounts in neurons. In humans, loss-of-function mutations in laforin and malin, proteins involved in suppressing glycogen synthesis, induce the presence of high numbers of insoluble polyglucosan bodies in neuronal cells. Known as Lafora bodies (LBs), these deposits result in the aggressive neurodegeneration seen in Lafora's disease. Polysaccharide-based aggregates, called corpora amylacea (CA), are also present in the neurons of aged human brains. Despite the similarity of CA to LBs, the mechanisms and functional consequences of CA formation are yet unknown. Here, we show that wild-type laboratory mice also accumulate glycogen-based aggregates in the brain as they age. These structures are immunopositive for an array of metabolic and stress-response proteins, some of which were previously shown to aggregate in correlation with age in the human brain and are also present in LBs. Remarkably, these structures and their associated protein aggregates are not present in the aged mouse brain upon genetic ablation of glycogen synthase. Similar genetic intervention in Drosophila prevents the accumulation of glycogen clusters in the neuronal processes of aged flies. Most interestingly, targeted reduction of Drosophila glycogen synthase in neurons improves neurological function with age and extends lifespan. These results demonstrate that neuronal glycogen accumulation contributes to physiological aging and may therefore constitute a key factor regulating age-related neurological decline in humans. © 2014 The Authors. Aging cell published by the Anatomical Society and John Wiley & Sons Ltd.

  9. Mechanical unloading of the failing human heart fails to activate the protein kinase B/Akt/glycogen synthase kinase-3beta survival pathway.

    Science.gov (United States)

    Razeghi, Peter; Bruckner, Brian A; Sharma, Saumya; Youker, Keith A; Frazier, O H; Taegtmeyer, Heinrich

    2003-01-01

    Left ventricular assist device (LVAD) support of the failing human heart improves myocyte function and increases cell survival. One potential mechanism underlying this phenomenon is activation of the protein kinase B (PKB)/Akt/glycogen synthase kinase-3beta (GSK-3beta) survival pathway. Left ventricular tissue was obtained both at the time of implantation and explantation of the LVAD (n = 11). Six patients were diagnosed with idiopathic dilated cardiomyopathy, 4 patients with ischemic cardiomyopathy and 1 patient with peripartum cardiomyopathy. The mean duration of LVAD support was 205 +/- 35 days. Myocyte diameter and phosphorylation of ERK were used as indices for reverse remodeling. Transcript levels of genes required for the activation of PKB/Akt (insulin-like growth factor-1, insulin receptor substrate-1) were measured by quantitative RT-PCR. In addition, we measured the relative activity of PKB/Akt and GSK-3beta, and assayed for molecular and histological indices of PKB/Akt activation (cyclooxygenase mRNA levels and glycogen levels). Myocyte diameter and phosphorylation of ERK decreased with LVAD support. In contrast, none of the components of the PKB/Akt/GSK-3beta pathway changed significantly with mechanical unloading. The PKB/Akt/GSK-3beta pathway is not activated during LVAD support. Other signaling pathways must be responsible for the improvement of cellular function and cell survival during LVAD support. Copyright 2003 S. Karger AG, Basel

  10. Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens.

    Science.gov (United States)

    Cortés-Vieyra, Ricarda; Bravo-Patiño, Alejandro; Valdez-Alarcón, Juan J; Juárez, Marcos Cajero; Finlay, B Brett; Baizabal-Aguirre, Víctor M

    2012-06-12

    Glycogen synthase kinase 3β (GSK3β) plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB) activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.

  11. Presence of the glycogen synthase 1 (GYS1) mutation causing type 1 polysaccharide storage myopathy in continental European draught horse breeds.

    Science.gov (United States)

    Baird, J D; Valberg, S J; Anderson, S M; McCue, M E; Mickelson, J R

    2010-11-13

    The purpose of this study was to determine which continental European draught horse breeds harbour a mutation in the glycogen synthase 1 gene (GYS1) that is known to be responsible for type 1 polysaccharide storage myopathy in quarter horses and North American draught horses. Of a non-random selection of continental European draught horses belonging to 13 breeds, 62 per cent (250 of 403) tested were found to carry the mutant allele. The horses were located in Belgium, France, Germany, The Netherlands, Spain and Sweden. The mutation was identified in animals from each of the breeds examined. In the breeds in which more than 15 animals were available for testing, the highest percentages of GYS1-positive horses were found in the Belgian trekpaard (92 per cent; 35 of 38 horses tested), Comtois (80 per cent; 70 of 88), Netherlands trekpaard (74 per cent; 17 of 23), Rheinisch-Deutsches kaltblut (68 per cent; 30 of 44) and Breton (64 per cent; 32 of 51).

  12. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  13. Glycogen synthase kinase 3 phosphorylates kinesin light chains and negatively regulates kinesin-based motility

    Science.gov (United States)

    Morfini, Gerardo; Szebenyi, Gyorgyi; Elluru, Ravindhra; Ratner, Nancy; Brady, Scott T.

    2002-01-01

    Membrane-bounded organelles (MBOs) are delivered to different domains in neurons by fast axonal transport. The importance of kinesin for fast antero grade transport is well established, but mechanisms for regulating kinesin-based motility are largely unknown. In this report, we provide biochemical and in vivo evidence that kinesin light chains (KLCs) interact with and are in vivo substrates for glycogen synthase kinase 3 (GSK3). Active GSK3 inhibited anterograde, but not retrograde, transport in squid axoplasm and reduced the amount of kinesin bound to MBOs. Kinesin microtubule binding and microtubule-stimulated ATPase activities were unaffected by GSK3 phosphorylation of KLCs. Active GSK3 was also localized preferentially to regions known to be sites of membrane delivery. These data suggest that GSK3 can regulate fast anterograde axonal transport and targeting of cargos to specific subcellular domains in neurons.

  14. Nuclear glycogen synthase kinase-3 {beta} (GSK-3) in Rhipicephalus (Boophilus) microplus tick embryogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Mentzingen, Leticia; Andrade, Josiana G. de; Logullo, Carlos [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacazes, RJ (Brazil). Centro de Biociencias e Biotecnologia. Lab. de Quimica e Funcao de Proteinas e Peptideos (LQFPP); Andrade, Caroline P. de; Vaz Junior, Itabajara [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Centro de Biotecnologia

    2008-07-01

    Full text: Glycogen synthase kinase-3 (GSK3) is recognized as a key component of a large number of cellular processes and diseases. Several mechanisms play a part in controlling the actions of GSK3, including phosphorylation, protein complex formation, and subcellular distribution. Recent observations point to functions for phosphorylases several transcription factors in the nucleus. Also, GSK3b participate of the canonical W nt signalling pathway, which has been studied intensively in embryonic and cancer cells. Like in many other signaling pathways, most components in W nt signal transduction were highly conserved during the evolution. More than 40 proteins have been reported to be phosphorylated by GSK3, including over a dozen transcription factors. Although the mechanisms regulating GSK3 are not fully understood, precise control appears to be achieved by a combination of phosphorylation, localization, and interactions with GSK3-binding proteins. Although GSK3 is traditionally considered a cytosolic protein, it is also present in nuclei. Nuclear GSK3 is particularly interesting because of the many transcription factors that it regulates enabling GSK3 to influence many signaling pathways that converge on these transcription factors, thereby regulating the expression of many genes. Our group identified that GSK-3 {beta} could be detected in different stage eggs of R. micro plus. In this work we detected the GSK-3 in isolated nuclear fraction from the egg homogenates of R. micro plus by western-blot analysis, using anti-GSK- 3 {beta} antibodies. The enzyme activity was also detected radiochemically throughout embryogenesis in same fraction. The GSK-3 activity was inhibiting by using SB 216763 (selective molecule inhibitors of GSK-3). Taken together our results suggest that GSK-3 {beta} isoform probably is involved in gene transcription factors during R. micro plus embryo development.

  15. Aberrant glycogen synthase kinase 3β in the development of pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Takeo Shimasaki

    2012-01-01

    Full Text Available Development and progression of pancreatic cancer involves general metabolic disorder, local chronic inflammation, and multistep activation of distinct oncogenic molecular pathways. These pathologic processes result in a highly invasive and metastatic tumor phenotype that is a major obstacle to curative surgical intervention, infusional gemcitabine-based chemotherapy, and radiation therapy. Many clinical trials with chemical compounds and therapeutic antibodies targeting growth factors, angiogenic factors, and matrix metalloproteinases have failed to demonstrate definitive therapeutic benefits to refractory pancreatic cancer patients. Glycogen synthase kinase 3β (GSK3β, a serine/threonine protein kinase, has emerged as a therapeutic target in common chronic and progressive diseases, including cancer. Here we review accumulating evidence for a pathologic role of GSK3β in promoting tumor cell survival, proliferation, invasion, and resistance to chemotherapy and radiation in pancreatic cancer. We also discuss the putative involvement of GSK3β in mediating metabolic disorder, local inflammation, and molecular alteration leading to pancreatic cancer development. Taken together, we highlight potential therapeutic as well as preventive effects of GSK3β inhibition in pancreatic cancer.

  16. Inhibiting glycogen synthase kinase-3 and transforming growth factor-β signaling to promote epithelial transition of human adipose mesenchymal stem cells.

    Science.gov (United States)

    Setiawan, Melina; Tan, Xiao-Wei; Goh, Tze-Wei; Hin-Fai Yam, Gary; Mehta, Jodhbir S

    2017-09-02

    This study was aimed to investigate the epithelial differentiation of human adipose-derived mesenchymal stem cells (ADSCs) by inhibiting glycogen synthase kinase-3 (GSK3) and transforming growth factor β (TGFβ) signaling. STEMPRO human ADSCs at passage 2 were treated with CHIR99021 (GSK3 inhibitor), E-616452 (TGFβ1 receptor kinase inhibitor), A-83-01 (TGFβ type 1 receptor inhibitor), valproic acid (histone deacetylase inhibitor), tranylcypromine (monoamine oxidase inhibitor) and all-trans retinoic acid for 72 h. The mesenchymal-epithelial transition was shown by down-regulation of mesenchymal genes (Slug, Zinc Finger E-box Binding Homeobox 1 ZEB1, integrin α5 ITGA5 and vimentin VIM) and up-regulation of epithelial genes (E-cadherin, Epithelial Cell Adhesion Molecule EpCAM, Zonula Occludens-1 ZO-1, occludin, deltaN p63 δNp63, Transcription Factor 4 TCF4 and Twist Family bHLH Transcription Factor TWIST), compared to untreated ADSCs. Cell morphology and stress fiber pattern were examined and the treated cells became less migratory in scratch wound closure assay. The formation of cell junction complexes was observed under transmission electron microscopy. Global gene expression using GeneChip ® Human Genome U133 Array (Affymetrix) showed that the treatment up-regulated 540 genes (containing genes for cell cycle, cytoskeleton reorganization, chemotaxis, epithelium development and regulation of cell migration) and down-regulated 483 genes. Human ADSCs were transited to epithelial lineage by inhibiting GSK3 and TGFβ signaling. It can be an adult stem cell source for epithelial cell-based therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Cortés-Vieyra Ricarda

    2012-06-01

    Full Text Available Abstract Glycogen synthase kinase 3β (GSK3β plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.

  18. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  19. The consequences of long-term glycogen synthase kinase-3 inhibition on normal and insulin resistant rat hearts.

    Science.gov (United States)

    Flepisi, T B; Lochner, Amanda; Huisamen, Barbara

    2013-10-01

    Glycogen synthase kinase-3 (GSK-3) is a serine-threonine protein kinase, discovered as a regulator of glycogen synthase. GSK-3 may regulate the expression of SERCA-2a potentially affecting myocardial contractility. It is known to phosphorylate and inhibit IRS-1, thus disrupting insulin signalling. This study aimed to determine whether myocardial GSK-3 protein and its substrate proteins are dysregulated in obesity and insulin resistance, and whether chronic GSK-3 inhibition can prevent or reverse this. Weight matched male Wistar rats were rendered obese by hyperphagia using a special diet (DIO) for 16 weeks and compared to chow fed controls. Half of each group was treated with the GSK-3 inhibitor CHIR118637 (30 mg/kg/day) from week 12 to16 of the diet period. Biometric and biochemical parameters were measured and protein expression determined by Western blotting and specific antibodies. Ca(2+)ATPase activity was determined spectrophotometrically. Cardiomyocytes were prepared by collagenase perfusion and insulin stimulated 2-deoxy-glucose uptake determined. DIO rats were significantly heavier than controls, associated with increased intra-peritoneal fat and insulin resistance. GSK-3 inhibition did not affect weight but improved insulin resistance, also on cellular level. It had no effect on GSK-3 expression but elevated its phospho/total ratio and elevated IRS-2 expression. Obesity lowered SERCA-2a expression and activity while GSK-3 inhibition alleviated this. The phospho/total ratio of phospholamban underscored inhibition of SERCA-2a in obesity. In addition, signs of myocardial hypertrophy were observed in treated control rats. GSK-3 inhibition could not reverse all the detrimental effects of obesity but may be harmful in normal rat hearts. It regulates IRS-2, SERCA-2a and phospholamban expression but not IRS-1.

  20. Putative role of glycogen as a peripheral biomarker of GSK3β activity.

    Science.gov (United States)

    Frizzo, Marcos Emilio

    2013-09-01

    Glycogen synthase kinase 3-β (GSK3β) has a pivotal role in several intracellular signaling cascades that are involved in gene transcription, cytoskeletal reorganization, energy metabolism, cell cycle regulation, and apoptosis. This kinase has pleiotropic functions, and the importance of its activity has recently been shown in neurons and platelets. In addition to its regulatory function in several physiological events, changes in GSK3β activity have been associated with many psychiatric and neurodegenerative illnesses, such as Alzheimer's disease, schizophrenia and autism-spectrum disorders. Beside the reports of its involvement in several pathologies, it has become increasingly apparent that GSK3β might be a common therapeutic target for different classes of psychiatric drugs, and also that the GSK3β ratio may be a useful parameter to determine the biochemical changes that might occur during antidepressant treatment. Although GSK3β is commonly described as a key enzyme in a plethora of signaling cascades, originally it was identified as playing an important role in the regulation of glycogen synthesis, given its ability to inactivate glycogen synthase (GS) by phosphorylation. Acting as a constitutively active kinase, GSK3β phosphorylates GS, which results in a decrease of glycogen production. GSK3β phosphorylation increases glycogen synthesis and storage, while its dephosphorylation decreases glycogen synthesis. Inactivation of GSK3β leads to dephosphorylation of GS and increase in glycogen synthesis in the adipose tissue, muscle and liver. Glycogen levels are reduced by antidepressant treatment, and this effect seems to be related to an effect of drugs on GSK3β activity. Peripherally, glycogen is also abundantly found in platelets, where it is considered a major energy source, required for a variety of its functions, including the release reaction. Recently, analysis of platelets from patients with late-life major depression showed that active forms of

  1. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  2. Glycogen metabolism in the glucose-sensing and supply-driven β-cell.

    Science.gov (United States)

    Andersson, Lotta E; Nicholas, Lisa M; Filipsson, Karin; Sun, Jiangming; Medina, Anya; Al-Majdoub, Mahmoud; Fex, Malin; Mulder, Hindrik; Spégel, Peter

    2016-12-01

    Glycogen metabolism in β-cells may affect downstream metabolic pathways controlling insulin release. We examined glycogen metabolism in human islets and in the rodent-derived INS-1 832/13 β-cells and found them to express the same isoforms of key enzymes required for glycogen metabolism. Our findings indicate that glycogenesis is insulin-independent but influenced by extracellular glucose concentrations. Levels of glycogen synthase decrease with increasing glucose concentrations, paralleling accumulation of glycogen. We did not find cAMP-elicited glycogenolysis and insulin secretion to be causally related. In conclusion, our results reveal regulated glycogen metabolism in human islets and insulin-secreting cells. Whether glycogen metabolism affects insulin secretion under physiological conditions remains to be determined. © 2016 Federation of European Biochemical Societies.

  3. Brain glycogen in health and disease.

    Science.gov (United States)

    Duran, Jordi; Guinovart, Joan J

    2015-12-01

    Glycogen is present in the brain at much lower concentrations than in muscle or liver. However, by characterizing an animal depleted of brain glycogen, we have shown that the polysaccharide plays a key role in learning capacity and in activity-dependent changes in hippocampal synapse strength. Since glycogen is essentially found in astrocytes, the diverse roles proposed for this polysaccharide in the brain have been attributed exclusively to these cells. However, we have demonstrated that neurons have an active glycogen metabolism that contributes to tolerance to hypoxia. However, these cells can store only minute amounts of glycogen, since the progressive accumulation of this molecule leads to neuronal loss. Loss-of-function mutations in laforin and malin cause Lafora disease. This condition is characterized by the presence of high numbers of insoluble polyglucosan bodies, known as Lafora bodies, in neuronal cells. Our findings reveal that the accumulation of this aberrant glycogen accounts for the neurodegeneration and functional consequences, as well as the impaired autophagy, observed in models of this disease. Similarly glycogen synthase is responsible for the accumulation of corpora amylacea, which are polysaccharide-based aggregates present in the neurons of aged human brains. Our findings change the current view of the role of glycogen in the brain and reveal that endogenous neuronal glycogen metabolism is important under stress conditions and that neuronal glycogen accumulation contributes to neurodegenerative diseases and to aging-related corpora amylacea formation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Inhibition of glycogen synthase kinase-3β attenuates glucocorticoid-induced suppression of myogenic differentiation in vitro.

    Directory of Open Access Journals (Sweden)

    Zhenyu Ma

    Full Text Available Glucocorticoids are the only therapy that has been demonstrated to alter the progress of Duchenne muscular dystrophy (DMD, the most common muscular dystrophy in children. However, glucocorticoids disturb skeletal muscle metabolism and hamper myogenesis and muscle regeneration. The mechanisms involved in the glucocorticoid-mediated suppression of myogenic differentiation are not fully understood. Glycogen synthase kinase-3β (GSK-3β is considered to play a central role as a negative regulator in myogenic differentiation. Here, we showed that glucocorticoid treatment during the first 48 h in differentiation medium decreased the level of phosphorylated Ser9-GSK-3β, an inactive form of GSK-3β, suggesting that glucocorticoids affect GSK-3β activity. We then investigated whether GSK-3β inhibition could regulate glucocorticoid-mediated suppression of myogenic differentiation in vitro. Two methods were employed to inhibit GSK-3β: pharmacological inhibition with LiCl and GSK-3β gene knockdown. We found that both methods resulted in enhanced myotube formation and increased levels of muscle regulatory factors and muscle-specific protein expression. Importantly, GSK-3β inhibition attenuated glucocorticoid-induced suppression of myogenic differentiation. Collectively, these data suggest the involvement of GSK-3β in the glucocorticoid-mediated impairment of myogenic differentiation. Therefore, the inhibition of GSK-3β may be a strategy for preventing glucocorticoid-induced muscle degeneration.

  5. Glycogen and glucose metabolism are essential for early embryonic development of the red flour beetle Tribolium castaneum.

    Directory of Open Access Journals (Sweden)

    Amanda Fraga

    Full Text Available Control of energy metabolism is an essential process for life. In insects, egg formation (oogenesis and embryogenesis is dependent on stored molecules deposited by the mother or transcribed later by the zygote. In oviparous insects the egg becomes an isolated system after egg laying with all energy conversion taking place during embryogenesis. Previous studies in a few vector species showed a strong correlation of key morphogenetic events and changes in glucose metabolism. Here, we investigate glycogen and glucose metabolism in the red flour beetle Tribolium castaneum, an insect amenable to functional genomic studies. To examine the role of the key enzymes on glycogen and glucose regulation we cloned and analyzed the function of glycogen synthase kinase 3 (GSK-3 and hexokinase (HexA genes during T. castaneum embryogenesis. Expression analysis via in situ hybridization shows that both genes are expressed only in the embryonic tissue, suggesting that embryonic and extra-embryonic cells display different metabolic activities. dsRNA adult female injection (parental RNAi of both genes lead a reduction in egg laying and to embryonic lethality. Morphological analysis via DAPI stainings indicates that early development is impaired in Tc-GSK-3 and Tc-HexA1 RNAi embryos. Importantly, glycogen levels are upregulated after Tc-GSK-3 RNAi and glucose levels are upregulated after Tc-HexA1 RNAi, indicating that both genes control metabolism during embryogenesis and oogenesis, respectively. Altogether our results show that T. castaneum embryogenesis depends on the proper control of glucose and glycogen.

  6. Glycogen and Glucose Metabolism Are Essential for Early Embryonic Development of the Red Flour Beetle Tribolium castaneum

    Science.gov (United States)

    Fraga, Amanda; Ribeiro, Lupis; Lobato, Mariana; Santos, Vitória; Silva, José Roberto; Gomes, Helga; da Cunha Moraes, Jorge Luiz; de Souza Menezes, Jackson

    2013-01-01

    Control of energy metabolism is an essential process for life. In insects, egg formation (oogenesis) and embryogenesis is dependent on stored molecules deposited by the mother or transcribed later by the zygote. In oviparous insects the egg becomes an isolated system after egg laying with all energy conversion taking place during embryogenesis. Previous studies in a few vector species showed a strong correlation of key morphogenetic events and changes in glucose metabolism. Here, we investigate glycogen and glucose metabolism in the red flour beetle Tribolium castaneum, an insect amenable to functional genomic studies. To examine the role of the key enzymes on glycogen and glucose regulation we cloned and analyzed the function of glycogen synthase kinase 3 (GSK-3) and hexokinase (HexA) genes during T. castaneum embryogenesis. Expression analysis via in situ hybridization shows that both genes are expressed only in the embryonic tissue, suggesting that embryonic and extra-embryonic cells display different metabolic activities. dsRNA adult female injection (parental RNAi) of both genes lead a reduction in egg laying and to embryonic lethality. Morphological analysis via DAPI stainings indicates that early development is impaired in Tc-GSK-3 and Tc-HexA1 RNAi embryos. Importantly, glycogen levels are upregulated after Tc-GSK-3 RNAi and glucose levels are upregulated after Tc-HexA1 RNAi, indicating that both genes control metabolism during embryogenesis and oogenesis, respectively. Altogether our results show that T. castaneum embryogenesis depends on the proper control of glucose and glycogen. PMID:23750237

  7. Effect of acute exercise on glycogen synthase in muscle from obese and diabetic subjects.

    Science.gov (United States)

    Jensen, Jørgen; Tantiwong, Puntip; Stuenæs, Jorid T; Molina-Carrion, Marjorie; DeFronzo, Ralph A; Sakamoto, Kei; Musi, Nicolas

    2012-07-01

    Insulin stimulates glycogen synthase (GS) through dephosphorylation of serine residues, and this effect is impaired in skeletal muscle from insulin-resistant [obese and type 2 diabetic (T2DM)] subjects. Exercise also increases GS activity, yet it is not known whether the ability of exercise to affect GS is impaired in insulin-resistant subjects. The objective of this study was to examine the effect of acute exercise on GS phosphorylation and enzyme kinetic properties in muscle from insulin-resistant individuals. Lean normal glucose-tolerant (NGT), obese NGT, and obese T2DM subjects performed 40 min of moderate-intensity cycle exercise (70% of Vo(2max)). GS kinetic properties and phosphorylation were measured in vastus lateralis muscle before exercise, immediately after exercise, and 3.5 h postexercise. In lean subjects, GS fractional activity increased twofold after 40 min of exercise, and it remained elevated after the 3.5-h rest period. Importantly, exercise also decreased GS K(m) for UDP-glucose from ≈0.5 to ≈0.2 mM. In lean subjects, exercise caused significant dephosphorylation of GS by 50-70% (Ser(641), Ser(645), and Ser(645,649,653,657)), and phosphorylation of these sites remained decreased after 3.5 h; Ser⁷ phosphorylation was not regulated by exercise. In obese NGT and T2DM subjects, exercise increased GS fractional activity, decreased K(m) for UDP-glucose, and decreased GS phosphorylation as effectively as in lean NGT subjects. We conclude that the molecular regulatory process by which exercise promotes glycogen synthesis in muscle is preserved in insulin-resistant subjects.

  8. An efficient nonviral gene-delivery vector based on hyperbranched cationic glycogen derivatives

    Directory of Open Access Journals (Sweden)

    Liang X

    2014-01-01

    Full Text Available Xuan Liang,1,* Xianyue Ren,2,* Zhenzhen Liu,1 Yingliang Liu,1 Jue Wang,2 Jingnan Wang,2 Li-Ming Zhang,1 David YB Deng,2 Daping Quan,1 Liqun Yang1 1Institute of Polymer Science, School of Chemistry and Chemical Engineering, Key Laboratory of Designed Synthesis and Application of Polymer Material, Key Laboratory for Polymeric Composite and Functional Materials of Ministry of Education, Sun Yat-Sen University, Guangzhou, People's Republic of China; 2Research Center of Translational Medicine, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, People's Republic of China *Both these authors contributed equally to this work Background: The purpose of this study was to synthesize and evaluate hyperbranched cationic glycogen derivatives as an efficient nonviral gene-delivery vector. Methods: A series of hyperbranched cationic glycogen derivatives conjugated with 3-(dimethylamino-1-propylamine (DMAPA-Glyp and 1-(2-aminoethyl piperazine (AEPZ-Glyp residues were synthesized and characterized by Fourier-transform infrared and hydrogen-1 nuclear magnetic resonance spectroscopy. Their buffer capacity was assessed by acid–base titration in aqueous NaCl solution. Plasmid deoxyribonucleic acid (pDNA condensation ability and protection against DNase I degradation of the glycogen derivatives were assessed using agarose gel electrophoresis. The zeta potentials and particle sizes of the glycogen derivative/pDNA complexes were measured, and the images of the complexes were observed using atomic force microscopy. Blood compatibility and cytotoxicity were evaluated by hemolysis assay and MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay, respectively. pDNA transfection efficiency mediated by the cationic glycogen derivatives was evaluated by flow cytometry and fluorescence microscopy in the 293T (human embryonic kidney and the CNE2 (human nasopharyngeal carcinoma cell lines. In vivo delivery of pDNA in model animals (Sprague Dawley

  9. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  10. Activation of GABAB receptors inhibits protein kinase B /Glycogen Synthase Kinase 3 signaling

    Directory of Open Access Journals (Sweden)

    Lu Frances Fangjia

    2012-11-01

    Full Text Available Abstract Accumulated evidence has suggested that potentiation of cortical GABAergic inhibitory neurotransmission may be a key mechanism in the treatment of schizophrenia. However, the downstream molecular mechanisms related to GABA potentiation remain unexplored. Recent studies have suggested that dopamine D2 receptor antagonists, which are used in the clinical treatment of schizophrenia, modulate protein kinase B (Akt/glycogen synthase kinase (GSK-3 signaling. Here we report that activation of GABAB receptors significantly inhibits Akt/GSK-3 signaling in a β-arrestin-dependent pathway. Agonist stimulation of GABAB receptors enhances the phosphorylation of Akt (Thr-308 and enhances the phosphorylation of GSK-3α (Ser-21/β (Ser-9 in both HEK-293T cells expressing GABAB receptors and rat hippocampal slices. Furthermore, knocking down the expression of β-arrestin2 using siRNA abolishes the GABAB receptor-mediated modulation of GSK-3 signaling. Our data may help to identify potentially novel targets through which GABAB receptor agents may exert therapeutic effects in the treatment of schizophrenia.

  11. A whole-body model for glycogen regulation reveals a critical role for substrate cycling in maintaining blood glucose homeostasis.

    Directory of Open Access Journals (Sweden)

    Ke Xu

    2011-12-01

    Full Text Available Timely, and sometimes rapid, metabolic adaptation to changes in food supply is critical for survival as an organism moves from the fasted to the fed state, and vice versa. These transitions necessitate major metabolic changes to maintain energy homeostasis as the source of blood glucose moves away from ingested carbohydrates, through hepatic glycogen stores, towards gluconeogenesis. The integration of hepatic glycogen regulation with extra-hepatic energetics is a key aspect of these adaptive mechanisms. Here we use computational modeling to explore hepatic glycogen regulation under fed and fasting conditions in the context of a whole-body model. The model was validated against previous experimental results concerning glycogen phosphorylase a (active and glycogen synthase a dynamics. The model qualitatively reproduced physiological changes that occur during transition from the fed to the fasted state. Analysis of the model reveals a critical role for the inhibition of glycogen synthase phosphatase by glycogen phosphorylase a. This negative regulation leads to high levels of glycogen synthase activity during fasting conditions, which in turn increases substrate (futile cycling, priming the system for a rapid response once an external source of glucose is restored. This work demonstrates that a mechanistic understanding of the design principles used by metabolic control circuits to maintain homeostasis can benefit from the incorporation of mathematical descriptions of these networks into "whole-body" contextual models that mimic in vivo conditions.

  12. Influence of pre-exercise muscle glycogen content on exercise-induced transcriptional regulation of metabolic genes

    DEFF Research Database (Denmark)

    Pilegaard, Henriette; Keller, Charlotte; Steensberg, Adam

    2002-01-01

    Transcription of metabolic genes is transiently induced during recovery from exercise in skeletal muscle of humans. To determine whether pre-exercise muscle glycogen content influences the magnitude and/or duration of this adaptive response, six male subjects performed one-legged cycling exercise...... to lower muscle glycogen content in one leg and then, the following day, completed 2.5 h low intensity two-legged cycling exercise. Nuclei and mRNA were isolated from biopsies obtained from the vastus lateralis muscle of the control and reduced glycogen (pre-exercise glycogen = 609 +/- 47 and 337 +/- 33...... mmol kg(-1) dry weight, respectively) legs before and after 0, 2 and 5 h of recovery. Exercise induced a significant (P glycogen leg only. Although PDK4...

  13. Variations in Glycogen Synthesis in Human Pluripotent Stem Cells with Altered Pluripotent States

    Science.gov (United States)

    Chen, Richard J.; Zhang, Guofeng; Garfield, Susan H.; Shi, Yi-Jun; Chen, Kevin G.; Robey, Pamela G.; Leapman, Richard D.

    2015-01-01

    Human pluripotent stem cells (hPSCs) represent very promising resources for cell-based regenerative medicine. It is essential to determine the biological implications of some fundamental physiological processes (such as glycogen metabolism) in these stem cells. In this report, we employ electron, immunofluorescence microscopy, and biochemical methods to study glycogen synthesis in hPSCs. Our results indicate that there is a high level of glycogen synthesis (0.28 to 0.62 μg/μg proteins) in undifferentiated human embryonic stem cells (hESCs) compared with the glycogen levels (0 to 0.25 μg/μg proteins) reported in human cancer cell lines. Moreover, we found that glycogen synthesis was regulated by bone morphogenetic protein 4 (BMP-4) and the glycogen synthase kinase 3 (GSK-3) pathway. Our observation of glycogen bodies and sustained expression of the pluripotent factor Oct-4 mediated by the potent GSK-3 inhibitor CHIR-99021 reveals an altered pluripotent state in hPSC culture. We further confirmed glycogen variations under different naïve pluripotent cell growth conditions based on the addition of the GSK-3 inhibitor BIO. Our data suggest that primed hPSCs treated with naïve growth conditions acquire altered pluripotent states, similar to those naïve-like hPSCs, with increased glycogen synthesis. Furthermore, we found that suppression of phosphorylated glycogen synthase was an underlying mechanism responsible for altered glycogen synthesis. Thus, our novel findings regarding the dynamic changes in glycogen metabolism provide new markers to assess the energetic and various pluripotent states in hPSCs. The components of glycogen metabolic pathways offer new assays to delineate previously unrecognized properties of hPSCs under different growth conditions. PMID:26565809

  14. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  15. Lack of Glycogenin Causes Glycogen Accumulation and Muscle Function Impairment.

    Science.gov (United States)

    Testoni, Giorgia; Duran, Jordi; García-Rocha, Mar; Vilaplana, Francisco; Serrano, Antonio L; Sebastián, David; López-Soldado, Iliana; Sullivan, Mitchell A; Slebe, Felipe; Vilaseca, Marta; Muñoz-Cánoves, Pura; Guinovart, Joan J

    2017-07-05

    Glycogenin is considered essential for glycogen synthesis, as it acts as a primer for the initiation of the polysaccharide chain. Against expectations, glycogenin-deficient mice (Gyg KO) accumulate high amounts of glycogen in striated muscle. Furthermore, this glycogen contains no covalently bound protein, thereby demonstrating that a protein primer is not strictly necessary for the synthesis of the polysaccharide in vivo. Strikingly, in spite of the higher glycogen content, Gyg KO mice showed lower resting energy expenditure and less resistance than control animals when subjected to endurance exercise. These observations can be attributed to a switch of oxidative myofibers toward glycolytic metabolism. Mice overexpressing glycogen synthase in the muscle showed similar alterations, thus indicating that this switch is caused by the excess of glycogen. These results may explain the muscular defects of GSD XV patients, who lack glycogenin-1 and show high glycogen accumulation in muscle. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Lithium Impairs Kidney Development and Inhibits Glycogen Synthase Kinase-3β in Collecting Duct Principal Cells

    DEFF Research Database (Denmark)

    Kjærsgaard, Gitte; Madsen, Kirsten; Marcussen, Niels

    level significantly whereas total GSK-3β abundance was unaltered. Li+ treatment increased α-Smooth Muscle Actin (α-SMA) protein level significantly whereas E-cadherin expression was unaltered. In summary, Li+ treatment impairs postnatal development of the kidney cortex and outer medulla and increases pGSK......The postnatal rat kidney is highly susceptible to Lithium (Li+), which leads to significant tissue injury. We hypothesized that Li+ impairs development of the kidney through entry into epithelial cells of the distal nephron, inhibition of Glycogen Synthase Kinase-3β (GSK-3β) through phosphorylation...... on serine9 (pGSK-3β)and subsequent epithelial to mesenchymal dedifferentiation (EMT). GSK-3β immunoreactive protein was associated with collecting ducts in developing and adult human and rat kidney. Total GSK-3β protein abundance was stable in medulla while it decreased in cortex in the postnatal period...

  17. Regulation of mouse brain glycogen synthase kinase-3 by atypical antipsychotics.

    Science.gov (United States)

    Li, Xiaohua; Rosborough, Kelley M; Friedman, Ari B; Zhu, Wawa; Roth, Kevin A

    2007-02-01

    Glycogen synthase kinase-3 (GSK3) has been recognized as an important enzyme that modulates many aspects of neuronal function. Accumulating evidence implicates abnormal activity of GSK3 in mood disorders and schizophrenia, and GSK3 is a potential protein kinase target for psychotropics used in these disorders. We previously reported that serotonin, a major neurotransmitter involved in mood disorders, regulates GSK3 by acutely increasing its N-terminal serine phosphorylation. The present study was undertaken to further determine if atypical antipsychotics, which have therapeutic effects in both mood disorders and schizophrenia, can regulate phospho-Ser-GSK3 and inhibit its activity. The results showed that acute treatment of mice with risperidone rapidly increased the level of brain phospho-Ser-GSK3 in the cortex, hippocampus, striatum, and cerebellum in a dose-dependent manner. Regulation of phospho-Ser-GSK3 was a shared effect among several atypical antipsychotics, including olanzapine, clozapine, quetiapine, and ziprasidone. In addition, combination treatment of mice with risperidone and a monoamine reuptake inhibitor antidepressant imipramine or fluoxetine elicited larger increases in brain phospho-Ser-GSK3 than each agent alone. Taken together, these results provide new information suggesting that atypical antipsychotics, in addition to mood stabilizers and antidepressants, can inhibit the activity of GSK3. These findings may support the pharmacological mechanisms of atypical antipsychotics in the treatment of mood disorders.

  18. Regulation of glycogen metabolism by the CRE-1, RCO-1 and RCM-1 proteins in Neurospora crassa. The role of CRE-1 as the central transcriptional regulator.

    Science.gov (United States)

    Cupertino, Fernanda Barbosa; Virgilio, Stela; Freitas, Fernanda Zanolli; Candido, Thiago de Souza; Bertolini, Maria Célia

    2015-04-01

    The transcription factor CreA/Mig1/CRE-1 is a repressor protein that regulates the use of alternative carbon sources via a mechanism known as Carbon Catabolite Repression (CCR). In Saccharomyces cerevisiae, Mig1 recruits the complex Ssn6-Tup1, the Neurospora crassa RCM-1 and RCO-1 orthologous proteins, respectively, to bind to promoters of glucose-repressible genes. We have been studying the regulation of glycogen metabolism in N. crassa and the identification of the RCO-1 corepressor as a regulator led us to investigate the regulatory role of CRE-1 in this process. Glycogen content is misregulated in the rco-1(KO), rcm-1(RIP) and cre-1(KO) strains, and the glycogen synthase phosphorylation is decreased in all strains, showing that CRE-1, RCO-1 and RCM-1 proteins are involved in glycogen accumulation and in the regulation of GSN activity by phosphorylation. We also confirmed the regulatory role of CRE-1 in CCR and its nuclear localization under repressing condition in N. crassa. The expression of all glycogenic genes is misregulated in the cre-1(KO) strain, suggesting that CRE-1 also controls glycogen metabolism by regulating gene expression. The existence of a high number of the Aspergillus nidulans CreA motif (5'-SYGGRG-3') in the glycogenic gene promoters led us to analyze the binding of CRE-1 to some DNA motifs both in vitro by DNA gel shift and in vivo by ChIP-qPCR analysis. CRE-1 bound in vivo to all motifs analyzed demonstrating that it down-regulates glycogen metabolism by controlling gene expression and GSN phosphorylation. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. The glycogen metabolism via Akt signaling is important for the secretion of enamel matrix in tooth development.

    Science.gov (United States)

    Ida-Yonemochi, Hiroko; Otsu, Keishi; Ohshima, Hayato; Harada, Hidemitsu

    2016-02-01

    Cells alter their energy metabolism depending on the stage of differentiation or various environments. In the ameloblast differentiation of continuous growing mouse incisors, we found temporary glycogen storage in preameloblasts before the start of enamel matrix secretion and investigated the relationship between enamel matrix secretion and glycogen metabolism. Immunohistochemistry showed that in the transitional stage from preameloblasts to secretory ameloblasts, the glycogen synthase changed from the inactive form to the active form, the expression of glycogen phosphorylase increased, and further, the levels of IGF-1, IGF-1 receptor and activated Akt increased. These results suggested that the activation of Akt signaling via IGF is linked to the onset of both glycogen metabolism and enamel matrix deposition. In the experiments using organ culture and ameloblast cell line, the activation of Akt signaling by IGF-1 stimulated glycogen metabolism through the up-regulation of Glut-1,-4 and Gsk-3β and the dephosphorylation of glycogen synthase. Subsequently, they resulted in increased enamel matrix secretion. In contrast, some inhibitors of Akt signals and glycogen synthesis/degradation down-regulated enamel matrix secretion. Taking these findings together, glycogen metabolism via Akt signaling is an essential system for the secretion of enamel matrix in ameloblast differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Glycogen synthesis in glycogenin 1-deficient patients

    DEFF Research Database (Denmark)

    Krag, Thomas O.; Ruiz-Ruiz, Cristina; Vissing, John

    2017-01-01

    Context: Glycogen storage disease (GSD) type XV is a rare disease caused by mutations in the GYG1 gene that codes for the core molecule of muscle glycogen, glycogenin 1. Nonetheless, glycogen is present in muscles of glycogenin 1-deficient patients, suggesting an alternative for glycogen buildup....... A likely candidate is glycogenin 2, an isoform expressed in the liver and heart but not in healthy skeletal muscle. Objective: We wanted to investigate the formation of glycogen and changes in glycogen metabolism in patients with GSD type XV. Design, Setting, and Patients: Two patients with mutations...... in the GYG1 gene were investigated for histopathology, ultrastructure, and expression of proteins involved in glycogen synthesis and metabolism. Results: Apart from occurrence of polyglucosan (PG) bodies in few fibers, glycogen appeared normal in most cells, and the concentration was normal in patients...

  1. Rerouting of carbon flux in a glycogen mutant of cyanobacteria assessed via isotopically non-stationary 13 C metabolic flux analysis.

    Science.gov (United States)

    Hendry, John I; Prasannan, Charulata; Ma, Fangfang; Möllers, K Benedikt; Jaiswal, Damini; Digmurti, Madhuri; Allen, Doug K; Frigaard, Niels-Ulrik; Dasgupta, Santanu; Wangikar, Pramod P

    2017-10-01

    Cyanobacteria, which constitute a quantitatively dominant phylum, have attracted attention in biofuel applications due to favorable physiological characteristics, high photosynthetic efficiency and amenability to genetic manipulations. However, quantitative aspects of cyanobacterial metabolism have received limited attention. In the present study, we have performed isotopically non-stationary 13 C metabolic flux analysis (INST- 13 C-MFA) to analyze rerouting of carbon in a glycogen synthase deficient mutant strain (glgA-I glgA-II) of the model cyanobacterium Synechococcus sp. PCC 7002. During balanced photoautotrophic growth, 10-20% of the fixed carbon is stored in the form of glycogen via a pathway that is conserved across the cyanobacterial phylum. Our results show that deletion of glycogen synthase gene orchestrates cascading effects on carbon distribution in various parts of the metabolic network. Carbon that was originally destined to be incorporated into glycogen gets partially diverted toward alternate storage molecules such as glucosylglycerol and sucrose. The rest is partitioned within the metabolic network, primarily via glycolysis and tricarboxylic acid cycle. A lowered flux toward carbohydrate synthesis and an altered distribution at the glucose-1-phosphate node indicate flexibility in the network. Further, reversibility of glycogen biosynthesis reactions points toward the presence of futile cycles. Similar redistribution of carbon was also predicted by Flux Balance Analysis. The results are significant to metabolic engineering efforts with cyanobacteria where fixed carbon needs to be re-routed to products of interest. Biotechnol. Bioeng. 2017;114: 2298-2308. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. The nutritional status of Methanosarcina acetivorans regulates glycogen metabolism and gluconeogenesis and glycolysis fluxes.

    Science.gov (United States)

    Santiago-Martínez, Michel Geovanni; Encalada, Rusely; Lira-Silva, Elizabeth; Pineda, Erika; Gallardo-Pérez, Juan Carlos; Reyes-García, Marco Antonio; Saavedra, Emma; Moreno-Sánchez, Rafael; Marín-Hernández, Alvaro; Jasso-Chávez, Ricardo

    2016-05-01

    Gluconeogenesis is an essential pathway in methanogens because they are unable to use exogenous hexoses as carbon source for cell growth. With the aim of understanding the regulatory mechanisms of central carbon metabolism in Methanosarcina acetivorans, the present study investigated gene expression, the activities and metabolic regulation of key enzymes, metabolite contents and fluxes of gluconeogenesis, as well as glycolysis and glycogen synthesis/degradation pathways. Cells were grown with methanol as a carbon source. Key enzymes were kinetically characterized at physiological pH/temperature. Active consumption of methanol during exponential cell growth correlated with significant methanogenesis, gluconeogenic flux and steady glycogen synthesis. After methanol exhaustion, cells reached the stationary growth phase, which correlated with the rise in glycogen consumption and glycolytic flux, decreased methanogenesis, negligible acetate production and an absence of gluconeogenesis. Elevated activities of carbon monoxide dehydrogenase/acetyl-CoA synthetase complex and pyruvate: ferredoxin oxidoreductase suggested the generation of acetyl-CoA and pyruvate for glycogen synthesis. In the early stationary growth phase, the transcript contents and activities of pyruvate phosphate dikinase, fructose 1,6-bisphosphatase and glycogen synthase decreased, whereas those of glycogen phosphorylase, ADP-phosphofructokinase and pyruvate kinase increased. Therefore, glycogen and gluconeogenic metabolites were synthesized when an external carbon source was provided. Once such a carbon source became depleted, glycolysis and methanogenesis fed by glycogen degradation provided the ATP supply. Weak inhibition of key enzymes by metabolites suggested that the pathways evaluated were mainly transcriptionally regulated. Because glycogen metabolism and glycolysis/gluconeogenesis are not present in all methanogens, the overall data suggest that glycogen storage might represent an environmental

  3. Investigation and management of the hepatic glycogen storage diseases.

    Science.gov (United States)

    Bhattacharya, Kaustuv

    2015-07-01

    The glycogen storage diseases (GSD) comprise a group of disorders that involve the disruption of metabolism of glycogen. Glycogen is stored in various organs including skeletal muscle, the kidneys and liver. The liver stores glycogen to supply the rest of the body with glucose when required. Therefore, disruption of this process can lead to hypoglycaemia. If glycogen is not broken down effectively, this can lead to hepatomegaly. Glycogen synthase deficiency leads to impaired glycogen synthesis and consequently the liver is small. Glycogen brancher deficiency can lead to abnormal glycogen being stored in the liver leading to a quite different disorder of progressive liver dysfunction. Understanding the physiology of GSD I, III, VI and IX guides dietary treatments and the provision of appropriate amounts and types of carbohydrates. There has been recent re-emergence in the literature of the use of ketones in therapy, either in the form of the salt D,L-3-hydroxybutyrate or medium chain triglyceride (MCT). High protein diets have also been advocated. Alternative waxy maize based starches seem to show promising early data of efficacy. There are many complications of each of these disorders and they need to be prospectively surveyed and managed. Liver and kidney transplantation is still indicated in severe refractory disease.

  4. Glycogen depletion and resynthesis during 14 days of chronic low-frequency stimulation of rabbit muscle

    DEFF Research Database (Denmark)

    Prats, C; Bernal, C; Cadefau, J A

    2002-01-01

    Electro-stimulation alters muscle metabolism and the extent of this change depends on application intensity and duration. The effect of 14 days of chronic electro-stimulation on glycogen turnover and on the regulation of glycogen synthase in fast-twitch muscle was studied. The results showed that...

  5. Inhibitory properties of 1,4-dideoxy-1,4-imino-d-arabinitol (DAB) derivatives acting on glycogen metabolising enzymes.

    Science.gov (United States)

    Díaz-Lobo, Mireia; Concia, Alda Lisa; Gómez, Livia; Clapés, Pere; Fita, Ignacio; Guinovart, Joan J; Ferrer, Joan C

    2016-09-26

    Glycogen synthase (GS) and glycogen phosphorylase (GP) are the key enzymes that control, respectively, the synthesis and degradation of glycogen, a multi-branched glucose polymer that serves as a form of energy storage in bacteria, fungi and animals. An abnormal glycogen metabolism is associated with several human diseases. Thus, GS and GP constitute adequate pharmacological targets to modulate cellular glycogen levels by means of their selective inhibition. The compound 1,4-dideoxy-1,4-imino-d-arabinitol (DAB) is a known potent inhibitor of GP. We studied the inhibitory effect of DAB, its enantiomer LAB, and 29 DAB derivatives on the activity of rat muscle glycogen phosphorylase (RMGP) and E. coli glycogen synthase (EcGS). The isoform 4 of sucrose synthase (SuSy4) from Solanum tuberosum L. was also included in the study for comparative purposes. Although these three enzymes possess highly conserved catalytic site architectures, the DAB derivatives analysed showed extremely diverse inhibitory potential. Subtle changes in the positions of crucial residues in their active sites are sufficient to discriminate among the structural differences of the tested inhibitors. For the two Leloir-type enzymes, EcGS and SuSy4, which use sugar nucleotides as donors, the inhibitory potency of the compounds analysed was synergistically enhanced by more than three orders of magnitude in the presence of ADP and UDP, respectively. Our results are consistent with a model in which these compounds bind to the subsite in the active centre of the enzymes that is normally occupied by the glucosyl residue which is transferred between donor and acceptor substrates. The ability to selectively inhibit the catalytic activity of the key enzymes of the glycogen metabolism may represent a new approach for the treatment of disorders of the glycogen metabolism.

  6. Abnormal Glycogen Storage by Retinal Neurons in Diabetes.

    Science.gov (United States)

    Gardiner, Tom A; Canning, Paul; Tipping, Nuala; Archer, Desmond B; Stitt, Alan W

    2015-12-01

    It is widely held that neurons of the central nervous system do not store glycogen and that accumulation of the polysaccharide may cause neurodegeneration. Since primary neural injury occurs in diabetic retinopathy, we examined neuronal glycogen status in the retina of streptozotocin-induced diabetic and control rats. Glycogen was localized in eyes of streptozotocin-induced diabetic and control rats using light microscopic histochemistry and electron microscopy, and correlated with immunohistochemical staining for glycogen phosphorylase and phosphorylated glycogen synthase (pGS). Electron microscopy of 2-month-old diabetic rats (n = 6) showed massive accumulations of glycogen in the perinuclear cytoplasm of many amacrine neurons. In 4-month-old diabetic rats (n = 11), quantification of glycogen-engorged amacrine cells showed a mean of 26 cells/mm of central retina (SD ± 5), compared to 0.5 (SD ± 0.2) in controls (n = 8). Immunohistochemical staining for glycogen phosphorylase revealed strong expression in amacrine and ganglion cells of control retina, and increased staining in cell processes of the inner plexiform layer in diabetic retina. In control retina, the inactive pGS was consistently sequestered within the cell nuclei of all retinal neurons and the retinal pigment epithelium (RPE), but in diabetics nuclear pGS was reduced or lost in all classes of retinal cell except the ganglion cells and cone photoreceptors. The present study identifies a large population of retinal neurons that normally utilize glycogen metabolism but show pathologic storage of the polysaccharide during uncontrolled diabetes.

  7. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Directory of Open Access Journals (Sweden)

    Hoseok Choi

    2016-04-01

    Full Text Available Assaying the glycogen synthase kinase-3 (GSK3 activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts.

  8. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Science.gov (United States)

    Choi, Hoseok; Choi, Bomi; Seo, Ju Tae; Lee, Kyung Jin; Gye, Myung Chan; Kim, Young-Pil

    2016-01-01

    Assaying the glycogen synthase kinase-3 (GSK3) activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed) peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts. PMID:27092510

  9. Novel method for detection of glycogen in cells.

    Science.gov (United States)

    Skurat, Alexander V; Segvich, Dyann M; DePaoli-Roach, Anna A; Roach, Peter J

    2017-05-01

    Glycogen, a branched polymer of glucose, functions as an energy reserve in many living organisms. Abnormalities in glycogen metabolism, usually excessive accumulation, can be caused genetically, most often through mutation of the enzymes directly involved in synthesis and degradation of the polymer leading to a variety of glycogen storage diseases (GSDs). Microscopic visualization of glycogen deposits in cells and tissues is important for the study of normal glycogen metabolism as well as diagnosis of GSDs. Here, we describe a method for the detection of glycogen using a renewable, recombinant protein which contains the carbohydrate-binding module (CBM) from starch-binding domain containing protein 1 (Stbd1). We generated a fusion protein containing g lutathione S-transferase, a cM c eptitope and the tbd1 BM (GYSC) for use as a glycogen-binding probe, which can be detected with secondary antibodies against glutathione S-transferase or cMyc. By enzyme-linked immunosorbent assay, we demonstrate that GYSC binds glycogen and two other polymers of glucose, amylopectin and amylose. Immunofluorescence staining of cultured cells indicate a GYSC-specific signal that is co-localized with signals obtained with anti-glycogen or anti-glycogen synthase antibodies. GYSC-positive staining inside of lysosomes is observed in individual muscle fibers isolated from mice deficient in lysosomal enzyme acid alpha-glucosidase, a well-characterized model of GSD II (Pompe disease). Co-localized GYSC and glycogen signals are also found in muscle fibers isolated from mice deficient in malin, a model for Lafora disease. These data indicate that GYSC is a novel probe that can be used to study glycogen metabolism under normal and pathological conditions. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  10. Phosphorylations of Serines 21/9 in Glycogen Synthase Kinase 3α/β Are Not Required for Cell Lineage Commitment or WNT Signaling in the Normal Mouse Intestine.

    Directory of Open Access Journals (Sweden)

    Fiona Hey

    Full Text Available The WNT signalling pathway controls many developmental processes and plays a key role in maintenance of intestine renewal and homeostasis. Glycogen Synthase Kinase 3 (GSK3 is an important component of the WNT pathway and is involved in regulating β-catenin stability and expression of WNT target genes. The mechanisms underpinning GSK3 regulation in this context are not completely understood, with some evidence suggesting this occurs through inhibitory N-terminal serine phosphorylation in a similar way to GSK3 inactivation in insulin signaling. To investigate this in a physiologically relevant context, we have analysed the intestinal phenotype of GSK3 knockin mice in which N-terminal serines 21/9 of GSK3α/β have been mutated to non-phosphorylatable alanine residues. We show that these knockin mutations have very little effect on overall intestinal integrity, cell lineage commitment, β-catenin localization or WNT target gene expression although a small increase in apoptosis at villi tips is observed. Our results provide in vivo evidence that GSK3 is regulated through mechanisms independent of N-terminal serine phosphorylation in order for β-catenin to be stabilised.

  11. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  12. Glycogen synthase kinase-3 (GSK3) regulates TNF production and haemocyte phagocytosis in the immune response of Chinese mitten crab Eriocheir sinensis.

    Science.gov (United States)

    Li, Xiaowei; Jia, Zhihao; Wang, Weilin; Wang, Lingling; Liu, Zhaoqun; Yang, Bin; Jia, Yunke; Song, Xiaorui; Yi, Qilin; Qiu, Limei; Song, Linsheng

    2017-08-01

    Glycogen synthase kinase-3 (GSK3) is a serine/threonine protein kinase firstly identified as a regulator of glycogen synthesis. Recently, it has been proved to be a key regulator of the immune reaction. In the present study, a GSK3 homolog gene (designated as EsGSK3) was cloned from Chinese mitten crab, Eriocheir sinensis. The open reading frame (ORF) was 1824 bp, which encoded a predicted polypeptide of 607 amino acids. There was a conserved Serine/Threonine Kinase domain and a DNA binding domain found in EsGSK3. Phylogenetic analysis showed that EsGSK3 was firstly clustered with GSK3-β from oriental river prawn Macrobrachium nipponense in the invertebrate branch, while GSK3s from vertebrates formed the other distinct branch. EsGSK3 mRNA transcripts could be detected in all tested tissues of the crab including haepatopancreas, eyestalk, muscle, gonad, haemocytes and haematopoietic tissue with the highest expression level in haepatopancreas. And EsGSK3 protein was mostly detected in the cytoplasm of haemocyte by immunofluorescence analysis. The expression levels of EsGSK3 mRNA increased significantly at 6 h after Aeromonas hydrophila challenge (p level at 48 h (p > 0.05). The mRNA expression of lipopolysaccharide-induced tumor necrosis factor (TNF)-α factor (EsLITAF) was also induced by A. hydrophila challenge. However, the mRNA expression of EsLITAF and TNF-α production was significantly suppressed after EsGSK3 was blocked in vivo with specific inhibitor lithium, while the phagocytosis of crab haemocytes was significantly promoted. These results collectively demonstrated that EsGSK3 could regulate the innate immune responses of E. sinensis by promoting TNF-α production and inhibiting haemocyte phagocytosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Identification of a Glycogen Synthase Kinase-3[beta] Inhibitor that Attenuates Hyperactivity in CLOCK Mutant Mice

    Energy Technology Data Exchange (ETDEWEB)

    Kozikowski, Alan P.; Gunosewoyo, Hendra; Guo, Songpo; Gaisina, Irina N.; Walter, Richard L.; Ketcherside, Ariel; McClung, Colleen A.; Mesecar, Andrew D.; Caldarone, Barbara (Psychogenics); (Purdue); (UIC); (UTSMC)

    2012-05-02

    Bipolar disorder is characterized by a cycle of mania and depression, which affects approximately 5 million people in the United States. Current treatment regimes include the so-called 'mood-stabilizing drugs', such as lithium and valproate that are relatively dated drugs with various known side effects. Glycogen synthase kinase-3{beta} (GSK-3{beta}) plays a central role in regulating circadian rhythms, and lithium is known to be a direct inhibitor of GSK-3{beta}. We designed a series of second generation benzofuran-3-yl-(indol-3-yl)maleimides containing a piperidine ring that possess IC{sub 50} values in the range of 4 to 680 nM against human GSK-3{beta}. One of these compounds exhibits reasonable kinase selectivity and promising preliminary absorption, distribution, metabolism, and excretion (ADME) data. The administration of this compound at doses of 10 to 25 mg kg{sup -1} resulted in the attenuation of hyperactivity in amphetamine/chlordiazepoxide-induced manic-like mice together with enhancement of prepulse inhibition, similar to the effects found for valproate (400 mg kg{sup -1}) and the antipsychotic haloperidol (1 mg kg{sup -1}). We also tested this compound in mice carrying a mutation in the central transcriptional activator of molecular rhythms, the CLOCK gene, and found that the same compound attenuates locomotor hyperactivity in response to novelty. This study further demonstrates the use of inhibitors of GSK-3{beta} in the treatment of manic episodes of bipolar/mood disorders, thus further validating GSK-3{beta} as a relevant therapeutic target in the identification of new therapies for bipolar patients.

  14. Green Tea Polyphenol Epigallocatechin-3-Gallate Enhance Glycogen Synthesis and Inhibit Lipogenesis in Hepatocytes

    Directory of Open Access Journals (Sweden)

    Jane J. Y. Kim

    2013-01-01

    Full Text Available The beneficial effects of green tea polyphenols (GTP against metabolic syndrome and type 2 diabetes by suppressing appetite and nutrient absorption have been well reported. However the direct effects and mechanisms of GTP on glucose and lipid metabolism remain to be elucidated. Since the liver is an important organ involved in glucose and lipid metabolism, we examined the effects and mechanisms of GTP on glycogen synthesis and lipogenesis in HepG2 cells. Concentrations of GTP containing 68% naturally occurring (−-epigallocatechin-3-gallate (EGCG were incubated in HepG2 cells with high glucose (30 mM under 100 nM of insulin stimulation for 24 h. GTP enhanced glycogen synthesis in a dose-dependent manner. 10 μM of EGCG significantly increased glycogen synthesis by 2fold (P<0.05 compared with insulin alone. Western blotting revealed that phosphorylation of Ser9 glycogen synthase kinase 3β and Ser641 glycogen synthase was significantly increased in GTP-treated HepG2 cells compared with nontreated cells. 10 μM of EGCG also significantly inhibited lipogenesis (P<0.01. We further demonstrated that this mechanism involves enhanced expression of phosphorylated AMP-activated protein kinase α and acetyl-CoA carboxylase in HepG2 cells. Our results showed that GTP is capable of enhancing insulin-mediated glucose and lipid metabolism by regulating enzymes involved in glycogen synthesis and lipogenesis.

  15. Regulation of glycogen synthase kinase-3 during bipolar mania treatment.

    Science.gov (United States)

    Li, Xiaohong; Liu, Min; Cai, Zhuoji; Wang, Gang; Li, Xiaohua

    2010-11-01

    Bipolar disorder is a debilitating psychiatric illness presenting with recurrent mania and depression. The pathophysiology of bipolar disorder is poorly understood, and molecular targets in the treatment of bipolar disorder remain to be identified. Preclinical studies have suggested that glycogen synthase kinase-3 (GSK3) is a potential therapeutic target in bipolar disorder, but evidence of abnormal GSK3 in human bipolar disorder and its response to treatment is still lacking. This study was conducted in acutely ill type I bipolar disorder subjects who were hospitalized for a manic episode. The protein level and the inhibitory serine phosphorylation of GSK3 in peripheral blood mononuclear cells of bipolar manic and healthy control subjects were compared, and the response of GSK3 to antimanic treatment was evaluated. The levels of GSK3α and GSK3β in this group of bipolar manic subjects were higher than healthy controls. Symptom improvement during an eight-week antimanic treatment with lithium, valproate, and atypical antipsychotics was accompanied by a significant increase in the inhibitory serine phosphorylation of GSK3, but not the total level of GSK3, whereas concomitant electroconvulsive therapy treatment during a manic episode appeared to dampen the response of GSK3 to pharmacological treatment. Results of this study suggest that GSK3 can be modified during the treatment of bipolar mania. This finding in human bipolar disorder is in agreement with preclinical data suggesting that inhibition of GSK3 by increasing serine phosphorylation is a response of GSK3 to psychotropics used in bipolar disorder, supporting the notion that GSK3 is a promising molecular target in the pharmacological treatment of bipolar disorder. © 2010 John Wiley and Sons A/S.

  16. Glycogen synthase kinase-3: A promising therapeutic target for Fragile X Syndrome

    Directory of Open Access Journals (Sweden)

    Marjelo M. Mines

    2011-11-01

    Full Text Available Recent advances in understanding the pathophysiological mechanisms contributing to Fragile X Syndrome (FXS have increased optimism that drug interventions can provide significant therapeutic benefits. FXS results from inadequate expression of functional fragile X mental retardation protein (FMRP. FMRP may have several functions, but it is most well-established as an RNA-binding protein that regulates translation, and it is by this mechanism that FMRP is capable of affecting numerous cellular processes by selectively regulating protein levels. The multiple cellular functions regulated by FMRP suggest that multiple interventions may be required for reversing the effects of deficient FMRP. Evidence that inhibitors of glycogen synthase kinase-3 (GSK3 may contribute to the therapeutic treatment of FXS is reviewed here. In the mouse model of FXS, which lacks FMRP expression (FX mice, GSK3 is hyperactive in several brain regions. Furthermore, significant improvements in several FX-related phenotypes have been obtained in FX mice following the administration of lithium, and in some case other GSK3 inhibitors. These responses include normalization of heightened audiogenic seizure susceptibility and of hyperactive locomotor behavior, enhancement of passive avoidance learning retention and of sociability behaviors, and corrections of macroorchidism, neuronal spine density, and neural plasticity measured electrophysiologically as long term depression. A pilot clinical trial of lithium in FXS patients also found improvements in several measures of behavior. Taken together, these findings indicate that lithium and other inhibitors of GSK3 are promising candidate therapeutic agents for treating FXS.

  17. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  18. Glycogen synthase kinase 3 (GSK3) in the heart: a point of integration in hypertrophic signalling and a therapeutic target? A critical analysis.

    Science.gov (United States)

    Sugden, P H; Fuller, S J; Weiss, S C; Clerk, A

    2008-03-01

    Glycogen synthase kinase 3 (GSK3, of which there are two isoforms, GSK3alpha and GSK3beta) was originally characterized in the context of regulation of glycogen metabolism, though it is now known to regulate many other cellular processes. Phosphorylation of GSK3alpha(Ser21) and GSK3beta(Ser9) inhibits their activity. In the heart, emphasis has been placed particularly on GSK3beta, rather than GSK3alpha. Importantly, catalytically-active GSK3 generally restrains gene expression and, in the heart, catalytically-active GSK3 has been implicated in anti-hypertrophic signalling. Inhibition of GSK3 results in changes in the activities of transcription and translation factors in the heart and promotes hypertrophic responses, and it is generally assumed that signal transduction from hypertrophic stimuli to GSK3 passes primarily through protein kinase B/Akt (PKB/Akt). However, recent data suggest that the situation is far more complex. We review evidence pertaining to the role of GSK3 in the myocardium and discuss effects of genetic manipulation of GSK3 activity in vivo. We also discuss the signalling pathways potentially regulating GSK3 activity and propose that, depending on the stimulus, phosphorylation of GSK3 is independent of PKB/Akt. Potential GSK3 substrates studied in relation to myocardial hypertrophy include nuclear factors of activated T cells, beta-catenin, GATA4, myocardin, CREB, and eukaryotic initiation factor 2Bvarepsilon. These and other transcription factor substrates putatively important in the heart are considered. We discuss whether cardiac pathologies could be treated by therapeutic intervention at the GSK3 level but conclude that any intervention would be premature without greater understanding of the precise role of GSK3 in cardiac processes.

  19. Glycogen synthase kinase-3β ablation limits pancreatitis-induced acinar-to-ductal metaplasia.

    Science.gov (United States)

    Ding, Li; Liou, Geou-Yarh; Schmitt, Daniel M; Storz, Peter; Zhang, Jin-San; Billadeau, Daniel D

    2017-09-01

    Acinar-to-ductal metaplasia (ADM) is a reversible epithelial transdifferentiation process that occurs in the pancreas in response to acute inflammation. ADM can rapidly progress towards pre-malignant pancreatic intraepithelial neoplasia (PanIN) lesions in the presence of mutant KRas and ultimately pancreatic adenocarcinoma (PDAC). In the present work, we elucidate the role and related mechanism of glycogen synthase kinase-3beta (GSK-3β) in ADM development using in vitro 3D cultures and genetically engineered mouse models. We show that GSK-3β promotes TGF-α-induced ADM in 3D cultured primary acinar cells, whereas deletion of GSK-3β attenuates caerulein-induced ADM formation and PanIN progression in Kras G12D transgenic mice. Furthermore, we demonstrate that GSK-3β ablation influences ADM formation and PanIN progression by suppressing oncogenic KRas-driven cell proliferation. Mechanistically, we show that GSK-3β regulates proliferation by increasing the activation of S6 kinase. Taken together, these results indicate that GSK-3β participates in early pancreatitis-induced ADM and thus could be a target for the treatment of chronic pancreatitis and the prevention of PDAC progression. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  20. Analysis of genes involved in glycogen degradation in Escherichia coli.

    Science.gov (United States)

    Strydom, Lindi; Jewell, Jonathan; Meier, Michael A; George, Gavin M; Pfister, Barbara; Zeeman, Samuel; Kossmann, Jens; Lloyd, James R

    2017-02-01

    Escherichia coli accumulate or degrade glycogen depending on environmental carbon supply. Glycogen phosphorylase (GlgP) and glycogen debranching enzyme (GlgX) are known to act on the glycogen polymer, while maltodextrin phosphorylase (MalP) is thought to remove maltodextrins released by GlgX. To examine the roles of these enzymes in more detail, single, double and triple mutants lacking all their activities were produced. GlgX and GlgP were shown to act directly on the glycogen polymer, while MalP most likely catabolised soluble malto-oligosaccharides. Interestingly, analysis of a triple mutant lacking all three enzymes indicates the presence of another enzyme that can release maltodextrins from glycogen. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Tissue injury after lithium treatment in human and rat postnatal kidney involves glycogen synthase kinase 3β-positive epithelium

    DEFF Research Database (Denmark)

    Kjaersgaard, Gitte; Madsen, Kirsten; Marcussen, Niels

    2012-01-01

    plasma lithium concentration of 1.0 mmol/L. Kidneys from lithium-treated rat pups exhibited dilated distal nephron segments with microcysts. Stereological analysis showed reduced cortex and outer medullary volumes. Lithium increased pGSK-3β and the proliferation marker PCNA protein abundances in cortex...... concentration capacity and diminished outer medullary volume. Histological sections of nephrectomy samples and a biopsy from 3 long-term lithium-treated patients showed multiple cortical microcysts that originated from normally appearing tubules. Microcysts were lined by a cuboidal PCNA-, GSK-3β- and pGSK-3β......It was hypothesized that lithium causes accelerated and permanent injury to the postnatally developing kidney through entry into epithelial cells of the distal nephron and inhibition of glycogen synthase kinase-3β (GSK-3β). GSK-3β immunoreactivity was associated with glomeruli, thick ascending limb...

  2. Molecular cloning of a novel GSK3/shaggy-like gene from Triticum ...

    African Journals Online (AJOL)

    The deduced amino acid sequence showed a high homology with shaggy-like kinases from Triticum aestivum, Zea mays, Trifolium repens, Nicotine tabacum, Medicago sativa and Arabidopsis thaliana; therefore, the gene was named TmGSK1 (Triticum monococcum Glycogen Synthase Kinase 1,GenBank Accession No.

  3. Exposures to arsenite and methylarsonite produce insulin resistance and impair insulin-dependent glycogen metabolism in hepatocytes.

    Science.gov (United States)

    Zhang, Chongben; Fennel, Emily M J; Douillet, Christelle; Stýblo, Miroslav

    2017-12-01

    Environmental exposure to inorganic arsenic (iAs) has been shown to disturb glucose homeostasis, leading to diabetes. Previous laboratory studies have suggested several mechanisms that may underlie the diabetogenic effects of iAs exposure, including (i) inhibition of insulin signaling (leading to insulin resistance) in glucose metabolizing peripheral tissues, (ii) inhibition of insulin secretion by pancreatic β cells, and (iii) dysregulation of the methylation or expression of genes involved in maintenance of glucose or insulin metabolism and function. Published studies have also shown that acute or chronic iAs exposures may result in depletion of hepatic glycogen stores. However, effects of iAs on pathways and mechanisms that regulate glycogen metabolism in the liver have never been studied. The present study examined glycogen metabolism in primary murine hepatocytes exposed in vitro to arsenite (iAs 3+ ) or its methylated metabolite, methylarsonite (MAs 3+ ). The results show that 4-h exposures to iAs 3+ and MAs 3+ at concentrations as low as 0.5 and 0.2 µM, respectively, decreased glycogen content in insulin-stimulated hepatocytes by inhibiting insulin-dependent activation of glycogen synthase (GS) and by inducing activity of glycogen phosphorylase (GP). Further investigation revealed that both iAs 3+ and MAs 3+ inhibit insulin-dependent phosphorylation of protein kinase B/Akt, one of the mechanisms involved in the regulation of GS and GP by insulin. Thus, inhibition of insulin signaling (i.e., insulin resistance) is likely responsible for the dysregulation of glycogen metabolism in hepatocytes exposed to iAs 3+ and MAs 3+ . This study provides novel information about the mechanisms by which iAs exposure impairs glucose homeostasis, pointing to hepatic metabolism of glycogen as one of the targets.

  4. Inhibition of autophagic proteolysis by inhibitors of phosphoinositide 3-kinase can interfere with the regulation of glycogen synthesis in isolated hepatocytes

    NARCIS (Netherlands)

    Dubbelhuis, Peter F.; van Sluijters, Daphne A.; Blommaart, Edward F. C.; Gustafson, Lori A.; van Woerkom, George M.; Herling, Andreas W.; Burger, Hans-Joerg; Meijer, Alfred J.

    2002-01-01

    Amino acid-induced cell swelling stimulates conversion of glucose into glycogen in isolated hepatocytes. Activation of glycogen synthase (GS) phosphatase, caused by the fall in intracellular chloride accompanying regulatory volume decrease, and activation of phosphoinositide 3-kinase (PI 3-kinase),

  5. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  6. Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3.

    Science.gov (United States)

    Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian

    2010-10-01

    According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the

  7. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  8. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  9. Muscle Glycogen Remodeling and Glycogen Phosphate Metabolism following Exhaustive Exercise of Wild Type and Laforin Knockout Mice*

    Science.gov (United States)

    Irimia, Jose M.; Tagliabracci, Vincent S.; Meyer, Catalina M.; Segvich, Dyann M.; DePaoli-Roach, Anna A.; Roach, Peter J.

    2015-01-01

    Glycogen, the repository of glucose in many cell types, contains small amounts of covalent phosphate, of uncertain function and poorly understood metabolism. Loss-of-function mutations in the laforin gene cause the fatal neurodegenerative disorder, Lafora disease, characterized by increased glycogen phosphorylation and the formation of abnormal deposits of glycogen-like material called Lafora bodies. It is generally accepted that the phosphate is removed by the laforin phosphatase. To study the dynamics of skeletal muscle glycogen phosphorylation in vivo under physiological conditions, mice were subjected to glycogen-depleting exercise and then monitored while they resynthesized glycogen. Depletion of glycogen by exercise was associated with a substantial reduction in total glycogen phosphate and the newly resynthesized glycogen was less branched and less phosphorylated. Branching returned to normal on a time frame of days, whereas phosphorylation remained suppressed over a longer period of time. We observed no change in markers of autophagy. Exercise of 3-month-old laforin knock-out mice caused a similar depletion of glycogen but no loss of glycogen phosphate. Furthermore, remodeling of glycogen to restore the basal branching pattern was delayed in the knock-out animals. From these results, we infer that 1) laforin is responsible for glycogen dephosphorylation during exercise and acts during the cytosolic degradation of glycogen, 2) excess glycogen phosphorylation in the absence of laforin delays the normal remodeling of the branching structure, and 3) the accumulation of glycogen phosphate is a relatively slow process involving multiple cycles of glycogen synthesis-degradation, consistent with the slow onset of the symptoms of Lafora disease. PMID:26216881

  10. Glycogen Storage Disease Type IV

    DEFF Research Database (Denmark)

    Bendroth-Asmussen, Lisa; Aksglaede, Lise; Gernow, Anne B

    2016-01-01

    molecular genetic analyses confirmed glycogen storage disease Type IV with the finding of compound heterozygosity for 2 mutations (c.691+2T>C and c.1570C>T, p.R524X) in the GBE1 gene. We conclude that glycogen storage disease Type IV can cause early miscarriage and that diagnosis can initially be made...

  11. Dysregulation of glycogen synthase COOH- and NH2-terminal phosphorylation by insulin in obesity and type 2 diabetes mellitus

    DEFF Research Database (Denmark)

    Højlund, Kurt; Birk, Jesper Bratz; Klein, Ditte Kjærsgaard

    2009-01-01

    Context: Insulin-stimulated glucose disposal is impaired in obesity and type 2 diabetes mellitus (T2DM) and is tightly linked to impaired skeletal muscle glucose uptake and storage. Impaired activation of glycogen synthase (GS) by insulin is a well-established defect in both obesity and T2DM....... The exaggerated insulin resistance in T2DM compared with obese subjects was not reflected by differences in site 3 phosphorylation but was accompanied by a significantly higher site 1b phosphorylation during insulin stimulation. Hyperphosphorylation of another Ca(2+)/calmodulin-dependent kinase-II target......, phospholamban-Thr17, was also evident in T2DM. Dephosphorylation of GS by phosphatase treatment fully restored GS activity in all groups. Conclusions: Dysregulation of GS phosphorylation plays a major role in impaired insulin regulation of GS in obesity and T2DM. In obesity, independent of T2DM...

  12. Mechanisms limiting glycogen storage in muscle during prolonged insulin stimulation

    International Nuclear Information System (INIS)

    Richter, E.A.; Hansen, S.A.; Hansen, B.F.

    1988-01-01

    The extent to which muscle glycogen concentrations can be increased during exposure to maximal insulin concentrations and abundant glucose was investigated in the isolated perfused rat hindquarter preparation. Perfusion for 7 h in the presence of 20,000 μU/ml insulin and 11-13 mM glucose increased muscle glycogen concentrations to maximal values 2, 3, and 3.5 times above normal fed levels in fast-twitch white, slow-twitch red, and fast-twitch red fibers, respectively. Glucose uptake decreased from 34.9 μmol·g -1 ·h -1 at 0 h to 7.5 after 7 h of perfusion. During the perfusion muscle glycogen synthase activity decreased and free intracellular glucose and glucose 6-phosphate increased indicating that glucose disposal was impaired. However, glucose transport as measured by the uptake of 3-O-[ 14 C]methyl-D-glucose was also markedly decreased after 5 and 7 h of perfusion compared with initial values. Total muscle water concentration decreased during glycogen loading of the muscles. Mechanisms limiting glycogen storage under maximal insulin stimulation include impaired insulin-stimulated membrane transport of glucose as well as impaired intracellular glucose disposal

  13. Chronic corticosterone exposure reduces hippocampal glycogen level and induces depression-like behavior in mice.

    Science.gov (United States)

    Zhang, Hui-yu; Zhao, Yu-nan; Wang, Zhong-li; Huang, Yu-fang

    2015-01-01

    Long-term exposure to stress or high glucocorticoid levels leads to depression-like behavior in rodents; however, the cause remains unknown. Increasing evidence shows that astrocytes, the most abundant cells in the central nervous system (CNS), are important to the nervous system. Astrocytes nourish and protect the neurons, and serve as glycogen repositories for the brain. The metabolic process of glycogen, which is closely linked to neuronal activity, can supply sufficient energy substrates for neurons. The research team probed into the effects of chronic corticosterone (CORT) exposure on the glycogen level of astrocytes in the hippocampal tissues of male C57BL/6N mice in this study. The results showed that chronic CORT injection reduced hippocampal neurofilament light protein (NF-L) and synaptophysin (SYP) levels, induced depression-like behavior in male mice, reduced hippocampal glycogen level and glycogen synthase activity, and increased glycogen phosphorylase activity. The results suggested that the reduction of the hippocampal glycogen level may be the mechanism by which chronic CORT treatment damages hippocampal neurons and induces depression-like behavior in male mice.

  14. Discovery of novel 2-(4-aryl-2-methylpiperazin-1-yl)-pyrimidin-4-ones as glycogen synthase kinase-3β inhibitors.

    Science.gov (United States)

    Kohara, Toshiyuki; Nakayama, Kazuki; Watanabe, Kazutoshi; Kusaka, Shin-Ichi; Sakai, Daiki; Tanaka, Hiroshi; Fukunaga, Kenji; Sunada, Shinji; Nabeno, Mika; Saito, Ken-Ichi; Eguchi, Jun-Ichi; Mori, Akiko; Tanaka, Shinji; Bessho, Tomoko; Takiguchi-Hayashi, Keiko; Horikawa, Takashi

    2017-08-15

    We herein describe the results of further evolution of glycogen synthase kinase (GSK)-3β inhibitors from our promising compounds containing a 3-methylmorpholine moiety. Transformation of the morpholine moiety into a piperazine moiety resulted in potent GSK-3β inhibitors. SAR studies focused on the nitrogen atom of the piperazine moiety revealed that a phenyl group afforded potent inhibitory activity toward GSK-3β. Docking studies indicated that the phenyl group on the piperazine nitrogen atom and the methyl group on the piperazine make cation-π and CH-π interactions with GSK-3β respectively. 4-Methoxyphenyl analogue 29 showed most potent inhibitory activity toward GSK-3β with good in vitro and in vivo pharmacokinetic profiles, and 29 demonstrated a significant decrease in tau phosphorylation after oral administration in mice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Role of Glycogen Synthase Kinase-3β in APP Hyperphosphorylation Induced by NMDA Stimulation in Cortical Neurons

    Directory of Open Access Journals (Sweden)

    Xanthi Antoniou

    2010-01-01

    Full Text Available The phosphorylation of Amyloid Precursor Protein (APP at Thr668 plays a key role in APP metabolism that is highly relevant to AD. The c-Jun-N-terminal kinase (JNK, glycogen synthase kinase-3β (GSK-3β and cyclin-dependent kinase 5 (Cdk5 can all be responsible for this phosphorylation. These kinases are activated by excitotoxic stimuli fundamental hallmarks of AD. The exposure of cortical neurons to a high dose of NMDA (100 μM for 30’-45’ led to an increase of P-APP Thr668. During NMDA stimulation APP hyperphosphorylation has to be assigned to GSK-3β activity, since addition of L803-mts, a substrate competitive inhibitor of GSK-3β reduced APP phosphorylation induced by NMDA. On the contrary, inhibition of JNK and Cdk5 with D-JNKI1 and Roscovitine respectively did not prevent NMDA-induced P-APP increase. These data show a tight connection, in excitotoxic conditions, between APP metabolism and the GSK-3β signaling pathway.

  16. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  17. Up-regulation of insulin-like growth factor 2 by ketamine requires glycogen synthase kinase-3 inhibition

    Science.gov (United States)

    Grieco, Steven F.; Cheng, Yuyan; Eldar-Finkelman, Hagit; Jope, Richard S.; Beurel, Eléonore

    2016-01-01

    An antidepressant dose of the rapidly-acting ketamine inhibits glycogen synthase kinase-3 (GSK3) in mouse hippocampus, and this inhibition is required for the antidepressant effect of ketamine in learned helplessness depression-like behavior. Here we report that treatment with an antidepressant dose of ketamine (10 mg/kg) increased expression of insulin-like growth factor 2 (IGF2) in mouse hippocampus, an effect that required ketamine-induced inhibition of GSK3. Ketamine also inhibited hippocampal GSK3 and increased expression of hippocampal IGF2 in mice when administered after the induction of learned helplessness. Treatment with the specific GSK3 inhibitor L803-mts was sufficient to up-regulate hippocampal IGF2 expression. Administration of IGF2 siRNA reduced ketamine's antidepressant effect in the learned helplessness paradigm. Mice subjected to the learned helplessness paradigm were separated into two groups, those that were resilient (non-depressed) and those that were susceptible (depressed). Non-depressed resilient mice displayed higher expression of IGF2 than susceptible mice. These results indicate that IGF2 contributes to ketamine's antidepressant effect and that IGF2 may confer resilience to depression-like behavior. PMID:27542584

  18. Ketamine up-regulates a cluster of intronic miRNAs within the serotonin receptor 2C gene by inhibiting glycogen synthase kinase-3.

    Science.gov (United States)

    Grieco, Steven F; Velmeshev, Dmitry; Magistri, Marco; Eldar-Finkelman, Hagit; Faghihi, Mohammad A; Jope, Richard S; Beurel, Eleonore

    2017-09-01

    We examined mechanisms that contribute to the rapid antidepressant effect of ketamine in mice that is dependent on glycogen synthase kinase-3 (GSK3) inhibition. We measured serotonergic (5HT)-2C-receptor (5HTR2C) cluster microRNA (miRNA) levels in mouse hippocampus after administering an antidepressant dose of ketamine (10 mg/kg) in wild-type and GSK3 knockin mice, after GSK3 inhibition with L803-mts, and in learned helpless mice. Ketamine up-regulated cluster miRNAs 448-3p, 764-5p, 1264-3p, 1298-5p and 1912-3p (2- to 11-fold). This up-regulation was abolished in GSK3 knockin mice that express mutant constitutively active GSK3. The GSK3 specific inhibitor L803-mts was antidepressant in the learned helplessness and novelty suppressed feeding depression-like behaviours and up-regulated the 5HTR2C miRNA cluster in mouse hippocampus. After administration of the learned helplessness paradigm mice were divided into cohorts that were resilient (non-depressed) or were susceptible (depressed) to learned helplessness. The resilient, but not depressed, mice displayed increased hippocampal levels of miRNAs 448-3p and 1264-3p. Administration of an antagonist to miRNA 448-3p diminished the antidepressant effect of ketamine in the learned helplessness paradigm, indicating that up-regulation of miRNA 448-3p provides an antidepressant action. These findings identify a new outcome of GSK3 inhibition by ketamine that may contribute to antidepressant effects.

  19. Axonal and dendritic localization of mRNAs for glycogen-metabolizing enzymes in cultured rodent neurons.

    Science.gov (United States)

    Pfeiffer-Guglielmi, Brigitte; Dombert, Benjamin; Jablonka, Sibylle; Hausherr, Vanessa; van Thriel, Christoph; Schöbel, Nicole; Jansen, Ralf-Peter

    2014-06-04

    Localization of mRNAs encoding cytoskeletal or signaling proteins to neuronal processes is known to contribute to axon growth, synaptic differentiation and plasticity. In addition, a still increasing spectrum of mRNAs has been demonstrated to be localized under different conditions and developing stages thus reflecting a highly regulated mechanism and a role of mRNA localization in a broad range of cellular processes. Applying fluorescence in-situ-hybridization with specific riboprobes on cultured neurons and nervous tissue sections, we investigated whether the mRNAs for two metabolic enzymes, namely glycogen synthase (GS) and glycogen phosphorylase (GP), the key enzymes of glycogen metabolism, may also be targeted to neuronal processes. If it were so, this might contribute to clarify the so far enigmatic role of neuronal glycogen. We found that the mRNAs for both enzymes are localized to axonal and dendritic processes in cultured lumbar spinal motoneurons, but not in cultured trigeminal neurons. In cultured cortical neurons which do not store glycogen but nevertheless express glycogen synthase, the GS mRNA is also subject to axonal and dendritic localization. In spinal motoneurons and trigeminal neurons in situ, however, the mRNAs could only be demonstrated in the neuronal somata but not in the nerves. We could demonstrate that the mRNAs for major enzymes of neural energy metabolism can be localized to neuronal processes. The heterogeneous pattern of mRNA localization in different culture types and developmental stages stresses that mRNA localization is a versatile mechanism for the fine-tuning of cellular events. Our findings suggest that mRNA localization for enzymes of glycogen metabolism could allow adaptation to spatial and temporal energy demands in neuronal events like growth, repair and synaptic transmission.

  20. Functional consequences of brain glycogen deficiency on the sleep-wake cycle regulation in PTG-KO mice

    KAUST Repository

    Burlet-Godinot, S.

    2017-12-31

    Introduction: In the CNS, glycogen is mainly localized in astrocytes where its levels are linked to neuronal activity. Astrocytic glycogen synthesis is regulated by glycogen synthase (GS) activity that is positively controlled by protein targeting to glycogen (PTG) expression levels. Although the role of glycogen in sleep/wake regulation is still poorly understood, we have previously demonstrated that, following a 6 hour gentle sleep deprivation (GSD), PTG mRNA expression and GS activity increased in the brain in mice while glycogen levels were paradoxically maintained and not affected. In order to gain further insight on the role of PTG in this process, we studied the sleep/wake cycle parameters in PTG knockout (PTG-KO) mice under baseline conditions and after a 6 hour GSD. Glycogen levels as well as mRNAs expression of genes related to energy metabolism were also determined in several brain areas. Materials and methods: Adult male C57BL/6J (WT) and PTG-KO mice were sleep-recorded under baseline conditions (24 h recordings, 12 h light/dark cycle) and following 6 hours GSD from ZT00 to ZT06. Vigilance states were visually scored (4 s temporal window). Spectral analysis of the EEG signal was performed using a discrete Fourier transformation. Glycogen measurements and gene expression analysis were assessed using a biochemical assay and quantitative RT-PCR respectively, on separate cohorts in WT vs PTG-KO mice at the end of the 6 hours GSD or in control animals (CTL) in different brain structures. Results: Quantitative analysis of the sleep/wake cycle under baseline conditions did not reveal major differences between the WT and the PTG-KO mice. However, during the dark period, the PTG-KO mice showed a significant increase in the number of wake and slow wave sleep episodes (respectively +26.5±8% and +26.1±8%; p< 0.05) together with a significant shortening in their duration (-21.6±7.2% and -14.3±2.8%; p< 0.01). No such quantitative changes were observed during

  1. Phosphoproteomics reveals that glycogen synthase kinase-3 phosphorylates multiple splicing factors and is associated with alternative splicing

    Science.gov (United States)

    Shinde, Mansi Y.; Sidoli, Simone; Kulej, Katarzyna; Mallory, Michael J.; Radens, Caleb M.; Reicherter, Amanda L.; Myers, Rebecca L.; Barash, Yoseph; Lynch, Kristen W.; Garcia, Benjamin A.; Klein, Peter S.

    2017-01-01

    Glycogen synthase kinase-3 (GSK-3) is a constitutively active, ubiquitously expressed protein kinase that regulates multiple signaling pathways. In vitro kinase assays and genetic and pharmacological manipulations of GSK-3 have identified more than 100 putative GSK-3 substrates in diverse cell types. Many more have been predicted on the basis of a recurrent GSK-3 consensus motif ((pS/pT)XXX(S/T)), but this prediction has not been tested by analyzing the GSK-3 phosphoproteome. Using stable isotope labeling of amino acids in culture (SILAC) and MS techniques to analyze the repertoire of GSK-3–dependent phosphorylation in mouse embryonic stem cells (ESCs), we found that ∼2.4% of (pS/pT)XXX(S/T) sites are phosphorylated in a GSK-3–dependent manner. A comparison of WT and Gsk3a;Gsk3b knock-out (Gsk3 DKO) ESCs revealed prominent GSK-3–dependent phosphorylation of multiple splicing factors and regulators of RNA biosynthesis as well as proteins that regulate transcription, translation, and cell division. Gsk3 DKO reduced phosphorylation of the splicing factors RBM8A, SRSF9, and PSF as well as the nucleolar proteins NPM1 and PHF6, and recombinant GSK-3β phosphorylated these proteins in vitro. RNA-Seq of WT and Gsk3 DKO ESCs identified ∼190 genes that are alternatively spliced in a GSK-3–dependent manner, supporting a broad role for GSK-3 in regulating alternative splicing. The MS data also identified posttranscriptional regulation of protein abundance by GSK-3, with ∼47 proteins (1.4%) whose levels increased and ∼78 (2.4%) whose levels decreased in the absence of GSK-3. This study provides the first unbiased analysis of the GSK-3 phosphoproteome and strong evidence that GSK-3 broadly regulates alternative splicing. PMID:28916722

  2. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  3. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  4. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  5. Glycogen metabolism in brain and neurons - astrocytes metabolic cooperation can be altered by pre- and neonatal lead (Pb) exposure.

    Science.gov (United States)

    Baranowska-Bosiacka, Irena; Falkowska, Anna; Gutowska, Izabela; Gąssowska, Magdalena; Kolasa-Wołosiuk, Agnieszka; Tarnowski, Maciej; Chibowska, Karina; Goschorska, Marta; Lubkowska, Anna; Chlubek, Dariusz

    2017-09-01

    Lead (Pb) is an environmental neurotoxin which particularly affects the developing brain but the molecular mechanism of its neurotoxicity still needs clarification. The aim of this paper was to examine whether pre- and neonatal exposure to Pb (concentration of Pb in rat offspring blood below the "threshold level") may affect the brain's energy metabolism in neurons and astrocytes via the amount of available glycogen. We investigated the glycogen concentration in the brain, as well as the expression of the key enzymes involved in glycogen metabolism in brain: glycogen synthase 1 (Gys1), glycogen phosphorylase (PYGM, an isoform active in astrocytes; and PYGB, an isoform active in neurons) and phosphorylase kinase β (PHKB). Moreover, the expression of connexin 43 (Cx43) was evaluated to analyze whether Pb poisoning during the early phase of life may affect the neuron-astrocytes' metabolic cooperation. This work shows for the first time that exposure to Pb in early life can impair brain energy metabolism by reducing the amount of glycogen and decreasing the rate of its metabolism. This reduction in brain glycogen level was accompanied by a decrease in Gys1 expression. We noted a reduction in the immunoreactivity and the gene expression of both PYGB and PYGM isoform, as well as an increase in the expression of PHKB in Pb-treated rats. Moreover, exposure to Pb induced decrease in connexin 43 immunoexpression in all the brain structures analyzed, both in astrocytes as well as in neurons. Our data suggests that exposure to Pb in the pre- and neonatal periods results in a decrease in the level of brain glycogen and a reduction in the rate of its metabolism, thereby reducing glucose availability, which as a further consequence may lead to the impairment of brain energy metabolism and the metabolic cooperation between neurons and astrocytes. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Initiation of glycogen biosynthesis in rat heart. Studies with a purified preparation

    International Nuclear Information System (INIS)

    Blumenfeld, M.L.; Krisman, C.R.

    1985-01-01

    Two fractions of glycogen synthase were isolated from rat cardiac muscle on the basis of a different affinity for DEAE-cellulose and omega-aminobutyl-agarose. One of these fractions was able to transfer glucosyl residues from UDP-glucose not only to glycogen (GS-1 activity) but also to an endogenous acceptor. The latter reaction (GS-2 activity) occurred in the absence of added glycogen, and its reaction product was insoluble in trichloroacetic acid. This compound was degraded by amylolytic enzymes, thus showing that the product synthesized on the endogenous acceptor was an alpha 1,4-glucan. After incubation with alpha-amylase-free proteolytic enzyme, the compound was rendered trichloroacetic acid-soluble. Polyacrylamide gel electrophoresis, under both native and denaturing conditions, showed that GS-2 reaction products moved electrophoretically associated to protein. The results give further evidence for the association between an alpha 1,4-glucan and protein, which the authors postulate is related to the initiation of glycogen biosynthesis

  7. Enzymatic regulation of seasonal glycogen cycling in the freeze-tolerant wood frog, Rana sylvatica.

    Science.gov (United States)

    do Amaral, M Clara F; Lee, Richard E; Costanzo, Jon P

    2016-12-01

    Liver glycogen is an important energy store in vertebrates, and in the freeze-tolerant wood frog, Rana sylvatica, this carbohydrate also serves as a major source of the cryoprotectant glucose. We investigated how variation in the levels of the catalytic subunit of protein kinase A (PKAc), glycogen phosphorylase (GP), and glycogen synthase (GS) relates to seasonal glycogen cycling in a temperate (Ohioan) and subarctic (Alaskan) populations of this species. In spring, Ohioan frogs had reduced potential for glycogen synthesis, as evidenced by low GS activity and high PKAc protein levels. In addition, glycogen levels in spring were the lowest of four seasonal samples, as energy input was likely directed towards metabolism and somatic growth during this period. Near-maximal glycogen levels were reached by mid-summer, and remained unchanged in fall and winter, suggesting that glycogenesis was curtailed during this period. Ohioan frogs had a high potential for glycogenolysis and glycogenesis in winter, as evidenced by large glycogen reserves, high levels of GP and GS proteins, and high GS activity, which likely allows for rapid mobilization of cryoprotectant during freezing and replenishing of glycogen reserves during thawing. Alaskan frogs also achieved a near-maximal liver glycogen concentration by summer and displayed high glycogenic and glycogenolytic potential in winter, but, unlike Ohioan frogs, started replenishing their energy reserves early in spring. We conclude that variation in levels of both glycogenolytic and glycogenic enzymes likely happens in response to seasonal changes in energetic strategies and demands, with winter survival being a key component to understanding the regulation of glycogen cycling in this species.

  8. Determination of the Glycogen Content in Cyanobacteria.

    Science.gov (United States)

    De Porcellinis, Alice; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

    2017-07-17

    Cyanobacteria accumulate glycogen as a major intracellular carbon and energy storage during photosynthesis. Recent developments in research have highlighted complex mechanisms of glycogen metabolism, including the diel cycle of biosynthesis and catabolism, redox regulation, and the involvement of non-coding RNA. At the same time, efforts are being made to redirect carbon from glycogen to desirable products in genetically engineered cyanobacteria to enhance product yields. Several methods are used to determine the glycogen contents in cyanobacteria, with variable accuracies and technical complexities. Here, we provide a detailed protocol for the reliable determination of the glycogen content in cyanobacteria that can be performed in a standard life science laboratory. The protocol entails the selective precipitation of glycogen from the cell lysate and the enzymatic depolymerization of glycogen to generate glucose monomers, which are detected by a glucose oxidase-peroxidase (GOD-POD) enzyme coupled assay. The method has been applied to Synechocystis sp. PCC 6803 and Synechococcus sp. PCC 7002, two model cyanobacterial species that are widely used in metabolic engineering. Moreover, the method successfully showed differences in the glycogen contents between the wildtype and mutants defective in regulatory elements or glycogen biosynthetic genes.

  9. CHEMICAL CHARACTERIZATION OF A HYPOGLYCEMIC EXTRACT FROM CUCURBITA FICIFOLIA BOUCHE THAT INDUCES LIVER GLYCOGEN ACCUMULATION IN DIABETIC MICE.

    Science.gov (United States)

    Jessica, Garcia Gonzalez; Mario, Garcia Lorenzana; Alejandro, Zamilpa; Cesar, Almanza Perez Julio; Ivan, Jasso Villagomez E; Ruben, Roman Ramos; Javier, Alarcon-Aguilar Francisco

    2017-01-01

    The aqueous extract of Cucurbita ficifolia ( C. ficifolia ) fruit has demonstrated hypoglycemic effect, which may be attributed to some components in the extract. However, the major secondary metabolites in this fruit have not yet been identified and little is known about its extra-pancreatic action, in particular, on liver carbohydrate metabolism. Therefore, in addition to the isolation and structural elucidation of the principal components in the aqueous extract of C. ficifolia , the aim of this study was to determine whether or not the hypoglycemic effect of the aqueous extract of Cucurbita ficifolia ( C. ficifolia ) fruit is due to accumulation of liver glycogen in diabetic mice. The aqueous extract from fruit of C. ficifolia was fractionated and its main secondary metabolites were purified and chemically characterized (NMR and GC-MS). Alloxan-induced diabetic mice received daily by gavage the aqueous extract (30 days). The liver glycogen content was quantified by spectroscopic method and by PAS stain; ALT and AST by spectrometric method; glycogen synthase, glycogen phosphorylase and GLUT2 by Western blot; the mRNA expression of GLUT2 and glucagon-receptor by RT-PCR; while serum insulin was quantified by ELISA method. A liver histological analysis was also performed by H&E stain. Chemical fingerprint showed five majoritarian compounds in the aqueous extract of C. ficifolia : p -coumaric acid, p-hydroxybenzoic acid, salicin, stigmast-7,2,2-dien-3-ol and stigmast-7-en-3-ol. The histological analysis showed accumulation of liver glycogen. Also, increased glycogen synthase and decreased glycogen phosphorylase were observed. Interestingly, the histological architecture evidenced a liver-protective effect due the extract. Five compounds were identified in C. ficifolia aqueous extract. The hypoglycemic effect of this extract may be partially explained by liver glycogen accumulation. The bioactive compound responsible for the hypoglycemic effect of this extract will be

  10. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  11. Glycogen synthase kinase-3 inhibition by 3-anilino-4-phenylmaleimides: insights from 3D-QSAR and docking

    Science.gov (United States)

    Prasanna, Sivaprakasam; Daga, Pankaj R.; Xie, Aihua; Doerksen, Robert J.

    2009-02-01

    Glycogen synthase kinase-3, a serine/threonine kinase, has been implicated in a wide variety of pathological conditions such as diabetes, Alzheimer's disease, stroke, bipolar disorder, malaria and cancer. Herein we report 3D-QSAR analyses using CoMFA and CoMSIA and molecular docking studies on 3-anilino-4-phenylmaleimides as GSK-3α inhibitors, in order to better understand the mechanism of action and structure-activity relationship of these compounds. Comparison of the active site residues of GSK-3α and GSK-3β isoforms shows that all the key amino acids involved in polar interactions with the maleimides for the β isoform are the same in the α isoform, except that Asp133 in the β isoform is replaced by Glu196 in the α isoform. We prepared a homology model for GSK-3α, and showed that the change from Asp to Glu should not affect maleimide binding significantly. Docking studies revealed the binding poses of three subclasses of these ligands, namely anilino, N-methylanilino and indoline derivatives, within the active site of the β isoform, and helped to explain the difference in their inhibitory activity.

  12. Low birth weight and zygosity status is associated with defective muscle glycogen and glycogen synthase regulation in elderly twins

    DEFF Research Database (Denmark)

    Poulsen, Pernille; Wojtaszewski, Jørgen; Richter, Erik

    2007-01-01

    OBJECTIVE: An adverse intrauterine environment indicated by both low birth weight and monozygosity is associated with an age- or time-dependent reduction in glucose disposal and nonoxidative glucose metabolism in twins, suggesting impaired regulation of muscle glycogen synthesis. RESEARCH DESIGN ...

  13. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  14. A GYS1 gene mutation is highly associated with polysaccharide storage myopathy in Cob Normand draught horses.

    Science.gov (United States)

    Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G

    2009-02-01

    Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.

  15. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  16. Interaction of human biliverdin reductase with Akt/protein kinase B and phosphatidylinositol-dependent kinase 1 regulates glycogen synthase kinase 3 activity: a novel mechanism of Akt activation.

    Science.gov (United States)

    Miralem, Tihomir; Lerner-Marmarosh, Nicole; Gibbs, Peter E M; Jenkins, Jermaine L; Heimiller, Chelsea; Maines, Mahin D

    2016-08-01

    Biliverdin reductase A (BVR) and Akt isozymes have overlapping pleiotropic functions in the insulin/PI3K/MAPK pathway. Human BVR (hBVR) also reduces the hemeoxygenase activity product biliverdin to bilirubin and is directly activated by insulin receptor kinase (IRK). Akt isoenzymes (Akt1-3) are downstream of IRK and are activated by phosphatidylinositol-dependent kinase 1 (PDK1) phosphorylating T(308) before S(473) autophosphorylation. Akt (RxRxxSF) and PDK1 (RFxFPxFS) binding motifs are present in hBVR. Phosphorylation of glycogen synthase kinase 3 (GSK3) isoforms α/β by Akts inhibits their activity; nonphosphorylated GSK3β inhibits activation of various genes. We examined the role of hBVR in PDK1/Akt1/GSK3 signaling and Akt1 in hBVR phosphorylation. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. hBVR and Akt1 coimmunoprecipitated, and in-cell Förster resonance energy transfer (FRET) and glutathione S-transferase pulldown analyses identified Akt1 pleckstrin homology domain as the interactive domain. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. Site-directed mutagenesis, mass spectrometry, and kinetic analyses identified S(230) in hBVR (225)RNRYLSF sequence as the Akt1 target. Underlined amino acids are the essential residues of the signaling motifs. In cells, hBVR-activated Akt1 increased both GSK3α/β and forkhead box of the O class transcription class 3 (FoxO3) phosphorylation and inhibited total GSK3 activity; depletion of hBVR released inhibition and stimulated glucose uptake. Immunoprecipitation analysis showed that PDK1 and hBVR interact through hBVR's PDK1 binding (161)RFGFPAFS motif and formation of the PDK1/hBVR/Akt1 complex. sihBVR blocked complex formation. Findings identify hBVR as a previously unknown coactivator of Akt1 and as a key mediator of Akt1/GSK3 pathway, as well as define a key role for hBVR in Akt1 activation by PDK1.-Miralem, T., Lerner

  17. Glycogen Synthase Kinase 3 Inactivation Induces Cell Senescence through Sterol Regulatory Element Binding Protein 1-Mediated Lipogenesis in Chang Cells.

    Science.gov (United States)

    Kim, You-Mie; Song, Insun; Seo, Yong-Hak; Yoon, Gyesoon

    2013-12-01

    Enhanced lipogenesis plays a critical role in cell senescence via induction of expression of the mature form of sterol regulatory element binding protein 1 (SREBP1), which contributes to an increase in organellar mass, one of the indicators of senescence. We investigated the molecular mechanisms by which signaling molecules control SREBP1-mediated lipogenesis and senescence. We developed cellular models for stress-induced senescence, by exposing Chang cells, which are immortalized human liver cells, to subcytotoxic concentrations (200 µM) of deferoxamine (DFO) and H2O2. In this model of stress-induced cell senescence using DFO and H2O2, the phosphorylation profile of glycogen synthase kinase 3α (GSK3α) and β corresponded closely to the expression profile of the mature form of SREBP-1 protein. Inhibition of GSK3 with a subcytotoxic concentration of the selective GSK3 inhibitor SB415286 significantly increased mature SREBP1 expression, as well as lipogenesis and organellar mass. In addition, GSK3 inhibition was sufficient to induce senescence in Chang cells. Suppression of GSK3 expression with siRNAs specific to GSK3α and β also increased mature SREBP1 expression and induced senescence. Finally, blocking lipogenesis with fatty acid synthase inhibitors (cerulenin and C75) and siRNA-mediated silencing of SREBP1 and ATP citrate lyase (ACL) significantly attenuated GSK3 inhibition-induced senescence. GSK3 inactivation is an important upstream event that induces SREBP1-mediated lipogenesis and consequent cell senescence.

  18. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  19. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  20. Hypothalamic glycogen synthase kinase 3β has a central role in the regulation of food intake and glucose metabolism.

    Science.gov (United States)

    Benzler, Jonas; Ganjam, Goutham K; Krüger, Manon; Pinkenburg, Olaf; Kutschke, Maria; Stöhr, Sigrid; Steger, Juliane; Koch, Christiane E; Ölkrug, Rebecca; Schwartz, Michael W; Shepherd, Peter R; Grattan, David R; Tups, Alexander

    2012-10-01

    GSK3β (glycogen synthase kinase 3β) is a ubiquitous kinase that plays a key role in multiple intracellular signalling pathways, and increased GSK3β activity is implicated in disorders ranging from cancer to Alzheimer's disease. In the present study, we provide the first evidence of increased hypothalamic signalling via GSK3β in leptin-deficient Lep(ob/ob) mice and show that intracerebroventricular injection of a GSK3β inhibitor acutely improves glucose tolerance in these mice. The beneficial effect of the GSK3β inhibitor was dependent on hypothalamic signalling via PI3K (phosphoinositide 3-kinase), a key intracellular mediator of both leptin and insulin action. Conversely, neuron-specific overexpression of GSK3β in the mediobasal hypothalamus exacerbated the hyperphagia, obesity and impairment of glucose tolerance induced by a high-fat diet, while having little effect in controls fed standard chow. These results demonstrate that increased hypothalamic GSK3β signalling contributes to deleterious effects of leptin deficiency and exacerbates high-fat diet-induced weight gain and glucose intolerance.

  1. Structure determination of glycogen synthase kinase-3 from Leishmania major and comparative inhibitor structure-activity relationships with Trypanosoma brucei GSK-3

    Energy Technology Data Exchange (ETDEWEB)

    Ojo, Kayode K; Arakaki, Tracy L; Napuli, Alberto J; Inampudi, Krishna K; Keyloun, Katelyn R; Zhang, Li; Hol, Wim G.J.; Verlind, Christophe L.M.J.; Merritt, Ethan A; Van Voorhis, Wesley C [UWASH

    2012-04-24

    Glycogen synthase kinase-3 (GSK-3) is a drug target under intense investigation in pharmaceutical companies and constitutes an attractive piggyback target for eukaryotic pathogens. Two different GSKs are found in trypanosomatids, one about 150 residues shorter than the other. GSK-3 short (GeneDB: Tb927.10.13780) has previously been validated genetically as a drug target in Trypanosoma brucei by RNAi induced growth retardation; and chemically by correlation between enzyme and in vitro growth inhibition. Here, we report investigation of the equivalent GSK-3 short enzymes of L. major (LmjF18.0270) and L. infantum (LinJ18_V3.0270, identical in amino acid sequences to LdonGSK-3 short) and a crystal structure of LmajGSK-3 short at 2 Å resolution. The inhibitor structure-activity relationships (SARs) of L. major and L. infantum are virtually identical, suggesting that inhibitors could be useful for both cutaneous and visceral leishmaniasis. Leishmania spp. GSK-3 short has different inhibitor SARs than TbruGSK-3 short, which can be explained mostly by two variant residues in the ATP-binding pocket. Indeed, mutating these residues in the ATP-binding site of LmajGSK-3 short to the TbruGSK-3 short equivalents results in a mutant LmajGSK-3 short enzyme with SAR more similar to that of TbruGSK-3 short. The differences between human GSK-3β (HsGSK-3β) and LmajGSK-3 short SAR suggest that compounds which selectively inhibit LmajGSK-3 short may be found.

  2. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  3. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  4. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  5. Lithium chloride increases the production of amyloid-beta peptide independently from its inhibition of glycogen synthase kinase 3.

    Science.gov (United States)

    Feyt, Christine; Kienlen-Campard, Pascal; Leroy, Karelle; N'Kuli, Francisca; Courtoy, Pierre J; Brion, Jean-Pierre; Octave, Jean-Noël

    2005-09-30

    Glycogen synthase kinase 3 (GSK3) is able to phosphorylate tau at many sites that are found to be phosphorylated in paired helical filaments in Alzheimer disease. Lithium chloride (LiCl) efficiently inhibits GSK3 and was recently reported to also decrease the production of amyloid-beta peptide (Abeta) from its precursor, the amyloid precursor protein. Therefore, lithium has been proposed as a combined therapeutic agent, inhibiting both the hyperphosphorylation of tau and the production of Abeta. Here, we demonstrate that the inhibition of GSK3 by LiCl induced the nuclear translocation of beta-catenin in Chinese hamster ovary cells and rat cultured neurons, in which a decrease in tau phosphorylation was observed. In both cellular models, a nontoxic concentration of LiCl increased the production of Abeta by increasing the beta-cleavage of amyloid precursor protein, generating more substrate for an unmodified gamma-secretase activity. SB415286, another GSK3 inhibitor, induced the nuclear translocation of beta-catenin and slightly decreased Abeta production. It is concluded that the LiCl-mediated increase in Abeta production is not related to GSK3 inhibition.

  6. Glycogen synthase kinase-3β facilitates cell apoptosis induced by high fluence low-power laser irradiation through acceleration of Bax translocation

    Science.gov (United States)

    Huang, Lei; Wu, Shengnan; Xing, Da

    2011-03-01

    Glycogen synthase kinase-3β (GSK-3β) is a critical activator of cell apoptosis induced by a diverse array of insults. However, the effects of GSK-3β on the human lung adenocarcinoma cell (ASTC-a-1) apoptosis induced by high fluence low-power laser irradiation (HF-LPLI) are not clear. Here, we showed that GSK-3β was constantly translocated from cytoplasm to nucleus and activated during HF-LPLI-induced cell apoptosis. In addition, we found that co-overexpression of YFP-GSK-3β and CFP-Bax in ASTC-a-1 cells accelerated both Bax translocations to mitochondria and cell apoptosis, compared to the cells expressed CFP-Bax only under HF-LPLI treatment, indicating that GSK-3β facilitated ASTC-a-1 cells apoptosis through acceleration mitochondrial translocation of Bax. Our results demonstrate that GSK-3β exerts some of its pro-apoptotic effects in ASTC-a-1 cells by regulating the mitochondrial localization of Bax, a key component of the intrinsic apoptotic cascade.

  7. POST-EXERCISE MUSCLE GLYCOGEN REPLETION IN THE EXTREME: EFFECT OF FOOD ABSENCE AND ACTIVE RECOVERY

    Directory of Open Access Journals (Sweden)

    Paul A. Fournier

    2004-09-01

    Full Text Available Glycogen plays a major role in supporting the energy demands of skeletal muscles during high intensity exercise. Despite its importance, the amount of glycogen stored in skeletal muscles is so small that a large fraction of it can be depleted in response to a single bout of high intensity exercise. For this reason, it is generally recommended to ingest food after exercise to replenish rapidly muscle glycogen stores, otherwise one's ability to engage in high intensity activity might be compromised. But what if food is not available? It is now well established that, even in the absence of food intake, skeletal muscles have the capacity to replenish some of their glycogen at the expense of endogenous carbon sources such as lactate. This is facilitated, in part, by the transient dephosphorylation-mediated activation of glycogen synthase and inhibition of glycogen phosphorylase. There is also evidence that muscle glycogen synthesis occurs even under conditions conducive to an increased oxidation of lactate post-exercise, such as during active recovery from high intensity exercise. Indeed, although during active recovery glycogen resynthesis is impaired in skeletal muscle as a whole because of increased lactate oxidation, muscle glycogen stores are replenished in Type IIa and IIb fibers while being broken down in Type I fibers of active muscles. This unique ability of Type II fibers to replenish their glycogen stores during exercise should not come as a surprise given the advantages in maintaining adequate muscle glycogen stores in those fibers that play a major role in fight or flight responses

  8. Possible Role of the Glycogen Synthase Kinase-3 Signaling Pathway in Trimethyltin-Induced Hippocampal Neurodegeneration in Mice

    Science.gov (United States)

    Kim, Sung-Ho; Kim, Jong-Choon; Wang, Hongbing; Shin, Taekyun; Moon, Changjong

    2013-01-01

    Trimethyltin (TMT) is an organotin compound with potent neurotoxic effects characterized by neuronal destruction in selective regions, including the hippocampus. Glycogen synthase kinase-3 (GSK-3) regulates many cellular processes, and is implicated in several neurodegenerative disorders. In this study, we evaluated the therapeutic effect of lithium, a selective GSK-3 inhibitor, on the hippocampus of adult C57BL/6 mice with TMT treatment (2.6 mg/kg, intraperitoneal [i.p.]) and on cultured hippocampal neurons (12 days in vitro) with TMT treatment (5 µM). Lithium (50 mg/kg, i.p., 0 and 24 h after TMT injection) significantly attenuated TMT-induced hippocampal cell degeneration, seizure, and memory deficits in mice. In cultured hippocampal neurons, lithium treatment (0–10 mM; 1 h before TMT application) significantly reduced TMT-induced cytotoxicity in a dose-dependent manner. Additionally, the dynamic changes in GSK-3/β-catenin signaling were observed in the mouse hippocampus and cultured hippocampal neurons after TMT treatment with or without lithium. Therefore, lithium inhibited the detrimental effects of TMT on the hippocampal neurons in vivo and in vitro, suggesting involvement of the GSK-3/β-catenin signaling pathway in TMT-induced hippocampal cell degeneration and dysfunction. PMID:23940567

  9. Glycogen Synthase Kinase 3β Inhibition as a Therapeutic Approach in the Treatment of Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Liang Ma

    2013-08-01

    Full Text Available Alternative strategies beyond current chemotherapy and radiation therapy regimens are needed in the treatment of advanced stage and recurrent endometrial cancers. There is considerable promise for biologic agents targeting the extracellular signal-regulated kinase (ERK pathway for treatment of these cancers. Many downstream substrates of the ERK signaling pathway, such as glycogen synthase kinase 3β (GSK3β, and their roles in endometrial carcinogenesis have not yet been investigated. In this study, we tested the importance of GSK3β inhibition in endometrial cancer cell lines and in vivo models. Inhibition of GSK3β by either lithium chloride (LiCl or specific GSK3β inhibitor VIII showed cytostatic and cytotoxic effects on multiple endometrial cancer cell lines, with little effect on the immortalized normal endometrial cell line. Flow cytometry and immunofluorescence revealed a G2/M cell cycle arrest in both type I (AN3CA, KLE, and RL952 and type II (ARK1 endometrial cancer cell lines. In addition, LiCl pre-treatment sensitized AN3CA cells to the chemotherapy agent paclitaxel. Administration of LiCl to AN3CA tumor-bearing mice resulted in partial or complete regression of some tumors. Thus, GSK3β activity is associated with endometrial cancer tumorigenesis and its pharmacologic inhibition reduces cell proliferation and tumor growth.

  10. The modulation of the symbiont/host interaction between Wolbachia pipientis and Aedes fluviatilis embryos by glycogen metabolism.

    Directory of Open Access Journals (Sweden)

    Mariana da Rocha Fernandes

    Full Text Available Wolbachia pipientis, a maternally transmitted bacterium that colonizes arthropods, may affect the general aspects of insect physiology, particularly reproduction. Wolbachia is a natural endosymbiont of Aedes fluviatilis, whose effects in embryogenesis and reproduction have not been addressed so far. In this context, we investigated the correlation between glucose metabolism and morphological alterations during A. fluviatilis embryo development in Wolbachia-positive (W+ and Wolbachia-negative (W- mosquito strains. While both strains do not display significant morphological and larval hatching differences, larger differences were observed in hexokinase activity and glycogen contents during early and mid-stages of embryogenesis, respectively. To investigate if glycogen would be required for parasite-host interaction, we reduced Glycogen Synthase Kinase-3 (GSK-3 levels in adult females and their eggs by RNAi. GSK-3 knock-down leads to embryonic lethality, lower levels of glycogen and total protein and Wolbachia reduction. Therefore, our results suggest that the relationship between A. fluviatilis and Wolbachia may be modulated by glycogen metabolism.

  11. Yeast Interacting Proteins Database: YLR258W, YLR258W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YLR258W GSY2 Glycogen synthase, similar to Gsy1p; expression induced by glucose limitation...bait as prey (3) YLR258W GSY2 Glycogen synthase, similar to Gsy1p; expression induced by glucose limitatio...pression induced by glucose limitation, nitrogen starvation, heat shock, and stationary phase; activity regu...LR258W Bait ORF YLR258W Bait gene name GSY2 Bait description Glycogen synthase, similar to Gsy1p; expression induced by glucose limit...ation, nitrogen starvation, heat shock, and stationary phase; activity regulated by

  12. Dietary Methionine Restriction Alleviates Hyperglycemia in Pigs with Intrauterine Growth Restriction by Enhancing Hepatic Protein Kinase B Signaling and Glycogen Synthesis.

    Science.gov (United States)

    Ying, Zhixiong; Zhang, Hao; Su, Weipeng; Zhou, Le; Wang, Fei; Li, Yue; Zhang, Lili; Wang, Tian

    2017-10-01

    Background: Individuals with intrauterine growth restriction (IUGR) are prone to developing type 2 diabetes mellitus (T2DM). Dietary methionine restriction (MR) improves insulin sensitivity and glucose homeostasis in individuals with normal birth weight (NBW). Objective: This study investigated the effects of MR on plasma glucose concentration and hepatic and muscle glucose metabolism in pigs with IUGR. Methods: Thirty female NBW and 60 same-sex spontaneous IUGR piglets (Landrace × Yorkshire) were selected. After weaning (day 21), the piglets were fed diets with adequate methionine (NBW-CON and IUGR-CON) or 30% less methionine (IUGR-MR) ( n = 6). At day 180, 1 pig with a body weight near the mean of each replication was selected for biochemical analysis. Results: The IUGR-CON group showed 41.6%, 68.6%, and 67.1% higher plasma glucose concentration, hepatic phosphoenolpyruvate carboxykinase activity, and glucose-6-phosphatase activity, respectively, than the NBW-CON group ( P glycogen content and glycogen synthase activity were 36.9% and 38.8% lower, respectively, in the IUGR-CON than the NBW-CON group ( P glycogen content and glycogen synthase activity of the IUGR-MR pigs were 62.9% and 50.8% higher than those of the IUGR-CON pigs ( P glycogen synthesis, implying a potential nutritional strategy to prevent type 2 diabetes mellitus in IUGR offspring. © 2017 American Society for Nutrition.

  13. Lowering Temperature is the Trigger for Glycogen Build-Up and Winter Fasting in Crucian Carp (Carassius carassius).

    Science.gov (United States)

    Varis, Joonas; Haverinen, Jaakko; Vornanen, Matti

    2016-02-01

    Seasonal changes in physiology of vertebrate animals are triggered by environmental cues including temperature, day-length and oxygen availability. Crucian carp (Carassius carassius) tolerate prolonged anoxia in winter by using several physiological adaptations that are seasonally activated. This study examines which environmental cues are required to trigger physiological adjustments for winter dormancy in crucian carp. To this end, crucian carp were exposed to changing environmental factors under laboratory conditions: effects of declining water temperature, shortening day-length and reduced oxygen availability, separately and in different combinations, were examined on glycogen content and enzyme activities involved in feeding (alkaline phosphatase, AP) and glycogen metabolism (glycogen synthase, GyS; glycogen phosphorylase, GP). Lowering temperature induced a fall in activity of AP and a rise in glycogen content and rate of glycogen synthesis. Relative mass of the liver, and glycogen concentration of liver, muscle and brain increased with lowering temperature. Similarly activity of GyS in muscle and expression of GyS transcripts in brain were up-regulated by lowering temperature. Shortened day-length and oxygen availability had practically no effects on measured variables. We conclude that lowering temperature is the main trigger in preparation for winter anoxia in crucian carp.

  14. FLCN and AMPK Confer Resistance to Hyperosmotic Stress via Remodeling of Glycogen Stores.

    Directory of Open Access Journals (Sweden)

    Elite Possik

    2015-10-01

    Full Text Available Mechanisms of adaptation to environmental changes in osmolarity are fundamental for cellular and organismal survival. Here we identify a novel osmotic stress resistance pathway in Caenorhabditis elegans (C. elegans, which is dependent on the metabolic master regulator 5'-AMP-activated protein kinase (AMPK and its negative regulator Folliculin (FLCN. FLCN-1 is the nematode ortholog of the tumor suppressor FLCN, responsible for the Birt-Hogg-Dubé (BHD tumor syndrome. We show that flcn-1 mutants exhibit increased resistance to hyperosmotic stress via constitutive AMPK-dependent accumulation of glycogen reserves. Upon hyperosmotic stress exposure, glycogen stores are rapidly degraded, leading to a significant accumulation of the organic osmolyte glycerol through transcriptional upregulation of glycerol-3-phosphate dehydrogenase enzymes (gpdh-1 and gpdh-2. Importantly, the hyperosmotic stress resistance in flcn-1 mutant and wild-type animals is strongly suppressed by loss of AMPK, glycogen synthase, glycogen phosphorylase, or simultaneous loss of gpdh-1 and gpdh-2 enzymes. Our studies show for the first time that animals normally exhibit AMPK-dependent glycogen stores, which can be utilized for rapid adaptation to either energy stress or hyperosmotic stress. Importantly, we show that glycogen accumulates in kidneys from mice lacking FLCN and in renal tumors from a BHD patient. Our findings suggest a dual role for glycogen, acting as a reservoir for energy supply and osmolyte production, and both processes might be supporting tumorigenesis.

  15. Systemic Correction of Murine Glycogen Storage Disease Type IV by an AAV-Mediated Gene Therapy.

    Science.gov (United States)

    Yi, Haiqing; Zhang, Quan; Brooks, Elizabeth D; Yang, Chunyu; Thurberg, Beth L; Kishnani, Priya S; Sun, Baodong

    2017-03-01

    Deficiency of glycogen branching enzyme (GBE) causes glycogen storage disease type IV (GSD IV), which is characterized by the accumulation of a less branched, poorly soluble form of glycogen called polyglucosan (PG) in multiple tissues. This study evaluates the efficacy of gene therapy with an adeno-associated viral (AAV) vector in a mouse model of adult form of GSD IV (Gbe1 ys/ys ). An AAV serotype 9 (AAV9) vector containing a human GBE expression cassette (AAV-GBE) was intravenously injected into 14-day-old Gbe1 ys/ys mice at a dose of 5 × 10 11 vector genomes per mouse. Mice were euthanized at 3 and 9 months of age. In the AAV-treated mice at 3 months of age, GBE enzyme activity was highly elevated in heart, which is consistent with the high copy number of the viral vector genome detected. GBE activity also increased significantly in skeletal muscles and the brain, but not in the liver. The glycogen content was reduced to wild-type levels in muscles and significantly reduced in the liver and brain. At 9 months of age, though GBE activity was only significantly elevated in the heart, glycogen levels were significantly reduced in the liver, brain, and skeletal muscles of the AAV-treated mice. In addition, the AAV treatment resulted in an overall decrease in plasma activities of alanine transaminase, aspartate transaminase, and creatine kinase, and a significant increase in fasting plasma glucose concentration at 9 months of age. This suggests an alleviation of damage and improvement of function in the liver and muscles by the AAV treatment. This study demonstrated a long-term benefit of a systemic injection of an AAV-GBE vector in Gbe1 ys/ys mice.

  16. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  17. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  18. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  19. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  20. Glycogen Phosphomonoester Distribution in Mouse Models of the Progressive Myoclonic Epilepsy, Lafora Disease*

    Science.gov (United States)

    DePaoli-Roach, Anna A.; Contreras, Christopher J.; Segvich, Dyann M.; Heiss, Christian; Ishihara, Mayumi; Azadi, Parastoo; Roach, Peter J.

    2015-01-01

    Glycogen is a branched polymer of glucose that acts as an energy reserve in many cell types. Glycogen contains trace amounts of covalent phosphate, in the range of 1 phosphate per 500–2000 glucose residues depending on the source. The function, if any, is unknown, but in at least one genetic disease, the progressive myoclonic epilepsy Lafora disease, excessive phosphorylation of glycogen has been implicated in the pathology by disturbing glycogen structure. Some 90% of Lafora cases are attributed to mutations of the EPM2A or EPM2B genes, and mice with either gene disrupted accumulate hyperphosphorylated glycogen. It is, therefore, of importance to understand the chemistry of glycogen phosphorylation. Rabbit skeletal muscle glycogen contained covalent phosphate as monoesters of C2, C3, and C6 carbons of glucose residues based on analyses of phospho-oligosaccharides by NMR. Furthermore, using a sensitive assay for glucose 6-P in hydrolysates of glycogen coupled with measurement of total phosphate, we determined the proportion of C6 phosphorylation in rabbit muscle glycogen to be ∼20%. C6 phosphorylation also accounted for ∼20% of the covalent phosphate in wild type mouse muscle glycogen. Glycogen phosphorylation in Epm2a−/− and Epm2b−/− mice was increased 8- and 4-fold compared with wild type mice, but the proportion of C6 phosphorylation remained unchanged at ∼20%. Therefore, our results suggest that C2, C3, and/or C6 phosphate could all contribute to abnormal glycogen structure or to Lafora disease. PMID:25416783

  1. [Inhibition of glycogen synthase kinase 3b activity regulates Toll-like receptor 4-mediated liver inflammation].

    Science.gov (United States)

    Ren, Feng; Zhang, Hai-yan; Piao, Zheng-fu; Zheng, Su-jun; Chen, Yu; Chen, De-xi; Duan, Zhong-ping

    2012-09-01

    To determine the mechanism underlying the therapeutic activities of glycogen synthase kinase 3b (GSK3b) against hepatic ischemia-reperfusion (H-IR) injury by investigating the inhibitive effects of GSK3b on inflammation mediated by Toll-like receptor 4 (TLR4). C57BL/6 male mice were subjected to 90 min of warm liver cephalad lobe ischemia, followed by reperfusion for various lengths of time. The mice were divided into three groups: the H-IR untreated model (control group), and the H-IR inflammation-induced models that received an intraperitoneal injection of purified lipopolysaccharide (LPS) endotoxin alone (inflammation group) or with pretreatment of the SB216763 GSK3b-specific inhibitor (intervention group). To create a parallel isolated cell system for detailed investigations of macrophages, marrow-derived stem cells were isolated from femurs of the H-IR control group of mice and used to derive primary macrophages. The cells were then divided into the same three groups as the whole mouse system: control, LPS-induced inflammation model, and inflammation model with SB216763 intervention. Differential expressions of inflammation-related proteins and genes were detected by Western blotting and real-time quantitative PCR, respectively. The phosphorylation levels of ERK, JNK and p38 MAPK were induced in liver at 1 h after reperfusion, but then steadily decreased and returned to baseline levels by 4 h after reperfusion. In addition, the phosphorylation levels of ERK and JNK were induced in macrophages at 15 min after LPS stimulation, while the phosphorylation level of p38 MAPK was induced at 1 h; SB216763 pretreatment suppressed the LPS-stimulated ERK, JNK and p38 phosphorylation in macrophages. In the mouse model, GSK3b activity was found to promote the gene expression of anti-inflammatory cytokine IL-10 (control: 0.21 ± 0.08, inflammation: 0.83 ± 0.21, intervention: 1.76 ± 0.67; F = 3.16, P = 0.027) but to significantly inhibit the gene expression of pro

  2. Glycogen synthase kinase 3 regulates expression of nuclear factor-erythroid-2 related transcription factor-1 (Nrf1) and inhibits pro-survival function of Nrf1

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Madhurima; Kwong, Erick K.; Park, Eujean; Nagra, Parminder; Chan, Jefferson Y., E-mail: jchan@uci.edu

    2013-08-01

    Nuclear factor E2-related factor-1 (Nrf1) is a basic leucine zipper transcription factor that is known to regulate antioxidant and cytoprotective gene expression. It was recently shown that Nrf1 is regulated by SCF–Fbw7 ubiquitin ligase. However our knowledge of upstream signals that targets Nrf1 for degradation by the UPS is not known. We report here that Nrf1 expression is negatively regulated by glycogen synthase kinase 3 (GSK3) in Fbw7-dependent manner. We show that GSK3 interacts with Nrf1 and phosphorylates the Cdc4 phosphodegron domain (CPD) in Nrf1. Mutation of serine residue in the CPD of Nrf1 to alanine (S350A), blocks Nrf1 from phosphorylation by GSK3, and stabilizes Nrf1. Knockdown of Nrf1 and expression of a constitutively active form of GSK3 results in increased apoptosis in neuronal cells in response to ER stress, while expression of the GSK3 phosphorylation resistant S350A–Nrf1 attenuates apoptotic cell death. Together these data suggest that GSK3 regulates Nrf1 expression and cell survival function in response to stress activation. Highlights: • The effect of GSK3 on Nrf1 expression was examined. • GSK3 destabilizes Nrf1 protein via Fbw7 ubiquitin ligase. • GSK3 binds and phosphorylates Nrf1. • Protection from stress-induced apoptosis by Nrf1 is inhibited by GSK3.

  3. Structural mechanism of laforin function in glycogen dephosphorylation and lafora disease.

    Science.gov (United States)

    Raththagala, Madushi; Brewer, M Kathryn; Parker, Matthew W; Sherwood, Amanda R; Wong, Brian K; Hsu, Simon; Bridges, Travis M; Paasch, Bradley C; Hellman, Lance M; Husodo, Satrio; Meekins, David A; Taylor, Adam O; Turner, Benjamin D; Auger, Kyle D; Dukhande, Vikas V; Chakravarthy, Srinivas; Sanz, Pascual; Woods, Virgil L; Li, Sheng; Vander Kooi, Craig W; Gentry, Matthew S

    2015-01-22

    Glycogen is the major mammalian glucose storage cache and is critical for energy homeostasis. Glycogen synthesis in neurons must be tightly controlled due to neuronal sensitivity to perturbations in glycogen metabolism. Lafora disease (LD) is a fatal, congenital, neurodegenerative epilepsy. Mutations in the gene encoding the glycogen phosphatase laforin result in hyperphosphorylated glycogen that forms water-insoluble inclusions called Lafora bodies (LBs). LBs induce neuronal apoptosis and are the causative agent of LD. The mechanism of glycogen dephosphorylation by laforin and dysfunction in LD is unknown. We report the crystal structure of laforin bound to phosphoglucan product, revealing its unique integrated tertiary and quaternary structure. Structure-guided mutagenesis combined with biophysical and biochemical analyses reveal the basis for normal function of laforin in glycogen metabolism. Analyses of LD patient mutations define the mechanism by which subsets of mutations disrupt laforin function. These data provide fundamental insights connecting glycogen metabolism to neurodegenerative disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  5. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  6. Synthesis and biological evaluation of glycogen synthase kinase 3 (GSK-3) inhibitors: an fast and atom efficient access to 1-aryl-3-benzylureas.

    Science.gov (United States)

    Monte, Fabio Lo; Kramer, Thomas; Boländer, Alexander; Plotkin, Batya; Eldar-Finkelman, Hagit; Fuertes, Ana; Dominguez, Juan; Schmidt, Boris

    2011-09-15

    The glycogen synthase kinase 3 (GSK-3) is implicated in multiple cellular processes and has been linked to the pathogenesis of Alzheimer's disease (AD). In the course of our research topic we synthesized a library of potent GSK-3 inhibitors. We utilized the urea scaffold present in the potent and highly selective GSK-3 inhibitor AR-A014418 (AstraZeneca). This moiety suits both (a) a convergent approach utilizing readily accessible building blocks and (b) a divergent approach based on a microwave heating assisted Suzuki coupling. We established a chromatography-free purification method to generate products with sufficient purity for the biological assays. The structure-activity relationship of the library provided the rationale for the synthesis of the benzothiazolylurea 66 (IC(50)=140 nM) and the pyridylurea 62 (IC(50)=98 nM), which displayed two to threefold enhanced activity versus the reference compound 18 (AR-A014418: IC(50)=330 nM) in our assays. Copyright © 2011. Published by Elsevier Ltd.

  7. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  8. The Glycogen Synthase Kinase 3α and β Isoforms Differentially Regulates Interleukin-12p40 Expression in Endothelial Cells Stimulated with Peptidoglycan from Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Ricarda Cortés-Vieyra

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutively active regulatory enzyme that is important in cancer, diabetes, and cardiovascular, neurodegenerative, and psychiatric diseases. While GSK3α is usually important in neurodegenerative and psychiatric diseases GSK3β is fundamental in the inflammatory response caused by bacterial components. Peptidoglycan (PGN, one of the most abundant cell-wall structures of Gram-positive bacteria, is an important inducer of inflammation. To evaluate whether inhibition of GSK3α and GSK3β activity in bovine endothelial cells (BEC regulates the expression of the pro-inflammatory cytokine IL-12p40, we treated BEC with SDS-purified PGN from Staphylococcus aureus. We found that PGN triggered a TLR2/PI3K/Akt-dependent phosphorylation of GSK3α at Ser21, GSK3β at Ser9, and NF-κB p65 subunit (p65 at Ser536, and the phosphorylation of GSK3α was consistently higher than that of GSK3β. The expression of IL-12p40 was inhibited in BEC stimulated with PGN and pre-treated with a specific neutralizing anti-TLR2 antibody that targets the extracellular domain of TLR2 or by the addition of Akt-i IV (an Akt inhibitor. Inhibition of GSK3α and GSK3β with LiCl or SB216763 induced an increase in IL-12p40 mRNA and protein. The effect of each isoform on IL-12p40 expression was evaluated by siRNA-gene expression silencing of GSK3α and GSK3β. GSK3α gene silencing resulted in a marked increase in IL-12p40 mRNA and protein while GSK3β gene silencing had the opposite effect on IL-12p40 expression. These results indicate that the TLR2/PI3K/Akt-dependent inhibition of GSK3α activity also plays an important role in the inflammatory response caused by stimulation of BEC with PGN from S. aureus.

  9. Glycogen synthase kinase-3 levels and phosphorylation undergo large fluctuations in mouse brain during development

    Science.gov (United States)

    Beurel, Eléonore; Mines, Marjelo A; Song, Ling; Jope, Richard S

    2012-01-01

    Objectives Dysregulated glycogen synthase kinase-3 (GSK3) may contribute to the pathophysiology of mood disorders and other diseases, and appears to be a target of certain therapeutic drugs. The growing recognition of heightened vulnerability during development to many psychiatric diseases, including mood disorders, led us to test if there are developmental changes in mouse brain GSK3 and its regulation by phosphorylation and by therapeutic drugs. Methods GSK3 levels and phosphorylation were measured at seven ages of development in mouse cerebral cortex and hippocampus. Results Two periods of rapid transitions in GSK3 levels were identified, a large rise between postnatal day 1 and two to three weeks of age, where GSK3 levels were as high as four-fold adult mouse brain levels, and a rapid decline between two to four and eight weeks of age, when adult levels were reached. Inhibitory serine-phosphorylation of GSK3, particularly GSK3β, was extremely high in one-day postnatal mouse brain, and rapidly declined thereafter. These developmental changes in GSK3 were equivalent in male and female cerebral cortex, and differed from other signaling kinases, including Akt, ERK1/2, JNK, and p38 levels and phosphorylation. In contrast to adult mouse brain, where administration of lithium or fluoxetine rapidly and robustly increased serine-phosphorylation of GSK3, in young mice these responses were blunted or absent. Conclusions High brain levels of GSK3 and large fluctuations in its levels and phosphorylation in juvenile and adolescent mouse brain raise the possibility that they may contribute to destabilized mood regulation induced by environmental and genetic factors. PMID:23167932

  10. Glycogen Synthesis in Glycogenin 1-Deficient Patients: A Role for Glycogenin 2 in Muscle.

    Science.gov (United States)

    Krag, Thomas O; Ruiz-Ruiz, Cristina; Vissing, John

    2017-08-01

    Glycogen storage disease (GSD) type XV is a rare disease caused by mutations in the GYG1 gene that codes for the core molecule of muscle glycogen, glycogenin 1. Nonetheless, glycogen is present in muscles of glycogenin 1-deficient patients, suggesting an alternative for glycogen buildup. A likely candidate is glycogenin 2, an isoform expressed in the liver and heart but not in healthy skeletal muscle. We wanted to investigate the formation of glycogen and changes in glycogen metabolism in patients with GSD type XV. Two patients with mutations in the GYG1 gene were investigated for histopathology, ultrastructure, and expression of proteins involved in glycogen synthesis and metabolism. Apart from occurrence of polyglucosan (PG) bodies in few fibers, glycogen appeared normal in most cells, and the concentration was normal in patients with GSD type XV. We found that glycogenin 1 was absent, but glycogenin 2 was present in the patients, whereas the opposite was the case in healthy controls. Electron microscopy revealed that glycogen was present between and not inside myofibrils in type II fibers, compromising the ultrastructure of these fibers, and only type I fibers contained PG bodies. We also found significant changes to the expression levels of several enzymes directly involved in glycogen and glucose metabolism. To our knowledge, this is the first report demonstrating expression of glycogenin 2 in glycogenin 1-deficient patients, suggesting that glycogenin 2 rescues the formation of glycogen in patients with glycogenin 1 deficiency. Copyright © 2017 Endocrine Society

  11. Brain derived neurotrophic factor is involved in the regulation of glycogen synthase kinase 3β (GSK3β) signalling

    International Nuclear Information System (INIS)

    Gupta, Vivek; Chitranshi, Nitin; You, Yuyi; Gupta, Veer; Klistorner, Alexander; Graham, Stuart

    2014-01-01

    Highlights: • BDNF knockdown leads to activation of GSK3β in the neuronal cells. • BDNF knockdown can induce GSK3β activation beyond TrkB mediated effects. • BDNF impairment in vivo leads to age dependent activation of GSK3β in the retina. • Systemic treatment with TrkB agonist induces inhibition of retinal GSK3β. - Abstract: Glycogen synthase kinase 3β (GSK3β) is involved in several biochemical processes in neurons regulating cellular survival, gene expression, cell fate determination, metabolism and proliferation. GSK3β activity is inhibited through the phosphorylation of its Ser-9 residue. In this study we sought to investigate the role of BDNF/TrkB signalling in the modulation of GSK3β activity. BDNF/TrkB signalling regulates the GSK3β activity both in vivo in the retinal tissue as well as in the neuronal cells under culture conditions. We report here for the first time that BDNF can also regulate GSK3β activity independent of its effects through the TrkB receptor signalling. Knockdown of BDNF lead to a decline in GSK3β phosphorylation without having a detectable effect on the TrkB activity or its downstream effectors Akt and Erk1/2. Treatment with TrkB receptor agonist had a stimulating effect on the GSK3β phosphorylation, but the effect was significantly less pronounced in the cells in which BDNF was knocked down. The use of TrkB receptor antagonist similarly, manifested itself in the form of downregulation of GSK3β phosphorylation, but a combined TrkB inhibition and BDNF knockdown exhibited a much stronger negative effect. In vivo, we observed reduced levels of GSK3β phosphorylation in the retinal tissues of the BDNF +/− animals implicating critical role of BDNF in the regulation of the GSK3β activity. Concluding, BDNF/TrkB axis strongly regulates the GSK3β activity and BDNF also exhibits GSK3β regulatory effect independent of its actions through the TrkB receptor signalling

  12. Brain derived neurotrophic factor is involved in the regulation of glycogen synthase kinase 3β (GSK3β) signalling

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Vivek, E-mail: vivek.gupta@mq.edu.au [Australian School of Advanced Medicine, Macquarie University (Australia); Chitranshi, Nitin; You, Yuyi [Australian School of Advanced Medicine, Macquarie University (Australia); Gupta, Veer [School of Medical Sciences, Edith Cowan University, Perth (Australia); Klistorner, Alexander; Graham, Stuart [Australian School of Advanced Medicine, Macquarie University (Australia); Save Sight Institute, Sydney University, Sydney (Australia)

    2014-11-21

    Highlights: • BDNF knockdown leads to activation of GSK3β in the neuronal cells. • BDNF knockdown can induce GSK3β activation beyond TrkB mediated effects. • BDNF impairment in vivo leads to age dependent activation of GSK3β in the retina. • Systemic treatment with TrkB agonist induces inhibition of retinal GSK3β. - Abstract: Glycogen synthase kinase 3β (GSK3β) is involved in several biochemical processes in neurons regulating cellular survival, gene expression, cell fate determination, metabolism and proliferation. GSK3β activity is inhibited through the phosphorylation of its Ser-9 residue. In this study we sought to investigate the role of BDNF/TrkB signalling in the modulation of GSK3β activity. BDNF/TrkB signalling regulates the GSK3β activity both in vivo in the retinal tissue as well as in the neuronal cells under culture conditions. We report here for the first time that BDNF can also regulate GSK3β activity independent of its effects through the TrkB receptor signalling. Knockdown of BDNF lead to a decline in GSK3β phosphorylation without having a detectable effect on the TrkB activity or its downstream effectors Akt and Erk1/2. Treatment with TrkB receptor agonist had a stimulating effect on the GSK3β phosphorylation, but the effect was significantly less pronounced in the cells in which BDNF was knocked down. The use of TrkB receptor antagonist similarly, manifested itself in the form of downregulation of GSK3β phosphorylation, but a combined TrkB inhibition and BDNF knockdown exhibited a much stronger negative effect. In vivo, we observed reduced levels of GSK3β phosphorylation in the retinal tissues of the BDNF{sup +/−} animals implicating critical role of BDNF in the regulation of the GSK3β activity. Concluding, BDNF/TrkB axis strongly regulates the GSK3β activity and BDNF also exhibits GSK3β regulatory effect independent of its actions through the TrkB receptor signalling.

  13. Critical role of glycogen synthase kinase-3β in regulating the avian heterophil response to Salmonella enterica serovar Enteritidis

    Directory of Open Access Journals (Sweden)

    Michael eKogut

    2014-11-01

    Full Text Available A microarray-assisted gene expression screen of chicken heterophils revealed glycogen synthase kinase-3β (GSK-3β, a multifunctional Ser/Thr kinase, to be consistently up-regulated 30-180 min following stimulation with Salmonella enterica serovar Enteritidis (S. Enteritidis. The present study was designed to delineate the role of GSK-3β in regulating the innate function of chicken heterophils in response to S. Enteritidis exposure. Using a specific GSK-3β ELISA assay, 30 min after infection with S. Enteritidis, heterophils had a significant decrease in total GSK-3β, but a significant increase in phosphorylated GSK-3 (Ser9. By 60 min post-infection, there was no difference in the amount of phosphorylated GSK-3β (Ser9 in either the uninfected and infected heterophils. S. Enteritidis interaction with heterophils alters GSK-3 activity by stimulating phosphorylation at Ser9 and that peaks by 30 min post-infection. Further, inhibition of GSK3β with lithium chloride resulted in a significant decrease in NF-κB activation and expression of IL-6, but induces a significant increase in the expression of the anti-inflammatory cytokine, IL-10. Using a phospho-specific antibody array confirmed the phosphorylation of GSK-3β (Ser9 as well as the phosphorylation of the downstream cytokine-activated intracellular signaling pathway involved in stimulating immune responses, IκB, the IκB subunit IKK-β, and the NF-κB subunits p105, p65, and c-Rel. Our data revealed that the phosphorylation of GSK-3β (Ser9 is responsible for inducing and controlling an innate response to the bacteria. Our findings suggest that the repression of GSK-3 activity is beneficial to the host cell and may act as a target for treatment in controlling intestinal colonization in chickens. Further experiments will define the in vivo modulation of GSK-3 as a potential alternative to antibiotics in salmonella and other intestinal bacterial infections.

  14. Chronic inhibition of glycogen synthase kinase-3 protects against rotenone-induced cell death in human neuron-like cells by increasing BDNF secretion.

    Science.gov (United States)

    Giménez-Cassina, Alfredo; Lim, Filip; Díaz-Nido, Javier

    2012-12-07

    Mitochondrial dysfunction is a common feature of many neurodegenerative disorders. Likewise, activation of glycogen synthase kinase-3 (GSK-3) has been proposed to play an important role in neurodegeneration. This multifunctional protein kinase is involved in a number of cellular functions and we previously showed that chronic inhibition of GSK-3 protects neuronal cells against mitochondrial dysfunction-elicited cell death, through a mechanism involving increased glucose metabolism and the translocation of hexokinase II (HKII) to mitochondria. Here, we sought to gain deeper insight into the molecular basis of this neuroprotection. We found that chronic inhibition of GSK-3, either genetically or pharmacologically, elicited a marked increase in brain-derived neurotrophic factor (BDNF) secretion, which in turn conferred resistance to mitochondrial dysfunction through subcellular re-distribution of HKII. These results define a molecular pathway through which chronic inhibition of GSK-3 may protect neuronal cells from death. Moreover, they highlight the potential benefits of enhanced neurotrophic factor secretion as a therapeutic approach to treat neurodegenerative diseases. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  15. Biomarker for Glycogen Storage Diseases

    Science.gov (United States)

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  16. Maintaining glycogen synthase kinase-3 activity is critical for mTOR kinase inhibitors to inhibit cancer cell growth.

    Science.gov (United States)

    Koo, Junghui; Yue, Ping; Gal, Anthony A; Khuri, Fadlo R; Sun, Shi-Yong

    2014-05-01

    mTOR kinase inhibitors that target both mTORC1 and mTORC2 are being evaluated in cancer clinical trials. Here, we report that glycogen synthase kinase-3 (GSK3) is a critical determinant for the therapeutic response to this class of experimental drugs. Pharmacologic inhibition of GSK3 antagonized their suppressive effects on the growth of cancer cells similarly to genetic attenuation of GSK3. Conversely, expression of a constitutively activated form of GSK3β sensitized cancer cells to mTOR inhibition. Consistent with these findings, higher basal levels of GSK3 activity in a panel of human lung cancer cell lines correlated with more efficacious responses. Mechanistic investigations showed that mTOR kinase inhibitors reduced cyclin D1 levels in a GSK3β-dependent manner, independent of their effects on suppressing mTORC1 signaling and cap binding. Notably, selective inhibition of mTORC2 triggered proteasome-mediated cyclin D1 degradation, suggesting that mTORC2 blockade is responsible for GSK3-dependent reduction of cyclin D1. Silencing expression of the ubiquitin E3 ligase FBX4 rescued this reduction, implicating FBX4 in mediating this effect of mTOR inhibition. Together, our findings define a novel mechanism by which mTORC2 promotes cell growth, with potential implications for understanding the clinical action of mTOR kinase inhibitors. ©2014 AACR.

  17. Hyper-hippocampal glycogen induced by glycogen loading with exhaustive exercise.

    Science.gov (United States)

    Soya, Mariko; Matsui, Takashi; Shima, Takeru; Jesmin, Subrina; Omi, Naomi; Soya, Hideaki

    2018-01-19

    Glycogen loading (GL), a well-known type of sports conditioning, in combination with exercise and a high carbohydrate diet (HCD) for 1 week enhances individual endurance capacity through muscle glycogen supercompensation. This exercise-diet combination is necessary for successful GL. Glycogen in the brain contributes to hippocampus-related memory functions and endurance capacity. Although the effect of HCD on the brain remains unknown, brain supercompensation occurs following exhaustive exercise (EE), a component of GL. We thus employed a rat model of GL and examined whether GL increases glycogen levels in the brain as well as in muscle, and found that GL increased glycogen levels in the hippocampus and hypothalamus, as well as in muscle. We further explored the essential components of GL (exercise and/or diet conditions) to establish a minimal model of GL focusing on the brain. Exercise, rather than a HCD, was found to be crucial for GL-induced hyper-glycogen in muscle, the hippocampus and the hypothalamus. Moreover, EE was essential for hyper-glycogen only in the hippocampus even without HCD. Here we propose the EE component of GL without HCD as a condition that enhances brain glycogen stores especially in the hippocampus, implicating a physiological strategy to enhance hippocampal functions.

  18. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  19. Hepatic protein phosphatase 1 regulatory subunit 3B (Ppp1r3b) promotes hepatic glycogen synthesis and thereby regulates fasting energy homeostasis.

    Science.gov (United States)

    Mehta, Minal B; Shewale, Swapnil V; Sequeira, Raymond N; Millar, John S; Hand, Nicholas J; Rader, Daniel J

    2017-06-23

    Maintenance of whole-body glucose homeostasis is critical to glycemic function. Genetic variants mapping to chromosome 8p23.1 in genome-wide association studies have been linked to glycemic traits in humans. The gene of known function closest to the mapped region, PPP1R3B (protein phosphatase 1 regulatory subunit 3B), encodes a protein (G L ) that regulates glycogen metabolism in the liver. We therefore sought to test the hypothesis that hepatic PPP1R3B is associated with glycemic traits. We generated mice with either liver-specific deletion ( Ppp1r3b Δ hep ) or liver-specific overexpression of Ppp1r3b The Ppp1r3b deletion significantly reduced glycogen synthase protein abundance, and the remaining protein was predominantly phosphorylated and inactive. As a consequence, glucose incorporation into hepatic glycogen was significantly impaired, total hepatic glycogen content was substantially decreased, and mice lacking hepatic Ppp1r3b had lower fasting plasma glucose than controls. The concomitant loss of liver glycogen impaired whole-body glucose homeostasis and increased hepatic expression of glycolytic enzymes in Ppp1r3b Δ hep mice relative to controls in the postprandial state. Eight hours of fasting significantly increased the expression of two critical gluconeogenic enzymes, phosphoenolpyruvate carboxykinase and glucose-6-phosphatase, above the levels in control livers. Conversely, the liver-specific overexpression of Ppp1r3b enhanced hepatic glycogen storage above that of controls and, as a result, delayed the onset of fasting-induced hypoglycemia. Moreover, mice overexpressing hepatic Ppp1r3b upon long-term fasting (12-36 h) were protected from blood ketone-body accumulation, unlike control and Ppp1r3b Δ hep mice. These findings indicate a major role for Ppp1r3b in regulating hepatic glycogen stores and whole-body glucose/energy homeostasis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  1. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  2. Regulation of Th1 cells and experimental autoimmune encephalomyelitis (EAE) by glycogen synthase kinase-3

    Science.gov (United States)

    Beurel, Eléonore; Kaidanovich-Beilin, Oksana; Yeh, Wen-I; Song, Ling; Palomo, Valle; Michalek, Suzanne M.; Woodgett, James R.; Harrington, Laurie E.; Eldar-Finkelman, Hagit; Martinez, Ana; Jope, Richard S.

    2013-01-01

    Experimental autoimmune encephalomyelitis (EAE) is a rodent model of multiple sclerosis (MS), a debilitating autoimmune disease of the central nervous system, for which only limited therapeutic interventions are available. Since MS is mediated in part by autoreactive T cells, particularly Th17 and Th1 cells, in the present study, we tested if inhibitors of glycogen synthase kinase-3 (GSK3), previously reported to reduce Th17 cell generation, also alter Th1 cell production or ameliorate EAE. GSK3 inhibitors were found to impede the production of Th1 cells by reducing STAT1 activation. Molecularly reducing the expression of either of the two GSK3 isoforms demonstrated that Th17 cell production was sensitive to reduced levels of GSK3β, and Th1 cell production was inhibited in GSK3α-deficient cells. Administration of the selective GSK3 inhibitors TDZD-8, VP2.51, VP0.7, or L803-mts, significantly reduced the clinical symptoms of MOG35-55-induced EAE in mice, nearly eliminating the chronic progressive phase, and reduced the number of Th17 and Th1 cells in the spinal cord. Administration of TDZD-8 or L803-mts after the initial disease episode ameliorated clinical symptoms in a relapsing/remitting model of PLP139-151-induced EAE. Furthermore, deletion of GSK3β specifically in T cells was sufficient to ameliorate MOG35-55-induced EAE. These results demonstrate isoform-selective effects of GSK3 on T cell generation, therapeutic effects of GSK3 inhibitors in EAE, and that GSK3 inhibition in T cells is sufficient to reduce the severity of EAE, suggesting that GSK3 may be a feasible target for developing new therapeutic interventions for MS. PMID:23606540

  3. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  4. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  5. The canonical wnt signal restricts the glycogen synthase kinase 3/fbw7-dependent ubiquitination and degradation of eya1 phosphatase.

    Science.gov (United States)

    Sun, Ye; Li, Xue

    2014-07-01

    Haploinsufficiency of Eya1 causes the branchio-oto-renal (BOR) syndrome, and abnormally high levels of Eya1 are linked to breast cancer progression and poor prognosis. Therefore, regulation of Eya1 activity is key to its tissue-specific functions and oncogenic activities. Here, we show that Eya1 is posttranslationally modified by ubiquitin and that its ubiquitination level is self-limited to prevent premature degradation. Eya1 has an evolutionarily conserved CDC4 phosphodegron (CPD) signal, a target site of glycogen synthase kinase 3 (GSK3) kinase and Fbw7 ubiquitin ligase, which is required for Eya1 ubiquitination. Genetic deletion of Fbw7 and pharmacological inhibition of GSK3 significantly decrease Eya1 ubiquitination. Conversely, activation of the phosphatidylinositol 3-kinase (PI3K)/Akt and the canonical Wnt signal suppresses Eya1 ubiquitination. Compound Eya1(+/-); Wnt9b(+/-) mutants exhibit an increased penetrance of renal defect, indicating that they function in the same genetic pathway in vivo. Together, these findings reveal that the canonical Wnt and PI3K/Akt signal pathways restrain the GSK3/Fbw7-dependent Eya1 ubiquitination, and they further suggest that dysregulation of this novel axis contributes to tumorigenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  6. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of AMPA receptor signaling

    Science.gov (United States)

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-01-01

    Objectives Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. Methods In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Results Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. Conclusions These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. PMID:27687706

  7. The Antimalarial Effect of Curcumin Is Mediated by the Inhibition of Glycogen Synthase Kinase-3β.

    Science.gov (United States)

    Ali, Amatul Hamizah; Sudi, Suhaini; Basir, Rusliza; Embi, Noor; Sidek, Hasidah Mohd

    2017-02-01

    Curcumin, a bioactive compound in Curcuma longa, exhibits various pharmacological activities, including antimalarial effects. In silico docking simulation studies suggest that curcumin possesses glycogen synthase kinase-3β (GSK3β)-inhibitory properties. The involvement of GSK3 in the antimalarial effects in vivo is yet to be demonstrated. In this study, we aimed to evaluate whether the antimalarial effects of curcumin involve phosphorylation of host GSK3β. Intraperitoneal administration of curcumin into Plasmodium berghei NK65-infected mice resulted in dose-dependent chemosuppression of parasitemia development. At the highest dose tested (30 mg/kg body weight), both therapeutic and prophylactic administrations of curcumin resulted in suppression exceeding 50% and improved median survival time of infected mice compared to control. Western analysis revealed a 5.5-fold (therapeutic group) and 1.8-fold (prophylactic group) increase in phosphorylation of Ser 9 GSK3β and 1.6-fold (therapeutic group) and 1.7-fold (prophylactic group) increase in Ser 473 Akt in liver of curcumin-treated infected animals. Following P. berghei infection, levels of pro- and anti-inflammatory cytokines, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, interleukin (IL)-10, and IL-4 were elevated by 7.5-, 35.0-, 33.0-, and 2.2-fold, respectively. Curcumin treatment (therapeutic) caused a significant decrease (by 6.0- and 2.0-fold, respectively) in serum TNF-α and IFN-γ level, while IL-10 and IL-4 were elevated (by 1.4- and 1.8-fold). Findings from the present study demonstrate for the first time that the antimalarial action of curcumin involved inhibition of GSK3β.

  8. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  9. Regulation of glycogen synthase kinase-3β (GSK-3β) after ionizing radiation

    International Nuclear Information System (INIS)

    Boehme, K.A.

    2006-12-01

    Glycogen Synthase Kinase-3β (GSK-3β) phosphorylates the Mdm2 protein in the central domain. This phosphorylation is absolutely required for p53 degradation. Ionizing radiation inactivates GSK-3β by phosphorylation at serine 9 and in consequence prevents Mdm2 mediated p53 degradation. During the work for my PhD I identified Akt/PKB as the kinase that phosphorylates GSK-3β at serine 9 after ionizing radiation. Ionizing radiation leads to phosphorylation of Akt/PKB at threonine 308 and serine 473. The PI3 Kinase inhibitor LY294002 completely abolished Akt/PKB serine 473 phosphorylation and prevented the induction of GSK-3β serine 9 phosphorylation after ionizing radiation. Interestingly, the most significant activation of Akt/PKB after ionizing radiation occurred in the nucleus while cytoplasmic Akt/PKB was only weakly activated after radiation. By using siRNA, I showed that Akt1/PKBa, but not Akt2/PKBβ, is required for phosphorylation of GSK- 3β at serine 9 after ionizing radiation. Phosphorylation and activation of Akt/PKB after ionizing radiation depends on the DNA dependent protein kinase (DNA-PK), a member of the PI3 Kinase family, that is activated by free DNA ends. Both, in cells from SCID mice and after knockdown of the catalytic subunit of DNA-PK by siRNA in osteosarcoma cells, phosphorylation of Akt/PKB at serine 473 and of GSK-3β at serine 9 was completely abolished. Consistent with the principle that phosphorylation of GSK-3 at serine 9 contributes to p53 stabilization after radiation, the accumulation of p53 in response to ionizing radiation was largely prevented by downregulation of DNA-PK. From these results I conclude, that ionizing radiation induces a signaling cascade that leads to Akt1/PKBa activation mediated by DNA-PK dependent phosphorylation of serine 473. After activation Akt1/PKBa phosphorylates and inhibits GSK-3β in the nucleus. The resulting hypophosphorylated form of Mdm2 protein is no longer able to degrade p53 which in

  10. Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

    International Nuclear Information System (INIS)

    Rothenberg, M.; Hanson, M.R.

    1988-01-01

    A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

  11. Genetic models rule out a major role of beta cell glycogen in the control of glucose homeostasis.

    Science.gov (United States)

    Mir-Coll, Joan; Duran, Jordi; Slebe, Felipe; García-Rocha, Mar; Gomis, Ramon; Gasa, Rosa; Guinovart, Joan J

    2016-05-01

    Glycogen accumulation occurs in beta cells of diabetic patients and has been proposed to partly mediate glucotoxicity-induced beta cell dysfunction. However, the role of glycogen metabolism in beta cell function and its contribution to diabetes pathophysiology remain poorly understood. We investigated the function of beta cell glycogen by studying glucose homeostasis in mice with (1) defective glycogen synthesis in the pancreas; and (2) excessive glycogen accumulation in beta cells. Conditional deletion of the Gys1 gene and overexpression of protein targeting to glycogen (PTG) was accomplished by Cre-lox recombination using pancreas-specific Cre lines. Glucose homeostasis was assessed by determining fasting glycaemia, insulinaemia and glucose tolerance. Beta cell mass was determined by morphometry. Glycogen was detected histologically by periodic acid-Schiff's reagent staining. Isolated islets were used for the determination of glycogen and insulin content, insulin secretion, immunoblots and gene expression assays. Gys1 knockout (Gys1 (KO)) mice did not exhibit differences in glucose tolerance or basal glycaemia and insulinaemia relative to controls. Insulin secretion and gene expression in isolated islets was also indistinguishable between Gys1 (KO) and controls. Conversely, despite effective glycogen overaccumulation in islets, mice with PTG overexpression (PTG(OE)) presented similar glucose tolerance to controls. However, under fasting conditions they exhibited lower glycaemia and higher insulinaemia. Importantly, neither young nor aged PTG(OE) mice showed differences in beta cell mass relative to age-matched controls. Finally, a high-fat diet did not reveal a beta cell-autonomous phenotype in either model. Glycogen metabolism is not required for the maintenance of beta cell function. Glycogen accumulation in beta cells alone is not sufficient to trigger the dysfunction or loss of these cells, or progression to diabetes.

  12. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  13. Fructose effect to enhance liver glycogen deposition is due to inhibition of glycogenolysis

    International Nuclear Information System (INIS)

    Youn, J.; Kaslow, H.; Bergman, R.

    1987-01-01

    The effect of fructose on glycogen degradation was examined by measuring flux of [ 14 C] from prelabeled glycogen in perfused rat livers. During 2 h refeeding of fasted rats hepatic glycogen was labeled by injection of [U 14 C] galactose (0.1 mg and 0.02 μCi/g of body weight). Refed livers were perfused for 30 min with glucose only (10 mM) and for 60 min with glucose (10 mM) without (n=5) or with fructose (1, 2, 10 mM; n=5 for each). With fructose, label production immediately declined and remained suppressed through the end of perfusion (P < 0.05). Suppression was dose-dependent: steady state label production was suppressed 45, 64, and 72% by 1, 2, and 10 mM fructose (P < 0.0001), without significant changes in glycogen synthase or phosphorylase. These results suggest the existence of allosteric inhibition of phosphorylase in the presence of fructose. Fructose 1-phosphate (F1P) accumulated in proportion to fructose (0.11 +/- 0.01 without fructose, 0.86 +/- 0.03, 1.81 +/- 0.18, and 8.23 +/- 0.6 μmoles/g of liver with 1, 2, and 10 mM fructose. Maximum inhibition of phosphorylase was 82%; FIP concentration for half inhibition was 0.57 μmoles/g of liver, well within the concentration of F1P attained in refeeding. Fructose enhances net glycogen synthesis in liver by suppressing glycogenolysis and the suppression is presumably caused by allosteric inhibition of phosphorylase by F1P

  14. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  15. Glycogen branching enzyme (GBE1) mutation causing equine glycogen storage disease IV.

    Science.gov (United States)

    Ward, Tara L; Valberg, Stephanie J; Adelson, David L; Abbey, Colette A; Binns, Matthew M; Mickelson, James R

    2004-07-01

    Comparative biochemical and histopathological evidence suggests that a deficiency in the glycogen branching enzyme, encoded by the GBE1 gene, is responsible for a recently identified recessive fatal fetal and neonatal glycogen storage disease (GSD) in American Quarter Horses termed GSD IV. We have now derived the complete GBE1 cDNA sequences for control horses and affected foals, and identified a C to A substitution at base 102 that results in a tyrosine (Y) to stop (X) mutation in codon 34 of exon 1. All 11 affected foals were homozygous for the X34 allele, their 11 available dams and sires were heterozygous, and all 16 control horses were homozygous for the Y34 allele. The previous findings of poorly branched glycogen, abnormal polysaccharide accumulation, lack of measurable GBE1 enzyme activity and immunodetectable GBE1 protein, coupled with the present observation of abundant GBE1 mRNA in affected foals, are all consistent with the nonsense mutation in the 699 amino acid GBE1 protein. The affected foal pedigrees have a common ancestor and contain prolific stallions that are likely carriers of the recessive X34 allele. Defining the molecular basis of equine GSD IV will allow for accurate DNA testing and the ability to prevent occurrence of this devastating disease affecting American Quarter Horses and related breeds.

  16. Hyperinsulinemia enhances interleukin-17-induced inflammation to promote prostate cancer development in obese mice through inhibiting glycogen synthase kinase 3-mediated phosphorylation and degradation of interleukin-17 receptor

    Science.gov (United States)

    Chen, Chong; Ge, Dongxia; Qu, Yine; Chen, Rongyi; Fan, Yi-Ming; Li, Nan; Tang, Wendell W.; Zhang, Wensheng; Zhang, Kun; Wang, Alun R.; Rowan, Brian G.; Hill, Steven M.; Sartor, Oliver; Abdel, Asim B.; Myers, Leann; Lin, Qishan; You, Zongbing

    2016-01-01

    Interleukin-17 (IL-17) plays important roles in inflammation, autoimmune diseases, and some cancers. Obese people are in a chronic inflammatory state with increased serum levels of IL-17, insulin, and insulin-like growth factor 1 (IGF1). How these factors contribute to the chronic inflammatory status that promotes development of aggressive prostate cancer in obese men is largely unknown. We found that, in obese mice, hyperinsulinemia enhanced IL-17-induced expression of downstream proinflammatory genes with increased levels of IL-17 receptor A (IL-17RA), resulting in development of more invasive prostate cancer. Glycogen synthase kinase 3 (GSK3) constitutively bound to and phosphorylated IL-17RA at T780, leading to ubiquitination and proteasome-mediated degradation of IL-17RA, thus inhibiting IL-17-mediated inflammation. IL-17RA phosphorylation was reduced, while the IL-17RA levels were increased in the proliferative human prostate cancer cells compared to the normal cells. Insulin and IGF1 enhanced IL-17-induced inflammatory responses through suppressing GSK3, which was shown in the cultured cell lines in vitro and obese mouse models of prostate cancer in vivo. These findings reveal a mechanism underlying the intensified inflammation in obesity and obesity-associated development of aggressive prostate cancer, suggesting that targeting GSK3 may be a potential therapeutic approach to suppress IL-17-mediated inflammation in the prevention and treatment of prostate cancer, particularly in obese men. PMID:26871944

  17. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Extracellular cystatin SN and cathepsin B prevent cellular senescence by inhibiting abnormal glycogen accumulation.

    Science.gov (United States)

    Oh, Sang-Seok; Park, Soojong; Lee, Ki-Won; Madhi, Hamadi; Park, Sae Gwang; Lee, Hee Gu; Cho, Yong-Yeon; Yoo, Jiyun; Dong Kim, Kwang

    2017-04-06

    Cystatin SN (CST1), a known inhibitor of cathepsin B (CatB), has important roles in tumor development. Paradoxically, CatB is a member of the cysteine cathepsin family that acts in cellular processes, such as tumor development and invasion. However, the relationship between CST1 and CatB, and their roles in tumor development are poorly understood. In this study, we observed that the knockdown of CST1 induced the activity of senescence-associated β-galactosidase, a marker of cellular senescence, and expression of senescence-associated secretory phenotype genes, including interleukin-6 and chemokine (C-C motif) ligand 20, in MDA-MB-231 and SW480 cancer cells. Furthermore, CST1 knockdown decreased extracellular CatB activity, and direct CatB inhibition, using specific inhibitors or shCatB, induced cellular senescence. Reconstitution of CST1 restored CatB activity and inhibited cellular senescence in CST1 knockdown cells. CST1 knockdown or CatB inhibition increased glycogen synthase (GS) kinase 3β phosphorylation at serine 9, resulting in the activation of GS and the induction of glycogen accumulation associated with cellular senescence. Importantly, CST1 knockdown suppressed cancer cell proliferation, soft agar colony growth and tumor growth in a xenograft model. These results indicate that CST1-mediated extracellular CatB activity enhances tumor development by preventing cellular senescence. Our findings suggest that antagonists of CST1 or inhibitors of CatB are potential anticancer agents.

  19. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Directory of Open Access Journals (Sweden)

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  20. Glycogen synthase kinase 3β regulation of nuclear factor of activated T-cells isoform c1 in the vascular smooth muscle cell response to injury

    International Nuclear Information System (INIS)

    Chow Winsion; Hou Guangpei; Bendeck, Michelle P.

    2008-01-01

    The migration and proliferation of vascular smooth muscle cells (vSMCs) are critical events in neointima formation during atherosclerosis and restenosis. The transcription factor nuclear factor of activated T-cells-isoform c1 (NFATc1) is regulated by atherogenic cytokines, and has been implicated in the migratory and proliferative responses of vSMCs through the regulation of gene expression. In T-cells, calcineurin de-phosphorylates NFATc1, leading to its nuclear import, while glycogen synthase kinase 3 β (GSK3β) phosphorylates NFATc1 and promotes its nuclear export. However, the relationship between NFATc1 and GSK3β has not been studied during SMC migration and proliferation. We investigated this by scrape wounding vSMCs in vitro, and studying wound repair. NFATc1 protein was transiently increased, reaching a peak at 8 h after wounding. Cell fractionation and immunocytochemistry revealed that NFATc1 accumulation in the nucleus was maximal at 4 h after injury, and this was coincident with a significant 9 fold increase in transcriptional activity. Silencing NFATc1 expression with siRNA or inhibition of NFAT with cyclosporin A (CsA) attenuated wound closure by vSMCs. Phospho-GSK3β (inactive) increased to a peak at 30 min after injury, preceding the nuclear accumulation of NFATc1. Overexpression of a constitutively active mutant of GSK3β delayed the nuclear accumulation of NFATc1, caused a 50% decrease in NFAT transcriptional activity, and attenuated vSMC wound repair. We conclude that NFATc1 promotes the vSMC response to injury, and that inhibition of GSK3β is required for the activation of NFAT during wound repair

  1. Adenosine diphosphate sugar pyrophosphatase prevents glycogen biosynthesis in Escherichia coli

    Science.gov (United States)

    Moreno-Bruna, Beatriz; Baroja-Fernández, Edurne; Muñoz, Francisco José; Bastarrica-Berasategui, Ainara; Zandueta-Criado, Aitor; Rodríguez-López, Milagros; Lasa, Iñigo; Akazawa, Takashi; Pozueta-Romero, Javier

    2001-01-01

    An adenosine diphosphate sugar pyrophosphatase (ASPPase, EC 3.6.1.21) has been characterized by using Escherichia coli. This enzyme, whose activities in the cell are inversely correlated with the intracellular glycogen content and the glucose concentration in the culture medium, hydrolyzes ADP-glucose, the precursor molecule of glycogen biosynthesis. ASPPase was purified to apparent homogeneity (over 3,000-fold), and sequence analyses revealed that it is a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated as “nudix” hydrolases. Insertional mutagenesis experiments leading to the inactivation of the ASPPase encoding gene, aspP, produced cells with marginally low enzymatic activities and higher glycogen content than wild-type bacteria. aspP was cloned into an expression vector and introduced into E. coli. Transformed cells were shown to contain a dramatically reduced amount of glycogen, as compared with the untransformed bacteria. No pleiotropic changes in the bacterial growth occurred in both the aspP-overexpressing and aspP-deficient strains. The overall results pinpoint the reaction catalyzed by ASPPase as a potential step of regulating glycogen biosynthesis in E. coli. PMID:11416161

  2. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  3. The metabolic trinity, glucose-glycogen-lactate, links astrocytes and neurons in brain energetics, signaling, memory, and gene expression.

    Science.gov (United States)

    Dienel, Gerald A

    2017-01-10

    Glucose, glycogen, and lactate are traditionally identified with brain energetics, ATP turnover, and pathophysiology. However, recent studies extend their roles to include involvement in astrocytic signaling, memory consolidation, and gene expression. Emerging roles for these brain fuels and a readily-diffusible by-product are linked to differential fluxes in glycolytic and oxidative pathways, astrocytic glycogen dynamics, redox shifts, neuron-astrocyte interactions, and regulation of astrocytic activities by noradrenaline released from the locus coeruleus. Disproportionate utilization of carbohydrate compared with oxygen during brain activation is influenced by catecholamines, but its physiological basis is not understood and its magnitude may be affected by technical aspects of metabolite assays. Memory consolidation and gene expression are impaired by glycogenolysis blockade, and prevention of these deficits by injection of abnormally-high concentrations of lactate was interpreted as a requirement for astrocyte-to-neuron lactate shuttling in memory and gene expression. However, lactate transport was not measured and evidence for presumed shuttling is not compelling. In fact, high levels of lactate used to preserve memory consolidation and induce gene expression are sufficient to shut down neuronal firing via the HCAR1 receptor. In contrast, low lactate levels activate a receptor in locus coeruleus that stimulates noradrenaline release that may activate astrocytes throughout brain. Physiological relevance of exogenous concentrations of lactate used to mimic and evaluate metabolic, molecular, and behavioral effects of lactate requires close correspondence with the normal lactate levels, the biochemical and cellular sources and sinks, and specificity of lactate delivery to target cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Science.gov (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  5. Impairments in cognition and neural precursor cell proliferation in mice expressing constitutively active glycogen synthase kinase-3

    Directory of Open Access Journals (Sweden)

    Marta ePardo

    2015-03-01

    Full Text Available ABSTRACTBrain glycogen synthase kinase-3 (GSK3 is hyperactive in several neurological conditions that involve impairments in both cognition and neurogenesis. This raises the hypotheses that hyperactive GSK3 may directly contribute to impaired cognition, and that this may be related to deficiencies in neural precursor cells (NPC. To study the effects of hyperactive GSK3 in the absence of disease influences, we compared adult hippocampal NPC proliferation and performance in three cognitive tasks in male and female wild-type mice and GSK3 knockin mice, which express constitutively active GSK3. NPC proliferation was ~40% deficient in both male and female GSK3 knockin mice compared with wild-type mice. Environmental enrichment (EE increased NPC proliferation in male, but not female, GSK3 knockin mice and wild-type mice. Male and female GSK3 knockin mice exhibited impairments in novel object recognition, temporal order memory, and coordinate spatial processing compared with gender-matched wild-type mice. EE restored impaired novel object recognition and temporal ordering in both sexes of GSK3 knockin mice, indicating that this repair was not dependent on NPC proliferation, which was not increased by EE in female GSK3 knockin mice. Acute 1 hr pretreatment with the GSK3 inhibitor TDZD-8 also improved novel object recognition and temporal ordering in male and female GSK3 knockin mice. These findings demonstrate that hyperactive GSK3 is sufficient to impair adult hippocampal NPC proliferation and to impair performance in three cognitive tasks in both male and female mice, but these changes in NPC proliferation do not directly regulate novel object recognition and temporal ordering tasks.

  6. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  7. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  8. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  9. Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the β-Catenin/TCF/LEF-1 pathway in gastric cancer cells.

    Science.gov (United States)

    Tang, Xiaoli; Zheng, Dong; Hu, Ping; Zeng, Zongyue; Li, Ming; Tucker, Lynne; Monahan, Renee; Resnick, Murray B; Liu, Manran; Ramratnam, Bharat

    2014-03-01

    Glycogen synthase kinase 3 beta (GSK3β) is a critical protein kinase that phosphorylates numerous proteins in cells and thereby impacts multiple pathways including the β-Catenin/TCF/LEF-1 pathway. MicroRNAs (miRs) are a class of noncoding small RNAs of ∼22 nucleotides in length. Both GSK3β and miR play myriad roles in cell functions including stem cell development, apoptosis, embryogenesis and tumorigenesis. Here we show that GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway. Knockout of GSK3β in mouse embryonic fibroblast cells increases expression of miR-96, miR-182 and miR-183, coinciding with increases in the protein level and nuclear translocation of β-Catenin. In addition, overexpression of β-Catenin enhances the expression of miR-96, miR-182 and miR-183 in human gastric cancer AGS cells. GSK3β protein levels are decreased in human gastric cancer tissue compared with surrounding normal gastric tissue, coinciding with increases of β-Catenin protein, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster (pri-miR-183). Furthermore, suppression of miR-183-96-182 cluster with miRCURY LNA miR inhibitors decreases the proliferation and migration of AGS cells. Knockdown of GSK3β with siRNA increases the proliferation of AGS cells. Mechanistically, we show that β-Catenin/TCF/LEF-1 binds to the promoter of miR-183-96-182 cluster gene and thereby activates the transcription of the cluster. In summary, our findings identify a novel role for GSK3β in the regulation of miR-183-96-182 biogenesis through β-Catenin/TCF/LEF-1 pathway in gastric cancer cells.

  10. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    KAUST Repository

    Ruchti, E.; Roach, P.J.; DePaoli-Roach, A.A.; Magistretti, Pierre J.; Allaman, I.

    2016-01-01

    to induce glycogen synthesis and accumulation. In contrast, siRNA-mediated downregulation of PTG resulted in a 2-fold decrease in glycogen levels. Interestingly, PTG downregulation strongly impaired long-term astrocytic glycogen synthesis induced by insulin

  11. Glycogen resynthesis rate following cross-country skiing is closely correlated to skeletal muscle glycogen content

    DEFF Research Database (Denmark)

    Ørtenblad, Niels; Nielsen, Joachim; Saltin, Bengt

    on an optimal glycogen resynthesis rate before a subsequent exercise session. The purpose of present study was to evaluate the glycogen resynthesis rate in elite cross-country (cc) skiers, following exhaustive exercise, and to examine the role of muscular glycogen content on the resynthesis rate. METHOD: Ten...... as 4h and 22h after the race and analyzed for glycogen content. Figure 1. Correlation between muscle glycogen resynthesis rate and glycogen content after and in the rocery period after exercise. Line indicate best fit of all the data points (r2 = 0.41, p

  12. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  13. Glycogen metabolism in humans

    OpenAIRE

    Adeva-Andany, María M.; González-Lucán, Manuel; Donapetry-García, Cristóbal; Fernández-Fernández, Carlos; Ameneiros-Rodríguez, Eva

    2016-01-01

    In the human body, glycogen is a branched polymer of glucose stored mainly in the liver and the skeletal muscle that supplies glucose to the blood stream during fasting periods and to the muscle cells during muscle contraction. Glycogen has been identified in other tissues such as brain, heart, kidney, adipose tissue, and erythrocytes, but glycogen function in these tissues is mostly unknown. Glycogen synthesis requires a series of reactions that include glucose entrance into the cell through...

  14. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  15. Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05

    Directory of Open Access Journals (Sweden)

    Nur Syazwani Mohtar

    2016-12-01

    Full Text Available The glycogen branching enzyme (EC 2.4.1.18, which catalyses the formation of α-1,6-glycosidic branch points in glycogen structure, is often used to enhance the nutritional value and quality of food and beverages. In order to be applicable in industries, enzymes that are stable and active at high temperature are much desired. Using genome mining, the nucleotide sequence of the branching enzyme gene (glgB was extracted from the Geobacillus mahadia Geo-05 genome sequence provided by the Malaysia Genome Institute. The size of the gene is 2013 bp, and the theoretical molecular weight of the protein is 78.43 kDa. The gene sequence was then used to predict the thermostability, function and the three dimensional structure of the enzyme. The gene was cloned and overexpressed in E. coli to verify the predicted result experimentally. The purified enzyme was used to study the effect of temperature and pH on enzyme activity and stability, and the inhibitory effect by metal ion on enzyme activity. This thermostable glycogen branching enzyme was found to be most active at 55 °C, and the half-life at 60 °C and 70 °C was 24 h and 5 h, respectively. From this research, a thermostable glycogen branching enzyme was successfully isolated from Geobacillus mahadia Geo-05 by genome mining together with molecular biology technique.

  16. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Non-Classical Gluconeogenesis-Dependent Glucose Metabolism in Rhipicephalus microplus Embryonic Cell Line BME26

    Directory of Open Access Journals (Sweden)

    Renato Martins da Silva

    2015-01-01

    Full Text Available In this work we evaluated several genes involved in gluconeogenesis, glycolysis and glycogen metabolism, the major pathways for carbohydrate catabolism and anabolism, in the BME26 Rhipicephalus microplus embryonic cell line. Genetic and catalytic control of the genes and enzymes associated with these pathways are modulated by alterations in energy resource availability (primarily glucose. BME26 cells in media were investigated using three different glucose concentrations, and changes in the transcription levels of target genes in response to carbohydrate utilization were assessed. The results indicate that several genes, such as glycogen synthase (GS, glycogen synthase kinase 3 (GSK3, phosphoenolpyruvate carboxykinase (PEPCK, and glucose-6 phosphatase (GP displayed mutual regulation in response to glucose treatment. Surprisingly, the transcription of gluconeogenic enzymes was found to increase alongside that of glycolytic enzymes, especially pyruvate kinase, with high glucose treatment. In addition, RNAi data from this study revealed that the transcription of gluconeogenic genes in BME26 cells is controlled by GSK-3. Collectively, these results improve our understanding of how glucose metabolism is regulated at the genetic level in tick cells.

  18. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    Science.gov (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  19. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  20. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    Science.gov (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  1. Insights into Brain Glycogen Metabolism: THE STRUCTURE OF HUMAN BRAIN GLYCOGEN PHOSPHORYLASE.

    Science.gov (United States)

    Mathieu, Cécile; Li de la Sierra-Gallay, Ines; Duval, Romain; Xu, Ximing; Cocaign, Angélique; Léger, Thibaut; Woffendin, Gary; Camadro, Jean-Michel; Etchebest, Catherine; Haouz, Ahmed; Dupret, Jean-Marie; Rodrigues-Lima, Fernando

    2016-08-26

    Brain glycogen metabolism plays a critical role in major brain functions such as learning or memory consolidation. However, alteration of glycogen metabolism and glycogen accumulation in the brain contributes to neurodegeneration as observed in Lafora disease. Glycogen phosphorylase (GP), a key enzyme in glycogen metabolism, catalyzes the rate-limiting step of glycogen mobilization. Moreover, the allosteric regulation of the three GP isozymes (muscle, liver, and brain) by metabolites and phosphorylation, in response to hormonal signaling, fine-tunes glycogenolysis to fulfill energetic and metabolic requirements. Whereas the structures of muscle and liver GPs have been known for decades, the structure of brain GP (bGP) has remained elusive despite its critical role in brain glycogen metabolism. Here, we report the crystal structure of human bGP in complex with PEG 400 (2.5 Å) and in complex with its allosteric activator AMP (3.4 Å). These structures demonstrate that bGP has a closer structural relationship with muscle GP, which is also activated by AMP, contrary to liver GP, which is not. Importantly, despite the structural similarities between human bGP and the two other mammalian isozymes, the bGP structures reveal molecular features unique to the brain isozyme that provide a deeper understanding of the differences in the activation properties of these allosteric enzymes by the allosteric effector AMP. Overall, our study further supports that the distinct structural and regulatory properties of GP isozymes contribute to the different functions of muscle, liver, and brain glycogen. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  3. Maintained activity of glycogen synthase kinase-3β despite of its phosphorylation at serine-9 in okadaic acid-induced neurodegenerative model

    International Nuclear Information System (INIS)

    Lim, Yong-Whan; Yoon, Seung-Yong; Choi, Jung-Eun; Kim, Sang-Min; Lee, Hui-Sun; Choe, Han; Lee, Seung-Chul; Kim, Dong-Hou

    2010-01-01

    Glycogen synthase kinase-3β (GSK3β) is recognized as one of major kinases to phosphorylate tau in Alzheimer's disease (AD), thus lots of AD drug discoveries target GSK3β. However, the inactive form of GSK3β which is phosphorylated at serine-9 is increased in AD brains. This is also inconsistent with phosphorylation status of other GSK3β substrates, such as β-catenin and collapsin response mediator protein-2 (CRMP2) since their phosphorylation is all increased in AD brains. Thus, we addressed this paradoxical condition of AD in rat neurons treated with okadaic acid (OA) which inhibits protein phosphatase-2A (PP2A) and induces tau hyperphosphorylation and cell death. Interestingly, OA also induces phosphorylation of GSK3β at serine-9 and other substrates including tau, β-catenin and CRMP2 like in AD brains. In this context, we observed that GSK3β inhibitors such as lithium chloride and 6-bromoindirubin-3'-monoxime (6-BIO) reversed those phosphorylation events and protected neurons. These data suggest that GSK3β may still have its kinase activity despite increase of its phosphorylation at serine-9 in AD brains at least in PP2A-compromised conditions and that GSK3β inhibitors could be a valuable drug candidate in AD.

  4. Glycogen synthase kinase-3beta and the p25 activator of cyclin dependent kinase 5 increase pausing of mitochondria in neurons.

    Science.gov (United States)

    Morel, M; Authelet, M; Dedecker, R; Brion, J P

    2010-06-02

    The complex bi-directional axoplasmic transport of mitochondria is essential for proper metabolic functioning of neurons and is controlled by phosphorylation. We have investigated by time-lapse imaging the effects of increased expression of glycogen synthase kinase-3beta (GSK-3beta) and of the p25 activator of cyclin dependent kinase 5 on mitochondria movements in mammalian cortical neurons and in PC12 cells. Both GSK-3beta and p25 increased the stationary behaviour of mitochondria in PC12 and in neurons, decreased their anterograde transport but did not affect the intrinsic velocities of mitochondria. The microtubule-associated tau proteins were more phosphorylated in GSK-3beta and p25 transfected neurons, but ultrastructural observation showed that these cells still contained microtubules and nocodazole treatment further reduced residual mitochondria movements in GSK-3beta or p25 transfected neurons, indicating that microtubule disruption was not the primary cause of increased mitochondrial stationary behaviour in GSK-3beta or p25 transfected neurons. Our results suggest that increased expression of GSK-3beta and p25 acted rather by decreasing the frequency of mitochondrial movements driven by molecular motors and that GSK-3beta and p25 might regulate these transports by controlling the time that mitochondria spend pausing, rather than their velocities. Copyright 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  6. Glycogen synthase kinase-3 inhibition sensitizes human induced pluripotent stem cells to thiol-containing antioxidants induced apoptosis.

    Science.gov (United States)

    Tu, Chengyi; Xu, Robert; Koleti, Meghana; Zoldan, Janet

    2017-08-01

    Inhibition of glycogen synthase kinase 3 (GSK3) is an extensively used strategy to activate Wnt pathway for pluripotent stem cell (PSC) differentiation. However, the effects of such inhibition on PSCs, besides upregulating the Wnt pathway, have rarely been investigated despite that GSK3 is broadly involved in other cellular activities such as insulin signaling and cell growth/survival regulation. Here we describe a previously unknown synergistic effect between GSK3 inhibition (e.g., Chir99021 and LY2090314) and various normally non-toxic thiol-containing antioxidants (e.g., N-acetylcysteine, NAC) on the induction of apoptosis in human induced pluripotent stem cells (iPSCs). Neither Chir99021 nor the antioxidants individually induced significant apoptosis, whereas their combined treatment resulted in rapid and extensive apoptosis, with substantial caspase 3 activity observed within 3h and over 90% decrease in cell viability after 24h. We confirmed the generality of this phenomenon with multiple independent iPSCs lines, various thiol-based antioxidants and distinct GSK3 inhibitors. Mechanistically, we demonstrated that rapamycin treatment could substantially reduce cell death, suggesting the critical role of mammalian target of rapamycin (mTOR). Akt dysregulation was also found to partially contribute to cell apoptosis but was not the primary cause. Further, this coordinated proapoptotic effect was not detected in mouse ESCs but was present in another human cells line: a breast cancer cell line (MDA-MB-231). Given the wide use of GSK3 inhibition in biomedical research: from iPSC differentiation to cancer intervention and the treatment of neuronal diseases, researchers can potentially take advantage of or avoid this synergistic effect for improved experimental or clinical outcome. Copyright © 2017. Published by Elsevier B.V.

  7. Aberrant glycogen synthase kinase 3β is involved in pancreatic cancer cell invasion and resistance to therapy.

    Directory of Open Access Journals (Sweden)

    Ayako Kitano

    Full Text Available BACKGROUND AND PURPOSE: The major obstacles to treatment of pancreatic cancer are the highly invasive capacity and resistance to chemo- and radiotherapy. Glycogen synthase kinase 3β (GSK3β regulates multiple cellular pathways and is implicated in various diseases including cancer. Here we investigate a pathological role for GSK3β in the invasive and treatment resistant phenotype of pancreatic cancer. METHODS: Pancreatic cancer cells were examined for GSK3β expression, phosphorylation and activity using Western blotting and in vitro kinase assay. The effects of GSK3β inhibition on cancer cell survival, proliferation, invasive ability and susceptibility to gemcitabine and radiation were examined following treatment with a pharmacological inhibitor or by RNA interference. Effects of GSK3β inhibition on cancer cell xenografts were also examined. RESULTS: Pancreatic cancer cells showed higher expression and activity of GSK3β than non-neoplastic cells, which were associated with changes in its differential phosphorylation. Inhibition of GSK3β significantly reduced the proliferation and survival of cancer cells, sensitized them to gemcitabine and ionizing radiation, and attenuated their migration and invasion. These effects were associated with decreases in cyclin D1 expression and Rb phosphorylation. Inhibition of GSK3β also altered the subcellular localization of Rac1 and F-actin and the cellular microarchitecture, including lamellipodia. Coincident with these changes were the reduced secretion of matrix metalloproteinase-2 (MMP-2 and decreased phosphorylation of focal adhesion kinase (FAK. The effects of GSK3β inhibition on tumor invasion, susceptibility to gemcitabine, MMP-2 expression and FAK phosphorylation were observed in tumor xenografts. CONCLUSION: The targeting of GSK3β represents an effective strategy to overcome the dual challenges of invasiveness and treatment resistance in pancreatic cancer.

  8. Calcineurin B homologous protein 3 negatively regulates cardiomyocyte hypertrophy via inhibition of glycogen synthase kinase 3 phosphorylation.

    Science.gov (United States)

    Kobayashi, Soushi; Nakamura, Tomoe Y; Wakabayashi, Shigeo

    2015-07-01

    Cardiac hypertrophy is a leading cause of serious heart diseases. Although many signaling molecules are involved in hypertrophy, the functions of some proteins in this process are still unknown. Calcineurin B homologous protein 3 (CHP3)/tescalcin is an EF-hand Ca(2+)-binding protein that is abundantly expressed in the heart; however, the function of CHP3 is unclear. Here, we aimed to identify the cardiac functions of CHP3. CHP3 was expressed in hearts at a wide range of developmental stages and was specifically detected in neonatal rat ventricular myocytes (NRVMs) but not in cardiac fibroblasts in culture. Moreover, knockdown of CHP3 expression using adenoviral-based RNA interference in NRVMs resulted in enlargement of cardiomyocyte size, concomitant with increased expression of a pathological hypertrophy marker ANP. This same treatment elevated glycogen synthase kinase (GSK3α/β) phosphorylation, which is known to inhibit GSK3 function. In contrast, CHP3 overexpression blocked the insulin-induced phosphorylation of GSK3α/β without affecting the phosphorylation of Akt, which is an upstream kinase of GSK3α/β, in HEK293 cells, and it inhibited both IGF-1-induced phosphorylation of GSK3β and cardiomyocyte hypertrophy in NRVMs. Co-immunoprecipitation experiments revealed that GSK3β interacted with CHP3. However, a Ca(2+)-binding-defective mutation of CHP3 (CHP3-D123A) also interacted with GSK3β and had the same inhibitory effect on GSK3α/β phosphorylation, suggesting that the action of CHP3 was independent of Ca(2+). These findings suggest that CHP3 functions as a novel negative regulator of cardiomyocyte hypertrophy via inhibition of GSK3α/β phosphorylation and subsequent enzymatic activation of GSK3α/β. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Lithium ameliorates open-field and elevated plus maze behaviors, and brain phospho-glycogen synthase kinase 3-beta expression in fragile X syndrome model mice.

    Science.gov (United States)

    Chen, Xi; Sun, Weiwen; Pan, Ying; Yang, Quan; Cao, Kaiyi; Zhang, Jin; Zhang, Yizhi; Chen, Mincong; Chen, Feidi; Huang, Yueling; Dai, Lijun; Chen, Shengqiang

    2013-10-01

    To investigate whether lithium modifies open-field and elevated plus maze behavior, and brain phospho-glycogen synthase kinase 3 (P-GSK3beta) expression in Fmr1 knockout mice. One hundred and eighty FVB mice, including knockout and wild type, with an age of 30 days were used. An open-field and elevated plus maze was utilized to test behavior, while western blot was used to measure the P-GSK3beta expression. Six groups were formed: control (saline), lithium chloride 30, 60, 90, 120, and 200 mg/kg. The experiments were carried out in the Institute of Neuroscience, Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China between January and June 2012. Lithium significantly decreased total distance, crossing, central area time, and center entry in the open-field test (popen-arm tracking, open-arm entry, and open-arm time in the elevated plus maze (popen-field and elevated plus maze behaviors of Fmr1 knockout mice. This effect may be related to its enhancement of P-GSK3beta expression. Our findings suggest that lithium might have a therapeutic effect in fragile X syndrome.

  10. Insulin like growth factor-1 prevents 1-mentyl-4-phenylphyridinium-induced apoptosis in PC12 cells through activation of glycogen synthase kinase-3beta

    International Nuclear Information System (INIS)

    Sun, Xin; Huang, Luqi; Zhang, Min; Sun, Shenggang; Wu, Yan

    2010-01-01

    Dopaminergic neurons are lost mainly through apoptosis in Parkinson's disease. Insulin like growth factor-1 (IGF-1) inhibits apoptosis in a wide variety of tissues. Here we have shown that IGF-1 protects PC12 cells from toxic effects of 1-methyl-4-phenylpyridiniumion (MPP + ). Treatment of PC12 cells with recombinant human IGF-1 significantly decreased apoptosis caused by MPP + as measured by acridine orange/ethidium bromide staining. IGF-1 treatment induced sustained phosphorylation of glycogen synthase kinase-3beta (GSK-3beta) as shown by western blot analysis. The anti-apoptotic effect of IGF-1 was abrogated by LY294002, which indirectly inhibits phosphorylation of GSK-3beta. Lithium chloride (LiCl), a known inhibitor of GSK-3beta, also blocked MPP + -induced apoptosis. Finally, although IGF-1 enhanced phosphorylation of extracellular signal-regulated kinases ERK1 and 2 (ERK1/2), PD98059, a specific inhibitor of ERK1/2, did not alter the survival effect of IGF-1. Thus, our findings indicate that IGF-1 protects PC12 cells exposed to MPP + from apoptosis via the GSK-3beta signaling pathway.

  11. Pathogenesis of Lafora Disease: Transition of Soluble Glycogen to Insoluble Polyglucosan.

    Science.gov (United States)

    Sullivan, Mitchell A; Nitschke, Silvia; Steup, Martin; Minassian, Berge A; Nitschke, Felix

    2017-08-11

    Lafora disease (LD, OMIM #254780) is a rare, recessively inherited neurodegenerative disease with adolescent onset, resulting in progressive myoclonus epilepsy which is fatal usually within ten years of symptom onset. The disease is caused by loss-of-function mutations in either of the two genes EPM2A (laforin) or EPM2B (malin). It characteristically involves the accumulation of insoluble glycogen-derived particles, named Lafora bodies (LBs), which are considered neurotoxic and causative of the disease. The pathogenesis of LD is therefore centred on the question of how insoluble LBs emerge from soluble glycogen. Recent data clearly show that an abnormal glycogen chain length distribution, but neither hyperphosphorylation nor impairment of general autophagy, strictly correlates with glycogen accumulation and the presence of LBs. This review summarizes results obtained with patients, mouse models, and cell lines and consolidates apparent paradoxes in the LD literature. Based on the growing body of evidence, it proposes that LD is predominantly caused by an impairment in chain-length regulation affecting only a small proportion of the cellular glycogen. A better grasp of LD pathogenesis will further develop our understanding of glycogen metabolism and structure. It will also facilitate the development of clinical interventions that appropriately target the underlying cause of LD.

  12. Inhibition of glycogen synthase kinase-3 enhances the differentiation and reduces the proliferation of adult human olfactory epithelium neural precursors

    International Nuclear Information System (INIS)

    Manceur, Aziza P.; Tseng, Michael; Holowacz, Tamara; Witterick, Ian; Weksberg, Rosanna; McCurdy, Richard D.; Warsh, Jerry J.; Audet, Julie

    2011-01-01

    The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.

  13. Glycogen synthase kinase-3 inhibition attenuates fibroblast activation and development of fibrosis following renal ischemia-reperfusion in mice

    Directory of Open Access Journals (Sweden)

    Shailendra P. Singh

    2015-08-01

    Full Text Available Glycogen synthase kinase-3β (GSK3β is a serine/threonine protein kinase that plays an important role in renal tubular injury and regeneration in acute kidney injury. However, its role in the development of renal fibrosis, often a long-term consequence of acute kidney injury, is unknown. Using a mouse model of renal fibrosis induced by ischemia-reperfusion injury, we demonstrate increased GSK3β expression and activity in fibrotic kidneys, and its presence in myofibroblasts in addition to tubular epithelial cells. Pharmacological inhibition of GSK3 using TDZD-8 starting before or after ischemia-reperfusion significantly suppressed renal fibrosis by reducing the myofibroblast population, collagen-1 and fibronectin deposition, inflammatory cytokines, and macrophage infiltration. GSK3 inhibition in vivo reduced TGF-β1, SMAD3 activation and plasminogen activator inhibitor-1 levels. Consistently in vitro, TGF-β1 treatment increased GSK3β expression and GSK3 inhibition abolished TGF-β1-induced SMAD3 activation and α-smooth muscle actin (α-SMA expression in cultured renal fibroblasts. Importantly, overexpression of constitutively active GSK3β stimulated α-SMA expression even in the absence of TGF-β1 treatment. These results suggest that TGF-β regulates GSK3β, which in turn is important for TGF-β–SMAD3 signaling and fibroblast-to-myofibroblast differentiation. Overall, these studies demonstrate that GSK3 could promote renal fibrosis by activation of TGF-β signaling and the use of GSK3 inhibitors might represent a novel therapeutic approach for progressive renal fibrosis that develops as a consequence of acute kidney injury.

  14. Glycogen synthase kinase 3β in the basolateral amygdala is critical for the reconsolidation of cocaine reward memory.

    Science.gov (United States)

    Wu, Ping; Xue, Yan-Xue; Ding, Zeng-Bo; Xue, Li-Fen; Xu, Chun-Mei; Lu, Lin

    2011-07-01

    Exposure to cocaine-associated conditioned stimuli elicits craving and increases the probability of cocaine relapse in cocaine users even after extended periods of abstinence. Recent evidence indicates that cocaine seeking can be inhibited by disrupting the reconsolidation of the cocaine cue memories and that basolateral amygdala (BLA) neuronal activity plays a role in this effect. Previous studies demonstrated that glycogen synthase kinase 3β (GSK-3β) plays a role in the reconsolidation of fear memory. Here, we used a conditioned place preference procedure to examine the role of GSK-3β in the BLA in the reconsolidation of cocaine cue memories. GSK-3β activity in the BLA, but not central amygdala (CeA), in rats that acquired cocaine (10 mg/kg)-induced conditioned place preference increased after re-exposure to a previously cocaine-paired chamber (i.e., a memory reactivation procedure). Systemic injections of the GSK-3β inhibitor lithium chloride after memory reactivation impaired the reconsolidation of cocaine cue memories and inhibited subsequent cue-induced GSK-3β activity in the BLA. Basolateral amygdala, but not central amygdala, injections of SB216763, a selective inhibitor of GSK-3β, immediately after the reactivation of cocaine cue memories also disrupted cocaine cue memory reconsolidation and prevented cue-induced increases in GSK-3β activity in the BLA. The effect of SB216763 on the reconsolidation of cocaine cue memories lasted at least 2 weeks and was not recovered by a cocaine priming injection. These results indicate that GSK-3β activity in the BLA mediates the reconsolidation of cocaine cue memories. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

  15. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  16. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

  17. Integrated application of transcriptomics and metabolomics provides insights into glycogen content regulation in the Pacific oyster Crassostrea gigas.

    Science.gov (United States)

    Li, Busu; Song, Kai; Meng, Jie; Li, Li; Zhang, Guofan

    2017-09-11

    The Pacific oyster Crassostrea gigas is an important marine fishery resource, which contains high levels of glycogen that contributes to the flavor and the quality of the oyster. However, little is known about the molecular and chemical mechanisms underlying glycogen content differences in Pacific oysters. Using a homogeneous cultured Pacific oyster family, we explored these regulatory networks at the level of the metabolome and the transcriptome. Oysters with the highest and lowest natural glycogen content were selected for differential transcriptome and metabolome analysis. We identified 1888 differentially-expressed genes, seventy-five differentially-abundant metabolites, which are part of twenty-seven signaling pathways that were enriched using an integrated analysis of the interaction between the differentially-expressed genes and the differentially-abundant metabolites. Based on these results, we found that a high expression of carnitine O-palmitoyltransferase 2 (CPT2), indicative of increased fatty acid degradation, is associated with a lower glycogen content. Together, a high level of expression of phosphoenolpyruvate carboxykinase (PEPCK), and high levels of glucogenic amino acids likely underlie the increased glycogen production in high-glycogen oysters. In addition, the higher levels of the glycolytic enzymes hexokinase (HK) and pyruvate kinase (PK), as well as of the TCA cycle enzymes malate dehydrogenase (MDH) and pyruvate carboxylase (PYC), imply that there is a concomitant up-regulation of energy metabolism in high-glycogen oysters. High-glycogen oysters also appeared to have an increased ability to cope with stress, since the levels of the antioxidant glutathione peroxidase enzyme 5 (GPX5) gene were also increased. Our results suggest that amino acids and free fatty acids are closely related to glycogen content in oysters. In addition, oysters with a high glycogen content have a greater energy production capacity and a greater ability to cope with

  18. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  19. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Attenuation of ischemia-reperfusion injury by sevoflurane postconditioning involves protein kinase B and glycogen synthase kinase 3 beta activation in isolated rat hearts.

    Science.gov (United States)

    Fang, Neng-Xin; Yao, Yun-Tai; Shi, Chun-Xia; Li, Li-Huan

    2010-12-01

    Volatile anesthetic ischemic postconditioning reduces infarct size following ischemia/reperfusion. Whether phosphorylation of protein kinase B (PKB/Akt) and glycogen synthase kinase 3 beta (GSK3β) is causal for cardioprotection by postconditioning is controversial. We therefore investigated the impact of PKB/Akt and GSK3β in isolated perfused rat hearts subjected to 40 min of ischemia followed by 1 h of reperfusion. 2.0% sevoflurane (1.0 minimum alveolar concentration) was administered at the onset of reperfusion in 15 min as postconditioning. Western blot analysis was used to determine phosphorylation of PKB/Akt and its downstream target GSK3β after 1 h of reperfusion. Mitochondrial and cytosolic content of cytochrome C checked by western blot served as a marker for mitochondrial permeability transition pore opening. Sevoflurane postconditioning significantly improved functional cardiac recovery and decreased infarct size in isolated rat hearts. Compared with unprotected hearts, sevoflurane postconditioning-induced phosphorylation of PKB/Akt and GSK3β were significantly increased. Increase of cytochrome C in mitochondria and decrease of it in cytosol is significant when compared with unprotected ones which have reversal effects on cytochrome C. The current study presents evidence that sevoflurane-induced cardioprotection at the onset of reperfusion are partly through activation of PKB/Akt and GSK3β.

  1. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  2. Irisin inhibits hepatic gluconeogenesis and increases glycogen synthesis via the PI3K/Akt pathway in type 2 diabetic mice and hepatocytes.

    Science.gov (United States)

    Liu, Tong-Yan; Shi, Chang-Xiang; Gao, Run; Sun, Hai-Jian; Xiong, Xiao-Qing; Ding, Lei; Chen, Qi; Li, Yue-Hua; Wang, Jue-Jin; Kang, Yu-Ming; Zhu, Guo-Qing

    2015-11-01

    Increased glucose production and reduced hepatic glycogen storage contribute to metabolic abnormalities in diabetes. Irisin, a newly identified myokine, induces the browning of white adipose tissue, but its effects on gluconeogenesis and glycogenesis are unknown. In the present study, we investigated the effects and underlying mechanisms of irisin on gluconeogenesis and glycogenesis in hepatocytes with insulin resistance, and its therapeutic role in type 2 diabetic mice. Insulin resistance was induced by glucosamine (GlcN) or palmitate in human hepatocellular carcinoma (HepG2) cells and mouse primary hepatocytes. Type 2 diabetes was induced by streptozotocin/high-fat diet (STZ/HFD) in mice. In HepG2 cells, irisin ameliorated the GlcN-induced increases in glucose production, phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (G6Pase) expression, and glycogen synthase (GS) phosphorylation; it prevented GlcN-induced decreases in glycogen content and the phosphoinositide 3-kinase (PI3K) p110α subunit level, and the phosphorylation of Akt/protein kinase B, forkhead box transcription factor O1 (FOXO1) and glycogen synthase kinase-3 (GSK3). These effects of irisin were abolished by the inhibition of PI3K or Akt. The effects of irisin were confirmed in mouse primary hepatocytes with GlcN-induced insulin resistance and in human HepG2 cells with palmitate-induced insulin resistance. In diabetic mice, persistent subcutaneous perfusion of irisin improved the insulin sensitivity, reduced fasting blood glucose, increased GSK3 and Akt phosphorylation, glycogen content and irisin level, and suppressed GS phosphorylation and PEPCK and G6Pase expression in the liver. Irisin improves glucose homoeostasis by reducing gluconeogenesis via PI3K/Akt/FOXO1-mediated PEPCK and G6Pase down-regulation and increasing glycogenesis via PI3K/Akt/GSK3-mediated GS activation. Irisin may be regarded as a novel therapeutic strategy for insulin resistance and type 2 diabetes. © 2015

  3. Inherent lipid metabolic dysfunction in glycogen storage disease IIIa.

    Science.gov (United States)

    Li, Xin-Hua; Gong, Qi-Ming; Ling, Yun; Huang, Chong; Yu, De-Min; Gu, Lei-Lei; Liao, Xiang-Wei; Zhang, Dong-Hua; Hu, Xi-Qi; Han, Yue; Kong, Xiao-Fei; Zhang, Xin-Xin

    2014-12-05

    We studied two patients from a nonconsanguineous family with life-long abnormal liver function, hepatomegaly and abnormal fatty acid profiles. Abnormal liver function, hypoglycemia and muscle weakness are observed in various genetic diseases, including medium-chain acyl-CoA dehydrogenase (MCAD) deficiency and glycogen storage diseases. The proband showed increased free fatty acids, mainly C8 and C10, resembling fatty acid oxidation disorder. However, no mutation was found in ACADM and ACADL gene. Sequencing of theamylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase (AGL) gene showed that both patients were compound heterozygotes for c.118C > T (p.Gln40X) and c.753_756 del CAGA (p.Asp251Glufsx29), whereas their parents were each heterozygous for one of these mutations. The AGL protein was undetectable in EBV-B cells from the two patients. Transcriptome analysis demonstrated a significant different pattern of gene expression in both of patients’ cells, including genes involving in the PPAR signaling pathway, fatty acid biosynthesis, lipid synthesis and visceral fat deposition and metabolic syndrome. This unique gene expression pattern is probably due to the absence of AGL, which potentially accounts for the observed clinical phenotypes of hyperlipidemia and hepatocyte steatosis in glycogen storage disease type IIIa.

  4. Glycogen metabolism protects against metabolic insult to preserve carotid body function during glucose deprivation.

    Science.gov (United States)

    Holmes, Andrew P; Turner, Philip J; Carter, Paul; Leadbeater, Wendy; Ray, Clare J; Hauton, David; Buckler, Keith J; Kumar, Prem

    2014-10-15

    The view that the carotid body (CB) type I cells are direct physiological sensors of hypoglycaemia is challenged by the finding that the basal sensory neuronal outflow from the whole organ is unchanged in response to low glucose. The reason for this difference in viewpoint and how the whole CB maintains its metabolic integrity when exposed to low glucose is unknown. Here we show that, in the intact superfused rat CB, basal sensory neuronal activity was sustained during glucose deprivation for 29.1 ± 1.2 min, before irreversible failure following a brief period of excitation. Graded increases in the basal discharge induced by reducing the superfusate PO2 led to proportional decreases in the time to the pre-failure excitation during glucose deprivation which was dependent on a complete run-down in glycolysis and a fall in cellular energy status. A similar ability to withstand prolonged glucose deprivation was observed in isolated type I cells. Electron micrographs and immunofluorescence staining of rat CB sections revealed the presence of glycogen granules and the glycogen conversion enzymes glycogen synthase I and glycogen phosphorylase BB, dispersed throughout the type I cell cytoplasm. Furthermore, pharmacological attenuation of glycogenolysis and functional depletion of glycogen both significantly reduced the time to glycolytic run-down by ∼33 and 65%, respectively. These findings suggest that type I cell glycogen metabolism allows for the continuation of glycolysis and the maintenance of CB sensory neuronal output in periods of restricted glucose delivery and this may act as a key protective mechanism for the organ during hypoglycaemia. The ability, or otherwise, to preserve energetic status may thus account for variation in the reported capacity of the CB to sense physiological glucose concentrations and may even underlie its function during pathological states associated with augmented CB discharge. © 2014 The Authors. The Journal of Physiology © 2014

  5. Free Glycogen in Vaginal Fluids Is Associated with Lactobacillus Colonization and Low Vaginal pH

    Science.gov (United States)

    Mirmonsef, Paria; Hotton, Anna L.; Gilbert, Douglas; Burgad, Derick; Landay, Alan; Weber, Kathleen M.; Cohen, Mardge; Ravel, Jacques; Spear, Gregory T.

    2014-01-01

    Objective Lactobacillus dominates the lower genital tract microbiota of many women, producing a low vaginal pH, and is important for healthy pregnancy outcomes and protection against several sexually transmitted pathogens. Yet, factors that promote Lactobacillus remain poorly understood. We hypothesized that the amount of free glycogen in the lumen of the lower genital tract is an important determinant of Lactobacillus colonization and a low vaginal pH. Methods Free glycogen in lavage samples was quantified. Pyrosequencing of the 16S rRNA gene was used to identify microbiota from 21 African American women collected over 8–11 years. Results Free glycogen levels varied greatly between women and even in the same woman. Samples with the highest free glycogen had a corresponding median genital pH that was significantly lower (pH 4.4) than those with low glycogen (pH 5.8; pglycogen versus those with low glycogen (median = 0.97 vs. 0.05, pglycogen. High concentrations of glycogen corresponded to higher levels of L. crispatus and L. jensenii, but not L. iners. Conclusion These findings show that free glycogen in genital fluid is associated with a genital microbiota dominated by Lactobacillus, suggesting glycogen is important for maintaining genital health. Treatments aimed at increasing genital free glycogen might impact Lactobacillus colonization. PMID:25033265

  6. Glycogen synthase kinase-3: a key kinase in retinal neuron apoptosis in early diabetic retinopathy

    Institute of Scientific and Technical Information of China (English)

    Li Zhaohui; Ma Ling; Chen Xiaodong; Li Yonghao; Li Shiyi; Zhang Jinglin; Lu Lin

    2014-01-01

    Background Diabetes-related pathogenic factors can cause retinal ganglion cell (RGC) apoptosis,but the specific mechanism is not very clear.The aim of this study is to investigate the correlation between glycogen synthase kinase-3 (GSK-3) activation and retinal neuron apoptosis.Methods In an in vitro experiment,the number of apoptotic RGC-5 cells differentiated by staurosporine was evaluated via flow cytometry and nuclei staining using Hoechst 33258.GSK-3 phosphorylation and caspase-3 activation in RGC-5 cells after serum deprivation were determined using Western blotting.Mitochondrial membrane potential was detected using the dye 5,5',6,6'-tetrachloro-1,1',3,3'-tetrethyl benzimidalyl carbocyanine iodide,and reactive oxygen species (ROS) levels were measured with dihydroethidium.In an in vivo experiment,the number of apoptotic retinal neurons was evaluated via terminal transferase dUTP nick-end labeling (TUNEL),and GSK-3 phosphorylation was determined using Western blotting,in the retinal nerve epithelial tissue of rats in which diabetes was induced by intravenous tail-vein injection of streptozotocin for 4 weeks.Results The levels of phosphorylated Ser21/9 in GSK-3α/β and p-T308/S473-AKT were lower and the cleaved caspase-3 levels were higher in the serum-deprived model (P <0.05).Lithium chloride treatment was associated with a slower rate of apoptosis,increased mitochondrial membrane potential,and decreased ROS levels in differentiated RGC-5 cells (P <0.05).The level of blood glucose and the number of TUNEL-positive cells in the whole-mounted retinas were higher (P <0.01),and the levels of phosphorylated Ser21/9 in GSK-3α/β and body weight were lower (P <0.05).However,the thickness of the retinal nerve epithelial layer was not significantly less in diabetic rats compared with control group.Lithium chloride intravitreal injection increased the levels of phosphorylated Ser21/9 in GSK-3α/β and decreased TUNEL-positive cells in the whole-mounted retinas

  7. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  9. High glycogen levels enhance glycogen breakdown in isolated contracting skeletal muscle

    DEFF Research Database (Denmark)

    Richter, Erik; Galbo, H

    1986-01-01

    and after 15 min of intermittent electrical muscle stimulation. Before stimulation, glycogen was higher in rats that swam on the preceding day (supercompensated rats) compared with controls. During muscle contractions, glycogen breakdown in fast-twitch red and white fibers was larger in supercompensated...

  10. Free glycogen in vaginal fluids is associated with Lactobacillus colonization and low vaginal pH.

    Directory of Open Access Journals (Sweden)

    Paria Mirmonsef

    Full Text Available Lactobacillus dominates the lower genital tract microbiota of many women, producing a low vaginal pH, and is important for healthy pregnancy outcomes and protection against several sexually transmitted pathogens. Yet, factors that promote Lactobacillus remain poorly understood. We hypothesized that the amount of free glycogen in the lumen of the lower genital tract is an important determinant of Lactobacillus colonization and a low vaginal pH.Free glycogen in lavage samples was quantified. Pyrosequencing of the 16S rRNA gene was used to identify microbiota from 21 African American women collected over 8-11 years.Free glycogen levels varied greatly between women and even in the same woman. Samples with the highest free glycogen had a corresponding median genital pH that was significantly lower (pH 4.4 than those with low glycogen (pH 5.8; p<0.001. The fraction of the microbiota consisting of Lactobacillus was highest in samples with high glycogen versus those with low glycogen (median = 0.97 vs. 0.05, p<0.001. In multivariable analysis, having 1 vs. 0 male sexual partner in the past 6 months was negatively associated, while BMI ≥30 was positively associated with glycogen. High concentrations of glycogen corresponded to higher levels of L. crispatus and L. jensenii, but not L. iners.These findings show that free glycogen in genital fluid is associated with a genital microbiota dominated by Lactobacillus, suggesting glycogen is important for maintaining genital health. Treatments aimed at increasing genital free glycogen might impact Lactobacillus colonization.

  11. Hypoxic inactivation of glycogen synthase kinase-3β promotes gastric tumor growth and angiogenesis by facilitating hypoxia-inducible factor-1 signaling.

    Science.gov (United States)

    Ko, Young San; Cho, Sung Jin; Park, Jinju; Choi, Yiseul; Lee, Jae-Seon; Youn, Hong-Duk; Kim, Woo Ho; Kim, Min A; Park, Jong-Wan; Lee, Byung Lan

    2016-09-01

    Since the molecular mechanism of hypoxic adaptation in cancer cells is cell-type specific, we investigated whether glycogen synthase kinase-3β (GSK-3β) activation is involved in hypoxia-induced gastric tumor promotion. Stable gastric cancer cell lines (SNU-638, SNU-484, MKN1, and MKN45) were cultured under hypoxic conditions. Cells overexpressing wild-type GSK-3β (WT-GSK-3β) or kinase-dead mutant of GSK-3β (KD-GSK-3β) were generated and used for cell culture and animal studies. In cell culture experiments, hypoxia decreased GSK-3β activation in gastric cancer cells. Cell viability and the expressions of HIF-1α protein and VEGF mRNA in gastric cancer cells were higher in KD-GSK-3β transfectants than in WT-GSK-3β transfectants under hypoxic conditions, but not under normoxic conditions. Gastric cancer xenografts showed that tumor growth, microvessel area, HIF-1α activation, and VEGF expression were higher in KD-GSK-3β tumors than in WT-GSK-3β tumors in vivo. In addition, the expression of hypoxia-induced HIF-1α protein was regulated by GSK-3β at the translational level. Our data suggest that GSK-3β is involved in hypoxic adaptation of gastric cancer cells as an inhibitory upstream regulator of the HIF-1α/VEGF signaling pathway. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  12. Carbon Monoxide Protects against Hepatic Ischemia/Reperfusion Injury via ROS-Dependent Akt Signaling and Inhibition of Glycogen Synthase Kinase 3β

    Directory of Open Access Journals (Sweden)

    Hyo Jeong Kim

    2013-01-01

    Full Text Available Carbon monoxide (CO may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3 and phosphatidylinositol 3-kinase (PI3K-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.

  13. Carbon monoxide protects against hepatic ischemia/reperfusion injury via ROS-dependent Akt signaling and inhibition of glycogen synthase kinase 3β.

    Science.gov (United States)

    Kim, Hyo Jeong; Joe, Yeonsoo; Kong, Jin Sun; Jeong, Sun-Oh; Cho, Gyeong Jae; Ryter, Stefan W; Chung, Hun Taeg

    2013-01-01

    Carbon monoxide (CO) may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R) injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3) and phosphatidylinositol 3-kinase (PI3K)-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β) in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.

  14. Inhibition of glycogen synthase kinase 3beta ameliorates triptolide-induced acute cardiac injury by desensitizing mitochondrial permeability transition

    International Nuclear Information System (INIS)

    Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin; Fu, Xinlu; Shen, Feihai; Huang, Zhiying

    2016-01-01

    Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.

  15. Inhibition of glycogen synthase kinase 3beta ameliorates triptolide-induced acute cardiac injury by desensitizing mitochondrial permeability transition

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Fu, Xinlu [Laboratory Animals Center, Sun Yat-sen University, Guangzhou 510006 (China); Shen, Feihai, E-mail: shenfh3@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Huang, Zhiying, E-mail: hzhiying@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China)

    2016-12-15

    Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.

  16. In vivo effects of diabetes, insulin and oleanolic acid on enzymes of glycogen metabolism in the skin of streptozotocin-induced diabetic male Sprague-Dawley rats.

    Science.gov (United States)

    Mukundwa, Andrew; Langa, Silvana O; Mukaratirwa, Samson; Masola, Bubuya

    2016-03-04

    The skin is the largest organ in the body and diabetes induces pathologic changes on the skin that affect glucose homeostasis. Changes in skin glycogen and glucose levels can mirror serum glucose levels and thus the skin might contribute to whole body glucose metabolism. This study investigated the in vivo effects of diabetes, insulin and oleanolic acid (OA) on enzymes of glycogen metabolism in skin of type 1 diabetic rats. Diabetic and non-diabetic adult male Sprague-Dawley rats were treated with a single daily dose of insulin (4 IU/kg body weight), OA (80 mg/kg body weight) and a combination of OA + insulin for 14 days. Glycogen phosphorylase (GP) expression; and GP, glycogen synthase (GS) and hexokinase activities as well glycogen levels were evaluated. The results suggest that diabetes lowers hexokinase activity, GP activity and GP expression with no change in GS activity whilst the treatments increased GP expression and the activities of hexokinase, GP and GS except for the GS activity in OA treated rats. Glycogen levels were increased slightly by diabetes as well as OA treatment. In conclusion diabetes, OA and insulin can lead to changes in GS and GP activities in skin without significantly altering the glycogen content. We suggest that the skin may contribute to whole body glucose homeostasis particularly in disease states. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  18. Inhibition of glycogen synthase kinase-3β counteracts ligand-independent activity of the androgen receptor in castration resistant prostate cancer.

    Directory of Open Access Journals (Sweden)

    Stefanie V Schütz

    Full Text Available In order to generate genomic signals, the androgen receptor (AR has to be transported into the nucleus upon androgenic stimuli. However, there is evidence from in vitro experiments that in castration-resistant prostate cancer (CRPC cells the AR is able to translocate into the nucleus in a ligand-independent manner. The recent finding that inhibition of the glycogen-synthase-kinase 3β (GSK-3β induces a rapid nuclear export of the AR in androgen-stimulated prostate cancer cells prompted us to analyze the effects of a GSK-3β inhibition in the castration-resistant LNCaP sublines C4-2 and LNCaP-SSR. Both cell lines exhibit high levels of nuclear AR in the absence of androgenic stimuli. Exposure of these cells to the maleimide SB216763, a potent GSK-3β inhibitor, resulted in a rapid nuclear export of the AR even under androgen-deprived conditions. Moreover, the ability of C4-2 and LNCaP-SSR cells to grow in the absence of androgens was diminished after pharmacological inhibition of GSK-3β in vitro. The ability of SB216763 to modulate AR signalling and function in CRPC in vivo was additionally demonstrated in a modified chick chorioallantoic membrane xenograft assay after systemic delivery of SB216763. Our data suggest that inhibition of GSK-3β helps target the AR for export from the nucleus thereby diminishing the effects of mislocated AR in CRPC cells. Therefore, inhibition of GSK-3β could be an interesting new strategy for the treatment of CRPC.

  19. Inhibition of glycogen synthase kinase-3 enhances the differentiation and reduces the proliferation of adult human olfactory epithelium neural precursors

    Energy Technology Data Exchange (ETDEWEB)

    Manceur, Aziza P. [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Tseng, Michael [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Holowacz, Tamara [Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Witterick, Ian [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Department of Otolaryngology, Head and Neck Surgery, University of Toronto, ON (Canada); Weksberg, Rosanna [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); McCurdy, Richard D. [The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); Warsh, Jerry J. [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Audet, Julie, E-mail: julie.audet@utoronto.ca [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada)

    2011-09-10

    The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.

  20. Focal adhesion kinase-mediated activation of glycogen synthase kinase 3β regulates IL-33 receptor internalization and IL-33 signaling.

    Science.gov (United States)

    Zhao, Jing; Wei, Jianxin; Bowser, Rachel K; Traister, Russell S; Fan, Ming-Hui; Zhao, Yutong

    2015-01-15

    IL-33, a relatively new member of the IL-1 cytokine family, plays a crucial role in allergic inflammation and acute lung injury. Long form ST2 (ST2L), the receptor for IL-33, is expressed on immune effector cells and lung epithelia and plays a critical role in triggering inflammation. We have previously shown that ST2L stability is regulated by the ubiquitin-proteasome system; however, its upstream internalization has not been studied. In this study, we demonstrate that glycogen synthase kinase 3β (GSK3β) regulates ST2L internalization and IL-33 signaling. IL-33 treatment induced ST2L internalization, and an effect was attenuated by inhibition or downregulation of GSK3β. GSK3β was found to interact with ST2L on serine residue 446 in response to IL-33 treatment. GSK3β binding site mutant (ST2L(S446A)) and phosphorylation site mutant (ST2L(S442A)) are resistant to IL-33-induced ST2L internalization. We also found that IL-33 activated focal adhesion kinase (FAK). Inhibition of FAK impaired IL-33-induced GSK3β activation and ST2L internalization. Furthermore, inhibition of ST2L internalization enhanced IL-33-induced cytokine release in lung epithelial cells. These results suggest that modulation of the ST2L internalization by FAK/GSK3β might serve as a unique strategy to lessen pulmonary inflammation. Copyright © 2015 by The American Association of Immunologists, Inc.

  1. Inhibition of glycogen synthase kinase-3 reduces extension of the axonal leading process by destabilizing microtubules in cerebellar granule neurons.

    Science.gov (United States)

    Inami, Yoshihiro; Omura, Mitsuru; Kubota, Kenta; Konishi, Yoshiyuki

    2018-07-01

    Recent studies have uncovered various molecules that play key roles in neuronal morphogenesis. Nevertheless, the mechanisms underlying the neuron-type-dependent regulation of morphogenesis remain unknown. We have previously reported that inhibition of glycogen synthase kinase-3 (GSK3) markedly reduced axonal length of cerebellar granule neurons (CGNs) in a neuron-type-dependent manner. In the present study, we investigated the mechanisms by which the growth of CGN axons was severely suppressed upon GSK3 inhibition. Using time-lapse imaging of cultured CGNs at early morphogenesis, we found that extension of the leading process was severely inhibited by the pharmacological inhibition of GSK3. The rate of somal migration was also reduced with a GSK3 inhibitor in dissociated culture as well as in microexplant culture. In addition, CGNs ectopically expressed with a catalytically inactive mutant of GSK3 exhibited a migration defect in vivo. In axonal leading processes of CGNs, detyrosination and acetylation of α-tubulin, which are known to correlate with microtubule stability, were decreased by GSK3 inhibition. A photoconversion analysis found that inhibition of GSK3 increases the turnover of microtubules. Furthermore, in the presence of paclitaxel, a microtubule-stabilizing reagent, inhibition of GSK3 recovered the axonal leading process extension that was reduced by paclitaxel. Our results suggest that GSK3 supports the extension of axonal processes by stabilizing microtubules, contrary to its function in other neuron-types, lending mechanical insight into neuron-type-dependent morphological regulation. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Volume I. Glycogen: A historical overview, an adjunct to thesis. Volume II. Non-glucose components of glycogen

    International Nuclear Information System (INIS)

    Kirkman, B.R.

    1988-01-01

    Investigations have been carried out on three non-glucose components of native glycogen: protein, glucosamine, and phosphate. The protein, glycogenin, appears to serve as the primer upon which new molecules of glycogen are synthesized. When cell extracts are incubated with ( 14 C)UDPG, ( 14 C)glucose becomes transferred onto pre-existing chains of alpha-1,4 linked glucose associated with free glycogenin. The transferase and glycogenin remain associated during various purification steps. Liver glycogen appears to contain less than 0.02% protein which may correspond to the presence of one molecule of glycogenin (37 kDa) per alpha particle of liver glycogen. The core beta particle within each alpha particle may be synthesized upon glycogenin, while the remaining 20-40 beta particles may arise from each other. The author has demonstrated the natural occurrence of glucosamine in liver glycogen (but not muscle glycogen) from various species in an amount of about one molecule per molecule of glycogen. The glucosamine is underivatized, appears to be randomly scattered in the glycogen, and may be derived from dietary galactosamine. Similar to Fontana (1980), the author observed that native liver glycogen could be fractionated on DEAE-cellulose apparently on the basis of phosphate content. The more strongly bound glycogen possessed a greater molecular weight and content of glucosamine and phosphate. Possible explanations for these subfractions are considered. The phosphate appears to be concentrated near the center of the glycogen molecules. About 30% appears to be associated with glucose-6P and the remainder with an unidentified phosphodiester. The phosphate may stimulate glycogen synthesis. How the phosphate becomes incorporated is unknown

  3. Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2017-08-09

    Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

  4. Fisetin Confers Cardioprotection against Myocardial Ischemia Reperfusion Injury by Suppressing Mitochondrial Oxidative Stress and Mitochondrial Dysfunction and Inhibiting Glycogen Synthase Kinase 3β Activity

    Directory of Open Access Journals (Sweden)

    Karthi Shanmugam

    2018-01-01

    Full Text Available Acute myocardial infarction (AMI is the leading cause of morbidity and mortality worldwide. Timely reperfusion is considered an optimal treatment for AMI. Paradoxically, the procedure of reperfusion can itself cause myocardial tissue injury. Therefore, a strategy to minimize the reperfusion-induced myocardial tissue injury is vital for salvaging the healthy myocardium. Herein, we investigated the cardioprotective effects of fisetin, a natural flavonoid, against ischemia/reperfusion (I/R injury (IRI using a Langendorff isolated heart perfusion system. I/R produced significant myocardial tissue injury, which was characterized by elevated levels of lactate dehydrogenase and creatine kinase in the perfusate and decreased indices of hemodynamic parameters. Furthermore, I/R resulted in elevated oxidative stress, uncoupling of the mitochondrial electron transport chain, increased mitochondrial swelling, a decrease of the mitochondrial membrane potential, and induction of apoptosis. Moreover, IRI was associated with a loss of the mitochondrial structure and decreased mitochondrial biogenesis. However, when the animals were pretreated with fisetin, it significantly attenuated the I/R-induced myocardial tissue injury, blunted the oxidative stress, and restored the structure and function of mitochondria. Mechanistically, the fisetin effects were found to be mediated via inhibition of glycogen synthase kinase 3β (GSK3β, which was confirmed by a biochemical assay and molecular docking studies.

  5. Fisetin Confers Cardioprotection against Myocardial Ischemia Reperfusion Injury by Suppressing Mitochondrial Oxidative Stress and Mitochondrial Dysfunction and Inhibiting Glycogen Synthase Kinase 3β Activity.

    Science.gov (United States)

    Shanmugam, Karthi; Ravindran, Sriram; Kurian, Gino A; Rajesh, Mohanraj

    2018-01-01

    Acute myocardial infarction (AMI) is the leading cause of morbidity and mortality worldwide. Timely reperfusion is considered an optimal treatment for AMI. Paradoxically, the procedure of reperfusion can itself cause myocardial tissue injury. Therefore, a strategy to minimize the reperfusion-induced myocardial tissue injury is vital for salvaging the healthy myocardium. Herein, we investigated the cardioprotective effects of fisetin, a natural flavonoid, against ischemia/reperfusion (I/R) injury (IRI) using a Langendorff isolated heart perfusion system. I/R produced significant myocardial tissue injury, which was characterized by elevated levels of lactate dehydrogenase and creatine kinase in the perfusate and decreased indices of hemodynamic parameters. Furthermore, I/R resulted in elevated oxidative stress, uncoupling of the mitochondrial electron transport chain, increased mitochondrial swelling, a decrease of the mitochondrial membrane potential, and induction of apoptosis. Moreover, IRI was associated with a loss of the mitochondrial structure and decreased mitochondrial biogenesis. However, when the animals were pretreated with fisetin, it significantly attenuated the I/R-induced myocardial tissue injury, blunted the oxidative stress, and restored the structure and function of mitochondria. Mechanistically, the fisetin effects were found to be mediated via inhibition of glycogen synthase kinase 3 β (GSK3 β ), which was confirmed by a biochemical assay and molecular docking studies.

  6. Functional analysis of the glycogen binding subunit CG9238/Gbs-70E of protein phosphatase 1 in Drosophila melanogaster.

    Science.gov (United States)

    Kerekes, Éva; Kókai, Endre; Páldy, Ferenc Sándor; Dombrádi, Viktor

    2014-06-01

    The product of the CG9238 gene that we termed glycogen binding subunit 70E (Gbs-70E) was characterized by biochemical and molecular genetics methods. The interaction between Gbs-70E and all catalytic subunits of protein phosphatase 1 (Pp1-87B, Pp1-9C, Pp1-96A and Pp1-13C) of Drosophila melanogaster was confirmed by pairwise yeast two-hybrid tests, co-immunoprecipitation and pull down experiments. The binding of Gbs-70E to glycogen was demonstrated by sedimentation analysis. With RT-PCR we found that the mRNAs coding for the longer Gbs-70E PB/PC protein were expressed in all developmental stages of the fruit flies while the mRNA for the shorter Gbs-70E PA was restricted to the eggs and the ovaries of the adult females. The development specific expression of the shorter splice variant was not conserved in different Drosophila species. The expression level of the gene was manipulated by P-element insertions and gene deletion to analyze the functions of the gene product. A small or moderate reduction in the gene expression resulted in no significant changes, however, a deletion mutant expressing very low level of the transcript lived shorter and exhibited reduced glycogen content in the imagos. In addition, the gene deletion decreased the fertility of the fruit flies. Our results prove that Gbs-70E functions as the glycogen binding subunit of protein phosphatase 1 that regulates glycogen content and plays a role in the development of eggs in D. melanogaster. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Is Glycogenin Essential for Glycogen Synthesis?

    Science.gov (United States)

    Oldfors, Anders

    2017-07-05

    Glycogen synthesis requires a priming oligosaccharide, formed by autoglucosylation of glycogenin, a core protein in glycogen particles. In this edition of Cell Metabolism, Testoni et al. (2017) challenge this generally accepted concept by demonstrating that glycogenin inactivation in mice results in an increased amount of glycogen and not glycogen depletion. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  9. Insights into Brain Glycogen Metabolism

    Science.gov (United States)

    Mathieu, Cécile; de la Sierra-Gallay, Ines Li; Duval, Romain; Xu, Ximing; Cocaign, Angélique; Léger, Thibaut; Woffendin, Gary; Camadro, Jean-Michel; Etchebest, Catherine; Haouz, Ahmed; Dupret, Jean-Marie; Rodrigues-Lima, Fernando

    2016-01-01

    Brain glycogen metabolism plays a critical role in major brain functions such as learning or memory consolidation. However, alteration of glycogen metabolism and glycogen accumulation in the brain contributes to neurodegeneration as observed in Lafora disease. Glycogen phosphorylase (GP), a key enzyme in glycogen metabolism, catalyzes the rate-limiting step of glycogen mobilization. Moreover, the allosteric regulation of the three GP isozymes (muscle, liver, and brain) by metabolites and phosphorylation, in response to hormonal signaling, fine-tunes glycogenolysis to fulfill energetic and metabolic requirements. Whereas the structures of muscle and liver GPs have been known for decades, the structure of brain GP (bGP) has remained elusive despite its critical role in brain glycogen metabolism. Here, we report the crystal structure of human bGP in complex with PEG 400 (2.5 Å) and in complex with its allosteric activator AMP (3.4 Å). These structures demonstrate that bGP has a closer structural relationship with muscle GP, which is also activated by AMP, contrary to liver GP, which is not. Importantly, despite the structural similarities between human bGP and the two other mammalian isozymes, the bGP structures reveal molecular features unique to the brain isozyme that provide a deeper understanding of the differences in the activation properties of these allosteric enzymes by the allosteric effector AMP. Overall, our study further supports that the distinct structural and regulatory properties of GP isozymes contribute to the different functions of muscle, liver, and brain glycogen. PMID:27402852

  10. Brain glycogen

    DEFF Research Database (Denmark)

    Obel, Linea Lykke Frimodt; Müller, Margit S; Walls, Anne B

    2012-01-01

    Glycogen is a complex glucose polymer found in a variety of tissues, including brain, where it is localized primarily in astrocytes. The small quantity found in brain compared to e.g., liver has led to the understanding that brain glycogen is merely used during hypoglycemia or ischemia....... In this review evidence is brought forward highlighting what has been an emerging understanding in brain energy metabolism: that glycogen is more than just a convenient way to store energy for use in emergencies-it is a highly dynamic molecule with versatile implications in brain function, i.e., synaptic...... activity and memory formation. In line with the great spatiotemporal complexity of the brain and thereof derived focus on the basis for ensuring the availability of the right amount of energy at the right time and place, we here encourage a closer look into the molecular and subcellular mechanisms...

  11. Glycogen synthase kinase-3beta (GSK3beta) negatively regulates PTTG1/human securin protein stability, and GSK3beta inactivation correlates with securin accumulation in breast tumors.

    Science.gov (United States)

    Mora-Santos, Mar; Limón-Mortés, M Cristina; Giráldez, Servando; Herrero-Ruiz, Joaquín; Sáez, Carmen; Japón, Miguel Á; Tortolero, Maria; Romero, Francisco

    2011-08-26

    PTTG1, also known as securin, is an inactivating partner of separase, the major effector for chromosome segregation during mitosis. At the metaphase-to-anaphase transition, securin is targeted for proteasomal destruction by the anaphase-promoting complex or cyclosome, allowing activation of separase. In addition, securin is overexpressed in metastatic or genomically instable tumors, suggesting a relevant role for securin in tumor progression. Stability of securin is regulated by phosphorylation; some phosphorylated forms are degraded out of mitosis, by the action of the SKP1-CUL1-F-box protein (SCF) complex. The kinases targeting securin for proteolysis have not been identified, and mechanistic insight into the cause of securin accumulation in human cancers is lacking. Here, we demonstrate that glycogen synthase kinase-3β (GSK3β) phosphorylates securin to promote its proteolysis via SCF(βTrCP) E3 ubiquitin ligase. Importantly, a strong correlation between securin accumulation and GSK3β inactivation was observed in breast cancer tissues, indicating that GSK3β inactivation may account for securin accumulation in breast cancers.

  12. Characterization of a canine model of glycogen storage disease type IIIa

    Directory of Open Access Journals (Sweden)

    Haiqing Yi

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR. The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT, aspartate transaminase (AST and alkaline phosphatase (ALP activities; serum creatine phosphokinase (CPK activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions.

  13. Muscle glycogen stores and fatigue

    DEFF Research Database (Denmark)

    Ørtenblad, Niels; Westerblad, Håkan; Nielsen, Joachim

    2013-01-01

      Studies performed at the beginning of the last century revealed the importance of carbohydrate as a fuel during exercise, and the importance of muscle glycogen on performance has subsequently been confirmed in numerous studies. However, the link between glycogen depletion and impaired muscle...... function during fatigue is not well understood and a direct cause-and-effect relationship between glycogen and muscle function remains to be established. The use of electron microscopy has revealed that glycogen is not homogeneously distributed in skeletal muscle fibres, but rather localized in distinct...... pools. Furthermore, each glycogen granule has its own metabolic machinery with glycolytic enzymes and regulating proteins. One pool of such glycogenolytic complexes is localized within the myofibrils in close contact with key proteins involved in the excitation-contraction coupling and Ca2+ release from...

  14. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  15. Astrocyte glycogen and brain energy metabolism.

    Science.gov (United States)

    Brown, Angus M; Ransom, Bruce R

    2007-09-01

    The brain contains glycogen but at low concentration compared with liver and muscle. In the adult brain, glycogen is found predominantly in astrocytes. Astrocyte glycogen content is modulated by a number of factors including some neurotransmitters and ambient glucose concentration. Compelling evidence indicates that astrocyte glycogen breaks down during hypoglycemia to lactate that is transferred to adjacent neurons or axons where it is used aerobically as fuel. In the case of CNS white matter, this source of energy can extend axon function for 20 min or longer. Likewise, during periods of intense neural activity when energy demand exceeds glucose supply, astrocyte glycogen is degraded to lactate, a portion of which is transferred to axons for fuel. Astrocyte glycogen, therefore, offers some protection against hypoglycemic neural injury and ensures that neurons and axons can maintain their function during very intense periods of activation. These emerging principles about the roles of astrocyte glycogen contradict the long held belief that this metabolic pool has little or no functional significance.

  16. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  17. Glycogen synthase kinase 3 has a limited role in cell cycle regulation of cyclin D1 levels.

    Science.gov (United States)

    Yang, Ke; Guo, Yang; Stacey, William C; Harwalkar, Jyoti; Fretthold, Jonathan; Hitomi, Masahiro; Stacey, Dennis W

    2006-08-30

    The expression level of cyclin D1 plays a vital role in the control of proliferation. This protein is reported to be degraded following phosphorylation by glycogen synthase kinase 3 (GSK3) on Thr-286. We recently showed that phosphorylation of Thr-286 is responsible for a decline in cyclin D1 levels during S phase, an event required for efficient DNA synthesis. These studies were undertaken to test the possibility that phosphorylation by GSK3 is responsible for the S phase specific decline in cyclin D1 levels, and that this event is regulated by the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway which controls GSK3. We found, however, that neither PI3K, AKT, GSK3, nor proliferative signaling activity in general is responsible for the S phase decline in cyclin D1 levels. In fact, the activity of these signaling kinases does not vary through the cell cycle of proliferating cells. Moreover, we found that GSK3 activity has little influence over cyclin D1 expression levels during any cell cycle phase. Inhibition of GSK3 activity by siRNA, LiCl, or other chemical inhibitors failed to influence cyclin D1 phosphorylation on Thr-286, even though LiCl efficiently blocked phosphorylation of beta-catenin, a known substrate of GSK3. Likewise, the expression of a constitutively active GSK3 mutant protein failed to influence cyclin D1 phosphorylation or total protein expression level. Because we were unable to identify any proliferative signaling molecule or pathway which is regulated through the cell cycle, or which is able to influence cyclin D1 levels, we conclude that the suppression of cyclin D1 levels during S phase is regulated by cell cycle position rather than signaling activity. We propose that this mechanism guarantees the decline in cyclin D1 levels during each S phase; and that in so doing it reduces the likelihood that simple over expression of cyclin D1 can lead to uncontrolled cell growth.

  18. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  19. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  20. Revisiting Glycogen Content in the Human Brain.

    Science.gov (United States)

    Öz, Gülin; DiNuzzo, Mauro; Kumar, Anjali; Moheet, Amir; Seaquist, Elizabeth R

    2015-12-01

    Glycogen provides an important glucose reservoir in the brain since the concentration of glucosyl units stored in glycogen is several fold higher than free glucose available in brain tissue. We have previously reported 3-4 µmol/g brain glycogen content using in vivo (13)C magnetic resonance spectroscopy (MRS) in conjunction with [1-(13)C]glucose administration in healthy humans, while higher levels were reported in the rodent brain. Due to the slow turnover of bulk brain glycogen in humans, complete turnover of the glycogen pool, estimated to take 3-5 days, was not observed in these prior studies. In an attempt to reach complete turnover and thereby steady state (13)C labeling in glycogen, here we administered [1-(13)C]glucose to healthy volunteers for 80 h. To eliminate any net glycogen synthesis during this period and thereby achieve an accurate estimate of glycogen concentration, volunteers were maintained at euglycemic blood glucose levels during [1-(13)C]glucose administration and (13)C-glycogen levels in the occipital lobe were measured by (13)C MRS approximately every 12 h. Finally, we fitted the data with a biophysical model that was recently developed to take into account the tiered structure of the glycogen molecule and additionally incorporated blood glucose levels and isotopic enrichments as input function in the model. We obtained excellent fits of the model to the (13)C-glycogen data, and glycogen content in the healthy human brain tissue was found to be 7.8 ± 0.3 µmol/g, a value substantially higher than previous estimates of glycogen content in the human brain.

  1. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    Science.gov (United States)

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. No effect of glycogen level on glycogen metabolism during high intensity exercise

    DEFF Research Database (Denmark)

    Vandenberghe, Katleen; Hespel, P.; Eynde, Bart Vanden

    1995-01-01

    , either for 1 min 45 s (protocol 1; N = 18) or to exhaustion (protocol 2; N = 14). The exercise tests were preceded by either 5 d on a controlled normal (N) diet, or by 2 d of glycogen-depleting exercise accompanied by the normal diet followed by 3 d on a carbohydrate-rich (CHR) diet. In protocol 1......This study examined the effect of glycogen supercompensation on glycogen breakdown, muscle and blood lactate accumulation, blood-pH, and performance during short-term high-intensity exercise. Young healthy volunteers performed two supramaximal (125% of VO2max) exercise tests on a bicycle ergometer...

  3. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  4. Characterization of the highly branched glycogen from the thermoacidophilic red microalga Galdieria sulphuraria and comparison with other glycogens.

    Science.gov (United States)

    Martinez-Garcia, Marta; Stuart, Marc C A; van der Maarel, Marc J E C

    2016-08-01

    The thermoacidophilic red microalga Galdieria sulphuraria synthesizes glycogen when growing under heterotrophic conditions. Structural characterization revealed that G. sulphuraria glycogen is the most highly branched glycogen described to date, with 18% of α-(1→6) linkages. Moreover, it differs from other glycogens because it is composed of short chains only and has a substantially smaller molecular weight and particle size. The physiological role of this highly branched glycogen in G. sulphuraria is discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    OpenAIRE

    Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  6. Recent development and gene therapy for glycogen storage disease type Ia.

    Science.gov (United States)

    Chou, Janice Y; Kim, Goo-Young; Cho, Jun-Ho

    2017-09-01

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive metabolic disorder caused by a deficiency in glucose-6-phosphatase-α (G6Pase-α or G6PC) that is expressed primarily in the liver, kidney, and intestine. G6Pase-α catalyzes the hydrolysis of glucose-6-phosphate (G6P) to glucose and phosphate in the terminal step of gluconeogenesis and glycogenolysis, and is a key enzyme for endogenous glucose production. The active site of G6Pase-α is inside the endoplasmic reticulum (ER) lumen. For catalysis, the substrate G6P must be translocated from the cytoplasm into the ER lumen by a G6P transporter (G6PT). The functional coupling of G6Pase-α and G6PT maintains interprandial glucose homeostasis. Dietary therapies for GSD-Ia are available, but cannot prevent the long-term complication of hepatocellular adenoma that may undergo malignant transformation to hepatocellular carcinoma. Animal models of GSD-Ia are now available and are being exploited to both delineate the disease more precisely and develop new treatment approaches, including gene therapy.

  7. Defective insulin signaling pathway and increased glycogen synthase kinase-3 activity in the brain of diabetic mice: parallels with Alzheimer's disease and correction by insulin.

    Science.gov (United States)

    Jolivalt, C G; Lee, C A; Beiswenger, K K; Smith, J L; Orlov, M; Torrance, M A; Masliah, E

    2008-11-15

    We have evaluated the effect of peripheral insulin deficiency on brain insulin pathway activity in a mouse model of type 1 diabetes, the parallels with Alzheimer's disease (AD), and the effect of treatment with insulin. Nine weeks of insulin-deficient diabetes significantly impaired the learning capacity of mice, significantly reduced insulin-degrading enzyme protein expression, and significantly reduced phosphorylation of the insulin-receptor and AKT. Phosphorylation of glycogen synthase kinase-3 (GSK3) was also significantly decreased, indicating increased GSK3 activity. This evidence of reduced insulin signaling was associated with a concomitant increase in tau phosphorylation and amyloid beta protein levels. Changes in phosphorylation levels of insulin receptor, GSK3, and tau were not observed in the brain of db/db mice, a model of type 2 diabetes, after a similar duration (8 weeks) of diabetes. Treatment with insulin from onset of diabetes partially restored the phosphorylation of insulin receptor and of GSK3, partially reduced the level of phosphorylated tau in the brain, and partially improved learning ability in insulin-deficient diabetic mice. Our data indicate that mice with systemic insulin deficiency display evidence of reduced insulin signaling pathway activity in the brain that is associated with biochemical and behavioral features of AD and that it can be corrected by insulin treatment.

  8. Malin decreases glycogen accumulation by promoting the degradation of protein targeting to glycogen (PTG)

    OpenAIRE

    Worby, Carolyn A.; Gentry, Matthew S.; Dixon, Jack E.

    2007-01-01

    Lafora disease (LD) is an autosomal recessive neurodegenerative disease that results in progressive myoclonus epilepsy and death. LD is caused by mutations in either the E3 ubiquitin ligase malin or the dual-specificity phosphatase laforin. A hallmark of LD is the accumulation of insoluble glycogen in the cytoplasm of cells from most tissues. Glycogen metabolism is regulated by phosphorylation of key metabolic enzymes. One regulator of this phosphorylation is protein targeting to glycogen (PT...

  9. Up-Regulation of Excitatory Amino Acid Transporters EAAT3 and EAAT4 by Lithium Sensitive Glycogen Synthase Kinase GSK3ß

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab

    2016-12-01

    Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.

  10. Glycogen Synthase Kinase-3 Modulates Hyperosmotic-Induced Urea Transporter A1 Relocation in the Inner Medullary Collecting Duct Cells.

    Science.gov (United States)

    Li, Yong-Xia; Huang, Yun; Liu, Song; Mao, Yan; Yuan, Cheng-Yan; Yang, Xiao; Yao, Li-Jun

    2016-01-01

    Glycogen synthase kinase 3 (GSK3) regulates urine concentration by mediating the vasopressin-induced aquaporin 2 expression and water permeability, although it is unknown whether GSK3 also mediates the accumulation of the urea transporter A1 (UT-A1). The aim of this study is to investigate the effect of GSK3 on UT-A1 distribution. Mouse inner medullary collecting duct 3 cells were transfected with UT-A1-GFP construct. The stable transfected cells were cultured under hypertonic conditions, treated with GSK3 inhibitor lithium chloride, GSK3 activator, lysosome or proteasome inhibitor. The expression levels of UT-A1, GSK3, and phospho-GSK3 were analyzed using western blot. The interaction between UT-A1 and the Golgi apparatus was examined using confocal immunofluorescence microscope. The UT-A1 trafficking was examined using the biotinylation of surface membranes. UT-A1 dissociated away from the Golgi apparatus and translocated to the plasma membrane under hypertonic-NaCl and NaCl plus urea stimulation. This movement was accompanied by the increased phosphorylation of GSK3 and its localization on the cellular membrane. Moreover, these results were duplicated by treating the cells with the GSK3 inhibitor, and by contrast, were partially reversed by the GSK3 activator. Treating cells with a lysosome or proteasome inhibitor failed to attenuate the effects of hypertonic stimulus, indicating that the loss of UT-A1 from the Golgi was not due to degradation. Our results suggest that GSK3 may in part modulate the hypertonic-induced intracellular UT-A1 redistribution and its accumulation on the plasma membrane, which may constitute another mechanism by which GSK3 modulates urine concentration. © 2016 S. Karger AG, Basel.

  11. Two structurally distinct inhibitors of glycogen synthase kinase 3 induced centromere positive micronuclei in human lymphoblastoid TK6 cells.

    Science.gov (United States)

    Mishima, Masayuki; Tanaka, Kenji; Takeiri, Akira; Harada, Asako; Kubo, Chiyomi; Sone, Sachiko; Nishimura, Yoshikazu; Tachibana, Yukako; Okazaki, Makoto

    2008-08-25

    Glycogen synthase kinase 3 (GSK3) is an attractive novel pharmacological target. Inhibition of GSK3 is recently regarded as one of the viable approaches to therapy for Alzheimer's disease, cancer, diabetes mellitus, osteoporosis, and bipolar mood disorder. Here, we have investigated the aneugenic potential of two potent and highly specific inhibitors of GSK3 by using an in vitro micronucleus test with human lymphoblastoid TK6 cells. One inhibitor was a newly synthesized maleimide derivative and the other was a previously known aminopyrimidine derivative. Both compounds elicited statistically significant and concentration-dependent increases in micronucleated cells. One hundred micronuclei (MN) of each were analyzed using centromeric DNA staining with fluorescence in situ hybridization. Both the two structurally distinct compounds induced centromere-positive micronuclei (CMN). Calculated from the frequency of MN cells and the percentage of CMN, CMN cell incidence after treatment with the maleimide compound at 1.2 microM, 2.4 microM, and 4.8 microM was 11.6, 27.7, and 56.3 per 1000 cells, respectively; the negative control was 4.5. CMN cell incidence after the treatment with the aminopyrimidine compound at 1.8 microM, 3.6 microM, and 5.4 microM was 6.7, 9.8 and 17.2 per 1000 cells, respectively. Both compounds exhibited concentration-dependent increase in the number of mitotic cells. The frequency of CMN cells correlated well with mitotic cell incidence after treatment with either compound. Furthermore, both inhibitors induced abnormal mitotic cells with asymmetric mitotic spindles and lagging anaphase chromosomes. These results lend further support to the hypothesis that the inhibition of GSK3 activity affects microtubule function and exhibits an aneugenic mode of action.

  12. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  13. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  14. Postexercise muscle glycogen resynthesis in humans.

    Science.gov (United States)

    Burke, Louise M; van Loon, Luc J C; Hawley, John A

    2017-05-01

    Since the pioneering studies conducted in the 1960s in which glycogen status was investigated using the muscle biopsy technique, sports scientists have developed a sophisticated appreciation of the role of glycogen in cellular adaptation and exercise performance, as well as sites of storage of this important metabolic fuel. While sports nutrition guidelines have evolved during the past decade to incorporate sport-specific and periodized manipulation of carbohydrate (CHO) availability, athletes attempt to maximize muscle glycogen synthesis between important workouts or competitive events so that fuel stores closely match the demands of the prescribed exercise. Therefore, it is important to understand the factors that enhance or impair this biphasic process. In the early postexercise period (0-4 h), glycogen depletion provides a strong drive for its own resynthesis, with the provision of CHO (~1 g/kg body mass) optimizing this process. During the later phase of recovery (4-24 h), CHO intake should meet the anticipated fuel needs of the training/competition, with the type, form, and pattern of intake being less important than total intake. Dietary strategies that can enhance glycogen synthesis from suboptimal amounts of CHO or energy intake are of practical interest to many athletes; in this scenario, the coingestion of protein with CHO can assist glycogen storage. Future research should identify other factors that enhance the rate of synthesis of glycogen storage in a limited time frame, improve glycogen storage from a limited CHO intake, or increase muscle glycogen supercompensation. Copyright © 2017 the American Physiological Society.

  15. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  16. Effects of starvation on the carbohydrate metabolism in Harmonia axyridis (Pallas

    Directory of Open Access Journals (Sweden)

    Zuo-Kun Shi

    2017-07-01

    Full Text Available Trehalose plays an important role in energy storage, metabolism, and protection from extreme environmental conditions in insects. Trehalose is the main blood sugar in insects, and it can be rapidly used as an energy source in times of need. To elucidate the mechanisms of the starvation response, we observed the effects of starvation on trehalose and glycogen, trehalase activity, and the relative gene expression of genes in the trehalose and glycogen metabolic pathways in the invasive beetle Harmonia axyridis. Our results show that trehalose levels and the activities of two types of trehalases decreased significantly in the first 8 h of starvation, while the relative expression of HaTreh1-1 increased. While trehalose remained nearly constant at a relatively high level from 8 to 24 h, glycogen levels decreased significantly from 8 h to 24 h of starvation. Likewise, glycogen phosphorylase (HaGP expression was significantly higher at 12 to 24 h starvation than the first 8 h, while the expression of glycogen synthase (HaGS was relatively stable. Furthermore, trehalose decreased significantly from 24 h starvation to 72 h starvation, while trehalase activities and the relative expression of some HaTreh genes generally increased toward the end of the starvation period. The expression of trehalose-6-phosphate synthase (HaTPS increased significantly, supporting the increase in trehalose synthesis. These results show that trehalose plays a key role in the energy provided during the starvation process through the molecular and biochemical regulation of trehalose and glycogen metabolism.

  17. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

    Science.gov (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

    2018-04-01

    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  18. Protective Effects of Kaempferol against Myocardial Ischemia/Reperfusion Injury in Isolated Rat Heart via Antioxidant Activity and Inhibition of Glycogen Synthase Kinase-3β

    Science.gov (United States)

    Zhou, Mingjie; Ren, Huanhuan; Wang, Wenjuan; Zheng, Qiusheng; Wang, Dong

    2015-01-01

    Objective. This study aimed to evaluate the protective effect of kaempferol against myocardial ischemia/reperfusion (I/R) injury in rats. Method. Left ventricular developed pressure (LVDP) and its maximum up/down rate (±dp/dt max) were recorded as myocardial function. Infarct size was detected with 2,3,5-triphenyltetrazolium chloride staining. Cardiomyocyte apoptosis was determined using terminal deoxynucleotidyl nick-end labeling (TUNEL). The levels of creatine kinase (CK), lactate dehydrogenase (LDH), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione/glutathione disulfide (GSH/GSSG) ratio, and tumor necrosis factor-alpha (TNF-α) were determined using enzyme linked immunosorbent assay (ELISA). Moreover, total glycogen synthase kinase-3β (GSK-3β), phospho-GSK-3β (P-GSK-3β), precaspase-3, cleaved caspase-3, and cytoplasm cytochrome C were assayed using Western blot analysis. Results. Pretreatment with kaempferol significantly improved the recovery of LVDP and ±dp/dt max, as well as increased the levels of SOD and P-GSK-3β and GSH/GSSG ratio. However, the pretreatment reduced myocardial infarct size and TUNEL-positive cell rate, as well as decreased the levels of cleaved caspase-3, cytoplasm cytochrome C, CK, LDH, MDA, and TNF-α. Conclusion. These results suggested that kaempferol provides cardioprotection via antioxidant activity and inhibition of GSK-3β activity in rats with I/R. PMID:26265983

  19. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  20. Increased Laforin and Laforin Binding to Glycogen Underlie Lafora Body Formation in Malin-deficient Lafora Disease*

    Science.gov (United States)

    Tiberia, Erica; Turnbull, Julie; Wang, Tony; Ruggieri, Alessandra; Zhao, Xiao-Chu; Pencea, Nela; Israelian, Johan; Wang, Yin; Ackerley, Cameron A.; Wang, Peixiang; Liu, Yan; Minassian, Berge A.

    2012-01-01

    The solubility of glycogen, essential to its metabolism, is a property of its shape, a sphere generated through extensive branching during synthesis. Lafora disease (LD) is a severe teenage-onset neurodegenerative epilepsy and results from multiorgan accumulations, termed Lafora bodies (LB), of abnormally structured aggregation-prone and digestion-resistant glycogen. LD is caused by loss-of-function mutations in the EPM2A or EPM2B gene, encoding the interacting laforin phosphatase and malin E3 ubiquitin ligase enzymes, respectively. The substrate and function of malin are unknown; an early counterintuitive observation in cell culture experiments that it targets laforin to proteasomal degradation was not pursued until now. The substrate and function of laforin have recently been elucidated. Laforin dephosphorylates glycogen during synthesis, without which phosphate ions interfere with and distort glycogen construction, leading to LB. We hypothesized that laforin in excess or not removed following its action on glycogen also interferes with glycogen formation. We show in malin-deficient mice that the absence of malin results in massively increased laforin preceding the appearance of LB and that laforin gradually accumulates in glycogen, which corresponds to progressive LB generation. We show that increasing the amounts of laforin in cell culture causes LB formation and that this occurs only with glycogen binding-competent laforin. In summary, malin deficiency causes increased laforin, increased laforin binding to glycogen, and LB formation. Furthermore, increased levels of laforin, when it can bind glycogen, causes LB. We conclude that malin functions to regulate laforin and that malin deficiency at least in part causes LB and LD through increased laforin binding to glycogen. PMID:22669944

  1. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  3. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  4. The genes and enzymes of sucrose metabolism in moderately thermophilic methanotroph Methylocaldum szegediense O12.

    Science.gov (United States)

    But, Sergey Y; Solntseva, Natalia P; Egorova, Svetlana V; Mustakhimov, Ildar I; Khmelenina, Valentina N; Reshetnikov, Alexander; Trotsenko, Yuri A

    2018-05-01

    Four enzymes involved in sucrose metabolism: sucrose phosphate synthase (Sps), sucrose phosphate phosphatase (Spp), sucrose synthase (Sus) and fructokinase (FruK), were obtained as his-tagged proteins from the moderately thermophilic methanotroph Methylocaldum szegediense O12. Sps, Spp, FruK and Sus demonstrated biochemical properties similar to those of other bacterial counterparts, but the translated amino acid sequences of Sps and Spp displayed high divergence from the respective microbial enzymes. The Sus of M. szegediense O12 catalyzed the reversible reaction of sucrose cleavage in the presence of ADP or UDP and preferred ADP as a substrate, thus implying a connection between sucrose and glycogen metabolism. Sus-like genes were found only in a few methanotrophs, whereas amylosucrase was generally used in sucrose cleavage in this group of bacteria. Like other microbial fructokinases, FruK of M. szegediense O12 showed a high specificity to fructose.

  5. The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Science.gov (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  7. Hepatic glycogen synthesis in the fetal mouse: An ultrastructural, morphometric, and autoradiographic investigation of the relationship between the smooth endoplasmic reticulum and glycogen

    International Nuclear Information System (INIS)

    Breslin, J.S.

    1989-01-01

    Fetal rodent hepatocytes undergo a rapid and significant accumulation of glycogen prior to birth. The distinct association of the smooth endoplasmic reticulum (SER) with glycogen during glycogen synthesis documented in the adult hepatocyte has not been clearly demonstrated in the fetus. The experiments described in this dissertation tested the hypothesis that SER is present and functions in the synthesis of fetal hepatic glycogen. Biochemical analysis, light microscopic (LM) histochemistry and electron microscope (EM) morphometry demonstrated that fetal hepatic glycogen synthesis began on day 15, with maximum accumulation occurring between days 17-19. Glycogen accumulation began in a small population of cells. Both the number of cells containing glycogen and the quantity of glycogen per cell increased as glycogen accumulated. Smooth endoplasmic reticulum (SER) was observed on day 14 of gestation and throughout fetal hepatic glycogen synthesis, primarily as dilated ribosome-free terminal extensions of rough endoplasmic reticulum (RER), frequently associated with glycogen. SER was in close proximity to isolated particles of glycogen and at the periphery of large compact glycogen deposits. Morphometry demonstrated that the membrane surface of SER in the average fetal hepatocyte increased as glycogen accumulated through day 18 and dropped significantly as glycogen levels peaked on day 19. Parallel alterations in RER membrane surface, indicated overall increases in ER membrane surface. Autoradiography following administration of 3 H-galactose demonstrated that newly synthesized glycogen was deposited near profiles of SER at day 16 and at day 18; however, at day 18 the majority of label was uniformly distributed over glycogen remote from profiles of SER

  8. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  9. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  10. Glycogen synthase kinase 3 beta alters anxiety-, depression-, and addiction-related behaviors and neuronal activity in the nucleus accumbens shell

    Science.gov (United States)

    Crofton, Elizabeth J.; Nenov, Miroslav N.; Zhang, Yafang; Scala, Federico; Page, Sean A.; McCue, David L.; Li, Dingge; Hommel, Jonathan D.; Laezza, Fernanda; Green, Thomas A.

    2017-01-01

    Psychiatric disorders such as anxiety, depression and addiction are often comorbid brain pathologies thought to share common mechanistic biology. As part of the cortico-limbic circuit, the nucleus accumbens shell (NAcSh) plays a fundamental role in integrating information in the circuit, such that modulation of NAcSh circuitry alters anxiety, depression, and addiction-related behaviors. Intracellular kinase cascades in the NAcSh have proven important mediators of behavior. To investigate glycogen-synthase kinase 3 (GSK3) beta signaling in the NAcSh in vivo we knocked down GSK3beta expression with a novel adeno-associated viral vector (AAV2) and assessed changes in anxiety- and depression-like behavior and cocaine self-administration in GSK3beta knockdown rats. GSK3beta knockdown reduced anxiety-like behavior while increasing depression-like behavior and cocaine self-administration. Correlative electrophysiological recordings in acute brain slices were used to assess the effect of AAV-shGSK3beta on spontaneous firing and intrinsic excitability of tonically active interneurons (TANs), cells required for input and output signal integration in the NAcSh and for processing reward-related behaviors. Loose-patch recordings showed that TANs transduced by AAV-shGSK3beta exhibited reduction in tonic firing and increased spike half width. When assessed by whole-cell patch clamp recordings these changes were mirrored by reduction in action potential firing and accompanied by decreased hyperpolarization-induced depolarizing sag potentials, increased action potential current threshold, and decreased maximum rise time. These results suggest that silencing of GSK3beta in the NAcSh increases depression- and addiction-related behavior, possibly by decreasing intrinsic excitability of TANs. However, this study does not rule out contributions from other neuronal sub-types. PMID:28126496

  11. Glycogen synthase kinase-3β inhibition in the medial prefrontal cortex mediates paradoxical amphetamine action in a mouse model of ADHD

    Directory of Open Access Journals (Sweden)

    Yi-Chun eYen

    2015-03-01

    Full Text Available Psychostimulants show therapeutic efficacy in the treatment of attention-deficit hyperactivity disorder (ADHD. It is generally assumed that they ameliorate ADHD symptoms via interfering with monoaminergic signaling. We combined behavioral pharmacology, neurochemistry and molecular analyses to identify mechanisms underlying the paradoxical calming effect of amphetamine in low trait anxiety behavior (LAB mice, a novel multigenetic animal model of ADHD. Amphetamine (1 mg/kg and methylphenidate (10 mg/kg elicited similar dopamine and norepinephrine release in the medial prefrontal cortex (mPFC and in the striatum of LAB mice. In contrast, amphetamine decreased, while methylphenidate increased locomotor activity. This argues against changes in dopamine and/or norepinephrine release as mediators of amphetamine paradoxical effects. Instead, the calming activity of amphetamine corresponded to the inhibition of glycogen synthase kinase3β (GSK3β activity, specifically in the mPFC. Accordingly, not only systemic administration of the GSK3β inhibitor TDZD-8 (20 mg/kg, but also local microinjections of TDZD-8 and amphetamine into the mPFC, but not into the striatum, decreased locomotor activity in LAB mice. Amphetamine effects seem to depend on NMDA receptor signaling, since pre- or co-treatment with MK-801 (0.3 mg/kg abolished the effects of amphetamine (1 mg/kg on the locomotion and on the phosphorylation of GSK3β at the level of the mPFC. Taken together, the paradoxical calming effect of amphetamine in hyperactive LAB mice concurs with a decreased GSK3β activity in the mPFC. This effect appears to be independent of dopamine or norepinephrine release, but contingent on NMDA receptor signaling.

  12. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    Science.gov (United States)

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Schwann Cell Glycogen Selectively Supports Myelinated Axon Function

    Science.gov (United States)

    Brown, Angus M; Evans, Richard D; Black, Joel; Ransom, Bruce R

    2012-01-01

    Objectives Interruption of energy supply to peripheral axons is a cause of axon loss. We determined if glycogen was present in mammalian peripheral nerve, and if it supported axon conduction during aglycemia. Methods We used biochemical assay and electron microscopy to determine the presence of glycogen, and electrophysiology to monitor axon function. Results Glycogen was present in sciatic nerve, its concentration varying directly with ambient [glucose]. Electron microscopy detected glycogen granules primarily in myelinating Schwann cell cytoplasm and these diminished after exposure to aglycemia. During aglycemia, conduction failure in large myelinated axons (A fibers) mirrored the time-course of glycogen loss. Latency to CAP failure was directly related to nerve glycogen content at aglycemia onset. Glycogen did not benefit the function of slow-conducting, small diameter unmyelinated axons (C fibers) during aglycemia. Blocking glycogen breakdown pharmacologically accelerated CAP failure during aglycemia in A fibers, but not in C fibers. Lactate was as effective as glucose in supporting sciatic nerve function, and was continuously released into the extracellular space in the presence of glucose and fell rapidly during aglycemia. Interpretation Our findings indicated that glycogen is present in peripheral nerve, primarily in myelinating Schwann cells, and exclusively supports large diameter, myelinated axon conduction during aglycemia. Available evidence suggests that peripheral nerve glycogen breaks down during aglycemia and is passed, probably as lactate, to myelinated axons to support function. Unmyelinated axons are not protected by glycogen and are more vulnerable to dysfunction during periods of hypoglycemia. PMID:23034913

  14. Quantitative Phosphoproteomic Study Reveals that Protein Kinase A Regulates Neural Stem Cell Differentiation Through Phosphorylation of Catenin Beta-1 and Glycogen Synthase Kinase 3β.

    Science.gov (United States)

    Wang, Shuxin; Li, Zheyi; Shen, Hongyan; Zhang, Zhong; Yin, Yuxin; Wang, Qingsong; Zhao, Xuyang; Ji, Jianguo

    2016-08-01

    Protein phosphorylation is central to the understanding of multiple cellular signaling pathways responsible for regulating the self-renewal and differentiation of neural stem cells (NSCs). Here we performed a large-scale phosphoproteomic analysis of rat fetal NSCs using strong cation exchange chromatography prefractionation and citric acid-assisted two-step enrichment with TiO2 strategy followed by nanoLC-MS/MS analysis. Totally we identified 32,546 phosphosites on 5,091 phosphoproteins, among which 23,945 were class I phosphosites, and quantified 16,000 sites during NSC differentiation. More than 65% of class I phosphosites were novel when compared with PhosphoSitePlus database. Quantification results showed that the early and late stage of NSC differentiation differ greatly. We mapped 69 changed phosphosites on 20 proteins involved in Wnt signaling pathway, including S552 on catenin beta-1 (Ctnnb1) and S9 on glycogen synthase kinase 3β (Gsk3β). Western blotting and real-time PCR results proved that Wnt signaling pathway plays critical roles in NSC fate determination. Furthermore, inhibition and activation of PKA dramatically affected the phosphorylation state of Ctnnb1 and Gsk3β, which regulates the differentiation of NSCs. Our data provides a valuable resource for studying the self-renewal and differentiation of NSCs. Stem Cells 2016;34:2090-2101. © 2016 AlphaMed Press.

  15. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  16. Glycogen distribution in adult and geriatric mice brains

    KAUST Repository

    Alrabeh, Rana

    2017-05-01

    Astrocytes, the most abundant glial cell type in the brain, undergo a number of roles in brain physiology; among them, the energetic support of neurons is the best characterized. Contained within astrocytes is the brain’s obligate energy store, glycogen. Through glycogenolysis, glycogen, a storage form of glucose, is converted to pyruvate that is further reduced to lactate and transferred to neurons as an energy source via MCTs. Glycogen is a multi-branched polysaccharide synthesized from the glucose uptaken in astrocytes. It has been shown that glycogen accumulates with age and contributes to the physiological ageing process in the brain. In this study, we compared glycogen distribution between young adults and geriatric mice to understand the energy consumption of synaptic terminals during ageing using computational tools. We segmented and densely reconstructed neuropil and glycogen granules within six (three 4 month old old and three 24 month old) volumes of Layer 1 somatosensory cortex mice brains from FIB-SEM stacks, using a combination of semi-automated and manual tools, ilastik and TrakEM2. Finally, the 3D visualization software, Blender, was used to analyze the dataset using the DBSCAN and KDTree Nearest neighbor algorithms to study the distribution of glycogen granules compared to synapses, using a plugin that was developed for this purpose. The Nearest Neighbors and clustering results of 6 datasets show that glycogen clusters around excitatory synapses more than inhibitory synapses and that, in general, glycogen is found around axonal boutons more than dendritic spines. There was no significant accumulation of glycogen with ageing within our admittedly small dataset. However, there was a homogenization of glycogen distribution with age and that is consistent with published literature. We conclude that glycogen distribution in the brain is not a random process but follows a function distribution.

  17. The Csr System Regulates Escherichia coli Fitness by Controlling Glycogen Accumulation and Energy Levels.

    Science.gov (United States)

    Morin, Manon; Ropers, Delphine; Cinquemani, Eugenio; Portais, Jean-Charles; Enjalbert, Brice; Cocaign-Bousquet, Muriel

    2017-10-31

    In the bacterium Escherichia coli , the posttranscriptional regulatory system Csr was postulated to influence the transition from glycolysis to gluconeogenesis. Here, we explored the role of the Csr system in the glucose-acetate transition as a model of the glycolysis-to-gluconeogenesis switch. Mutations in the Csr system influence the reorganization of gene expression after glucose exhaustion and disturb the timing of acetate reconsumption after glucose exhaustion. Analysis of metabolite concentrations during the transition revealed that the Csr system has a major effect on the energy levels of the cells after glucose exhaustion. This influence was demonstrated to result directly from the effect of the Csr system on glycogen accumulation. Mutation in glycogen metabolism was also demonstrated to hinder metabolic adaptation after glucose exhaustion because of insufficient energy. This work explains how the Csr system influences E. coli fitness during the glycolysis-gluconeogenesis switch and demonstrates the role of glycogen in maintenance of the energy charge during metabolic adaptation. IMPORTANCE Glycogen is a polysaccharide and the main storage form of glucose from bacteria such as Escherichia coli to yeasts and mammals. Although its function as a sugar reserve in mammals is well documented, the role of glycogen in bacteria is not as clear. By studying the role of posttranscriptional regulation during metabolic adaptation, for the first time, we demonstrate the role of sugar reserve played by glycogen in E. coli Indeed, glycogen not only makes it possible to maintain sufficient energy during metabolic transitions but is also the key component in the capacity of cells to resume growth. Since the essential posttranscriptional regulatory system Csr is a major regulator of glycogen accumulation, this work also sheds light on the central role of posttranscriptional regulation in metabolic adaptation. Copyright © 2017 Morin et al.

  18. Regulation of glycogen synthase kinase-3{beta} (GSK-3{beta}) after ionizing radiation; Regulation der Glykogen Synthase Kinase-3{beta} (GSK-3{beta}) nach ionisierender Strahlung

    Energy Technology Data Exchange (ETDEWEB)

    Boehme, K.A.

    2006-12-15

    Glycogen Synthase Kinase-3{beta} (GSK-3{beta}) phosphorylates the Mdm2 protein in the central domain. This phosphorylation is absolutely required for p53 degradation. Ionizing radiation inactivates GSK-3{beta} by phosphorylation at serine 9 and in consequence prevents Mdm2 mediated p53 degradation. During the work for my PhD I identified Akt/PKB as the kinase that phosphorylates GSK-3{beta} at serine 9 after ionizing radiation. Ionizing radiation leads to phosphorylation of Akt/PKB at threonine 308 and serine 473. The PI3 Kinase inhibitor LY294002 completely abolished Akt/PKB serine 473 phosphorylation and prevented the induction of GSK-3{beta} serine 9 phosphorylation after ionizing radiation. Interestingly, the most significant activation of Akt/PKB after ionizing radiation occurred in the nucleus while cytoplasmic Akt/PKB was only weakly activated after radiation. By using siRNA, I showed that Akt1/PKBa, but not Akt2/PKB{beta}, is required for phosphorylation of GSK- 3{beta} at serine 9 after ionizing radiation. Phosphorylation and activation of Akt/PKB after ionizing radiation depends on the DNA dependent protein kinase (DNA-PK), a member of the PI3 Kinase family, that is activated by free DNA ends. Both, in cells from SCID mice and after knockdown of the catalytic subunit of DNA-PK by siRNA in osteosarcoma cells, phosphorylation of Akt/PKB at serine 473 and of GSK-3{beta} at serine 9 was completely abolished. Consistent with the principle that phosphorylation of GSK-3 at serine 9 contributes to p53 stabilization after radiation, the accumulation of p53 in response to ionizing radiation was largely prevented by downregulation of DNA-PK. From these results I conclude, that ionizing radiation induces a signaling cascade that leads to Akt1/PKBa activation mediated by DNA-PK dependent phosphorylation of serine 473. After activation Akt1/PKBa phosphorylates and inhibits GSK-3{beta} in the nucleus. The resulting hypophosphorylated form of Mdm2 protein is no longer

  19. In vivo hepatic glycogen metabolism in the baboon

    International Nuclear Information System (INIS)

    Jehenson, P.; Canioni, P.; Hantraye, P.; Gueron, M.; Syrota, A.

    1988-01-01

    This paper describes hepatic glycogen synthesis from glucose studied in the baboon by C-13 MR spectroscopy at 2 T. Glycogen synthesis was followed for 3 hours on natural abundance spectra during glucose infusion. (1-C-13)-glucose (3g) was then injected. It produced a ten times larger rate of increase of glycogen-C 1 , which is much lower than expected, suggesting that glycogen synthesis mainly occurred from unlabeled gluconeogenic substrates. Signal-to-noise ratio was 50 for glycogen-C 1 on 2-minute H-1 decoupled spectra. Labeling of C 1 but also C 2 , C 5 and C 6 of glycogen indicated a 15% contribution of indirect pathways to its synthesis from glucose

  20. Drug induced exocytosis of glycogen in Pompe disease.

    Science.gov (United States)

    Turner, Christopher T; Fuller, Maria; Hopwood, John J; Meikle, Peter J; Brooks, Doug A

    2016-10-28

    Pompe disease is caused by a deficiency in the lysosomal enzyme α-glucosidase, and this leads to glycogen accumulation in the autolysosomes of patient cells. Glycogen storage material is exocytosed at a basal rate in cultured Pompe cells, with one study showing up to 80% is released under specific culture conditions. Critically, exocytosis induction may reduce glycogen storage in Pompe patients, providing the basis for a therapeutic strategy whereby stored glycogen is redirected to an extracellular location and subsequently degraded by circulating amylases. The focus of the current study was to identify compounds capable of inducing rapid glycogen exocytosis in cultured Pompe cells. Here, calcimycin, lysophosphatidylcholine and α-l-iduronidase each significantly increased glycogen exocytosis compared to vehicle-treated controls. The most effective compound, calcimycin, induced exocytosis through a Ca 2+ -dependent mechanism, although was unable to release a pool of vesicular glycogen larger than the calcimycin-induced exocytic pore. There was reduced glycogen release from Pompe compared to unaffected cells, primarily due to increased granule size in Pompe cells. Drug induced exocytosis therefore shows promise as a therapeutic approach for Pompe patients but strategies are required to enhance the release of large molecular weight glycogen granules. Copyright © 2016. Published by Elsevier Inc.

  1. Glycogen Shunt Activity and Glycolytic Supercompensation in Astrocytes May Be Distinctly Mediated via the Muscle Form of Glycogen Phosphorylase

    DEFF Research Database (Denmark)

    Jakobsen, Emil; Bak, Lasse K; Walls, Anne B

    2017-01-01

    Glycogen is the main storage form of glucose in the brain. In contrast with previous beliefs, brain glycogen has recently been shown to play important roles in several brain functions. A fraction of metabolized glucose molecules are being shunted through glycogen before reentering the glycolytic ...

  2. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

    2008-01-01

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  3. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

    NARCIS (Netherlands)

    Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

    2000-01-01

    The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

  4. Nuclear Glycogen Inclusions in Canine Parietal Cells.

    Science.gov (United States)

    Silvestri, S; Lepri, E; Dall'Aglio, C; Marchesi, M C; Vitellozzi, G

    2017-05-01

    Nuclear glycogen inclusions occur infrequently in pathologic conditions but also in normal human and animal tissues. Their function or significance is unclear. To the best of the authors' knowledge, no reports of nuclear glycogen inclusions in canine parietal cells exist. After initial observations of nuclear inclusions/pseudoinclusions during routine histopathology, the authors retrospectively examined samples of gastric mucosa from dogs presenting with gastrointestinal signs for the presence of intranuclear inclusions/pseudoinclusions and determined their composition using histologic and electron-microscopic methods. In 24 of 108 cases (22%), the authors observed various numbers of intranuclear inclusions/pseudoinclusions within scattered parietal cells. Nuclei were characterized by marked karyomegaly and chromatin margination around a central optically empty or slightly eosinophilic area. The intranuclear inclusions/pseudoinclusions stained positive with periodic acid-Schiff (PAS) and were diastase sensitive, consistent with glycogen. Several PAS-positive/diastase-sensitive sections were further examined by transmission electron microscopy, also using periodic acid-thiocarbohydrazide-silver proteinate (PA-TCH-SP) staining to identify polysaccharides. Ultrastructurally, the nuclear inclusions were composed of electron-dense particles that were not membrane bound, without evidence of nuclear membrane invaginations or cytoplasmic organelles in the nuclei, and positive staining with PA-TCH-SP, confirming a glycogen composition. No cytoplasmic glycogen deposits were observed, suggesting that the intranuclear glycogen inclusions were probably synthesized in loco. Nuclear glycogen inclusions were not associated with gastritis or colonization by Helicobacter-like organisms ( P > .05). Our findings suggest that nuclear glycogen inclusions in canine parietal cells could be an incidental finding. Nevertheless, since nuclear glycogen is present in several pathologic

  5. Muscle glycogen and cell function--Location, location, location.

    Science.gov (United States)

    Ørtenblad, N; Nielsen, J

    2015-12-01

    The importance of glycogen, as a fuel during exercise, is a fundamental concept in exercise physiology. The use of electron microscopy has revealed that glycogen is not evenly distributed in skeletal muscle fibers, but rather localized in distinct pools. In this review, we present the available evidence regarding the subcellular localization of glycogen in skeletal muscle and discuss this from the perspective of skeletal muscle fiber function. The distribution of glycogen in the defined pools within the skeletal muscle varies depending on exercise intensity, fiber phenotype, training status, and immobilization. Furthermore, these defined pools may serve specific functions in the cell. Specifically, reduced levels of these pools of glycogen are associated with reduced SR Ca(2+) release, muscle relaxation rate, and membrane excitability. Collectively, the available literature strongly demonstrates that the subcellular localization of glycogen has to be considered to fully understand the role of glycogen metabolism and signaling in skeletal muscle function. Here, we propose that the effect of low muscle glycogen on excitation-contraction coupling may serve as a built-in mechanism, which links the energetic state of the muscle fiber to energy utilization. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  8. Tyrosine glycosylation is involved in muscle-glycogen synthesis

    International Nuclear Information System (INIS)

    Rodriguez, I.R.; Tandecarz, J.S.; Kirkman, B.R.; Whelan, W.J.

    1986-01-01

    Rabbit-muscle glycogen contains a covalently bound protein having Mr 37,000 that the authors will henceforth refer to as glycogenin. It is completely insoluble in water at pH 5, and may be generated as a precipitate as a result of the combined action on glycogen of α-amylase and glucoamylase, or by treatment with anhydrous hydrogen fluoride. In the former case the protein still carries some of the glucose residues of glycogen (10-30 per mole of glycogenin). The linkage between glycogen and glycogenin has been identified as a novel glycosidic-amino acid bond. The authors demonstrated glucosylation with UDP[/sup 14/C]glucose by a muscle extract of two rabbit-muscle proteins contained in the same extract. The relation of these proteins to glycogenin, and whether the amino acid undergoing glucosylation is tyrosine, remains to be explored. The discovery of glycogenin is, the authors believe, an important clue to the mechanism of biogenesis of glycogen and may represent a previously unsuspected means of metabolic control of the glycogen content of the cell and the location of glycogen within the cell. The facts that the linkage between glycogen and glycogenin is via tyrosine, that insulin stimulates glycogen synthesis, and acts on its receptor by causing it to become an active tyrosine kinase, may be linked by a common thread

  9. Insulin action in denervated skeletal muscle

    International Nuclear Information System (INIS)

    Smith, R.L.

    1987-01-01

    The goal of this study was to determine the mechanisms responsible for reduced insulin response in denervated muscle. Denervation for 3 days of rat muscles consisting of very different compositions of fiber types decreased insulin stimulated [U- 14 C]glucose incorporation into glycogen by 80%. Associated with the reduction in glycogen synthesis was a decreased activation of glycogen synthase. Denervation of hemidiaphragms for 1 day decreased both the basal and insulin stimulated activity ratios of glycogen synthase and the rate of insulin stimulated [U- 14 C[glucose incorporation into glycogen by 50%. Insulin stimulation of 2-deoxy[ 3 H]glucose uptake was not decreased until 3 days after denervation. Consistent with the effects on glucose transport,insulin did not increase the intracellular concentration of glucose-6-P in muscles 3 days after denervation. Furthermore, since the Ka for glucose-6-P activation of glycogen synthase was not decreased by insulin in denervated hemidiaphragms, the effects of denervation on glycogen synthase and glucose transport were synergistic resulting in the 80% decrease in glycogen synthesis rates

  10. Convergence of the mammalian target of rapamycin complex 1- and glycogen synthase kinase 3-β-signaling pathways regulates the innate inflammatory response.

    Science.gov (United States)

    Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S; Greenway, Terrance; Martin, Michael

    2011-05-01

    The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin's ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3.

  11. A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

    Science.gov (United States)

    Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

    2016-12-28

    The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

  12. Genetics Home Reference: glycogen storage disease type VII

    Science.gov (United States)

    ... Home Health Conditions Glycogen storage disease type VII Glycogen storage disease type VII Printable PDF Open All ... Javascript to view the expand/collapse boxes. Description Glycogen storage disease type VII (GSDVII) is an inherited ...

  13. Genetics Home Reference: glycogen storage disease type IV

    Science.gov (United States)

    ... Home Health Conditions Glycogen storage disease type IV Glycogen storage disease type IV Printable PDF Open All ... Javascript to view the expand/collapse boxes. Description Glycogen storage disease type IV (GSD IV) is an ...

  14. Pleiotropy of Glycogen Synthase Kinase-3 Inhibition by CHIR99021 Promotes Self-Renewal of Embryonic Stem Cells from Refractory Mouse Strains

    Science.gov (United States)

    Ye, Shoudong; Tan, Li; Yang, Rongqing; Fang, Bo; Qu, Su; Schulze, Eric N.; Song, Houyan; Ying, Qilong; Li, Ping

    2012-01-01

    Background Inhibition of glycogen synthase kinase-3 (GSK-3) improves the efficiency of embryonic stem (ES) cell derivation from various strains of mice and rats, as well as dramatically promotes ES cell self-renewal potential. β-catenin has been reported to be involved in the maintenance of self-renewal of ES cells through TCF dependent and independent pathway. But the intrinsic difference between ES cell lines from different species and strains has not been characterized. Here, we dissect the mechanism of GSK-3 inhibition by CHIR99021 in mouse ES cells from refractory mouse strains. Methodology/Principal Findings We found that CHIR99021, a GSK-3 specific inhibitor, promotes self-renewal of ES cells from recalcitrant C57BL/6 (B6) and BALB/c mouse strains through stabilization of β-catenin and c-Myc protein levels. Stabilized β-catenin promoted ES self-renewal through two mechanisms. First, β-catenin translocated into the nucleus to maintain stem cell pluripotency in a lymphoid-enhancing factor/T-cell factor–independent manner. Second, β-catenin binds plasma membrane-localized E-cadherin, which ensures a compact, spherical morphology, a hallmark of ES cells. Further, elevated c-Myc protein levels did not contribute significantly to CH-mediated ES cell self-renewal. Instead, the role of c-Myc is dependent on its transformation activity and can be replaced by N-Myc but not L-Myc. β-catenin and c-Myc have similar effects on ES cells derived from both B6 and BALB/c mice. Conclusions/Significance Our data demonstrated that GSK-3 inhibition by CH promotes self-renewal of mouse ES cells with non-permissive genetic backgrounds by regulation of multiple signaling pathways. These findings would be useful to improve the availability of normally non-permissive mouse strains as research tools. PMID:22540008

  15. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  16. Labeling of hepatic glycogen after short- and long-term stimulation of glycogen synthesis in rats injected with 3H-galactose

    International Nuclear Information System (INIS)

    Michaels, J.E.; Garfield, S.A.; Hung, J.T.; Cardell, R.R. Jr.

    1990-01-01

    The effects of short- and long-term stimulation of glycogen synthesis elicited by dexamethasone were studied by light (LM) and electron (EM) microscopic radioautography (RAG) and biochemical analysis. Adrenalectomized rats were fasted overnight and pretreated for short- (3 hr) or long-term (14 hr) periods with dexamethasone prior to intravenous injection of tracer doses of 3H-galactose. Analysis of LM-RAGs from short-term rats revealed that about equal percentages (44%) of hepatocytes became heavily or lightly labeled 1 hr after labeling. The percentage of heavily labeled cells increased slightly 6 hr after labeling, and unlabeled glycogen became apparent in some hepatocytes. The percentage of heavily labeled cells had decreased somewhat 12 hr after labeling, and more unlabeled glycogen was evident. In the long-term rats 1 hr after labeling, a higher percentage of heavily labeled cells (76%) was observed compared to short-term rats, and most glycogen was labeled. In spite of the high amount of labeling seen initially, the percentage of heavily labeled hepatocytes had decreased considerably to 55% by 12 hr after injection; and sparsely labeled and unlabeled glycogen was prevalent. The EM-RAGs of both short- and long-term rats were similar. Silver grains were associated with glycogen patches 1 hr after labeling; 12 hr after labeling, the glycogen patches had enlarged; and label, where present, was dispersed over the enlarged glycogen clumps. Analysis of DPM/mg tissue corroborated the observed decrease in label 12 hr after administration in the long-term animals. The loss of label observed 12 hr after injection in the long-term pretreated rats suggests that turnover of glycogen occurred during this interval despite the net accumulation of glycogen that was visible morphologically and evident from biochemical measurement

  17. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Functional significance of brain glycogen in sustaining glutamatergic neurotransmission.

    Science.gov (United States)

    Sickmann, Helle M; Walls, Anne B; Schousboe, Arne; Bouman, Stephan D; Waagepetersen, Helle S

    2009-05-01

    The involvement of brain glycogen in sustaining neuronal activity has previously been demonstrated. However, to what extent energy derived from glycogen is consumed by astrocytes themselves or is transferred to the neurons in the form of lactate for oxidative metabolism to proceed is at present unclear. The significance of glycogen in fueling glutamate uptake into astrocytes was specifically addressed in cultured astrocytes. Moreover, the objective was to elucidate whether glycogen derived energy is important for maintaining glutamatergic neurotransmission, induced by repetitive exposure to NMDA in co-cultures of cerebellar neurons and astrocytes. In the astrocytes it was shown that uptake of the glutamate analogue D-[3H]aspartate was impaired when glycogen degradation was inhibited irrespective of the presence of glucose, signifying that energy derived from glycogen degradation is important for the astrocytic compartment. By inhibiting glycogen degradation in co-cultures it was evident that glycogen provides energy to sustain glutamatergic neurotransmission, i.e. release and uptake of glutamate. The relocation of glycogen derived lactate to the neuronal compartment was investigated by employing d-lactate, a competitive substrate for the monocarboxylate transporters. Neurotransmitter release was affected by the presence of d-lactate indicating that glycogen derived energy is important not only in the astrocytic but also in the neuronal compartment.

  19. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  20. Overlapping functions of the starch synthases SSII and SSIII in amylopectin biosynthesis in Arabidopsis

    Directory of Open Access Journals (Sweden)

    D'Hulst Christophe

    2008-09-01

    Full Text Available Abstract Background The biochemical mechanisms that determine the molecular architecture of amylopectin are central in plant biology because they allow long-term storage of reduced carbon. Amylopectin structure imparts the ability to form semi-crystalline starch granules, which in turn provides its glucose storage function. The enzymatic steps of amylopectin biosynthesis resemble those of the soluble polymer glycogen, however, the reasons for amylopectin's architectural distinctions are not clearly understood. The multiplicity of starch biosynthetic enzymes conserved in plants likely is involved. For example, amylopectin chain elongation in plants involves five conserved classes of starch synthase (SS, whereas glycogen biosynthesis typically requires only one class of glycogen synthase. Results Null mutations were characterized in AtSS2, which codes for SSII, and mutant lines were compared to lines lacking SSIII and to an Atss2, Atss3 double mutant. Loss of SSII did not affect growth rate or starch quantity, but caused increased amylose/amylopectin ratio, increased total amylose, and deficiency in amylopectin chains with degree of polymerization (DP 12 to DP28. In contrast, loss of both SSII and SSIII caused slower plant growth and dramatically reduced starch content. Extreme deficiency in DP12 to DP28 chains occurred in the double mutant, far more severe than the summed changes in SSII- or SSIII-deficient plants lacking only one of the two enzymes. Conclusion SSII and SSIII have partially redundant functions in determination of amylopectin structure, and these roles cannot be substituted by any other conserved SS, specifically SSI, GBSSI, or SSIV. Even though SSIII is not required for the normal abundance of glucan chains of DP12 to DP18, the enzyme clearly is capable of functioning in production such chains. The role of SSIII in producing these chains cannot be detected simply by analysis of an individual mutation. Competition between

  1. Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

    DEFF Research Database (Denmark)

    Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

    2008-01-01

    Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

  2. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  3. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  4. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Heteropoly acid catalyzed hydrolysis of glycogen to glucose

    International Nuclear Information System (INIS)

    Klein, Miri; Pulidindi, Indra Neel; Perkas, Nina; Gedanken, Aharon

    2015-01-01

    Complete conversion of glycogen to glucose is achieved by using H 3 PW 12 O 40 ·nH 2 O (HPW) and H 4 SiW 12 O 40 ·nH 2 O (HSiW) as catalysts for the hydrolysis under optimized hydrothermal conditions (mass fraction of catalyst 2.4%, 373 K and 2 h reaction time). The reusability of the catalyst (HPW) was demonstrated. In addition to carrying out the glycogen hydrolysis in an autoclave, other novel methods such as microwave irradiation and sonication have also been investigated. At higher mass fraction of the heteropoly acids (10.5%), glycogen could be completely converted to glucose under microwave irradiation. Sonication of an aqueous solution of glycogen in the presence of HPW and HSiW also yielded glucose. Thus, heteropoly acids are efficient, environmentally friendly and reusable catalysts for the conversion of glycogen to glucose. - Highlights: • Hydrothermal, microwave and sonication based methods of hydrolysis. • Heteropoly acids are green catalysts for glycogen hydrolysis. • Glycogen from cyanobacteria is demonstrated as a potential feedstock for glucose

  6. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  7. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

    DEFF Research Database (Denmark)

    Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

    2014-01-01

    BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

  8. Patterns of glycogen turnover in liver characterized by computer modeling

    International Nuclear Information System (INIS)

    Youn, J.H.; Bergman, R.N.

    1987-01-01

    The authors used a computer model of liver glycogen turnover to reexamine the data of Devos and Hers, who reported the time course of accumulation in and loss from glycogen of label originating in [1- 14 C]galactose injected at different times after the start of refeeding of 40-h fasted mice or rats. In the present study computer representation of individual glycogen molecules was utilized to account for growth and degradation of glycogen according to specific hypothetical patterns. Using this model they could predict the accumulation and localization within glycogen of labeled glucose residues and compare the predictions with the previously published data. They considered three specific hypotheses of glycogen accumulation during refeeding: (1) simultaneous, (2) sequential, and (3) accelerating growth. Hypothetical patterns of glycogen degradation were (1) ordered and (2) random degradation. The pattern of glycogen synthesis consistent with experimental data was a steadily increasing number of growing glycogen molecules, whereas during degradation glycogen molecules are exposed to degrading enzymes randomly, rather than in a specific reverse order of synthesis. These patterns predict the existence of a specific mechanism for the steadily increasing seeding of new glycogen molecules during synthesis

  9. An X11alpha/FSBP complex represses transcription of the GSK3beta gene promoter.

    LENUS (Irish Health Repository)

    Lau, Kwok-Fai

    2010-08-04

    X11alpha is a neuronal adaptor protein that interacts with the amyloid precursor protein (APP) through a centrally located phosphotyrosine binding domain to inhibit the production of Abeta peptide that is deposited in Alzheimer\\'s disease brains. X11alpha also contains two C-terminal postsynaptic density-95, large discs, zona occludens 1 (PDZ) domains, and we show here that through its PDZ domains, X11alpha interacts with a novel transcription factor, fibrinogen silencer binding protein. Moreover, we show that an X11alpha\\/fibrinogen silencer binding protein complex signals to the nucleus to repress glycogen synthase kinase-3beta promoter activity. Glycogen synthase kinase-3beta is a favoured candidate kinase for phosphorylating tau in Alzheimer\\'s disease. Our findings show a new function for X11alpha that may impact on Alzheimer\\'s disease pathogenesis.

  10. Contributions of Glycogen to Astrocytic Energetics during Brain Activation

    Science.gov (United States)

    Dienel, Gerald A.; Cruz, Nancy F.

    2014-01-01

    Glycogen is the major store of glucose in brain and is mainly in astrocytes. Brain glycogen levels in unstimulated, carefully-handled rats are 10-12 mol/g, and assuming that astrocytes account for half the brain mass, astrocytic glycogen content is twice as high. Glycogen turnover is slow under basal conditions, but it is mobilized during activation. There is no net increase in incorporation of label from glucose during activation, whereas label release from pre-labeled glycogen exceeds net glycogen consumption, which increases during stronger stimuli. Because glycogen level is restored by non-oxidative metabolism, astrocytes can influence the global ratio of oxygen to glucose utilization. Compensatory increases in utilization of blood glucose during inhibition of glycogen phosphorylase are large and approximate glycogenolysis rates during sensory stimulation. In contrast, glycogenolysis rates during hypoglycemia are low due to continued glucose delivery and oxidation of endogenous substrates; rates that preserve neuronal function in the absence of glucose are also low, probably due to metabolite oxidation. Modeling studies predict that glycogenolysis maintains a high level of glucose-6-phosphate in astrocytes to maintain feedback inhibition of hexokinase, thereby diverting glucose for use by neurons. The fate of glycogen carbon in vivo is not known, but lactate efflux from brain best accounts for the major metabolic characteristics during activation of living brain. Substantial shuttling coupled with oxidation of glycogen-derived lactate is inconsistent with available evidence. Glycogen has important roles in astrocytic energetics, including glucose sparing, control of extracellular K+ level, oxidative stress management, and memory consolidation; it is a multi-functional compound. PMID:24515302

  11. Contributions of glycogen to astrocytic energetics during brain activation.

    Science.gov (United States)

    Dienel, Gerald A; Cruz, Nancy F

    2015-02-01

    Glycogen is the major store of glucose in brain and is mainly in astrocytes. Brain glycogen levels in unstimulated, carefully-handled rats are 10-12 μmol/g, and assuming that astrocytes account for half the brain mass, astrocytic glycogen content is twice as high. Glycogen turnover is slow under basal conditions, but it is mobilized during activation. There is no net increase in incorporation of label from glucose during activation, whereas label release from pre-labeled glycogen exceeds net glycogen consumption, which increases during stronger stimuli. Because glycogen level is restored by non-oxidative metabolism, astrocytes can influence the global ratio of oxygen to glucose utilization. Compensatory increases in utilization of blood glucose during inhibition of glycogen phosphorylase are large and approximate glycogenolysis rates during sensory stimulation. In contrast, glycogenolysis rates during hypoglycemia are low due to continued glucose delivery and oxidation of endogenous substrates; rates that preserve neuronal function in the absence of glucose are also low, probably due to metabolite oxidation. Modeling studies predict that glycogenolysis maintains a high level of glucose-6-phosphate in astrocytes to maintain feedback inhibition of hexokinase, thereby diverting glucose for use by neurons. The fate of glycogen carbon in vivo is not known, but lactate efflux from brain best accounts for the major metabolic characteristics during activation of living brain. Substantial shuttling coupled with oxidation of glycogen-derived lactate is inconsistent with available evidence. Glycogen has important roles in astrocytic energetics, including glucose sparing, control of extracellular K(+) level, oxidative stress management, and memory consolidation; it is a multi-functional compound.

  12. Carcass glycogen repletion on carbohydrate re-feeding after starvation.

    OpenAIRE

    Cox, D J; Palmer, T N

    1987-01-01

    In mice, the response of carcass glycogen to glucose re-feeding after starvation is biphasic. The initial repletive phase is followed by partial (greater than 50%) glycogen mobilization. This turnover of carcass glycogen in response to carbohydrate re-feeding may play an important role in the provision of C3 precursors for hepatic glycogen synthesis.

  13. Clinicopathological and biological significance of aberrant activation of glycogen synthase kinase-3 in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Fu Y

    2014-06-01

    Full Text Available Yunfeng Fu,1 Xinyu Wang,1 Xiaodong Cheng,1 Feng Ye,2 Xing Xie,1,2 Weiguo Lu1,2 1Department of Gynecologic Oncology, Women's Hospital, School of Medicine, Zhejiang University, 2Women's Reproduction and Health Laboratory of Zhejiang Province, Hangzhou, People's Republic of China Background: Glycogen synthase kinase-3 (GSK-3 plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/βTyr279/216 in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition can influence cell viability and tumor growth of ovarian cancer. Methods: Immunohistochemistry was used to examine expression of GSK-3α/β and pGSK-3α/βTyr279/216 in 71 human epithelial ovarian cancer tissues and correlations between protein expression, and clinicopathological factors were analyzed. Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay following exposure of ovarian carcinoma cells to pharmacological inhibitors of GSK-3 or GSK-3 small interfering RNA. In vivo validation of tumor growth inhibition was performed with xenograft mice. Results: The expression levels of GSK-3α/β and pGSK-3α/βTyr279/216 in ovarian cancers were significantly higher than those in benign tumors. High expression of GSK-3α/β was more likely to be found in patients with advanced International Federation of Gynecology and Obstetrics (FIGO stages and high serum cancer antigen 125. Higher expression of pGSK-3α/βTyr279/216 was associated with advanced FIGO stages, residual tumor mass, high serum cancer antigen 125, and poor chemoresponse. Worse overall survival was revealed by Kaplan–Meier survival curves in patients with high expression of GSK-3α/β or pGSK-3α/βTyr279/216. Multivariate analysis indicated that FIGO stage, GSK-3α/β expression, and pGSK-3α/βTyr279/216 expression were independent prognostic factors for overall

  14. Homogenization versus homogenization-free method to measure muscle glycogen fractions.

    Science.gov (United States)

    Mojibi, N; Rasouli, M

    2016-12-01

    The glycogen is extracted from animal tissues with or without homogenization using cold perchloric acid. Three methods were compared for determination of glycogen in rat muscle at different physiological states. Two groups of five rats were kept at rest or 45 minutes muscular activity. The glycogen fractions were extracted and measured by using three methods. The data of homogenization method shows that total glycogen decreased following 45 min physical activity and the change occurred entirely in acid soluble glycogen (ASG), while AIG did not change significantly. Similar results were obtained by using "total-glycogen-fractionation methods". The findings of "homogenization-free method" indicate that the acid insoluble fraction (AIG) was the main portion of muscle glycogen and the majority of changes occurred in AIG fraction. The results of "homogenization method" are identical with "total glycogen fractionation", but differ with "homogenization-free" protocol. The ASG fraction is the major portion of muscle glycogen and is more metabolically active form.

  15. Extraction of glycogen on mild condition lacks AIG fraction.

    Science.gov (United States)

    Ghafouri, Z; Rasouli, M

    2016-12-01

    Extraction of animal tissues with cold water or perchloric acid yields less glycogen than is obtained with hot-alkaline. Extraction with acid and alkaline gives two fractions, acid soluble (ASG) and insoluble glycogen (AIG). The aim of this work is to examine the hypothesis that not all liver glycogen is extractable by Tris-buffer using current techniques. Rat liver was homogenized with Tris-buffer pH 8.3 and extracted for the glycogen fractions, ASG and AIG. The degree of homogenization was changed to remove all glycogen. The content of glycogen was 47.7 ± 1.2 and 11.6 ± 0.8 mg/g wet liver in the supernatant and pellet of the first extraction respectively. About 24% of total glycogen is lost through the first pellet. Increasing the extent of homogenization from 30 to 180 sec and from 15000 to 20000 rpm followed with 30 sec ultrasonication did not improve the extraction. ASG and AIG constitute about 77% and 23% of the pellet glycogen respectively. Extraction with cold Tris-buffer failed to extract glycogen completely.  Increasing the extent of homogenization followed with ultrasonication also did not improve the extraction. Thus it is necessary to re-examine the previous findings obtained by extraction with cold Tris-buffer.

  16. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  17. Glycogen Reduction in Myotubes of Late-Onset Pompe Disease Patients Using Antisense Technology.

    Science.gov (United States)

    Goina, Elisa; Peruzzo, Paolo; Bembi, Bruno; Dardis, Andrea; Buratti, Emanuele

    2017-09-06

    Glycogen storage disease type II (GSDII) is a lysosomal disorder caused by the deficient activity of acid alpha-glucosidase (GAA) enzyme, leading to the accumulation of glycogen within the lysosomes. The disease has been classified in infantile and late-onset forms. Most late-onset patients share a splicing mutation c.-32-13T > G in intron 1 of the GAA gene that prevents efficient recognition of exon 2 by the spliceosome. In this study, we have mapped the splicing silencers of GAA exon 2 and developed antisense morpholino oligonucleotides (AMOs) to inhibit those regions and rescue normal splicing in the presence of the c.-32-13T > G mutation. Using a minigene approach and patient fibroblasts, we successfully increased inclusion of exon 2 in the mRNA and GAA enzyme production by targeting a specific silencer with a combination of AMOs. Most importantly, the use of these AMOs in patient myotubes results in a decreased accumulation of glycogen. To our knowledge, this is the only therapeutic approach resulting in a decrease of glycogen accumulation in patient tissues beside enzyme replacement therapy (ERT) and TFEB overexpression. As a result, it may represent a highly novel and promising therapeutic line for GSDII. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. Ordered synthesis and mobilization of glycogen in the perfused heart

    International Nuclear Information System (INIS)

    Brainard, J.R.; Hutson, J.Y.; Hoekenga, D.E.; Lenhoff, R.

    1989-01-01

    The molecular order of synthesis and mobilization of glycogen in the perfused heart was studied by 13 C NMR. By varying the glucose isotopomer ([1- 13 C]glucose or [2- 13 C]glucose) supplied to the heart, glycogen synthesized at different times during the perfusion was labeled at different carbon sites. Subsequently, the in situ mobilization of glycogen during ischemia was observed by detection of labeled lactate derived from glycolysis of the glucosyl monomers. When [1- 13 C]glucose was given initially in the perfusion and [2- 13 C]glucose was given second, [2- 13 C]lactate was detected first during ischemia and [3- 13 C]lactate second. This result, and the equivalent result when the glucose labels were given in the reverse order, demonstrates that glycogen synthesis and mobilization are ordered in the heart, where glycogen is found morphologically only as β particles. Previous studies of glycogen synthesis and mobilization in liver and adipocytes have suggested that the organization of β particles into α particles was partially responsible for ordered synthesis and mobilization. The observations reported here for cardiac glycogen suggest that another mechanism is responsible. In addition to examine the ordered synthesis and mobilization of cardiac glycogen, the authors have selectively monitored the NMR properties of 13 C-labeled glycogen synthesized early in the perfusion during further glycogen synthesis from a second, differently labeled substrate. During synthesis from the second labeled glucose monomer, the glycogen resonance from the first label decreased in integrated intensity and increased in line width. These results suggest either that there is significant isotopic exchange of glucosyl monomers in glycogen during net synthesis or that glucosyl residues incorporated into glycogen undergo motional restrictions as further glycogen synthesis occurs

  19. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

    Science.gov (United States)

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-03-09

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. Introduction to the Thematic Minireview Series: Brain glycogen metabolism.

    Science.gov (United States)

    Carlson, Gerald M; Dienel, Gerald A; Colbran, Roger J

    2018-05-11

    The synthesis of glycogen allows for efficient intracellular storage of glucose molecules in a soluble form that can be rapidly released to enter glycolysis in response to energy demand. Intensive studies of glucose and glycogen metabolism, predominantly in skeletal muscle and liver, have produced innumerable insights into the mechanisms of hormone action, resulting in the award of several Nobel Prizes over the last one hundred years. Glycogen is actually present in all cells and tissues, albeit at much lower levels than found in muscle or liver. However, metabolic and physiological roles of glycogen in other tissues are poorly understood. This series of Minireviews summarizes what is known about the enzymes involved in brain glycogen metabolism and studies that have linked glycogen metabolism to multiple brain functions involving metabolic communication between astrocytes and neurons. Recent studies unexpectedly linking some forms of epilepsy to mutations in two poorly understood proteins involved in glycogen metabolism are also reviewed. © 2018 Carlson et al.

  1. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

    Science.gov (United States)

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

    2015-03-31

    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  3. Ultrastructure and cytochemistry of cardiac intramitochondrial glycogen.

    Science.gov (United States)

    Sótonyi, P; Somogyi, E; Nemes, A; Juhász-Nagy, S

    1976-01-01

    Authors have observed abnormalities of glycogen localization in cardiac muscle, after normothermic cardiac arrest. The identification of these intramitrochondrial particles as glycogen was confirmed by selective staining with periodic acid-lead citrat, periodic acid-thiosemicarbazide protein methods and by their selective removal from tissue sections by alfa-amylase. The intramitochondrial glycogen particles were of beta-type. Some intramitochondrial particles were surrounded by paired membranes which resulted from protrusion of parts of mitochondrial membrane.

  4. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

    Science.gov (United States)

    Xiang, Lin; Zhao, Kaige; Chen, Longqing

    2010-01-01

    Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  5. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  6. Muscle glycogen and cell function - Location, location, location

    DEFF Research Database (Denmark)

    Ørtenblad, N; Nielsen, Joachim

    2015-01-01

    The importance of glycogen, as a fuel during exercise, is a fundamental concept in exercise physiology. The use of electron microscopy has revealed that glycogen is not evenly distributed in skeletal muscle fibers, but rather localized in distinct pools. In this review, we present the available...... evidence regarding the subcellular localization of glycogen in skeletal muscle and discuss this from the perspective of skeletal muscle fiber function. The distribution of glycogen in the defined pools within the skeletal muscle varies depending on exercise intensity, fiber phenotype, training status......, and immobilization. Furthermore, these defined pools may serve specific functions in the cell. Specifically, reduced levels of these pools of glycogen are associated with reduced SR Ca(2+) release, muscle relaxation rate, and membrane excitability. Collectively, the available literature strongly demonstrates...

  7. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. The Csr System Regulates Escherichia coli Fitness by Controlling Glycogen Accumulation and Energy Levels

    Directory of Open Access Journals (Sweden)

    Manon Morin

    2017-10-01

    Full Text Available In the bacterium Escherichia coli, the posttranscriptional regulatory system Csr was postulated to influence the transition from glycolysis to gluconeogenesis. Here, we explored the role of the Csr system in the glucose-acetate transition as a model of the glycolysis-to-gluconeogenesis switch. Mutations in the Csr system influence the reorganization of gene expression after glucose exhaustion and disturb the timing of acetate reconsumption after glucose exhaustion. Analysis of metabolite concentrations during the transition revealed that the Csr system has a major effect on the energy levels of the cells after glucose exhaustion. This influence was demonstrated to result directly from the effect of the Csr system on glycogen accumulation. Mutation in glycogen metabolism was also demonstrated to hinder metabolic adaptation after glucose exhaustion because of insufficient energy. This work explains how the Csr system influences E. coli fitness during the glycolysis-gluconeogenesis switch and demonstrates the role of glycogen in maintenance of the energy charge during metabolic adaptation.

  9. Glycogen dynamics of crucian carp (Carassius carassius) in prolonged anoxia.

    Science.gov (United States)

    Vornanen, Matti; Haverinen, Jaakko

    2016-12-01

    Mobilization of glycogen stores was examined in the anoxic crucian carp (Carassius carassius Linnaeus). Winter-acclimatized fish were exposed to anoxia for 1, 3, or 6 weeks at 2 °C, and changes in the size of glycogen deposits were followed. After 1 week of anoxia, a major part of the glycogen stores was mobilized in liver (79.5 %) and heart (75.6 %), and large decreases occurred in gill (46.7 %) and muscle (45.1 %). Brain was an exception in that its glycogen content remained unchanged. The amount of glycogen degraded during the first anoxic week was sufficient for the anaerobic ethanol production for more than 6 weeks of anoxia. After 3 and 6 weeks of anoxia, there was little further degradation of glycogen in other tissues except the brain where the stores were reduced by 30.1 and 49.9 % after 3 and 6 weeks of anoxia, respectively. One week of normoxic recovery following the 6-week anoxia was associated with a complete replenishment of the brain glycogen and partial recovery of liver, heart, and gill glycogen stores. Notably, the resynthesis of glycogen occurred at the expense of the existing energy reserves of the body in fasting fish. These findings indicate that in crucian carp, glycogen stores are quickly mobilized after the onset of anoxia, with the exception of the brain whose glycogen stores may be saved for putative emergency situations.

  10. 1H NMR visibility of mammalian glycogen in solution

    International Nuclear Information System (INIS)

    Zang, L.H.; Rothman, D.L.; Shulman, R.G.

    1990-01-01

    High-resolution 1 H NMR spectra of rabbit liver glycogen in 2 H 2 O were obtained at 500 MHz, and several resonances were assigned by comparison with the chemical shifts of α-linked diglucose molecules. The NMR relaxation times T 1 and T 2 of glycogen in 2 H 2 O were determined to be 1.1 and 0.029 s, respectively. The measured natural linewidth of the carbon-1 proton is in excellent agreement with that calculated from T 2 . The visibility measurements made by digesting glycogen and comparing glucose and glycogen signal intensities demonstrate that in spite of the very high molecular weight, all of the proton nuclei in glycogen contribute to the NMR spectrum. The result is not unexpected, since 100% NMR visibility was previously observed from the carbon nuclei of glycogen, due to the rapid intramolecular motions

  11. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  12. Glucose dependence of glycogen synthase activity regulation by GSK3 and MEK/ERK inhibitors and angiotensin-(1-7) action on these pathways in cultured human myotubes.

    Science.gov (United States)

    Montori-Grau, Marta; Tarrats, Núria; Osorio-Conles, Oscar; Orozco, Anna; Serrano-Marco, Lucía; Vázquez-Carrera, Manuel; Gómez-Foix, Anna M

    2013-05-01

    Glycogen synthase (GS) is activated by glucose/glycogen depletion in skeletal muscle cells, but the contributing signaling pathways, including the chief GS regulator GSK3, have not been fully defined. The MEK/ERK pathway is known to regulate GSK3 and respond to glucose. The aim of this study was to elucidate the GSK3 and MEK/ERK pathway contribution to GS activation by glucose deprivation in cultured human myotubes. Moreover, we tested the glucose-dependence of GSK3 and MEK/ERK effects on GS and angiotensin (1-7) actions on these pathways. We show that glucose deprivation activated GS, but did not change phospho-GS (Ser640/1), GSK3β activity or activity-activating phosphorylation of ERK1/2. We then treated glucose-replete and -depleted cells with SB415286, U0126, LY294 and rapamycin to inhibit GSK3, MEK1/2, PI3K and mTOR, respectively. SB415286 activated GS and decreased the relative phospho-GS (Ser640/1) level, more in glucose-depleted than -replete cells. U0126 activated GS and reduced the phospho-GS (Ser640/1) content significantly in glucose-depleted cells, while GSK3β activity tended to increase. LY294 inactivated GS in glucose-depleted cells only, without affecting relative phospho-GS (Ser640/1) level. Rapamycin had no effect on GS activation. Angiotensin-(1-7) raised phospho-ERK1/2 but not phospho-GSK3β (Ser9) content, while it inactivated GS and increased GS phosphorylation on Ser640/1, in glucose-replete cells. In glucose-depleted cells, angiotensin-(1-7) effects on ERK1/2 and GS were reverted, while relative phospho-GSK3β (Ser9) content decreased. In conclusion, activation of GS by glucose deprivation is not due to GS Ser640/1 dephosphorylation, GSK3β or ERK1/2 regulation in cultured myotubes. However, glucose depletion enhances GS activation/Ser640/1 dephosphorylation due to both GSK3 and MEK/ERK inhibition. Angiotensin-(1-7) inactivates GS in glucose-replete cells in association with ERK1/2 activation, not with GSK3 regulation, and glucose

  13. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  14. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  15. An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

    Science.gov (United States)

    Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

  16. Acid hydrolysis and molecular density of phytoglycogen and liver glycogen helps understand the bonding in glycogen α (composite particles.

    Directory of Open Access Journals (Sweden)

    Prudence O Powell

    Full Text Available Phytoglycogen (from certain mutant plants and animal glycogen are highly branched glucose polymers with similarities in structural features and molecular size range. Both appear to form composite α particles from smaller β particles. The molecular size distribution of liver glycogen is bimodal, with distinct α and β components, while that of phytoglycogen is monomodal. This study aims to enhance our understanding of the nature of the link between liver-glycogen β particles resulting in the formation of large α particles. It examines the time evolution of the size distribution of these molecules during acid hydrolysis, and the size dependence of the molecular density of both glucans. The monomodal distribution of phytoglycogen decreases uniformly in time with hydrolysis, while with glycogen, the large particles degrade significantly more quickly. The size dependence of the molecular density shows qualitatively different shapes for these two types of molecules. The data, combined with a quantitative model for the evolution of the distribution during degradation, suggest that the bonding between β into α particles is different between phytoglycogen and liver glycogen, with the formation of a glycosidic linkage for phytoglycogen and a covalent or strong non-covalent linkage, most probably involving a protein, for glycogen as most likely. This finding is of importance for diabetes, where α-particle structure is impaired.

  17. Acid Hydrolysis and Molecular Density of Phytoglycogen and Liver Glycogen Helps Understand the Bonding in Glycogen α (Composite) Particles

    Science.gov (United States)

    Powell, Prudence O.; Sullivan, Mitchell A.; Sheehy, Joshua J.; Schulz, Benjamin L.; Warren, Frederick J.; Gilbert, Robert G.

    2015-01-01

    Phytoglycogen (from certain mutant plants) and animal glycogen are highly branched glucose polymers with similarities in structural features and molecular size range. Both appear to form composite α particles from smaller β particles. The molecular size distribution of liver glycogen is bimodal, with distinct α and β components, while that of phytoglycogen is monomodal. This study aims to enhance our understanding of the nature of the link between liver-glycogen β particles resulting in the formation of large α particles. It examines the time evolution of the size distribution of these molecules during acid hydrolysis, and the size dependence of the molecular density of both glucans. The monomodal distribution of phytoglycogen decreases uniformly in time with hydrolysis, while with glycogen, the large particles degrade significantly more quickly. The size dependence of the molecular density shows qualitatively different shapes for these two types of molecules. The data, combined with a quantitative model for the evolution of the distribution during degradation, suggest that the bonding between β into α particles is different between phytoglycogen and liver glycogen, with the formation of a glycosidic linkage for phytoglycogen and a covalent or strong non-covalent linkage, most probably involving a protein, for glycogen as most likely. This finding is of importance for diabetes, where α-particle structure is impaired. PMID:25799321

  18. Exercise in muscle glycogen storage diseases.

    Science.gov (United States)

    Preisler, Nicolai; Haller, Ronald G; Vissing, John

    2015-05-01

    Glycogen storage diseases (GSD) are inborn errors of glycogen or glucose metabolism. In the GSDs that affect muscle, the consequence of a block in skeletal muscle glycogen breakdown or glucose use, is an impairment of muscular performance and exercise intolerance, owing to 1) an increase in glycogen storage that disrupts contractile function and/or 2) a reduced substrate turnover below the block, which inhibits skeletal muscle ATP production. Immobility is associated with metabolic alterations in muscle leading to an increased dependence on glycogen use and a reduced capacity for fatty acid oxidation. Such changes may be detrimental for persons with GSD from a metabolic perspective. However, exercise may alter skeletal muscle substrate metabolism in ways that are beneficial for patients with GSD, such as improving exercise tolerance and increasing fatty acid oxidation. In addition, a regular exercise program has the potential to improve general health and fitness and improve quality of life, if executed properly. In this review, we describe skeletal muscle substrate use during exercise in GSDs, and how blocks in metabolic pathways affect exercise tolerance in GSDs. We review the studies that have examined the effect of regular exercise training in different types of GSD. Finally, we consider how oral substrate supplementation can improve exercise tolerance and we discuss the precautions that apply to persons with GSD that engage in exercise.

  19. Qualitative and Quantitative Analyses of Glycogen in Human Milk.

    Science.gov (United States)

    Matsui-Yatsuhashi, Hiroko; Furuyashiki, Takashi; Takata, Hiroki; Ishida, Miyuki; Takumi, Hiroko; Kakutani, Ryo; Kamasaka, Hiroshi; Nagao, Saeko; Hirose, Junko; Kuriki, Takashi

    2017-02-22

    Identification as well as a detailed analysis of glycogen in human milk has not been shown yet. The present study confirmed that glycogen is contained in human milk by qualitative and quantitative analyses. High-performance anion exchange chromatography (HPAEC) and high-performance size exclusion chromatography with a multiangle laser light scattering detector (HPSEC-MALLS) were used for qualitative analysis of glycogen in human milk. Quantitative analysis was carried out by using samples obtained from the individual milks. The result revealed that the concentration of human milk glycogen varied depending on the mother's condition-such as the period postpartum and inflammation. The amounts of glycogen in human milk collected at 0 and 1-2 months postpartum were higher than in milk collected at 3-14 months postpartum. In the milk from mothers with severe mastitis, the concentration of glycogen was about 40 times higher than that in normal milk.

  20. Characterization of the growth and degradation of glycogen in the liver

    International Nuclear Information System (INIS)

    Youn, J.; Bergman, R.

    1986-01-01

    The patterns of the growth and degradation of hepatic glycogen were studied using a computer model. The database was that of Devos and Hers on the distribution of label in glycogen from [1- 14 C] galactose injected at different times after the start of refeeding 40 h fasted mice. The data was simulated to examine the following hypotheses (H): Glycogen Synthesis H.S1: all glycogen molecules grow simultaneously. H.S2: at each moment of synthesis only a fixed number of molecules grow. H.S3: the number of growing molecules increases linearly with respect to time. H.S4: increase in the number of growing molecules is accelerated as glycogen is synthesized. Glycogen Degradation H.D1: glycogen molecules to be attacked by degrading enzymes are randomly chosen. H.D2: glycogen molecules are degraded sequentially in the reverse order of synthesis. H.D3: glycogen molecules have different probabilities of degradation depending upon the time of synthesis. The growth and degradation according to hypotheses S4 and D3, respectively, could best account for the data. The modelling study predicts that, at the beginning of refeeding, only a small number of molecules grow. But, as glycogen is synthesized, the rate of seeding of new glycogen molecules increases with time, causing a nonlinear proliferation of the number of growing molecules. During degradation glycogen molecules synthesized later have a greater chance to be degraded first, a characteristic which may be explained by the rosette structure of liver glycogen

  1. Glycogen with short average chain length enhances bacterial durability

    Science.gov (United States)

    Wang, Liang; Wise, Michael J.

    2011-09-01

    Glycogen is conventionally viewed as an energy reserve that can be rapidly mobilized for ATP production in higher organisms. However, several studies have noted that glycogen with short average chain length in some bacteria is degraded very slowly. In addition, slow utilization of glycogen is correlated with bacterial viability, that is, the slower the glycogen breakdown rate, the longer the bacterial survival time in the external environment under starvation conditions. We call that a durable energy storage mechanism (DESM). In this review, evidence from microbiology, biochemistry, and molecular biology will be assembled to support the hypothesis of glycogen as a durable energy storage compound. One method for testing the DESM hypothesis is proposed.

  2. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    Science.gov (United States)

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

  4. Glycogen synthesis from lactate in a chronically active muscle

    International Nuclear Information System (INIS)

    Talmadge, R.J.; Scheide, J.I.; Silverman, H.

    1989-01-01

    In response to neural overactivity (pseudomyotonia), gastrocnemius muscle fibers from C57Bl/6Jdy2J/dy2J mice have different metabolic profiles compared with normal mice. A population of fibers in the fast-twitch superficial region of the dy2J gastrocnemius stores unusually high amounts of glycogen, leading to an increased glycogen storage in the whole muscle. The dy2J muscle also contains twice as much lactate as normal muscle. A [ 14 C]lactate intraperitoneal injection leads to preferential 14 C incorporation into glycogen in the dy2J muscle compared with normal muscle. To determine whether skeletal muscles were incorporating lactate into glycogen without body organ (liver, kidney) input, gastrocnemius muscles were bathed in 10 mM [ 14 C]lactate with intact neural and arterial supply but with impeded venous return. The contralateral gastrocnemius serves as a control for body organ input. By using this in situ procedure, we demonstrate that under conditions of high lactate both normal and dy2J muscle can directly synthesize glycogen from lactate. In this case, normal whole muscle incorporates [14C] lactate into glycogen at a higher rate than dy2J whole muscle. Autoradiography, however, suggests that the high-glycogen-containing muscle fibers in the dy2J muscle incorporate lactate into glycogen at nearly four times the rate of normal or surrounding muscle fibers

  5. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

    2014-01-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  6. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  7. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  8. Molecular Structure of Human-Liver Glycogen.

    Directory of Open Access Journals (Sweden)

    Bin Deng

    Full Text Available Glycogen is a highly branched glucose polymer which is involved in maintaining blood-sugar homeostasis. Liver glycogen contains large composite α particles made up of linked β particles. Previous studies have shown that the binding which links β particles into α particles is impaired in diabetic mice. The present study reports the first molecular structural characterization of human-liver glycogen from non-diabetic patients, using transmission electron microscopy for morphology and size-exclusion chromatography for the molecular size distribution; the latter is also studied as a function of time during acid hydrolysis in vitro, which is sensitive to certain structural features, particularly glycosidic vs. proteinaceous linkages. The results are compared with those seen in mice and pigs. The molecular structural change during acid hydrolysis is similar in each case, and indicates that the linkage of β into α particles is not glycosidic. This result, and the similar morphology in each case, together imply that human liver glycogen has similar molecular structure to those of mice and pigs. This knowledge will be useful for future diabetes drug targets.

  9. Glycogen metabolism and the homeostatic regulation of sleep

    KAUST Repository

    Petit, Jean-Marie

    2014-11-16

    In 1995 Benington and Heller formulated an energy hypothesis of sleep centered on a key role of glycogen. It was postulated that a major function of sleep is to replenish glycogen stores in the brain that have been depleted during wakefulness which is associated to an increased energy demand. Astrocytic glycogen depletion participates to an increase of extracellular adenosine release which influences sleep homeostasis. Here, we will review some evidence obtained by studies addressing the question of a key role played by glycogen metabolism in sleep regulation as proposed by this hypothesis or by an alternative hypothesis named “glycogenetic” hypothesis as well as the importance of the confounding effect of glucocorticoïds. Even though actual collected data argue in favor of a role of sleep in brain energy balance-homeostasis, they do not support a critical and direct involvement of glycogen metabolism on sleep regulation. For instance, glycogen levels during the sleep-wake cycle are driven by different physiological signals and therefore appear more as a marker-integrator of brain energy status than a direct regulator of sleep homeostasis. In support of this we provide evidence that blockade of glycogen mobilization does not induce more sleep episodes during the active period while locomotor activity is reduced. These observations do not invalidate the energy hypothesis of sleep but indicate that underlying cellular mechanisms are more complex than postulated by Benington and Heller.

  10. Convergence of the Mammalian Target of Rapamycin Complex 1- and Glycogen Synthase Kinase 3-β–Signaling Pathways Regulates the Innate Inflammatory Response

    Science.gov (United States)

    Wang, Huizhi; Brown, Jonathan; Gu, Zhen; Garcia, Carlos A.; Liang, Ruqiang; Alard, Pascale; Beurel, Eléonore; Jope, Richard S.; Greenway, Terrance; Martin, Michael

    2011-01-01

    The PI3K pathway and its regulation of mammalian target of rapamycin complex 1 (mTORC1) and glycogen synthase kinase 3 (GSK3) play pivotal roles in controlling inflammation. In this article, we show that mTORC1 and GSK3-β converge and that the capacity of mTORC1 to affect the inflammatory response is due to the inactivation of GSK3-β. Inhibition of mTORC1 attenuated GSK3 phosphorylation and increased its kinase activity. Immunoprecipitation and in vitro kinase assays demonstrated that GSK3-β associated with a downstream target of mTORC1, p85S6K, and phosphorylated GSK3-β. Inhibition of S6K1 abrogated the phosphorylation of GSK3-β while increasing and decreasing the levels of IL-12 and IL-10, respectively, in LPS-stimulated monocytes. In contrast, the direct inhibition of GSK3 attenuated the capacity of S6K1 inhibition to influence the levels of IL-10 and IL-12 produced by LPS-stimulated cells. At the transcriptional level, mTORC1 inhibition reduced the DNA binding of CREB and this effect was reversed by GSK3 inhibition. As a result, mTORC1 inhibition increased the levels of NF-κB p65 associated with CREB-binding protein. Inhibition of NF-κB p65 attenuated rapamycin’s ability to influence the levels of pro- or anti-inflammatory cytokine production in monocytes stimulated with LPS. These studies identify the molecular mechanism by which mTORC1 affects GSK3 and show that mTORC1 inhibition regulates pro- and anti-inflammatory cytokine production via its capacity to inactivate GSK3. PMID:21422248

  11. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Science.gov (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  12. Neurons have an active glycogen metabolism that contributes to tolerance to hypoxia.

    Science.gov (United States)

    Saez, Isabel; Duran, Jordi; Sinadinos, Christopher; Beltran, Antoni; Yanes, Oscar; Tevy, María F; Martínez-Pons, Carlos; Milán, Marco; Guinovart, Joan J

    2014-06-01

    Glycogen is present in the brain, where it has been found mainly in glial cells but not in neurons. Therefore, all physiologic roles of brain glycogen have been attributed exclusively to astrocytic glycogen. Working with primary cultured neurons, as well as with genetically modified mice and flies, here we report that-against general belief-neurons contain a low but measurable amount of glycogen. Moreover, we also show that these cells express the brain isoform of glycogen phosphorylase, allowing glycogen to be fully metabolized. Most importantly, we show an active neuronal glycogen metabolism that protects cultured neurons from hypoxia-induced death and flies from hypoxia-induced stupor. Our findings change the current view of the role of glycogen in the brain and reveal that endogenous neuronal glycogen metabolism participates in the neuronal tolerance to hypoxic stress.

  13. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  14. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

    Science.gov (United States)

    Ghosh, Subhabrata; Mandi, Swati Sen

    2015-07-25

    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Can glycogen be measured by in vivo neutron activation analysis?

    International Nuclear Information System (INIS)

    Sutcliffe, J.F.; Smith, A.H.; King, R.F.G.H.; Smith, M.A.

    1992-01-01

    The object of this note is to examine the feasibility of measuring liver glycogen using in vivo neutron activation analysis. The authors present equations which allow the mass of glycogen to be expressed in terms of the masses of oxygen, hydrogen, carbon and nitrogen. Using the most precise, published measurements of these elements, the standard deviation in the estimate of liver glycogen was 34 g. The magnitude of this error precluded observing changes in liver glycogen which are normally in the range 16 g to 72 g. However, this technique might be useful in detecting transient high concentrations of liver glycogen.(UK)

  16. Neurons have an active glycogen metabolism that contributes to tolerance to hypoxia

    Science.gov (United States)

    Saez, Isabel; Duran, Jordi; Sinadinos, Christopher; Beltran, Antoni; Yanes, Oscar; Tevy, María F; Martínez-Pons, Carlos; Milán, Marco; Guinovart, Joan J

    2014-01-01

    Glycogen is present in the brain, where it has been found mainly in glial cells but not in neurons. Therefore, all physiologic roles of brain glycogen have been attributed exclusively to astrocytic glycogen. Working with primary cultured neurons, as well as with genetically modified mice and flies, here we report that—against general belief—neurons contain a low but measurable amount of glycogen. Moreover, we also show that these cells express the brain isoform of glycogen phosphorylase, allowing glycogen to be fully metabolized. Most importantly, we show an active neuronal glycogen metabolism that protects cultured neurons from hypoxia-induced death and flies from hypoxia-induced stupor. Our findings change the current view of the role of glycogen in the brain and reveal that endogenous neuronal glycogen metabolism participates in the neuronal tolerance to hypoxic stress. PMID:24569689

  17. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  18. Glycogen distribution in the microwave-fixed mouse brain reveals heterogeneous astrocytic patterns.

    Science.gov (United States)

    Oe, Yuki; Baba, Otto; Ashida, Hitoshi; Nakamura, Kouichi C; Hirase, Hajime

    2016-09-01

    In the brain, glycogen metabolism has been implied in synaptic plasticity and learning, yet the distribution of this molecule has not been fully described. We investigated cerebral glycogen of the mouse by immunohistochemistry (IHC) using two monoclonal antibodies that have different affinities depending on the glycogen size. The use of focused microwave irradiation yielded well-defined glycogen immunoreactive signals compared with the conventional periodic acid-Schiff method. The IHC signals displayed a punctate distribution localized predominantly in astrocytic processes. Glycogen immunoreactivity (IR) was high in the hippocampus, striatum, cortex, and cerebellar molecular layer, whereas it was low in the white matter and most of the subcortical structures. Additionally, glycogen distribution in the hippocampal CA3-CA1 and striatum had a 'patchy' appearance with glycogen-rich and glycogen-poor astrocytes appearing in alternation. The glycogen patches were more evident with large-molecule glycogen in young adult mice but they were hardly observable in aged mice (1-2 years old). Our results reveal brain region-dependent glycogen accumulation and possibly metabolic heterogeneity of astrocytes. GLIA 2016;64:1532-1545. © 2016 The Authors. Glia Published by Wiley Periodicals, Inc.

  19. Preactivated thiolated glycogen as mucoadhesive polymer for drug delivery.

    Science.gov (United States)

    Perrone, Mara; Lopalco, Antonio; Lopedota, Angela; Cutrignelli, Annalisa; Laquintana, Valentino; Douglas, Justin; Franco, Massimo; Liberati, Elisa; Russo, Vincenzo; Tongiani, Serena; Denora, Nunzio; Bernkop-Schnürch, Andreas

    2017-10-01

    The purpose of this study was to synthesize and characterize a novel thiolated glycogen, so-named S-preactivated thiolated glycogen, as a mucosal drug delivery systems and the assessment of its mucoadhesive properties. In this regard, glycogen-cysteine and glycogen-cysteine-2-mercaptonicotinic acid conjugates were synthesized. Glycogen was activated by an oxidative ring opening with sodium periodate resulting in reactive aldehyde groups to which cysteine was bound via reductive amination. The obtained thiolated polymer displayed 2203.09±200μmol thiol groups per gram polymer. In a second step, the thiol moieties of thiolated glycogen were protected by disulfide bond formation with the thiolated aromatic residue 2-mercaptonicotinic acid (2MNA). In vitro screening of mucoadhesive properties was performed on porcine intestinal mucosa using different methods. In particular, in terms of rheology investigations of mucus/polymer mixtures, the S-preactivated thiolated glycogen showed a 4.7-fold increase in dynamic viscosity over a time period of 5h, in comparison to mucus/Simulated Intestinal Fluid control. The S-preactivated polymer remained attached on freshly excised porcine mucosa for 45h. Analogous results were obtained with tensile studies demonstrating a 2.7-fold increase in maximum detachment force and 3.1- fold increase in total work of adhesion for the S-preactivated polymer compared to unmodified glycogen. Moreover, water-uptake studies showed an over 4h continuing weight gain for the S-preactivated polymer, whereas disintegration took place for the unmodified polymer within the first hour. Furthermore, even in the highest tested concentration of 2mg/ml the new conjugates did not show any cytotoxicity on Caco-2 cell monolayer using an MTT assay. According to these results, S-preactivated glycogen represents a promising type of mucoadhesive polymers useful for the development of various mucosal drug delivery systems. Copyright © 2017 Elsevier B.V. All rights

  20. Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Lin-Hui Gao

    2018-01-01

    Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

  1. Glycogen metabolism in radiation induced hepatocellular carcinoma in Swiss albino mice

    International Nuclear Information System (INIS)

    Gupta, N.K.; Kumar, Ashok

    1988-01-01

    Glycogen content and the activities of phosphorylase, glycogen sythetase (GS), glucose 6-phosphatase (G6Pase), phosphohexose isomerase (PHI), glucose 6-phosphodehydrogenase were biochemically determined in the heparocellular carcinoma induced in swiss albino mice following radiocalcium internal irradiation. The content glycogen and the activities of phosphorylase, glycogen synthetase, G6Pase, PHI, GPT and GOT are considerably reduced in the hepatocellular carcinoma compared to that in control liver. However, the activity of G6PDH shows an increased activity. Results indicate that the decreas ed glycogen content in the hepatocellular carcinoma is due to the reduced glycogen synthetase activity and utilization of glucose by HMP pathway. (author). 2 tabs., 24 refs

  2. Gene expression profiles reveal key pathways and genes associated with neuropathic pain in patients with spinal cord injury.

    Science.gov (United States)

    He, Xijing; Fan, Liying; Wu, Zhongheng; He, Jiaxuan; Cheng, Bin

    2017-04-01

    Previous gene expression profiling studies of neuropathic pain (NP) following spinal cord injury (SCI) have predominantly been performed in animal models. The present study aimed to investigate gene alterations in patients with spinal cord injury and to further examine the mechanisms underlying NP following SCI. The GSE69901 gene expression profile was downloaded from the public Gene Expression Omnibus database. Samples of peripheral blood mononuclear cells (PBMCs) derived from 12 patients with intractable NP and 13 control patients without pain were analyzed to identify the differentially expressed genes (DEGs), followed by functional enrichment analysis and protein‑protein interaction (PPI) network construction. In addition, a transcriptional regulation network was constructed and functional gene clustering was performed. A total of 70 upregulated and 61 downregulated DEGs were identified in the PBMC samples from patients with NP. The upregulated and downregulated genes were significantly involved in different Gene Ontology terms and pathways, including focal adhesion, T cell receptor signaling pathway and mitochondrial function. Glycogen synthase kinase 3 β (GSK3B) was identified as a hub protein in the PPI network. In addition, ornithine decarboxylase 1 (ODC1) and ornithine aminotransferase (OAT) were regulated by additional transcription factors in the regulation network. GSK3B, OAT and ODC1 were significantly enriched in two functional gene clusters, the function of mitochondrial membrane and DNA binding. Focal adhesion and the T cell receptor signaling pathway may be significantly linked with NP, and GSK3B, OAT and ODC1 may be potential targets for the treatment of NP.

  3. Regulatory role of tumor necrosis factor receptor-associated factor 6 in breast cancer by activating the protein kinase B/glycogen synthase kinase 3β signaling pathway.

    Science.gov (United States)

    Shen, Hongyu; Li, Liangpeng; Yang, Sujin; Wang, Dandan; Zhou, Siying; Chen, Xiu; Tang, Jinhai

    2017-08-01

    Tumor necrosis factor receptor-associated factor 6 (TRAF6) is an endogenous adaptor of innate and adaptive immune responses, and serves a crucial role in tumor necrosis factor receptor and toll‑like/interleukin‑1 receptor signaling. Although studies have demonstrated that TRAF6 has oncogenic activity, its potential contributions to breast cancer in human remains largely uninvestigated. The present study examined the expression levels and function of TRAF6 in breast carcinoma (n=32) and adjacent healthy (n=25) tissue samples. Compared with adjacent healthy tissues, TRAF6 protein expression levels were significantly upregulated in breast cancer tissues. Reverse transcription‑quantitative polymerase chain reaction analysis revealed a significant upregulation of the cellular proliferative marker Ki‑67 and proliferation cell nuclear antigen expression levels in breast carcinoma specimens. Furthermore, protein expression levels of the accessory molecule, transforming growth factor β‑activated kinase 1 (TAK1), were significantly increased in breast cancer patients, as detected by western blot analysis. As determined by MTT assay, TRAF6 exerted profoundly proliferative effects in the MCF‑7 breast cancer cell line; however, these detrimental effects were ameliorated by TAK1 inhibition. Notably, protein kinase B (AKT)/glycogen synthase kinase (GSK)3β phosphorylation levels were markedly upregulated in breast cancer samples, compared with adjacent healthy tissues. In conclusion, an altered TRAF6‑TAK1 axis and its corresponding downstream AKT/GSK3β signaling molecules may contribute to breast cancer progression. Therefore, TRAF6 may represent a potential therapeutic target for the treatment of breast cancer.

  4. Determining mutations in G6PC and SLC37A4 genes in a sample of Brazilian patients with glycogen storage disease types Ia and Ib

    Directory of Open Access Journals (Sweden)

    Marcelo Paschoalete Carlin

    2013-01-01

    Full Text Available Glycogen storage disease (GSD comprises a group of autosomal recessive disorders characterized by deficiency of the enzymes that regulate the synthesis or degradation of glycogen. Types Ia and Ib are the most prevalent; while the former is caused by deficiency of glucose-6-phosphatase (G6Pase, the latter is associated with impaired glucose-6-phosphate transporter, where the catalytic unit of G6Pase is located. Over 85 mutations have been reported since the cloning of G6PC and SLC37A4 genes. In this study, twelve unrelated patients with clinical symptoms suggestive of GSDIa and Ib were investigated by using genetic sequencing of G6PC and SLC37A4 genes, being three confirmed as having GSD Ia, and two with GSD Ib. In seven of these patients no mutations were detected in any of the genes. Five changes were detected in G6PC, including three known point mutations (p.G68R, p.R83C and p.Q347X and two neutral mutations (c.432G > A and c.1176T > C. Four changes were found in SLC37A4: a known point mutation (p.G149E, a novel frameshift insertion (c.1338_1339insT, and two neutral mutations (c.1287G > A and c.1076-28C > T. The frequency of mutations in our population was similar to that observed in the literature, in which the mutation p.R83C is also the most frequent one. Analysis of both genes should be considered in the investigation of this condition. An alternative explanation to the negative results in this molecular study is the possibility of a misdiagnosis. Even with a careful evaluation based on laboratory and clinical findings, overlap with other types of GSD is possible, and further molecular studies should be indicated.

  5. Engineering Limonene and Bisabolene Production in Wild Type and a Glycogen-Deficient Mutant of Synechococcus sp. PCC 7002

    Energy Technology Data Exchange (ETDEWEB)

    Davies, Fiona K., E-mail: fdavies@mines.edu [Department of Chemistry and Geochemistry, Colorado School of Mines, Golden, CO (United States); Work, Victoria H. [Civil and Environmental Engineering Division, Colorado School of Mines, Golden, CO (United States); Beliaev, Alexander S. [Biological Sciences Division, Pacific Northwest National Laboratory, Richland, WA (United States); Posewitz, Matthew C. [Department of Chemistry and Geochemistry, Colorado School of Mines, Golden, CO (United States)

    2014-06-19

    The plant terpenoids limonene (C{sub 10}H{sub 16}) and α-bisabolene (C{sub 15}H{sub 24}) are hydrocarbon precursors to a range of industrially relevant chemicals. High-titer microbial synthesis of limonene and α-bisabolene could pave the way for advances in in vivo engineering of tailor-made hydrocarbons, and production at commercial scale. We have engineered the fast-growing unicellular euryhaline cyanobacterium Synechococcus sp. PCC 7002 to produce yields of 4 mg L{sup −1} limonene and 0.6 mg L{sup −1} α-bisabolene through heterologous expression of the Mentha spicatal-limonene synthase or the Abies grandis (E)-α-bisabolene synthase genes, respectively. Titers were significantly higher when a dodecane overlay was applied during culturing, suggesting either that dodecane traps large quantities of volatile limonene or α-bisabolene that would otherwise be lost to evaporation, and/or that continuous product removal in dodecane alleviates product feedback inhibition to promote higher rates of synthesis. We also investigate limonene and bisabolene production in the ΔglgC genetic background, where carbon partitioning is redirected at the expense of glycogen biosynthesis. The Synechococcus sp. PCC 7002 ΔglgC mutant excreted a suite of overflow metabolites (α-ketoisocaproate, pyruvate, α-ketoglutarate, succinate, and acetate) during nitrogen-deprivation, and also at the onset of stationary growth in nutrient-replete media. None of the excreted metabolites, however, appeared to be effectively utilized for terpenoid metabolism. Interestingly, we observed a 1.6- to 2.5-fold increase in the extracellular concentration of most excreted organic acids when the ΔglgC mutant was conferred with the ability to produce limonene. Overall, Synechococcus sp. PCC 7002 provides a highly promising platform for terpenoid biosynthetic and metabolic engineering efforts.

  6. Engineering limonene and bisabolene production in wild type and a glycogen-deficient mutant of Synechococcus sp. PCC 7002

    Energy Technology Data Exchange (ETDEWEB)

    Davies, Fiona K.; Work, Victoria H.; Beliaev, Alex S.; Posewitz, Matthew C.

    2014-06-19

    The plant terpenoids limonene (C10H16) and α-bisabolene (C15H24) are hydrocarbon precursors to a range of industrially-relevant chemicals. High-titer microbial synthesis of limonene and α- bisabolene could pave the way for advances in in vivo engineering of tailor-made hydrocarbons, and production at commercial scale. We have engineered the fast-growing unicellular euryhaline cyanobacterium Synechococcus sp. PCC 7002 to produce yields of 4 mg L-1 limonene and 0.6 mg L-1 α-bisabolene through heterologous expression of the Mentha spicata L-limonene synthase or the Abies grandis (E)-α-bisabolene synthase genes, respectively. Titers were significantly higher when a dodecane overlay was applied during culturing, suggesting either that dodecane traps large quantities of volatile limonene and α-bisabolene that would otherwise be lost to evaporation, and/or that continuous product removal in dodecane alleviates product feedback inhibition to promote higher rates of synthesis. We also investigate limonene and bisabolene production in the ΔglgC genetic background, where carbon partitioning is redirected at the expense of glycogen biosynthesis. The Synechococcus sp. PCC 7002 ΔglgC mutant excreted a suite of overflow metabolites (α-ketoisocaproate, pyruvate, α-ketoglutarate, succinate and acetate) during nitrogen deprivation, and also at the onset of stationary growth in nutrient-replete media. None of the excreted metabolites, however, appeared to be effectively utilized for terpenoid metabolism. Interestingly, we observed a 1.6 to 2.5-fold increase in the extracellular concentration of most excreted organic acids when the ΔglgC mutant was conferred with the ability to produce limonene. Overall, Synechococcus sp. PCC 7002 provides a highly promising platform for terpenoid biosynthetic and metabolic engineering efforts.

  7. Engineering Limonene and Bisabolene Production in Wild Type and a Glycogen-Deficient Mutant of Synechococcus sp. PCC 7002.

    Science.gov (United States)

    Davies, Fiona K; Work, Victoria H; Beliaev, Alexander S; Posewitz, Matthew C

    2014-01-01

    The plant terpenoids limonene (C10H16) and α-bisabolene (C15H24) are hydrocarbon precursors to a range of industrially relevant chemicals. High-titer microbial synthesis of limonene and α-bisabolene could pave the way for advances in in vivo engineering of tailor-made hydrocarbons, and production at commercial scale. We have engineered the fast-growing unicellular euryhaline cyanobacterium Synechococcus sp. PCC 7002 to produce yields of 4 mg L(-1) limonene and 0.6 mg L(-1) α-bisabolene through heterologous expression of the Mentha spicatal-limonene synthase or the Abies grandis (E)-α-bisabolene synthase genes, respectively. Titers were significantly higher when a dodecane overlay was applied during culturing, suggesting either that dodecane traps large quantities of volatile limonene or α-bisabolene that would otherwise be lost to evaporation, and/or that continuous product removal in dodecane alleviates product feedback inhibition to promote higher rates of synthesis. We also investigate limonene and bisabolene production in the ΔglgC genetic background, where carbon partitioning is redirected at the expense of glycogen biosynthesis. The Synechococcus sp. PCC 7002 ΔglgC mutant excreted a suite of overflow metabolites (α-ketoisocaproate, pyruvate, α-ketoglutarate, succinate, and acetate) during nitrogen-deprivation, and also at the onset of stationary growth in nutrient-replete media. None of the excreted metabolites, however, appeared to be effectively utilized for terpenoid metabolism. Interestingly, we observed a 1.6- to 2.5-fold increase in the extracellular concentration of most excreted organic acids when the ΔglgC mutant was conferred with the ability to produce limonene. Overall, Synechococcus sp. PCC 7002 provides a highly promising platform for terpenoid biosynthetic and metabolic engineering efforts.

  8. Engineering Limonene and Bisabolene Production in Wild Type and a Glycogen-Deficient Mutant of Synechococcus sp. PCC 7002

    International Nuclear Information System (INIS)

    Davies, Fiona K.; Work, Victoria H.; Beliaev, Alexander S.; Posewitz, Matthew C.

    2014-01-01

    The plant terpenoids limonene (C 10 H 16 ) and α-bisabolene (C 15 H 24 ) are hydrocarbon precursors to a range of industrially relevant chemicals. High-titer microbial synthesis of limonene and α-bisabolene could pave the way for advances in in vivo engineering of tailor-made hydrocarbons, and production at commercial scale. We have engineered the fast-growing unicellular euryhaline cyanobacterium Synechococcus sp. PCC 7002 to produce yields of 4 mg L −1 limonene and 0.6 mg L −1 α-bisabolene through heterologous expression of the Mentha spicatal-limonene synthase or the Abies grandis (E)-α-bisabolene synthase genes, respectively. Titers were significantly higher when a dodecane overlay was applied during culturing, suggesting either that dodecane traps large quantities of volatile limonene or α-bisabolene that would otherwise be lost to evaporation, and/or that continuous product removal in dodecane alleviates product feedback inhibition to promote higher rates of synthesis. We also investigate limonene and bisabolene production in the ΔglgC genetic background, where carbon partitioning is redirected at the expense of glycogen biosynthesis. The Synechococcus sp. PCC 7002 ΔglgC mutant excreted a suite of overflow metabolites (α-ketoisocaproate, pyruvate, α-ketoglutarate, succinate, and acetate) during nitrogen-deprivation, and also at the onset of stationary growth in nutrient-replete media. None of the excreted metabolites, however, appeared to be effectively utilized for terpenoid metabolism. Interestingly, we observed a 1.6- to 2.5-fold increase in the extracellular concentration of most excreted organic acids when the ΔglgC mutant was conferred with the ability to produce limonene. Overall, Synechococcus sp. PCC 7002 provides a highly promising platform for terpenoid biosynthetic and metabolic engineering efforts.

  9. Why does the brain (not) have glycogen?

    Science.gov (United States)

    DiNuzzo, Mauro; Maraviglia, Bruno; Giove, Federico

    2011-05-01

    In the present paper we formulate the hypothesis that brain glycogen is a critical determinant in the modulation of carbohydrate supply at the cellular level. Specifically, we propose that mobilization of astrocytic glycogen after an increase in AMP levels during enhanced neuronal activity controls the concentration of glucose phosphates in astrocytes. This would result in modulation of glucose phosphorylation by hexokinase and upstream cell glucose uptake. This mechanism would favor glucose channeling to activated neurons, supplementing the already rich neuron-astrocyte metabolic and functional partnership with important implications for the energy compounds used to sustain neuronal activity. The hypothesis is based on recent modeling evidence suggesting that rapid glycogen breakdown can profoundly alter the short-term kinetics of glucose delivery to neurons and astrocytes. It is also based on review of the literature relevant to glycogen metabolism during physiological brain activity, with an emphasis on the metabolic pathways identifying both the origin and the fate of this glucose reserve. Copyright © 2011 WILEY Periodicals, Inc.

  10. A new non-degradative method to purify glycogen.

    Science.gov (United States)

    Tan, Xinle; Sullivan, Mitchell A; Gao, Fei; Li, Shihan; Schulz, Benjamin L; Gilbert, Robert G

    2016-08-20

    Liver glycogen, a complex branched glucose polymer containing a small amount of protein, is important for maintaining glucose homeostasis (blood-sugar control) in humans. It has recently been found that glycogen molecular structure is impaired in diabetes. Isolating the carbohydrate polymer and any intrinsically-attached protein(s) is an essential prerequisite for studying this structural impairment. This requires an effective, non-degradative and efficient purification method to exclude the many other proteins present in liver. Proteins and glycogen have different ranges of molecular sizes. Despite the plethora of proteins that might still be present in significant abundance after other isolation techniques, SEC (size exclusion chromatography, also known as GPC), which separates by molecular size, should separate those extraneous to glycogen from glycogen with any intrinsically associated protein(s). A novel purification method is developed for this, based on preparative SEC following sucrose gradient centrifugation. Proteomics is used to show that the new method compares favourably with current methods in the literature. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  12. Molecular diagnosis of glycogen storage disease and disorders with overlapping clinical symptoms by massive parallel sequencing.

    Science.gov (United States)

    Vega, Ana I; Medrano, Celia; Navarrete, Rosa; Desviat, Lourdes R; Merinero, Begoña; Rodríguez-Pombo, Pilar; Vitoria, Isidro; Ugarte, Magdalena; Pérez-Cerdá, Celia; Pérez, Belen

    2016-10-01

    Glycogen storage disease (GSD) is an umbrella term for a group of genetic disorders that involve the abnormal metabolism of glycogen; to date, 23 types of GSD have been identified. The nonspecific clinical presentation of GSD and the lack of specific biomarkers mean that Sanger sequencing is now widely relied on for making a diagnosis. However, this gene-by-gene sequencing technique is both laborious and costly, which is a consequence of the number of genes to be sequenced and the large size of some genes. This work reports the use of massive parallel sequencing to diagnose patients at our laboratory in Spain using either a customized gene panel (targeted exome sequencing) or the Illumina Clinical-Exome TruSight One Gene Panel (clinical exome sequencing (CES)). Sequence variants were matched against biochemical and clinical hallmarks. Pathogenic mutations were detected in 23 patients. Twenty-two mutations were recognized (mostly loss-of-function mutations), including 11 that were novel in GSD-associated genes. In addition, CES detected five patients with mutations in ALDOB, LIPA, NKX2-5, CPT2, or ANO5. Although these genes are not involved in GSD, they are associated with overlapping phenotypic characteristics such as hepatic, muscular, and cardiac dysfunction. These results show that next-generation sequencing, in combination with the detection of biochemical and clinical hallmarks, provides an accurate, high-throughput means of making genetic diagnoses of GSD and related diseases.Genet Med 18 10, 1037-1043.

  13. Long-term safety and efficacy of AAV gene therapy in the canine model of glycogen storage disease type Ia.

    Science.gov (United States)

    Lee, Young Mok; Conlon, Thomas J; Specht, Andrew; Coleman, Kirsten E; Brown, Laurie M; Estrella, Ana M; Dambska, Monika; Dahlberg, Kathryn R; Weinstein, David A

    2018-05-25

    Viral mediated gene therapy has progressed after overcoming early failures, and gene therapy has now been approved for several conditions in Europe and the USA. Glycogen storage disease (GSD) type Ia, caused by a deficiency of glucose-6-phosphatase-α, has been viewed as an outstanding candidate for gene therapy. This follow-up report describes the long-term outcome for the naturally occurring GSD-Ia dogs treated with rAAV-GPE-hG6PC-mediated gene therapy. A total of seven dogs were treated with rAAV-GPE-hG6PC-mediated gene therapy. The first four dogs were treated at birth, and three dogs were treated between 2 and 6 months of age to assess the efficacy and safety in animals with mature livers. Blood and urine samples, radiographic studies, histological evaluation, and biodistribution were assessed. Gene therapy improved survival in the GSD-Ia dogs. With treatment, the biochemical studies normalized for the duration of the study (up to 7 years). None of the rAAV-GPE-hG6PC-treated dogs had focal hepatic lesions or renal abnormalities. Dogs treated at birth required a second dose of rAAV after 2-4 months; gene therapy after hepatic maturation resulted in improved efficacy after a single dose. rAAV-GPE-hG6PC treatment in GSD-Ia dogs was found to be safe and efficacious. GSD-Ia is an attractive target for human gene therapy since it is a monogenic disorder with limited tissue involvement. Blood glucose and lactate monitoring can be used to assess effectiveness and as a biomarker of success. GSD-Ia can also serve as a model for other hepatic monogenic disorders.

  14. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor signaling.

    Science.gov (United States)

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-09-01

    Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  16. Exercise in muscle glycogen storage diseases

    DEFF Research Database (Denmark)

    Preisler, Nicolai Rasmus; Haller, Ronald G; Vissing, John

    2015-01-01

    exercise program has the potential to improve general health and fitness and improve quality of life, if executed properly. In this review, we describe skeletal muscle substrate use during exercise in GSDs, and how blocks in metabolic pathways affect exercise tolerance in GSDs. We review the studies...... that have examined the effect of regular exercise training in different types of GSD. Finally, we consider how oral substrate supplementation can improve exercise tolerance and we discuss the precautions that apply to persons with GSD that engage in exercise.......Glycogen storage diseases (GSD) are inborn errors of glycogen or glucose metabolism. In the GSDs that affect muscle, the consequence of a block in skeletal muscle glycogen breakdown or glucose use, is an impairment of muscular performance and exercise intolerance, owing to 1) an increase...

  17. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline

    2011-01-01

    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  18. Technical and experimental features of Magnetic Resonance Spectroscopy of brain glycogen metabolism.

    Science.gov (United States)

    Soares, Ana Francisca; Gruetter, Rolf; Lei, Hongxia

    2017-07-15

    In the brain, glycogen is a source of glucose not only in emergency situations but also during normal brain activity. Altered brain glycogen metabolism is associated with energetic dysregulation in pathological conditions, such as diabetes or epilepsy. Both in humans and animals, brain glycogen levels have been assessed non-invasively by Carbon-13 Magnetic Resonance Spectroscopy ( 13 C-MRS) in vivo. With this approach, glycogen synthesis and degradation may be followed in real time, thereby providing valuable insights into brain glycogen dynamics. However, compared to the liver and muscle, where glycogen is abundant, the sensitivity for detection of brain glycogen by 13 C-MRS is inherently low. In this review we focus on strategies used to optimize the sensitivity for 13 C-MRS detection of glycogen. Namely, we explore several technical perspectives, such as magnetic field strength, field homogeneity, coil design, decoupling, and localization methods. Furthermore, we also address basic principles underlying the use of 13 C-labeled precursors to enhance the detectable glycogen signal, emphasizing specific experimental aspects relevant for obtaining kinetic information on brain glycogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  20. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    Science.gov (United States)

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  1. Local depletion of glycogen with supramaximal exercise in human skeletal muscle fibres.

    Science.gov (United States)

    Gejl, Kasper D; Ørtenblad, Niels; Andersson, Erik; Plomgaard, Peter; Holmberg, Hans-Christer; Nielsen, Joachim

    2017-05-01

    Glycogen is stored in local spatially distinct compartments within skeletal muscle fibres and is the main energy source during supramaximal exercise. Using quantitative electron microscopy, we show that supramaximal exercise induces a differential depletion of glycogen from these compartments and also demonstrate how this varies with fibre types. Repeated exercise alters this compartmentalized glycogen depletion. The results obtained in the present study help us understand the muscle metabolic dynamics of whole body repeated supramaximal exercise, and suggest that the muscle has a compartmentalized local adaptation to repeated exercise, which affects glycogen depletion. Skeletal muscle glycogen is heterogeneously distributed in three separated compartments (intramyofibrillar, intermyofibrillar and subsarcolemmal). Although only constituting 3-13% of the total glycogen volume, the availability of intramyofibrillar glycogen is of particular importance to muscle function. The present study aimed to investigate the depletion of these three subcellular glycogen compartments during repeated supramaximal exercise in elite athletes. Ten elite cross-country skiers (aged 25 ± 4 years, V̇O2 max : 65 ± 4 ml kg -1  min -1 ; mean ± SD) performed four ∼4 min supramaximal sprint time trials (STT 1-4) with 45 min of recovery. The subcellular glycogen volumes in musculus triceps brachii were quantified from electron microscopy images before and after both STT 1 and 4. During STT 1, the depletion of intramyofibrillar glycogen was higher in type 1 fibres [-52%; (-89:-15%)] than type 2 fibres [-15% (-52:22%)] (P = 0.02), whereas the depletion of intermyofibrillar glycogen [main effect: -19% (-33:0%), P = 0.006] and subsarcolemmal glycogen [main effect: -35% (-66:0%), P = 0.03] was similar between fibre types. By contrast, only intermyofibrillar glycogen volume was significantly reduced during STT 4, in both fibre types [main effect: -31% (-50:-11%), P = 0

  2. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  3. First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

    Directory of Open Access Journals (Sweden)

    Patrick C Y Woo

    Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

  4. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    International Nuclear Information System (INIS)

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

    2010-01-01

    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  5. Glycogen Synthase Kinase 3α Is the Main Isoform That Regulates the Transcription Factors Nuclear Factor-Kappa B and cAMP Response Element Binding in Bovine Endothelial Cells Infected with Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Octavio Silva-García

    2018-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutive enzyme implicated in the regulation of cytokine expression and the inflammatory response during bacterial infections. Mammals have two GSK3 isoforms named GSK3α and GSK3β that plays different but often overlapping functions. Although the role of GSK3β in cytokine regulation during the inflammatory response caused by bacteria is well described, GSK3α has not been found to participate in this process. Therefore, we tested if GSK3α may act as a regulatory isoform in the cytokine expression by bovine endothelial cells infected with Staphylococcus aureus because this bacterium is one of the major pathogens that cause tissue damage associated with inflammatory dysfunction. Interestingly, although both isoforms were phosphorylated–inactivated, we consistently observed a higher phosphorylation of GSK3α at Ser21 than that of GSK3β at Ser9 after bacterial challenge. During a temporal course of infection, we characterized a molecular switch from pro-inflammatory cytokine expression (IL-8, promoted by nuclear factor-kappa B (NF-κB, at an early stage (2 h to an anti-inflammatory cytokine expression (IL-10, promoted by cAMP response element binding (CREB, at a later stage (6 h. We observed an indirect effect of GSK3α activity on NF-κB activation that resulted in a low phosphorylation of CREB at Ser133, a decreased interaction between CREB and the co-activator CREB-binding protein (CBP, and a lower expression level of IL-10. Gene silencing of GSK3α and GSK3β with siRNA indicated that GSK3α knockout promoted the interaction between CREB and CBP that, in turn, increased the expression of IL-10, reduced the interaction of NF-κB with CBP, and reduced the expression of IL-8. These results indicate that GSK3α functions as the primary isoform that regulates the expression of IL-10 in endothelial cells infected with S. aureus.

  6. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Human skeletal muscle glycogen utilization in exhaustive exercise

    DEFF Research Database (Denmark)

    Nielsen, Joachim; Holmberg, Hans-Christer; Schrøder, Henrik Daa

    2011-01-01

    Although glycogen is known to be heterogeneously distributed within skeletal muscle cells, there is presently little information available about the role of fibre types, utilization and resynthesis during and after exercise with respect to glycogen localization. Here, we tested the hypothesis...... to be influenced by fibre type prior to exercise, as well as carbohydrate availability during the subsequent period of recovery. These findings provide insight into the significance of fibre type-specific compartmentalization of glycogen metabolism in skeletal muscle during exercise and subsequent recovery. ....... that utilization of glycogen with different subcellular localizations during exhaustive arm and leg exercise differs and examined the influence of fibre type and carbohydrate availability on its subsequent resynthesis. When 10 elite endurance athletes (22 ± 1 years, VO2 max = 68 ± 5 ml kg-1 min-1, mean ± SD...

  8. Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

    Science.gov (United States)

    Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

    2015-01-01

    Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

  9. Inadequate Brain Glycogen or Sleep Increases Spreading Depression Susceptibility

    KAUST Repository

    Kilic, Kivilcim; Karatas, Hulya; Donmez-Demir, Buket; Eren-Kocak, Emine; Gursoy-Ozdemir, Yasemin; Can, Alp; Petit, Jean-Marie; Magistretti, Pierre J.; Dalkara, Turgay

    2017-01-01

    Glycogen in astrocyte endfeet contributes to maintenance of low extracellular glutamate and K+ concentrations around synapses. Sleep deprivation (SD), a common migraine trigger induces transcriptional changes in astrocytes reducing glycogen breakdown. We hypothesize that when glycogen utilization cannot match synaptic energy demand, extracellular K+ can rise to levels that activate neuronal pannexin-1 channels and downstream inflammatory pathway, which might be one of the mechanisms initiating migraine headaches.We suppressed glycogen breakdown by inhibiting glycogen phosphorylation with 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and by SD.DAB caused neuronal pannexin-1 large-pore opening and activation of the downstream inflammatory pathway as shown by procaspase-1 cleavage and HMGB1 release from neurons. Six-hour SD induced pannexin-1 mRNA. DAB and SD also lowered the cortical spreading depression (CSD) induction threshold, which was reversed by glucose or lactate supplement, suggesting that glycogen-derived energy substrates are needed to prevent CSD generation. Supporting this, knocking-down neuronal lactate transporter, MCT2 with an anti-sense oligonucleotide or inhibiting glucose transport from vessels to astrocytes with intracerebroventricularly given phloretin reduced the CSD threshold. In vivo recordings with a K+ -sensitive/selective fluoroprobe, APG-4 disclosed that DAB treatment or SD caused significant rise in extracellular K+ during whisker-stimulation, illustrating the critical role of glycogen in extracellular K+ clearance.Synaptic metabolic stress caused by insufficient glycogen-derived energy substrate supply can activate neuronal pannexin-1 channels as well as lowering the CSD threshold. Therefore, conditions that limit energy supply to synapse (e.g. SD) may predispose to migraine attacks as suggested by genetic studies associating glucose or lactate transporter deficiency with migraine. This article is protected by copyright. All rights reserved.

  10. Inadequate Brain Glycogen or Sleep Increases Spreading Depression Susceptibility

    KAUST Repository

    Kilic, Kivilcim

    2017-12-16

    Glycogen in astrocyte endfeet contributes to maintenance of low extracellular glutamate and K+ concentrations around synapses. Sleep deprivation (SD), a common migraine trigger induces transcriptional changes in astrocytes reducing glycogen breakdown. We hypothesize that when glycogen utilization cannot match synaptic energy demand, extracellular K+ can rise to levels that activate neuronal pannexin-1 channels and downstream inflammatory pathway, which might be one of the mechanisms initiating migraine headaches.We suppressed glycogen breakdown by inhibiting glycogen phosphorylation with 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and by SD.DAB caused neuronal pannexin-1 large-pore opening and activation of the downstream inflammatory pathway as shown by procaspase-1 cleavage and HMGB1 release from neurons. Six-hour SD induced pannexin-1 mRNA. DAB and SD also lowered the cortical spreading depression (CSD) induction threshold, which was reversed by glucose or lactate supplement, suggesting that glycogen-derived energy substrates are needed to prevent CSD generation. Supporting this, knocking-down neuronal lactate transporter, MCT2 with an anti-sense oligonucleotide or inhibiting glucose transport from vessels to astrocytes with intracerebroventricularly given phloretin reduced the CSD threshold. In vivo recordings with a K+ -sensitive/selective fluoroprobe, APG-4 disclosed that DAB treatment or SD caused significant rise in extracellular K+ during whisker-stimulation, illustrating the critical role of glycogen in extracellular K+ clearance.Synaptic metabolic stress caused by insufficient glycogen-derived energy substrate supply can activate neuronal pannexin-1 channels as well as lowering the CSD threshold. Therefore, conditions that limit energy supply to synapse (e.g. SD) may predispose to migraine attacks as suggested by genetic studies associating glucose or lactate transporter deficiency with migraine. This article is protected by copyright. All rights reserved.

  11. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  12. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  13. Functional Characterization of Sesquiterpene Synthase from Polygonum minus

    Directory of Open Access Journals (Sweden)

    Su-Fang Ee

    2014-01-01

    Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

  14. The glucose-galactose paradox in neonatal murine hepatic glycogen synthesis

    International Nuclear Information System (INIS)

    Kunst, C.; Kliegman, R.; Trindade, C.

    1989-01-01

    In adults glucose incorporation to glycogen is indirect after recycling from lactate. In neonates galactose entry to glycogen exceeds that for glucose, but the pathway is unknown. The pathway of hexose incorporation to glycogen was studied in 5-7-day-old rats and 6-h-old rats injected intraperitoneally (IP) with either double-labeled [6-3H]glucose (nonrecycling), [U-14C]glucose (recycling), or [6-3H]glucose and [U-14C]galactose in saline. In another group of pups, 1 g/kg of glucose or galactose was administered in addition to tracers to determine glycemia and net glycogen synthesis between 15 and 180 min after injection. Blood glucose increased from 3.4 +/- 0.4 to 8.5 +/- 1.5 mM in 5-7-day-old pups in response to IP glucose; there was no glycemic response to galactose, although galactose levels increased from 0.5 to 6.3 mM at 15 min. Hepatic glycogen increased after IP glucose from 14 +/- 2 at 15 min to 30 +/- 3 at 120 min (P less than 0.01), whereas after IP galactose glycogen was 44 +/- 6 mumol/g at 120 min (P less than 0.05). After IP glucose, 3H and 14C disintegration per minute in glycogen increased slowly with 14C exceeding 3H at 120 and 180 min. In contrast IP [14C]galactose resulted in a much greater peak of 14C incorporation into glycogen. The ratio of 3H to 14C in glycogen relative to the injectate after IP glucose decreased from 0.69 +/- 0.12 to 0.36 +/- 0.03 (P less than 0.01) between 15 to 180 min, whereas the ratio after galactose was 0.20 +/- 0.007 to 0.15 +/- 0.02 at these times. The 6-h-old pups also demonstrated augmented incorporation of [14C]galactose in glycogen relative to [3H-14C]glucose. In contrast to 5-7-day-old pups there was no evidence of glucose recycling in 6-h-old pups. In conclusion galactose entry into glycogen exceeds that for glucose and is not dependent on recycling

  15. Sodium valproate increases the brain isoform of glycogen phosphorylase: looking for a compensation mechanism in McArdle disease using a mouse primary skeletal-muscle culture in vitro

    Directory of Open Access Journals (Sweden)

    Noemí de Luna

    2015-05-01

    Full Text Available McArdle disease, also termed ‘glycogen storage disease type V’, is a disorder of skeletal muscle carbohydrate metabolism caused by inherited deficiency of the muscle-specific isoform of glycogen phosphorylase (GP-MM. It is an autosomic recessive disorder that is caused by mutations in the PYGM gene and typically presents with exercise intolerance, i.e. episodes of early exertional fatigue frequently accompanied by rhabdomyolysis and myoglobinuria. Muscle biopsies from affected individuals contain subsarcolemmal deposits of glycogen. Besides GP-MM, two other GP isoforms have been described: the liver (GP-LL and brain (GP-BB isoforms, which are encoded by the PYGL and PYGB genes, respectively; GP-BB is the main GP isoform found in human and rat foetal tissues, including the muscle, although its postnatal expression is dramatically reduced in the vast majority of differentiated tissues with the exception of brain and heart, where it remains as the major isoform. We developed a cell culture model from knock-in McArdle mice that mimics the glycogen accumulation and GP-MM deficiency observed in skeletal muscle from individuals with McArdle disease. We treated mouse primary skeletal muscle cultures in vitro with sodium valproate (VPA, a histone deacetylase inhibitor. After VPA treatment, myotubes expressed GP-BB and a dose-dependent decrease in glycogen accumulation was also observed. Thus, this in vitro model could be useful for high-throughput screening of new drugs to treat this disease. The immortalization of these primary skeletal muscle cultures could provide a never-ending source of cells for this experimental model. Furthermore, VPA could be considered as a gene-expression modulator, allowing compensatory expression of GP-BB and decreased glycogen accumulation in skeletal muscle of individuals with McArdle disease.

  16. High glycogen levels in the hippocampus of patients with epilepsy

    DEFF Research Database (Denmark)

    Dalsgaard, Mads K; Madsen, Flemming F; Secher, Niels H

    2006-01-01

    During intense cerebral activation approximately half of the glucose plus lactate taken up by the human brain is not oxidized and could replenish glycogen deposits, but the human brain glycogen concentration is unknown. In patients with temporal lobe epilepsy, undergoing curative surgery, brain......, glycogen was similarly higher than in grey and white matter. Consequently, in human grey and white matter and, particularly, in the hippocampus of patients with temporal lope epilepsy, glycogen constitutes a large, active energy reserve, which may be of importance for energy provision during sustained...

  17. Glycogen in the Nervous System. I; Methods for Light and Electron Microscopy

    Science.gov (United States)

    Estable, Rosita F. De; Estable-Puig, J. F.; Miquel, J.

    1964-01-01

    'l'he relative value of different methods for combined light and electron microscopical studies of glycogen in the nervous tissue was investigated. Picroalcoholic fixatives preserve glycogen in a considerable amount but give an inadequate morphological image of glycogen distribution and are unsuitable for ultrastructural studies. Fixation by perfusion, with Dalton's chromeosmic fluid seems adequate for ultrastructural cytochemistry of glycogen. Furthermore it permits routine paraffin embedding of brain slices adjacent to those used for electron microscopy. Dimedone blocking is a necessary step for a selective staining of glycogen with PAS after osmic fixation. Enzymatic removal of glycogen in osmic fixed nervous tissue can be done In paraffin-embedded tissue. It can also be performed in glycolmethacrylate-embedded tissue without removal of the embedding medium. Paraphenylenediamine stains glycogen following periodic acid oxidation.

  18. The effect of glycogen phosphorolysis on basal glutaminergic transmission.

    Science.gov (United States)

    Mozrzymas, Jerzy; Szczęsny, Tomasz; Rakus, Darek

    2011-01-14

    Astrocytic glycogen metabolism sustains neuronal activity but its impact on basal glutamatergic synaptic transmission is not clear. To address this issue, we have compared the effect of glycogen breakdown inhibition on miniature excitatory postsynaptic currents (mEPSCs) in rat hippocampal pure neuronal culture (PNC) and in astrocyte-neuronal co-cultures (ANCC). Amplitudes of mEPSC in ANCC were nearly twice as large as in PNC with no difference in current kinetics. Inhibition of glycogen phosphorylase reduced mEPSC amplitude by roughly 40% in ANCC being ineffective in PNC. Altogether, these data indicate that astrocyte-neuronal interaction enhances basal mEPSCs in ANCC mainly due to astrocytic glycogen metabolism. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. Glycogen distribution in the microwave‐fixed mouse brain reveals heterogeneous astrocytic patterns

    Science.gov (United States)

    Baba, Otto; Ashida, Hitoshi; Nakamura, Kouichi C.

    2016-01-01

    In the brain, glycogen metabolism has been implied in synaptic plasticity and learning, yet the distribution of this molecule has not been fully described. We investigated cerebral glycogen of the mouse by immunohistochemistry (IHC) using two monoclonal antibodies that have different affinities depending on the glycogen size. The use of focused microwave irradiation yielded well‐defined glycogen immunoreactive signals compared with the conventional periodic acid‐Schiff method. The IHC signals displayed a punctate distribution localized predominantly in astrocytic processes. Glycogen immunoreactivity (IR) was high in the hippocampus, striatum, cortex, and cerebellar molecular layer, whereas it was low in the white matter and most of the subcortical structures. Additionally, glycogen distribution in the hippocampal CA3‐CA1 and striatum had a ‘patchy’ appearance with glycogen‐rich and glycogen‐poor astrocytes appearing in alternation. The glycogen patches were more evident with large‐molecule glycogen in young adult mice but they were hardly observable in aged mice (1–2 years old). Our results reveal brain region‐dependent glycogen accumulation and possibly metabolic heterogeneity of astrocytes. GLIA 2016;64:1532–1545 PMID:27353480

  20. Cloning and expression of pineapple sucrose- phosphate synthase ...

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.