WorldWideScience

Sample records for glycogen operon effect

  1. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  2. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  3. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  4. Regulation of glycogen synthesis in rat skeletal muscle after glycogen-depleting contractile activity: effects of adrenaline on glycogen synthesis and activation of glycogen synthase and glycogen phosphorylase.

    OpenAIRE

    Franch, J; Aslesen, R; Jensen, J

    1999-01-01

    We investigated the effects of insulin and adrenaline on the rate of glycogen synthesis in skeletal muscles after electrical stimulation in vitro. The contractile activity decreased the glycogen concentration by 62%. After contractile activity, the glycogen stores were fully replenished at a constant and high rate for 3 h when 10 m-i.u./ml insulin was present. In the absence of insulin, only 65% of the initial glycogen stores was replenished. Adrenaline decreased insulin-stimulated glycogen s...

  5. No effect of glycogen level on glycogen metabolism during high intensity exercise

    DEFF Research Database (Denmark)

    Vandenberghe, Katleen; Hespel, P.; Eynde, Bart Vanden

    1995-01-01

    , either for 1 min 45 s (protocol 1; N = 18) or to exhaustion (protocol 2; N = 14). The exercise tests were preceded by either 5 d on a controlled normal (N) diet, or by 2 d of glycogen-depleting exercise accompanied by the normal diet followed by 3 d on a carbohydrate-rich (CHR) diet. In protocol 1......This study examined the effect of glycogen supercompensation on glycogen breakdown, muscle and blood lactate accumulation, blood-pH, and performance during short-term high-intensity exercise. Young healthy volunteers performed two supramaximal (125% of VO2max) exercise tests on a bicycle ergometer...

  6. The effect of glycogen phosphorolysis on basal glutaminergic transmission.

    Science.gov (United States)

    Mozrzymas, Jerzy; Szczęsny, Tomasz; Rakus, Darek

    2011-01-14

    Astrocytic glycogen metabolism sustains neuronal activity but its impact on basal glutamatergic synaptic transmission is not clear. To address this issue, we have compared the effect of glycogen breakdown inhibition on miniature excitatory postsynaptic currents (mEPSCs) in rat hippocampal pure neuronal culture (PNC) and in astrocyte-neuronal co-cultures (ANCC). Amplitudes of mEPSC in ANCC were nearly twice as large as in PNC with no difference in current kinetics. Inhibition of glycogen phosphorylase reduced mEPSC amplitude by roughly 40% in ANCC being ineffective in PNC. Altogether, these data indicate that astrocyte-neuronal interaction enhances basal mEPSCs in ANCC mainly due to astrocytic glycogen metabolism. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  8. Effect of glycogen synthase overexpression on insulin-stimulated muscle glucose uptake and storage.

    Science.gov (United States)

    Fogt, Donovan L; Pan, Shujia; Lee, Sukho; Ding, Zhenping; Scrimgeour, Angus; Lawrence, John C; Ivy, John L

    2004-03-01

    Insulin-stimulated muscle glucose uptake is inversely associated with the muscle glycogen concentration. To investigate whether this association is a cause and effect relationship, we compared insulin-stimulated muscle glucose uptake in noncontracted and postcontracted muscle of GSL3-transgenic and wild-type mice. GSL3-transgenic mice overexpress a constitutively active form of glycogen synthase, which results in an abundant storage of muscle glycogen. Muscle contraction was elicited by in situ electrical stimulation of the sciatic nerve. Right gastrocnemii from GSL3-transgenic and wild-type mice were subjected to 30 min of electrical stimulation followed by hindlimb perfusion of both hindlimbs. Thirty minutes of contraction significantly reduced muscle glycogen concentration in wild-type (49%) and transgenic (27%) mice, although transgenic mice retained 168.8 +/- 20.5 micromol/g glycogen compared with 17.7 +/- 2.6 micromol/g glycogen for wild-type mice. Muscle of transgenic and wild-type mice demonstrated similar pre- (3.6 +/- 0.3 and 3.9 +/- 0.6 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) and postcontraction (7.9 +/- 0.4 and 7.0 +/- 0.4 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) insulin-stimulated glucose uptakes. However, the [14C]glucose incorporated into glycogen was greater in noncontracted (151%) and postcontracted (157%) transgenic muscle vs. muscle of corresponding wild-type mice. These results indicate that glycogen synthase activity is not rate limiting for insulin-stimulated glucose uptake in skeletal muscle and that the inverse relationship between muscle glycogen and insulin-stimulated glucose uptake is an association, not a cause and effect relationship.

  9. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Science.gov (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  10. Muscle glycogen storage postexercise: effect of mode of carbohydrate administration.

    Science.gov (United States)

    Reed, M J; Brozinick, J T; Lee, M C; Ivy, J L

    1989-02-01

    The primary purpose of this study was to determine whether gastric emptying limits the rate of muscle glycogen storage during the initial 4 h after exercise when a carbohydrate supplement is provided. A secondary purpose was to determine whether liquid (L) and solid (S) carbohydrate (CHO) feedings result in different rates of muscle glycogen storage after exercise. Eight subjects cycled for 2 h on three separate occasions to deplete their muscle glycogen stores. After each exercise bout they received 3 g CHO/kg body wt in L (50% glucose polymer) or S (rice/banana cake) form or by intravenous infusion (I; 20% sterile glucose). The L and S supplements were divided into two equal doses and administered immediately after and 120 min after exercise, whereas the I supplement was administered continuously during the first 235 min of the 240-min recovery period. Blood samples were drawn from an antecubital vein before exercise, during exercise, and throughout recovery. Muscle biopsies were taken from the vastus lateralis immediately after and 120 and 240 min after exercise. Blood glucose and insulin declined during exercise and increased significantly above preexercise levels during recovery in all treatments. The increase in blood glucose during the I treatment, however, was three times greater than during the L or S treatments. The average insulin response of the L treatment (61.7 +/- 4.9 microU/ml) was significantly greater than that of the S treatment (47.5 +/- 4.2 microU/ml) but not that of the I (55.3 +/- 4.5 microU/ml) treatment.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Effects of Coffee Components on Muscle Glycogen Recovery: A Systematic Review.

    Science.gov (United States)

    Loureiro, Laís Monteiro Rodrigues; Reis, Caio Eduardo Gonçalves; da Costa, Teresa Helena Macedo

    2018-01-18

    Coffee is one of the most consumed beverages in the world and it can improve insulin sensitivity, stimulating glucose uptake in skeletal muscle when adequate carbohydrate intake is observed. The aim of this review is to analyze the effects of coffee and coffee components on muscle glycogen metabolism. A literature search was conducted according to PRISMA and seven studies were included. They explored the effects of coffee components on various substances and signaling proteins. In one of the studies with humans, caffeine was shown to increase glucose levels, Ca 2+ /calmodulin-dependent protein kinase (CaMK) phosphorylation, glycogen resynthesis rates and glycogen accumulation after exercise. After intravenous injection of caffeine in rats, caffeine increased adenosine monophosphate-activated protein kinase (AMPK) and acetyl-CoA carboxylase (ACC) phosphorylation, and glucose transport. In in vitro studies caffeine raised AMPK and ACC phosphorylation, increasing glucose transport activity and reducing energy status in rat muscle cells. Cafestol and caffeic acid increased insulin secretion in rat beta-cells, and glucose uptake into human muscle cells. Caffeic acid also increased AMPK and ACC phosphorylation, reducing the energy status and increasing glucose uptake in rat muscle cells. Chlorogenic acid did not show any positive or negative effect. The findings from the current review must be taken with caution due to the limited number of studies on the subject. In conclusion, various coffee components had a neutral or positive role in the metabolism of glucose and muscle glycogen, whilst no detrimental effect was described. Coffee beverages should be tested as an option for athlete's glycogen recovery.

  12. Effects of commercially available pneumatic compression on muscle glycogen recovery after exercise.

    Science.gov (United States)

    Keck, Nathan A; Cuddy, John S; Hailes, Walter S; Dumke, Charles L; Ruby, Brent C

    2015-02-01

    The purpose of this study was to investigate the effects of pneumatic compression pants on postexercise glycogen resynthesis. Active male subjects (n = 10) completed 2 trials consisting of a 90-minute glycogen depleting ride, followed by 4 hours of recovery with either a pneumatic compression device (PCD) or passive recovery (PR) in a random counterbalanced order. A carbohydrate beverage (1.8 g·kg bodyweight) was provided at 0 and 2 hours after exercise. Muscle biopsies (vastus lateralis) were obtained immediately and 4 hours after exercise for glycogen analyses. Blood samples were collected throughout recovery to measure glucose and insulin. Eight fingerstick blood samples for lactate were collected in the last 20 minutes of the exercise period and during the initial portion of the recovery period. Heart rate was monitored throughout the trial. During the PCD trial, subjects recovered using a commercially available recovery device (NormaTec PCD) operational at 0-60 and 120-180 minutes into recovery period. The same PCD was worn during the PR trial but was not turned on to create pulsatile pressures. There was no difference in muscle glycogen resynthesis during the recovery period (6.9 ± 0.8 and 6.9 ± 0.5 mmol·kg wet wt·h for the PR and PCD trials, respectively). Blood glucose, insulin, and lactate concentrations changed with respect to time but were not different between trials (p > 0.05). The use of PCD did not alter the rate of muscle glycogen resynthesis, blood lactate, or blood glucose and insulin concentrations associated with a postexercise oral glucose load.

  13. Fructose effect to enhance liver glycogen deposition is due to inhibition of glycogenolysis

    International Nuclear Information System (INIS)

    Youn, J.; Kaslow, H.; Bergman, R.

    1987-01-01

    The effect of fructose on glycogen degradation was examined by measuring flux of [ 14 C] from prelabeled glycogen in perfused rat livers. During 2 h refeeding of fasted rats hepatic glycogen was labeled by injection of [U 14 C] galactose (0.1 mg and 0.02 μCi/g of body weight). Refed livers were perfused for 30 min with glucose only (10 mM) and for 60 min with glucose (10 mM) without (n=5) or with fructose (1, 2, 10 mM; n=5 for each). With fructose, label production immediately declined and remained suppressed through the end of perfusion (P < 0.05). Suppression was dose-dependent: steady state label production was suppressed 45, 64, and 72% by 1, 2, and 10 mM fructose (P < 0.0001), without significant changes in glycogen synthase or phosphorylase. These results suggest the existence of allosteric inhibition of phosphorylase in the presence of fructose. Fructose 1-phosphate (F1P) accumulated in proportion to fructose (0.11 +/- 0.01 without fructose, 0.86 +/- 0.03, 1.81 +/- 0.18, and 8.23 +/- 0.6 μmoles/g of liver with 1, 2, and 10 mM fructose. Maximum inhibition of phosphorylase was 82%; FIP concentration for half inhibition was 0.57 μmoles/g of liver, well within the concentration of F1P attained in refeeding. Fructose enhances net glycogen synthesis in liver by suppressing glycogenolysis and the suppression is presumably caused by allosteric inhibition of phosphorylase by F1P

  14. Deleterious effects of neuronal accumulation of glycogen in flies and mice

    OpenAIRE

    Duran, Jordi; Tevy, María Florencia; Garcia-Rocha, Mar; Calbó, Joaquim; Milán, Marco; Guinovart, Joan J

    2012-01-01

    Under physiological conditions, most neurons keep glycogen synthase (GS) in an inactive form and do not show detectable levels of glycogen. Nevertheless, aberrant glycogen accumulation in neurons is a hallmark of patients suffering from Lafora disease or other polyglucosan disorders. Although these diseases are associated with mutations in genes involved in glycogen metabolism, the role of glycogen accumulation remains elusive. Here, we generated mouse and fly models expressing an active form...

  15. Effect of chronic hypoglycaemia on glucose concentration and glycogen content in rat brain: a localized 13C NMR study

    OpenAIRE

    Lei, Hongxia; Gruetter, Rolf

    2006-01-01

    While chronic hypoglycaemia has been reported to increase unidirectional glucose transport across the blood-brain barrier (BBB) and to increase GLUT1 expression at the endothelium, the effect on steady-state brain d-glucose and brain glycogen content is currently unknown. Brain glucose and glycogen concentrations were directly measured in vivo using localized 13C magnetic resonance spectroscopy (MRS) following 12-14 days of hypoglycaemia. Brain glucose content was significantly increased by 4...

  16. Radiation effects on testes. XI. Studies on glycogen and its metabolizing enzymes following radiation-induced atrophy

    International Nuclear Information System (INIS)

    Gupta, G.S.; Bawa, S.R.

    1977-01-01

    Effect of radiation on enzymes of carbohydrate metabolism has been studied. It is observed that hexokinase of testis is highly sensitive to radiation damage. Reduced hexokinase activity seems to be related to those parts of the testis (spermatocytes and spermatids) which depend upon glucose for their functioning. Radiation-induced atrophic testis is rich in glycogen content. The observations on the inhibition of gluocose-6-phosphatase and phosphorylase may explain the higher levels of the polysaccharide although a possibility of enhanced glycogenesis due to the activation of glycogen synthetase has also been suggested. The presence of glucose-6-phosphate isomerase and glycogen in atrophied testis in 11-month-treated rats indicate the higher glycolytic activity with hyperplastic testicular interstitium. The results suggest that the accumulated glycogen is acting as a reserve substrate in nongerminal cells

  17. Histochemical Effects of “Verita WG” on Glycogen and Lipid Storage in Common Carp (Cyprinus carpio L. Liver

    Directory of Open Access Journals (Sweden)

    Elenka Georgieva

    2013-12-01

    Full Text Available We aimed in the present work is to study the effects of fosetyl-Al and fenamidone based fungicide (“Verita WG” on glycogen storage and expression of lipid droplets in common carp (Cyprinus carpio, L. liver. Concentrations of the test chemical were 30 mg/L, 38 mg/L and 50 mg/L under laboratory conditions. We used PAS-reaction for detection of glycogen storage and Sudan III staining for detection of lipid droplets in common carp hepatocytes. Hence, we found that the amount of glycogen and the fat storage in the liver increased proportionally with the increased fungicide concentrations. We also found conglomerates of accumulated glycogen in certain hepatocytes at all used concentrations. Overall, the results demonstrated enhanced glyconeogenesis and fat accumulation in the common carp liver, exposed to the test chemical.

  18. Effect of eccentric exercise with reduced muscle glycogen on plasma interleukin-6 and neuromuscular responses of musculus quadriceps femoris.

    Science.gov (United States)

    Gavin, James P; Myers, Stephen D; Willems, Mark E T

    2016-07-01

    Eccentric exercise can result in muscle damage and interleukin-6 (IL-6) secretion. Glycogen availability is a potent stimulator of IL-6 secretion. We examined effects of eccentric exercise in a low-glycogen state on neuromuscular function and plasma IL-6 secretion. Twelve active men (23 ± 4 yr, 179 ± 5 cm, 77 ± 10 kg, means ± SD) completed two downhill treadmill runs (gradient, -12%, 5 × 8 min; speed, 12.1 ± 1.1 km/h) with normal (NG) and reduced muscle glycogen (RG) in randomized order and at least 6 wk apart. Muscle glycogen was reduced using an established cycling protocol until exhaustion and dietary manipulation the evening before the morning run. Physiological responses were measured up to 48 h after the downhill runs. During recovery, force deficits of musculus quadriceps femoris by maximal isometric contractions were similar. Changes in low-frequency fatigue were larger with RG. Voluntary activation and plasma IL-6 levels were similar in recovery between conditions. It is concluded that unaccustomed, damaging eccentric exercise with low muscle glycogen of the m. quadriceps femoris 1) exacerbated low-frequency fatigue but 2) had no additional effect on IL-6 secretion. Neuromuscular impairment after eccentric exercise with low muscle glycogen appears to have a greater peripheral component in early recovery. Copyright © 2016 the American Physiological Society.

  19. Deleterious effects of neuronal accumulation of glycogen in flies and mice.

    Science.gov (United States)

    Duran, Jordi; Tevy, María Florencia; Garcia-Rocha, Mar; Calbó, Joaquim; Milán, Marco; Guinovart, Joan J

    2012-08-01

    Under physiological conditions, most neurons keep glycogen synthase (GS) in an inactive form and do not show detectable levels of glycogen. Nevertheless, aberrant glycogen accumulation in neurons is a hallmark of patients suffering from Lafora disease or other polyglucosan disorders. Although these diseases are associated with mutations in genes involved in glycogen metabolism, the role of glycogen accumulation remains elusive. Here, we generated mouse and fly models expressing an active form of GS to force neuronal accumulation of glycogen. We present evidence that the progressive accumulation of glycogen in mouse and Drosophila neurons leads to neuronal loss, locomotion defects and reduced lifespan. Our results highlight glycogen accumulation in neurons as a direct cause of neurodegeneration. Copyright © 2012 EMBO Molecular Medicine.

  20. Salinity Effects on Strategies of Glycogen Utilization in Livers of Euryhaline Milkfish (Chanos chanos under Hypothermal Stress

    Directory of Open Access Journals (Sweden)

    Chia-Hao Chang

    2018-02-01

    Full Text Available The fluctuation of temperature affects many physiological responses in ectothermic organisms, including feed intake, growth, reproduction, and behavior. Changes in environmental temperatures affect the acquisition of energy, whereas hepatic glycogen plays a central role in energy supply for the homeostasis of the entire body. Glycogen phosphorylase (GP, which catalyzes the rate-limiting step in glycogenolysis, is also an indicator of environmental stress. Here, we examined the effects of salinity on glycogen metabolism in milkfish livers under cold stress. A reduction of feed intake was observed in both freshwater (FW and seawater (SW milkfish under cold adaptation. At normal temperature (28°C, compared to the FW milkfish, the SW milkfish exhibited greater mRNA abundance of the liver isoform of GP (Ccpygl, higher GP activity, and less glycogen content in the livers. Upon hypothermal (18°C stress, hepatic Ccpygl mRNA expression of FW milkfish surged at 3 h, declined at 6 and 12 h, increased again at 24 h, and increased significantly after 96 h. Increases in GP protein, GP activity, and the phosphorylation state and the breakdown of glycogen were also found in FW milkfish livers after 12 h of exposure at 18°C. Conversely, the Ccpygl transcript levels in SW milkfish were downregulated after 1 h of exposure at 18°C, whereas the protein abundance of GP, GP activity, and glycogen content were not significantly altered. Taken together, under 18°C cold stress, FW milkfish exhibited an acute response with the breakdown of hepatic glycogen for maintaining energy homeostasis of the entire body, whereas no change was observed in the hepatic glycogen content and GP activity of SW milkfish because of their greater tolerance to cold conditions.

  1. Effect of carbon tetrachloride on glycogen metabolism in fasted and refed mice

    International Nuclear Information System (INIS)

    Pushpendran, C.K.; Shenoy, B.V.; Eapen, J.

    1977-01-01

    Hepatic glycogen was depleted rapidly in fasted mice treated with CCl 4 . Glycogen breakdown was slow when CCl 4 was administered after 1 hr of refeeding. There was an initial increase and then a reduction in liver glycogen of mice refed for 2 hr prior to CCl 4 injection. The incorporation of glucose-U- 14 C into glycogen was higher in mice which were refed before CCl 4 administration than in fasted mice treated with the hepatotoxin. The specific activity of lactate was higher in CCl 4 treated mice. The data suggested differences in glycogen metabolism of fasted and refed mice in response to CCl 4 treatment. (author)

  2. THE EFFECT OF INSULIN AND CARBOHYDRATE SUPPLEMENTATION ON GLYCOGEN REPLENISHMENT AMONG DIFFERENT HINDLIMB MUSCLES IN RATS FOLLOWING PROLONGED SWIMMING

    Directory of Open Access Journals (Sweden)

    Mei-Chich Hsu

    2012-04-01

    Full Text Available In the present study we investigated the interactive effects of insulin and carbohydrate on glycogen replenishment in different rat hindlimb muscles. Forty male Sprague Dawley rats were assigned to 5 groups, including 1 sedentary control with carbohydrate supplement (2 g glucose · kg body wt-1, 2 sedentary rats with 16 hours recovery, carbohydrate and insulin (0.5 U · kg body wt-1, 3 swimming without recovery, 4 swimming with 16 hours recovery and carbohydrate supplement, and 5 swimming with 16 hours recovery, carbohydrate and insulin. The swimming protocol consisted of two 3 h swimming sections, which were separated by a 45 min rest. The insulin and carbohydrate were administered to the rats immediately after exercise. At the end of the experiment, the soleus (S, plantaris (P, quadriceps (Q and gastrocnemius (G were surgically excised to evaluate glycogen utilization and replenishment. We observed that glycogen utilization was significantly lower in G and Q than S and P during swimming (p <0.05, and S showed the greatest capacity of glycogen resynthesis after post-exercise recovery (p <0.05. In the sedentary state, the glycogen synthesis did not differ among hindlimb muscles during insulin and carbohydrate treatments. Interestingly, with insulin and carbohydrate, the glycogen resynthesis in S and P were significantly greater than in Q and G following post-exercise recovery (p <0.05. We therefore concluded that the soleus and plantaris are the primary working muscles during swimming, and the greatest glycogen replenishment capacity of the soleus during post-exercise recovery is likely due to its highest insulin sensitivity.

  3. Brain glycogen

    DEFF Research Database (Denmark)

    Obel, Linea Lykke Frimodt; Müller, Margit S; Walls, Anne B

    2012-01-01

    Glycogen is a complex glucose polymer found in a variety of tissues, including brain, where it is localized primarily in astrocytes. The small quantity found in brain compared to e.g., liver has led to the understanding that brain glycogen is merely used during hypoglycemia or ischemia....... In this review evidence is brought forward highlighting what has been an emerging understanding in brain energy metabolism: that glycogen is more than just a convenient way to store energy for use in emergencies-it is a highly dynamic molecule with versatile implications in brain function, i.e., synaptic...... activity and memory formation. In line with the great spatiotemporal complexity of the brain and thereof derived focus on the basis for ensuring the availability of the right amount of energy at the right time and place, we here encourage a closer look into the molecular and subcellular mechanisms...

  4. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    KAUST Repository

    Ruchti, E.

    2016-10-08

    The storage and use of glycogen, the main energy reserve in the brain, is a metabolic feature of astrocytes. Glycogen synthesis is regulated by Protein Targeting to Glycogen (PTG), a member of specific glycogen-binding subunits of protein phosphatase-1 (PPP1). It positively regulates glycogen synthesis through de-phosphorylation of both glycogen synthase (activation) and glycogen phosphorylase (inactivation). In cultured astrocytes, PTG mRNA levels were previously shown to be enhanced by the neurotransmitter noradrenaline. To achieve further insight into the role of PTG in the regulation of astrocytic glycogen, its levels of expression were manipulated in primary cultures of mouse cortical astrocytes using adenovirus-mediated overexpression of tagged-PTG or siRNA to downregulate its expression. Infection of astrocytes with adenovirus led to a strong increase in PTG expression and was associated with massive glycogen accumulation (>100 fold), demonstrating that increased PTG expression is sufficient to induce glycogen synthesis and accumulation. In contrast, siRNA-mediated downregulation of PTG resulted in a 2-fold decrease in glycogen levels. Interestingly, PTG downregulation strongly impaired long-term astrocytic glycogen synthesis induced by insulin or noradrenaline. Finally, these effects of PTG downregulation on glycogen metabolism could also be observed in cultured astrocytes isolated from PTG-KO mice. Collectively, these observations point to a major role of PTG in the regulation of glycogen synthesis in astrocytes and indicate that conditions leading to changes in PTG expression will directly impact glycogen levels in this cell type.

  5. POST-EXERCISE MUSCLE GLYCOGEN REPLETION IN THE EXTREME: EFFECT OF FOOD ABSENCE AND ACTIVE RECOVERY

    Directory of Open Access Journals (Sweden)

    Paul A. Fournier

    2004-09-01

    Full Text Available Glycogen plays a major role in supporting the energy demands of skeletal muscles during high intensity exercise. Despite its importance, the amount of glycogen stored in skeletal muscles is so small that a large fraction of it can be depleted in response to a single bout of high intensity exercise. For this reason, it is generally recommended to ingest food after exercise to replenish rapidly muscle glycogen stores, otherwise one's ability to engage in high intensity activity might be compromised. But what if food is not available? It is now well established that, even in the absence of food intake, skeletal muscles have the capacity to replenish some of their glycogen at the expense of endogenous carbon sources such as lactate. This is facilitated, in part, by the transient dephosphorylation-mediated activation of glycogen synthase and inhibition of glycogen phosphorylase. There is also evidence that muscle glycogen synthesis occurs even under conditions conducive to an increased oxidation of lactate post-exercise, such as during active recovery from high intensity exercise. Indeed, although during active recovery glycogen resynthesis is impaired in skeletal muscle as a whole because of increased lactate oxidation, muscle glycogen stores are replenished in Type IIa and IIb fibers while being broken down in Type I fibers of active muscles. This unique ability of Type II fibers to replenish their glycogen stores during exercise should not come as a surprise given the advantages in maintaining adequate muscle glycogen stores in those fibers that play a major role in fight or flight responses

  6. Effects of gamma-irradiation on the glycogen and lipid contents of the rat liver cells

    Energy Technology Data Exchange (ETDEWEB)

    Nahed, R H.A.; Al-Zahaby, Al-Ahmmady, S.; Sanad, S M.K.; Roushdy, H M

    1986-01-01

    Histochemical changes in the glycogen and lipid contents of the rat liver cells were studied at different intervals following whole body gamma-irradiation at the exposure dose level of 600 rads. The glycogen and lipid contents were significantly altered, the changes were time-dependent.

  7. Biomarker for Glycogen Storage Diseases

    Science.gov (United States)

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  8. Effect of carbon tetrachloride on glycogen metabolism in fasted and refed mice

    Energy Technology Data Exchange (ETDEWEB)

    Pushpendran, C K; Shenoy, B V; Eapen, J [Bhabha Atomic Research Centre, Bombay (India). Biochemistry and Food Technology Div.

    1977-11-01

    Hepatic glycogen was depleted rapidly in fasted mice treated with CCl/sub 4/. Glycogen breakdown was slow when CCl/sub 4/ was administered after 1 hr of refeeding. There was an initial increase and then a reduction in liver glycogen of mice refed for 2 hr prior to CCl/sub 4/ injection. The incorporation of glucose-U-/sup 14/C into glycogen was higher in mice which were refed before CCl/sub 4/ administration than in fasted mice treated with the hepatotoxin. The specific activity of lactate was higher in CCl/sub 4/ treated mice. The data suggested differences in glycogen metabolism of fasted and refed mice in response to CCl/sub 4/ treatment.

  9. Effect of D-tagatose on liver weight and glycogen content of rats.

    Science.gov (United States)

    Bär, A; Lina, B A; de Groot, D M; de Bie, B; Appel, M J

    1999-04-01

    D-tagatose is an incompletely absorbed ketohexose (stereoisomer of D-fructose) which has potential as an energy-reduced alternative sweetener. In an earlier 90-day toxicity study, rats fed diets with 10, 15 and 20% D-tagatose exhibited increased liver weights, but no histopathological alterations. To determine whether there might be any toxicological relevance to this effect, three studies were conducted in male, adult Sprague-Dawley rats. In the first study, four groups received Purina diet (group A), Purina diet with 20% D-tagatose (group B), SDS diet (group C), or SDS diet with 20% D-tagatose (group D). For groups A and B, the 28-day treatment period was followed by a 14-day recovery period (Purina diet). Food remained available to all animals until the time of sacrifice. Groups of 10 rats were killed on days 14 (groups A and B), 28 (groups A-D), and 42 (groups A and B). Body weights, as well as weights of wet and lyophilized livers, were determined. The lyophilized livers collected on day 28 from groups A and B were analyzed for protein, total lipid, glycogen, DNA, and residual moisture. By day 14, relative wet liver weights had increased by 23% in group B. On day 28, the increase was 38% in group B and 44% in group D. At the end of the recovery period, the increase had diminished to 14% in group B. On day 28, liver glycogen content (in %) was significantly increased, and liver protein, lipid, and DNA contents were significantly decreased in group B compared to group A. Total amounts per liver of protein, total lipid, glycogen, and DNA were significantly increased. In the second study, four groups of 20 rats each received SDS diet with 0, 5, 10, and 20% D-tagatose for 29-31 days. The food was available until the time of sacrifice. At termination, plasma was obtained from 10 rats/group for clinicochemical analyses. Five rats/group were subjected to whole-body perfusion, followed by processing of livers for qualitative and quantitative electron microscopic

  10. Effect of acute exercise on glycogen synthase in muscle from obese and diabetic subjects.

    Science.gov (United States)

    Jensen, Jørgen; Tantiwong, Puntip; Stuenæs, Jorid T; Molina-Carrion, Marjorie; DeFronzo, Ralph A; Sakamoto, Kei; Musi, Nicolas

    2012-07-01

    Insulin stimulates glycogen synthase (GS) through dephosphorylation of serine residues, and this effect is impaired in skeletal muscle from insulin-resistant [obese and type 2 diabetic (T2DM)] subjects. Exercise also increases GS activity, yet it is not known whether the ability of exercise to affect GS is impaired in insulin-resistant subjects. The objective of this study was to examine the effect of acute exercise on GS phosphorylation and enzyme kinetic properties in muscle from insulin-resistant individuals. Lean normal glucose-tolerant (NGT), obese NGT, and obese T2DM subjects performed 40 min of moderate-intensity cycle exercise (70% of Vo(2max)). GS kinetic properties and phosphorylation were measured in vastus lateralis muscle before exercise, immediately after exercise, and 3.5 h postexercise. In lean subjects, GS fractional activity increased twofold after 40 min of exercise, and it remained elevated after the 3.5-h rest period. Importantly, exercise also decreased GS K(m) for UDP-glucose from ≈0.5 to ≈0.2 mM. In lean subjects, exercise caused significant dephosphorylation of GS by 50-70% (Ser(641), Ser(645), and Ser(645,649,653,657)), and phosphorylation of these sites remained decreased after 3.5 h; Ser⁷ phosphorylation was not regulated by exercise. In obese NGT and T2DM subjects, exercise increased GS fractional activity, decreased K(m) for UDP-glucose, and decreased GS phosphorylation as effectively as in lean NGT subjects. We conclude that the molecular regulatory process by which exercise promotes glycogen synthesis in muscle is preserved in insulin-resistant subjects.

  11. Muscle glycogen stores and fatigue

    DEFF Research Database (Denmark)

    Ørtenblad, Niels; Westerblad, Håkan; Nielsen, Joachim

    2013-01-01

      Studies performed at the beginning of the last century revealed the importance of carbohydrate as a fuel during exercise, and the importance of muscle glycogen on performance has subsequently been confirmed in numerous studies. However, the link between glycogen depletion and impaired muscle...... function during fatigue is not well understood and a direct cause-and-effect relationship between glycogen and muscle function remains to be established. The use of electron microscopy has revealed that glycogen is not homogeneously distributed in skeletal muscle fibres, but rather localized in distinct...... pools. Furthermore, each glycogen granule has its own metabolic machinery with glycolytic enzymes and regulating proteins. One pool of such glycogenolytic complexes is localized within the myofibrils in close contact with key proteins involved in the excitation-contraction coupling and Ca2+ release from...

  12. Effect of pH on Cleavage of Glycogen by Vaginal Enzymes.

    Directory of Open Access Journals (Sweden)

    Greg T Spear

    Full Text Available Glycogen expressed by the lower genital tract epithelium is believed to support Lactobacillus growth in vivo, although most genital isolates of Lactobacillus are not able to use glycogen as an energy source in vitro. We recently reported that α-amylase is present in the genital fluid of women and that it breaks down glycogen into small carbohydrates that support growth of lactobacilli. Since the pH of the lower genital tract can be very low, we determined how low pH affects glycogen processing by α-amylase. α-amylase in saliva degraded glycogen similarly at pH 6 and 7, but activity was reduced by 52% at pH 4. The glycogen degrading activity in nine genital samples from seven women showed a similar profile with an average reduction of more than 50% at pH 4. However, two samples collected from one woman at different times had a strikingly different pH profile with increased glycogen degradation at pH 4, 5 and 6 compared to pH 7. This second pH profile did not correlate with levels of human α-acid glucosidase or human intestinal maltase glucoamylase. High-performance anion-exchange chromatography showed that mostly maltose was produced from glycogen by samples with the second pH profile in contrast to genital α-amylase that yielded maltose, maltotriose and maltotetraose. These studies show that at low pH, α-amylase activity is reduced to low but detectable levels, which we speculate helps maintain Lactobacillus growth at a limited but sustained rate. Additionally, some women have a genital enzyme distinct from α-amylase with higher activity at low pH. Further studies are needed to determine the identity and distribution of this second enzyme, and whether its presence influences the makeup of genital microbiota.

  13. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  14. Muscle glycogen resynthesis during recovery from cycle exercise: no effect of additional protein ingestion

    DEFF Research Database (Denmark)

    Van Hall, Gerrit; Shirreffs, S M; Calbet, J A

    2000-01-01

    In the present study, we have investigated the effect of carbohydrate and protein hydrolysate ingestion on muscle glycogen resynthesis during 4 h of recovery from intense cycle exercise. Five volunteers were studied during recovery while they ingested, immediately after exercise, a 600-ml bolus......, and 18 +/- 6 for the first 1.5 h of recovery and decreased to 30 +/- 6, 36 +/- 3, and 8 +/- 6 mmol. kg dry muscle(-1). h(-1) between 1.5 and 4 h for CHO/protein, CHO, and water ingestion, respectively. No differences could be observed between CHO/protein and CHO ingestion ingestion. It is concluded...... and then every 15 min a 150-ml bolus containing 1) 1.67 g. kg body wt(-1). l(-1) of sucrose and 0.5 g. kg body wt(-1). l(-1) of a whey protein hydrolysate (CHO/protein), 2) 1.67 g. kg body wt(-1). l(-1) of sucrose (CHO), and 3) water. CHO/protein and CHO ingestion caused an increased arterial glucose...

  15. Muscle glycogen synthesis before and after exercise.

    Science.gov (United States)

    Ivy, J L

    1991-01-01

    The importance of carbohydrates as a fuel source during endurance exercise has been known for 60 years. With the advent of the muscle biopsy needle in the 1960s, it was determined that the major source of carbohydrate during exercise was the muscle glycogen stores. It was demonstrated that the capacity to exercise at intensities between 65 to 75% VO2max was related to the pre-exercise level of muscle glycogen, i.e. the greater the muscle glycogen stores, the longer the exercise time to exhaustion. Because of the paramount importance of muscle glycogen during prolonged, intense exercise, a considerable amount of research has been conducted in an attempt to design the best regimen to elevate the muscle's glycogen stores prior to competition and to determine the most effective means of rapidly replenishing the muscle glycogen stores after exercise. The rate-limiting step in glycogen synthesis is the transfer of glucose from uridine diphosphate-glucose to an amylose chain. This reaction is catalysed by the enzyme glycogen synthase which can exist in a glucose-6-phosphate-dependent, inactive form (D-form) and a glucose-6-phosphate-independent, active form (I-form). The conversion of glycogen synthase from one form to the other is controlled by phosphorylation-dephosphorylation reactions. The muscle glycogen concentration can vary greatly depending on training status, exercise routines and diet. The pattern of muscle glycogen resynthesis following exercise-induced depletion is biphasic. Following the cessation of exercise and with adequate carbohydrate consumption, muscle glycogen is rapidly resynthesised to near pre-exercise levels within 24 hours. Muscle glycogen then increases very gradually to above-normal levels over the next few days. Contributing to the rapid phase of glycogen resynthesis is an increase in the percentage of glycogen synthase I, an increase in the muscle cell membrane permeability to glucose, and an increase in the muscle's sensitivity to insulin

  16. Effects of hypothyroidism on the sensitivity of glycolysis and glycogen synthesis to insulin in the soleus muscle of the rat.

    Science.gov (United States)

    Dimitriadis, G D; Leighton, B; Parry-Billings, M; West, D; Newsholme, E A

    1989-01-01

    1. The effects of hypothyroidism on the sensitivity of glycolysis and glycogen synthesis to insulin were investigated in the isolated, incubated soleus muscle of the rat. 2. Hypothyroidism, which was induced by administration of propylthiouracil to the rats, decreased fasting plasma levels of free fatty acids and increased plasma levels of glucose but did not significantly change plasma levels of insulin. 3. The sensitivity of the rates of glycogen synthesis to insulin was increased at physiological, but decreased at supraphysiological, concentrations of insulin. 4. The rates of glycolysis in the hypothyroid muscles were decreased at all insulin concentrations studied and the EC50 for insulin was increased more than 8-fold; the latter indicates decreased sensitivity of this process to insulin. However, at physiological concentrations of insulin, the rates of glucose phosphorylation in the soleus muscles of hypothyroid rats were not different from controls. This suggests that hypothyroidism affects glucose metabolism in muscle not by affecting glucose transport but by decreasing the rate of glucose 6-phosphate conversion to lactate and increasing the rate of conversion of glucose 6-phosphate to glycogen. 5. The rates of glucose oxidation were decreased in the hypothyroid muscles at all insulin concentrations. PMID:2649073

  17. Effect of oral D-tagatose on liver volume and hepatic glycogen accumulation in healthy male volunteers.

    Science.gov (United States)

    Boesch, C; Ith, M; Jung, B; Bruegger, K; Erban, S; Diamantis, I; Kreis, R; Bär, A

    2001-04-01

    Standard toxicity tests with high levels of D-tagatose showed a reversible enlargement of the liver in Sprague-Dawley rats without increase of liver enzymes. The present study tests the hypotheses that partial substitution of dietary sucrose by D-tagatose for 28 days increases the volume of human liver and the concentration of liver glycogen. Twelve healthy, male volunteers were studied in a double-blind crossover study with ingestion of D-tagatose (3x15 g daily) and placebo (sucrose, 3x15 g daily) for periods of 28 days each. Liver volume and glycogen concentration have been determined by magnetic resonance (MR) imaging and spectroscopy, which were accompanied by routine medical examinations. MR examinations before and after the treatments revealed no effects (P>0.05) of treatment, period, or subject for changes in liver volume or glycogen concentration. A steady increase of liver volumes, independent of the D-tagatose or placebo intake, has been observed over the study in parallel with a slight increase in body weight. The treatment with D-tagatose was not associated with clinically relevant changes of the examined clinico-chemical and hematological parameters, including liver enzymes and uric acid. Copyright 2001 Academic Press.

  18. Curative effect of spleen homogenate against radiation injury to serum glucose, liver glycogen and plasma protein fractions in rats

    International Nuclear Information System (INIS)

    Roushdy, H.M.; Ibrahim, H.A.; Edrees, G.M.F.

    1984-01-01

    The influence of the spleen homogenate injection as a curative substance against gamma irradiation effects has been investigated in male albino rats. The parameters tested were, life span, serum glucose level, liver glycogen content, serum protein fractions and A/G ratio. The results obtained are as follows: Irradiated group showed 100% mortality over 22 days, this percentage dropped to 60% over 30 days for irradiated group received spleen homogenate treatment. Irradiated animals, recorded initial hyperglycaemia which diminished by time, whereas the liver glycogen concentration showed first to initially increase then to decrease abruptly. Treatment with spleen homogenate after irradiation ameliorated the magnitude of radiation induced hyperglycaemia and liver glycogen depletion. The serum Albumin/Globulin ratio decreased by irradiation due to the decrease in the serum albumin accompanied by an increase in the serum globulin content. This ratio could be restored towards its normal level in irradiated animals received spleen homogenate treatment. The data obtained suggests the possibility of using spleen homogenate for the treatment of accidental radiation syndrome

  19. The Antimalarial Effect of Curcumin Is Mediated by the Inhibition of Glycogen Synthase Kinase-3β.

    Science.gov (United States)

    Ali, Amatul Hamizah; Sudi, Suhaini; Basir, Rusliza; Embi, Noor; Sidek, Hasidah Mohd

    2017-02-01

    Curcumin, a bioactive compound in Curcuma longa, exhibits various pharmacological activities, including antimalarial effects. In silico docking simulation studies suggest that curcumin possesses glycogen synthase kinase-3β (GSK3β)-inhibitory properties. The involvement of GSK3 in the antimalarial effects in vivo is yet to be demonstrated. In this study, we aimed to evaluate whether the antimalarial effects of curcumin involve phosphorylation of host GSK3β. Intraperitoneal administration of curcumin into Plasmodium berghei NK65-infected mice resulted in dose-dependent chemosuppression of parasitemia development. At the highest dose tested (30 mg/kg body weight), both therapeutic and prophylactic administrations of curcumin resulted in suppression exceeding 50% and improved median survival time of infected mice compared to control. Western analysis revealed a 5.5-fold (therapeutic group) and 1.8-fold (prophylactic group) increase in phosphorylation of Ser 9 GSK3β and 1.6-fold (therapeutic group) and 1.7-fold (prophylactic group) increase in Ser 473 Akt in liver of curcumin-treated infected animals. Following P. berghei infection, levels of pro- and anti-inflammatory cytokines, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, interleukin (IL)-10, and IL-4 were elevated by 7.5-, 35.0-, 33.0-, and 2.2-fold, respectively. Curcumin treatment (therapeutic) caused a significant decrease (by 6.0- and 2.0-fold, respectively) in serum TNF-α and IFN-γ level, while IL-10 and IL-4 were elevated (by 1.4- and 1.8-fold). Findings from the present study demonstrate for the first time that the antimalarial action of curcumin involved inhibition of GSK3β.

  20. Effects of diabetes on brain metabolism - is brain glycogen a significant player?

    DEFF Research Database (Denmark)

    Sickmann, Helle M; Waagepetersen, Helle S.

    2015-01-01

    Brain glycogen, being an intracellular glucose reservoir, contributes to maintain energy and neurotransmitter homeostasis under physiological as well as pathological conditions. Under conditions with a disturbance in systemic glucose metabolism such as in diabetes, the supply of glucose to the br......Brain glycogen, being an intracellular glucose reservoir, contributes to maintain energy and neurotransmitter homeostasis under physiological as well as pathological conditions. Under conditions with a disturbance in systemic glucose metabolism such as in diabetes, the supply of glucose...... to the brain may be affected and have important impacts on brain metabolism and neurotransmission. This also implies that brain glycogen may serve an essential role in the diabetic state to sustain appropriate brain function. There are two main types of diabetes; type 1 and type 2 diabetes and both types may...... understanding of how brain energy and neurotransmitter metabolism is affected in diabetes. There will be a particular focus on the role of brain glycogen to support glycolytic and TCA cycle activity as well as glutamate-glutamine cycle in type 1 and type 2 diabetes....

  1. Human acid alpha-glucosidase from rabbit milk has therapeutic effect in mice with glycogen storage disease type II

    NARCIS (Netherlands)

    A.G.A. Bijvoet (Agnes); A.J.J. Reuser (Arnold); H. van Hirtum (Hans); M.A. Kroos (Marian); E.H. van de Kamp; O. Schoneveld; P. Visser (Pim); J.P. Brakenhoff (Just); M. Weggeman (Miranda); E.J.J.M. van Corven (Emiel); A.T. van der Ploeg (Ans)

    1999-01-01

    textabstractPompe's disease or glycogen storage disease type II (GSDII) belongs to the family of inherited lysosomal storage diseases. The underlying deficiency of acid alpha-glucosidase leads in different degrees of severity to glycogen storage in heart, skeletal

  2. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  3. Glycogen metabolism in humans

    OpenAIRE

    Adeva-Andany, María M.; González-Lucán, Manuel; Donapetry-García, Cristóbal; Fernández-Fernández, Carlos; Ameneiros-Rodríguez, Eva

    2016-01-01

    In the human body, glycogen is a branched polymer of glucose stored mainly in the liver and the skeletal muscle that supplies glucose to the blood stream during fasting periods and to the muscle cells during muscle contraction. Glycogen has been identified in other tissues such as brain, heart, kidney, adipose tissue, and erythrocytes, but glycogen function in these tissues is mostly unknown. Glycogen synthesis requires a series of reactions that include glucose entrance into the cell through...

  4. Effect of long-term intraperitoneal zinc administration on liver glycogen levels in diabetic rats subjected to acute forced swimming.

    Science.gov (United States)

    Bicer, Mursel; Gunay, Mehmet; Akil, Mustafa; Avunduk, Mustafa Cihat; Mogulkoc, Rasim; Baltaci, Abdulkerim Kasim

    2011-03-01

    This study aims to examine the effect of zinc administration on liver glycogen levels of rats in which diabetes was induced with streptozotocin and which were subjected to acute swimming exercise. The study was conducted on 80 adult Sprague-Dawley male rats, which were equally allocated to eight groups: group 1, general control; group 2, zinc-administrated control; group 3, zinc-administrated diabetic control; group 4, swimming control; group 5, zinc-administrated swimming; group 6, zinc-administrated diabetic swimming; group 7, diabetic swimming; group 8, diabetic control group. In order to induce diabetes, animals were injected with 40 mg/kg intraperitoneal (ip) streptozotocin. The injections were repeated in the same dose after 24 h. Animals which had blood glucose at or above 300 mg/dl 6 days after the last injections were accepted as diabetic. Zinc was administrated ip for 4 weeks as 6 mg/kg/day per rat. Hepatic tissue samples taken from the animals at the end of the study were fixed in 95% ethyl alcohol. Cross sections of 5 µm thickness, taken by the help of a microtome from the tissue samples buried in paraffin, were placed on a microscope slide and stained with periodic acid-Schiff and evaluated by light microscope. All microscopic images were transferred to a PC and assessed with the help of Clemex PE3.5 image analysis software. The lowest liver glycogen levels in the study were obtained in groups 3, 4, 6, 7, and 8. Liver glycogen levels in group 5 were higher than groups 3, 4, 6, 7, and 8, but lower than groups 1 and 2 (p swimming exercise were restored by zinc administration and that diabetes induced in rats prevented the protective effect of zinc.

  5. Eckmaxol, a Phlorotannin Extracted from Ecklonia maxima, Produces Anti-β-amyloid Oligomer Neuroprotective Effects Possibly via Directly Acting on Glycogen Synthase Kinase 3β.

    Science.gov (United States)

    Wang, Jialing; Zheng, Jiachen; Huang, Chunhui; Zhao, Jiaying; Lin, Jiajia; Zhou, Xuezhen; Naman, C Benjamin; Wang, Ning; Gerwick, William H; Wang, Qinwen; Yan, Xiaojun; Cui, Wei; He, Shan

    2018-04-10

    Alzheimer's disease is a progressive neurodegenerative disorder that mainly affects the elderly. Soluble β-amyloid oligomer, which can induce neurotoxicity, is generally regarded as the main neurotoxin in Alzheimer's disease. Here we report that eckmaxol, a phlorotannin extracted from the brown alga Ecklonia maxima, could produce neuroprotective effects in SH-SY5Y cells. Eckmaxol effectively prevented but did not rescue β-amyloid oligomer-induced neuronal apoptosis and increase of intracellular reactive oxygen species. Eckmaxol also significantly reversed the decreased expression of phospho-Ser9-glycogen synthase kinase 3β and increased expression of phospho-extracellular signal-regulated kinase, which was induced by Aβ oligomer. Moreover, both glycogen synthase kinase 3β and mitogen activated protein kinase inhibitors produced neuroprotective effects in SH-SY5Y cells. Furthermore, eckmaxol showed favorable interaction in the ATP binding site of glycogen synthase kinase 3β and mitogen activated protein kinase. These results suggested that eckmaxol might produce neuroprotective effects via concurrent inhibition of glycogen synthase kinase 3β and extracellular signal-regulated kinase pathways, possibly via directly acting on glycogen synthase kinase 3β and mitogen activated protein kinase. Based on the central role that β-amyloid oligomers play in the pathogenesis of Alzheimer's disease and the high annual production of Ecklonia maxima for alginate and other nutritional ingredients, this report represents a new candidate for the treatment of Alzheimer's disease, and also expands the potential application of Ecklonia maxima and its constituents in the field of pharmacology.

  6. Long-term effects of rapamycin treatment on insulin mediated phosphorylation of Akt/PKB and glycogen synthase activity

    International Nuclear Information System (INIS)

    Varma, Shailly; Shrivastav, Anuraag; Changela, Sheena; Khandelwal, Ramji L.

    2008-01-01

    Protein kinase B (Akt/PKB) is a Ser/Thr kinase that is involved in the regulation of cell proliferation/survival through mammalian target of rapamycin (mTOR) and the regulation of glycogen metabolism through glycogen synthase kinase 3β (GSK-3β) and glycogen synthase (GS). Rapamycin is an inhibitor of mTOR. The objective of this study was to investigate the effects of rapamycin pretreatment on the insulin mediated phosphorylation of Akt/PKB phosphorylation and GS activity in parental HepG2 and HepG2 cells with overexpression of constitutively active Akt1/PKB-α (HepG2-CA-Akt/PKB). Rapamycin pretreatment resulted in a decrease (20-30%) in the insulin mediated phosphorylation of Akt1 (Ser 473) in parental HepG2 cells but showed an upregulation of phosphorylation in HepG2-CA-Akt/PKB cells. Rictor levels were decreased (20-50%) in parental HepG2 cells but were not significantly altered in the HepG2-CA-Akt/PKB cells. Furthermore, rictor knockdown decreased the phosphorylation of Akt (Ser 473) by 40-60% upon rapamycin pretreatment. GS activity followed similar trends as that of phosphorylated Akt and so with rictor levels in these cells pretreated with rapamycin; parental HepG2 cells showed a decrease in GS activity, whereas as HepG2-CA-Akt/PKB cells showed an increase in GS activity. The changes in the levels of phosphorylated Akt/PKB (Ser 473) correlated with GS and protein phoshatase-1 activity

  7. Effects of Glucose with Casein Peptide Supplementation on Post-Exercise Muscle Glycogen Resynthesis in C57BL/6J Mice

    Directory of Open Access Journals (Sweden)

    Yutaka Matsunaga

    2018-06-01

    Full Text Available Numerous studies have reported that post-exercise ingestion of carbohydrates with protein supplementation can enhance glycogen recovery. However, few reports have focused on the degrees of degradation of the ingested proteins due to post-exercise glycogen resynthesis. Accordingly, the aim of this study was to clarify the effects of differences in protein degradation on muscle glycogen recovery. Male seven-week-old C57BL/6J mice performed a single bout of 60-min treadmill running exercise and were then orally administered glucose (Glu; 1.5 mg/g body weight (BW, glucose with casein peptide (Glu + Pep; 1.5 + 0.5 mg/g BW or its constituent amino acid mixture (Glu + AA; 1.5 + 0.5 mg/g BW. At 120 min after supplementation, the soleus muscle glycogen content in the Glu and Glu + AA groups was significantly higher than that immediately after exercise; however, no such difference was observed in the Glu + Pep group. Blood substrate concentration and insulin signaling did not differ among the three groups. Furthermore, energy expenditure during the recovery period in the Glu + Pep group was significantly higher than that in the Glu and Glu + AA groups. These findings suggest that post-exercise co-ingestion of glucose and casein peptide might delay glycogen resynthesis, at least in part through increased energy expenditure caused by casein peptide ingestion.

  8. Short and long-term effects of internal irradiation on the murine hepatic glycogen and its metabolizing enzymes

    International Nuclear Information System (INIS)

    Gupta, N.K.

    1990-01-01

    Glycogen content and the activities of phosphorylase, phosphorhexose isomerase, glucose 6-phosphatase, glycogen synthesis' phosphorylase and succinate dehydrogenase have been biochemically determined in the liver of Swiss albino mice after radiocalcium internal irradiation up to 225 days posttreatment. Increase in the glycogen content and glycogen synthesis phosphorylase with a concomitant decrease in the activities of phosphorylase, glucose 6-phosphatase, phosphohexose isomerase and succinate dehydrogenase reveals inhibited glycolysis in the presence of normal glyogenesis and inhibited Kreb's cycle in the liver during early intervals. Decrease in the glycogen content at later stages along with decrease in the activities of all these enzymes is probably because of an inhibited glycogen biosynthesis and its catabolism through HMP shunt. (orig.)

  9. Effect of intraperitoneal selenium administration on liver glycogen levels in rats subjected to acute forced swimming.

    Science.gov (United States)

    Akil, Mustafa; Bicer, Mursel; Kilic, Mehmet; Avunduk, Mustafa Cihat; Mogulkoc, Rasim; Baltaci, Abdulkerim Kasim

    2011-03-01

    There are a few of studies examining how selenium, which is known to reduce oxidative damage in exercise, influences glucose metabolism and exhaustion in physical activity. The present study aims to examine how selenium administration affects liver glycogen levels in rats subjected to acute swimming exercise. The study included 32 Sprague-Dawley type male rats, which were equally allocated to four groups: Group 1, general control; Group 2; selenium-supplemented control (6 mg/kg/day sodium selenite); Group 3, swimming control; Group 4, selenium-supplemented swimming (6 mg/kg/day sodium selenite). Liver tissue samples collected from the animals at the end of the study were fixed in 95% ethyl alcohol. From the tissue samples buried into paraffin, 5-µm cross-sections were obtained using a microtome, put on a microscope slide, and stained with PAS. Stained preparations were assessed using a Nikon Eclipse E400 light microscope. All images obtained with the light microscope were transferred to a PC and evaluated using Clemex PE 3.5 image analysis software. The highest liver glycogen levels were found in groups 1 and 2 (p swimming exercise can be restored by selenium administration. It can be argued that physiological doses of selenium administration can contribute to performance.

  10. Effects of various types of stress on the metabolism of reserve carbohydrates in Saccharomyces cerevisiae: genetic evidence for a stress-induced recycling of glycogen and trehalose.

    Science.gov (United States)

    Parrou, J L; Teste, M A; François, J

    1997-06-01

    It is well known that glycogen and trehalose accumulate in yeast under nutrient starvation or entering into the stationary phase of growth, and that high levels of trehalose are found in heat-shocked cells. However, effects of various types of stress on trehalose, and especially on glycogen, are poorly documented. Taking into account that almost all genes encoding the enzymes involved in the metabolism of these two reserve carbohydrates contain between one and several copies of the stress-responsive element (STRE), an investigation was made of the possibility of a link between the potential transcriptional induction of these genes and the accumulation of glycogen and trehalose under different stress conditions. Using transcriptional fusions, it was found that all these genes were induced in a similar fashion, although to various extents, by temperature, osmotic and oxidative stresses. Experiments performed with an msn2/msn4 double mutant proved that the transcriptional induction of the genes encoding glycogen synthase (GSY2) and trehalose-6-phosphate synthase (TPS1) was needed for the small increase in glycogen and trehalose upon exposure to a mild heat stress and salt shock. However, the extent of transcriptional activation of these genes upon stresses in wild-type strains was not correlated with a proportional rise in either glycogen or trehalose. The major explanation for this lack of correlation comes from the fact that genes encoding the enzymes of the biosynthetic and of the biodegradative pathways were almost equally induced. Hence, trehalose and glycogen accumulated to much higher levels in cells lacking neutral trehalose or glycogen phosphorylase exposed to stress conditions, which suggested that one of the major effects of stress in yeast is to induce a wasteful expenditure of energy by increasing the recycling of these molecules. We also found that transcriptional induction of STRE-controlled genes was abolished at temperatures above 40 degree C, while

  11. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  12. A thermal after-effect of UV irradiation of muscle glycogen phosphorylase b.

    Directory of Open Access Journals (Sweden)

    Valeriya V Mikhaylova

    Full Text Available Different test systems are used to characterize the anti-aggregation efficiency of molecular chaperone proteins and of low-molecular-weight chemical chaperones. Test systems based on aggregation of UV-irradiated protein are of special interest because they allow studying the protective action of different agents at physiological temperatures. The kinetics of UV-irradiated glycogen phosphorylase b (UV-Phb from rabbit skeletal muscle was studied at 37°C using dynamic light scattering in a wide range of protein concentrations. It has been shown that the order of aggregation with respect to the protein is equal to unity. A conclusion has been made that the rate-limiting stage of the overall process of aggregation is heat-induced structural reorganization of a UV-Phb molecule, which contains concealed damage.

  13. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  14. Evidence against the selfish operon theory.

    Science.gov (United States)

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  15. Schwann Cell Glycogen Selectively Supports Myelinated Axon Function

    Science.gov (United States)

    Brown, Angus M; Evans, Richard D; Black, Joel; Ransom, Bruce R

    2012-01-01

    Objectives Interruption of energy supply to peripheral axons is a cause of axon loss. We determined if glycogen was present in mammalian peripheral nerve, and if it supported axon conduction during aglycemia. Methods We used biochemical assay and electron microscopy to determine the presence of glycogen, and electrophysiology to monitor axon function. Results Glycogen was present in sciatic nerve, its concentration varying directly with ambient [glucose]. Electron microscopy detected glycogen granules primarily in myelinating Schwann cell cytoplasm and these diminished after exposure to aglycemia. During aglycemia, conduction failure in large myelinated axons (A fibers) mirrored the time-course of glycogen loss. Latency to CAP failure was directly related to nerve glycogen content at aglycemia onset. Glycogen did not benefit the function of slow-conducting, small diameter unmyelinated axons (C fibers) during aglycemia. Blocking glycogen breakdown pharmacologically accelerated CAP failure during aglycemia in A fibers, but not in C fibers. Lactate was as effective as glucose in supporting sciatic nerve function, and was continuously released into the extracellular space in the presence of glucose and fell rapidly during aglycemia. Interpretation Our findings indicated that glycogen is present in peripheral nerve, primarily in myelinating Schwann cells, and exclusively supports large diameter, myelinated axon conduction during aglycemia. Available evidence suggests that peripheral nerve glycogen breaks down during aglycemia and is passed, probably as lactate, to myelinated axons to support function. Unmyelinated axons are not protected by glycogen and are more vulnerable to dysfunction during periods of hypoglycemia. PMID:23034913

  16. Hyper-hippocampal glycogen induced by glycogen loading with exhaustive exercise.

    Science.gov (United States)

    Soya, Mariko; Matsui, Takashi; Shima, Takeru; Jesmin, Subrina; Omi, Naomi; Soya, Hideaki

    2018-01-19

    Glycogen loading (GL), a well-known type of sports conditioning, in combination with exercise and a high carbohydrate diet (HCD) for 1 week enhances individual endurance capacity through muscle glycogen supercompensation. This exercise-diet combination is necessary for successful GL. Glycogen in the brain contributes to hippocampus-related memory functions and endurance capacity. Although the effect of HCD on the brain remains unknown, brain supercompensation occurs following exhaustive exercise (EE), a component of GL. We thus employed a rat model of GL and examined whether GL increases glycogen levels in the brain as well as in muscle, and found that GL increased glycogen levels in the hippocampus and hypothalamus, as well as in muscle. We further explored the essential components of GL (exercise and/or diet conditions) to establish a minimal model of GL focusing on the brain. Exercise, rather than a HCD, was found to be crucial for GL-induced hyper-glycogen in muscle, the hippocampus and the hypothalamus. Moreover, EE was essential for hyper-glycogen only in the hippocampus even without HCD. Here we propose the EE component of GL without HCD as a condition that enhances brain glycogen stores especially in the hippocampus, implicating a physiological strategy to enhance hippocampal functions.

  17. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  18. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  19. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  20. Effects of Enzymatically Synthesized Glycogen and Exercise on Abdominal Fat Accumulation in High-Fat Diet-Fed Mice.

    Science.gov (United States)

    Tamura, Shohei; Honda, Kazuhisa; Morinaga, Ryoji; Saneyasu, Takaoki; Kamisoyama, Hiroshi

    2017-01-01

    The combination of diet and exercise is the first choice for the treatment of obesity and metabolic syndrome. We previously reported that enzymatically synthesized glycogen (ESG) suppresses abdominal fat accumulation in obese rats. However, the effect of the combination of ESG and exercise on abdominal fat accumulation has not yet been investigated. Our goal in this study was therefore to evaluate the effects of dietary ESG and its combination with exercise on abdominal fat accumulation in high-fat diet (HFD)-fed mice. Male ICR mice were assigned to four groups: HFD, HFD containing 20% ESG, HFD with exercise, HFD containing 20% ESG with exercise. Treadmill exercise was performed for 3 wk (25 m/min, 30 min/d, 3 d/wk) after 5-d adaption to running at that speed. Both ESG and exercise significantly reduced the weights of abdominal adipose tissues. In addition, the combination of ESG and exercise significantly suppressed abdominal fat accumulation, suggesting that ESG and exercise showed an additive effect. Exercise significantly increased the mRNA levels of lipid metabolism-related genes such as lipoprotein lipase, peroxisome proliferator-activated receptor delta; factor-delta (PPARδ), carnitin palmitoyltransferase b, adipose triglyceride lipase (ATGL), and uncoupling protein-3 in the gastrocnemius muscle. On the other hand, dietary ESG significantly decreased the mRNA levels of PPARδ and ATGL in the gastrocnemius muscle. These results suggest that the combined treatment of ESG and exercise effectively suppresses abdominal fat accumulation in HFD-fed mice by different mechanisms.

  1. In vivo effects of diabetes, insulin and oleanolic acid on enzymes of glycogen metabolism in the skin of streptozotocin-induced diabetic male Sprague-Dawley rats.

    Science.gov (United States)

    Mukundwa, Andrew; Langa, Silvana O; Mukaratirwa, Samson; Masola, Bubuya

    2016-03-04

    The skin is the largest organ in the body and diabetes induces pathologic changes on the skin that affect glucose homeostasis. Changes in skin glycogen and glucose levels can mirror serum glucose levels and thus the skin might contribute to whole body glucose metabolism. This study investigated the in vivo effects of diabetes, insulin and oleanolic acid (OA) on enzymes of glycogen metabolism in skin of type 1 diabetic rats. Diabetic and non-diabetic adult male Sprague-Dawley rats were treated with a single daily dose of insulin (4 IU/kg body weight), OA (80 mg/kg body weight) and a combination of OA + insulin for 14 days. Glycogen phosphorylase (GP) expression; and GP, glycogen synthase (GS) and hexokinase activities as well glycogen levels were evaluated. The results suggest that diabetes lowers hexokinase activity, GP activity and GP expression with no change in GS activity whilst the treatments increased GP expression and the activities of hexokinase, GP and GS except for the GS activity in OA treated rats. Glycogen levels were increased slightly by diabetes as well as OA treatment. In conclusion diabetes, OA and insulin can lead to changes in GS and GP activities in skin without significantly altering the glycogen content. We suggest that the skin may contribute to whole body glucose homeostasis particularly in disease states. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Short and Long Term Effects of High-Intensity Interval Training on Hormones, Metabolites, Antioxidant System, Glycogen Concentration, and Aerobic Performance Adaptations in Rats

    OpenAIRE

    de Araujo, Gustavo G.; Papoti, Marcelo; dos Reis, Ivan Gustavo Masselli; de Mello, Maria A. R.; Gobatto, Claudio A.

    2016-01-01

    The purpose of the study was to investigate the effects of short and long term High-Intensity Interval Training (HIIT) on anaerobic and aerobic performance, creatinine, uric acid, urea, creatine kinase, lactate dehydrogenase, catalase, superoxide dismutase, testosterone, corticosterone, and glycogen concentration (liver, soleus, and gastrocnemius). The Wistar rats were separated in two groups: HIIT and sedentary/control (CT). The lactate minimum (LM) was used to evaluate the aerobic and anaer...

  3. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  4. Increased subsarcolemmal lipids in type 2 diabetes: effect of training on localization of lipids, mitochondria, and glycogen in sedentary human skeletal muscle

    DEFF Research Database (Denmark)

    Nielsen, Joachim; Hey-Mogensen, Martin; Vind, Birgitte F

    2010-01-01

    The purpose of the study was to investigate the effect of aerobic training and type 2 diabetes on intramyocellular localization of lipids, mitochondria, and glycogen. Obese type 2 diabetic patients (n = 12) and matched obese controls (n = 12) participated in aerobic cycling training for 10 wk....... Endurance-trained athletes (n = 15) were included for comparison. Insulin action was determined by euglycemic-hyperinsulinemic clamp. Intramyocellular contents of lipids, mitochondria, and glycogen at different subcellular compartments were assessed by transmission electron microscopy in biopsies obtained...... from vastus lateralis muscle. Type 2 diabetic patients were more insulin resistant than obese controls and had threefold higher volume of subsarcolemmal (SS) lipids compared with obese controls and endurance-trained subjects. No difference was found in intermyofibrillar lipids. Importantly, following...

  5. Effect of heavy metals on the level of vitamin E, total lipid and glycogen reserves in the liver of common carp (Cyprinus carpio L.

    Directory of Open Access Journals (Sweden)

    Vinodhini Rajamanickam

    2008-06-01

    Full Text Available The aim of this study is to examine some changes in the biochemical profile of the liver tissue of common carp (Cyprinus carpio L. exposed to a sublethal concentration of heavy metal mixture (cadmium, chromium, nickel and lead. The biochemical profile, specifically glycogen, total lipid and vitamin E content in the liver tissue was examined and compared to that of the control group. The exposed group showed a marked decline in glycogen and vitamin E reserves. Conversely an increase in total lipid in comparison to control was observed. The result reflects the sensitivity of these biochemical parameters to the effects of sublethal levels of combined heavy metals for this the widely consumed freshwater fish.

  6. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  7. The effect of free glutamine and peptide ingestion on the rate of muscle glycogen resynthesis in man

    DEFF Research Database (Denmark)

    Van Hall, Gerrit; Saris, W H; van de Schoor, P A

    2000-01-01

    hydrolysate (26% glutamine) and 3) a whey hydrolysate (6.6% glutamine). Plasma glutamine, decreased by approximately 20% during recovery with ingestion of the control drink, no changes with ingestion of the protein hydrolysates drinks, and a 2-fold increase with ingestion of the free glutamine drinks....... The rate of glycogen resynthesis was not significantly different in the four tests: 28 +/- 5, 26 +/- 6, 33 +/- 4, and 34 +/- 3 mmol glucosyl units x kg(-1) dry weight muscle x h(-1) for the control, glutamine, wheat- and whey hydrolysate ingestion, respectively. It is concluded that ingestion...... of a glutamine/carbohydrate mixture does not increase the rate of glycogen resynthesis in muscle. Glycogen resynthesis rates were higher, although not statistically significant, after ingestion of the drink containing the wheat (21 +/- 8%) and whey protein hydrolysate (20 +/- 6%) compared to ingestion...

  8. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  9. Fed-batch cultivation of baker's yeast followed by nitrogen or carbon starvation: effects on fermentative capacity and content of trehalose and glycogen

    DEFF Research Database (Denmark)

    Jørgensen, Henning; Olsson, Lisbeth; Rønnow, B.

    2002-01-01

    , trehalose and glycogen. Nitrogen starvation triggered the accumulation of trehalose and glycogen. After 8 h of starvation, the content of trehalose and glycogen was increased 4-fold and 2-fold, respectively. Carbon starvation resulted in a partial conversion of glycogen into trehalose. The trehalose content...... increased from 45 to 64 mg (g dry-weight)(-1), whereas the glycogen content in the same period was reduced from 55 to 5 mg (g dry-weight)(-1). Glycogen was consumed faster than trehalose during storage of the starved yeast for 1 month. Nitrogen starvation resulted in a decrease in the protein content...

  10. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  11. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  12. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  13. Investigation and management of the hepatic glycogen storage diseases.

    Science.gov (United States)

    Bhattacharya, Kaustuv

    2015-07-01

    The glycogen storage diseases (GSD) comprise a group of disorders that involve the disruption of metabolism of glycogen. Glycogen is stored in various organs including skeletal muscle, the kidneys and liver. The liver stores glycogen to supply the rest of the body with glucose when required. Therefore, disruption of this process can lead to hypoglycaemia. If glycogen is not broken down effectively, this can lead to hepatomegaly. Glycogen synthase deficiency leads to impaired glycogen synthesis and consequently the liver is small. Glycogen brancher deficiency can lead to abnormal glycogen being stored in the liver leading to a quite different disorder of progressive liver dysfunction. Understanding the physiology of GSD I, III, VI and IX guides dietary treatments and the provision of appropriate amounts and types of carbohydrates. There has been recent re-emergence in the literature of the use of ketones in therapy, either in the form of the salt D,L-3-hydroxybutyrate or medium chain triglyceride (MCT). High protein diets have also been advocated. Alternative waxy maize based starches seem to show promising early data of efficacy. There are many complications of each of these disorders and they need to be prospectively surveyed and managed. Liver and kidney transplantation is still indicated in severe refractory disease.

  14. Drug induced exocytosis of glycogen in Pompe disease.

    Science.gov (United States)

    Turner, Christopher T; Fuller, Maria; Hopwood, John J; Meikle, Peter J; Brooks, Doug A

    2016-10-28

    Pompe disease is caused by a deficiency in the lysosomal enzyme α-glucosidase, and this leads to glycogen accumulation in the autolysosomes of patient cells. Glycogen storage material is exocytosed at a basal rate in cultured Pompe cells, with one study showing up to 80% is released under specific culture conditions. Critically, exocytosis induction may reduce glycogen storage in Pompe patients, providing the basis for a therapeutic strategy whereby stored glycogen is redirected to an extracellular location and subsequently degraded by circulating amylases. The focus of the current study was to identify compounds capable of inducing rapid glycogen exocytosis in cultured Pompe cells. Here, calcimycin, lysophosphatidylcholine and α-l-iduronidase each significantly increased glycogen exocytosis compared to vehicle-treated controls. The most effective compound, calcimycin, induced exocytosis through a Ca 2+ -dependent mechanism, although was unable to release a pool of vesicular glycogen larger than the calcimycin-induced exocytic pore. There was reduced glycogen release from Pompe compared to unaffected cells, primarily due to increased granule size in Pompe cells. Drug induced exocytosis therefore shows promise as a therapeutic approach for Pompe patients but strategies are required to enhance the release of large molecular weight glycogen granules. Copyright © 2016. Published by Elsevier Inc.

  15. Glycogen availability and skeletal muscle adaptations with endurance and resistance exercise

    NARCIS (Netherlands)

    Knuiman, Pim; Hopman, Maria T.E.; Mensink, Marco

    2015-01-01

    It is well established that glycogen depletion affects endurance exercise performance negatively. Moreover, numerous studies have demonstrated that post-exercise carbohydrate ingestion improves exercise recovery by increasing glycogen resynthesis. However, recent research into the effects of

  16. Mountain-bike racing – the influence of prior glycogen- reducing ...

    African Journals Online (AJOL)

    bout of glycogen-reducing exercise on the general stress and immune response to ..... interaction effect of glutamine supplementation and glycogen reduction on the .... Hammarqvist F, Ejesson B, Wernerman J. Stress hormones initiate pro-.

  17. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Effect of increased natural radiation background on glycogen content of peripheral blood leukocytes of microtus oeconomus Pall

    International Nuclear Information System (INIS)

    Materij, L.D.; Maslova, K.I.

    1984-01-01

    In experiments on Microtus oeconomus Pall, living in natural conditions with normal (0.72-1.08 pA/kg) and increased (3.6-1440 pA/kg) levels of external gamma-radiation and affected by numerous incorporated radionuclides, the differences were detected, by the cytochemical method, both in the total glycogen content of eucocytes and in the type of grouping of cells depending on the cegre of their saturation with polysaccharide

  19. Free fatty acids increase hepatic glycogen content in obese males

    NARCIS (Netherlands)

    Allick, G.; Sprangers, F.; Weverling, G. J.; Ackermans, M. T.; Meijer, A. J.; Romijn, J. A.; Endert, E.; Bisschop, P. H.; Sauerwein, H. P.

    2004-01-01

    Obesity is associated with increased hepatic glycogen content. In vivo and in vitro data suggest that plasma free fatty acids (FFA) may cause this increase. In this study we investigated the effect of physiological plasma FFA levels on hepatic glycogen metabolism by studying intrahepatic glucose

  20. Exercise in muscle glycogen storage diseases.

    Science.gov (United States)

    Preisler, Nicolai; Haller, Ronald G; Vissing, John

    2015-05-01

    Glycogen storage diseases (GSD) are inborn errors of glycogen or glucose metabolism. In the GSDs that affect muscle, the consequence of a block in skeletal muscle glycogen breakdown or glucose use, is an impairment of muscular performance and exercise intolerance, owing to 1) an increase in glycogen storage that disrupts contractile function and/or 2) a reduced substrate turnover below the block, which inhibits skeletal muscle ATP production. Immobility is associated with metabolic alterations in muscle leading to an increased dependence on glycogen use and a reduced capacity for fatty acid oxidation. Such changes may be detrimental for persons with GSD from a metabolic perspective. However, exercise may alter skeletal muscle substrate metabolism in ways that are beneficial for patients with GSD, such as improving exercise tolerance and increasing fatty acid oxidation. In addition, a regular exercise program has the potential to improve general health and fitness and improve quality of life, if executed properly. In this review, we describe skeletal muscle substrate use during exercise in GSDs, and how blocks in metabolic pathways affect exercise tolerance in GSDs. We review the studies that have examined the effect of regular exercise training in different types of GSD. Finally, we consider how oral substrate supplementation can improve exercise tolerance and we discuss the precautions that apply to persons with GSD that engage in exercise.

  1. Effect of whey protein- and carbohydrate-enriched diet on glycogen resynthesis during the first 48 h after a soccer game

    DEFF Research Database (Denmark)

    Gunnarsson, Thomas Gunnar Petursson; Bendiksen, Mads; Bischoff, R.

    2013-01-01

    The effect of a whey protein- and carbohydrate (CHO)-enriched diet on the rate of muscle glycogen resynthesis after a soccer match was examined. Sixteen elite soccer players were randomly assigned to a group ingesting a diet rich in carbohydrates and whey protein [CHO, protein, and fat content...... was 71, 21, and 8E%, respectively; high content of carbohydrates and whey protein (HCP), n¿=¿9] or a group ingesting a normal diet (55, 18, and 26E%; control [CON], n¿=¿7) during a 48-h recovery period after a soccer match. CON and three additional players carried out a 90- and 60-min simulated match...

  2. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  3. Exercise in muscle glycogen storage diseases

    DEFF Research Database (Denmark)

    Preisler, Nicolai Rasmus; Haller, Ronald G; Vissing, John

    2015-01-01

    exercise program has the potential to improve general health and fitness and improve quality of life, if executed properly. In this review, we describe skeletal muscle substrate use during exercise in GSDs, and how blocks in metabolic pathways affect exercise tolerance in GSDs. We review the studies...... that have examined the effect of regular exercise training in different types of GSD. Finally, we consider how oral substrate supplementation can improve exercise tolerance and we discuss the precautions that apply to persons with GSD that engage in exercise.......Glycogen storage diseases (GSD) are inborn errors of glycogen or glucose metabolism. In the GSDs that affect muscle, the consequence of a block in skeletal muscle glycogen breakdown or glucose use, is an impairment of muscular performance and exercise intolerance, owing to 1) an increase...

  4. Glycogen phosphorylation and Lafora disease.

    Science.gov (United States)

    Roach, Peter J

    2015-12-01

    Covalent phosphorylation of glycogen, first described 35 years ago, was put on firm ground through the work of the Whelan laboratory in the 1990s. But glycogen phosphorylation lay fallow until interest was rekindled in the mid 2000s by the finding that it could be removed by a glycogen-binding phosphatase, laforin, and that mutations in laforin cause a fatal teenage-onset epilepsy, called Lafora disease. Glycogen phosphorylation is due to phosphomonoesters at C2, C3 and C6 of glucose residues. Phosphate is rare, ranging from 1:500 to 1:5000 phosphates/glucose depending on the glycogen source. The mechanisms of glycogen phosphorylation remain under investigation but one hypothesis to explain C2 and perhaps C3 phosphate is that it results from a rare side reaction of the normal synthetic enzyme glycogen synthase. Lafora disease is likely caused by over-accumulation of abnormal glycogen in insoluble deposits termed Lafora bodies in neurons. The abnormality in the glycogen correlates with elevated phosphorylation (at C2, C3 and C6), reduced branching, insolubility and an enhanced tendency to aggregate and become insoluble. Hyperphosphorylation of glycogen is emerging as an important feature of this deadly childhood disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Molecular Basis of Impaired Glycogen Metabolism during Ischemic Stroke and Hypoxia

    Science.gov (United States)

    Hossain, Mohammed Iqbal; Roulston, Carli Lorraine; Stapleton, David Ian

    2014-01-01

    Background Ischemic stroke is the combinatorial effect of many pathological processes including the loss of energy supplies, excessive intracellular calcium accumulation, oxidative stress, and inflammatory responses. The brain's ability to maintain energy demand through this process involves metabolism of glycogen, which is critical for release of stored glucose. However, regulation of glycogen metabolism in ischemic stroke remains unknown. In the present study, we investigate the role and regulation of glycogen metabolizing enzymes and their effects on the fate of glycogen during ischemic stroke. Results Ischemic stroke was induced in rats by peri-vascular application of the vasoconstrictor endothelin-1 and forebrains were collected at 1, 3, 6 and 24 hours post-stroke. Glycogen levels and the expression and activity of enzymes involved in glycogen metabolism were analyzed. We found elevated glycogen levels in the ipsilateral hemispheres compared with contralateral hemispheres at 6 and 24 hours (25% and 39% increase respectively; PGlycogen synthase activity and glycogen branching enzyme expression were found to be similar between the ipsilateral, contralateral, and sham control hemispheres. In contrast, the rate-limiting enzyme for glycogen breakdown, glycogen phosphorylase, had 58% lower activity (Pglycogen debranching enzyme expression 24 hours post-stroke was 77% (Pglycogen phosphorylase activity and increased glycogen accumulation but did not alter glycogen synthase activity. Furthermore, elevated glycogen levels provided metabolic support to astrocytes during hypoxia. Conclusion Our study has identified that glycogen breakdown is impaired during ischemic stroke, the molecular basis of which includes reduced glycogen debranching enzyme expression level together with reduced glycogen phosphorylase and PKA activity. PMID:24858129

  6. Synthesis of glycogen from fructose in the presence of elevated levels of glycogen phosphorylase a in rat hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Massagué, J; Salavert, A; Guinovart, J J

    1980-03-20

    Incubation of hepatocytes with glucose promoted the increase in the glycogen synthase (-glucose 6-phosphate/+glucose 6-phosphate) activity ratio, the decrease in the levels of phosphorylase a and a marked increase in the intracellular glycogen level. Incubation with fructose alone promoted the simultaneous activation of glycogen synthase and increase in the levels of phosphorylase a. Strikingly, glycogen deposition occurred in spite of the elevated levels of phosphorylase a. When glucose and fructose were added to the media the activation of glycogen synthase was always higher than when the hexoses were added separately. On the other hand the effects on glycogen phosphorylase were a function of the relative concentrations of both sugars. Inactivation of glycogen phosphorylase occurred when the fructose to glucose ratio was low while activation took place when the ratio was high. The simultaneous presence of glucose and fructose resulted, in all cases, in an enhancement in the deposition of glycogen. The effects described were not limited to fructose as D-glyceraldehyde, dihydroxyacetone, L-sorbose, D-tagatose and sorbitol, compounds metabolically related to fructose, provoked the same behaviour.

  7. Muscle glycogen and cell function--Location, location, location.

    Science.gov (United States)

    Ørtenblad, N; Nielsen, J

    2015-12-01

    The importance of glycogen, as a fuel during exercise, is a fundamental concept in exercise physiology. The use of electron microscopy has revealed that glycogen is not evenly distributed in skeletal muscle fibers, but rather localized in distinct pools. In this review, we present the available evidence regarding the subcellular localization of glycogen in skeletal muscle and discuss this from the perspective of skeletal muscle fiber function. The distribution of glycogen in the defined pools within the skeletal muscle varies depending on exercise intensity, fiber phenotype, training status, and immobilization. Furthermore, these defined pools may serve specific functions in the cell. Specifically, reduced levels of these pools of glycogen are associated with reduced SR Ca(2+) release, muscle relaxation rate, and membrane excitability. Collectively, the available literature strongly demonstrates that the subcellular localization of glycogen has to be considered to fully understand the role of glycogen metabolism and signaling in skeletal muscle function. Here, we propose that the effect of low muscle glycogen on excitation-contraction coupling may serve as a built-in mechanism, which links the energetic state of the muscle fiber to energy utilization. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Effect of Entodinium caudatum on starch intake and glycogen formation by Eudiplodinium maggii in the rumen and reticulum.

    Science.gov (United States)

    Bełżecki, Grzegorz; McEwan, Neil R; Kowalik, Barbara; Michałowski, Tadeusz; Miltko, Renata

    2017-02-01

    This study aimed to quantify the engulfed starch and reserve α-glucans (glycogen) in the cells of the ciliates Eudiplodinium maggii, as well the α-glucans in defaunated and selectively faunated sheep. The content of starch inside the cell of ciliates varied from 21 to 183mg/g protozoal DM relative to the rumen fauna composition whereas, the glycogen fluctuated between 17 and 126mg/g dry matter (DM) of this ciliate species. Establishment of the population Entodinium caudatum in the rumen of sheep already faunated with E. maggii caused a drop in both types of quantified carbohydrates. The content of α-glucans in the rumen of defaunated sheep varied from 4.4 to 19.9mg/g DM and increased to 7.4-29.9 or 11.8-33.9mg/g DM of rumen contents in the presence of only E. maggii or E. maggii and E. caudatum, respectively. The lowest content of the carbohydrates was always found just before feeding and the highest at 4h thereafter. The α-glucans in the reticulum varied 7.5-40.1, 14.3-76.8 or 21.9-106.1mg/g DM of reticulum content for defaunated, monofaunated or bifaunated sheep, respectively. The results indicated that both ciliate species engulf starch granules and convert the digestion products to the glycogen, diminishing the pool of starch available for amylolytic bacteria. Copyright © 2016 Elsevier GmbH. All rights reserved.

  9. Muscle and liver glycogen, protein, and triglyceride in the rat

    DEFF Research Database (Denmark)

    Richter, Erik; Sonne, Bente; Joensen Mikines, Kari

    1984-01-01

    in skeletal muscle was accompanied by increased breakdown of triglyceride and/or protein. Thus, the effect of exhausting swimming and of running on concentrations of glycogen, protein, and triglyceride in skeletal muscle and liver were studied in rats with and without deficiencies of the sympatho......-adrenal system. In control rats, both swimming and running decreased the concentration of glycogen in fast-twitch red and slow-twitch red muscle whereas concentrations of protein and triglyceride did not decrease. In the liver, swimming depleted glycogen stores but protein and triglyceride concentrations did...... not decrease. In exercising rats, muscle glycogen breakdown was impaired by adrenodemedullation and restored by infusion of epinephrine. However, impaired glycogen breakdown during exercise was not accompanied by a significant net breakdown of protein or triglyceride. Surgical sympathectomy of the muscles did...

  10. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Science.gov (United States)

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  11. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  12. Effect of fasting and different diets on 14C incorporation from U-14C glucose into glycogen and carbon dioxide by cerebral cortical slices of rats

    International Nuclear Information System (INIS)

    Visweswaran, P.; Binod Kumar; Sinha, A.P.; Suraiya, A.; Brahamchari, A.K.; Singh, S.P.

    1994-01-01

    There are some reports regarding change in the glycogen level due to fasting. Here an attempt is made by keeping the albino rats under fasting or feeding different diets on the rate of 14 C incorporation into glycogen and carbon dioxide from U- 14 C glucose. Our study reveals that the above conditions do not alter any significant change in the glycogen and carbon dioxide in the cerebral cortical slices of albino rats. (author). 8 refs., 1 tab

  13. Effect of irradiation with fast electrons on the uridindiphosphateglucose mechanism of glycogen synthesis in NKly tumours, spleen and liver of mice having tumours

    International Nuclear Information System (INIS)

    Goryukhina, T.A.; Misheneva, V.S.; Burova, T.M.; Seits, I.F.

    1976-01-01

    A marked and stable decrease in the glycogen content of the liver has been observed within the entire 96-hour period after a single exposure to fast electrons (1000 rads) of mice having NKly tumour. Tumour cells maintain a low glycogen level that is peculiar for them. Activity of enzymes (UDPG-pyrophosphorylase, phosphoglucomutase and UDPG-glycogensynthetase) considerably changes but, in most cases, there is no parallelism between the glycogen content and glycogensynthetase activity

  14. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Science.gov (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  16. Short and Long Term Effects of High-Intensity Interval Training on Hormones, Metabolites, Antioxidant System, Glycogen Concentration, and Aerobic Performance Adaptations in Rats.

    Science.gov (United States)

    de Araujo, Gustavo G; Papoti, Marcelo; Dos Reis, Ivan Gustavo Masselli; de Mello, Maria A R; Gobatto, Claudio A

    2016-01-01

    The purpose of the study was to investigate the effects of short and long term High-Intensity Interval Training (HIIT) on anaerobic and aerobic performance, creatinine, uric acid, urea, creatine kinase, lactate dehydrogenase, catalase, superoxide dismutase, testosterone, corticosterone, and glycogen concentration (liver, soleus, and gastrocnemius). The Wistar rats were separated in two groups: HIIT and sedentary/control (CT). The lactate minimum (LM) was used to evaluate the aerobic and anaerobic performance (AP) (baseline, 6, and 12 weeks). The lactate peak determination consisted of two swim bouts at 13% of body weight (bw): (1) 30 s of effort; (2) 30 s of passive recovery; (3) exercise until exhaustion (AP). Tethered loads equivalent to 3.5, 4.0, 4.5, 5.0, 5.5, and 6.5% bw were performed in incremental phase. The aerobic capacity in HIIT group increased after 12 weeks (5.2 ± 0.2% bw) in relation to baseline (4.4 ± 0.2% bw), but not after 6 weeks (4.5 ± 0.3% bw). The exhaustion time in HIIT group showed higher values than CT after 6 (HIIT = 58 ± 5 s; CT = 40 ± 7 s) and 12 weeks (HIIT = 62 ± 7 s; CT = 49 ± 3 s). Glycogen (mg/100 mg) increased in gastrocnemius for HIIT group after 6 weeks (0.757 ± 0.076) and 12 weeks (1.014 ± 0.157) in comparison to baseline (0.358 ± 0.024). In soleus, the HIIT increased glycogen after 6 weeks (0.738 ± 0.057) and 12 weeks (0.709 ± 0.085) in comparison to baseline (0.417 ± 0.035). The glycogen in liver increased after HIIT 12 weeks (4.079 ± 0.319) in relation to baseline (2.400 ± 0.416). The corticosterone (ng/mL) in HIIT increased after 6 weeks (529.0 ± 30.5) and reduced after 12 weeks (153.6 ± 14.5) in comparison to baseline (370.0 ± 18.3). In conclusion, long term HIIT enhanced the aerobic capacity, but short term was not enough to cause aerobic adaptations. The anaerobic performance increased in HIIT short and long term compared with CT, without differences between HIIT short and long term. Furthermore, the

  17. SHORT AND LONG TERM EFFECTS OF HIGH-INTENSITY INTERVAL TRAINING ON HORMONES, METABOLITES, ANTIOXIDANT SYSTEM, GLYCOGEN CONCENTRATION AND AEROBIC PERFORMANCE ADAPTATIONS IN RATS

    Directory of Open Access Journals (Sweden)

    Gustavo Gomes De Araujo

    2016-10-01

    Full Text Available The purpose of the study was to investigate the effects of short and long term High-Intensity Interval Training (HIIT on anaerobic and aerobic performance, creatinine, uric acid, urea, creatine kinase, lactate dehydrogenase, catalase, superoxide dismutase, testosterone, corticosterone and glycogen concentration (liver, soleus and gastrocnemius. The Wistar were separated in two groups: HIIT and sedentary/control (CT. The lactate minimum (LM was used to evaluate the aerobic and anaerobic performance (AP (baseline, 6 and 12 wk. The lactate peak determination consisted of two swim bouts at 13% of body weight (bw: 1 30 s of effort; 2 30 s of passive recovery; 3 exercise until exhaustion (AP. Tethered loads equivalent to 3.5, 4.0, 4.5, 5.0, 5.5 and 6.5% bw were performed in incremental phase. The aerobic capacity in HIIT group increased after 12 wk (5.2±0.2 % bw in relation to baseline (4.4±0.2 % bw, but not after 6 wk (4.5±0.3 % bw. The exhaustion time in HIIT group showed higher values than CT after 6 (HIIT= 58±5 s; CT=40±7 s and 12 wk (HIIT=62±7 s; CT=49±3 s. Glycogen (mg/100mg increased in gastrocnemius for HIIT group after 6 wk (0.757±0.076 and 12 wk (1.014±0.157 in comparison to baseline (0.358±0.024. In soleus, the HIIT increased glycogen after 6 wk (0.738±0.057 and 12 wk (0.709±0.085 in comparison to baseline (0.417±0.035. The glycogen in liver increased after HIIT 12 wk (4.079±0.319 in relation to baseline (2.400±0.416. The corticosterone (ng/mL in HIIT increased after 6 wk (529.0±30.5 and reduced after 12 wk (153.6±14.5 in comparison to baseline (370.0±18.3. In conclusion, long term HIIT enhanced the aerobic capacity, but short term (6wk was not enough to cause aerobic adaptations. The anaerobic performance increased in HIIT short and long term compared with CT, without differences between HIIT short and long term. Furthermore, the glycogen super-compensantion increased after short and long term HIIT in comparison to

  18. Glycogen Storage Disease Type IV

    DEFF Research Database (Denmark)

    Bendroth-Asmussen, Lisa; Aksglaede, Lise; Gernow, Anne B

    2016-01-01

    molecular genetic analyses confirmed glycogen storage disease Type IV with the finding of compound heterozygosity for 2 mutations (c.691+2T>C and c.1570C>T, p.R524X) in the GBE1 gene. We conclude that glycogen storage disease Type IV can cause early miscarriage and that diagnosis can initially be made...

  19. Insights into Brain Glycogen Metabolism

    Science.gov (United States)

    Mathieu, Cécile; de la Sierra-Gallay, Ines Li; Duval, Romain; Xu, Ximing; Cocaign, Angélique; Léger, Thibaut; Woffendin, Gary; Camadro, Jean-Michel; Etchebest, Catherine; Haouz, Ahmed; Dupret, Jean-Marie; Rodrigues-Lima, Fernando

    2016-01-01

    Brain glycogen metabolism plays a critical role in major brain functions such as learning or memory consolidation. However, alteration of glycogen metabolism and glycogen accumulation in the brain contributes to neurodegeneration as observed in Lafora disease. Glycogen phosphorylase (GP), a key enzyme in glycogen metabolism, catalyzes the rate-limiting step of glycogen mobilization. Moreover, the allosteric regulation of the three GP isozymes (muscle, liver, and brain) by metabolites and phosphorylation, in response to hormonal signaling, fine-tunes glycogenolysis to fulfill energetic and metabolic requirements. Whereas the structures of muscle and liver GPs have been known for decades, the structure of brain GP (bGP) has remained elusive despite its critical role in brain glycogen metabolism. Here, we report the crystal structure of human bGP in complex with PEG 400 (2.5 Å) and in complex with its allosteric activator AMP (3.4 Å). These structures demonstrate that bGP has a closer structural relationship with muscle GP, which is also activated by AMP, contrary to liver GP, which is not. Importantly, despite the structural similarities between human bGP and the two other mammalian isozymes, the bGP structures reveal molecular features unique to the brain isozyme that provide a deeper understanding of the differences in the activation properties of these allosteric enzymes by the allosteric effector AMP. Overall, our study further supports that the distinct structural and regulatory properties of GP isozymes contribute to the different functions of muscle, liver, and brain glycogen. PMID:27402852

  20. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    OpenAIRE

    E. Ruchti; P.J. Roach; A.A. DePaoli-Roach; P.J. Magistretti; I. Allaman

    2016-01-01

    The storage and use of glycogen, the main energy reserve in the brain, is a metabolic feature of astrocytes. Glycogen synthesis is regulated by Protein Targeting to Glycogen (PTG), a member of specific glycogen-binding subunits of protein phosphatase-1 (PPP1). It positively regulates glycogen synthesis through de-phosphorylation of both glycogen synthase (activation) and glycogen phosphorylase (inactivation). In cultured astrocytes, PTG mRNA levels were previously shown to be enhanced by the ...

  1. Glycogen metabolism and the homeostatic regulation of sleep

    KAUST Repository

    Petit, Jean-Marie

    2014-11-16

    In 1995 Benington and Heller formulated an energy hypothesis of sleep centered on a key role of glycogen. It was postulated that a major function of sleep is to replenish glycogen stores in the brain that have been depleted during wakefulness which is associated to an increased energy demand. Astrocytic glycogen depletion participates to an increase of extracellular adenosine release which influences sleep homeostasis. Here, we will review some evidence obtained by studies addressing the question of a key role played by glycogen metabolism in sleep regulation as proposed by this hypothesis or by an alternative hypothesis named “glycogenetic” hypothesis as well as the importance of the confounding effect of glucocorticoïds. Even though actual collected data argue in favor of a role of sleep in brain energy balance-homeostasis, they do not support a critical and direct involvement of glycogen metabolism on sleep regulation. For instance, glycogen levels during the sleep-wake cycle are driven by different physiological signals and therefore appear more as a marker-integrator of brain energy status than a direct regulator of sleep homeostasis. In support of this we provide evidence that blockade of glycogen mobilization does not induce more sleep episodes during the active period while locomotor activity is reduced. These observations do not invalidate the energy hypothesis of sleep but indicate that underlying cellular mechanisms are more complex than postulated by Benington and Heller.

  2. Glycogen synthase activation by sugars in isolated hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  3. Metformin normalizes the structural changes in glycogen preceding prediabetes in mice overexpressing neuropeptide Y in noradrenergic neurons.

    Science.gov (United States)

    Ailanen, Liisa; Bezborodkina, Natalia N; Virtanen, Laura; Ruohonen, Suvi T; Malova, Anastasia V; Okovityi, Sergey V; Chistyakova, Elizaveta Y; Savontaus, Eriika

    2018-04-01

    Hepatic insulin resistance and increased gluconeogenesis are known therapeutic targets of metformin, but the role of hepatic glycogen in the pathogenesis of diabetes is less clear. Mouse model of neuropeptide Y (NPY) overexpression in noradrenergic neurons (OE-NPY D βH ) with a phenotype of late onset obesity, hepatosteatosis, and prediabetes was used to study early changes in glycogen structure and metabolism preceding prediabetes. Furthermore, the effect of the anti-hyperglycemic agent, metformin (300 mg/kg/day/4 weeks in drinking water), was assessed on changes in glycogen metabolism, body weight, fat mass, and glucose tolerance. Glycogen structure was characterized by cytofluorometric analysis in isolated hepatocytes and mRNA expression of key enzymes by qPCR. OE-NPY D βH mice displayed decreased labile glycogen fraction relative to stabile fraction (the intermediate form of glycogen) suggesting enhanced glycogen cycling. This was supported by decreased filling of glucose residues in the 10th outer tier of the glycogen molecule, which suggests accelerated glycogen phosphorylation. Metformin reduced fat mass gain in both genotypes, but glucose tolerance was improved mostly in wild-type mice. However, metformin inhibited glycogen accumulation and normalized the ratio between glycogen structures in OE-NPY D βH mice indicating decreased glycogen synthesis. Furthermore, the presence of glucose residues in the 11th tier together with decreased glycogen phosphorylase expression suggested inhibition of glycogen degradation. In conclusion, structural changes in glycogen of OE-NPY D βH mice point to increased glycogen metabolism, which may predispose them to prediabetes. Metformin treatment normalizes these changes and suppresses both glycogen synthesis and phosphorylation, which may contribute to its preventive effect on the onset of diabetes.

  4. Is Glycogenin Essential for Glycogen Synthesis?

    Science.gov (United States)

    Oldfors, Anders

    2017-07-05

    Glycogen synthesis requires a priming oligosaccharide, formed by autoglucosylation of glycogenin, a core protein in glycogen particles. In this edition of Cell Metabolism, Testoni et al. (2017) challenge this generally accepted concept by demonstrating that glycogenin inactivation in mice results in an increased amount of glycogen and not glycogen depletion. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Exercise Training-Induced Adaptations Associated with Increases in Skeletal Muscle Glycogen Content

    Science.gov (United States)

    Manabe, Yasuko; Gollisch, Katja S.C.; Holton, Laura; Kim, Young–Bum; Brandauer, Josef; Fujii, Nobuharu L.; Hirshman, Michael F.; Goodyear, Laurie J.

    2012-01-01

    Chronic exercise training results in numerous skeletal muscle adaptations, including increases in insulin sensitivity and glycogen content. To understand the mechanism for increased muscle glycogen, we studied the effects of exercise training on glycogen regulatory proteins in rat skeletal muscle. Female Sprague Dawley rats performed voluntary wheel running for 1, 4, or 7 weeks. After 7 weeks of training, insulin-stimulated glucose uptake was increased in epitrochlearis muscle. Compared to sedentary control rats, muscle glycogen did not change after 1 week of training, but increased significantly after 4 and 7 weeks. The increases in muscle glycogen were accompanied by elevated glycogen synthase activity and protein expression. To assess the regulation of glycogen synthase, we examined its major activator, protein phosphatase 1 (PP1), and its major deactivator, glycogen synthase kinase 3 (GSK3). Consistent with glycogen synthase activity, PP1 activity was unchanged after 1 week of training but significantly increased after 4 and 7 weeks of training. Protein expression of RGL(GM), another regulatory PP1 subunit, significantly decreased after 4 and 7 weeks of training. Unlike PP1, GSK3 phosphorylation did not follow the pattern of glycogen synthase activity. The ~40% decrease in GSK-3α phosphorylation after 1 week of exercise training persisted until 7 weeks and may function as a negative feedback to elevated glycogen. Our findings suggest that exercise training-induced increases in muscle glycogen content could be regulated by multiple mechanisms including enhanced insulin sensitivity, glycogen synthase expression, allosteric activation of glycogen synthase and PP1activity. PMID:23206309

  6. The Staphylococcus aureus group II biotin protein ligase BirA is an effective regulator of biotin operon transcription and requires the DNA binding domain for full enzymatic activity.

    Science.gov (United States)

    Henke, Sarah K; Cronan, John E

    2016-11-01

    Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.

  7. Type I Glycogen Storage Disease

    Science.gov (United States)

    ... Legacy Society Make Gifts of Stock Donate Your Car Personal Fundraising Partnership & Support Share Your Story Spread the Word Give While You Shop Contact Us Donate Now Glycogen Storage Disease Type ...

  8. Type I Glycogen Storage Disease

    Science.gov (United States)

    ... the most common form of glycogen storage disease, accounting for 25% of all cases. It is an ... Links Videos Webinars About ALF OVERVIEW Programs About Liver Disease Ask the Experts People ALF ...

  9. Protein targeting to glycogen is a master regulator of glycogen synthesis in astrocytes

    KAUST Repository

    Ruchti, E.; Roach, P.J.; DePaoli-Roach, A.A.; Magistretti, Pierre J.; Allaman, I.

    2016-01-01

    to induce glycogen synthesis and accumulation. In contrast, siRNA-mediated downregulation of PTG resulted in a 2-fold decrease in glycogen levels. Interestingly, PTG downregulation strongly impaired long-term astrocytic glycogen synthesis induced by insulin

  10. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  11. Stochastic simulations of the tetracycline operon

    Science.gov (United States)

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  12. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  13. Effects of hypoxia on ionic regulation, glycogen utilization and antioxidative ability in the gills and liver of the aquatic air-breathing fish Trichogaster microlepis.

    Science.gov (United States)

    Huang, Chun-Yen; Lin, Hui-Chen; Lin, Cheng-Huang

    2015-01-01

    We examined the hypothesis that Trichogaster microlepis, a fish with an accessory air-breathing organ, uses a compensatory strategy involving changes in both behavior and protein levels to enhance its gas exchange ability. This compensatory strategy enables the gill ion-regulatory metabolism to maintain homeostasis during exposure to hypoxia. The present study aimed to determine whether ionic regulation, glycogen utilization and antioxidant activity differ in terms of expression under hypoxic stresses; fish were sampled after being subjected to 3 or 12h of hypoxia and 12h of recovery under normoxia. The air-breathing behavior of the fish increased under hypoxia. No morphological modification of the gills was observed. The expression of carbonic anhydrase II did not vary among the treatments. The Na(+)/K(+)-ATPase enzyme activity did not decrease, but increases in Na(+)/K(+)-ATPase protein expression and ionocyte levels were observed. The glycogen utilization increased under hypoxia as measured by glycogen phosphorylase protein expression and blood glucose level, whereas the glycogen content decreased. The enzyme activity of several components of the antioxidant system in the gills, including catalase, glutathione peroxidase, and superoxidase dismutase, increased in enzyme activity. Based on the above data, we concluded that T. microlepis is a hypoxia-tolerant species that does not exhibit ion-regulatory suppression but uses glycogen to maintain energy utilization in the gills under hypoxic stress. Components of the antioxidant system showed increased expression under the applied experimental treatments. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Protective Effects of Kaempferol against Myocardial Ischemia/Reperfusion Injury in Isolated Rat Heart via Antioxidant Activity and Inhibition of Glycogen Synthase Kinase-3β

    Science.gov (United States)

    Zhou, Mingjie; Ren, Huanhuan; Wang, Wenjuan; Zheng, Qiusheng; Wang, Dong

    2015-01-01

    Objective. This study aimed to evaluate the protective effect of kaempferol against myocardial ischemia/reperfusion (I/R) injury in rats. Method. Left ventricular developed pressure (LVDP) and its maximum up/down rate (±dp/dt max) were recorded as myocardial function. Infarct size was detected with 2,3,5-triphenyltetrazolium chloride staining. Cardiomyocyte apoptosis was determined using terminal deoxynucleotidyl nick-end labeling (TUNEL). The levels of creatine kinase (CK), lactate dehydrogenase (LDH), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione/glutathione disulfide (GSH/GSSG) ratio, and tumor necrosis factor-alpha (TNF-α) were determined using enzyme linked immunosorbent assay (ELISA). Moreover, total glycogen synthase kinase-3β (GSK-3β), phospho-GSK-3β (P-GSK-3β), precaspase-3, cleaved caspase-3, and cytoplasm cytochrome C were assayed using Western blot analysis. Results. Pretreatment with kaempferol significantly improved the recovery of LVDP and ±dp/dt max, as well as increased the levels of SOD and P-GSK-3β and GSH/GSSG ratio. However, the pretreatment reduced myocardial infarct size and TUNEL-positive cell rate, as well as decreased the levels of cleaved caspase-3, cytoplasm cytochrome C, CK, LDH, MDA, and TNF-α. Conclusion. These results suggested that kaempferol provides cardioprotection via antioxidant activity and inhibition of GSK-3β activity in rats with I/R. PMID:26265983

  15. Glycogen synthesis in glycogenin 1-deficient patients

    DEFF Research Database (Denmark)

    Krag, Thomas O.; Ruiz-Ruiz, Cristina; Vissing, John

    2017-01-01

    Context: Glycogen storage disease (GSD) type XV is a rare disease caused by mutations in the GYG1 gene that codes for the core molecule of muscle glycogen, glycogenin 1. Nonetheless, glycogen is present in muscles of glycogenin 1-deficient patients, suggesting an alternative for glycogen buildup....... A likely candidate is glycogenin 2, an isoform expressed in the liver and heart but not in healthy skeletal muscle. Objective: We wanted to investigate the formation of glycogen and changes in glycogen metabolism in patients with GSD type XV. Design, Setting, and Patients: Two patients with mutations...... in the GYG1 gene were investigated for histopathology, ultrastructure, and expression of proteins involved in glycogen synthesis and metabolism. Results: Apart from occurrence of polyglucosan (PG) bodies in few fibers, glycogen appeared normal in most cells, and the concentration was normal in patients...

  16. Hexokinase 2, glycogen synthase and phosphorylase play a key role in muscle glycogen supercompensation

    DEFF Research Database (Denmark)

    Irimia, José M; Rovira, Jordi; Nielsen, Jakob N

    2012-01-01

    Glycogen-depleting exercise can lead to supercompensation of muscle glycogen stores, but the biochemical mechanisms of this phenomenon are still not completely understood.......Glycogen-depleting exercise can lead to supercompensation of muscle glycogen stores, but the biochemical mechanisms of this phenomenon are still not completely understood....

  17. Somatomedin-C stimulates glycogen synthesis in fetal rat hepatocytes

    International Nuclear Information System (INIS)

    Freemark, M.; D'Ercole, A.J.; Handwerger, S.

    1985-01-01

    The effects of somatomedin-C/insulin-like growth factor I (Sm-C) on glycogen metabolism in cultured hepatocytes from 20-day-old rat fetuses have been examined and compared with the effects of insulin. Sm-C (25-375 ng/ml; 3.25-50 nM) stimulated dose-dependent increases in [ 14 C]glucose incorporation into glycogen (14.4-72.9% and total cell glycogen content (10.6-34.3%. Maximal stimulation of glycogen synthesis by Sm-C occurred at 2-4 h of incubation. Insulin (10 nM to 10 microM) also stimulated [ 14 C]glucose incorporation but its potency was only 1/20th that of Sm-C. The time course of stimulation of glucose incorporation by insulin was identical to that of Sm-C, the dose-response curves of the two hormones were parallel, and the maximal effects of insulin were not enhanced by simultaneous exposure of cells to Sm-C. These findings suggest that Sm-C and insulin stimulate glycogenesis in fetal liver through similar or identical mechanisms. Since the potency of Sm-C was 20 times greater than that of insulin, the glycogenic action of insulin in fetal liver may be mediated through binding to a hepatic receptor which also binds Sm-C. In addition to having mitogenic effects on fetal tissues, Sm-C may have direct anabolic effects on fetal carbohydrate metabolism

  18. Local depletion of glycogen with supramaximal exercise in human skeletal muscle fibres.

    Science.gov (United States)

    Gejl, Kasper D; Ørtenblad, Niels; Andersson, Erik; Plomgaard, Peter; Holmberg, Hans-Christer; Nielsen, Joachim

    2017-05-01

    Glycogen is stored in local spatially distinct compartments within skeletal muscle fibres and is the main energy source during supramaximal exercise. Using quantitative electron microscopy, we show that supramaximal exercise induces a differential depletion of glycogen from these compartments and also demonstrate how this varies with fibre types. Repeated exercise alters this compartmentalized glycogen depletion. The results obtained in the present study help us understand the muscle metabolic dynamics of whole body repeated supramaximal exercise, and suggest that the muscle has a compartmentalized local adaptation to repeated exercise, which affects glycogen depletion. Skeletal muscle glycogen is heterogeneously distributed in three separated compartments (intramyofibrillar, intermyofibrillar and subsarcolemmal). Although only constituting 3-13% of the total glycogen volume, the availability of intramyofibrillar glycogen is of particular importance to muscle function. The present study aimed to investigate the depletion of these three subcellular glycogen compartments during repeated supramaximal exercise in elite athletes. Ten elite cross-country skiers (aged 25 ± 4 years, V̇O2 max : 65 ± 4 ml kg -1  min -1 ; mean ± SD) performed four ∼4 min supramaximal sprint time trials (STT 1-4) with 45 min of recovery. The subcellular glycogen volumes in musculus triceps brachii were quantified from electron microscopy images before and after both STT 1 and 4. During STT 1, the depletion of intramyofibrillar glycogen was higher in type 1 fibres [-52%; (-89:-15%)] than type 2 fibres [-15% (-52:22%)] (P = 0.02), whereas the depletion of intermyofibrillar glycogen [main effect: -19% (-33:0%), P = 0.006] and subsarcolemmal glycogen [main effect: -35% (-66:0%), P = 0.03] was similar between fibre types. By contrast, only intermyofibrillar glycogen volume was significantly reduced during STT 4, in both fibre types [main effect: -31% (-50:-11%), P = 0

  19. Swelling of rat hepatocytes stimulates glycogen synthesis

    NARCIS (Netherlands)

    Baquet, A.; Hue, L.; Meijer, A. J.; van Woerkom, G. M.; Plomp, P. J.

    1990-01-01

    In hepatocytes from fasted rats, several amino acids are known to stimulate glycogen synthesis via activation of glycogen synthase. The hypothesis that an increase in cell volume resulting from amino acid uptake may be involved in the stimulation of glycogen synthesis is supported by the following

  20. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    OpenAIRE

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  1. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  2. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Science.gov (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  3. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  4. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  5. Effects of training distance on feed intake, growth, body condition and muscle glycogen content in young Standardbred horses fed a forage-only diet.

    Science.gov (United States)

    Ringmark, S; Revold, T; Jansson, A

    2017-10-01

    This study examined feed intake, growth, body condition, muscle glycogen content and nutrition-related health in 16 Standardbred horses fed a high-energy, forage-only diet ad libitum and allocated to either a control training programme (C-group) or a training programme with the high-intensity training distance reduced by 30% (R-group), from January as 2-year olds until December as 3-year olds. Feed intake was recorded on 10 occasions during 3 consecutive days. Body weight was recorded once in a week and height, body condition score (BCS), rump fat thickness and thickness of the m. longissimus dorsi were measured at 7±3-week intervals throughout the study. Muscle biopsies of the m. gluteus medius were taken in December as 2-year olds and in November as 3-year olds and analysed for glycogen content. Nutrition-related health disorders were noted when they occurred. Horses consumed 1.7% to 2.6% dry matter of BW, corresponding to 19 to 28 MJ metabolisable energy/100 kg BW. There were no differences between training groups in feed intake or any of the body measurements. The pooled weekly BCS was maintained between 4.8 and 5.1 (root mean square error (RMSE)=0.4). Muscle glycogen content was 587 and 623 mmol/kg dry weight (RMSE=68) as 2- and 3-year olds, respectively, and there was no difference between training groups. When managed under normal conditions, no nutrition-related health disorders or stereotypic behaviours were observed. It was concluded that the training programme did not affect feed intake, growth, BCS or muscle glycogen content. In addition, the forage-only diet did not appear to prohibit muscle glycogen storage, growth or maintenance of body condition, and seemed to promote good nutrition-related health.

  6. Glycogen depletion and resynthesis during 14 days of chronic low-frequency stimulation of rabbit muscle

    DEFF Research Database (Denmark)

    Prats, C; Bernal, C; Cadefau, J A

    2002-01-01

    Electro-stimulation alters muscle metabolism and the extent of this change depends on application intensity and duration. The effect of 14 days of chronic electro-stimulation on glycogen turnover and on the regulation of glycogen synthase in fast-twitch muscle was studied. The results showed that...

  7. Labeling of hepatic glycogen after short- and long-term stimulation of glycogen synthesis in rats injected with 3H-galactose

    International Nuclear Information System (INIS)

    Michaels, J.E.; Garfield, S.A.; Hung, J.T.; Cardell, R.R. Jr.

    1990-01-01

    The effects of short- and long-term stimulation of glycogen synthesis elicited by dexamethasone were studied by light (LM) and electron (EM) microscopic radioautography (RAG) and biochemical analysis. Adrenalectomized rats were fasted overnight and pretreated for short- (3 hr) or long-term (14 hr) periods with dexamethasone prior to intravenous injection of tracer doses of 3H-galactose. Analysis of LM-RAGs from short-term rats revealed that about equal percentages (44%) of hepatocytes became heavily or lightly labeled 1 hr after labeling. The percentage of heavily labeled cells increased slightly 6 hr after labeling, and unlabeled glycogen became apparent in some hepatocytes. The percentage of heavily labeled cells had decreased somewhat 12 hr after labeling, and more unlabeled glycogen was evident. In the long-term rats 1 hr after labeling, a higher percentage of heavily labeled cells (76%) was observed compared to short-term rats, and most glycogen was labeled. In spite of the high amount of labeling seen initially, the percentage of heavily labeled hepatocytes had decreased considerably to 55% by 12 hr after injection; and sparsely labeled and unlabeled glycogen was prevalent. The EM-RAGs of both short- and long-term rats were similar. Silver grains were associated with glycogen patches 1 hr after labeling; 12 hr after labeling, the glycogen patches had enlarged; and label, where present, was dispersed over the enlarged glycogen clumps. Analysis of DPM/mg tissue corroborated the observed decrease in label 12 hr after administration in the long-term animals. The loss of label observed 12 hr after injection in the long-term pretreated rats suggests that turnover of glycogen occurred during this interval despite the net accumulation of glycogen that was visible morphologically and evident from biochemical measurement

  8. A new non-degradative method to purify glycogen.

    Science.gov (United States)

    Tan, Xinle; Sullivan, Mitchell A; Gao, Fei; Li, Shihan; Schulz, Benjamin L; Gilbert, Robert G

    2016-08-20

    Liver glycogen, a complex branched glucose polymer containing a small amount of protein, is important for maintaining glucose homeostasis (blood-sugar control) in humans. It has recently been found that glycogen molecular structure is impaired in diabetes. Isolating the carbohydrate polymer and any intrinsically-attached protein(s) is an essential prerequisite for studying this structural impairment. This requires an effective, non-degradative and efficient purification method to exclude the many other proteins present in liver. Proteins and glycogen have different ranges of molecular sizes. Despite the plethora of proteins that might still be present in significant abundance after other isolation techniques, SEC (size exclusion chromatography, also known as GPC), which separates by molecular size, should separate those extraneous to glycogen from glycogen with any intrinsically associated protein(s). A novel purification method is developed for this, based on preparative SEC following sucrose gradient centrifugation. Proteomics is used to show that the new method compares favourably with current methods in the literature. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. 13C MRS Studies of the Control of Hepatic Glycogen Metabolism at High Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Corin O. Miller

    2017-06-01

    Full Text Available Introduction: Glycogen is the primary intracellular storage form of carbohydrates. In contrast to most tissues where stored glycogen can only supply the local tissue with energy, hepatic glycogen is mobilized and released into the blood to maintain appropriate circulating glucose levels, and is delivered to other tissues as glucose in response to energetic demands. Insulin and glucagon, two current targets of high interest in the pharmaceutical industry, are well-known glucose-regulating hormones whose primary effect in liver is to modulate glycogen synthesis and breakdown. The purpose of these studies was to develop methods to measure glycogen metabolism in real time non-invasively both in isolated mouse livers, and in non-human primates (NHPs using 13C MRS.Methods: Livers were harvested from C57/Bl6 mice and perfused with [1-13C] Glucose. To demonstrate the ability to measure acute changes in glycogen metabolism ex-vivo, fructose, glucagon, and insulin were administered to the liver ex-vivo. The C1 resonance of glycogen was measured in real time with 13C MRS using an 11.7T (500 MHz NMR spectrometer. To demonstrate the translatability of this approach, NHPs (male rhesus monkeys were studied in a 7 T Philips MRI using a partial volume 1H/13C imaging coil. NPHs were subjected to a variable IV infusion of [1-13C] glucose (to maintain blood glucose at 3-4x basal, along with a constant 1 mg/kg/min infusion of fructose. The C1 resonance of glycogen was again measured in real time with 13C MRS. To demonstrate the ability to measure changes in glycogen metabolism in vivo, animals received a glucagon infusion (1 μg/kg bolus followed by 40 ng/kg/min constant infusion half way through the study on the second study session.Results: In both perfused mouse livers and in NHPs, hepatic 13C-glycogen synthesis (i.e., monotonic increases in the 13C-glycogen NMR signal was readily detected. In both paradigms, addition of glucagon resulted in cessation of glycogen

  10. Ursolic acid and luteolin-7-glucoside improve lipid profiles and increase liver glycogen content through glycogen synthase kinase-3.

    Science.gov (United States)

    Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina

    2010-06-01

    In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.

  11. Glycogen resynthesis rate following cross-country skiing is closely correlated to skeletal muscle glycogen content

    DEFF Research Database (Denmark)

    Ørtenblad, Niels; Nielsen, Joachim; Saltin, Bengt

    on an optimal glycogen resynthesis rate before a subsequent exercise session. The purpose of present study was to evaluate the glycogen resynthesis rate in elite cross-country (cc) skiers, following exhaustive exercise, and to examine the role of muscular glycogen content on the resynthesis rate. METHOD: Ten...... as 4h and 22h after the race and analyzed for glycogen content. Figure 1. Correlation between muscle glycogen resynthesis rate and glycogen content after and in the rocery period after exercise. Line indicate best fit of all the data points (r2 = 0.41, p

  12. Brain glycogen in health and disease.

    Science.gov (United States)

    Duran, Jordi; Guinovart, Joan J

    2015-12-01

    Glycogen is present in the brain at much lower concentrations than in muscle or liver. However, by characterizing an animal depleted of brain glycogen, we have shown that the polysaccharide plays a key role in learning capacity and in activity-dependent changes in hippocampal synapse strength. Since glycogen is essentially found in astrocytes, the diverse roles proposed for this polysaccharide in the brain have been attributed exclusively to these cells. However, we have demonstrated that neurons have an active glycogen metabolism that contributes to tolerance to hypoxia. However, these cells can store only minute amounts of glycogen, since the progressive accumulation of this molecule leads to neuronal loss. Loss-of-function mutations in laforin and malin cause Lafora disease. This condition is characterized by the presence of high numbers of insoluble polyglucosan bodies, known as Lafora bodies, in neuronal cells. Our findings reveal that the accumulation of this aberrant glycogen accounts for the neurodegeneration and functional consequences, as well as the impaired autophagy, observed in models of this disease. Similarly glycogen synthase is responsible for the accumulation of corpora amylacea, which are polysaccharide-based aggregates present in the neurons of aged human brains. Our findings change the current view of the role of glycogen in the brain and reveal that endogenous neuronal glycogen metabolism is important under stress conditions and that neuronal glycogen accumulation contributes to neurodegenerative diseases and to aging-related corpora amylacea formation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Glycogen storage disease type III. A case report.

    Science.gov (United States)

    de Waal, A; Röhm, G F; Hoek, B B; Potgieter, G M; Oosthuysen, W T

    1984-01-07

    A 5-year-old Black boy presented with massive hepatomegaly and muscle weakness. Liver biopsy revealed the presence of glycogen pools in the cytoplasm and nuclei of hepatocytes. Erythrocyte glycogen levels, identified as limit dextrin, were grossly increased. The galactose tolerance test as well as the two-stage glucagon stimulation test suggested a decrease in activity of both amylo-1,6-glucosidase and glucose-6-phosphatase enzymes. This was confirmed by direct assays performed on liver tissue and erythrocytes. The decrease in glucose-6-phosphatase activity was attributed to a secondary effect of limit dextrin.

  14. Revisiting Glycogen Content in the Human Brain.

    Science.gov (United States)

    Öz, Gülin; DiNuzzo, Mauro; Kumar, Anjali; Moheet, Amir; Seaquist, Elizabeth R

    2015-12-01

    Glycogen provides an important glucose reservoir in the brain since the concentration of glucosyl units stored in glycogen is several fold higher than free glucose available in brain tissue. We have previously reported 3-4 µmol/g brain glycogen content using in vivo (13)C magnetic resonance spectroscopy (MRS) in conjunction with [1-(13)C]glucose administration in healthy humans, while higher levels were reported in the rodent brain. Due to the slow turnover of bulk brain glycogen in humans, complete turnover of the glycogen pool, estimated to take 3-5 days, was not observed in these prior studies. In an attempt to reach complete turnover and thereby steady state (13)C labeling in glycogen, here we administered [1-(13)C]glucose to healthy volunteers for 80 h. To eliminate any net glycogen synthesis during this period and thereby achieve an accurate estimate of glycogen concentration, volunteers were maintained at euglycemic blood glucose levels during [1-(13)C]glucose administration and (13)C-glycogen levels in the occipital lobe were measured by (13)C MRS approximately every 12 h. Finally, we fitted the data with a biophysical model that was recently developed to take into account the tiered structure of the glycogen molecule and additionally incorporated blood glucose levels and isotopic enrichments as input function in the model. We obtained excellent fits of the model to the (13)C-glycogen data, and glycogen content in the healthy human brain tissue was found to be 7.8 ± 0.3 µmol/g, a value substantially higher than previous estimates of glycogen content in the human brain.

  15. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  16. Lafora disease offers a unique window into neuronal glycogen metabolism.

    Science.gov (United States)

    Gentry, Matthew S; Guinovart, Joan J; Minassian, Berge A; Roach, Peter J; Serratosa, Jose M

    2018-05-11

    Lafora disease (LD) is a fatal, autosomal recessive, glycogen-storage disorder that manifests as severe epilepsy. LD results from mutations in the gene encoding either the glycogen phosphatase laforin or the E3 ubiquitin ligase malin. Individuals with LD develop cytoplasmic, aberrant glycogen inclusions in nearly all tissues that more closely resemble plant starch than human glycogen. This Minireview discusses the unique window into glycogen metabolism that LD research offers. It also highlights recent discoveries, including that glycogen contains covalently bound phosphate and that neurons synthesize glycogen and express both glycogen synthase and glycogen phosphorylase. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Modulation of glycogen and breast meat processing ability by nutrition in chickens: effect of crude protein level in 2 chicken genotypes.

    Science.gov (United States)

    Jlali, M; Gigaud, V; Métayer-Coustard, S; Sellier, N; Tesseraud, S; Le Bihan-Duval, E; Berri, C

    2012-02-01

    The aim of the study was to evaluate the impact of 2 isoenergetic growing diets with different CP (17 vs. 23%) on the performance and breast meat quality of 2 lines of chicken divergently selected for abdominal fatness [i.e., fat and lean (LL) lines]. Growth performance, breast and abdominal fat yields, breast meat quality parameters (pH, color, drip loss), and muscle glycogen storage at death were measured. Increased dietary CP resulted in increased BW, increased breast meat yield, and reduced abdominal fatness at slaughter regardless of genotype (P chickens. Giving LL chickens the low-CP diet led to reduced concentration of muscle glycogen (P chicken. The results also highlighted the need to take into account interaction with the genetic background of the animal to select nutritional strategies to improve meat quality traits in poultry.

  18. Sugar versus fat: elimination of glycogen storage improves lipid accumulation in Yarrowia lipolytica.

    Science.gov (United States)

    Bhutada, Govindprasad; Kavšcek, Martin; Ledesma-Amaro, Rodrigo; Thomas, Stéphane; Rechberger, Gerald N; Nicaud, Jean-Marc; Natter, Klaus

    2017-05-01

    Triacylglycerol (TAG) and glycogen are the two major metabolites for carbon storage in most eukaryotic organisms. We investigated the glycogen metabolism of the oleaginous Yarrowia lipolytica and found that this yeast accumulates up to 16% glycogen in its biomass. Assuming that elimination of glycogen synthesis would result in an improvement of lipid accumulation, we characterized and deleted the single gene coding for glycogen synthase, YlGSY1. The mutant was grown under lipogenic conditions with glucose and glycerol as substrates and we obtained up to 60% improvement in TAG accumulation compared to the wild-type strain. Additionally, YlGSY1 was deleted in a background that was already engineered for high lipid accumulation. In this obese background, TAG accumulation was also further increased. The highest lipid content of 52% was found after 3 days of cultivation in nitrogen-limited glycerol medium. Furthermore, we constructed mutants of Y. lipolytica and Saccharomyces cerevisiae that are deleted for both glycogen and TAG synthesis, demonstrating that the ability to store carbon is not essential. Overall, this work showed that glycogen synthesis is a competing pathway for TAG accumulation in oleaginous yeasts and that deletion of the glycogen synthase has beneficial effects on neutral lipid storage. © FEMS 2017.

  19. 13C Mrs Studies of the Control of Hepatic Glycogen Metabolism at High Magnetic Fields

    Science.gov (United States)

    Miller, Corin O.; Cao, Jin; Zhu, He; Chen, Li M.; Wilson, George; Kennan, Richard; Gore, John C.

    2017-06-01

    Introduction: Glycogen is the primary intracellular storage form of carbohydrates. In contrast to most tissues where stored glycogen can only supply the local tissue with energy, hepatic glycogen is mobilized and released into the blood to maintain appropriate circulating glucose levels, and is delivered to other tissues as glucose in response to energetic demands. Insulin and glucagon, two current targets of high interest in the pharmaceutical industry, are well known glucose-regulating hormones whose primary effect in liver is to modulate glycogen synthesis and breakdown. The purpose of these studies was to develop methods to measure glycogen metabolism in real time non-invasively both in isolated mouse livers, and in non-human primates (NHPs) using 13C MRS. Methods: Livers were harvested from C57/Bl6 mice and perfused with [1-13C] Glucose. To demonstrate the ability to measure acute changes in glycogen metabolism ex-vivo, fructose, glucagon, and insulin were administered to the liver ex-vivo. The C1 resonance of glycogen was measured in real time with 13C MRS using an 11.7T (500 MHz) NMR spectrometer. To demonstrate the translatability of this approach, NHPs (male rhesus monkeys) were studied in a 7 T Philips MRI using a partial volume 1H/13C imaging coil. NPHs were subjected to a variable IV infusion of [1-13C] glucose (to maintain blood glucose at 3-4x basal), along with a constant 1 mg/kg/min infusion of fructose. The C1 resonance of glycogen was again measured in real time with 13C MRS. To demonstrate the ability to measure changes in glycogen metabolism in vivo, animals received a glucagon infusion (1 μg/kg bolus followed by 40 ng/kg/min constant infusion) half way through the study on the second study session. Results: In both perfused mouse livers and in NHPs, hepatic 13C-glycogen synthesis (i.e. monotonic increases in the 13C-glycogen NMR signal) was readily detected. In both paradigms, addition of glucagon resulted in cessation of glycogen synthesis

  20. Ultrastructure and cytochemistry of cardiac intramitochondrial glycogen.

    Science.gov (United States)

    Sótonyi, P; Somogyi, E; Nemes, A; Juhász-Nagy, S

    1976-01-01

    Authors have observed abnormalities of glycogen localization in cardiac muscle, after normothermic cardiac arrest. The identification of these intramitrochondrial particles as glycogen was confirmed by selective staining with periodic acid-lead citrat, periodic acid-thiosemicarbazide protein methods and by their selective removal from tissue sections by alfa-amylase. The intramitochondrial glycogen particles were of beta-type. Some intramitochondrial particles were surrounded by paired membranes which resulted from protrusion of parts of mitochondrial membrane.

  1. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  2. Mountain bike racing - the influence of prior glycogen-inducing ...

    African Journals Online (AJOL)

    Objective. To investigate the effect of pre-exercise glutamine supplementation and the influence of a prior acute bout of glycogen-reducing exercise on the general stress and immune response to acute high-intensity cycling. Design. Randomised, double-blind, cross-over supplementation study. Setting and intervention.

  3. Determination of the Glycogen Content in Cyanobacteria.

    Science.gov (United States)

    De Porcellinis, Alice; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

    2017-07-17

    Cyanobacteria accumulate glycogen as a major intracellular carbon and energy storage during photosynthesis. Recent developments in research have highlighted complex mechanisms of glycogen metabolism, including the diel cycle of biosynthesis and catabolism, redox regulation, and the involvement of non-coding RNA. At the same time, efforts are being made to redirect carbon from glycogen to desirable products in genetically engineered cyanobacteria to enhance product yields. Several methods are used to determine the glycogen contents in cyanobacteria, with variable accuracies and technical complexities. Here, we provide a detailed protocol for the reliable determination of the glycogen content in cyanobacteria that can be performed in a standard life science laboratory. The protocol entails the selective precipitation of glycogen from the cell lysate and the enzymatic depolymerization of glycogen to generate glucose monomers, which are detected by a glucose oxidase-peroxidase (GOD-POD) enzyme coupled assay. The method has been applied to Synechocystis sp. PCC 6803 and Synechococcus sp. PCC 7002, two model cyanobacterial species that are widely used in metabolic engineering. Moreover, the method successfully showed differences in the glycogen contents between the wildtype and mutants defective in regulatory elements or glycogen biosynthetic genes.

  4. Postexercise muscle glycogen resynthesis in humans.

    Science.gov (United States)

    Burke, Louise M; van Loon, Luc J C; Hawley, John A

    2017-05-01

    Since the pioneering studies conducted in the 1960s in which glycogen status was investigated using the muscle biopsy technique, sports scientists have developed a sophisticated appreciation of the role of glycogen in cellular adaptation and exercise performance, as well as sites of storage of this important metabolic fuel. While sports nutrition guidelines have evolved during the past decade to incorporate sport-specific and periodized manipulation of carbohydrate (CHO) availability, athletes attempt to maximize muscle glycogen synthesis between important workouts or competitive events so that fuel stores closely match the demands of the prescribed exercise. Therefore, it is important to understand the factors that enhance or impair this biphasic process. In the early postexercise period (0-4 h), glycogen depletion provides a strong drive for its own resynthesis, with the provision of CHO (~1 g/kg body mass) optimizing this process. During the later phase of recovery (4-24 h), CHO intake should meet the anticipated fuel needs of the training/competition, with the type, form, and pattern of intake being less important than total intake. Dietary strategies that can enhance glycogen synthesis from suboptimal amounts of CHO or energy intake are of practical interest to many athletes; in this scenario, the coingestion of protein with CHO can assist glycogen storage. Future research should identify other factors that enhance the rate of synthesis of glycogen storage in a limited time frame, improve glycogen storage from a limited CHO intake, or increase muscle glycogen supercompensation. Copyright © 2017 the American Physiological Society.

  5. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Science.gov (United States)

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  6. Genetics Home Reference: glycogen storage disease type VII

    Science.gov (United States)

    ... Home Health Conditions Glycogen storage disease type VII Glycogen storage disease type VII Printable PDF Open All ... Javascript to view the expand/collapse boxes. Description Glycogen storage disease type VII (GSDVII) is an inherited ...

  7. Genetics Home Reference: glycogen storage disease type IV

    Science.gov (United States)

    ... Home Health Conditions Glycogen storage disease type IV Glycogen storage disease type IV Printable PDF Open All ... Javascript to view the expand/collapse boxes. Description Glycogen storage disease type IV (GSD IV) is an ...

  8. Putative role of glycogen as a peripheral biomarker of GSK3β activity.

    Science.gov (United States)

    Frizzo, Marcos Emilio

    2013-09-01

    Glycogen synthase kinase 3-β (GSK3β) has a pivotal role in several intracellular signaling cascades that are involved in gene transcription, cytoskeletal reorganization, energy metabolism, cell cycle regulation, and apoptosis. This kinase has pleiotropic functions, and the importance of its activity has recently been shown in neurons and platelets. In addition to its regulatory function in several physiological events, changes in GSK3β activity have been associated with many psychiatric and neurodegenerative illnesses, such as Alzheimer's disease, schizophrenia and autism-spectrum disorders. Beside the reports of its involvement in several pathologies, it has become increasingly apparent that GSK3β might be a common therapeutic target for different classes of psychiatric drugs, and also that the GSK3β ratio may be a useful parameter to determine the biochemical changes that might occur during antidepressant treatment. Although GSK3β is commonly described as a key enzyme in a plethora of signaling cascades, originally it was identified as playing an important role in the regulation of glycogen synthesis, given its ability to inactivate glycogen synthase (GS) by phosphorylation. Acting as a constitutively active kinase, GSK3β phosphorylates GS, which results in a decrease of glycogen production. GSK3β phosphorylation increases glycogen synthesis and storage, while its dephosphorylation decreases glycogen synthesis. Inactivation of GSK3β leads to dephosphorylation of GS and increase in glycogen synthesis in the adipose tissue, muscle and liver. Glycogen levels are reduced by antidepressant treatment, and this effect seems to be related to an effect of drugs on GSK3β activity. Peripherally, glycogen is also abundantly found in platelets, where it is considered a major energy source, required for a variety of its functions, including the release reaction. Recently, analysis of platelets from patients with late-life major depression showed that active forms of

  9. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Science.gov (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  10. Effective removal of a range of Ti/Ri plasmids using a pBBR1-type vector having a repABC operon and a lux reporter system.

    Science.gov (United States)

    Yamamoto, Shinji; Sakai, Ayako; Agustina, Vita; Moriguchi, Kazuki; Suzuki, Katsunori

    2018-02-01

    Ti and Ri plasmids of pathogenic Agrobacterium strains are stably maintained by the function of a repABC operon and have been classified into four incompatibility groups, namely, incRh1, incRh2, incRh3, and incRh4. Removal of these plasmids from their bacterial cells is an important step in determining strain-specific virulence characteristics and to construct strains useful for transformation. Here, we developed two powerful tools to improve this process. We first established a reporter system to detect the presence and absence of Ti/Ri plasmids in cells by using an acetosyringone (AS)-inducible promoter of the Ti2 small RNA and luxAB from Vibrio harveyi. This system distinguished a Ti/Ri plasmid-free cell colony among plasmid-harboring cell colonies by causing the latter colonies to emit light in response to AS. We then constructed new "Ti/Ri eviction plasmids," each of which carries a repABC from one of four Ti/Ri plasmids that belonged to incRh1, incRh2, incRh3, and incRh4 groups in the suicidal plasmid pK18mobsacB and in a broad-host-range pBBR1 vector. Introduction of the new eviction plasmids into Agrobacterium cells harboring the corresponding Ti/Ri plasmids led to Ti/Ri plasmid-free cells in every incRh group. The Ti/Ri eviction was more effective by plasmids with the pBBR1 backbone than by those with the pK18mobsacB backbone. Furthermore, the highly stable cryptic plasmid pAtC58 in A. tumefaciens C58 was effectively evicted by the introduction of a pBBR1 vector containing the repABC of pAtC58. These results indicate that the set of pBBR1-repABC plasmids is a powerful tool for the removal of stable rhizobial plasmids.

  11. [3H] glycogen hydrolysis in brain slices: responses to meurotransmitters and modulation of noradrenaline receptors

    International Nuclear Information System (INIS)

    Quach, T.T.; Rose, C.; Schwartz, J.C.

    1978-01-01

    Different agents have been investigated for their effects on [ 3 H] glycogen synthesized in mouse cortical slices. Of these noradrenaline, serotonin and histamine induced clear concentration-dependent glycogenesis. [ 3 H] glycogen hydrolysis induced by noradrenaline appears to be mediated by beta-adrenergic receptors because it is completely prevented by timolol, while phentolamine is ineffective. It seems to involve cyclic AMP because it is potentiated in the presence of isobutylmethylxanthine; in addition dibutyryl cyclic AMP (but not dibutyryl cyclic GMP) promotes glycogenolysis. Lower concentrations of noradrenaline were necessary for [ 3 H] glycogen hydrolysis (ECsub(50) 0.5μM) than for stimulation of cyclic AMP accumulation (ECsub(50) = 8μM). After subchronic reserpine treatment the concentration-response curve to noradrenaline was significantly shifted to the left (ECsub(50) = 0.09 +- 0.02 μM as compared with 0.49 +- 0.08μM in saline-pretreated mice) without modifications of either the basal [ 3 H] glycogen level, maximal glycogenolytic effect, or the dibutyryl cAMP-induced glycogenolytic response. In addition to noradrenaline, clear concentration-dependent [ 3 H] glycogen hydrolysis was observed in the presence of histamine or serotonin. In contrast to the partial [ 3 H] glycogen hydrolysis elicited by these biogenic amines, depolarization of the slices by 50 mM K + provoked a nearly total [ 3 H] glycogen hydrolysis. (author)

  12. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  13. Chronic corticosterone exposure reduces hippocampal glycogen level and induces depression-like behavior in mice.

    Science.gov (United States)

    Zhang, Hui-yu; Zhao, Yu-nan; Wang, Zhong-li; Huang, Yu-fang

    2015-01-01

    Long-term exposure to stress or high glucocorticoid levels leads to depression-like behavior in rodents; however, the cause remains unknown. Increasing evidence shows that astrocytes, the most abundant cells in the central nervous system (CNS), are important to the nervous system. Astrocytes nourish and protect the neurons, and serve as glycogen repositories for the brain. The metabolic process of glycogen, which is closely linked to neuronal activity, can supply sufficient energy substrates for neurons. The research team probed into the effects of chronic corticosterone (CORT) exposure on the glycogen level of astrocytes in the hippocampal tissues of male C57BL/6N mice in this study. The results showed that chronic CORT injection reduced hippocampal neurofilament light protein (NF-L) and synaptophysin (SYP) levels, induced depression-like behavior in male mice, reduced hippocampal glycogen level and glycogen synthase activity, and increased glycogen phosphorylase activity. The results suggested that the reduction of the hippocampal glycogen level may be the mechanism by which chronic CORT treatment damages hippocampal neurons and induces depression-like behavior in male mice.

  14. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  15. Astrocyte glycogen and brain energy metabolism.

    Science.gov (United States)

    Brown, Angus M; Ransom, Bruce R

    2007-09-01

    The brain contains glycogen but at low concentration compared with liver and muscle. In the adult brain, glycogen is found predominantly in astrocytes. Astrocyte glycogen content is modulated by a number of factors including some neurotransmitters and ambient glucose concentration. Compelling evidence indicates that astrocyte glycogen breaks down during hypoglycemia to lactate that is transferred to adjacent neurons or axons where it is used aerobically as fuel. In the case of CNS white matter, this source of energy can extend axon function for 20 min or longer. Likewise, during periods of intense neural activity when energy demand exceeds glucose supply, astrocyte glycogen is degraded to lactate, a portion of which is transferred to axons for fuel. Astrocyte glycogen, therefore, offers some protection against hypoglycemic neural injury and ensures that neurons and axons can maintain their function during very intense periods of activation. These emerging principles about the roles of astrocyte glycogen contradict the long held belief that this metabolic pool has little or no functional significance.

  16. Carcass glycogen repletion on carbohydrate re-feeding after starvation.

    OpenAIRE

    Cox, D J; Palmer, T N

    1987-01-01

    In mice, the response of carcass glycogen to glucose re-feeding after starvation is biphasic. The initial repletive phase is followed by partial (greater than 50%) glycogen mobilization. This turnover of carcass glycogen in response to carbohydrate re-feeding may play an important role in the provision of C3 precursors for hepatic glycogen synthesis.

  17. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Science.gov (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  18. Nuclear Glycogen Inclusions in Canine Parietal Cells.

    Science.gov (United States)

    Silvestri, S; Lepri, E; Dall'Aglio, C; Marchesi, M C; Vitellozzi, G

    2017-05-01

    Nuclear glycogen inclusions occur infrequently in pathologic conditions but also in normal human and animal tissues. Their function or significance is unclear. To the best of the authors' knowledge, no reports of nuclear glycogen inclusions in canine parietal cells exist. After initial observations of nuclear inclusions/pseudoinclusions during routine histopathology, the authors retrospectively examined samples of gastric mucosa from dogs presenting with gastrointestinal signs for the presence of intranuclear inclusions/pseudoinclusions and determined their composition using histologic and electron-microscopic methods. In 24 of 108 cases (22%), the authors observed various numbers of intranuclear inclusions/pseudoinclusions within scattered parietal cells. Nuclei were characterized by marked karyomegaly and chromatin margination around a central optically empty or slightly eosinophilic area. The intranuclear inclusions/pseudoinclusions stained positive with periodic acid-Schiff (PAS) and were diastase sensitive, consistent with glycogen. Several PAS-positive/diastase-sensitive sections were further examined by transmission electron microscopy, also using periodic acid-thiocarbohydrazide-silver proteinate (PA-TCH-SP) staining to identify polysaccharides. Ultrastructurally, the nuclear inclusions were composed of electron-dense particles that were not membrane bound, without evidence of nuclear membrane invaginations or cytoplasmic organelles in the nuclei, and positive staining with PA-TCH-SP, confirming a glycogen composition. No cytoplasmic glycogen deposits were observed, suggesting that the intranuclear glycogen inclusions were probably synthesized in loco. Nuclear glycogen inclusions were not associated with gastritis or colonization by Helicobacter-like organisms ( P > .05). Our findings suggest that nuclear glycogen inclusions in canine parietal cells could be an incidental finding. Nevertheless, since nuclear glycogen is present in several pathologic

  19. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...

  20. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Science.gov (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  1. Role of glycogen-lowering exercise in the change of fat oxidation in response to a high-fat diet.

    NARCIS (Netherlands)

    Schrauwen, P.; van Marken Lichtenbelt, W.D.; Saris, W.H.M.; Westerterp, K.R.

    1997-01-01

    Department of Human Biology, Maastricht University, The Netherlands. One of the candidate factors for determining the increase of fat oxidation after a switch from a reduced-fat diet to a high-fat diet is the size of the glycogen storage. Therefore, we studied the effect of low glycogen stores on

  2. Malin decreases glycogen accumulation by promoting the degradation of protein targeting to glycogen (PTG)

    OpenAIRE

    Worby, Carolyn A.; Gentry, Matthew S.; Dixon, Jack E.

    2007-01-01

    Lafora disease (LD) is an autosomal recessive neurodegenerative disease that results in progressive myoclonus epilepsy and death. LD is caused by mutations in either the E3 ubiquitin ligase malin or the dual-specificity phosphatase laforin. A hallmark of LD is the accumulation of insoluble glycogen in the cytoplasm of cells from most tissues. Glycogen metabolism is regulated by phosphorylation of key metabolic enzymes. One regulator of this phosphorylation is protein targeting to glycogen (PT...

  3. Genetic models rule out a major role of beta cell glycogen in the control of glucose homeostasis.

    Science.gov (United States)

    Mir-Coll, Joan; Duran, Jordi; Slebe, Felipe; García-Rocha, Mar; Gomis, Ramon; Gasa, Rosa; Guinovart, Joan J

    2016-05-01

    Glycogen accumulation occurs in beta cells of diabetic patients and has been proposed to partly mediate glucotoxicity-induced beta cell dysfunction. However, the role of glycogen metabolism in beta cell function and its contribution to diabetes pathophysiology remain poorly understood. We investigated the function of beta cell glycogen by studying glucose homeostasis in mice with (1) defective glycogen synthesis in the pancreas; and (2) excessive glycogen accumulation in beta cells. Conditional deletion of the Gys1 gene and overexpression of protein targeting to glycogen (PTG) was accomplished by Cre-lox recombination using pancreas-specific Cre lines. Glucose homeostasis was assessed by determining fasting glycaemia, insulinaemia and glucose tolerance. Beta cell mass was determined by morphometry. Glycogen was detected histologically by periodic acid-Schiff's reagent staining. Isolated islets were used for the determination of glycogen and insulin content, insulin secretion, immunoblots and gene expression assays. Gys1 knockout (Gys1 (KO)) mice did not exhibit differences in glucose tolerance or basal glycaemia and insulinaemia relative to controls. Insulin secretion and gene expression in isolated islets was also indistinguishable between Gys1 (KO) and controls. Conversely, despite effective glycogen overaccumulation in islets, mice with PTG overexpression (PTG(OE)) presented similar glucose tolerance to controls. However, under fasting conditions they exhibited lower glycaemia and higher insulinaemia. Importantly, neither young nor aged PTG(OE) mice showed differences in beta cell mass relative to age-matched controls. Finally, a high-fat diet did not reveal a beta cell-autonomous phenotype in either model. Glycogen metabolism is not required for the maintenance of beta cell function. Glycogen accumulation in beta cells alone is not sufficient to trigger the dysfunction or loss of these cells, or progression to diabetes.

  4. Enhanced Glycogen Storage of a Subcellular Hot Spot in Human Skeletal Muscle during Early Recovery from Eccentric Contractions

    Science.gov (United States)

    Nielsen, Joachim; Farup, Jean; Rahbek, Stine Klejs; de Paoli, Frank Vincenzo; Vissing, Kristian

    2015-01-01

    Unaccustomed eccentric exercise is accompanied by muscle damage and impaired glucose uptake and glycogen synthesis during subsequent recovery. Recently, it was shown that the role and regulation of glycogen in skeletal muscle are dependent on its subcellular localization, and that glycogen synthesis, as described by the product of glycogen particle size and number, is dependent on the time course of recovery after exercise and carbohydrate availability. In the present study, we investigated the subcellular distribution of glycogen in fibers with high (type I) and low (type II) mitochondrial content during post-exercise recovery from eccentric contractions. Analysis was completed on five male subjects performing an exercise bout consisting of 15 x 10 maximal eccentric contractions. Carbohydrate-rich drinks were subsequently ingested throughout a 48 h recovery period and muscle biopsies for analysis included time points 3, 24 and 48 h post exercise from the exercising leg, whereas biopsies corresponding to prior to and at 48 h after the exercise bout were collected from the non-exercising, control leg. Quantitative imaging by transmission electron microscopy revealed an early (post 3 and 24 h) enhanced storage of intramyofibrillar glycogen (defined as glycogen particles located within the myofibrils) of type I fibers, which was associated with an increase in the number of particles. In contrast, late in recovery (post 48 h), intermyofibrillar, intramyofibrillar and subsarcolemmal glycogen in both type I and II fibers were lower in the exercise leg compared with the control leg, and this was associated with a smaller size of the glycogen particles. We conclude that in the carbohydrate-supplemented state, the effect of eccentric contractions on glycogen metabolism depends on the subcellular localization, muscle fiber’s oxidative capacity, and the time course of recovery. The early enhanced storage of intramyofibrillar glycogen after the eccentric contractions may

  5. Glycogen production for biofuels by the euryhaline cyanobacteria Synechococcus sp. strain PCC 7002 from an oceanic environment.

    Science.gov (United States)

    Aikawa, Shimpei; Nishida, Atsumi; Ho, Shih-Hsin; Chang, Jo-Shu; Hasunuma, Tomohisa; Kondo, Akihiko

    2014-01-01

    Oxygenic photosynthetic microorganisms such as cyanobacteria and microalgae have attracted attention as an alternative carbon source for the next generation of biofuels. Glycogen abundantly accumulated in cyanobacteria is a promising feedstock which can be converted to ethanol through saccharification and fermentation processes. In addition, the utilization of marine cyanobacteria as a glycogen producer can eliminate the need for a freshwater supply. Synechococcus sp. strain PCC 7002 is a fast-growing marine coastal euryhaline cyanobacteria, however, the glycogen yield has not yet been determined. In the present study, the effects of light intensity, CO2 concentration, and salinity on the cell growth and glycogen content were investigated in order to maximize glycogen production in Synechococcus sp. strain PCC 7002. The optimal culture conditions for glycogen production in Synechococcus sp. strain PCC 7002 were investigated. The maximum glycogen production of 3.5 g L(-1) for 7 days (a glycogen productivity of 0.5 g L(-1) d(-1)) was obtained under a high light intensity, a high CO2 level, and a nitrogen-depleted condition in brackish water. The glycogen production performance in Synechococcus sp. strain PCC 7002 was the best ever reported in the α-polyglucan (glycogen or starch) production of cyanobacteria and microalgae. In addition, the robustness of glycogen production in Synechococcus sp. strain PCC 7002 to salinity was evaluated in seawater and freshwater. The peak of glycogen production of Synechococcus sp. strain PCC 7002 in seawater and freshwater were 3.0 and 1.8 g L(-1) in 7 days, respectively. Glycogen production in Synechococcus sp. strain PCC 7002 maintained the same level in seawater and half of the level in freshwater compared with the optimal result obtained in brackish water. We conclude that Synechococcus sp. strain PCC 7002 has high glycogen production activity and glycogen can be provided from coastal water accompanied by a fluctuation

  6. Green Tea Polyphenol Epigallocatechin-3-Gallate Enhance Glycogen Synthesis and Inhibit Lipogenesis in Hepatocytes

    Directory of Open Access Journals (Sweden)

    Jane J. Y. Kim

    2013-01-01

    Full Text Available The beneficial effects of green tea polyphenols (GTP against metabolic syndrome and type 2 diabetes by suppressing appetite and nutrient absorption have been well reported. However the direct effects and mechanisms of GTP on glucose and lipid metabolism remain to be elucidated. Since the liver is an important organ involved in glucose and lipid metabolism, we examined the effects and mechanisms of GTP on glycogen synthesis and lipogenesis in HepG2 cells. Concentrations of GTP containing 68% naturally occurring (−-epigallocatechin-3-gallate (EGCG were incubated in HepG2 cells with high glucose (30 mM under 100 nM of insulin stimulation for 24 h. GTP enhanced glycogen synthesis in a dose-dependent manner. 10 μM of EGCG significantly increased glycogen synthesis by 2fold (P<0.05 compared with insulin alone. Western blotting revealed that phosphorylation of Ser9 glycogen synthase kinase 3β and Ser641 glycogen synthase was significantly increased in GTP-treated HepG2 cells compared with nontreated cells. 10 μM of EGCG also significantly inhibited lipogenesis (P<0.01. We further demonstrated that this mechanism involves enhanced expression of phosphorylated AMP-activated protein kinase α and acetyl-CoA carboxylase in HepG2 cells. Our results showed that GTP is capable of enhancing insulin-mediated glucose and lipid metabolism by regulating enzymes involved in glycogen synthesis and lipogenesis.

  7. The Csr System Regulates Escherichia coli Fitness by Controlling Glycogen Accumulation and Energy Levels.

    Science.gov (United States)

    Morin, Manon; Ropers, Delphine; Cinquemani, Eugenio; Portais, Jean-Charles; Enjalbert, Brice; Cocaign-Bousquet, Muriel

    2017-10-31

    In the bacterium Escherichia coli , the posttranscriptional regulatory system Csr was postulated to influence the transition from glycolysis to gluconeogenesis. Here, we explored the role of the Csr system in the glucose-acetate transition as a model of the glycolysis-to-gluconeogenesis switch. Mutations in the Csr system influence the reorganization of gene expression after glucose exhaustion and disturb the timing of acetate reconsumption after glucose exhaustion. Analysis of metabolite concentrations during the transition revealed that the Csr system has a major effect on the energy levels of the cells after glucose exhaustion. This influence was demonstrated to result directly from the effect of the Csr system on glycogen accumulation. Mutation in glycogen metabolism was also demonstrated to hinder metabolic adaptation after glucose exhaustion because of insufficient energy. This work explains how the Csr system influences E. coli fitness during the glycolysis-gluconeogenesis switch and demonstrates the role of glycogen in maintenance of the energy charge during metabolic adaptation. IMPORTANCE Glycogen is a polysaccharide and the main storage form of glucose from bacteria such as Escherichia coli to yeasts and mammals. Although its function as a sugar reserve in mammals is well documented, the role of glycogen in bacteria is not as clear. By studying the role of posttranscriptional regulation during metabolic adaptation, for the first time, we demonstrate the role of sugar reserve played by glycogen in E. coli Indeed, glycogen not only makes it possible to maintain sufficient energy during metabolic transitions but is also the key component in the capacity of cells to resume growth. Since the essential posttranscriptional regulatory system Csr is a major regulator of glycogen accumulation, this work also sheds light on the central role of posttranscriptional regulation in metabolic adaptation. Copyright © 2017 Morin et al.

  8. Energy Metabolism of the Brain, Including the Cooperation between Astrocytes and Neurons, Especially in the Context of Glycogen Metabolism.

    Science.gov (United States)

    Falkowska, Anna; Gutowska, Izabela; Goschorska, Marta; Nowacki, Przemysław; Chlubek, Dariusz; Baranowska-Bosiacka, Irena

    2015-10-29

    Glycogen metabolism has important implications for the functioning of the brain, especially the cooperation between astrocytes and neurons. According to various research data, in a glycogen deficiency (for example during hypoglycemia) glycogen supplies are used to generate lactate, which is then transported to neighboring neurons. Likewise, during periods of intense activity of the nervous system, when the energy demand exceeds supply, astrocyte glycogen is immediately converted to lactate, some of which is transported to the neurons. Thus, glycogen from astrocytes functions as a kind of protection against hypoglycemia, ensuring preservation of neuronal function. The neuroprotective effect of lactate during hypoglycemia or cerebral ischemia has been reported in literature. This review goes on to emphasize that while neurons and astrocytes differ in metabolic profile, they interact to form a common metabolic cooperation.

  9. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Science.gov (United States)

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Glycogen synthase kinase 3: more than a namesake.

    Science.gov (United States)

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  11. High glycogen levels enhance glycogen breakdown in isolated contracting skeletal muscle

    DEFF Research Database (Denmark)

    Richter, Erik; Galbo, H

    1986-01-01

    and after 15 min of intermittent electrical muscle stimulation. Before stimulation, glycogen was higher in rats that swam on the preceding day (supercompensated rats) compared with controls. During muscle contractions, glycogen breakdown in fast-twitch red and white fibers was larger in supercompensated...

  12. Nature of complexing of glycogen with iodine in presence of CaCl2

    International Nuclear Information System (INIS)

    Bobrova, L.N.

    1986-01-01

    The absorption and dichroic absorbance of an iodine complex of muscle glycogen were studied as a function of the CaCl 2 concentration. It was found that high CaCl 2 concentrations, at which the staining of glycogen upon interaction with iodine increases sharply, destabilize the α-glucan helix and lead to a disturbance in the formation of a specific chromophore of the iodine-glycogen complex, which is indicated by the loss of dichroism. The stained chromophore appearing upon a simultaneous decrease in the dichroism is evidently produced by a nonhelical mechanism and is therefore nonspecific. This nonspecific chromophore may be the source of errors in spectrophotometric characterization of the structure of glycogens. It was shown using rabbit skeletal muscle and liver glycogens that the Krisman method, in which concentrated solutions of CaCl 2 are used, does not reveal the differences in the structure of the glycogens that are found at low CaCl 2 concentrations. The unfavorable effect of high CaCl 2 concentrations on helix formation must be kept in mind in a determination of the stoichiometry of the interaction of iodine with α-glucan

  13. Phosphorylation-dependent translocation of glycogen synthase to a novel structure during glycogen resynthesis

    DEFF Research Database (Denmark)

    Prats, Clara; Cadefau, Joan A; Cussó, Roser

    2005-01-01

    Glycogen metabolism has been the subject of extensive research, but the mechanisms by which it is regulated are still not fully understood. It is well accepted that the rate-limiting enzymes in glycogenesis and glycogenolysis are glycogen synthase (GS) and glycogen phosphorylase (GPh), respectively....... Both enzymes are regulated by reversible phosphorylation and by allosteric effectors. However, evidence in the literature indicates that changes in muscle GS and GPh intracellular distribution may constitute a new regulatory mechanism of glycogen metabolism. Already in the 1960s, it was proposed...... that glycogen was present in dynamic cellular organelles that were termed glycosomas but no such cellular entities have ever been demonstrated. The aim of this study was to characterize muscle GS and GPh intracellular distribution and to identify possible translocation processes of both enzymes. Using in situ...

  14. Neuronal glycogen synthesis contributes to physiological aging.

    Science.gov (United States)

    Sinadinos, Christopher; Valles-Ortega, Jordi; Boulan, Laura; Solsona, Estel; Tevy, Maria F; Marquez, Mercedes; Duran, Jordi; Lopez-Iglesias, Carmen; Calbó, Joaquim; Blasco, Ester; Pumarola, Marti; Milán, Marco; Guinovart, Joan J

    2014-10-01

    Glycogen is a branched polymer of glucose and the carbohydrate energy store for animal cells. In the brain, it is essentially found in glial cells, although it is also present in minute amounts in neurons. In humans, loss-of-function mutations in laforin and malin, proteins involved in suppressing glycogen synthesis, induce the presence of high numbers of insoluble polyglucosan bodies in neuronal cells. Known as Lafora bodies (LBs), these deposits result in the aggressive neurodegeneration seen in Lafora's disease. Polysaccharide-based aggregates, called corpora amylacea (CA), are also present in the neurons of aged human brains. Despite the similarity of CA to LBs, the mechanisms and functional consequences of CA formation are yet unknown. Here, we show that wild-type laboratory mice also accumulate glycogen-based aggregates in the brain as they age. These structures are immunopositive for an array of metabolic and stress-response proteins, some of which were previously shown to aggregate in correlation with age in the human brain and are also present in LBs. Remarkably, these structures and their associated protein aggregates are not present in the aged mouse brain upon genetic ablation of glycogen synthase. Similar genetic intervention in Drosophila prevents the accumulation of glycogen clusters in the neuronal processes of aged flies. Most interestingly, targeted reduction of Drosophila glycogen synthase in neurons improves neurological function with age and extends lifespan. These results demonstrate that neuronal glycogen accumulation contributes to physiological aging and may therefore constitute a key factor regulating age-related neurological decline in humans. © 2014 The Authors. Aging cell published by the Anatomical Society and John Wiley & Sons Ltd.

  15. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  16. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Science.gov (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Science.gov (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  18. [Effect of nutritional status of the donor on the quality of hepatic graft. Value of restoration of glycogenic reserves of the donor].

    Science.gov (United States)

    Pattou, F; Boudjema, K; Kerr-Conte, J; Wolf, P; Jaeck, D; Cinqualbre, J

    1992-01-01

    Initial function of the graft is an essential factor for successful liver transplantation. The aim of this study was to evaluate the influence of the nutritional status of the donor on hepatic graft quality at reperfusion. Livers (n = 41) were taken from pigs normally fed or fasted for 24 h or fasted for 24 h and conditioned for 2 hours with a solution containing glucose, fructose and glutamine. The quality of liver grafts was evaluated using an original, blood-free isolated perfusion model, after 8 h cold storage, or after 15 min warm ischemia performed prior to harvesting. The hepatic concentration of glycogen and ATP, measured from in vivo biopsies, was decreased in fasted animals (P less than 0.05 vs fed) and restored by nutritional conditioning (P less than 0.05 vs fasted). At the time of reperfusion following 8 h cold ischemia, the liberation of aminotransferases and lactate dehydrogenase was elevated in livers coming from fasted animals (P less than 0.05 vs fed) and restored to fed levels after nutritional conditioning (P less than 0.01 vs fasted). After 15 min of warm ischemia, the bile secretion during the reperfusion period was decreased in the 24 h fasted livers (P less than 0.01 vs fed) and reestablished after nutritional conditioning (P less than 0.01 vs fasted). Perfusion of the donor liver, in the 2 h preceding harvest, with a solution of glucose plus neoglucogenic precursors enhances the quality of the liver graft at the time of reperfusion.(ABSTRACT TRUNCATED AT 250 WORDS)

  19. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  20. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  1. Manipulation of Muscle Creatine and Glycogen Changes Dual X-ray Absorptiometry Estimates of Body Composition.

    Science.gov (United States)

    Bone, Julia L; Ross, Megan L; Tomcik, Kristyen A; Jeacocke, Nikki A; Hopkins, Will G; Burke, Louise M

    2017-05-01

    Standardizing a dual x-ray absorptiometry (DXA) protocol is thought to provide a reliable measurement of body composition. We investigated the effects of manipulating muscle glycogen and creatine content independently and additively on DXA estimates of lean mass. Eighteen well-trained male cyclists undertook a parallel group application of creatine loading (n = 9) (20 g·d for 5 d loading; 3 g·d maintenance) or placebo (n = 9) with crossover application of glycogen loading (12 v 6 g·kg BM per day for 48 h) as part of a larger study involving a glycogen-depleting exercise protocol. Body composition, total body water, muscle glycogen and creatine content were assessed via DXA, bioelectrical impedance spectroscopy and standard biopsy techniques. Changes in the mean were assessed using the following effect-size scale: >0.2 small, >0.6, moderate, >1.2 large and compared with the threshold for the smallest worthwhile effect of the treatment. Glycogen loading, both with and without creatine loading, resulted in substantial increases in estimates of lean body mass (mean ± SD; 3.0% ± 0.7% and 2.0% ± 0.9%) and leg lean mass (3.1% ± 1.8% and 2.6% ± 1.0%) respectively. A substantial decrease in leg lean mass was observed after the glycogen depleting condition (-1.4% ± 1.6%). Total body water showed substantial increases after glycogen loading (2.3% ± 2.3%), creatine loading (1.4% ± 1.9%) and the combined treatment (2.3% ± 1.1%). Changes in muscle metabolites and water content alter DXA estimates of lean mass during periods in which minimal change in muscle protein mass is likely. This information needs to be considered in interpreting the results of DXA-derived estimates of body composition in athletes.

  2. Changes in liver glycogen reserve in Wistar rats as a result of polysaccharide treatment and single sublethal gamma-irradiation

    International Nuclear Information System (INIS)

    Metodiev, S.; Lambov, V.; Pavlova, N.

    1993-01-01

    The phase changes in the quantity of liver glycogen after single sublethal irradiation are investigated. The lowest concentration levels are registered at days 1, 3, 8 and 13 post irradiation. The effect of polysaccharide radioresistance modulation on the liver glycogen concentration is evaluated. The subcutaneous polysaccharide application of the immuno-active product PL prevents the sharp decrease of the liver glycogen concentration level, as a result of radiation provoked damages. The polysaccharide protection is most effective 5 - 21 days after irradiation. The conclusions are based on enzymic and hystomorphological studies. (author)

  3. Muscle Glycogen Remodeling and Glycogen Phosphate Metabolism following Exhaustive Exercise of Wild Type and Laforin Knockout Mice*

    Science.gov (United States)

    Irimia, Jose M.; Tagliabracci, Vincent S.; Meyer, Catalina M.; Segvich, Dyann M.; DePaoli-Roach, Anna A.; Roach, Peter J.

    2015-01-01

    Glycogen, the repository of glucose in many cell types, contains small amounts of covalent phosphate, of uncertain function and poorly understood metabolism. Loss-of-function mutations in the laforin gene cause the fatal neurodegenerative disorder, Lafora disease, characterized by increased glycogen phosphorylation and the formation of abnormal deposits of glycogen-like material called Lafora bodies. It is generally accepted that the phosphate is removed by the laforin phosphatase. To study the dynamics of skeletal muscle glycogen phosphorylation in vivo under physiological conditions, mice were subjected to glycogen-depleting exercise and then monitored while they resynthesized glycogen. Depletion of glycogen by exercise was associated with a substantial reduction in total glycogen phosphate and the newly resynthesized glycogen was less branched and less phosphorylated. Branching returned to normal on a time frame of days, whereas phosphorylation remained suppressed over a longer period of time. We observed no change in markers of autophagy. Exercise of 3-month-old laforin knock-out mice caused a similar depletion of glycogen but no loss of glycogen phosphate. Furthermore, remodeling of glycogen to restore the basal branching pattern was delayed in the knock-out animals. From these results, we infer that 1) laforin is responsible for glycogen dephosphorylation during exercise and acts during the cytosolic degradation of glycogen, 2) excess glycogen phosphorylation in the absence of laforin delays the normal remodeling of the branching structure, and 3) the accumulation of glycogen phosphate is a relatively slow process involving multiple cycles of glycogen synthesis-degradation, consistent with the slow onset of the symptoms of Lafora disease. PMID:26216881

  4. Lowering Temperature is the Trigger for Glycogen Build-Up and Winter Fasting in Crucian Carp (Carassius carassius).

    Science.gov (United States)

    Varis, Joonas; Haverinen, Jaakko; Vornanen, Matti

    2016-02-01

    Seasonal changes in physiology of vertebrate animals are triggered by environmental cues including temperature, day-length and oxygen availability. Crucian carp (Carassius carassius) tolerate prolonged anoxia in winter by using several physiological adaptations that are seasonally activated. This study examines which environmental cues are required to trigger physiological adjustments for winter dormancy in crucian carp. To this end, crucian carp were exposed to changing environmental factors under laboratory conditions: effects of declining water temperature, shortening day-length and reduced oxygen availability, separately and in different combinations, were examined on glycogen content and enzyme activities involved in feeding (alkaline phosphatase, AP) and glycogen metabolism (glycogen synthase, GyS; glycogen phosphorylase, GP). Lowering temperature induced a fall in activity of AP and a rise in glycogen content and rate of glycogen synthesis. Relative mass of the liver, and glycogen concentration of liver, muscle and brain increased with lowering temperature. Similarly activity of GyS in muscle and expression of GyS transcripts in brain were up-regulated by lowering temperature. Shortened day-length and oxygen availability had practically no effects on measured variables. We conclude that lowering temperature is the main trigger in preparation for winter anoxia in crucian carp.

  5. Glycogen metabolism in aerobic mixed cultures

    DEFF Research Database (Denmark)

    Dircks, Klaus; Beun, J.J.; van Loosdrecht, M.C.M.

    2001-01-01

    In this study, the metabolism of glycogen storage and consumption in mixed cultures under aerobic conditions is described. The experimental results are used to calibrate a metabolic model, which as sole stoichiometric variables has the efficiency of oxidative phosphorylation (delta) and maintenance...... of glycogen and subsequent growth occur without significant loss of energy, as compared with direct growth on glucose. For kinetic modeling, Monod kinetics is used most commonly in activated sludge models to describe the rate of microbial transformation. Monod kinetics, however, does not provide a good...

  6. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  7. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  8. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    OpenAIRE

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  9. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  10. Low-carbohydrate diet induces metabolic depression: a possible mechanism to conserve glycogen.

    Science.gov (United States)

    Winwood-Smith, Hugh S; Franklin, Craig E; White, Craig R

    2017-10-01

    Long-term studies have found that low-carbohydrate diets are more effective for weight loss than calorie-restricted diets in the short term but equally or only marginally more effective in the long term. Low-carbohydrate diets have been linked to reduced glycogen stores and increased feelings of fatigue. We propose that reduced physical activity in response to lowered glycogen explains the diminishing weight loss advantage of low-carbohydrate compared with low-calorie diets over longer time periods. We explored this possibility by feeding adult Drosophila melanogaster a standard or a low-carbohydrate diet for 9 days and measured changes in metabolic rate, glycogen stores, activity, and body mass. We hypothesized that a low-carbohydrate diet would cause a reduction in glycogen stores, which recover over time, a reduction in physical activity, and an increase in resting metabolic rate. The low-carbohydrate diet reduced glycogen stores, which recovered over time. Activity was unaffected by diet, but metabolic rate was reduced, in the low-carbohydrate group. We conclude that metabolic depression could explain the decreased effectiveness of low-carbohydrate diets over time and recommend further investigation of long-term metabolic effects of dietary interventions and a greater focus on physiological plasticity within the study of human nutrition. Copyright © 2017 the American Physiological Society.

  11. Cell swelling and glycogen metabolism in hepatocytes from fasted rats

    NARCIS (Netherlands)

    Gustafson, L. A.; Jumelle-Laclau, M. N.; van Woerkom, G. M.; van Kuilenburg, A. B.; Meijer, A. J.

    1997-01-01

    Cell swelling is known to increase net glycogen production from glucose in hepatocytes from fasted rats by activating glycogen synthase. Since both active glycogen synthase and phosphorylase are present in hepatocytes, suppression of flux through phosphorylase may also contribute to the net increase

  12. Mechanism of activation of liver glycogen synthase by swelling

    NARCIS (Netherlands)

    Meijer, A. J.; Baquet, A.; Gustafson, L.; van Woerkom, G. M.; Hue, L.

    1992-01-01

    The mechanism linking the stimulation of liver glycogen synthesis to swelling induced either by amino acids or hypotonicity was studied in hepatocytes, in gel-filtered liver extracts, and in purified preparations of particulate glycogen to which glycogen-metabolizing enzymes are bound. High

  13. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  14. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  15. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  16. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  17. Characterization of a canine model of glycogen storage disease type IIIa

    Directory of Open Access Journals (Sweden)

    Haiqing Yi

    2012-11-01

    Glycogen storage disease type IIIa (GSD IIIa is an autosomal recessive disease caused by deficiency of glycogen debranching enzyme (GDE in liver and muscle. The disorder is clinically heterogeneous and progressive, and there is no effective treatment. Previously, a naturally occurring dog model for this condition was identified in curly-coated retrievers (CCR. The affected dogs carry a frame-shift mutation in the GDE gene and have no detectable GDE activity in liver and muscle. We characterized in detail the disease expression and progression in eight dogs from age 2 to 16 months. Monthly blood biochemistry revealed elevated and gradually increasing serum alanine transaminase (ALT, aspartate transaminase (AST and alkaline phosphatase (ALP activities; serum creatine phosphokinase (CPK activity exceeded normal range after 12 months. Analysis of tissue biopsy specimens at 4, 12 and 16 months revealed abnormally high glycogen contents in liver and muscle of all dogs. Fasting liver glycogen content increased from 4 months to 12 months, but dropped at 16 months possibly caused by extended fibrosis; muscle glycogen content continually increased with age. Light microscopy revealed significant glycogen accumulation in hepatocytes at all ages. Liver histology showed progressive, age-related fibrosis. In muscle, scattered cytoplasmic glycogen deposits were present in most cells at 4 months, but large, lake-like accumulation developed by 12 and 16 months. Disruption of the contractile apparatus and fraying of myofibrils was observed in muscle at 12 and 16 months by electron microscopy. In conclusion, the CCR dogs are an accurate model of GSD IIIa that will improve our understanding of the disease progression and allow opportunities to investigate treatment interventions.

  18. Quantitative comparison of pathways of hepatic glycogen repletion in fed and fasted humans

    International Nuclear Information System (INIS)

    Shulman, G.I.; Cline, G.; Schumann, W.C.; Chandramouli, V.; Kumaran, K.; Landau, B.R.

    1990-01-01

    The effect of fasting vs. refeeding on hepatic glycogen repletion by the direct pathway, i.e., glucose----glucose 6-phosphate (G-6-P)----glycogen, was determined. Acetaminophen was administered during an infusion of glucose labeled with [1-13C]- and [6-14C]glucose into four healthy volunteers after an overnight fast and into the same subjects 4 h after breakfast. 13C enrichments in C-1 and C-6 of glucose formed from urinary acetaminophen glucuronide compared with enrichments in C-1 and C-6 of plasma glucose provided an estimate of glycogen formation by the direct pathway. The specific activity of glucose from the glucuronide compared with the specific activity of the plasma glucose, along with the percentages of 14C in C-1 and C-6 of the glucose from the glucuronide, also provided an estimate of the amount of glycogen formed by the direct pathway. The estimates were similar. Those from [6-14C]glucose would have been higher than from [1-13C]glucose if the pentose cycle contribution to overall glucose utilization had been significant. After an overnight fast, during the last hour of infusion, 49 +/- 3% of the glycogen formed was formed via the direct pathway. After breakfast, at similar plasma glucose and insulin concentrations, the percentage increased to 69 +/- 7% (P less than 0.02). Thus the contributions of the pathways to hepatic glycogen formation depend on the dietary state of the individual. For a dietary regimen in which individuals consume multiple meals per day containing at least a moderate amount of carbohydrates most glycogen synthesis occurs by the direct pathway

  19. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  20. Glycogen Shunt Activity and Glycolytic Supercompensation in Astrocytes May Be Distinctly Mediated via the Muscle Form of Glycogen Phosphorylase

    DEFF Research Database (Denmark)

    Jakobsen, Emil; Bak, Lasse K; Walls, Anne B

    2017-01-01

    Glycogen is the main storage form of glucose in the brain. In contrast with previous beliefs, brain glycogen has recently been shown to play important roles in several brain functions. A fraction of metabolized glucose molecules are being shunted through glycogen before reentering the glycolytic ...

  1. Differential effects of safflower oil versus fish oil feeding on insulin-stimulated glycogen synthesis, glycolysis, and pyruvate dehydrogenase flux in skeletal muscle: a 13C nuclear magnetic resonance study.

    Science.gov (United States)

    Jucker, B M; Cline, G W; Barucci, N; Shulman, G I

    1999-01-01

    To examine the effects of safflower oil versus fish oil feeding on in vivo intramuscular glucose metabolism and relative pyruvate dehydrogenase (PDH) versus tricarboxylic acid (TCA) cycle flux, rats were pair-fed on diets consisting of 1) 59% safflower oil, 2) 59% menhaden fish oil, or 3) 59% carbohydrate (control) in calories. Rates of glycolysis and glycogen synthesis were assessed by monitoring [1-(13)C]glucose label incorporation into [1-(13)C]glycogen, [3-(13)C]lactate, and [3-(13)C]alanine in the hindlimb of awake rats via 13C nuclear magnetic resonance (NMR) spectroscopy during a euglycemic (approximately 6 mmol/l) hyperinsulinemic (approximately 180 microU/ml) clamp. A steady-state isotopic analysis of lactate, alanine, and glutamate was used to determine the relative PDH versus TCA cycle flux present in muscle under these conditions. The safflower oil-fed rats were insulin resistant compared with control and fish oil-fed rats, as reflected by a markedly reduced glucose infusion rate (Ginf) during the clamp (21.4 +/- 2.3 vs. 31.6 +/- 2.8 and 31.7 +/- 1.9 mg x kg(-1) x min(-1) in safflower oil versus control and fish oil groups, respectively, P safflower oil group was associated with a lower rate of glycolysis (21.7 +/- 2.2 nmol x g(-1) x min(-1)) versus control (62.1 +/- 10.3 nmol x g(-1) x min(-1), P safflower oil, fish oil, and control, respectively) was detected. The intramuscular triglyceride (TG) content was increased in the safflower oil group (7.3 +/- 0.8 micromol/g) compared with the control group (5.2 +/- 0.8 micromol/g, P safflower oil (43 +/- 8%) versus the control (73 +/- 8%, P safflower oil feeding was a consequence of reduced glycolytic flux associated with an increase in relative free fatty acid/ketone oxidation versus TCA cycle flux, whereas fish oil feeding did not alter glucose metabolism and may in part be protective of insulin-stimulated glucose disposal by limiting intramuscular TG deposition.

  2. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  3. Insights into Brain Glycogen Metabolism: THE STRUCTURE OF HUMAN BRAIN GLYCOGEN PHOSPHORYLASE.

    Science.gov (United States)

    Mathieu, Cécile; Li de la Sierra-Gallay, Ines; Duval, Romain; Xu, Ximing; Cocaign, Angélique; Léger, Thibaut; Woffendin, Gary; Camadro, Jean-Michel; Etchebest, Catherine; Haouz, Ahmed; Dupret, Jean-Marie; Rodrigues-Lima, Fernando

    2016-08-26

    Brain glycogen metabolism plays a critical role in major brain functions such as learning or memory consolidation. However, alteration of glycogen metabolism and glycogen accumulation in the brain contributes to neurodegeneration as observed in Lafora disease. Glycogen phosphorylase (GP), a key enzyme in glycogen metabolism, catalyzes the rate-limiting step of glycogen mobilization. Moreover, the allosteric regulation of the three GP isozymes (muscle, liver, and brain) by metabolites and phosphorylation, in response to hormonal signaling, fine-tunes glycogenolysis to fulfill energetic and metabolic requirements. Whereas the structures of muscle and liver GPs have been known for decades, the structure of brain GP (bGP) has remained elusive despite its critical role in brain glycogen metabolism. Here, we report the crystal structure of human bGP in complex with PEG 400 (2.5 Å) and in complex with its allosteric activator AMP (3.4 Å). These structures demonstrate that bGP has a closer structural relationship with muscle GP, which is also activated by AMP, contrary to liver GP, which is not. Importantly, despite the structural similarities between human bGP and the two other mammalian isozymes, the bGP structures reveal molecular features unique to the brain isozyme that provide a deeper understanding of the differences in the activation properties of these allosteric enzymes by the allosteric effector AMP. Overall, our study further supports that the distinct structural and regulatory properties of GP isozymes contribute to the different functions of muscle, liver, and brain glycogen. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Muscle glycogen metabolism changes in rats fed early postnatal a fructose-rich diet after maternal protein malnutrition: effects of acute physical exercise at the maximal lactate steady-state intensity.

    Science.gov (United States)

    Cambri, Lucieli T; Ribeiro, Carla; Botezelli, José D; Ghezzi, Ana C; Mello, Maria Ar

    2014-01-01

    The objective was to evaluate the muscle glucose metabolism in rats fed a fructose-rich diet after fetal protein malnutrition, at rest and after acute physical exercise at maximal lactate steady-state intensity. The male offspring born of mothers fed on a balanced or low-protein diet were split in four groups until 60 days: Balanced (B): balanced diet during the whole period; Balanced/Fructose (BF): balanced diet in utero and fructose-rich diet after birth; Low protein/Balanced (LB): low-protein diet in utero and balanced diet after birth; Low protein/Fructose (LF): low protein diet in utero and fructose-rich diet after birth. Acute physical exercise reduced the muscle glycogen concentrations in all groups, although the LF group showed higher concentrations at rest. There was no difference among the groups in the glucose uptake and oxidation rates in the isolated soleus muscle neither at rest nor after acute exercise. However, glycogen synthesis was higher in the LF muscle than in the others at rest. Acute physical exercise increased glycogen synthesis in all groups, and the LF group showed the highest values. The fructose-rich diet administered in rats after fetal protein malnutrition alters muscle glycogen concentrations and glycogen synthesis in the rest and after acute exercise at maximal lactate steady-state intensity.

  5. Local depletion of glycogen with supra-maximal exercise in human skeletal muscle fibres

    DEFF Research Database (Denmark)

    Gejl, Kasper Degn; Ørtenblad, Niels; Andersson, Erik

    2017-01-01

    importance to muscle function. The present study was designed to investigate the depletion of these three sub-cellular glycogen compartments during repeated supra-maximal exercise in elite athletes. Ten elite cross-country skiers (age: 25 ± 4 yrs., VO2 max : 65 ± 4 ml kg(-1) min(-1) , mean ± SD) performed...... four ∼4-minute supra-maximal sprint time trials (STT 1-4) with 45 min recovery. The sub-cellular glycogen volumes in m. triceps brachii were quantified from electron microscopy images before and after both STT 1 and STT 4. During STT 1, the depletion of intramyofibrillar glycogen was higher in type I...... fibres (-52% [-89:-15%]) than type 2 fibres (-15% [-52:22%]) (P = 0.02), while the depletion of intermyofibrillar glycogen (main effect: -19% [-33:0], P = 0.006) and subsarcolemmal glycogen (main effect: -35% [-66:0%], P = 0.03) was similar between fibre types. In contrast, only intermyofibrillar...

  6. Determination of the glycogen content in cyanobacteria

    DEFF Research Database (Denmark)

    Porcellinis, Alice De; Frigaard, Niels-Ulrik; Sakuragi, Yumiko

    2017-01-01

    of glycogen to generate glucose monomers, which are detected by a glucose oxidase-peroxidase (GOD-POD) enzyme coupled assay. The method has been applied to Synechocystis sp. PCC 6803 and Synechococcus sp. PCC 7002, two model cyanobacterial species that are widely used in metabolic engineering. Moreover...

  7. Pregnancies in glycogen storage disease type Ia

    NARCIS (Netherlands)

    Martens, Danielle H. J.; Rake, Jan Peter; Schwarz, Martin; Ullrich, Kurt; Weinstein, David A.; Merkel, Martin; Sauer, Pieter J. J.; Smit, G. Peter A.

    OBJECTIVE: Reports on pregnancies in women with glycogen storage disease type Ia (GSD-Ia) are scarce. Because of improved life expectancy, pregnancy is becoming an important issue. We describe 15 pregnancies by focusing on dietary treatment, biochemical parameters, and GSD-Ia complications. STUDY

  8. Molecular Structure of Human-Liver Glycogen.

    Directory of Open Access Journals (Sweden)

    Bin Deng

    Full Text Available Glycogen is a highly branched glucose polymer which is involved in maintaining blood-sugar homeostasis. Liver glycogen contains large composite α particles made up of linked β particles. Previous studies have shown that the binding which links β particles into α particles is impaired in diabetic mice. The present study reports the first molecular structural characterization of human-liver glycogen from non-diabetic patients, using transmission electron microscopy for morphology and size-exclusion chromatography for the molecular size distribution; the latter is also studied as a function of time during acid hydrolysis in vitro, which is sensitive to certain structural features, particularly glycosidic vs. proteinaceous linkages. The results are compared with those seen in mice and pigs. The molecular structural change during acid hydrolysis is similar in each case, and indicates that the linkage of β into α particles is not glycosidic. This result, and the similar morphology in each case, together imply that human liver glycogen has similar molecular structure to those of mice and pigs. This knowledge will be useful for future diabetes drug targets.

  9. Why does the brain (not) have glycogen?

    Science.gov (United States)

    DiNuzzo, Mauro; Maraviglia, Bruno; Giove, Federico

    2011-05-01

    In the present paper we formulate the hypothesis that brain glycogen is a critical determinant in the modulation of carbohydrate supply at the cellular level. Specifically, we propose that mobilization of astrocytic glycogen after an increase in AMP levels during enhanced neuronal activity controls the concentration of glucose phosphates in astrocytes. This would result in modulation of glucose phosphorylation by hexokinase and upstream cell glucose uptake. This mechanism would favor glucose channeling to activated neurons, supplementing the already rich neuron-astrocyte metabolic and functional partnership with important implications for the energy compounds used to sustain neuronal activity. The hypothesis is based on recent modeling evidence suggesting that rapid glycogen breakdown can profoundly alter the short-term kinetics of glucose delivery to neurons and astrocytes. It is also based on review of the literature relevant to glycogen metabolism during physiological brain activity, with an emphasis on the metabolic pathways identifying both the origin and the fate of this glucose reserve. Copyright © 2011 WILEY Periodicals, Inc.

  10. Refeeding-induced brown adipose tissue glycogen hyper-accumulation in mice is mediated by insulin and catecholamines.

    Directory of Open Access Journals (Sweden)

    Christopher M Carmean

    Full Text Available Brown adipose tissue (BAT generates heat during adaptive thermogenesis through a combination of oxidative metabolism and uncoupling protein 1-mediated electron transport chain uncoupling, using both free-fatty acids and glucose as substrate. Previous rat-based work in 1942 showed that prolonged partial fasting followed by refeeding led to a dramatic, transient increase in glycogen stores in multiple fat depots. In the present study, the protocol was replicated in male CD1 mice, resulting in a 2000-fold increase in interscapular BAT (IBAT glycogen levels within 4-12 hours (hr of refeeding, with IBAT glycogen stores reaching levels comparable to fed liver glycogen. Lesser effects occurred in white adipose tissues (WAT. Over the next 36 hr, glycogen levels dissipated and histological analysis revealed an over-accumulation of lipid droplets, suggesting a potential metabolic connection between glycogenolysis and lipid synthesis. 24 hr of total starvation followed by refeeding induced a robust and consistent glycogen over-accumulation similar in magnitude and time course to the prolonged partial fast. Experimentation demonstrated that hyperglycemia was not sufficient to drive glycogen accumulation in IBAT, but that elevated circulating insulin was sufficient. Additionally, pharmacological inhibition of catecholamine production reduced refeeding-induced IBAT glycogen storage, providing evidence of a contribution from the central nervous system. These findings highlight IBAT as a tissue that integrates both canonically-anabolic and catabolic stimulation for the promotion of glycogen storage during recovery from caloric deficit. The preservation of this robust response through many generations of animals not subjected to food deprivation suggests that the over-accumulation phenomenon plays a critical role in IBAT physiology.

  11. Refeeding-Induced Brown Adipose Tissue Glycogen Hyper-Accumulation in Mice Is Mediated by Insulin and Catecholamines

    Science.gov (United States)

    Carmean, Christopher M.; Bobe, Alexandria M.; Yu, Justin C.; Volden, Paul A.; Brady, Matthew J.

    2013-01-01

    Brown adipose tissue (BAT) generates heat during adaptive thermogenesis through a combination of oxidative metabolism and uncoupling protein 1-mediated electron transport chain uncoupling, using both free-fatty acids and glucose as substrate. Previous rat-based work in 1942 showed that prolonged partial fasting followed by refeeding led to a dramatic, transient increase in glycogen stores in multiple fat depots. In the present study, the protocol was replicated in male CD1 mice, resulting in a 2000-fold increase in interscapular BAT (IBAT) glycogen levels within 4–12 hours (hr) of refeeding, with IBAT glycogen stores reaching levels comparable to fed liver glycogen. Lesser effects occurred in white adipose tissues (WAT). Over the next 36 hr, glycogen levels dissipated and histological analysis revealed an over-accumulation of lipid droplets, suggesting a potential metabolic connection between glycogenolysis and lipid synthesis. 24 hr of total starvation followed by refeeding induced a robust and consistent glycogen over-accumulation similar in magnitude and time course to the prolonged partial fast. Experimentation demonstrated that hyperglycemia was not sufficient to drive glycogen accumulation in IBAT, but that elevated circulating insulin was sufficient. Additionally, pharmacological inhibition of catecholamine production reduced refeeding-induced IBAT glycogen storage, providing evidence of a contribution from the central nervous system. These findings highlight IBAT as a tissue that integrates both canonically-anabolic and catabolic stimulation for the promotion of glycogen storage during recovery from caloric deficit. The preservation of this robust response through many generations of animals not subjected to food deprivation suggests that the over-accumulation phenomenon plays a critical role in IBAT physiology. PMID:23861810

  12. Can glycogen be measured by in vivo neutron activation analysis?

    International Nuclear Information System (INIS)

    Sutcliffe, J.F.; Smith, A.H.; King, R.F.G.H.; Smith, M.A.

    1992-01-01

    The object of this note is to examine the feasibility of measuring liver glycogen using in vivo neutron activation analysis. The authors present equations which allow the mass of glycogen to be expressed in terms of the masses of oxygen, hydrogen, carbon and nitrogen. Using the most precise, published measurements of these elements, the standard deviation in the estimate of liver glycogen was 34 g. The magnitude of this error precluded observing changes in liver glycogen which are normally in the range 16 g to 72 g. However, this technique might be useful in detecting transient high concentrations of liver glycogen.(UK)

  13. Glycogen with short average chain length enhances bacterial durability

    Science.gov (United States)

    Wang, Liang; Wise, Michael J.

    2011-09-01

    Glycogen is conventionally viewed as an energy reserve that can be rapidly mobilized for ATP production in higher organisms. However, several studies have noted that glycogen with short average chain length in some bacteria is degraded very slowly. In addition, slow utilization of glycogen is correlated with bacterial viability, that is, the slower the glycogen breakdown rate, the longer the bacterial survival time in the external environment under starvation conditions. We call that a durable energy storage mechanism (DESM). In this review, evidence from microbiology, biochemistry, and molecular biology will be assembled to support the hypothesis of glycogen as a durable energy storage compound. One method for testing the DESM hypothesis is proposed.

  14. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  15. Radiometric assays for glycerol, glucose, and glycogen

    International Nuclear Information System (INIS)

    Bradley, D.C.; Kaslow, H.R.

    1989-01-01

    We have developed radiometric assays for small quantities of glycerol, glucose and glycogen, based on a technique described by Thorner and Paulus for the measurement of glycerokinase activity. In the glycerol assay, glycerol is phosphorylated with [32P]ATP and glycerokinase, residual [32P]ATP is hydrolyzed by heating in acid, and free [32P]phosphate is removed by precipitation with ammonium molybdate and triethylamine. Standard dose-response curves were linear from 50 to 3000 pmol glycerol with less than 3% SD in triplicate measurements. Of the substances tested for interference, only dihydroxyacetone gave a slight false positive signal at high concentration. When used to measure glycerol concentrations in serum and in media from incubated adipose tissue, the radiometric glycerol assay correlated well with a commonly used spectrophotometric assay. The radiometric glucose assay is similar to the glycerol assay, except that glucokinase is used instead of glycerokinase. Dose response was linear from 5 to 3000 pmol glucose with less than 3% SD in triplicate measurements. Glucosamine and N-acetylglucosamine gave false positive signals when equimolar to glucose. When glucose concentrations in serum were measured, the radiometric glucose assay agreed well with hexokinase/glucose-6-phosphate dehydrogenase (H/GDH)-based and glucose oxidase/H2O2-based glucose assays. The radiometric method for glycogen measurement incorporates previously described isolation and digestion techniques, followed by the radiometric assay of free glucose. When used to measure glycogen in mouse epididymal fat pads, the radiometric glycogen assay correlated well with the H/GDH-based glycogen assay. All three radiometric assays offer several practical advantages over spectral assays

  16. Glycogen dynamics of crucian carp (Carassius carassius) in prolonged anoxia.

    Science.gov (United States)

    Vornanen, Matti; Haverinen, Jaakko

    2016-12-01

    Mobilization of glycogen stores was examined in the anoxic crucian carp (Carassius carassius Linnaeus). Winter-acclimatized fish were exposed to anoxia for 1, 3, or 6 weeks at 2 °C, and changes in the size of glycogen deposits were followed. After 1 week of anoxia, a major part of the glycogen stores was mobilized in liver (79.5 %) and heart (75.6 %), and large decreases occurred in gill (46.7 %) and muscle (45.1 %). Brain was an exception in that its glycogen content remained unchanged. The amount of glycogen degraded during the first anoxic week was sufficient for the anaerobic ethanol production for more than 6 weeks of anoxia. After 3 and 6 weeks of anoxia, there was little further degradation of glycogen in other tissues except the brain where the stores were reduced by 30.1 and 49.9 % after 3 and 6 weeks of anoxia, respectively. One week of normoxic recovery following the 6-week anoxia was associated with a complete replenishment of the brain glycogen and partial recovery of liver, heart, and gill glycogen stores. Notably, the resynthesis of glycogen occurred at the expense of the existing energy reserves of the body in fasting fish. These findings indicate that in crucian carp, glycogen stores are quickly mobilized after the onset of anoxia, with the exception of the brain whose glycogen stores may be saved for putative emergency situations.

  17. Patterns of glycogen turnover in liver characterized by computer modeling

    International Nuclear Information System (INIS)

    Youn, J.H.; Bergman, R.N.

    1987-01-01

    The authors used a computer model of liver glycogen turnover to reexamine the data of Devos and Hers, who reported the time course of accumulation in and loss from glycogen of label originating in [1- 14 C]galactose injected at different times after the start of refeeding of 40-h fasted mice or rats. In the present study computer representation of individual glycogen molecules was utilized to account for growth and degradation of glycogen according to specific hypothetical patterns. Using this model they could predict the accumulation and localization within glycogen of labeled glucose residues and compare the predictions with the previously published data. They considered three specific hypotheses of glycogen accumulation during refeeding: (1) simultaneous, (2) sequential, and (3) accelerating growth. Hypothetical patterns of glycogen degradation were (1) ordered and (2) random degradation. The pattern of glycogen synthesis consistent with experimental data was a steadily increasing number of growing glycogen molecules, whereas during degradation glycogen molecules are exposed to degrading enzymes randomly, rather than in a specific reverse order of synthesis. These patterns predict the existence of a specific mechanism for the steadily increasing seeding of new glycogen molecules during synthesis

  18. Glycogen and its metabolism: some new developments and old themes

    Science.gov (United States)

    Roach, Peter J.; Depaoli-Roach, Anna A.; Hurley, Thomas D.; Tagliabracci, Vincent S.

    2016-01-01

    Glycogen is a branched polymer of glucose that acts as a store of energy in times of nutritional sufficiency for utilization in times of need. Its metabolism has been the subject of extensive investigation and much is known about its regulation by hormones such as insulin, glucagon and adrenaline (epinephrine). There has been debate over the relative importance of allosteric compared with covalent control of the key biosynthetic enzyme, glycogen synthase, as well as the relative importance of glucose entry into cells compared with glycogen synthase regulation in determining glycogen accumulation. Significant new developments in eukaryotic glycogen metabolism over the last decade or so include: (i) three-dimensional structures of the biosynthetic enzymes glycogenin and glycogen synthase, with associated implications for mechanism and control; (ii) analyses of several genetically engineered mice with altered glycogen metabolism that shed light on the mechanism of control; (iii) greater appreciation of the spatial aspects of glycogen metabolism, including more focus on the lysosomal degradation of glycogen; and (iv) glycogen phosphorylation and advances in the study of Lafora disease, which is emerging as a glycogen storage disease. PMID:22248338

  19. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  20. Lack of Glycogenin Causes Glycogen Accumulation and Muscle Function Impairment.

    Science.gov (United States)

    Testoni, Giorgia; Duran, Jordi; García-Rocha, Mar; Vilaplana, Francisco; Serrano, Antonio L; Sebastián, David; López-Soldado, Iliana; Sullivan, Mitchell A; Slebe, Felipe; Vilaseca, Marta; Muñoz-Cánoves, Pura; Guinovart, Joan J

    2017-07-05

    Glycogenin is considered essential for glycogen synthesis, as it acts as a primer for the initiation of the polysaccharide chain. Against expectations, glycogenin-deficient mice (Gyg KO) accumulate high amounts of glycogen in striated muscle. Furthermore, this glycogen contains no covalently bound protein, thereby demonstrating that a protein primer is not strictly necessary for the synthesis of the polysaccharide in vivo. Strikingly, in spite of the higher glycogen content, Gyg KO mice showed lower resting energy expenditure and less resistance than control animals when subjected to endurance exercise. These observations can be attributed to a switch of oxidative myofibers toward glycolytic metabolism. Mice overexpressing glycogen synthase in the muscle showed similar alterations, thus indicating that this switch is caused by the excess of glycogen. These results may explain the muscular defects of GSD XV patients, who lack glycogenin-1 and show high glycogen accumulation in muscle. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Introduction to the Thematic Minireview Series: Brain glycogen metabolism.

    Science.gov (United States)

    Carlson, Gerald M; Dienel, Gerald A; Colbran, Roger J

    2018-05-11

    The synthesis of glycogen allows for efficient intracellular storage of glucose molecules in a soluble form that can be rapidly released to enter glycolysis in response to energy demand. Intensive studies of glucose and glycogen metabolism, predominantly in skeletal muscle and liver, have produced innumerable insights into the mechanisms of hormone action, resulting in the award of several Nobel Prizes over the last one hundred years. Glycogen is actually present in all cells and tissues, albeit at much lower levels than found in muscle or liver. However, metabolic and physiological roles of glycogen in other tissues are poorly understood. This series of Minireviews summarizes what is known about the enzymes involved in brain glycogen metabolism and studies that have linked glycogen metabolism to multiple brain functions involving metabolic communication between astrocytes and neurons. Recent studies unexpectedly linking some forms of epilepsy to mutations in two poorly understood proteins involved in glycogen metabolism are also reviewed. © 2018 Carlson et al.

  2. Nardostachys Jatamansi root extract protects of radiation induced glycogen depletion in Albino Wistar rats

    International Nuclear Information System (INIS)

    Damodara Gowda, K.M.; Krishna, A.P.; Shetty, Lathika; Suchetha Shetty, N.; Sanjeev, Ganesh

    2013-01-01

    Exposure to ionizing radiation cause variety of pathological processes in irradiated cells. The killing action of ionizing radiation is mainly mediated through the free radicals generated from the radiolysis of cellular water. In the present study, protective effects of Nardostachys Jatamansi root extract (NJE) on radiation induced depletion of glycogen in rats exposed to 3 Gy whole body electron beam irradiation (EBR) was investigated. EBR was performed at Microtron centre, Mangalore University. Treatment of rats with NJE at a dosage of 100, 200 and 400 mg/kg bw respectively once daily for 15 days before, after and both before and after irradiation was done. The liver, kidney and muscle was separated and used for the estimation of total glycogen content using standard procedures and also for the histochemical localization of glycogen by PAS staining method. The data was analyzed by paired t test and Kruskal Wallis test. P<0.05 was the level of significance. The irradiated rats exhibited significant decline (p=0.000) in the level of total glycogen content in the tissues of liver, kidney and muscle whereas, a nonsignificant variation was recorded in rats treated with NJE. This study indicated that treatment with NJE both before and after irradiation for 15 consecutive days provided significant protection against irradiation induced depletion of glycogen. (author)

  3. Characterization of the highly branched glycogen from the thermoacidophilic red microalga Galdieria sulphuraria and comparison with other glycogens.

    Science.gov (United States)

    Martinez-Garcia, Marta; Stuart, Marc C A; van der Maarel, Marc J E C

    2016-08-01

    The thermoacidophilic red microalga Galdieria sulphuraria synthesizes glycogen when growing under heterotrophic conditions. Structural characterization revealed that G. sulphuraria glycogen is the most highly branched glycogen described to date, with 18% of α-(1→6) linkages. Moreover, it differs from other glycogens because it is composed of short chains only and has a substantially smaller molecular weight and particle size. The physiological role of this highly branched glycogen in G. sulphuraria is discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Processivity and Subcellular Localization of Glycogen Synthase Depend on a Non-catalytic High Affinity Glycogen-binding Site*

    OpenAIRE

    Díaz, Adelaida; Martínez-Pons, Carlos; Fita, Ignacio; Ferrer, Juan C.; Guinovart, Joan J.

    2011-01-01

    Glycogen synthase, a central enzyme in glucose metabolism, catalyzes the successive addition of α-1,4-linked glucose residues to the non-reducing end of a growing glycogen molecule. A non-catalytic glycogen-binding site, identified by x-ray crystallography on the surface of the glycogen synthase from the archaeon Pyrococcus abyssi, has been found to be functionally conserved in the eukaryotic enzymes. The disruption of this binding site in both the archaeal and the human muscle glycogen synth...

  5. Ordered synthesis and mobilization of glycogen in the perfused heart

    International Nuclear Information System (INIS)

    Brainard, J.R.; Hutson, J.Y.; Hoekenga, D.E.; Lenhoff, R.

    1989-01-01

    The molecular order of synthesis and mobilization of glycogen in the perfused heart was studied by 13 C NMR. By varying the glucose isotopomer ([1- 13 C]glucose or [2- 13 C]glucose) supplied to the heart, glycogen synthesized at different times during the perfusion was labeled at different carbon sites. Subsequently, the in situ mobilization of glycogen during ischemia was observed by detection of labeled lactate derived from glycolysis of the glucosyl monomers. When [1- 13 C]glucose was given initially in the perfusion and [2- 13 C]glucose was given second, [2- 13 C]lactate was detected first during ischemia and [3- 13 C]lactate second. This result, and the equivalent result when the glucose labels were given in the reverse order, demonstrates that glycogen synthesis and mobilization are ordered in the heart, where glycogen is found morphologically only as β particles. Previous studies of glycogen synthesis and mobilization in liver and adipocytes have suggested that the organization of β particles into α particles was partially responsible for ordered synthesis and mobilization. The observations reported here for cardiac glycogen suggest that another mechanism is responsible. In addition to examine the ordered synthesis and mobilization of cardiac glycogen, the authors have selectively monitored the NMR properties of 13 C-labeled glycogen synthesized early in the perfusion during further glycogen synthesis from a second, differently labeled substrate. During synthesis from the second labeled glucose monomer, the glycogen resonance from the first label decreased in integrated intensity and increased in line width. These results suggest either that there is significant isotopic exchange of glucosyl monomers in glycogen during net synthesis or that glucosyl residues incorporated into glycogen undergo motional restrictions as further glycogen synthesis occurs

  6. CHEMICAL CHARACTERIZATION OF A HYPOGLYCEMIC EXTRACT FROM CUCURBITA FICIFOLIA BOUCHE THAT INDUCES LIVER GLYCOGEN ACCUMULATION IN DIABETIC MICE.

    Science.gov (United States)

    Jessica, Garcia Gonzalez; Mario, Garcia Lorenzana; Alejandro, Zamilpa; Cesar, Almanza Perez Julio; Ivan, Jasso Villagomez E; Ruben, Roman Ramos; Javier, Alarcon-Aguilar Francisco

    2017-01-01

    The aqueous extract of Cucurbita ficifolia ( C. ficifolia ) fruit has demonstrated hypoglycemic effect, which may be attributed to some components in the extract. However, the major secondary metabolites in this fruit have not yet been identified and little is known about its extra-pancreatic action, in particular, on liver carbohydrate metabolism. Therefore, in addition to the isolation and structural elucidation of the principal components in the aqueous extract of C. ficifolia , the aim of this study was to determine whether or not the hypoglycemic effect of the aqueous extract of Cucurbita ficifolia ( C. ficifolia ) fruit is due to accumulation of liver glycogen in diabetic mice. The aqueous extract from fruit of C. ficifolia was fractionated and its main secondary metabolites were purified and chemically characterized (NMR and GC-MS). Alloxan-induced diabetic mice received daily by gavage the aqueous extract (30 days). The liver glycogen content was quantified by spectroscopic method and by PAS stain; ALT and AST by spectrometric method; glycogen synthase, glycogen phosphorylase and GLUT2 by Western blot; the mRNA expression of GLUT2 and glucagon-receptor by RT-PCR; while serum insulin was quantified by ELISA method. A liver histological analysis was also performed by H&E stain. Chemical fingerprint showed five majoritarian compounds in the aqueous extract of C. ficifolia : p -coumaric acid, p-hydroxybenzoic acid, salicin, stigmast-7,2,2-dien-3-ol and stigmast-7-en-3-ol. The histological analysis showed accumulation of liver glycogen. Also, increased glycogen synthase and decreased glycogen phosphorylase were observed. Interestingly, the histological architecture evidenced a liver-protective effect due the extract. Five compounds were identified in C. ficifolia aqueous extract. The hypoglycemic effect of this extract may be partially explained by liver glycogen accumulation. The bioactive compound responsible for the hypoglycemic effect of this extract will be

  7. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  8. Epinephrine-stimulated glycogen breakdown activates glycogen synthase and increases insulin-stimulated glucose uptake in epitrochlearis muscles

    DEFF Research Database (Denmark)

    Kolnes, Anders J; Birk, Jesper Bratz; Eilertsen, Einar

    2015-01-01

    Adrenaline increases glycogen synthase (GS) phosphorylation and decreases GS activity but also stimulates glycogen breakdown and low glycogen content normally activates GS. To test the hypothesis that glycogen content directly regulates GS phosphorylation, glycogen breakdown was stimulated...... in condition with decreased GS activation. Saline or adrenaline (0.02mg/100g rat) was injected subcutaneously in Wistar rats (~130 g) with low (24 h fasted), normal (normal diet) and high glycogen content (fasted-refed) and epitrochlearis muscles were removed after 3 h and incubated ex vivo eliminating...... adrenaline action. Adrenaline injection reduced glycogen content in epitrochlearis muscles with high (120.7±17.8 vs 204.6±14.5 mmol•kg(-1); pglycogen (89.5±7.6 vs 152.6±8.1 mmol•kg(-1); pglycogen (90.0±5.0 vs 102.8±7.8 mmol•kg(-1); p=0...

  9. Energy utilization and gluconeogenesis in isolated leech segmental ganglia: Quantitative studies on the control and cellular localization of endogenous glycogen.

    Science.gov (United States)

    Pennington, A J; Pentreath, V W

    1988-01-01

    The isolated segmental ganglia of the horse leech Haemopis sanguisuga were used as a model system to study the utilization and control of glycogen stores within nervous tissue. The glycogen in the ganglia was extracted and assayed fluorimentrically and its cellular localization and turnover studied by autoradiography in conjunction with [(3)H]glucose. We measured the glycogen after various periods of electrical stimulation and after incubation with K(+), Ca(2+), ouabain and glucose. The results for each experimental ganglion were compared to a paired control ganglion and the results analysed by paired t-tests. Electrical stimulation caused sequential changes in glycogen levels: a reduction of up to 67% (5-10 min); followed by an increase of up to 124% (between 15-50 min); followed by a reduction of up to 63% (60-90 min). Values were calculated for glucose utilization (e.g. 0.53 ?mol glucose/gm wet weight/min after 90 min) and estimates derived for glucose consumption per action potential per neuron (e.g. 0.12 fmol at 90 min). Glucose (1.5-10 mM) increased the amount of glycogen (1.5 mM by 30% at 60 min) and attenuated the effects of electrical stimulation. Ouabain (1 mM) blocked the effect of 5 min electrical stimulation. Nine millimolar K(+) increased glycogen by 27% after 10 min and decreased glycogen by 34% after 60 min; 3 mM Ca(2+) had no effect after 10 or 20 min and decreased glycogen by 29% after 60 min. Other concentrations of K(+) and Ca(2+) reduced glycogen after 60 min. Autoradiographic analysis demonstrated that the effects of elevated K(+) were principally within the glial cells. We conclude that (i) the glycogen stores in the glial cells of leech segmental ganglia provide an endogenous energy source which can support sustained neuronal activity, (ii) both electrical stimulation and elevated K(+) can induce gluconeogenesis within the ganglia, (iii) that electrical activation of neurons produces changes in the glycogen in the glial cells which are

  10. Intrinsic and extrinsic carbohydrates in the vagina: A short review on vaginal glycogen.

    Science.gov (United States)

    Tester, Richard; Al-Ghazzewi, Farage H

    2018-06-01

    The reasons for (i) the presence and (ii) mechanisms of utilisation of glycogen by the lactic acid bacteria in the human vaginal tract are not well understood. It is probable that the vaginal epithelia produce both glycogen and α-amylase where the enzyme depolymerises the polysaccharide within the vagina itself. Only these depolymerised residues are then utilised for growth by the lactic acid bacteria. The lactic acid bacteria cannot metabolise the glycogen directly due to their incapacity to produce the α-amylase enzyme. These bacteria may, however, metabolise exogenous carbohydrates (such as prebiotics) selectively for growth effectively. These carbohydrate utilisation issues within the vagina are considered in this short review. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  12. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  13. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  14. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  15. Functional significance of brain glycogen in sustaining glutamatergic neurotransmission.

    Science.gov (United States)

    Sickmann, Helle M; Walls, Anne B; Schousboe, Arne; Bouman, Stephan D; Waagepetersen, Helle S

    2009-05-01

    The involvement of brain glycogen in sustaining neuronal activity has previously been demonstrated. However, to what extent energy derived from glycogen is consumed by astrocytes themselves or is transferred to the neurons in the form of lactate for oxidative metabolism to proceed is at present unclear. The significance of glycogen in fueling glutamate uptake into astrocytes was specifically addressed in cultured astrocytes. Moreover, the objective was to elucidate whether glycogen derived energy is important for maintaining glutamatergic neurotransmission, induced by repetitive exposure to NMDA in co-cultures of cerebellar neurons and astrocytes. In the astrocytes it was shown that uptake of the glutamate analogue D-[3H]aspartate was impaired when glycogen degradation was inhibited irrespective of the presence of glucose, signifying that energy derived from glycogen degradation is important for the astrocytic compartment. By inhibiting glycogen degradation in co-cultures it was evident that glycogen provides energy to sustain glutamatergic neurotransmission, i.e. release and uptake of glutamate. The relocation of glycogen derived lactate to the neuronal compartment was investigated by employing d-lactate, a competitive substrate for the monocarboxylate transporters. Neurotransmitter release was affected by the presence of d-lactate indicating that glycogen derived energy is important not only in the astrocytic but also in the neuronal compartment.

  16. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  17. Role of Maltose Enzymes in Glycogen Synthesis by Escherichia coli▿

    Science.gov (United States)

    Park, Jong-Tae; Shim, Jae-Hoon; Tran, Phuong Lan; Hong, In-Hee; Yong, Hwan-Ung; Oktavina, Ershita Fitria; Nguyen, Hai Dang; Kim, Jung-Wan; Lee, Tae Soo; Park, Sung-Hoon; Boos, Winfried; Park, Kwan-Hwa

    2011-01-01

    Mutants with deletion mutations in the glg and mal gene clusters of Escherichia coli MC4100 were used to gain insight into glycogen and maltodextrin metabolism. Glycogen content, molecular mass, and branch chain distribution were analyzed in the wild type and in ΔmalP (encoding maltodextrin phosphorylase), ΔmalQ (encoding amylomaltase), ΔglgA (encoding glycogen synthase), and ΔglgA ΔmalP derivatives. The wild type showed increasing amounts of glycogen when grown on glucose, maltose, or maltodextrin. When strains were grown on maltose, the glycogen content was 20 times higher in the ΔmalP strain (0.97 mg/mg protein) than in the wild type (0.05 mg/mg protein). When strains were grown on glucose, the ΔmalP strain and the wild type had similar glycogen contents (0.04 mg/mg and 0.03 mg/mg protein, respectively). The ΔmalQ mutant did not grow on maltose but showed wild-type amounts of glycogen when grown on glucose, demonstrating the exclusive function of GlgA for glycogen synthesis in the absence of maltose metabolism. No glycogen was found in the ΔglgA and ΔglgA ΔmalP strains grown on glucose, but substantial amounts (0.18 and 1.0 mg/mg protein, respectively) were found when they were grown on maltodextrin. This demonstrates that the action of MalQ on maltose or maltodextrin can lead to the formation of glycogen and that MalP controls (inhibits) this pathway. In vitro, MalQ in the presence of GlgB (a branching enzyme) was able to form glycogen from maltose or linear maltodextrins. We propose a model of maltodextrin utilization for the formation of glycogen in the absence of glycogen synthase. PMID:21421758

  18. Exposures to arsenite and methylarsonite produce insulin resistance and impair insulin-dependent glycogen metabolism in hepatocytes.

    Science.gov (United States)

    Zhang, Chongben; Fennel, Emily M J; Douillet, Christelle; Stýblo, Miroslav

    2017-12-01

    Environmental exposure to inorganic arsenic (iAs) has been shown to disturb glucose homeostasis, leading to diabetes. Previous laboratory studies have suggested several mechanisms that may underlie the diabetogenic effects of iAs exposure, including (i) inhibition of insulin signaling (leading to insulin resistance) in glucose metabolizing peripheral tissues, (ii) inhibition of insulin secretion by pancreatic β cells, and (iii) dysregulation of the methylation or expression of genes involved in maintenance of glucose or insulin metabolism and function. Published studies have also shown that acute or chronic iAs exposures may result in depletion of hepatic glycogen stores. However, effects of iAs on pathways and mechanisms that regulate glycogen metabolism in the liver have never been studied. The present study examined glycogen metabolism in primary murine hepatocytes exposed in vitro to arsenite (iAs 3+ ) or its methylated metabolite, methylarsonite (MAs 3+ ). The results show that 4-h exposures to iAs 3+ and MAs 3+ at concentrations as low as 0.5 and 0.2 µM, respectively, decreased glycogen content in insulin-stimulated hepatocytes by inhibiting insulin-dependent activation of glycogen synthase (GS) and by inducing activity of glycogen phosphorylase (GP). Further investigation revealed that both iAs 3+ and MAs 3+ inhibit insulin-dependent phosphorylation of protein kinase B/Akt, one of the mechanisms involved in the regulation of GS and GP by insulin. Thus, inhibition of insulin signaling (i.e., insulin resistance) is likely responsible for the dysregulation of glycogen metabolism in hepatocytes exposed to iAs 3+ and MAs 3+ . This study provides novel information about the mechanisms by which iAs exposure impairs glucose homeostasis, pointing to hepatic metabolism of glycogen as one of the targets.

  19. Postexercise Glycogen Recovery and Exercise Performance is Not Significantly Different Between Fast Food and Sport Supplements.

    Science.gov (United States)

    Cramer, Michael J; Dumke, Charles L; Hailes, Walter S; Cuddy, John S; Ruby, Brent C

    2015-10-01

    A variety of dietary choices are marketed to enhance glycogen recovery after physical activity. Past research informs recommendations regarding the timing, dose, and nutrient compositions to facilitate glycogen recovery. This study examined the effects of isoenergetic sport supplements (SS) vs. fast food (FF) on glycogen recovery and exercise performance. Eleven males completed two experimental trials in a randomized, counterbalanced order. Each trial included a 90-min glycogen depletion ride followed by a 4-hr recovery period. Absolute amounts of macronutrients (1.54 ± 0.27 g·kg-1 carbohydrate, 0.24 ± 0.04 g·kg fat-1, and 0.18 ±0.03g·kg protein-1) as either SS or FF were provided at 0 and 2 hr. Muscle biopsies were collected from the vastus lateralis at 0 and 4 hr post exercise. Blood samples were analyzed at 0, 30, 60, 120, 150, 180, and 240 min post exercise for insulin and glucose, with blood lipids analyzed at 0 and 240 min. A 20k time-trial (TT) was completed following the final muscle biopsy. There were no differences in the blood glucose and insulin responses. Similarly, rates of glycogen recovery were not different across the diets (6.9 ± 1.7 and 7.9 ± 2.4 mmol·kg wet weight- 1·hr-1 for SS and FF, respectively). There was also no difference across the diets for TT performance (34.1 ± 1.8 and 34.3 ± 1.7 min for SS and FF, respectively. These data indicate that short-term food options to initiate glycogen resynthesis can include dietary options not typically marketed as sports nutrition products such as fast food menu items.

  20. 1H NMR visibility of mammalian glycogen in solution

    International Nuclear Information System (INIS)

    Zang, L.H.; Rothman, D.L.; Shulman, R.G.

    1990-01-01

    High-resolution 1 H NMR spectra of rabbit liver glycogen in 2 H 2 O were obtained at 500 MHz, and several resonances were assigned by comparison with the chemical shifts of α-linked diglucose molecules. The NMR relaxation times T 1 and T 2 of glycogen in 2 H 2 O were determined to be 1.1 and 0.029 s, respectively. The measured natural linewidth of the carbon-1 proton is in excellent agreement with that calculated from T 2 . The visibility measurements made by digesting glycogen and comparing glucose and glycogen signal intensities demonstrate that in spite of the very high molecular weight, all of the proton nuclei in glycogen contribute to the NMR spectrum. The result is not unexpected, since 100% NMR visibility was previously observed from the carbon nuclei of glycogen, due to the rapid intramolecular motions

  1. In vivo hepatic glycogen metabolism in the baboon

    International Nuclear Information System (INIS)

    Jehenson, P.; Canioni, P.; Hantraye, P.; Gueron, M.; Syrota, A.

    1988-01-01

    This paper describes hepatic glycogen synthesis from glucose studied in the baboon by C-13 MR spectroscopy at 2 T. Glycogen synthesis was followed for 3 hours on natural abundance spectra during glucose infusion. (1-C-13)-glucose (3g) was then injected. It produced a ten times larger rate of increase of glycogen-C 1 , which is much lower than expected, suggesting that glycogen synthesis mainly occurred from unlabeled gluconeogenic substrates. Signal-to-noise ratio was 50 for glycogen-C 1 on 2-minute H-1 decoupled spectra. Labeling of C 1 but also C 2 , C 5 and C 6 of glycogen indicated a 15% contribution of indirect pathways to its synthesis from glucose

  2. Analysis of genes involved in glycogen degradation in Escherichia coli.

    Science.gov (United States)

    Strydom, Lindi; Jewell, Jonathan; Meier, Michael A; George, Gavin M; Pfister, Barbara; Zeeman, Samuel; Kossmann, Jens; Lloyd, James R

    2017-02-01

    Escherichia coli accumulate or degrade glycogen depending on environmental carbon supply. Glycogen phosphorylase (GlgP) and glycogen debranching enzyme (GlgX) are known to act on the glycogen polymer, while maltodextrin phosphorylase (MalP) is thought to remove maltodextrins released by GlgX. To examine the roles of these enzymes in more detail, single, double and triple mutants lacking all their activities were produced. GlgX and GlgP were shown to act directly on the glycogen polymer, while MalP most likely catabolised soluble malto-oligosaccharides. Interestingly, analysis of a triple mutant lacking all three enzymes indicates the presence of another enzyme that can release maltodextrins from glycogen. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Qualitative and Quantitative Analyses of Glycogen in Human Milk.

    Science.gov (United States)

    Matsui-Yatsuhashi, Hiroko; Furuyashiki, Takashi; Takata, Hiroki; Ishida, Miyuki; Takumi, Hiroko; Kakutani, Ryo; Kamasaka, Hiroshi; Nagao, Saeko; Hirose, Junko; Kuriki, Takashi

    2017-02-22

    Identification as well as a detailed analysis of glycogen in human milk has not been shown yet. The present study confirmed that glycogen is contained in human milk by qualitative and quantitative analyses. High-performance anion exchange chromatography (HPAEC) and high-performance size exclusion chromatography with a multiangle laser light scattering detector (HPSEC-MALLS) were used for qualitative analysis of glycogen in human milk. Quantitative analysis was carried out by using samples obtained from the individual milks. The result revealed that the concentration of human milk glycogen varied depending on the mother's condition-such as the period postpartum and inflammation. The amounts of glycogen in human milk collected at 0 and 1-2 months postpartum were higher than in milk collected at 3-14 months postpartum. In the milk from mothers with severe mastitis, the concentration of glycogen was about 40 times higher than that in normal milk.

  4. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  5. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  6. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Science.gov (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  7. Glycogen distribution in adult and geriatric mice brains

    KAUST Repository

    Alrabeh, Rana

    2017-05-01

    Astrocytes, the most abundant glial cell type in the brain, undergo a number of roles in brain physiology; among them, the energetic support of neurons is the best characterized. Contained within astrocytes is the brain’s obligate energy store, glycogen. Through glycogenolysis, glycogen, a storage form of glucose, is converted to pyruvate that is further reduced to lactate and transferred to neurons as an energy source via MCTs. Glycogen is a multi-branched polysaccharide synthesized from the glucose uptaken in astrocytes. It has been shown that glycogen accumulates with age and contributes to the physiological ageing process in the brain. In this study, we compared glycogen distribution between young adults and geriatric mice to understand the energy consumption of synaptic terminals during ageing using computational tools. We segmented and densely reconstructed neuropil and glycogen granules within six (three 4 month old old and three 24 month old) volumes of Layer 1 somatosensory cortex mice brains from FIB-SEM stacks, using a combination of semi-automated and manual tools, ilastik and TrakEM2. Finally, the 3D visualization software, Blender, was used to analyze the dataset using the DBSCAN and KDTree Nearest neighbor algorithms to study the distribution of glycogen granules compared to synapses, using a plugin that was developed for this purpose. The Nearest Neighbors and clustering results of 6 datasets show that glycogen clusters around excitatory synapses more than inhibitory synapses and that, in general, glycogen is found around axonal boutons more than dendritic spines. There was no significant accumulation of glycogen with ageing within our admittedly small dataset. However, there was a homogenization of glycogen distribution with age and that is consistent with published literature. We conclude that glycogen distribution in the brain is not a random process but follows a function distribution.

  8. Novel method for detection of glycogen in cells.

    Science.gov (United States)

    Skurat, Alexander V; Segvich, Dyann M; DePaoli-Roach, Anna A; Roach, Peter J

    2017-05-01

    Glycogen, a branched polymer of glucose, functions as an energy reserve in many living organisms. Abnormalities in glycogen metabolism, usually excessive accumulation, can be caused genetically, most often through mutation of the enzymes directly involved in synthesis and degradation of the polymer leading to a variety of glycogen storage diseases (GSDs). Microscopic visualization of glycogen deposits in cells and tissues is important for the study of normal glycogen metabolism as well as diagnosis of GSDs. Here, we describe a method for the detection of glycogen using a renewable, recombinant protein which contains the carbohydrate-binding module (CBM) from starch-binding domain containing protein 1 (Stbd1). We generated a fusion protein containing g lutathione S-transferase, a cM c eptitope and the tbd1 BM (GYSC) for use as a glycogen-binding probe, which can be detected with secondary antibodies against glutathione S-transferase or cMyc. By enzyme-linked immunosorbent assay, we demonstrate that GYSC binds glycogen and two other polymers of glucose, amylopectin and amylose. Immunofluorescence staining of cultured cells indicate a GYSC-specific signal that is co-localized with signals obtained with anti-glycogen or anti-glycogen synthase antibodies. GYSC-positive staining inside of lysosomes is observed in individual muscle fibers isolated from mice deficient in lysosomal enzyme acid alpha-glucosidase, a well-characterized model of GSD II (Pompe disease). Co-localized GYSC and glycogen signals are also found in muscle fibers isolated from mice deficient in malin, a model for Lafora disease. These data indicate that GYSC is a novel probe that can be used to study glycogen metabolism under normal and pathological conditions. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  9. Partial recovery of erythrocyte glycogen in diabetic rats treated with phenobarbital

    Directory of Open Access Journals (Sweden)

    da-Silva C.A.

    1997-01-01

    Full Text Available Erythrocytes may play a role in glucose homeostasis during the postprandial period. Erythrocytes from diabetic patients are defective in glucose transport and metabolism, functions that may affect glycogen storage. Phenobarbital, a hepatic enzyme inducer, has been used in the treatment of patients with non-insulin-dependent diabetes mellitus (NIDDM, increasing the insulin-mediated glucose disposal. We studied the effects of phenobarbital treatment in vivo on glycemia and erythrocyte glycogen content in control and alloxan-diabetic rats during the postprandial period. In control rats (blood glucose, 73 to 111 mg/dl in femoral and suprahepatic veins the erythrocyte glycogen content was 45.4 ± 1.1 and 39.1 ± 0.8 µg/g Hb (mean ± SEM, N = 4-6 in the femoral artery and vein, respectively, and 37.9 ± 1.1 in the portal vein and 47.5 ± 0.9 in the suprahepatic vein. Diabetic rats (blood glucose, 300-350 mg/dl presented low (P<0.05 erythrocyte glycogen content, i.e., 9.6 ± 0.1 and 7.1 ± 0.7 µg/g Hb in the femoral artery and vein, respectively, and 10.0 ± 0.7 and 10.7 ± 0.5 in the portal and suprahepatic veins, respectively. After 10 days of treatment, phenobarbital (0.5 mg/ml in the drinking water did not change blood glucose or erythrocyte glycogen content in control rats. In diabetic rats, however, it lowered (P<0.05 blood glucose in the femoral artery (from 305 ± 18 to 204 ± 45 mg/dl and femoral vein (from 300 ± 11 to 174 ± 48 mg/dl and suprahepatic vein (from 350 ± 10 to 174 ± 42 mg/dl, but the reduction was not sufficient for complete recovery. Phenobarbital also stimulated the glycogen synthesis, leading to a partial recovery of glycogen stores in erythrocytes. In treated rats, erythrocyte glycogen content increased to 20.7 ± 3.8 µg/g Hb in the femoral artery and 30.9 ± 0.9 µg/g Hb in the suprahepatic vein (P<0.05. These data indicate that phenobarbital activated some of the insulin-stimulated glucose metabolism steps which were

  10. Glycogen storage disease type I: clinical and laboratory profile

    Directory of Open Access Journals (Sweden)

    Berenice L. Santos

    2014-12-01

    Full Text Available OBJECTIVES: To characterize the clinical, laboratory, and anthropometric profile of a sample of Brazilian patients with glycogen storage disease type I managed at an outpatient referral clinic for inborn errors of metabolism. METHODS: This was a cross-sectional outpatient study based on a convenience sampling strategy. Data on diagnosis, management, anthropometric parameters, and follow-up were assessed. RESULTS: Twenty-one patients were included (median age 10 years, range 1-25 years, all using uncooked cornstarch therapy. Median age at diagnosis was 7 months (range, 1-132 months, and 19 patients underwent liver biopsy for diagnostic confirmation. Overweight, short stature, hepatomegaly, and liver nodules were present in 16 of 21, four of 21, nine of 14, and three of 14 patients, respectively. A correlation was found between height-for-age and BMI-for-age Z-scores (r = 0.561; p = 0.008. CONCLUSIONS: Diagnosis of glycogen storage disease type I is delayed in Brazil. Most patients undergo liver biopsy for diagnostic confirmation, even though the combination of a characteristic clinical presentation and molecular methods can provide a definitive diagnosis in a less invasive manner. Obesity is a side effect of cornstarch therapy, and appears to be associated with growth in these patients.

  11. High glycogen levels in the hippocampus of patients with epilepsy

    DEFF Research Database (Denmark)

    Dalsgaard, Mads K; Madsen, Flemming F; Secher, Niels H

    2006-01-01

    During intense cerebral activation approximately half of the glucose plus lactate taken up by the human brain is not oxidized and could replenish glycogen deposits, but the human brain glycogen concentration is unknown. In patients with temporal lobe epilepsy, undergoing curative surgery, brain......, glycogen was similarly higher than in grey and white matter. Consequently, in human grey and white matter and, particularly, in the hippocampus of patients with temporal lope epilepsy, glycogen constitutes a large, active energy reserve, which may be of importance for energy provision during sustained...

  12. Tyrosine glycosylation is involved in muscle-glycogen synthesis

    International Nuclear Information System (INIS)

    Rodriguez, I.R.; Tandecarz, J.S.; Kirkman, B.R.; Whelan, W.J.

    1986-01-01

    Rabbit-muscle glycogen contains a covalently bound protein having Mr 37,000 that the authors will henceforth refer to as glycogenin. It is completely insoluble in water at pH 5, and may be generated as a precipitate as a result of the combined action on glycogen of α-amylase and glucoamylase, or by treatment with anhydrous hydrogen fluoride. In the former case the protein still carries some of the glucose residues of glycogen (10-30 per mole of glycogenin). The linkage between glycogen and glycogenin has been identified as a novel glycosidic-amino acid bond. The authors demonstrated glucosylation with UDP[/sup 14/C]glucose by a muscle extract of two rabbit-muscle proteins contained in the same extract. The relation of these proteins to glycogenin, and whether the amino acid undergoing glucosylation is tyrosine, remains to be explored. The discovery of glycogenin is, the authors believe, an important clue to the mechanism of biogenesis of glycogen and may represent a previously unsuspected means of metabolic control of the glycogen content of the cell and the location of glycogen within the cell. The facts that the linkage between glycogen and glycogenin is via tyrosine, that insulin stimulates glycogen synthesis, and acts on its receptor by causing it to become an active tyrosine kinase, may be linked by a common thread

  13. Extraction of glycogen on mild condition lacks AIG fraction.

    Science.gov (United States)

    Ghafouri, Z; Rasouli, M

    2016-12-01

    Extraction of animal tissues with cold water or perchloric acid yields less glycogen than is obtained with hot-alkaline. Extraction with acid and alkaline gives two fractions, acid soluble (ASG) and insoluble glycogen (AIG). The aim of this work is to examine the hypothesis that not all liver glycogen is extractable by Tris-buffer using current techniques. Rat liver was homogenized with Tris-buffer pH 8.3 and extracted for the glycogen fractions, ASG and AIG. The degree of homogenization was changed to remove all glycogen. The content of glycogen was 47.7 ± 1.2 and 11.6 ± 0.8 mg/g wet liver in the supernatant and pellet of the first extraction respectively. About 24% of total glycogen is lost through the first pellet. Increasing the extent of homogenization from 30 to 180 sec and from 15000 to 20000 rpm followed with 30 sec ultrasonication did not improve the extraction. ASG and AIG constitute about 77% and 23% of the pellet glycogen respectively. Extraction with cold Tris-buffer failed to extract glycogen completely.  Increasing the extent of homogenization followed with ultrasonication also did not improve the extraction. Thus it is necessary to re-examine the previous findings obtained by extraction with cold Tris-buffer.

  14. Abnormal Glycogen Storage by Retinal Neurons in Diabetes.

    Science.gov (United States)

    Gardiner, Tom A; Canning, Paul; Tipping, Nuala; Archer, Desmond B; Stitt, Alan W

    2015-12-01

    It is widely held that neurons of the central nervous system do not store glycogen and that accumulation of the polysaccharide may cause neurodegeneration. Since primary neural injury occurs in diabetic retinopathy, we examined neuronal glycogen status in the retina of streptozotocin-induced diabetic and control rats. Glycogen was localized in eyes of streptozotocin-induced diabetic and control rats using light microscopic histochemistry and electron microscopy, and correlated with immunohistochemical staining for glycogen phosphorylase and phosphorylated glycogen synthase (pGS). Electron microscopy of 2-month-old diabetic rats (n = 6) showed massive accumulations of glycogen in the perinuclear cytoplasm of many amacrine neurons. In 4-month-old diabetic rats (n = 11), quantification of glycogen-engorged amacrine cells showed a mean of 26 cells/mm of central retina (SD ± 5), compared to 0.5 (SD ± 0.2) in controls (n = 8). Immunohistochemical staining for glycogen phosphorylase revealed strong expression in amacrine and ganglion cells of control retina, and increased staining in cell processes of the inner plexiform layer in diabetic retina. In control retina, the inactive pGS was consistently sequestered within the cell nuclei of all retinal neurons and the retinal pigment epithelium (RPE), but in diabetics nuclear pGS was reduced or lost in all classes of retinal cell except the ganglion cells and cone photoreceptors. The present study identifies a large population of retinal neurons that normally utilize glycogen metabolism but show pathologic storage of the polysaccharide during uncontrolled diabetes.

  15. Pemulihan Kadar Glikogen Serta Peningkatan Konsumsi Glukosa dan Trigliserida Saat Aktivitas Fisik Pascapemberian Ekstrak Kulit Buah Manggis (GLYCOGEN RECOVERY AND INCREASE CONSUMPTION OF GLUCOSE AND TRIGLYCERIDE DURING PHYSICAL ACTIVITIES AFTER ADMINISTRA

    OpenAIRE

    I Nyoman Arsana; Ni Ketut Ayu Juliasih

    2016-01-01

    This study was aimed to investigate the effect of mangosteen rind on the glycogen recovery of themuscle and the liver, and the glucose and the triglyceride consumption during physical activities. ARandomized Block Design was applied with four treatments: control (K), physical activity (KF), physicalactivity and extract (FE),extract (E). The extract dosage was 400 mg/kg bodyweight/day administered forfour weeks. The assessed variables were the muscle glycogen, the liver glycogen, the blood gly...

  16. Diurnal variation in glycogen phosphorylase activity in rat liver. A quantitative histochemical study

    NARCIS (Netherlands)

    Frederiks, W. M.; Marx, F.; Bosch, K. S.

    1987-01-01

    The diurnal variations of the glycogen content and of glycogen phosphorylase activity in periportal and pericentral areas of rat liver parenchyma have been analyzed in periodic acid Schiff (PAS)-stained cryostat sections using quantitative microdensitometry. Glycogen content and phosphorylase

  17. Volume I. Glycogen: A historical overview, an adjunct to thesis. Volume II. Non-glucose components of glycogen

    International Nuclear Information System (INIS)

    Kirkman, B.R.

    1988-01-01

    Investigations have been carried out on three non-glucose components of native glycogen: protein, glucosamine, and phosphate. The protein, glycogenin, appears to serve as the primer upon which new molecules of glycogen are synthesized. When cell extracts are incubated with ( 14 C)UDPG, ( 14 C)glucose becomes transferred onto pre-existing chains of alpha-1,4 linked glucose associated with free glycogenin. The transferase and glycogenin remain associated during various purification steps. Liver glycogen appears to contain less than 0.02% protein which may correspond to the presence of one molecule of glycogenin (37 kDa) per alpha particle of liver glycogen. The core beta particle within each alpha particle may be synthesized upon glycogenin, while the remaining 20-40 beta particles may arise from each other. The author has demonstrated the natural occurrence of glucosamine in liver glycogen (but not muscle glycogen) from various species in an amount of about one molecule per molecule of glycogen. The glucosamine is underivatized, appears to be randomly scattered in the glycogen, and may be derived from dietary galactosamine. Similar to Fontana (1980), the author observed that native liver glycogen could be fractionated on DEAE-cellulose apparently on the basis of phosphate content. The more strongly bound glycogen possessed a greater molecular weight and content of glucosamine and phosphate. Possible explanations for these subfractions are considered. The phosphate appears to be concentrated near the center of the glycogen molecules. About 30% appears to be associated with glucose-6P and the remainder with an unidentified phosphodiester. The phosphate may stimulate glycogen synthesis. How the phosphate becomes incorporated is unknown

  18. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  19. A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

    DEFF Research Database (Denmark)

    Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

    2017-01-01

    BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...

  20. Contributions of Glycogen to Astrocytic Energetics during Brain Activation

    Science.gov (United States)

    Dienel, Gerald A.; Cruz, Nancy F.

    2014-01-01

    Glycogen is the major store of glucose in brain and is mainly in astrocytes. Brain glycogen levels in unstimulated, carefully-handled rats are 10-12 mol/g, and assuming that astrocytes account for half the brain mass, astrocytic glycogen content is twice as high. Glycogen turnover is slow under basal conditions, but it is mobilized during activation. There is no net increase in incorporation of label from glucose during activation, whereas label release from pre-labeled glycogen exceeds net glycogen consumption, which increases during stronger stimuli. Because glycogen level is restored by non-oxidative metabolism, astrocytes can influence the global ratio of oxygen to glucose utilization. Compensatory increases in utilization of blood glucose during inhibition of glycogen phosphorylase are large and approximate glycogenolysis rates during sensory stimulation. In contrast, glycogenolysis rates during hypoglycemia are low due to continued glucose delivery and oxidation of endogenous substrates; rates that preserve neuronal function in the absence of glucose are also low, probably due to metabolite oxidation. Modeling studies predict that glycogenolysis maintains a high level of glucose-6-phosphate in astrocytes to maintain feedback inhibition of hexokinase, thereby diverting glucose for use by neurons. The fate of glycogen carbon in vivo is not known, but lactate efflux from brain best accounts for the major metabolic characteristics during activation of living brain. Substantial shuttling coupled with oxidation of glycogen-derived lactate is inconsistent with available evidence. Glycogen has important roles in astrocytic energetics, including glucose sparing, control of extracellular K+ level, oxidative stress management, and memory consolidation; it is a multi-functional compound. PMID:24515302

  1. Contributions of glycogen to astrocytic energetics during brain activation.

    Science.gov (United States)

    Dienel, Gerald A; Cruz, Nancy F

    2015-02-01

    Glycogen is the major store of glucose in brain and is mainly in astrocytes. Brain glycogen levels in unstimulated, carefully-handled rats are 10-12 μmol/g, and assuming that astrocytes account for half the brain mass, astrocytic glycogen content is twice as high. Glycogen turnover is slow under basal conditions, but it is mobilized during activation. There is no net increase in incorporation of label from glucose during activation, whereas label release from pre-labeled glycogen exceeds net glycogen consumption, which increases during stronger stimuli. Because glycogen level is restored by non-oxidative metabolism, astrocytes can influence the global ratio of oxygen to glucose utilization. Compensatory increases in utilization of blood glucose during inhibition of glycogen phosphorylase are large and approximate glycogenolysis rates during sensory stimulation. In contrast, glycogenolysis rates during hypoglycemia are low due to continued glucose delivery and oxidation of endogenous substrates; rates that preserve neuronal function in the absence of glucose are also low, probably due to metabolite oxidation. Modeling studies predict that glycogenolysis maintains a high level of glucose-6-phosphate in astrocytes to maintain feedback inhibition of hexokinase, thereby diverting glucose for use by neurons. The fate of glycogen carbon in vivo is not known, but lactate efflux from brain best accounts for the major metabolic characteristics during activation of living brain. Substantial shuttling coupled with oxidation of glycogen-derived lactate is inconsistent with available evidence. Glycogen has important roles in astrocytic energetics, including glucose sparing, control of extracellular K(+) level, oxidative stress management, and memory consolidation; it is a multi-functional compound.

  2. Glycogen synthesis in human gastrocnemius muscle is not representative of whole-body muscle glycogen synthesis.

    NARCIS (Netherlands)

    Serlie, M.J.; Haan, J.H.A. de; Tack, C.J.J.; Verberne, H.J.; Ackermans, M.T.; Heerschap, A.; Sauerwein, H.P.

    2005-01-01

    The introduction of 13C magnetic resonance spectroscopy (MRS) has enabled noninvasive measurement of muscle glycogen synthesis in humans. Conclusions based on measurements by the MRS technique assume that glucose metabolism in gastrocnemius muscle is representative for all skeletal muscles and thus

  3. Glycogen synthesis in human gastrocnemius muscle is not representative of whole-body muscle glycogen synthesis

    NARCIS (Netherlands)

    Serlie, Mireille J. M.; de Haan, Jacco H.; Tack, Cees J.; Verberne, Hein J.; Ackermans, Mariette T.; Heerschap, Arend; Sauerwein, Hans P.

    2005-01-01

    The introduction of C-13 magnetic resonance spectroscopy (MRS) has enabled noninvasive measurement of muscle glycogen synthesis in humans. Conclusions based on measurements by the MRS technique assume that glucose metabolism in gastrocnemius muscle is representative for all skeletal muscles and thus

  4. Glycogen Synthase Kinase-3 is involved in glycogen metabolism control and embryogenesis of Rhodnius prolixus.

    Science.gov (United States)

    Mury, Flávia B; Lugon, Magda D; DA Fonseca, Rodrigo Nunes; Silva, Jose R; Berni, Mateus; Araujo, Helena M; Fontenele, Marcio Ribeiro; Abreu, Leonardo Araujo DE; Dansa, Marílvia; Braz, Glória; Masuda, Hatisaburo; Logullo, Carlos

    2016-10-01

    Rhodnius prolixus is a blood-feeding insect that transmits Trypanosoma cruzi and Trypanosoma rangeli to vertebrate hosts. Rhodnius prolixus is also a classical model in insect physiology, and the recent availability of R. prolixus genome has opened new avenues on triatomine research. Glycogen synthase kinase 3 (GSK-3) is classically described as a key enzyme involved in glycogen metabolism, also acting as a downstream component of the Wnt pathway during embryogenesis. GSK-3 has been shown to be highly conserved among several organisms, mainly in the catalytic domain region. Meanwhile, the role of GSK-3 during R. prolixus embryogenesis or glycogen metabolism has not been investigated. Here we show that chemical inhibition of GSK-3 by alsterpaullone, an ATP-competitive inhibitor of GSK3, does not affect adult survival rate, though it alters oviposition and egg hatching. Specific GSK-3 gene silencing by dsRNA injection in adult females showed a similar phenotype. Furthermore, bright field and 4'-6-diamidino-2-phenylindole (DAPI) staining analysis revealed that ovaries and eggs from dsGSK-3 injected females exhibited specific morphological defects. We also demonstrate that glycogen content was inversely related to activity and transcription levels of GSK-3 during embryogenesis. Lastly, after GSK-3 knockdown, we observed changes in the expression of the Wingless (Wnt) downstream target β-catenin as well as in members of other pathways such as the receptor Notch. Taken together, our results show that GSK-3 regulation is essential for R. prolixus oogenesis and embryogenesis.

  5. Muscular glycogen storage diseases without increased glycogen content on histoplathological examination

    NARCIS (Netherlands)

    Hoeksma, M.; den Dunnen, W. F. A.; Niezen-Koning, K. E.; van Diggelen, O. P.; van Spronsen, F. J.

    Histopathological findings of muscle biopsies from five patients with two different muscular glycogen storage diseases (mGSD) were presented. From these investigations it emerged that the yield of histopathology in mGSD is low. In only one of five patients histopathological findings gave a clue

  6. Expression and characterization of thermostable glycogen branching enzyme from Geobacillus mahadia Geo-05

    Directory of Open Access Journals (Sweden)

    Nur Syazwani Mohtar

    2016-12-01

    Full Text Available The glycogen branching enzyme (EC 2.4.1.18, which catalyses the formation of α-1,6-glycosidic branch points in glycogen structure, is often used to enhance the nutritional value and quality of food and beverages. In order to be applicable in industries, enzymes that are stable and active at high temperature are much desired. Using genome mining, the nucleotide sequence of the branching enzyme gene (glgB was extracted from the Geobacillus mahadia Geo-05 genome sequence provided by the Malaysia Genome Institute. The size of the gene is 2013 bp, and the theoretical molecular weight of the protein is 78.43 kDa. The gene sequence was then used to predict the thermostability, function and the three dimensional structure of the enzyme. The gene was cloned and overexpressed in E. coli to verify the predicted result experimentally. The purified enzyme was used to study the effect of temperature and pH on enzyme activity and stability, and the inhibitory effect by metal ion on enzyme activity. This thermostable glycogen branching enzyme was found to be most active at 55 °C, and the half-life at 60 °C and 70 °C was 24 h and 5 h, respectively. From this research, a thermostable glycogen branching enzyme was successfully isolated from Geobacillus mahadia Geo-05 by genome mining together with molecular biology technique.

  7. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  8. The flagellar master operon flhDC is a pleiotropic regulator involved in motility and virulence of the fish pathogen Yersinia ruckeri

    Science.gov (United States)

    Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...

  9. Functional significance of brain glycogen in sustaining glutamatergic neurotransmission

    DEFF Research Database (Denmark)

    Sickmann, Helle M; Walls, Anne B; Schousboe, Arne

    2009-01-01

    The involvement of brain glycogen in sustaining neuronal activity has previously been demonstrated. However, to what extent energy derived from glycogen is consumed by astrocytes themselves or is transferred to the neurons in the form of lactate for oxidative metabolism to proceed is at present u...

  10. Glycogen metabolism and the homeostatic regulation of sleep

    KAUST Repository

    Petit, Jean-Marie; Burlet-Godinot, Sophie; Magistretti, Pierre J.; Allaman, Igor

    2014-01-01

    In 1995 Benington and Heller formulated an energy hypothesis of sleep centered on a key role of glycogen. It was postulated that a major function of sleep is to replenish glycogen stores in the brain that have been depleted during wakefulness which

  11. Glucose 6-phosphate compartmentation and the control of glycogen synthesis

    NARCIS (Netherlands)

    Meijer, Alfred

    2002-01-01

    Using adenovirus-mediated gene transfer into FTO-2B cells, a rat hepatoma cell line, we have overexpressed hexokinase I, (HK I), glucokinase (GK), liver glycogen synthase (LGS), muscle glycogen synthase (MGS), and combinations of each of the two glucose phosphorylating enzymes with each one of the

  12. Glycogen synthesis from lactate in a chronically active muscle

    International Nuclear Information System (INIS)

    Talmadge, R.J.; Scheide, J.I.; Silverman, H.

    1989-01-01

    In response to neural overactivity (pseudomyotonia), gastrocnemius muscle fibers from C57Bl/6Jdy2J/dy2J mice have different metabolic profiles compared with normal mice. A population of fibers in the fast-twitch superficial region of the dy2J gastrocnemius stores unusually high amounts of glycogen, leading to an increased glycogen storage in the whole muscle. The dy2J muscle also contains twice as much lactate as normal muscle. A [ 14 C]lactate intraperitoneal injection leads to preferential 14 C incorporation into glycogen in the dy2J muscle compared with normal muscle. To determine whether skeletal muscles were incorporating lactate into glycogen without body organ (liver, kidney) input, gastrocnemius muscles were bathed in 10 mM [ 14 C]lactate with intact neural and arterial supply but with impeded venous return. The contralateral gastrocnemius serves as a control for body organ input. By using this in situ procedure, we demonstrate that under conditions of high lactate both normal and dy2J muscle can directly synthesize glycogen from lactate. In this case, normal whole muscle incorporates [14C] lactate into glycogen at a higher rate than dy2J whole muscle. Autoradiography, however, suggests that the high-glycogen-containing muscle fibers in the dy2J muscle incorporate lactate into glycogen at nearly four times the rate of normal or surrounding muscle fibers

  13. Exercise intolerance in Glycogen Storage Disease Type III

    DEFF Research Database (Denmark)

    Preisler, Nicolai; Pradel, Agnès; Husu, Edith

    2013-01-01

    Myopathic symptoms in Glycogen Storage Disease Type IIIa (GSD IIIa) are generally ascribed to the muscle wasting that these patients suffer in adult life, but an inability to debranch glycogen likely also has an impact on muscle energy metabolism. We hypothesized that patients with GSD IIIa can...

  14. Muscle glycogen and cell function - Location, location, location

    DEFF Research Database (Denmark)

    Ørtenblad, N; Nielsen, Joachim

    2015-01-01

    The importance of glycogen, as a fuel during exercise, is a fundamental concept in exercise physiology. The use of electron microscopy has revealed that glycogen is not evenly distributed in skeletal muscle fibers, but rather localized in distinct pools. In this review, we present the available...... evidence regarding the subcellular localization of glycogen in skeletal muscle and discuss this from the perspective of skeletal muscle fiber function. The distribution of glycogen in the defined pools within the skeletal muscle varies depending on exercise intensity, fiber phenotype, training status......, and immobilization. Furthermore, these defined pools may serve specific functions in the cell. Specifically, reduced levels of these pools of glycogen are associated with reduced SR Ca(2+) release, muscle relaxation rate, and membrane excitability. Collectively, the available literature strongly demonstrates...

  15. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Science.gov (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  17. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  18. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  19. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  20. Ingestion of glucose or sucrose prevents liver but not muscle glycogen depletion during prolonged endurance-type exercise in trained cyclists.

    Science.gov (United States)

    Gonzalez, Javier T; Fuchs, Cas J; Smith, Fiona E; Thelwall, Pete E; Taylor, Roy; Stevenson, Emma J; Trenell, Michael I; Cermak, Naomi M; van Loon, Luc J C

    2015-12-15

    The purpose of this study was to define the effect of glucose ingestion compared with sucrose ingestion on liver and muscle glycogen depletion during prolonged endurance-type exercise. Fourteen cyclists completed two 3-h bouts of cycling at 50% of peak power output while ingesting either glucose or sucrose at a rate of 1.7 g/min (102 g/h). Four cyclists performed an additional third test for reference in which only water was consumed. We employed (13)C magnetic resonance spectroscopy to determine liver and muscle glycogen concentrations before and after exercise. Expired breath was sampled during exercise to estimate whole body substrate use. After glucose and sucrose ingestion, liver glycogen levels did not show a significant decline after exercise (from 325 ± 168 to 345 ± 205 and 321 ± 177 to 348 ± 170 mmol/l, respectively; P > 0.05), with no differences between treatments. Muscle glycogen concentrations declined (from 101 ± 49 to 60 ± 34 and 114 ± 48 to 67 ± 34 mmol/l, respectively; P glycogen concentrations declined during exercise when only water was ingested. Both glucose and sucrose ingestion prevent liver glycogen depletion during prolonged endurance-type exercise. Sucrose ingestion does not preserve liver glycogen concentrations more than glucose ingestion. However, sucrose ingestion does increase whole body carbohydrate utilization compared with glucose ingestion. This trial was registered at https://www.clinicaltrials.gov as NCT02110836. Copyright © 2015 the American Physiological Society.

  1. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Science.gov (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  2. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  3. Liver glycogen reduces food intake and attenuates obesity in a high-fat diet-fed mouse model.

    Science.gov (United States)

    López-Soldado, Iliana; Zafra, Delia; Duran, Jordi; Adrover, Anna; Calbó, Joaquim; Guinovart, Joan J

    2015-03-01

    We generated mice that overexpress protein targeting to glycogen (PTG) in the liver (PTG(OE)), which results in an increase in liver glycogen. When fed a high-fat diet (HFD), these animals reduced their food intake. The resulting effect was a lower body weight, decreased fat mass, and reduced leptin levels. Furthermore, PTG overexpression reversed the glucose intolerance and hyperinsulinemia caused by the HFD and protected against HFD-induced hepatic steatosis. Of note, when fed an HFD, PTG(OE) mice did not show the decrease in hepatic ATP content observed in control animals and had lower expression of neuropeptide Y and higher expression of proopiomelanocortin in the hypothalamus. Additionally, after an overnight fast, PTG(OE) animals presented high liver glycogen content, lower liver triacylglycerol content, and lower serum concentrations of fatty acids and β-hydroxybutyrate than control mice, regardless of whether they were fed an HFD or a standard diet. In conclusion, liver glycogen accumulation caused a reduced food intake, protected against the deleterious effects of an HFD, and diminished the metabolic impact of fasting. Therefore, we propose that hepatic glycogen content be considered a potential target for the pharmacological manipulation of diabetes and obesity. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  4. Inhibitory properties of 1,4-dideoxy-1,4-imino-d-arabinitol (DAB) derivatives acting on glycogen metabolising enzymes.

    Science.gov (United States)

    Díaz-Lobo, Mireia; Concia, Alda Lisa; Gómez, Livia; Clapés, Pere; Fita, Ignacio; Guinovart, Joan J; Ferrer, Joan C

    2016-09-26

    Glycogen synthase (GS) and glycogen phosphorylase (GP) are the key enzymes that control, respectively, the synthesis and degradation of glycogen, a multi-branched glucose polymer that serves as a form of energy storage in bacteria, fungi and animals. An abnormal glycogen metabolism is associated with several human diseases. Thus, GS and GP constitute adequate pharmacological targets to modulate cellular glycogen levels by means of their selective inhibition. The compound 1,4-dideoxy-1,4-imino-d-arabinitol (DAB) is a known potent inhibitor of GP. We studied the inhibitory effect of DAB, its enantiomer LAB, and 29 DAB derivatives on the activity of rat muscle glycogen phosphorylase (RMGP) and E. coli glycogen synthase (EcGS). The isoform 4 of sucrose synthase (SuSy4) from Solanum tuberosum L. was also included in the study for comparative purposes. Although these three enzymes possess highly conserved catalytic site architectures, the DAB derivatives analysed showed extremely diverse inhibitory potential. Subtle changes in the positions of crucial residues in their active sites are sufficient to discriminate among the structural differences of the tested inhibitors. For the two Leloir-type enzymes, EcGS and SuSy4, which use sugar nucleotides as donors, the inhibitory potency of the compounds analysed was synergistically enhanced by more than three orders of magnitude in the presence of ADP and UDP, respectively. Our results are consistent with a model in which these compounds bind to the subsite in the active centre of the enzymes that is normally occupied by the glucosyl residue which is transferred between donor and acceptor substrates. The ability to selectively inhibit the catalytic activity of the key enzymes of the glycogen metabolism may represent a new approach for the treatment of disorders of the glycogen metabolism.

  5. Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21.

    Science.gov (United States)

    Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng

    2015-10-01

    To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

  6. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  7. Heteropoly acid catalyzed hydrolysis of glycogen to glucose

    International Nuclear Information System (INIS)

    Klein, Miri; Pulidindi, Indra Neel; Perkas, Nina; Gedanken, Aharon

    2015-01-01

    Complete conversion of glycogen to glucose is achieved by using H 3 PW 12 O 40 ·nH 2 O (HPW) and H 4 SiW 12 O 40 ·nH 2 O (HSiW) as catalysts for the hydrolysis under optimized hydrothermal conditions (mass fraction of catalyst 2.4%, 373 K and 2 h reaction time). The reusability of the catalyst (HPW) was demonstrated. In addition to carrying out the glycogen hydrolysis in an autoclave, other novel methods such as microwave irradiation and sonication have also been investigated. At higher mass fraction of the heteropoly acids (10.5%), glycogen could be completely converted to glucose under microwave irradiation. Sonication of an aqueous solution of glycogen in the presence of HPW and HSiW also yielded glucose. Thus, heteropoly acids are efficient, environmentally friendly and reusable catalysts for the conversion of glycogen to glucose. - Highlights: • Hydrothermal, microwave and sonication based methods of hydrolysis. • Heteropoly acids are green catalysts for glycogen hydrolysis. • Glycogen from cyanobacteria is demonstrated as a potential feedstock for glucose

  8. Glycogen storage disease type III: modified Atkins diet improves myopathy.

    Science.gov (United States)

    Mayorandan, Sebene; Meyer, Uta; Hartmann, Hans; Das, Anibh Martin

    2014-11-28

    Frequent feeds with carbohydrate-rich meals or continuous enteral feeding has been the therapy of choice in glycogen storage disease (Glycogenosis) type III. Recent guidelines on diagnosis and management recommend frequent feedings with high complex carbohydrates or cornstarch avoiding fasting in children, while in adults a low-carb-high-protein-diet is recommended. While this regimen can prevent hypoglycaemia in children it does not improve skeletal and heart muscle function, which are compromised in patients with glycogenosis IIIa. Administration of carbohydrates may elicit reactive hyperinsulinism, resulting in suppression of lipolysis, ketogenesis, gluconeogenesis, and activation of glycogen synthesis. Thus, heart and skeletal muscle are depleted of energy substrates. Modified Atkins diet leads to increased blood levels of ketone bodies and fatty acids. We hypothesize that this health care intervention improves the energetic balance of muscles. We treated 2 boys with glycogenosis IIIa aged 9 and 11 years with a modified Atkins diet (10 g carbohydrate per day, protein and fatty acids ad libitum) over a period of 32 and 26 months, respectively. In both patients, creatine kinase levels in blood dropped in response to Atkins diet. When diet was withdrawn in one of the patients he complained of chest pain, reduced physical strength and creatine kinase levels rapidly increased. This was reversed when Atkins diet was reintroduced. One patient suffered from severe cardiomyopathy which significantly improved under diet. Patients with glycogenosis IIIa benefit from an improved energetic state of heart and skeletal muscle by introduction of Atkins diet both on a biochemical and clinical level. Apart from transient hypoglycaemia no serious adverse effects were observed.

  9. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  10. Glycogen branching enzyme (GBE1) mutation causing equine glycogen storage disease IV.

    Science.gov (United States)

    Ward, Tara L; Valberg, Stephanie J; Adelson, David L; Abbey, Colette A; Binns, Matthew M; Mickelson, James R

    2004-07-01

    Comparative biochemical and histopathological evidence suggests that a deficiency in the glycogen branching enzyme, encoded by the GBE1 gene, is responsible for a recently identified recessive fatal fetal and neonatal glycogen storage disease (GSD) in American Quarter Horses termed GSD IV. We have now derived the complete GBE1 cDNA sequences for control horses and affected foals, and identified a C to A substitution at base 102 that results in a tyrosine (Y) to stop (X) mutation in codon 34 of exon 1. All 11 affected foals were homozygous for the X34 allele, their 11 available dams and sires were heterozygous, and all 16 control horses were homozygous for the Y34 allele. The previous findings of poorly branched glycogen, abnormal polysaccharide accumulation, lack of measurable GBE1 enzyme activity and immunodetectable GBE1 protein, coupled with the present observation of abundant GBE1 mRNA in affected foals, are all consistent with the nonsense mutation in the 699 amino acid GBE1 protein. The affected foal pedigrees have a common ancestor and contain prolific stallions that are likely carriers of the recessive X34 allele. Defining the molecular basis of equine GSD IV will allow for accurate DNA testing and the ability to prevent occurrence of this devastating disease affecting American Quarter Horses and related breeds.

  11. Preactivated thiolated glycogen as mucoadhesive polymer for drug delivery.

    Science.gov (United States)

    Perrone, Mara; Lopalco, Antonio; Lopedota, Angela; Cutrignelli, Annalisa; Laquintana, Valentino; Douglas, Justin; Franco, Massimo; Liberati, Elisa; Russo, Vincenzo; Tongiani, Serena; Denora, Nunzio; Bernkop-Schnürch, Andreas

    2017-10-01

    The purpose of this study was to synthesize and characterize a novel thiolated glycogen, so-named S-preactivated thiolated glycogen, as a mucosal drug delivery systems and the assessment of its mucoadhesive properties. In this regard, glycogen-cysteine and glycogen-cysteine-2-mercaptonicotinic acid conjugates were synthesized. Glycogen was activated by an oxidative ring opening with sodium periodate resulting in reactive aldehyde groups to which cysteine was bound via reductive amination. The obtained thiolated polymer displayed 2203.09±200μmol thiol groups per gram polymer. In a second step, the thiol moieties of thiolated glycogen were protected by disulfide bond formation with the thiolated aromatic residue 2-mercaptonicotinic acid (2MNA). In vitro screening of mucoadhesive properties was performed on porcine intestinal mucosa using different methods. In particular, in terms of rheology investigations of mucus/polymer mixtures, the S-preactivated thiolated glycogen showed a 4.7-fold increase in dynamic viscosity over a time period of 5h, in comparison to mucus/Simulated Intestinal Fluid control. The S-preactivated polymer remained attached on freshly excised porcine mucosa for 45h. Analogous results were obtained with tensile studies demonstrating a 2.7-fold increase in maximum detachment force and 3.1- fold increase in total work of adhesion for the S-preactivated polymer compared to unmodified glycogen. Moreover, water-uptake studies showed an over 4h continuing weight gain for the S-preactivated polymer, whereas disintegration took place for the unmodified polymer within the first hour. Furthermore, even in the highest tested concentration of 2mg/ml the new conjugates did not show any cytotoxicity on Caco-2 cell monolayer using an MTT assay. According to these results, S-preactivated glycogen represents a promising type of mucoadhesive polymers useful for the development of various mucosal drug delivery systems. Copyright © 2017 Elsevier B.V. All rights

  12. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

    Science.gov (United States)

    Tadmor, Arbel

    2009-03-01

    In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

  13. The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence.

    Science.gov (United States)

    Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier

    2014-01-01

    The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

  14. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    Science.gov (United States)

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  15. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

    Science.gov (United States)

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

    2016-01-01

    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. The modulation of the symbiont/host interaction between Wolbachia pipientis and Aedes fluviatilis embryos by glycogen metabolism.

    Directory of Open Access Journals (Sweden)

    Mariana da Rocha Fernandes

    Full Text Available Wolbachia pipientis, a maternally transmitted bacterium that colonizes arthropods, may affect the general aspects of insect physiology, particularly reproduction. Wolbachia is a natural endosymbiont of Aedes fluviatilis, whose effects in embryogenesis and reproduction have not been addressed so far. In this context, we investigated the correlation between glucose metabolism and morphological alterations during A. fluviatilis embryo development in Wolbachia-positive (W+ and Wolbachia-negative (W- mosquito strains. While both strains do not display significant morphological and larval hatching differences, larger differences were observed in hexokinase activity and glycogen contents during early and mid-stages of embryogenesis, respectively. To investigate if glycogen would be required for parasite-host interaction, we reduced Glycogen Synthase Kinase-3 (GSK-3 levels in adult females and their eggs by RNAi. GSK-3 knock-down leads to embryonic lethality, lower levels of glycogen and total protein and Wolbachia reduction. Therefore, our results suggest that the relationship between A. fluviatilis and Wolbachia may be modulated by glycogen metabolism.

  17. Mechanisms limiting glycogen storage in muscle during prolonged insulin stimulation

    DEFF Research Database (Denmark)

    Richter, Erik; Hansen, S A; Hansen, B F

    1988-01-01

    increased muscle glycogen concentrations to maximal values 2, 3, and 3.5 times above normal fed levels in fast-twitch white, slow-twitch red, and fast-twitch red fibers, respectively. Glucose uptake decreased (mean +/- SE) from 34.9 +/- 1.2 mumol.g-1.h-1 at 0 h to 7.5 +/- 0.7 after 7 h of perfusion. During...... compared with initial values. Total muscle water concentration decreased during glycogen loading of the muscles. Mechanisms limiting glycogen storage under maximal insulin stimulation include impaired insulin-stimulated membrane transport of glucose as well as impaired intracellular glucose disposal....

  18. Hepatic glycogen synthesis in the fetal mouse: An ultrastructural, morphometric, and autoradiographic investigation of the relationship between the smooth endoplasmic reticulum and glycogen

    International Nuclear Information System (INIS)

    Breslin, J.S.

    1989-01-01

    Fetal rodent hepatocytes undergo a rapid and significant accumulation of glycogen prior to birth. The distinct association of the smooth endoplasmic reticulum (SER) with glycogen during glycogen synthesis documented in the adult hepatocyte has not been clearly demonstrated in the fetus. The experiments described in this dissertation tested the hypothesis that SER is present and functions in the synthesis of fetal hepatic glycogen. Biochemical analysis, light microscopic (LM) histochemistry and electron microscope (EM) morphometry demonstrated that fetal hepatic glycogen synthesis began on day 15, with maximum accumulation occurring between days 17-19. Glycogen accumulation began in a small population of cells. Both the number of cells containing glycogen and the quantity of glycogen per cell increased as glycogen accumulated. Smooth endoplasmic reticulum (SER) was observed on day 14 of gestation and throughout fetal hepatic glycogen synthesis, primarily as dilated ribosome-free terminal extensions of rough endoplasmic reticulum (RER), frequently associated with glycogen. SER was in close proximity to isolated particles of glycogen and at the periphery of large compact glycogen deposits. Morphometry demonstrated that the membrane surface of SER in the average fetal hepatocyte increased as glycogen accumulated through day 18 and dropped significantly as glycogen levels peaked on day 19. Parallel alterations in RER membrane surface, indicated overall increases in ER membrane surface. Autoradiography following administration of 3 H-galactose demonstrated that newly synthesized glycogen was deposited near profiles of SER at day 16 and at day 18; however, at day 18 the majority of label was uniformly distributed over glycogen remote from profiles of SER

  19. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  20. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  2. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  3. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  4. CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

    Science.gov (United States)

    Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

    2015-02-27

    It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    International Nuclear Information System (INIS)

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

    1986-01-01

    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

  6. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  7. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  8. Genetics Home Reference: glycogen storage disease type 0

    Science.gov (United States)

    ... skeletal muscle, glycogen stored in muscle cells is broken down to supply the cells with energy. The ... that is stored in the liver can be broken down rapidly when glucose is needed to maintain ...

  9. Genetics Home Reference: glycogen storage disease type VI

    Science.gov (United States)

    ... or elevated levels of ketones in the blood (ketosis). Ketones are molecules produced during the breakdown of ... and may use fats for energy, resulting in ketosis. Glycogen accumulates within liver cells, causing these cells ...

  10. Genetics Home Reference: glycogen storage disease type IX

    Science.gov (United States)

    ... or elevated levels of ketones in the blood (ketosis). Ketones are molecules produced during the breakdown of ... down glycogen for glucose contributes to hypoglycemia and ketosis. Reduced energy production in muscle cells leads to ...

  11. Human skeletal muscle glycogen utilization in exhaustive exercise

    DEFF Research Database (Denmark)

    Nielsen, Joachim; Holmberg, Hans-Christer; Schrøder, Henrik Daa

    2011-01-01

    Although glycogen is known to be heterogeneously distributed within skeletal muscle cells, there is presently little information available about the role of fibre types, utilization and resynthesis during and after exercise with respect to glycogen localization. Here, we tested the hypothesis...... to be influenced by fibre type prior to exercise, as well as carbohydrate availability during the subsequent period of recovery. These findings provide insight into the significance of fibre type-specific compartmentalization of glycogen metabolism in skeletal muscle during exercise and subsequent recovery. ....... that utilization of glycogen with different subcellular localizations during exhaustive arm and leg exercise differs and examined the influence of fibre type and carbohydrate availability on its subsequent resynthesis. When 10 elite endurance athletes (22 ± 1 years, VO2 max = 68 ± 5 ml kg-1 min-1, mean ± SD...

  12. Genetics Home Reference: glycogen storage disease type V

    Science.gov (United States)

    ... with GSDV experience mild symptoms such as poor stamina; others do not experience any symptoms. Related Information ... myophosphorylase. This enzyme is found only in muscle cells, where it breaks down glycogen into a simpler ...

  13. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  14. Intracellular compartmentalization of skeletal muscle glycogen metabolism and insulin signalling

    DEFF Research Database (Denmark)

    Prats Gavalda, Clara; Gomez-Cabello, Alba; Vigelsø Hansen, Andreas

    2011-01-01

    The interest in skeletal muscle metabolism and insulin signalling has increased exponentially in recent years as a consequence of their role in the development of type 2 diabetes mellitus. Despite this, the exact mechanisms involved in the regulation of skeletal muscle glycogen metabolism...... and insulin signalling transduction remain elusive. We believe that one of the reasons is that the role of intracellular compartmentalization as a regulator of metabolic pathways and signalling transduction has been rather ignored. This paper briefly reviews the literature to discuss the role of intracellular...... compartmentalization in the regulation of skeletal muscle glycogen metabolism and insulin signalling. As a result, a hypothetical regulatory mechanism is proposed by which cells could direct glycogen resynthesis towards different pools of glycogen particles depending on the metabolic needs. Furthermore, we discuss...

  15. Mitochondria, glycogen and lipid droplets in skeletal muscle during testosterone treatment and strength training. A randomized, double blinded, placebo-controlled trial

    DEFF Research Database (Denmark)

    Jensen, Richard Christian; Lehman Christensen, Louise; Nielsen, Joachim

    2018-01-01

    estimated by transmission electron microscopy. Insulin sensitivity (insulin‐stimulated Rd) and body composition were assessed by euglycemic‐hyperinsulinemic clamp and dual X‐ray absorptiometry, respectively. TRT significantly increased total testosterone levels, BioT, and lean body mass (LBM) (p ...‐glycogen fraction correlated inversely with Δ‐LBM (ρ = −0.83; p = 0.002) during six‐month TRT, but no significant changes were observed in mitochondrial, glycogen, and LD volume fractions during TRT and ST. In conclusion, in this exploratory small‐scale study, the beneficial effects of six‐month TRT on total...... testosterone, LBM, and percent body fat were not followed by significant changes in fractions of mitochondria, glycogen, or lipid in skeletal muscle of aging men with lowered testosterone levels. Six‐month ST or combined three‐month ST+TRT did not change intramyocellular mitochondria, glycogen, and LD...

  16. Glycogen-bound polyphosphate kinase from the archaebacterium Sulfolobus acidocaldarius.

    OpenAIRE

    Skórko, R; Osipiuk, J; Stetter, K O

    1989-01-01

    Glycogen-bound polyphosphate kinase has been isolated from a crude extract of Sulfolobus acidocaldarius by isopycnic centrifugation in CsCl. Divalent cations (Mn2+ greater than Mg2+) stimulated the reaction. The enzyme does not require the presence of histones for its activity; it is inhibited strongly by phosphate and slightly by fluoride. The protein from the glycogen complex migrated in a sodium dodecyl sulfate-polyacrylamide gel as a 57-kilodalton protein band; after isoelectric focusing ...

  17. Inadequate Brain Glycogen or Sleep Increases Spreading Depression Susceptibility

    KAUST Repository

    Kilic, Kivilcim; Karatas, Hulya; Donmez-Demir, Buket; Eren-Kocak, Emine; Gursoy-Ozdemir, Yasemin; Can, Alp; Petit, Jean-Marie; Magistretti, Pierre J.; Dalkara, Turgay

    2017-01-01

    Glycogen in astrocyte endfeet contributes to maintenance of low extracellular glutamate and K+ concentrations around synapses. Sleep deprivation (SD), a common migraine trigger induces transcriptional changes in astrocytes reducing glycogen breakdown. We hypothesize that when glycogen utilization cannot match synaptic energy demand, extracellular K+ can rise to levels that activate neuronal pannexin-1 channels and downstream inflammatory pathway, which might be one of the mechanisms initiating migraine headaches.We suppressed glycogen breakdown by inhibiting glycogen phosphorylation with 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and by SD.DAB caused neuronal pannexin-1 large-pore opening and activation of the downstream inflammatory pathway as shown by procaspase-1 cleavage and HMGB1 release from neurons. Six-hour SD induced pannexin-1 mRNA. DAB and SD also lowered the cortical spreading depression (CSD) induction threshold, which was reversed by glucose or lactate supplement, suggesting that glycogen-derived energy substrates are needed to prevent CSD generation. Supporting this, knocking-down neuronal lactate transporter, MCT2 with an anti-sense oligonucleotide or inhibiting glucose transport from vessels to astrocytes with intracerebroventricularly given phloretin reduced the CSD threshold. In vivo recordings with a K+ -sensitive/selective fluoroprobe, APG-4 disclosed that DAB treatment or SD caused significant rise in extracellular K+ during whisker-stimulation, illustrating the critical role of glycogen in extracellular K+ clearance.Synaptic metabolic stress caused by insufficient glycogen-derived energy substrate supply can activate neuronal pannexin-1 channels as well as lowering the CSD threshold. Therefore, conditions that limit energy supply to synapse (e.g. SD) may predispose to migraine attacks as suggested by genetic studies associating glucose or lactate transporter deficiency with migraine. This article is protected by copyright. All rights reserved.

  18. Inadequate Brain Glycogen or Sleep Increases Spreading Depression Susceptibility

    KAUST Repository

    Kilic, Kivilcim

    2017-12-16

    Glycogen in astrocyte endfeet contributes to maintenance of low extracellular glutamate and K+ concentrations around synapses. Sleep deprivation (SD), a common migraine trigger induces transcriptional changes in astrocytes reducing glycogen breakdown. We hypothesize that when glycogen utilization cannot match synaptic energy demand, extracellular K+ can rise to levels that activate neuronal pannexin-1 channels and downstream inflammatory pathway, which might be one of the mechanisms initiating migraine headaches.We suppressed glycogen breakdown by inhibiting glycogen phosphorylation with 1,4-dideoxy-1,4-imino-D-arabinitol (DAB) and by SD.DAB caused neuronal pannexin-1 large-pore opening and activation of the downstream inflammatory pathway as shown by procaspase-1 cleavage and HMGB1 release from neurons. Six-hour SD induced pannexin-1 mRNA. DAB and SD also lowered the cortical spreading depression (CSD) induction threshold, which was reversed by glucose or lactate supplement, suggesting that glycogen-derived energy substrates are needed to prevent CSD generation. Supporting this, knocking-down neuronal lactate transporter, MCT2 with an anti-sense oligonucleotide or inhibiting glucose transport from vessels to astrocytes with intracerebroventricularly given phloretin reduced the CSD threshold. In vivo recordings with a K+ -sensitive/selective fluoroprobe, APG-4 disclosed that DAB treatment or SD caused significant rise in extracellular K+ during whisker-stimulation, illustrating the critical role of glycogen in extracellular K+ clearance.Synaptic metabolic stress caused by insufficient glycogen-derived energy substrate supply can activate neuronal pannexin-1 channels as well as lowering the CSD threshold. Therefore, conditions that limit energy supply to synapse (e.g. SD) may predispose to migraine attacks as suggested by genetic studies associating glucose or lactate transporter deficiency with migraine. This article is protected by copyright. All rights reserved.

  19. In vitro variation of glycogen content in three sheep nematodes.

    Science.gov (United States)

    Premvati, G; Chopra, A K

    1979-06-01

    In vitro variation of glycogen content under aerobic conditions was measured on fresh weight basis in 3 sheep nematodes inhabiting different niches; Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis. The parasites were saparated into species and then sexes and starved for varying periods of time up to 24 h in glucose-free physiological saline. The differences between females and males and among the species with respect to glycogen content and its rate of change with time are discussed.

  20. Dysregulation of muscle glycogen synthase in recovery from exercise in type 2 diabetes

    DEFF Research Database (Denmark)

    Pedersen, Andreas J T; Hingst, Janne Rasmuss; Friedrichsen, Martin

    2015-01-01

    AIMS/HYPOTHESIS: Insulin and exercise stimulate skeletal muscle glycogen synthase (GS) activity by dephosphorylation and changes in kinetic properties. The aim of this study was to investigate the effects of insulin, exercise and post-exercise insulin stimulation on GS phosphorylation, activity a...... and increased phosphorylation at sites 2 + 2a in type 2 diabetes in the recovery period imply an impaired response to exercise....

  1. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  2. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  3. Involvement of Glycogen Synthase Kinase-3 in the Mechanisms of Conditioned Food Aversion Memory Reconsolidation.

    Science.gov (United States)

    Nikitin, V P; Solntseva, S V; Kozyrev, S A

    2017-02-01

    Experiments were performed on the snails trained in conditioned food aversion for 3 days. Injection of TDZD-8 (glycogen synthase kinase-3 inhibitor, 2 mg/kg) in combination with reminder (presentation of a conditioned food stimulus) led to memory impairment developing 3 days after inhibitor/reminder exposure and followed by spontaneous recovery in 10 days. Injections of TDZD-8 in a dose of 4 or 20 mg/kg before reminder were shown to cause amnesia that persisted for more than 10 days. Memory recovery during repeated training was observed at the earlier period than after initial training. The impairment of memory reconsolidation by TDZD-8 after training of snails for 1 day was less pronounced than under standard training conditions (3 days). The effect of a glycogen synthase kinase-3 inhibitor during memory reconsolidation is probably followed by impairment of memory retrieval and/or partial loss, which can be compensated spontaneously or after repeated training.

  4. Homogenization versus homogenization-free method to measure muscle glycogen fractions.

    Science.gov (United States)

    Mojibi, N; Rasouli, M

    2016-12-01

    The glycogen is extracted from animal tissues with or without homogenization using cold perchloric acid. Three methods were compared for determination of glycogen in rat muscle at different physiological states. Two groups of five rats were kept at rest or 45 minutes muscular activity. The glycogen fractions were extracted and measured by using three methods. The data of homogenization method shows that total glycogen decreased following 45 min physical activity and the change occurred entirely in acid soluble glycogen (ASG), while AIG did not change significantly. Similar results were obtained by using "total-glycogen-fractionation methods". The findings of "homogenization-free method" indicate that the acid insoluble fraction (AIG) was the main portion of muscle glycogen and the majority of changes occurred in AIG fraction. The results of "homogenization method" are identical with "total glycogen fractionation", but differ with "homogenization-free" protocol. The ASG fraction is the major portion of muscle glycogen and is more metabolically active form.

  5. Neurons have an active glycogen metabolism that contributes to tolerance to hypoxia

    Science.gov (United States)

    Saez, Isabel; Duran, Jordi; Sinadinos, Christopher; Beltran, Antoni; Yanes, Oscar; Tevy, María F; Martínez-Pons, Carlos; Milán, Marco; Guinovart, Joan J

    2014-01-01

    Glycogen is present in the brain, where it has been found mainly in glial cells but not in neurons. Therefore, all physiologic roles of brain glycogen have been attributed exclusively to astrocytic glycogen. Working with primary cultured neurons, as well as with genetically modified mice and flies, here we report that—against general belief—neurons contain a low but measurable amount of glycogen. Moreover, we also show that these cells express the brain isoform of glycogen phosphorylase, allowing glycogen to be fully metabolized. Most importantly, we show an active neuronal glycogen metabolism that protects cultured neurons from hypoxia-induced death and flies from hypoxia-induced stupor. Our findings change the current view of the role of glycogen in the brain and reveal that endogenous neuronal glycogen metabolism participates in the neuronal tolerance to hypoxic stress. PMID:24569689

  6. Glucose uptake and transport in contracting, perfused rat muscle with different pre-contraction glycogen concentrations

    DEFF Research Database (Denmark)

    Hespel, P; Richter, Erik

    1990-01-01

    1. Glucose uptake and transport, muscle glycogen, free glucose and glucose-6-phosphate concentrations were studied in perfused resting and contracting rat skeletal muscle with different pre-contraction glycogen concentrations. Rats were pre-conditioned by a combination of swimming exercise and diet......, resulting in either low (glycogen-depleted rats), normal (control rats) or high (supercompensated rats) muscle glycogen concentrations at the time their hindlimbs were perfused. 2. Compared with control rats, pre-contraction muscle glycogen concentration was approximately 40% lower in glycogen-depleted rats......, whereas it was 40% higher in supercompensated rats. Muscle glycogen break-down correlated positively (r = 0.76; P less than 0.001) with pre-contraction muscle glycogen concentration. 3. Glucose uptake during contractions was approximately 50% higher in glycogen-depleted hindquarters than in control...

  7. Neurons have an active glycogen metabolism that contributes to tolerance to hypoxia.

    Science.gov (United States)

    Saez, Isabel; Duran, Jordi; Sinadinos, Christopher; Beltran, Antoni; Yanes, Oscar; Tevy, María F; Martínez-Pons, Carlos; Milán, Marco; Guinovart, Joan J

    2014-06-01

    Glycogen is present in the brain, where it has been found mainly in glial cells but not in neurons. Therefore, all physiologic roles of brain glycogen have been attributed exclusively to astrocytic glycogen. Working with primary cultured neurons, as well as with genetically modified mice and flies, here we report that-against general belief-neurons contain a low but measurable amount of glycogen. Moreover, we also show that these cells express the brain isoform of glycogen phosphorylase, allowing glycogen to be fully metabolized. Most importantly, we show an active neuronal glycogen metabolism that protects cultured neurons from hypoxia-induced death and flies from hypoxia-induced stupor. Our findings change the current view of the role of glycogen in the brain and reveal that endogenous neuronal glycogen metabolism participates in the neuronal tolerance to hypoxic stress.

  8. Acid hydrolysis and molecular density of phytoglycogen and liver glycogen helps understand the bonding in glycogen α (composite particles.

    Directory of Open Access Journals (Sweden)

    Prudence O Powell

    Full Text Available Phytoglycogen (from certain mutant plants and animal glycogen are highly branched glucose polymers with similarities in structural features and molecular size range. Both appear to form composite α particles from smaller β particles. The molecular size distribution of liver glycogen is bimodal, with distinct α and β components, while that of phytoglycogen is monomodal. This study aims to enhance our understanding of the nature of the link between liver-glycogen β particles resulting in the formation of large α particles. It examines the time evolution of the size distribution of these molecules during acid hydrolysis, and the size dependence of the molecular density of both glucans. The monomodal distribution of phytoglycogen decreases uniformly in time with hydrolysis, while with glycogen, the large particles degrade significantly more quickly. The size dependence of the molecular density shows qualitatively different shapes for these two types of molecules. The data, combined with a quantitative model for the evolution of the distribution during degradation, suggest that the bonding between β into α particles is different between phytoglycogen and liver glycogen, with the formation of a glycosidic linkage for phytoglycogen and a covalent or strong non-covalent linkage, most probably involving a protein, for glycogen as most likely. This finding is of importance for diabetes, where α-particle structure is impaired.

  9. Acid Hydrolysis and Molecular Density of Phytoglycogen and Liver Glycogen Helps Understand the Bonding in Glycogen α (Composite) Particles

    Science.gov (United States)

    Powell, Prudence O.; Sullivan, Mitchell A.; Sheehy, Joshua J.; Schulz, Benjamin L.; Warren, Frederick J.; Gilbert, Robert G.

    2015-01-01

    Phytoglycogen (from certain mutant plants) and animal glycogen are highly branched glucose polymers with similarities in structural features and molecular size range. Both appear to form composite α particles from smaller β particles. The molecular size distribution of liver glycogen is bimodal, with distinct α and β components, while that of phytoglycogen is monomodal. This study aims to enhance our understanding of the nature of the link between liver-glycogen β particles resulting in the formation of large α particles. It examines the time evolution of the size distribution of these molecules during acid hydrolysis, and the size dependence of the molecular density of both glucans. The monomodal distribution of phytoglycogen decreases uniformly in time with hydrolysis, while with glycogen, the large particles degrade significantly more quickly. The size dependence of the molecular density shows qualitatively different shapes for these two types of molecules. The data, combined with a quantitative model for the evolution of the distribution during degradation, suggest that the bonding between β into α particles is different between phytoglycogen and liver glycogen, with the formation of a glycosidic linkage for phytoglycogen and a covalent or strong non-covalent linkage, most probably involving a protein, for glycogen as most likely. This finding is of importance for diabetes, where α-particle structure is impaired. PMID:25799321

  10. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    OpenAIRE

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  11. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    OpenAIRE

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  12. The Csr System Regulates Escherichia coli Fitness by Controlling Glycogen Accumulation and Energy Levels

    Directory of Open Access Journals (Sweden)

    Manon Morin

    2017-10-01

    Full Text Available In the bacterium Escherichia coli, the posttranscriptional regulatory system Csr was postulated to influence the transition from glycolysis to gluconeogenesis. Here, we explored the role of the Csr system in the glucose-acetate transition as a model of the glycolysis-to-gluconeogenesis switch. Mutations in the Csr system influence the reorganization of gene expression after glucose exhaustion and disturb the timing of acetate reconsumption after glucose exhaustion. Analysis of metabolite concentrations during the transition revealed that the Csr system has a major effect on the energy levels of the cells after glucose exhaustion. This influence was demonstrated to result directly from the effect of the Csr system on glycogen accumulation. Mutation in glycogen metabolism was also demonstrated to hinder metabolic adaptation after glucose exhaustion because of insufficient energy. This work explains how the Csr system influences E. coli fitness during the glycolysis-gluconeogenesis switch and demonstrates the role of glycogen in maintenance of the energy charge during metabolic adaptation.

  13. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Science.gov (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  14. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  15. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  16. Glycogen storage disease type Ia: linkage of glucose, glycogen, lactic acid, triglyceride, and uric acid metabolism.

    Science.gov (United States)

    Sever, Sakine; Weinstein, David A; Wolfsdorf, Joseph I; Gedik, Reyhan; Schaefer, Ernst J

    2012-01-01

    A female presented in infancy with hypotonia, undetectable serum glucose, lactic acidosis, and triglycerides >5000 mg/dL. The diagnosis of type 1A glycogen storage disease was made via the result of a liver biopsy, which showed increased glycogen and absent glucose-6-phosphatase enzyme activity. The patient was treated with dextrose administered orally, which was replaced by frequent feedings of cornstarch, which resulted in an improvement of her metabolic parameters. At age 18 years of age, she had marked hypertriglyceridemia (3860 mg/dL) and eruptive xanthomas and was treated with fenofibrate, atorvastatin, and fish oil. At age 29 years she was noted to have multiple liver adenomas, severe anemia, and hyperuricemia. Aggressive cornstarch therapy was commenced with a goal of maintaining her blood glucose levels >75 mg/dL and lactate levels triglycerides 179, high-density lipoprotein cholesterol 32, and calculated low-density lipoprotein cholesterol 154. Her weight was stable with a body mass index of 24.8 kg/m(2). Her liver adenomas had decreased in size, and her anemia and hyperuricemia had improved. She was homozygous for the R83C missense mutation in G6PC. Our data indicate that optimized metabolic control to maintain blood glucose levels >75 mg/dL is critical in the management of this disease. Copyright © 2012. Published by Elsevier Inc.

  17. Glycogen metabolism in radiation induced hepatocellular carcinoma in Swiss albino mice

    International Nuclear Information System (INIS)

    Gupta, N.K.; Kumar, Ashok

    1988-01-01

    Glycogen content and the activities of phosphorylase, glycogen sythetase (GS), glucose 6-phosphatase (G6Pase), phosphohexose isomerase (PHI), glucose 6-phosphodehydrogenase were biochemically determined in the heparocellular carcinoma induced in swiss albino mice following radiocalcium internal irradiation. The content glycogen and the activities of phosphorylase, glycogen synthetase, G6Pase, PHI, GPT and GOT are considerably reduced in the hepatocellular carcinoma compared to that in control liver. However, the activity of G6PDH shows an increased activity. Results indicate that the decreas ed glycogen content in the hepatocellular carcinoma is due to the reduced glycogen synthetase activity and utilization of glucose by HMP pathway. (author). 2 tabs., 24 refs

  18. Estradiol stimulates glycogen synthesis whereas progesterone promotes glycogen catabolism in the uterus of the American mink (Neovison vison).

    Science.gov (United States)

    Bowman, Kole; Rose, Jack

    2017-01-01

    Glycogen synthesis by mink uterine glandular and luminal epithelia (GE and LE) is stimulated by estradiol (E 2 ) during estrus. Subsequently, the glycogen deposits are mobilized to near completion to meet the energy requirements of pre-embryonic development and implantation by as yet undetermined mechanisms. We hypothesized that progesterone (P 4 ) was responsible for catabolism of uterine glycogen reserves as one of its actions to ensure reproductive success. Mink were treated with E 2 , P 4 or vehicle (controls) for 3 days and uteri collected 24 h (E 2 , P 4 and vehicle) and 96 h (E 2 ) later. To evaluate E 2 priming, mink were treated with E 2 for 3 days, then P 4 for an additional 3 days (E 2 →P 4 ) and uteri collected 24 h later. Percent glycogen content of uterine epithelia was greater at E 2 + 96 h (GE = 5.71 ± 0.55; LE = 11.54 ± 2.32) than E 2 +24 h (GE = 3.63 ± 0.71; LE = 2.82 ± 1.03), and both were higher than controls (GE = 0.27 ± 0.15; LE = 0.54 ± 0.30; P glycogen content (GE = 0.61 ± 0.16; LE = 0.51 ± 0.13), to levels not different from controls, while concomitantly increasing catabolic enzyme (glycogen phosphorylase m and glucose-6-phosphatase) gene expression and amount of phospho-glycogen synthase protein (inactive) in uterine homogenates. Interestingly, E 2 →P 4 increased glycogen synthase 1 messenger RNA (mRNA) and hexokinase 1mRNA and protein. Our findings suggest to us that while E 2 promotes glycogen accumulation by the mink uterus during estrus and pregnancy, it is P 4 that induces uterine glycogen catabolism, releasing the glucose that is essential to support pre-embryonic survival and implantation. © 2016 Japanese Society of Animal Science.

  19. Glycogen storage disease type I: clinical and laboratory profile

    Directory of Open Access Journals (Sweden)

    Berenice L. Santos

    2014-11-01

    Full Text Available Objectives: To characterize the clinical, laboratory, and anthropometric profile of a sample of Brazilian patients with glycogen storage disease type I managed at an outpatient referral clinic for inborn errors of metabolism. Methods: This was a cross-sectional outpatient study based on a convenience sampling strategy. Data on diagnosis, management, anthropometric parameters, and follow-up were assessed. Results: Twenty-one patients were included (median age 10 years, range 1–25 years, all using uncooked cornstarch therapy. Median age at diagnosis was 7 months (range, 1–132 months, and 19 patients underwent liver biopsy for diagnostic confirmation. Overweight, short stature, hepatomegaly, and liver nodules were present in 16 of 21, four of 21, nine of 14, and three of 14 patients, respectively. A correlation was found between height-for-age and BMI-for-age Z-scores (r = 0.561; p = 0.008. Conclusions: Diagnosis of glycogen storage disease type I is delayed in Brazil. Most patients undergo liver biopsy for diagnostic confirmation, even though the combination of a characteristic clinical presentation and molecular methods can provide a definitive diagnosis in a less invasive manner. Obesity is a side effect of cornstarch therapy, and appears to be associated with growth in these patients. Resumo: Objetivos: Caracterizar o perfil clínico, laboratorial e antropométrico de uma amostra de pacientes brasileiros com doença de depósito de glicogênio tipo I tratados em um ambulatório de referência para erros inatos do metabolismo. Métodos: Este foi um estudo ambulatorial transversal com base em uma estratégia de amostragem de conveniência. Foram avaliados os dados com relação ao diagnóstico, tratamento, parâmetros antropométricos e acompanhamento. Resultados: Foram incluídos 21 pacientes (idade média de 10 anos, faixa 1-25 anos de idade, e todos se encontravam em terapia de amido de milho cru. A idade média na época do diagn

  20. Characterization of the growth and degradation of glycogen in the liver

    International Nuclear Information System (INIS)

    Youn, J.; Bergman, R.

    1986-01-01

    The patterns of the growth and degradation of hepatic glycogen were studied using a computer model. The database was that of Devos and Hers on the distribution of label in glycogen from [1- 14 C] galactose injected at different times after the start of refeeding 40 h fasted mice. The data was simulated to examine the following hypotheses (H): Glycogen Synthesis H.S1: all glycogen molecules grow simultaneously. H.S2: at each moment of synthesis only a fixed number of molecules grow. H.S3: the number of growing molecules increases linearly with respect to time. H.S4: increase in the number of growing molecules is accelerated as glycogen is synthesized. Glycogen Degradation H.D1: glycogen molecules to be attacked by degrading enzymes are randomly chosen. H.D2: glycogen molecules are degraded sequentially in the reverse order of synthesis. H.D3: glycogen molecules have different probabilities of degradation depending upon the time of synthesis. The growth and degradation according to hypotheses S4 and D3, respectively, could best account for the data. The modelling study predicts that, at the beginning of refeeding, only a small number of molecules grow. But, as glycogen is synthesized, the rate of seeding of new glycogen molecules increases with time, causing a nonlinear proliferation of the number of growing molecules. During degradation glycogen molecules synthesized later have a greater chance to be degraded first, a characteristic which may be explained by the rosette structure of liver glycogen

  1. Abnormal metabolism of glycogen phosphate as a cause for Lafora disease.

    Science.gov (United States)

    Tagliabracci, Vincent S; Girard, Jean Marie; Segvich, Dyann; Meyer, Catalina; Turnbull, Julie; Zhao, Xiaochu; Minassian, Berge A; Depaoli-Roach, Anna A; Roach, Peter J

    2008-12-05

    Lafora disease is a progressive myoclonus epilepsy with onset in the teenage years followed by neurodegeneration and death within 10 years. A characteristic is the widespread formation of poorly branched, insoluble glycogen-like polymers (polyglucosan) known as Lafora bodies, which accumulate in neurons, muscle, liver, and other tissues. Approximately half of the cases of Lafora disease result from mutations in the EPM2A gene, which encodes laforin, a member of the dual specificity protein phosphatase family that is able to release the small amount of covalent phosphate normally present in glycogen. In studies of Epm2a(-/-) mice that lack laforin, we observed a progressive change in the properties and structure of glycogen that paralleled the formation of Lafora bodies. At three months, glycogen metabolism remained essentially normal, even though the phosphorylation of glycogen has increased 4-fold and causes altered physical properties of the polysaccharide. By 9 months, the glycogen has overaccumulated by 3-fold, has become somewhat more phosphorylated, but, more notably, is now poorly branched, is insoluble in water, and has acquired an abnormal morphology visible by electron microscopy. These glycogen molecules have a tendency to aggregate and can be recovered in the pellet after low speed centrifugation of tissue extracts. The aggregation requires the phosphorylation of glycogen. The aggregrated glycogen sequesters glycogen synthase but not other glycogen metabolizing enzymes. We propose that laforin functions to suppress excessive glycogen phosphorylation and is an essential component of the metabolism of normally structured glycogen.

  2. Adenosine diphosphate sugar pyrophosphatase prevents glycogen biosynthesis in Escherichia coli

    Science.gov (United States)

    Moreno-Bruna, Beatriz; Baroja-Fernández, Edurne; Muñoz, Francisco José; Bastarrica-Berasategui, Ainara; Zandueta-Criado, Aitor; Rodríguez-López, Milagros; Lasa, Iñigo; Akazawa, Takashi; Pozueta-Romero, Javier

    2001-01-01

    An adenosine diphosphate sugar pyrophosphatase (ASPPase, EC 3.6.1.21) has been characterized by using Escherichia coli. This enzyme, whose activities in the cell are inversely correlated with the intracellular glycogen content and the glucose concentration in the culture medium, hydrolyzes ADP-glucose, the precursor molecule of glycogen biosynthesis. ASPPase was purified to apparent homogeneity (over 3,000-fold), and sequence analyses revealed that it is a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated as “nudix” hydrolases. Insertional mutagenesis experiments leading to the inactivation of the ASPPase encoding gene, aspP, produced cells with marginally low enzymatic activities and higher glycogen content than wild-type bacteria. aspP was cloned into an expression vector and introduced into E. coli. Transformed cells were shown to contain a dramatically reduced amount of glycogen, as compared with the untransformed bacteria. No pleiotropic changes in the bacterial growth occurred in both the aspP-overexpressing and aspP-deficient strains. The overall results pinpoint the reaction catalyzed by ASPPase as a potential step of regulating glycogen biosynthesis in E. coli. PMID:11416161

  3. Mechanisms limiting glycogen storage in muscle during prolonged insulin stimulation

    International Nuclear Information System (INIS)

    Richter, E.A.; Hansen, S.A.; Hansen, B.F.

    1988-01-01

    The extent to which muscle glycogen concentrations can be increased during exposure to maximal insulin concentrations and abundant glucose was investigated in the isolated perfused rat hindquarter preparation. Perfusion for 7 h in the presence of 20,000 μU/ml insulin and 11-13 mM glucose increased muscle glycogen concentrations to maximal values 2, 3, and 3.5 times above normal fed levels in fast-twitch white, slow-twitch red, and fast-twitch red fibers, respectively. Glucose uptake decreased from 34.9 μmol·g -1 ·h -1 at 0 h to 7.5 after 7 h of perfusion. During the perfusion muscle glycogen synthase activity decreased and free intracellular glucose and glucose 6-phosphate increased indicating that glucose disposal was impaired. However, glucose transport as measured by the uptake of 3-O-[ 14 C]methyl-D-glucose was also markedly decreased after 5 and 7 h of perfusion compared with initial values. Total muscle water concentration decreased during glycogen loading of the muscles. Mechanisms limiting glycogen storage under maximal insulin stimulation include impaired insulin-stimulated membrane transport of glucose as well as impaired intracellular glucose disposal

  4. Tissue glycogen and blood glucose in irradiated rats. I

    International Nuclear Information System (INIS)

    Ahlersova, E.; Ahlers, I.; Paulikova, E.; Praslicka, M.

    1980-01-01

    Fed and starved (overnight) male rats of the Wistar strain were exposed to whole-body irradiation with 14.35 Gy (1500 R) of X-rays. After irradiation and sham-irradiation all animals were starved until examination performed 1, 6, 24, 48 and 72 h after treatment. The concentration of glucose in the blood and the concentration of glycogen in the liver, heart, skeletal muscle, brown and white adipose tissue were determined. The concentrations of blood glucose and liver glycogen were found to increase between 1 and 6 h after irradiation of the starved animals. The most pronounced increase in glycogen concentration in the liver and heart muscle was observed 24 and 48 h after irradiation. A similar increase in the concentration of blood glucose was found between 48 and 72 h after irradiation. The fed and starved irradiated rats reacted differently, particularly between 48 and 72 h; the liver glycogen concentration decreased in the fed animals and remained elevated in the starved ones. Very high values of terminal glycemia were observed in both groups. The accumulation of glycogen in the heart muscle indicates that this organ is sensitive to ionizing radiation. (author)

  5. Tissue glycogen and blood glucose in irradiated rats. II

    International Nuclear Information System (INIS)

    Ahlersova, E.; Ahlers, I.; Praslicka, M.

    1980-01-01

    Male rats of the Wistar strain were continuously irradiated with 0.57 Gy (60 R) of gamma rays from a 60 Co source. Irradiation lasted from 1 to 50 days in an experimental field where also control animals shielded from radiation were placed. After a 16 h starvation, the concentration of glucose in the blood and of glycogen in the liver and the heart was determined 1, 3, 7, 14, 21, 25, 32, 39 and 50 days after the beginning of irradiation. The concentration of blood glucose in irradiated rats did not practically differ from that of control animals during the whole period of investigation. The concentration of liver glycogen in irradiated animals was higher than that in the controls during all time intervals, except for day 1. The values of glycogen in the heart muscle were approximately identical in the irradiated and control rats, except for day 21 when they sharply increased in the irradiated animals. In addition to the investigation of blood glucose and tissue glycogen during continuous irradiation, these parameters were studied immediately, and 1, 6 and 12 months after continuous irradiation with a daily exposure of 0.57 Gy (60 R) up to a total exposure of 14.35 Gy (1500 R) of gamma rays. Considerably higher values of liver glycogen were detected in the irradiated rats immediately, and 1 and 6 months after the end of irradiation. (author)

  6. Induction of the mar operon by miscellaneous groceries.

    Science.gov (United States)

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

    2004-01-01

    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  7. Glycogen synthase kinase-3 regulation of urinary concentrating ability.

    Science.gov (United States)

    Rao, Reena

    2012-09-01

    Glycogen synthase kinase-3 (GSK3) is an enzyme that is gaining prominence as a critical signaling molecule in the epithelial cells of renal tubules. This review will focus on recent findings exploring the role of GSK3 in renal collecting ducts, especially its role in urine concentration involving vasopressin signaling. Recent studies using inhibition or tissue-specific gene deletion of GSK3 revealed the mechanism by which GSK3 regulates aquaporin 2 water channels via adenylate cyclase or the prostaglandin-E2 pathway. In other studies, postnatal treatment with lithium, an inhibitor of GSK3, increased cell proliferation and led to microcyst formation in rat kidneys. These studies suggest that loss of GSK3 activity could interfere with renal water transport at two levels. In the short term, it could disrupt vasopressin signaling in collecting duct cells and in the long term it could alter the structure of the collecting ducts, making them less responsive to the hydro-osmotic effects of vasopressin. Ongoing studies reveal the crucial role played by GSK3 in the regulation of vasopressin action in the renal collecting ducts and suggest a possible use of GSK3 inhibitors in disease conditions associated with disrupted vasopressin signaling.

  8. Structural mechanism of laforin function in glycogen dephosphorylation and lafora disease.

    Science.gov (United States)

    Raththagala, Madushi; Brewer, M Kathryn; Parker, Matthew W; Sherwood, Amanda R; Wong, Brian K; Hsu, Simon; Bridges, Travis M; Paasch, Bradley C; Hellman, Lance M; Husodo, Satrio; Meekins, David A; Taylor, Adam O; Turner, Benjamin D; Auger, Kyle D; Dukhande, Vikas V; Chakravarthy, Srinivas; Sanz, Pascual; Woods, Virgil L; Li, Sheng; Vander Kooi, Craig W; Gentry, Matthew S

    2015-01-22

    Glycogen is the major mammalian glucose storage cache and is critical for energy homeostasis. Glycogen synthesis in neurons must be tightly controlled due to neuronal sensitivity to perturbations in glycogen metabolism. Lafora disease (LD) is a fatal, congenital, neurodegenerative epilepsy. Mutations in the gene encoding the glycogen phosphatase laforin result in hyperphosphorylated glycogen that forms water-insoluble inclusions called Lafora bodies (LBs). LBs induce neuronal apoptosis and are the causative agent of LD. The mechanism of glycogen dephosphorylation by laforin and dysfunction in LD is unknown. We report the crystal structure of laforin bound to phosphoglucan product, revealing its unique integrated tertiary and quaternary structure. Structure-guided mutagenesis combined with biophysical and biochemical analyses reveal the basis for normal function of laforin in glycogen metabolism. Analyses of LD patient mutations define the mechanism by which subsets of mutations disrupt laforin function. These data provide fundamental insights connecting glycogen metabolism to neurodegenerative disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Modified glycogen as construction material for functional biomimetic microfibers.

    Science.gov (United States)

    Rabyk, Mariia; Hruby, Martin; Vetrik, Miroslav; Kucka, Jan; Proks, Vladimir; Parizek, Martin; Konefal, Rafal; Krist, Pavel; Chvatil, David; Bacakova, Lucie; Slouf, Miroslav; Stepanek, Petr

    2016-11-05

    We describe a conceptually new, microfibrous, biodegradable functional material prepared from a modified storage polysaccharide also present in humans (glycogen) showing strong potential as direct-contact dressing/interface material for wound healing. Double bonds were introduced into glycogen via allylation and were further exploited for crosslinking of the microfibers. Triple bonds were introduced by propargylation and served for further click functionalization of the microfibers with bioactive peptide. A simple solvent-free method allowing the preparation of thick layers was used to produce microfibers (diameter ca 2μm) from allylated and/or propargylated glycogen. Crosslinking of the samples was performed by microtron beta-irradiation, and the irradiation dose was optimized to 2kGy. The results from biological testing showed that these highly porous, hydrophilic, readily functionalizable materials were completely nontoxic to cells growing in their presence. The fibers were gradually degraded in the presence of cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Serum glucose and liver glycogen in gamma irradiated rats

    International Nuclear Information System (INIS)

    Ahlersova, E.; Ahlers, I.; Molcanova, A.

    1988-01-01

    Overnight fasted male rats of Wistar strain were irradiated with single whole-body doses of 4.78-7.17-9.57 and 14.35 Gy of gamma rays. After decapitation at intervals 1-28 d (4.78 and 7.17 Gy), 1-7 d (9.57 Gy) and 1-3 d (14.35 Gy) glucose concentration in serum and glycogen concentration in liver of irradiated and non-irradiated animals were determined. The higher was radiation dose the more expressive extent and depth of changes (hyperglycemia, accumulation of glycogen) occured. Blood glucose and liver glycogen may serve as a reliable and dose-dependent biological indicators of metabolic changes in irradiated rats. (author)

  11. Muscle glycogen depletion and lactate concentration during downhill skiing.

    Science.gov (United States)

    Tesch, P; Larsson, L; Eriksson, A; Karlsson, J

    1978-01-01

    Skilled and unskilled skiers were studied during downhill skiing. Muscle glycogen and muscle lactate concentrations in the vastus lateralis muscle were determined following different skiing conditions. Heavy glycogen utilization was found in the groups studied during a day of skiing. The skilled and unskilled skiers differed with respect to selective glycogen depletion pattern and the skilled subjects demonstrated greater depletion of slow twitch fibers than the unskilled subjects. Lactate concentrations ranged from approximately 5-26 mmoles x kg-1 wet muscle after approximately one minute of maximal skiing. This wide range was not found to be related to the level of skiing proficiency. However, skiing with varyingly angled boots, resulting in different knee angles, did affect lactate concentration. Lactate concentration was positively correlated to individual muscle fiber composition expressed as a percent of fast twitch fibers. The results suggest more pronounced involvement of aerobic energy metabolism in skilled skiers than in unskilled skiers.

  12. UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

    International Nuclear Information System (INIS)

    Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

    1988-01-01

    Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

  13. Molecular cloning and characterization of glycogen synthase in Eriocheir sinensis.

    Science.gov (United States)

    Li, Ran; Zhu, Li-Na; Ren, Li-Qi; Weng, Jie-Yang; Sun, Jin-Sheng

    2017-12-01

    Glycogen plays an important role in glucose and energy homeostasis at cellular and organismal levels. In glycogen synthesis, glycogen synthase (GS) is a rate-limiting enzyme catalysing the addition of α-1,4-linked glucose units from (UDP) 3 -glucose to a nascent glycogen chain using glycogenin (GN) as a primer. While studies on mammalian liver GS (GYS2) are numerous, enzymes from crustaceans, which also use glycogen and glucose as their main energy source, have received less attention. In the present study, we amplified full-length GS cDNA from Eriocheir sinensis. Tissue expression profiling revealed the highest expression of GS in the hepatopancreas. During moulting, GS expression and activity declined, and glycogen levels in the hepatopancreas were reduced. Recombinant GS was expressed in Escherichia coli Rosetta (DE3), and induction at 37°C or 16°C yielded EsGS in insoluble inclusion bodies (EsGS-I) or in soluble form (EsGS-S), respectively. Enzyme activity was measured in a cell-free system containing glucose-6-phosphate (G6P), and both forms possessed glycosyltransferase activity, but refolded EsGS-I was more active. Enzyme activity of both GS and EsGS-I in the hepatopancreas was optimum at 25°C, which is coincident with the optimum growth temperature of Chinese mitten crab, and higher (37°C) or lower (16°C) temperatures resulted in lower enzyme activity. Taken together, the results suggest that GS may be important for maintaining normal physiological functions such as growth and reproduction. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Apelin ameliorates TNF-α-induced reduction of glycogen synthesis in the hepatocytes through G protein-coupled receptor APJ.

    Directory of Open Access Journals (Sweden)

    Jiaojiao Chu

    Full Text Available Apelin, a novel adipokine, is the specific endogenous ligand of G protein-coupled receptor APJ. Consistent with its putative role as an adipokine, apelin has been linked to states of insulin resistance. However, the function of apelin in hepatic insulin resistance, a vital part of insulin resistance, and its underlying mechanisms still remains unclear. Here we define the impacts of apelin on TNF-α-induced reduction of glycogen synthesis in the hepatocytes. Our studies indicate that apelin reversed TNF-α-induced reduction of glycogen synthesis in HepG2 cells, mouse primary hepatocytes and liver tissues of C57BL/6J mice by improving JNK-IRS1-AKT-GSK pathway. Moreover, Western blot revealed that APJ, but not apelin, expressed in the hepatocytes and liver tissues of mice. We found that F13A, a competitive antagonist for G protein-coupled receptor APJ, suppressed the effects of apelin on TNF-α-induced reduction of glycogen synthesis in the hepatocytes, suggesting APJ is involved in the function of apelin. In conclusion, we show novel evidence suggesting that apelin ameliorates TNF-α-induced reduction of glycogen synthesis in the hepatocytes through G protein-coupled receptor APJ. Apelin appears as a beneficial adipokine with anti-insulin resistance properties, and thus as a promising therapeutic target in metabolic disorders.

  15. Muscle and liver glycogen utilization during prolonged lift and carry exercise: male and female responses.

    Science.gov (United States)

    Price, Thomas B; Sanders, Kimberly

    2017-02-01

    This study examined the use of carbohydrates by men and women during lift/carry exercise. Effects of menstrual cycle variation were examined in women. Twenty-five subjects (15 M, 10 F) were studied; age 25 ± 2y M, 26 ± 3y F, weight 85 ± 3 kg* M, 63 ± 3 kg F, and height 181 ± 2 cm* M, 161 ± 2 cm F (* P  Glycogen utilization was tracked with natural abundance C-13 NMR of quadriceps femoris and biceps brachialis muscles, and in the liver at rest and throughout the exercise period. Males completed more of the 180 min protocol than females [166 ± 9 min M, 112 ± 16 min* F (L), 88 ± 16 min** F (F) (* P  = 0.0036, ** P  glycogen depletion was similar between sexes and within females in L/F phases [4.7 ± 0.8 mmol/L-h M, 4.5 ± 2.4 mmol/L-h F (L), 10.3 ± 3.5 mmol/L-h F (F)]. Biceps glycogen depletion was greater in females [2.7 ± 0.9 mmol/L-h M, 10.3 ± 1.3 mmol/L-h* F (L), 16.8 ± 4.8 mmol/L-h** F (F) (* P  = 0.0004, ** P  = 0.0122)]. Resting glycogen levels were higher in females during the follicular phase ( P  = 0.0077). Liver glycogen depletion increased during exercise, but was not significant. We conclude that with non-normalized lift/carry exercise: (1) Based on their smaller size, women are less capable of completing and work their upper body harder than men. (2) Women and men work their lower body at similar levels. (3) Women store more quadriceps carbohydrate during the follicular phase. (4) The liver is not significantly challenged by this protocol. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  16. Metabolic demands and replenishment of muscle glycogen after a rugby league match simulation protocol.

    Science.gov (United States)

    Bradley, Warren J; Hannon, Marcus P; Benford, Victoria; Morehen, James C; Twist, Craig; Shepherd, Sam; Cocks, Matthew; Impey, Samuel G; Cooper, Robert G; Morton, James P; Close, Graeme L

    2017-09-01

    The metabolic requirements of a rugby league match simulation protocol and the timing of carbohydrate provision on glycogen re-synthesis in damaged muscle were examined. Fifteen (mean±SD: age 20.9±2.9 year, body-mass 87.3±14.1kg, height 177.4±6.0cm) rugby league (RL) players consumed a 6gkgday-1 CHO diet for 7-days, completed a time to exhaustion test (TTE) and a glycogen depletion protocol on day-3, a RL simulated-match protocol (RLMSP) on day-5 and a TTE on day-7. Players were prescribed an immediate or delayed (2-h-post) re-feed post-simulation. Muscle biopsies and blood samples were obtained post-depletion, before and after simulated match-play, and 48-h after match-play with PlayerLoad and heart-rate collected throughout the simulation. Data were analysed using effects sizes±90% CI and magnitude-based inferences. PlayerLoad (8.0±0.7 AUmin-1) and %HRpeak (83±4.9%) during the simulation were similar to values reported for RL match-play. Muscle glycogen very likely increased from immediately after to 48-h post-simulation (272±97 cf. 416±162mmolkg-1d.w.; ES±90%CI) after immediate re-feed, but changes were unclear (283±68 cf. 361±144mmolkg-1d.w.; ES±90%CI) after delayed re-feed. CK almost certainly increased by 77.9±25.4% (0.75±0.19) post-simulation for all players. The RLMSP presents a replication of the internal loads associated with professional RL match-play, although difficulties in replicating the collision reduced the metabolic demands and glycogen utilisation. Further, it is possible to replete muscle glycogen in damaged muscle employing an immediate re-feed strategy. Copyright © 2017 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  17. Glycogen-bound polyphosphate kinase from the archaebacterium Sulfolobus acidocaldarius.

    Science.gov (United States)

    Skórko, R; Osipiuk, J; Stetter, K O

    1989-09-01

    Glycogen-bound polyphosphate kinase has been isolated from a crude extract of Sulfolobus acidocaldarius by isopycnic centrifugation in CsCl. Divalent cations (Mn2+ greater than Mg2+) stimulated the reaction. The enzyme does not require the presence of histones for its activity; it is inhibited strongly by phosphate and slightly by fluoride. The protein from the glycogen complex migrated in a sodium dodecyl sulfate-polyacrylamide gel as a 57-kilodalton protein band; after isoelectric focusing it separated into several spots in the pH range of 5.6 to 6.7.

  18. Enzymatic description of the anhydrofructose pathway of glycogen degradation. I

    DEFF Research Database (Denmark)

    Yu, Shukun; Refdahl, Charlotte; Lundt, Inge

    2004-01-01

    The anhydrofructose pathway describes the degradation of glycogen and starch to metabolites via 1,5-anhydro-D-fructose (1,5AnFru). The enzyme catalyzing the first reaction step of this pathway, i.e., a-1,4-glucan lyase (EC 4.2.1.13), has been purified, cloned and characterized from fungi and red...... possessed all enzymes needed for conversion of glycogen to APP, an a-1,4-glucan lyase from this fungus was isolated and partially sequenced. Based on this work, a scheme of the enzymatic description of the anhydrofructose pathway in A. melaloma was proposed. Keywords: Anhydrofructose pathway; Anthracobia...

  19. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  20. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  1. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  2. Differences between glycogen biogenesis in fast- and slow-twitch rabbit muscle

    DEFF Research Database (Denmark)

    Cussó, R; Lerner, L R; Cadefau, J

    2003-01-01

    Skeletal muscle glycogen is an essential energy substrate for muscular activity. The biochemical properties of the enzymes involved in de novo synthesis of glycogen were analysed in two types of rabbit skeletal muscle fiber (fast- and slow-twitch). Glycogen concentration was higher in fast...

  3. Glycogen metabolism in Schistosoma mansoni worms after their isolation from the host

    NARCIS (Netherlands)

    Tiolens, A.G.M.; Bergh, S.G. van den

    Adult Schistosoma mansoni worms rapidly degrade their endogenous glycogen stores immediately after isolation from the host. In NCTC 109 or in a diphasic culture medium the glycogen levels slowly recovered again after the initial decrease. The rapid degradation of glycogen could be prevented, even in

  4. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  5. Glutamate Cysteine Ligase—Modulatory Subunit Knockout Mouse Shows Normal Insulin Sensitivity but Reduced Liver Glycogen Storage

    KAUST Repository

    Lavoie, Suzie

    2016-04-21

    Glutathione (GSH) deficits have been observed in several mental or degenerative illness, and so has the metabolic syndrome. The impact of a decreased glucose metabolism on the GSH system is well-known, but the effect of decreased GSH levels on the energy metabolism is unclear. The aim of the present study was to investigate the sensitivity to insulin in the mouse knockout (KO) for the modulatory subunit of the glutamate cysteine ligase (GCLM), the rate-limiting enzyme of GSH synthesis. Compared to wildtype (WT) mice, GCLM-KO mice presented with reduced basal plasma glucose and insulin levels. During an insulin tolerance test, GCLM-KO mice showed a normal fall in glycemia, indicating normal insulin secretion. However, during the recovery phase, plasma glucose levels remained lower for longer in KO mice despite normal plasma glucagon levels. This is consistent with a normal counterregulatory hormonal response but impaired mobilization of glucose from endogenous stores. Following a resident-intruder stress, during which stress hormones mobilize glucose from hepatic glycogen stores, KO mice showed a lower hyperglycemic level despite higher plasma cortisol levels when compared to WT mice. The lower hepatic glycogen levels observed in GCLM-KO mice could explain the impaired glycogen mobilization following induced hypoglycemia. Altogether, our results indicate that reduced liver glycogen availability, as observed in GCLM-KO mice, could be at the origin of their lower basal and challenged glycemia. Further studies will be necessary to understand how a GSH deficit, typically observed in GCLM-KO mice, leads to a deficit in liver glycogen storage.

  6. Glutamate Cysteine Ligase—Modulatory Subunit Knockout Mouse Shows Normal Insulin Sensitivity but Reduced Liver Glycogen Storage

    KAUST Repository

    Lavoie, Suzie; Steullet, Pascal; Kulak, Anita; Preitner, Frederic; Do, Kim Q.; Magistretti, Pierre J.

    2016-01-01

    Glutathione (GSH) deficits have been observed in several mental or degenerative illness, and so has the metabolic syndrome. The impact of a decreased glucose metabolism on the GSH system is well-known, but the effect of decreased GSH levels on the energy metabolism is unclear. The aim of the present study was to investigate the sensitivity to insulin in the mouse knockout (KO) for the modulatory subunit of the glutamate cysteine ligase (GCLM), the rate-limiting enzyme of GSH synthesis. Compared to wildtype (WT) mice, GCLM-KO mice presented with reduced basal plasma glucose and insulin levels. During an insulin tolerance test, GCLM-KO mice showed a normal fall in glycemia, indicating normal insulin secretion. However, during the recovery phase, plasma glucose levels remained lower for longer in KO mice despite normal plasma glucagon levels. This is consistent with a normal counterregulatory hormonal response but impaired mobilization of glucose from endogenous stores. Following a resident-intruder stress, during which stress hormones mobilize glucose from hepatic glycogen stores, KO mice showed a lower hyperglycemic level despite higher plasma cortisol levels when compared to WT mice. The lower hepatic glycogen levels observed in GCLM-KO mice could explain the impaired glycogen mobilization following induced hypoglycemia. Altogether, our results indicate that reduced liver glycogen availability, as observed in GCLM-KO mice, could be at the origin of their lower basal and challenged glycemia. Further studies will be necessary to understand how a GSH deficit, typically observed in GCLM-KO mice, leads to a deficit in liver glycogen storage.

  7. Examination of liver and muscle glycogen and blood glucose levels ...

    African Journals Online (AJOL)

    Administrator

    2011-09-05

    Sep 5, 2011 ... changes in fish affect the conversion of liver glycogen into blood ... province, altitude 1248 m and surface area of 86 km2, 20 km in length 4.5 km in width ... alcohol (95% pure) were added, followed by boiling for a further 15 min. ..... water temperature on the blood glucose level of chub (Leuciscus cephalus ...

  8. Regulation of glucose and glycogen metabolism during and after exercise

    DEFF Research Database (Denmark)

    Jensen, Thomas Elbenhardt; Richter, Erik

    2012-01-01

    Utilization of carbohydrate in the form of intramuscular glycogen stores and glucose delivered from plasma becomes an increasingly important energy substrate to the working muscle with increasing exercise intensity. This review gives an update on the molecular signals by which glucose transport...

  9. Dysfunctional Muscle and Liver Glycogen Metabolism in mdx Dystrophic Mice

    Science.gov (United States)

    Stapleton, David I.; Lau, Xianzhong; Flores, Marcelo; Trieu, Jennifer; Gehrig, Stefan M.; Chee, Annabel; Naim, Timur; Lynch, Gordon S.; Koopman, René

    2014-01-01

    Background Duchenne muscular dystrophy (DMD) is a severe, genetic muscle wasting disorder characterised by progressive muscle weakness. DMD is caused by mutations in the dystrophin (dmd) gene resulting in very low levels or a complete absence of the dystrophin protein, a key structural element of muscle fibres which is responsible for the proper transmission of force. In the absence of dystrophin, muscle fibres become damaged easily during contraction resulting in their degeneration. DMD patients and mdx mice (an animal model of DMD) exhibit altered metabolic disturbances that cannot be attributed to the loss of dystrophin directly. We tested the hypothesis that glycogen metabolism is defective in mdx dystrophic mice. Results Dystrophic mdx mice had increased skeletal muscle glycogen (79%, (Pglycogen synthesis is initiated by glycogenin, the expression of which was increased by 50% in mdx mice (PGlycogen synthase activity was 12% higher (Pglycogen branching enzyme activity was 70% lower (Pglycogen breakdown, glycogen phosphorylase, had 62% lower activity (Pglycogen debranching enzyme expression was 50% higher (Pglycogen (Pglycogen metabolism in mdx mice identified reduced glycogenin protein expression (46% less; Pglycogen but reduced amounts of liver glycogen. PMID:24626262

  10. Increased hepatic glycogen synthetase and decreased phosphorylase in trained rats

    DEFF Research Database (Denmark)

    Galbo, H; Saugmann, P; Richter, Erik

    1979-01-01

    Rats were either physically trained by a 12 wk swimming program or were freely eating or weight matched, sedentary controls. Trained rats had a higher relative liver weight and total hepatic glycogen synthetase (EC 2.4.1.11) activity and a lower phosphorylase (EC 2.4.1.1) activity than the other...

  11. Muscle glycogen depletion patterns during draught work in Standardbred horses.

    Science.gov (United States)

    Gottlieb, M

    1989-03-01

    Muscle fibre recruitment was investigated during draught loaded exercise by studying glycogen depletion patterns from histochemical stains of muscle biopsies from the gluteus and semitendinosus muscles. Three Standardbred trotters performed several intervals of draught loaded exercise on a treadmill with 34 kp at a trot (7 m/sec) and with 34 and 80 kp, respectively at a walk (2m/sec). Exercise was continued until the horses were unwilling to continue. Glycogen depletion was seen in all three fibre types when trotting with 34 kp for 5 or 10 mins. When an equal weight resistance was pulled at a walk, glycogen depletion was first seen in type I fibres only, then followed by a small percentage of type IIA fibres after at least 1 h. When 80 kp was pulled at a walk both type I and IIA fibres showed glycogen depletion, and after at least 30 mins exercise a small percentage of type IIB fibres was also depleted. These results indicate that the muscle fibres are depleted, in order, from type I through IIA to IIB as the intensity or duration of draught work increases.

  12. Quantification of the glycogen cascade system: the ultrasensitive responses of liver glycogen synthase and muscle phosphorylase are due to distinctive regulatory designs

    Directory of Open Access Journals (Sweden)

    Venkatesh KV

    2005-05-01

    Full Text Available Abstract Background Signaling pathways include intricate networks of reversible covalent modification cycles. Such multicyclic enzyme cascades amplify the input stimulus, cause integration of multiple signals and exhibit sensitive output responses. Regulation of glycogen synthase and phosphorylase by reversible covalent modification cycles exemplifies signal transduction by enzyme cascades. Although this system for regulating glycogen synthesis and breakdown appears similar in all tissues, subtle differences have been identified. For example, phosphatase-1, a dephosphorylating enzyme of the system, is regulated quite differently in muscle and liver. Do these small differences in regulatory architecture affect the overall performance of the glycogen cascade in a specific tissue? We address this question by analyzing the regulatory structure of the glycogen cascade system in liver and muscle cells at steady state. Results The glycogen cascade system in liver and muscle cells was analyzed at steady state and the results were compared with literature data. We found that the cascade system exhibits highly sensitive switch-like responses to changes in cyclic AMP concentration and the outputs are surprisingly different in the two tissues. In muscle, glycogen phosphorylase is more sensitive than glycogen synthase to cyclic AMP, while the opposite is observed in liver. Furthermore, when the liver undergoes a transition from starved to fed-state, the futile cycle of simultaneous glycogen synthesis and degradation switches to reciprocal regulation. Under such a transition, different proportions of active glycogen synthase and phosphorylase can coexist due to the varying inhibition of glycogen-synthase phosphatase by active phosphorylase. Conclusion The highly sensitive responses of glycogen synthase in liver and phosphorylase in muscle to primary stimuli can be attributed to distinctive regulatory designs in the glycogen cascade system. The different

  13. Carbohydrate supercompensation and muscle glycogen utilization during exhaustive running in highly trained athletes

    DEFF Research Database (Denmark)

    Madsen, K; Pedersen, P K; Rose, P

    1990-01-01

    regimen (Norm), the other after a diet and training programme intended to increase muscle glycogen levels (Carb). Muscle glycogen concentration in the gastrocnemius muscle increased by 25% (P less than 0.05) from 581 mmol.kg-1 dry weight, SEM 50 to 722 mmol.kg-1 dry weight, SEM 34 after Carb. Running time...... (0.92, SEM 0.01 vs 0.89, SEM 0.01; P less than 0.05). Since muscle glycogen utilization was identical in the two tests, the indication of higher utilization of total carbohydrate appears to be related to a higher utilization of liver glycogen. We have concluded that glycogen depletion...

  14. Role of glycogen availability in sarcoplasmic reticulum Ca2+ kinetics in human skeletal muscle

    DEFF Research Database (Denmark)

    Ørtenblad, Niels; Nielsen, Joachim; Saltin, Bengt

    2011-01-01

    Glucose is stored as glycogen in skeletal muscle. The importance of glycogen as a fuel during exercise has been recognized since the 1960s; however, little is known about the precise mechanism that relates skeletal muscle glycogen to muscle fatigue. We show that low muscle glycogen is associated...... with an impairment of muscle ability to release Ca(2+), which is an important signal in the muscle activation. Thus, depletion of glycogen during prolonged, exhausting exercise may contribute to muscle fatigue by causing decreased Ca(2+) release inside the muscle. These data provide indications of a signal...

  15. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  16. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Science.gov (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  17. Glycogen Synthase in Sertoli Cells: More Than Glycogenesis?

    Science.gov (United States)

    Maldonado, Rodrigo; Mancilla, Héctor; Villarroel-Espíndola, Franz; Slebe, Felipe; Slebe, Juan Carlos; Méndez, Raúl; Guinovart, Joan J; Concha, Ilona I

    2016-11-01

    Sertoli cell metabolism actively maintains the nutritional needs of germ cells. It has been described that after glucose incorporation in Sertoli cells, less than 1% is converted to glycogen suggesting low levels of glycogen synthase activity. Phosphorylation of muscle glycogen synthase (MGS) at serine 640 (pS640MGS) decreases its activity, and this form of the enzyme was discovered as a non-ribosomal protein that modulates the translation of a subset of transcripts in HeLa cells. The aim of our study was to functionally characterize MGS in cultured Sertoli cells, as well as to explore this new feature related to RNA molecules. We detected MGS in the cytoplasm of Sertoli cells as well as in the nuclei. The activity rates of the enzyme were extremely low indicating that MGS is expressed but almost inactive. Protein targeting to glycogen (PTG) overexpression was performed to activate MGS by dephosphorylation. PTG induced glycogen synthesis massively, confirming that this enzyme is present but inactive. This finding correlates with high levels of pS640MGS, which were assayed by phosphatase treatment. To explore a putative new function for MGS in Sertoli cells, we performed RNA immunoprecipitation coupled to microarray studies. The results revealed that MGS co-immunoprecipitated with the several mRNAs and also rRNAs. These findings indicate that MGS is expressed Sertoli cells but in an inactive form, and also support a possibly novel feature of this metabolic enzyme associated with RNA-related molecules. J. Cell. Biochem. 117: 2597-2607, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Glycogen distribution in the microwave-fixed mouse brain reveals heterogeneous astrocytic patterns.

    Science.gov (United States)

    Oe, Yuki; Baba, Otto; Ashida, Hitoshi; Nakamura, Kouichi C; Hirase, Hajime

    2016-09-01

    In the brain, glycogen metabolism has been implied in synaptic plasticity and learning, yet the distribution of this molecule has not been fully described. We investigated cerebral glycogen of the mouse by immunohistochemistry (IHC) using two monoclonal antibodies that have different affinities depending on the glycogen size. The use of focused microwave irradiation yielded well-defined glycogen immunoreactive signals compared with the conventional periodic acid-Schiff method. The IHC signals displayed a punctate distribution localized predominantly in astrocytic processes. Glycogen immunoreactivity (IR) was high in the hippocampus, striatum, cortex, and cerebellar molecular layer, whereas it was low in the white matter and most of the subcortical structures. Additionally, glycogen distribution in the hippocampal CA3-CA1 and striatum had a 'patchy' appearance with glycogen-rich and glycogen-poor astrocytes appearing in alternation. The glycogen patches were more evident with large-molecule glycogen in young adult mice but they were hardly observable in aged mice (1-2 years old). Our results reveal brain region-dependent glycogen accumulation and possibly metabolic heterogeneity of astrocytes. GLIA 2016;64:1532-1545. © 2016 The Authors. Glia Published by Wiley Periodicals, Inc.

  19. Glycogen Synthesis in Glycogenin 1-Deficient Patients: A Role for Glycogenin 2 in Muscle.

    Science.gov (United States)

    Krag, Thomas O; Ruiz-Ruiz, Cristina; Vissing, John

    2017-08-01

    Glycogen storage disease (GSD) type XV is a rare disease caused by mutations in the GYG1 gene that codes for the core molecule of muscle glycogen, glycogenin 1. Nonetheless, glycogen is present in muscles of glycogenin 1-deficient patients, suggesting an alternative for glycogen buildup. A likely candidate is glycogenin 2, an isoform expressed in the liver and heart but not in healthy skeletal muscle. We wanted to investigate the formation of glycogen and changes in glycogen metabolism in patients with GSD type XV. Two patients with mutations in the GYG1 gene were investigated for histopathology, ultrastructure, and expression of proteins involved in glycogen synthesis and metabolism. Apart from occurrence of polyglucosan (PG) bodies in few fibers, glycogen appeared normal in most cells, and the concentration was normal in patients with GSD type XV. We found that glycogenin 1 was absent, but glycogenin 2 was present in the patients, whereas the opposite was the case in healthy controls. Electron microscopy revealed that glycogen was present between and not inside myofibrils in type II fibers, compromising the ultrastructure of these fibers, and only type I fibers contained PG bodies. We also found significant changes to the expression levels of several enzymes directly involved in glycogen and glucose metabolism. To our knowledge, this is the first report demonstrating expression of glycogenin 2 in glycogenin 1-deficient patients, suggesting that glycogenin 2 rescues the formation of glycogen in patients with glycogenin 1 deficiency. Copyright © 2017 Endocrine Society

  20. Insoluble glycogen, a metabolizable internal adsorbent, decreases the lethality of endotoxin shock in rats

    Directory of Open Access Journals (Sweden)

    S. Sipka

    1997-01-01

    Full Text Available Insoluble glycogen is an enzymatically modified form of naturally occurring soluble glycogen with a great adsorbing capacity. It can be metabolized by phagocytes to glucose. In this study we used insoluble glycogen intravenously in the experimental endotoxin shock of rats. Wistar male rats were sensitized to endotoxin by Pb acetate. The survival of rats were compared in groups of animals endotoxin shock treated and non-treated with insoluble glycogen. Furthermore, we have determined in vitro the binding capacity of insoluble glycogen for endotoxin, tumour necrosis factor alpha, interleukin-1 and secretable phospholipase A2. Use of 10 mg/kg dose of insoluble glycogen could completely prevent the lethality of shock induced by LD50 quantity of endotoxin in rats. All animals treated survived. Insoluble glycogen is a form of ‘metabolizable internal adsorbents’. It can potentially be used for treatment of septic shock.

  1. Glycogen in the Nervous System. I; Methods for Light and Electron Microscopy

    Science.gov (United States)

    Estable, Rosita F. De; Estable-Puig, J. F.; Miquel, J.

    1964-01-01

    'l'he relative value of different methods for combined light and electron microscopical studies of glycogen in the nervous tissue was investigated. Picroalcoholic fixatives preserve glycogen in a considerable amount but give an inadequate morphological image of glycogen distribution and are unsuitable for ultrastructural studies. Fixation by perfusion, with Dalton's chromeosmic fluid seems adequate for ultrastructural cytochemistry of glycogen. Furthermore it permits routine paraffin embedding of brain slices adjacent to those used for electron microscopy. Dimedone blocking is a necessary step for a selective staining of glycogen with PAS after osmic fixation. Enzymatic removal of glycogen in osmic fixed nervous tissue can be done In paraffin-embedded tissue. It can also be performed in glycolmethacrylate-embedded tissue without removal of the embedding medium. Paraphenylenediamine stains glycogen following periodic acid oxidation.

  2. Glycogen metabolism in the glucose-sensing and supply-driven β-cell.

    Science.gov (United States)

    Andersson, Lotta E; Nicholas, Lisa M; Filipsson, Karin; Sun, Jiangming; Medina, Anya; Al-Majdoub, Mahmoud; Fex, Malin; Mulder, Hindrik; Spégel, Peter

    2016-12-01

    Glycogen metabolism in β-cells may affect downstream metabolic pathways controlling insulin release. We examined glycogen metabolism in human islets and in the rodent-derived INS-1 832/13 β-cells and found them to express the same isoforms of key enzymes required for glycogen metabolism. Our findings indicate that glycogenesis is insulin-independent but influenced by extracellular glucose concentrations. Levels of glycogen synthase decrease with increasing glucose concentrations, paralleling accumulation of glycogen. We did not find cAMP-elicited glycogenolysis and insulin secretion to be causally related. In conclusion, our results reveal regulated glycogen metabolism in human islets and insulin-secreting cells. Whether glycogen metabolism affects insulin secretion under physiological conditions remains to be determined. © 2016 Federation of European Biochemical Societies.

  3. Low birth weight and zygosity status is associated with defective muscle glycogen and glycogen synthase regulation in elderly twins

    DEFF Research Database (Denmark)

    Poulsen, Pernille; Wojtaszewski, Jørgen; Richter, Erik

    2007-01-01

    OBJECTIVE: An adverse intrauterine environment indicated by both low birth weight and monozygosity is associated with an age- or time-dependent reduction in glucose disposal and nonoxidative glucose metabolism in twins, suggesting impaired regulation of muscle glycogen synthesis. RESEARCH DESIGN ...

  4. Consensus guidelines for management of glycogen storage disease type 1b - European Study on Glycogen Storage Disease Type 1

    NARCIS (Netherlands)

    Visser, G; Rake, JP; Labrune, P; Leonard, JV; Moses, S; Ullrich, K; Wendel, U; Smit, GPA

    2002-01-01

    Life expectancy in glycogen storage disease type 1 (GSD-1) has improved considerably. Its relative rarity implies that no metabolic centre has experience of large series of patients and therefore experience with long-term management and follow-up at each centre is limited. There is wide variation in

  5. Guidelines for management of glycogen storage disease type I - European study on glycogen storage disease type I (ESGSD I)

    NARCIS (Netherlands)

    Rake, JP; Visser, G; Labrune, P; Leonard, JV; Ullrich, K; Smit, GPA

    2002-01-01

    Life-expectancy in glycogen storage disease type I (GSD I) has improved considerably. Its relative rarity implies that no metabolic centre has experience of large series of patients and experience with long-term management and follow-up at each centre is limited. There is wide variation in methods

  6. Dietary Methionine Restriction Alleviates Hyperglycemia in Pigs with Intrauterine Growth Restriction by Enhancing Hepatic Protein Kinase B Signaling and Glycogen Synthesis.

    Science.gov (United States)

    Ying, Zhixiong; Zhang, Hao; Su, Weipeng; Zhou, Le; Wang, Fei; Li, Yue; Zhang, Lili; Wang, Tian

    2017-10-01

    Background: Individuals with intrauterine growth restriction (IUGR) are prone to developing type 2 diabetes mellitus (T2DM). Dietary methionine restriction (MR) improves insulin sensitivity and glucose homeostasis in individuals with normal birth weight (NBW). Objective: This study investigated the effects of MR on plasma glucose concentration and hepatic and muscle glucose metabolism in pigs with IUGR. Methods: Thirty female NBW and 60 same-sex spontaneous IUGR piglets (Landrace × Yorkshire) were selected. After weaning (day 21), the piglets were fed diets with adequate methionine (NBW-CON and IUGR-CON) or 30% less methionine (IUGR-MR) ( n = 6). At day 180, 1 pig with a body weight near the mean of each replication was selected for biochemical analysis. Results: The IUGR-CON group showed 41.6%, 68.6%, and 67.1% higher plasma glucose concentration, hepatic phosphoenolpyruvate carboxykinase activity, and glucose-6-phosphatase activity, respectively, than the NBW-CON group ( P glycogen content and glycogen synthase activity were 36.9% and 38.8% lower, respectively, in the IUGR-CON than the NBW-CON group ( P glycogen content and glycogen synthase activity of the IUGR-MR pigs were 62.9% and 50.8% higher than those of the IUGR-CON pigs ( P glycogen synthesis, implying a potential nutritional strategy to prevent type 2 diabetes mellitus in IUGR offspring. © 2017 American Society for Nutrition.

  7. Glycogenolysis in astrocytes supports blood-borne glucose channeling not glycogen-derived lactate shuttling to neurons: evidence from mathematical modeling.

    Science.gov (United States)

    DiNuzzo, Mauro; Mangia, Silvia; Maraviglia, Bruno; Giove, Federico

    2010-12-01

    In this article, we examined theoretically the role of human cerebral glycogen in buffering the metabolic requirement of a 360-second brain stimulation, expanding our previous modeling study of neurometabolic coupling. We found that glycogen synthesis and degradation affects the relative amount of glucose taken up by neurons versus astrocytes. Under conditions of 175:115 mmol/L (∼1.5:1) neuronal versus astrocytic activation-induced Na(+) influx ratio, ∼12% of astrocytic glycogen is mobilized. This results in the rapid increase of intracellular glucose-6-phosphate level on stimulation and nearly 40% mean decrease of glucose flow through hexokinase (HK) in astrocytes via product inhibition. The suppression of astrocytic glucose phosphorylation, in turn, favors the channeling of glucose from interstitium to nearby activated neurons, without a critical effect on the concurrent intercellular lactate trafficking. Under conditions of increased neuronal versus astrocytic activation-induced Na(+) influx ratio to 190:65 mmol/L (∼3:1), glycogen is not significantly degraded and blood glucose is primarily taken up by neurons. These results support a role for astrocytic glycogen in preserving extracellular glucose for neuronal utilization, rather than providing lactate to neurons as is commonly accepted by the current 'thinking paradigm'. This might be critical in subcellular domains during functional conditions associated with fast energetic demands.

  8. Synthesis of (benzimidazol-2-yl)aniline derivatives as glycogen phosphorylase inhibitors.

    Science.gov (United States)

    Galal, Shadia A; Khattab, Muhammad; Andreadaki, Fotini; Chrysina, Evangelia D; Praly, Jean-Pierre; Ragab, Fatma A F; El Diwani, Hoda I

    2016-11-01

    A series of (benzimidazol-2-yl)-aniline (1) derivatives has been synthesized and evaluated as glycogen phosphorylase (GP) inhibitors. Kinetics studies revealed that compounds displaying a lateral heterocyclic residue with several heteroatoms (series 3 and 5) exhibited modest inhibitory properties with IC 50 values in the 400-600μM range. Arylsulfonyl derivatives 7 (Ar: phenyl) and 9 (Ar: o-nitrophenyl) of 1 exhibited the highest activity (series 2) among the studied compounds (IC 50 324μM and 357μM, respectively) with stronger effect than the p-tolyl analogue 8. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Body mass dependence of glycogen stores in the anoxia-tolerant crucian carp ( Carassius carassius L.)

    Science.gov (United States)

    Vornanen, Matti; Asikainen, Juha; Haverinen, Jaakko

    2011-03-01

    Glycogen is a vital energy substrate for anaerobic organisms, and the size of glycogen stores can be a limiting factor for anoxia tolerance of animals. To this end, glycogen stores in 12 different tissues of the crucian carp ( Carassius carassius L.), an anoxia-tolerant fish species, were examined. Glycogen content of different tissues was 2-10 times higher in winter (0.68-18.20% of tissue wet weight) than in summer (0.12-4.23%). In scale, bone and brain glycogen stores were strongly dependent on body mass (range between 0.6 and 785 g), small fish having significantly more glycogen than large fish ( p glycogen reserves, measured as a sum of glycogen from different tissues, varied from 6.1% of the body mass in the 1-g fish to 2.0% in the 800-g fish. Since anaerobic metabolic rate scales down with body size, the whole body glycogen reserves could provide energy for approximately 79 and 88 days of anoxia in small and large fish, respectively. There was, however, a drastic difference in tissue distribution of glycogen between large and small fish: in the small fish, the liver was the major glycogen store (68% of the stores), while in the large fish, the white myotomal muscle was the principal deposit of glycogen (57%). Since muscle glycogen is considered to be unavailable for blood glucose regulation, its usefulness in anoxia tolerance of the large crucian carp might be limited, although not excluded. Therefore, mobilization of muscle glycogen under anoxia needs to be rigorously tested.

  10. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  13. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  14. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Science.gov (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  15. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  16. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  17. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  18. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  19. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  20. Lithium chloride ameliorates learning and memory ability and inhibits glycogen synthase kinase-3 beta activity in a mouse model of fragile X syndrome

    Institute of Scientific and Technical Information of China (English)

    Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi

    2011-01-01

    In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.

  1. Bi-phasic regulation of glycogen content in astrocytes via Cav-1/PTEN/PI3K/AKT/GSK-3β pathway by fluoxetine.

    Science.gov (United States)

    Bai, Qiufang; Song, Dan; Gu, Li; Verkhratsky, Alexei; Peng, Liang

    2017-04-01

    Here, we present the data indicating that chronic treatment with fluoxetine regulates Cav-1/PTEN/PI3K/AKT/GSK-3β signalling pathway and glycogen content in primary cultures of astrocytes with bi-phasic concentration dependence. At lower concentrations, fluoxetine downregulates gene expression of Cav-1, decreases membrane content of PTEN, increases activity of PI3K/AKT, and elevates GSK-3β phosphorylation thus suppressing its activity. At higher concentrations, fluoxetine acts in an inverse fashion. As expected, fluoxetine at lower concentrations increased while at higher concentrations decreased glycogen content in astrocytes. Our findings indicate that bi-phasic regulation of glycogen content via Cav-1/PTEN/PI3K/AKT/GSK-3β pathway by fluoxetine may be responsible for both therapeutic and side effects of the drug.

  2. Increased phosphorylation of skeletal muscle glycogen synthase at NH2-terminal sites during physiological hyperinsulinemia in type 2 diabetes

    DEFF Research Database (Denmark)

    Højlund, Kurt; Staehr, Peter; Hansen, Bo Falck

    2003-01-01

    In type 2 diabetes, insulin activation of muscle glycogen synthase (GS) is impaired. This defect plays a major role for the development of insulin resistance and hyperglycemia. In animal muscle, insulin activates GS by reducing phosphorylation at both NH(2)- and COOH-terminal sites......, but the mechanism involved in human muscle and the defect in type 2 diabetes remain unclear. We studied the effect of insulin at physiological concentrations on glucose metabolism, insulin signaling and phosphorylation of GS in skeletal muscle from type 2 diabetic and well-matched control subjects during euglycemic......-hyperinsulinemic clamps. Analysis using phospho-specific antibodies revealed that insulin decreases phosphorylation of sites 3a + 3b in human muscle, and this was accompanied by activation of Akt and inhibition of glycogen synthase kinase-3alpha. In type 2 diabetic subjects these effects of insulin were fully intact...

  3. Modelo experimental para restrição do crescimento fetal em ratos: efeito sobre o glicogênio hepático e morfometria intestinal e renal Experimental rat model for fetal growth restriction: effects on liver glycogen and intestinal and renal morphometry

    Directory of Open Access Journals (Sweden)

    Márcia Pereira Bueno

    2010-04-01

    Full Text Available OBJETIVO: avaliar a eficácia do modelo de RCIU por ligadura da artéria uterina simulando insuficiência placentária em ratos. MÉTODOS: fetos de ratas prenhes Sprague-Dawley foram divididos em três grupos: RCIU (restrição de crescimento intrauterino, com fetos submetidos à ligadura da artéria uterina com 18,5 dias de gestação (termo = 22 dias, C-RCIU (controle da restrição, com fetos do corno contralateral à ligadura, CE (Controle Externo, com fetos de ratas sem manipulação. Com 21,5 dias de gestação, foi realizada cesárea, os fetos foram pesados e dissecados para análise morfométrica e histológica do fígado, intestino e rins. RESULTADOS: os dados morfométricos avaliados mostraram o peso corpóreo (PC, hepático (PH e intestinal (PI dos fetos com RCIU menor que C-RCIU e CE (pPURPOSE: to evaluate the effectiveness of the IUGR model by uterine artery ligation mimicking placental insufficiency in rats. METHODS: sprague-Dawley rat fetuses were divided into three groups: IUGR (intrauterine growth restriction, with fetuses in the right horn of pregnant rats subjected to right uterine artery ligation at 18.5 days of gestation (term = 22 days; C-IUGR (control of restriction, with control fetuses in the left horn, and EC (external control, with fetuses of intact rats. Animals were harvested by cesarean section at day 21.5 days of gestation. Fetuses were weighed and then sacrificed. The intestine, liver, kidney and placenta were weighed and dissected for morphometric and histological analysis. RESULTS: the morphometric data showed decreased body weight (BW, liver weight (LW and intestinal weight (IW of fetuses with IUGR compared to C-IUGR and EC (p<0.001. The placental weight (PW, renal weight (RW and LW/BW, IW/BW, and RW/BW ratios did not change. IUGR fetuses had decreased kidney thickness (p<0.001 and decreased thickness of the intestinal mucosa and submucosa (p<0.05. Histological evaluation showed reduction of liver glycogen

  4. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  5. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  6. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  7. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    Science.gov (United States)

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  8. Technical and experimental features of Magnetic Resonance Spectroscopy of brain glycogen metabolism.

    Science.gov (United States)

    Soares, Ana Francisca; Gruetter, Rolf; Lei, Hongxia

    2017-07-15

    In the brain, glycogen is a source of glucose not only in emergency situations but also during normal brain activity. Altered brain glycogen metabolism is associated with energetic dysregulation in pathological conditions, such as diabetes or epilepsy. Both in humans and animals, brain glycogen levels have been assessed non-invasively by Carbon-13 Magnetic Resonance Spectroscopy ( 13 C-MRS) in vivo. With this approach, glycogen synthesis and degradation may be followed in real time, thereby providing valuable insights into brain glycogen dynamics. However, compared to the liver and muscle, where glycogen is abundant, the sensitivity for detection of brain glycogen by 13 C-MRS is inherently low. In this review we focus on strategies used to optimize the sensitivity for 13 C-MRS detection of glycogen. Namely, we explore several technical perspectives, such as magnetic field strength, field homogeneity, coil design, decoupling, and localization methods. Furthermore, we also address basic principles underlying the use of 13 C-labeled precursors to enhance the detectable glycogen signal, emphasizing specific experimental aspects relevant for obtaining kinetic information on brain glycogen. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Free Glycogen in Vaginal Fluids Is Associated with Lactobacillus Colonization and Low Vaginal pH

    Science.gov (United States)

    Mirmonsef, Paria; Hotton, Anna L.; Gilbert, Douglas; Burgad, Derick; Landay, Alan; Weber, Kathleen M.; Cohen, Mardge; Ravel, Jacques; Spear, Gregory T.

    2014-01-01

    Objective Lactobacillus dominates the lower genital tract microbiota of many women, producing a low vaginal pH, and is important for healthy pregnancy outcomes and protection against several sexually transmitted pathogens. Yet, factors that promote Lactobacillus remain poorly understood. We hypothesized that the amount of free glycogen in the lumen of the lower genital tract is an important determinant of Lactobacillus colonization and a low vaginal pH. Methods Free glycogen in lavage samples was quantified. Pyrosequencing of the 16S rRNA gene was used to identify microbiota from 21 African American women collected over 8–11 years. Results Free glycogen levels varied greatly between women and even in the same woman. Samples with the highest free glycogen had a corresponding median genital pH that was significantly lower (pH 4.4) than those with low glycogen (pH 5.8; pglycogen versus those with low glycogen (median = 0.97 vs. 0.05, pglycogen. High concentrations of glycogen corresponded to higher levels of L. crispatus and L. jensenii, but not L. iners. Conclusion These findings show that free glycogen in genital fluid is associated with a genital microbiota dominated by Lactobacillus, suggesting glycogen is important for maintaining genital health. Treatments aimed at increasing genital free glycogen might impact Lactobacillus colonization. PMID:25033265

  10. Cerebral glycogen in humans following acute and recurrent hypoglycemia: Implications on a role in hypoglycemia unawareness.

    Science.gov (United States)

    Öz, Gülin; DiNuzzo, Mauro; Kumar, Anjali; Moheet, Amir; Khowaja, Ameer; Kubisiak, Kristine; Eberly, Lynn E; Seaquist, Elizabeth R

    2017-08-01

    Supercompensated brain glycogen levels may contribute to the development of hypoglycemia-associated autonomic failure (HAAF) following recurrent hypoglycemia (RH) by providing energy for the brain during subsequent periods of hypoglycemia. To assess the role of glycogen supercompensation in the generation of HAAF, we estimated the level of brain glycogen following RH and acute hypoglycemia (AH). After undergoing 3 hyperinsulinemic, euglycemic and 3 hyperinsulinemic, hypoglycemic clamps (RH) on separate occasions at least 1 month apart, five healthy volunteers received [1- 13 C]glucose intravenously over 80+ h while maintaining euglycemia. 13 C-glycogen levels in the occipital lobe were measured by 13 C magnetic resonance spectroscopy at ∼8, 20, 32, 44, 56, 68 and 80 h at 4 T and glycogen levels estimated by fitting the data with a biophysical model that takes into account the tiered glycogen structure. Similarly, prior 13 C-glycogen data obtained following a single hypoglycemic episode (AH) were fitted with the same model. Glycogen levels did not significantly increase after RH relative to after euglycemia, while they increased by ∼16% after AH relative to after euglycemia. These data suggest that glycogen supercompensation may be blunted with repeated hypoglycemic episodes. A causal relationship between glycogen supercompensation and generation of HAAF remains to be established.

  11. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  12. Glycogenolysis during short-term fasting in malaria and healthy subjects - the potential regulatory role of glycogen content on glycogen breakdown: a hypothesis

    NARCIS (Netherlands)

    Sprangers, F.; Thien, H. V.; Ackermans, M. T.; Endert, E.; Sauerwein, H. P.

    2004-01-01

    Background & aims: During short-term starvation ( <24h), glucose production decreases 10-20% due to a decrease in glycogenolysis. In the fed state glycogen regulates its rate of breakdown, in order to limit glycogen accumulation. Whether in the fasted state a similar mechanism exists to preserve

  13. Variations in Glycogen Synthesis in Human Pluripotent Stem Cells with Altered Pluripotent States

    Science.gov (United States)

    Chen, Richard J.; Zhang, Guofeng; Garfield, Susan H.; Shi, Yi-Jun; Chen, Kevin G.; Robey, Pamela G.; Leapman, Richard D.

    2015-01-01

    Human pluripotent stem cells (hPSCs) represent very promising resources for cell-based regenerative medicine. It is essential to determine the biological implications of some fundamental physiological processes (such as glycogen metabolism) in these stem cells. In this report, we employ electron, immunofluorescence microscopy, and biochemical methods to study glycogen synthesis in hPSCs. Our results indicate that there is a high level of glycogen synthesis (0.28 to 0.62 μg/μg proteins) in undifferentiated human embryonic stem cells (hESCs) compared with the glycogen levels (0 to 0.25 μg/μg proteins) reported in human cancer cell lines. Moreover, we found that glycogen synthesis was regulated by bone morphogenetic protein 4 (BMP-4) and the glycogen synthase kinase 3 (GSK-3) pathway. Our observation of glycogen bodies and sustained expression of the pluripotent factor Oct-4 mediated by the potent GSK-3 inhibitor CHIR-99021 reveals an altered pluripotent state in hPSC culture. We further confirmed glycogen variations under different naïve pluripotent cell growth conditions based on the addition of the GSK-3 inhibitor BIO. Our data suggest that primed hPSCs treated with naïve growth conditions acquire altered pluripotent states, similar to those naïve-like hPSCs, with increased glycogen synthesis. Furthermore, we found that suppression of phosphorylated glycogen synthase was an underlying mechanism responsible for altered glycogen synthesis. Thus, our novel findings regarding the dynamic changes in glycogen metabolism provide new markers to assess the energetic and various pluripotent states in hPSCs. The components of glycogen metabolic pathways offer new assays to delineate previously unrecognized properties of hPSCs under different growth conditions. PMID:26565809

  14. Enzymatic regulation of seasonal glycogen cycling in the freeze-tolerant wood frog, Rana sylvatica.

    Science.gov (United States)

    do Amaral, M Clara F; Lee, Richard E; Costanzo, Jon P

    2016-12-01

    Liver glycogen is an important energy store in vertebrates, and in the freeze-tolerant wood frog, Rana sylvatica, this carbohydrate also serves as a major source of the cryoprotectant glucose. We investigated how variation in the levels of the catalytic subunit of protein kinase A (PKAc), glycogen phosphorylase (GP), and glycogen synthase (GS) relates to seasonal glycogen cycling in a temperate (Ohioan) and subarctic (Alaskan) populations of this species. In spring, Ohioan frogs had reduced potential for glycogen synthesis, as evidenced by low GS activity and high PKAc protein levels. In addition, glycogen levels in spring were the lowest of four seasonal samples, as energy input was likely directed towards metabolism and somatic growth during this period. Near-maximal glycogen levels were reached by mid-summer, and remained unchanged in fall and winter, suggesting that glycogenesis was curtailed during this period. Ohioan frogs had a high potential for glycogenolysis and glycogenesis in winter, as evidenced by large glycogen reserves, high levels of GP and GS proteins, and high GS activity, which likely allows for rapid mobilization of cryoprotectant during freezing and replenishing of glycogen reserves during thawing. Alaskan frogs also achieved a near-maximal liver glycogen concentration by summer and displayed high glycogenic and glycogenolytic potential in winter, but, unlike Ohioan frogs, started replenishing their energy reserves early in spring. We conclude that variation in levels of both glycogenolytic and glycogenic enzymes likely happens in response to seasonal changes in energetic strategies and demands, with winter survival being a key component to understanding the regulation of glycogen cycling in this species.

  15. Imidazopyridine-based inhibitors of glycogen synthase kinase 3: synthesis and evaluation of amide isostere replacements of the carboxamide scaffold.

    Science.gov (United States)

    Yngve, Ulrika; Söderman, Peter; Svensson, Mats; Rosqvist, Susanne; Arvidsson, Per I

    2012-11-01

    In this study, we explored the effect of bioisostere replacement in a series of glycogen synthase kinase 3 (GSK3) inhibitors based on the imidazopyridine core. The synthesis and biological evaluation of a number of novel sulfonamide, 1,2,4-oxadiazole, and thiazole derivates as amide bioisosteres, as well as a computational rationalization of the obtained results are reported. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  16. Impaired glycogen breakdown and synthesis in phosphoglucomutase 1 deficiency

    DEFF Research Database (Denmark)

    Preisler, Nicolai; Cohen, Jonathan; Vissing, Christoffer Rasmus

    2017-01-01

    contracture. Comparable to patients with McArdle disease, the patient developed a 'second wind' with a spontaneous fall in exercise heart rate and perceived exertion. Like in McArdle disease, this was attributable to an increase in muscle oxidative capacity. Carbohydrate oxidation was blocked during exercise......, and the patient had exaggerated oxidation of fat to fuel exercise. Exercise heart rate and perceived exertion were lower after IV glucose and oral sucrose. Muscle glycogen level was low normal. CONCLUSIONS: The second wind phenomenon has been considered to be pathognomonic for McArdle disease, but we demonstrate...... that it can also be present in PGM1 deficiency. We show that severe loss of PGM1 activity causes blocked muscle glycogenolysis that mimics McArdle disease, but may also limit glycogen synthesis, which broadens the phenotypic spectrum of this disorder....

  17. Muscle glycogen storage after different amounts of carbohydrate ingestion.

    Science.gov (United States)

    Ivy, J L; Lee, M C; Brozinick, J T; Reed, M J

    1988-11-01

    The purpose of this study was to determine whether the rate of muscle glycogen storage could be enhanced during the initial 4-h period postexercise by substantially increasing the amount of the carbohydrate consumed. Eight subjects cycled for 2 h on three separate occasions to deplete their muscle glycogen stores. Immediately and 2 h after exercise they consumed either 0 (P), 1.5 (L), or 3.0 g glucose/kg body wt (H) from a 50% glucose polymer solution. Blood samples were drawn from an antecubital vein before exercise, during exercise, and throughout recovery. Muscle biopsies were taken from the vastus lateralis immediately, 2 h, and 4 h after exercise. Blood glucose and insulin declined significantly during exercise in each of the three treatments. They remained below the preexercise concentrations during recovery in the P treatment but increased significantly above the preexercise concentrations during the L and H treatments. By the end of the 4 h-recovery period, blood glucose and insulin were still significantly above the preexercise concentrations in both treatments. Muscle glycogen storage was significantly increased above the basal rate (P, 0.5 mumol.g wet wt-1.h-1) after ingestion of either glucose polymer supplement. The rates of muscle glycogen storage, however, were not different between the L and H treatments during the first 2 h (L, 5.2 +/- 0.9 vs. H, 5.8 +/- 0.7 mumol.g wet wt-1.h-1) or the second 2 h of recovery (L, 4.0 +/- 0.9 vs. H, 4.5 +/- 0.6 mumol.g wet wt-1. h-1).(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Expression of a humanized viral 2A-mediated lux operon efficiently generates autonomous bioluminescence in human cells.

    Directory of Open Access Journals (Sweden)

    Tingting Xu

    Full Text Available Expression of autonomous bioluminescence from human cells was previously reported to be impossible, suggesting that all bioluminescent-based mammalian reporter systems must therefore require application of a potentially influential chemical substrate. While this was disproven when the bacterial luciferase (lux cassette was demonstrated to function in a human cell, its expression required multiple genetic constructs, was functional in only a single cell type, and generated a significantly reduced signal compared to substrate-requiring systems. Here we investigate the use of a humanized, viral 2A-linked lux genetic architecture for the efficient introduction of an autobioluminescent phenotype across a variety of human cell lines.The lux cassette was codon optimized and assembled into a synthetic human expression operon using viral 2A elements as linker regions. Human kidney, breast cancer, and colorectal cancer cell lines were both transiently and stably transfected with the humanized operon and the resulting autobioluminescent phenotype was evaluated using common imaging instrumentation. Autobioluminescent cells were screened for cytotoxic effects resulting from lux expression and their utility as bioreporters was evaluated through the demonstration of repeated monitoring of single populations over a prolonged period using both a modified E-SCREEN assay for estrogen detection and a classical cytotoxic compound detection assay for the antibiotic Zeocin. Furthermore, the use of self-directed bioluminescent initiation in response to target detection was assessed to determine its amenability towards deployment as fully autonomous sensors. In all cases, bioluminescent measurements were supported with traditional genetic and transcriptomic evaluations.Our results demonstrate that the viral 2A-linked, humanized lux genetic architecture successfully produced autobioluminescent phenotypes in all cell lines tested without the induction of cytotoxicity

  19. Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors

    Directory of Open Access Journals (Sweden)

    Daniela Hulcová

    2018-03-01

    Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.

  20. Dietary Management of the Ketogenic Glycogen Storage Diseases

    Directory of Open Access Journals (Sweden)

    Kaustuv Bhattacharya MBBS, MRCPCH, FRACP, MD

    2016-08-01

    Full Text Available The glycogen storage diseases (GSDs comprise a group of rare inherited disorders of glycogen metabolism. The hepatic glycogenolytic forms of these disorders are typically associated with hypoglycemia and hepatomegaly. For GSD I, secondary metabolic disturbances include fasting hyperlactatemia, hyperuricemia, and hyperlipidemia. Glycogen storage disease III is caused by reduced activity of the debrancher enzyme, GSD VI by phosphorylase, and GSD IX by phosphorylase kinase. It has often been reported that the non-GSD I group of disorders have a benign course. However, myopathy, cardiomyopathy, and cirrhosis have been reported significant clinical morbidities associated with GSD III and IX in particular. There have been a range of reports indicating high-protein diets, high-fat diets, medium chain triglyceride (MCT, modified Atkins diet, and therapeutic ketones as rescuing severe phenotypes of GSD III in particular. The etiology of these severe phenotypes has not been defined. Cases presented in this report indicate potential harm from excessive simple sugar use in GSD IX C. Review of the literature indicates that most interventions have reduced the glycemic load and provide alternate substrates for energy in rescue situations. Prevention of complications is most likely to occur with a mixed balanced low glycemic index diet potentially with relative increases in protein.

  1. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Science.gov (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  2. Sci—Fri AM: Mountain — 04: Label-free Raman spectroscopy of single tumour cells detects early radiation-induced glycogen synthesis associated with increased radiation resistance

    International Nuclear Information System (INIS)

    Matthews, Q; Lum, JJ; Isabelle, M; Harder, S; Jirasek, A; Brolo, AG

    2014-01-01

    Purpose: To use label-free Raman spectroscopy (RS) for early treatment monitoring of tumour cell radioresistance. Methods: Three human tumour cell lines, two radioresistant (H460, SF 2 = 0.57 and MCF7, SF 2 = 0.70) and one radiosensitive (LNCaP, SF 2 = 0.36), were irradiated with single fractions of 2, 4, 6, 8 or 10 Gy. In additional experiments, H460 and MCF7 cells were irradiated under co-treatment with the anti-diabetic drug metformin, a known radiosensitizing agent. Treated and control cultures were analyzed with RS daily for 3 days post-treatment. Single-cell Raman spectra were acquired from 20 live cells per sample, and experiments were repeated in triplicate. The combined data sets were analyzed with principal component analysis using standard algorithms. Cells from each culture were also subjected to standard assays for viability, proliferation, cell cycle, and radiation clonogenic survival. Results: The radioresistant cells (H460, MCF7) exhibited a RS molecular radiation response signature, detectable as early as 1 day post-treatment, of which radiation-induced glycogen synthesis is a significant contributor. The radiosensitive cells (LNCaP) exhibited negligible glycogen synthesis. Co-treatment with metformin in MCF7 cells blocked glycogen synthesis, reduced viability and proliferation, and increased radiosensitivity. Conversely, metformin co-treatment in H460 cells did not produce these same effects; importantly, both radiation-induced synthesis of glycogen and radiosensitivity were unaffected. Conclusions: Label-free RS can detect early glycogen synthesis post-irradiation, a previously undocumented metabolic mechanism associated with tumour cell radioresistance that can be targeted to increase radiosensitivity. RS monitoring of intratumoral glycogen may provide new opportunities for personalized combined modality radiotherapy treatments

  3. Sci—Fri AM: Mountain — 04: Label-free Raman spectroscopy of single tumour cells detects early radiation-induced glycogen synthesis associated with increased radiation resistance

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, Q; Lum, JJ [BC Cancer Agency — Vancouver Island Centre (Canada); Isabelle, M; Harder, S; Jirasek, A [Physics and Astronomy, University of Victoria (Australia); Brolo, AG [Chemistry, University of Victoria (Australia)

    2014-08-15

    Purpose: To use label-free Raman spectroscopy (RS) for early treatment monitoring of tumour cell radioresistance. Methods: Three human tumour cell lines, two radioresistant (H460, SF{sub 2} = 0.57 and MCF7, SF{sub 2} = 0.70) and one radiosensitive (LNCaP, SF{sub 2} = 0.36), were irradiated with single fractions of 2, 4, 6, 8 or 10 Gy. In additional experiments, H460 and MCF7 cells were irradiated under co-treatment with the anti-diabetic drug metformin, a known radiosensitizing agent. Treated and control cultures were analyzed with RS daily for 3 days post-treatment. Single-cell Raman spectra were acquired from 20 live cells per sample, and experiments were repeated in triplicate. The combined data sets were analyzed with principal component analysis using standard algorithms. Cells from each culture were also subjected to standard assays for viability, proliferation, cell cycle, and radiation clonogenic survival. Results: The radioresistant cells (H460, MCF7) exhibited a RS molecular radiation response signature, detectable as early as 1 day post-treatment, of which radiation-induced glycogen synthesis is a significant contributor. The radiosensitive cells (LNCaP) exhibited negligible glycogen synthesis. Co-treatment with metformin in MCF7 cells blocked glycogen synthesis, reduced viability and proliferation, and increased radiosensitivity. Conversely, metformin co-treatment in H460 cells did not produce these same effects; importantly, both radiation-induced synthesis of glycogen and radiosensitivity were unaffected. Conclusions: Label-free RS can detect early glycogen synthesis post-irradiation, a previously undocumented metabolic mechanism associated with tumour cell radioresistance that can be targeted to increase radiosensitivity. RS monitoring of intratumoral glycogen may provide new opportunities for personalized combined modality radiotherapy treatments.

  4. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  5. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  6. Use of deuterium labelled glucose in evaluating the pathway of hepatic glycogen synthesis

    International Nuclear Information System (INIS)

    Goodman, M.N.; Masuoka, L.K.; deRopp, J.S.; Jones, A.D.

    1989-01-01

    Deuterium labelled glucose has been used to study the pathway of hepatic glycogen synthesis during the fasted-refed transition in rats. Deuterium enrichment of liver glycogen was determined using nuclear magnetic resonance as well as mass spectroscopy. Sixty minutes after oral administration of deuterated glucose to fasted rats, the portal vein blood was fully enriched with deuterated glucose. Despite this, less than half of the glucose molecules incorporated into liver glycogen contained deuterium. The loss of deuterium label from glucose is consistent with hepatic glycogen synthesis by an indirect pathway requiring prior metabolism of glucose. The use of deuterium labelled glucose may prove to be a useful probe to study hepatic glycogen metabolism. Its use may also find application in the study of liver glycogen metabolism in humans by a noninvasive means

  7. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Science.gov (United States)

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  8. Energy metabolism and memory processing: role of glucose transport and glycogen in responses to adrenoceptor activation in the chicken.

    Science.gov (United States)

    Hutchinson, Dana S; Summers, Roger J; Gibbs, Marie E

    2008-06-15

    From experiments using a discriminated bead task in young chicks, we have defined when and where adrenoceptors (ARs) are involved in memory modulation. All three ARs subtypes (alpha(1)-, alpha(2)- and beta-ARs) are found in the chick brain and in regions associated with memory. Glucose and glycogen are important in the role of memory consolidation in the chick since increasing glucose levels improves memory consolidation while inhibiting glucose transporters (GLUTs) or glycogen breakdown inhibits memory consolidation. The selective beta(3)-AR agonist CL316243 enhances memory consolidation by a glucose-dependent mechanism and the administration of the non-metabolized glucose analogue 2-deoxyglucose reduces the ability of CL316243 to enhance memory. Agents that reduce glucose uptake by GLUTs and its incorporation into the glycolytic pathway also reduce the effectiveness of CL316243, but do not alter the dose-response relationship to the beta(2)-AR agonist zinterol. However, beta(2)-ARs do have a role in memory related to glycogen breakdown and inhibition of glycogenolysis reduces the ability of zinterol to enhance memory. Both beta(2)- and beta(3)-ARs are found on astrocytes from chick forebrain, and the actions of beta(3)-ARs on glucose uptake, and beta(2)-ARs on the breakdown of glycogen is consistent with an effect on astrocytic metabolism at the time of memory consolidation 30 min after training. We have shown that both beta(2)- and beta(3)-ARs can increase glucose uptake in chick astrocytes but do so by different mechanisms. This review will focus on the role of ARs on memory consolidation and specifically the role of energy metabolism on AR modulation of memory.

  9. Possible mechanism for changes in glycogen metabolism in unloaded soleus muscle

    Science.gov (United States)

    Henriksen, E. J.; Tischler, M. E.

    1985-01-01

    Carbohydrate metabolism has been shown to be affected in a number of ways by different models of hypokinesia. In vivo glycogen levels in the soleus muscle are known to be increased by short-term denervation and harness suspension. In addition, exposure to 7 days of hypogravity also caused a dramatic increase in glycogen concentration in this muscle. The biochemical alterations caused by unloading that may bring about these increases in glycogen storage in the soleus were sought.

  10. Free glycogen in vaginal fluids is associated with Lactobacillus colonization and low vaginal pH.

    Directory of Open Access Journals (Sweden)

    Paria Mirmonsef

    Full Text Available Lactobacillus dominates the lower genital tract microbiota of many women, producing a low vaginal pH, and is important for healthy pregnancy outcomes and protection against several sexually transmitted pathogens. Yet, factors that promote Lactobacillus remain poorly understood. We hypothesized that the amount of free glycogen in the lumen of the lower genital tract is an important determinant of Lactobacillus colonization and a low vaginal pH.Free glycogen in lavage samples was quantified. Pyrosequencing of the 16S rRNA gene was used to identify microbiota from 21 African American women collected over 8-11 years.Free glycogen levels varied greatly between women and even in the same woman. Samples with the highest free glycogen had a corresponding median genital pH that was significantly lower (pH 4.4 than those with low glycogen (pH 5.8; p<0.001. The fraction of the microbiota consisting of Lactobacillus was highest in samples with high glycogen versus those with low glycogen (median = 0.97 vs. 0.05, p<0.001. In multivariable analysis, having 1 vs. 0 male sexual partner in the past 6 months was negatively associated, while BMI ≥30 was positively associated with glycogen. High concentrations of glycogen corresponded to higher levels of L. crispatus and L. jensenii, but not L. iners.These findings show that free glycogen in genital fluid is associated with a genital microbiota dominated by Lactobacillus, suggesting glycogen is important for maintaining genital health. Treatments aimed at increasing genital free glycogen might impact Lactobacillus colonization.

  11. Glycogen Phosphomonoester Distribution in Mouse Models of the Progressive Myoclonic Epilepsy, Lafora Disease*

    Science.gov (United States)

    DePaoli-Roach, Anna A.; Contreras, Christopher J.; Segvich, Dyann M.; Heiss, Christian; Ishihara, Mayumi; Azadi, Parastoo; Roach, Peter J.

    2015-01-01

    Glycogen is a branched polymer of glucose that acts as an energy reserve in many cell types. Glycogen contains trace amounts of covalent phosphate, in the range of 1 phosphate per 500–2000 glucose residues depending on the source. The function, if any, is unknown, but in at least one genetic disease, the progressive myoclonic epilepsy Lafora disease, excessive phosphorylation of glycogen has been implicated in the pathology by disturbing glycogen structure. Some 90% of Lafora cases are attributed to mutations of the EPM2A or EPM2B genes, and mice with either gene disrupted accumulate hyperphosphorylated glycogen. It is, therefore, of importance to understand the chemistry of glycogen phosphorylation. Rabbit skeletal muscle glycogen contained covalent phosphate as monoesters of C2, C3, and C6 carbons of glucose residues based on analyses of phospho-oligosaccharides by NMR. Furthermore, using a sensitive assay for glucose 6-P in hydrolysates of glycogen coupled with measurement of total phosphate, we determined the proportion of C6 phosphorylation in rabbit muscle glycogen to be ∼20%. C6 phosphorylation also accounted for ∼20% of the covalent phosphate in wild type mouse muscle glycogen. Glycogen phosphorylation in Epm2a−/− and Epm2b−/− mice was increased 8- and 4-fold compared with wild type mice, but the proportion of C6 phosphorylation remained unchanged at ∼20%. Therefore, our results suggest that C2, C3, and/or C6 phosphate could all contribute to abnormal glycogen structure or to Lafora disease. PMID:25416783

  12. Human skeletal muscle glycogen utilization in exhaustive exercise: role of subcellular localization and fibre type

    Science.gov (United States)

    Nielsen, Joachim; Holmberg, Hans-Christer; Schrøder, Henrik D; Saltin, Bengt; Ørtenblad, Niels

    2011-01-01

    Abstract Although glycogen is known to be heterogeneously distributed within skeletal muscle cells, there is presently little information available about the role of fibre types, utilization and resynthesis during and after exercise with respect to glycogen localization. Here, we tested the hypothesis that utilization of glycogen with different subcellular localizations during exhaustive arm and leg exercise differs and examined the influence of fibre type and carbohydrate availability on its subsequent resynthesis. When 10 elite endurance athletes (22 ± 1 years, = 68 ± 5 ml kg−1 min−1, mean ± SD) performed one hour of exhaustive arm and leg exercise, transmission electron microscopy revealed more pronounced depletion of intramyofibrillar than of intermyofibrillar and subsarcolemmal glycogen. This phenomenon was the same for type I and II fibres, although at rest prior to exercise, the former contained more intramyofibrillar and subsarcolemmal glycogen than the latter. In highly glycogen-depleted fibres, the remaining small intermyofibrillar and subsarcolemmal glycogen particles were often found to cluster in groupings. In the recovery period, when the athletes received either a carbohydrate-rich meal or only water the impaired resynthesis of glycogen with water alone was associated primarily with intramyofibrillar glycogen. In conclusion, after prolonged high-intensity exercise the depletion of glycogen is dependent on subcellular localization. In addition, the localization of glycogen appears to be influenced by fibre type prior to exercise, as well as carbohydrate availability during the subsequent period of recovery. These findings provide insight into the significance of fibre type-specific compartmentalization of glycogen metabolism in skeletal muscle during exercise and subsequent recovery. PMID:21486810

  13. Detection of human muscle glycogen by natural abundance 13C NMR

    International Nuclear Information System (INIS)

    Avison, M.J.; Rothman, D.L.; Nadel, E.; Shulman, R.G.

    1988-01-01

    Natural abundance 13 C nuclear magnetic resonance spectroscopy was used to detect signals from glycogen in the human gastrocnemius muscle. The reproducibility of the measurement was demonstrated, and the ability to detect dynamic changes was confirmed by measuring a decrease in muscle glycogen levels after exercise and its subsequent repletion. Single frequency gated 1 H decoupling was used to obtain decoupled natural abundance 13 C NMR spectra of the C-1 position of muscle glycogen

  14. Glycogen accumulation in normal and irradiated minced muscle autografts on frog gastrocnemius

    International Nuclear Information System (INIS)

    Malhotra, R.K.; Kaul, R.; Malhotra, N.

    1989-01-01

    Alterations induced in glycogen content and phosphorylase activity have been studied in normal and irradiated minced muscle autografts on frog gastrocnemius at days 1, 3, 5, 7, 10, 15 and 30 postgrafting. The changes observed in the glycogen content and phosphorylase activity conform to the degeneration and regeneration phases of muscle repair. An attempt has been made to explain the altered glycogen utilizing capacities of the frog skeletal muscle during its repair and regeneration. (author)

  15. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  16. Intermittent-sprint performance and muscle glycogen after 30 h of sleep deprivation.

    Science.gov (United States)

    Skein, Melissa; Duffield, Rob; Edge, Johann; Short, Michael J; Mündel, Toby

    2011-07-01

    The aim of this study was to determine the effects of 30 h of sleep deprivation on consecutive-day intermittent-sprint performance and muscle glycogen content. Ten male, team-sport athletes performed a single-day "baseline" session and two consecutive-day experimental trials separated either by a normal night's sleep (CONT1 and CONT2) or no sleep (SDEP1 and SDEP2). Each session included a 30-min graded exercise run and 50-min intermittent-sprint exercise protocol, including a 15-m maximal sprint every minute and self-paced exercise bouts of varying intensities. Muscle biopsies were extracted before and after exercise during the baseline session and before exercise on day 2 during experimental trials. Voluntary force and activation of the right quadriceps, nude mass, HR, core temperature, capillary blood lactate and glucose, RPE, and a modified POMS were recorded before, after, and during the exercise protocols. Mean sprint times were slower on SDEP2 (2.78±0.17 s) compared with SDEP1 (2.70±0.16 s) and CONT2 (2.74±0.15 s, PSleep loss did not affect RPE but negatively affected POMS ratings (PSleep loss and associated reductions in muscle glycogen and perceptual stress reduced sprint performance and slowed pacing strategies during intermittent-sprint exercise for male team-sport athletes.

  17. Carbon-13 NMR of glycogen: Hydration response studied by using solids methods

    International Nuclear Information System (INIS)

    Jackson, C.L.; Bryant, R.G.

    1989-01-01

    The carbon-13 NMR spectra of glycogen are reported by using the methods of magic-angle sample spinning and high-power proton decoupling to provide a dynamic report on the glucose monomer behavior as a function of hydration. Although the glycogen behaves as a typical polymer in the dry state, addition of water makes a significant difference in the spectral appearance. Water addition decreases the carbon spin-lattice relaxation times by 2 orders of magnitude over the range from 7% to 70% water by weight. The proton-carbon dipole-dipole coupling, which broadens the carbon spectrum and permits cross-polarization spectroscopy, is lost with increasing hydration over this range. By 60% water by weight, scalar decoupling methods are sufficient to achieve a reasonably high-resolution spectrum. Further, at this concentration, the carbon spin-lattice relaxation times are near their minimum values at a resonance frequency of 50.3 MHz, making acquisition of carbon spectra relatively insensitive to intensity distortions associated with saturation effects. Though motional averaging places the spectrum in the solution phase limit, the static spectrum shows a residual broader component that would not necessarily be detected readily by using high-resolution liquid-state experiments

  18. Glycogen supercompensation in rat soleus muscle during recovery from nonweight bearing

    Science.gov (United States)

    Henriksen, Erik J.; Kirby, Christopher R.; Tischler, Marc E.

    1989-01-01

    Events leading to the normalization of the glycogen metabolism in the soleus muscle of rat, altered by 72-h three days of hind-limb suspension, were investigated during the 72-h recovery period when the animals were allowed to bear weight on all four limbs. Relative importance of the factors affecting glycogen metabolism in skeletal muscle during the recovery period was also examined. Glycogen concentration was found to decrease within 15 min and up to 2 h of recovery, while muscle glucose 6-phosphate, and the fractional activities of glycogen phosphorylase and glycogen synthase increased. From 2 to 4 h, when the glycogen synthase activity remained elevated and the phosphorylase activity declined, glycogen concentration increased, until it reached maximum values at about 24 h, after which it started to decrease, reaching control values by 72 h. At 12 and 24 h, the inverse relationship between glycogen concentration and the synthase activity ratio was lost, indicating that the reloading transiently uncoupled glycogen control of this enzyme.

  19. Glycogen distribution in the microwave‐fixed mouse brain reveals heterogeneous astrocytic patterns

    Science.gov (United States)

    Baba, Otto; Ashida, Hitoshi; Nakamura, Kouichi C.

    2016-01-01

    In the brain, glycogen metabolism has been implied in synaptic plasticity and learning, yet the distribution of this molecule has not been fully described. We investigated cerebral glycogen of the mouse by immunohistochemistry (IHC) using two monoclonal antibodies that have different affinities depending on the glycogen size. The use of focused microwave irradiation yielded well‐defined glycogen immunoreactive signals compared with the conventional periodic acid‐Schiff method. The IHC signals displayed a punctate distribution localized predominantly in astrocytic processes. Glycogen immunoreactivity (IR) was high in the hippocampus, striatum, cortex, and cerebellar molecular layer, whereas it was low in the white matter and most of the subcortical structures. Additionally, glycogen distribution in the hippocampal CA3‐CA1 and striatum had a ‘patchy’ appearance with glycogen‐rich and glycogen‐poor astrocytes appearing in alternation. The glycogen patches were more evident with large‐molecule glycogen in young adult mice but they were hardly observable in aged mice (1–2 years old). Our results reveal brain region‐dependent glycogen accumulation and possibly metabolic heterogeneity of astrocytes. GLIA 2016;64:1532–1545 PMID:27353480

  20. Characterization of Function of the GlgA2 Glycogen/Starch Synthase in Cyanobacterium sp. Clg1 Highlights Convergent Evolution of Glycogen Metabolism into Starch Granule Aggregation.

    Science.gov (United States)

    Kadouche, Derifa; Ducatez, Mathieu; Cenci, Ugo; Tirtiaux, Catherine; Suzuki, Eiji; Nakamura, Yasunori; Putaux, Jean-Luc; Terrasson, Amandine Durand; Diaz-Troya, Sandra; Florencio, Francisco Javier; Arias, Maria Cecilia; Striebeck, Alexander; Palcic, Monica; Ball, Steven G; Colleoni, Christophe

    2016-07-01

    At variance with the starch-accumulating plants and most of the glycogen-accumulating cyanobacteria, Cyanobacterium sp. CLg1 synthesizes both glycogen and starch. We now report the selection of a starchless mutant of this cyanobacterium that retains wild-type amounts of glycogen. Unlike other mutants of this type found in plants and cyanobacteria, this mutant proved to be selectively defective for one of the two types of glycogen/starch synthase: GlgA2. This enzyme is phylogenetically related to the previously reported SSIII/SSIV starch synthase that is thought to be involved in starch granule seeding in plants. This suggests that, in addition to the selective polysaccharide debranching demonstrated to be responsible for starch rather than glycogen synthesis, the nature and properties of the elongation enzyme define a novel determinant of starch versus glycogen accumulation. We show that the phylogenies of GlgA2 and of 16S ribosomal RNA display significant congruence. This suggests that this enzyme evolved together with cyanobacteria when they diversified over 2 billion years ago. However, cyanobacteria can be ruled out as direct progenitors of the SSIII/SSIV ancestral gene found in Archaeplastida. Hence, both cyanobacteria and plants recruited similar enzymes independently to perform analogous tasks, further emphasizing the importance of convergent evolution in the appearance of starch from a preexisting glycogen metabolism network. © 2016 American Society of Plant Biologists. All Rights Reserved.

  1. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  2. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  3. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  4. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  5. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Czech Academy of Sciences Publication Activity Database

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

    2015-01-01

    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  6. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  7. Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

    Directory of Open Access Journals (Sweden)

    Álvarez-Morales Ariel

    2011-05-01

    Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

  8. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

    Science.gov (United States)

    Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

    2013-01-01

    The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  9. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  10. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  11. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  12. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  13. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  14. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  15. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  16. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Science.gov (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  18. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  19. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  20. Insulin induces a positive relationship between the rates of ATP and glycogen changes in isolated rat liver in presence of glucose; a 31P and 13C NMR study.

    Science.gov (United States)

    Baillet-Blanco, Laurence; Beauvieux, Marie-Christine; Gin, Henri; Rigalleau, Vincent; Gallis, Jean-Louis

    2005-11-21

    There is an emerging theory suggesting that insulin, which is known to be the predominant postprandial anabolic hormone, is also a major regulator of mitochondrial oxidative phosphorylation in human skeletal muscle. However, little is known about its effects in the liver. Since there is a theoretical relationship between glycogen metabolism and energy status, a simultaneous and continuous investigation of hepatic ATP and glycogen content was performed in intact and isolated perfused liver by 31P and 13C nuclear magnetic resonance (NMR) The hepatic rates of ATP and glycogen changes were evaluated with different concentrations of insulin and glucose during continuous and short-term supply. Liver from rats fed ad libitum were perfused with Krebs-Henseleit Buffer (KHB)(controls) or KHB containing 6 mM glucose, 30 mM glucose, insulin alone, insulin + 6 mM glucose, insulin + 30 mM glucose. In the control, glycogenolysis occurred at a rate of -0.53 +/- 0.021 % x min(-1) and ATP content decreased at a rate of -0.28 +/- 0.029 % x min(-1). In the absence of insulin, there was a close proportional relationship between the glycogen flux and the glucose concentration, whereas ATP rates never varied. With insulin + glucose, both glycogen and ATP rates were strongly related to the glucose concentration; the magnitude of net glycogen flux was linearly correlated to the magnitude of net ATP flux: flux(glycogen) = 72.543(fluxATP) + 172.08, R2 = 0.98. Only the co-infusion of 30 mM glucose and insulin led to (i) a net glycogen synthesis, (ii) the maintenance of the hepatic ATP content, and a strong positive correlation between their net fluxes. This has never previously been reported. The specific effect of insulin on ATP change is likely related to a rapid stimulation of the hepatic mitochondrial oxidative phosphorylation. We propose that variations in the correlation between rates of ATP and glycogen changes could be a probe for insulin resistance due to the action of substrates

  1. Glycogen storage disease type II (Pompe disease in children

    Directory of Open Access Journals (Sweden)

    A. N. Semyachkina

    2014-01-01

    Full Text Available The paper gives the data available in the literature, which reflect the manifestations, diagnosis, and current treatments of the rare (orphan inherited disease glycogen storage disease type II or Pomp disease in children, as well as its classification. The infant form is shown to be most severe, resulting in death from cardiovascular or pulmonary failure generally within the first year of a child’s life. Emphasis is laid on major difficulties in the differential and true diagnosis of this severe disease. Much attention is given to the new pathogenetic treatment — genetically engineered enzyme replacement drug Myozyme®. The authors describe their clinical case of a child with the juvenile form of glycogen storage disease type II (late-onset Pompe disease. Particular emphasis is laid on the clinical symptoms of the disease and its diagnostic methods, among which the morphological analysis of a muscle biopsy specimen by light and electron microscopies, and enzyme and DNA diagnoses are of most importance. The proband was found to have significant lysosomal glycogen accumulation in the muscle biopsy specimen, reduced lymphocyte acid α-1,4-glucosidase activity to 4,2 nM/mg/h (normal value, 13,0—53,6 nM/mg/h, described in the HGMD missense mutation database from 1000 G>A p.Gly334er of the GAA in homozygous state, which verified the diagnosis of Pompe disease. 

  2. Compartmentation of glycogen metabolism revealed from 13C isotopologue distributions

    Directory of Open Access Journals (Sweden)

    Marin de Mas Igor

    2011-10-01

    Full Text Available Abstract Background Stable isotope tracers are used to assess metabolic flux profiles in living cells. The existing methods of measurement average out the isotopic isomer distribution in metabolites throughout the cell, whereas the knowledge of compartmental organization of analyzed pathways is crucial for the evaluation of true fluxes. That is why we accepted a challenge to create a software tool that allows deciphering the compartmentation of metabolites based on the analysis of average isotopic isomer distribution. Results The software Isodyn, which simulates the dynamics of isotopic isomer distribution in central metabolic pathways, was supplemented by algorithms facilitating the transition between various analyzed metabolic schemes, and by the tools for model discrimination. It simulated 13C isotope distributions in glucose, lactate, glutamate and glycogen, measured by mass spectrometry after incubation of hepatocytes in the presence of only labeled glucose or glucose and lactate together (with label either in glucose or lactate. The simulations assumed either a single intracellular hexose phosphate pool, or also channeling of hexose phosphates resulting in a different isotopic composition of glycogen. Model discrimination test was applied to check the consistency of both models with experimental data. Metabolic flux profiles, evaluated with the accepted model that assumes channeling, revealed the range of changes in metabolic fluxes in liver cells. Conclusions The analysis of compartmentation of metabolic networks based on the measured 13C distribution was included in Isodyn as a routine procedure. The advantage of this implementation is that, being a part of evaluation of metabolic fluxes, it does not require additional experiments to study metabolic compartmentation. The analysis of experimental data revealed that the distribution of measured 13C-labeled glucose metabolites is inconsistent with the idea of perfect mixing of hexose

  3. Glycogen as a biodegradable construction nanomaterial for in vivo use

    Czech Academy of Sciences Publication Activity Database

    Filippov, Sergey K.; Sedláček, Ondřej; Bogomolova, Anna; Vetrík, Miroslav; Jirák, D.; Kovář, J.; Kučka, Jan; Bals, S.; Turner, S.; Štěpánek, Petr; Hrubý, Martin

    2012-01-01

    Roč. 12, č. 12 (2012), s. 1731-1738 ISSN 1616-5187 R&D Projects: GA ČR GA202/09/2078; GA ČR GAP108/12/0640; GA ČR GAP208/10/1600; GA ČR GPP207/10/P054 Institutional research plan: CEZ:AV0Z40500505 Institutional support: RVO:61389013 Keywords : nanoparticles * in vivo imaging * glycogen Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.742, year: 2012

  4. Modified glycogen as construction material for functional biomimetic microfibers

    Czech Academy of Sciences Publication Activity Database

    Rabyk, Mariia; Hrubý, Martin; Vetrík, Miroslav; Kučka, Jan; Proks, Vladimír; Pařízek, Martin; Konefal, Rafal; Krist, Pavel; Chvátil, David; Bačáková, Lucie; Šlouf, Miroslav; Štěpánek, Petr

    2016-01-01

    Roč. 152, 5 November (2016), s. 271-279 ISSN 0144-8617 R&D Projects: GA ČR(CZ) GA13-08336S; GA MZd(CZ) NV15-25781A; GA MZd(CZ) NV15-32497A; GA MŠk(CZ) LM2015064 Institutional support: RVO:61389013 ; RVO:67985823 ; RVO:61389005 Keywords : glycogen * fibers * irradiation crosslinking Subject RIV: FR - Pharmacology ; Medidal Chemistry; FJ - Surgery incl. Transplants (FGU-C); BG - Nuclear, Atomic and Molecular Physics, Colliders (UJF-V) Impact factor: 4.811, year: 2016

  5. Partly ordered synthesis and degradation of glycogen in cultured rat myotubes

    DEFF Research Database (Denmark)

    Elsner, Peter; Quistorff, Bjørn; Hansen, Gert H

    2001-01-01

    The following questions concerning glycogen synthesis and degradation were examined in cultured rat myotubes. 1) Is synthesis and degradation of the individual glycogen molecule a strictly ordered process, with the last glucosyl unit incorporated into the molecule being the first to be released...

  6. Glycogen Supercompensation in the Rat Brain After Acute Hypoglycemia is Independent of Glucose Levels During Recovery.

    Science.gov (United States)

    Duarte, João M N; Morgenthaler, Florence D; Gruetter, Rolf

    2017-06-01

    Patients with diabetes display a progressive decay in the physiological counter-regulatory response to hypoglycemia, resulting in hypoglycemia unawareness. The mechanism through which the brain adapts to hypoglycemia may involve brain glycogen. We tested the hypothesis that brain glycogen supercompensation following hypoglycemia depends on blood glucose levels during recovery. Conscious rats were submitted to hypoglycemia of 2 mmol/L for 90 min and allowed to recover at different glycemia, controlled by means of i.v. glucose infusion. Brain glycogen concentration was elevated above control levels after 24 h of recovery in the cortex, hippocampus and striatum. This glycogen supercompensation was independent of blood glucose levels in the post-hypoglycemia period. In the absence of a preceding hypoglycemia insult, brain glycogen concentrations were unaltered after 24 h under hyperglycemia. In the hypothalamus, which controls peripheral glucose homeostasis, glycogen levels were unaltered. Overall, we conclude that post-hypoglycemia glycogen supercompensation occurs in several brain areas and its magnitude is independent of plasma glucose levels. By supporting brain metabolism during recurrent hypoglycemia periods, glycogen may have a role in the development of hypoglycemia unawareness.

  7. Glycogen serves as an energy source that maintains astrocyte cell proliferation in the neonatal telencephalon.

    Science.gov (United States)

    Gotoh, Hitoshi; Nomura, Tadashi; Ono, Katsuhiko

    2017-06-01

    Large amounts of energy are required when cells undergo cell proliferation and differentiation for mammalian neuronal development. Early neonatal mice face transient starvation and use stored energy for survival or to support development. Glycogen is a branched polysaccharide that is formed by glucose, and serves as an astrocytic energy store for rapid energy requirements. Although it is present in radial glial cells and astrocytes, the role of glycogen during development remains unclear. In the present study, we demonstrated that glycogen accumulated in glutamate aspartate transporter (GLAST)+ astrocytes in the subventricular zone and rostral migratory stream. Glycogen levels markedly decreased after birth due to the increase of glycogen phosphorylase, an essential enzyme for glycogen metabolism. In primary cultures and in vivo, the inhibition of glycogen phosphorylase decreased the proliferation of astrocytic cells. The number of cells in the G1 phase increased in combination with the up-regulation of cyclin-dependent kinase inhibitors or down-regulation of the phosphorylation of retinoblastoma protein (pRB), a determinant for cell cycle progression. These results suggest that glycogen accumulates in astrocytes located in specific areas during the prenatal stage and is used as an energy source to maintain normal development in the early postnatal stage.

  8. Is Type-2 Diabetes a Glycogen Storage Disease of Pancreatic β-Cells?

    Science.gov (United States)

    Ashcroft, Frances M; Rohm, Maria; Clark, Anne; Brereton, Melissa F

    2018-01-01

    Elevated plasma glucose leads to pancreatic β-cell dysfunction and death in type 2 diabetes. Glycogen accumulation, due to impaired metabolism, contributes to this ‘glucotoxicity’ via dysregulated biochemical pathways promoting β-cell dysfunction. Here, we review emerging data, and re-examine published findings, on the role of glycogen in β-cells in normoglycaemia and in diabetes. PMID:28683284

  9. A Ketone Ester Drink Increases Postexercise Muscle Glycogen Synthesis in Humans.

    Science.gov (United States)

    Holdsworth, David A; Cox, Peter J; Kirk, Tom; Stradling, Huw; Impey, Samuel G; Clarke, Kieran

    2017-09-01

    Physical endurance can be limited by muscle glycogen stores, in that glycogen depletion markedly reduces external work. During carbohydrate restriction, the liver synthesizes the ketone bodies, D-β-hydroxybutyrate, and acetoacetate from fatty acids. In animals and in the presence of glucose, D-β-hydroxybutyrate promotes insulin secretion and increases glycogen synthesis. Here we determined whether a dietary ketone ester, combined with plentiful glucose, can increase postexercise glycogen synthesis in human skeletal muscle. After an interval-based glycogen depletion exercise protocol, 12 well-trained male athletes completed a randomized, three-arm, blinded crossover recovery study that consisted of consumption of either a taste-matched, zero-calorie control or a ketone monoester drink, followed by a 10-mM glucose clamp or saline infusion for 2 h. The three postexercise conditions were control drink then saline infusion, control drink then hyperglycemic clamp, or ketone ester drink then hyperglycemic clamp. Skeletal muscle glycogen content was determined in muscle biopsies of vastus lateralis taken before and after the 2-h clamps. The ketone ester drink increased blood D-β-hydroxybutyrate concentrations to a maximum of 5.3 versus 0.7 mM for the control drink (P glycogen was 50% higher (246 vs 164 mmol glycosyl units per kilogram dry weight, P glycogen synthesis.

  10. Muscle Glycogen Content Modifies SR Ca2 + Release Rate in Elite Endurance Athletes

    DEFF Research Database (Denmark)

    Gejl, Kasper Degn; Hvid, Lars G; Frandsen, Ulrik

    2014-01-01

    The aim of the present study was to investigate the influence of muscle glycogen content on sarcoplasmic reticulum (SR) function and peak power output (Wpeak) in elite endurance athletes.......The aim of the present study was to investigate the influence of muscle glycogen content on sarcoplasmic reticulum (SR) function and peak power output (Wpeak) in elite endurance athletes....

  11. Changing shapes of glycogen-autophagy nexus in neurons: perspective from a rare epilepsy.

    Science.gov (United States)

    Singh, Pankaj Kumar; Singh, Sweta

    2015-01-01

    In brain, glycogen metabolism is predominantly restricted to astrocytes but it also indirectly supports neuronal functions. Increased accumulation of glycogen in neurons is mysteriously pathogenic triggering neurodegeneration as seen in "Lafora disease" (LD) and in other transgenic animal models of neuronal glycogen accumulation. LD is a fatal neurodegenerative disorder with excessive glycogen inclusions in neurons. Autophagy, a pathway for bulk degradation of obsolete cellular constituents also degrades metabolites like lipid and glycogen. Recently, defects in this pathway emerged as a plausible reason for glycogen accumulation in neurons in LD, although some contradictions prevail. Albeit surprising, a reciprocal regulation of autophagy by glycogen in neurons has also just been proposed. Notably, increasing evidences of interaction between proteins of autophagy and glycogen metabolism from diverse model systems indicate a conserved, dynamic, and regulatory cross-talk between these two pathways. Concerning these findings, we herein provide certain models for the molecular basis of this cross-talk and discuss its potential implication in the pathophysiology of LD.

  12. Contribution of glycogen in supporting axon conduction in the peripheral and central nervous systems: the role of lactate

    OpenAIRE

    Angus M Brown; Angus M Brown; Tom W Chambers; Timothy P Daly; Adam eHockley

    2014-01-01

    The role of glycogen in the central nervous system is intimately linked with the glycolytic pathway. Glycogen is synthesized from glucose, the primary substrate for glycolysis, and degraded to glucose-6-phosphate. The metabolic cost of shunting glucose via glycogen exceeds that of simple phosphorylation of glucose to glucose-6-phosphate by hexokinase; thus, there must be a metabolic advantage in utilizing this shunt pathway. The dogmatic view of glycogen as a storage depot persists, based on ...

  13. Energy Metabolism of the Brain, Including the Cooperation between Astrocytes and Neurons, Especially in the Context of Glycogen Metabolism

    OpenAIRE

    Falkowska, Anna; Gutowska, Izabela; Goschorska, Marta; Nowacki, Przemys?aw; Chlubek, Dariusz; Baranowska-Bosiacka, Irena

    2015-01-01

    Glycogen metabolism has important implications for the functioning of the brain, especially the cooperation between astrocytes and neurons. According to various research data, in a glycogen deficiency (for example during hypoglycemia) glycogen supplies are used to generate lactate, which is then transported to neighboring neurons. Likewise, during periods of intense activity of the nervous system, when the energy demand exceeds supply, astrocyte glycogen is immediately converted to lactate, s...

  14. Direct observation of glycogen synthesis in human muscle with 13C NMR

    International Nuclear Information System (INIS)

    Jue, T.; Rothman, D.L.; Shulman, G.I.; Tavitian, B.A.; DeFronzo, R.A.; Shulman, R.G.

    1989-01-01

    On the basis of previous indirect measurements, skeletal muscle has been implicated as the major site of glucose uptake and it has been suggested that muscle glycogen formation is the dominant pathway. However, direct measurements of the rates of glycogen synthesis have not been possible by previous techniques. The authors have developed 13 C NMR methods to measure directly the rate of human muscle glycogen formation from infused, isotopically labeled [1- 13 C]glucose. They show that under conditions of imposed hyperglycemia and hyperinsulinemia, a majority of the infused glucose was converted to muscle glycogen in a normal man. This directly shows that muscle is the major site of glucose disposal under these conditions, and provides quantitation of the glucose flux to muscle glycogen

  15. Dual regulation of muscle glycogen synthase during exercise by activation and compartmentalization

    DEFF Research Database (Denmark)

    Prats, Clara; Helge, Jørn W; Nordby, Pernille

    2009-01-01

    Glycogen synthase (GS) is considered the rate-limiting enzyme in glycogenesis but still today there is a lack of understanding on its regulation. We have previously shown phosphorylation-dependent GS intracellular redistribution at the start of glycogen re-synthesis in rabbit skeletal muscle (Prats......, C., Cadefau, J. A., Cussó, R., Qvortrup, K., Nielsen, J. N., Wojtaszewki, J. F., Wojtaszewki, J. F., Hardie, D. G., Stewart, G., Hansen, B. F., and Ploug, T. (2005) J. Biol. Chem. 280, 23165-23172). In the present study we investigate the regulation of human muscle GS activity by glycogen, exercise......, and insulin. Using immunocytochemistry we investigate the existence and relevance of GS intracellular compartmentalization during exercise and during glycogen re-synthesis. The results show that GS intrinsic activity is strongly dependent on glycogen levels and that such regulation involves associated...

  16. Subcellular distribution of glycogen and decreased tetanic Ca2+ in fatigued single intact mouse muscle fibres

    DEFF Research Database (Denmark)

    Nielsen, Joachim; Cheng, Arthur J; Ørtenblad, Niels

    2014-01-01

    In skeletal muscle fibres, glycogen has been shown to be stored at different subcellular locations: (i) between the myofibrils (intermyofibrillar); (ii) within the myofibrils (intramyofibrillar); and (iii) subsarcolemmal. Of these, intramyofibrillar glycogen has been implied as a critical regulator...... of sarcoplasmic reticulum Ca(2+) release. The aim of the present study was to test directly how the decrease in cytoplasmic free Ca(2+) ([Ca(2+)]i) during repeated tetanic contractions relates to the subcellular glycogen distribution. Single fibres of mouse flexor digitorum brevis muscles were fatigued with 70 Hz...... in tetanic [Ca(2+)]i, and hence force, is accompanied by major reductions in inter- and intramyofibrillar glycogen. The stronger correlation between decreased tetanic [Ca(2+)]i and reduced intramyofibrillar glycogen implies that sarcoplasmic reticulum Ca(2+) release critically depends on energy supply from...

  17. Inherent lipid metabolic dysfunction in glycogen storage disease IIIa.

    Science.gov (United States)

    Li, Xin-Hua; Gong, Qi-Ming; Ling, Yun; Huang, Chong; Yu, De-Min; Gu, Lei-Lei; Liao, Xiang-Wei; Zhang, Dong-Hua; Hu, Xi-Qi; Han, Yue; Kong, Xiao-Fei; Zhang, Xin-Xin

    2014-12-05

    We studied two patients from a nonconsanguineous family with life-long abnormal liver function, hepatomegaly and abnormal fatty acid profiles. Abnormal liver function, hypoglycemia and muscle weakness are observed in various genetic diseases, including medium-chain acyl-CoA dehydrogenase (MCAD) deficiency and glycogen storage diseases. The proband showed increased free fatty acids, mainly C8 and C10, resembling fatty acid oxidation disorder. However, no mutation was found in ACADM and ACADL gene. Sequencing of theamylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase (AGL) gene showed that both patients were compound heterozygotes for c.118C > T (p.Gln40X) and c.753_756 del CAGA (p.Asp251Glufsx29), whereas their parents were each heterozygous for one of these mutations. The AGL protein was undetectable in EBV-B cells from the two patients. Transcriptome analysis demonstrated a significant different pattern of gene expression in both of patients’ cells, including genes involving in the PPAR signaling pathway, fatty acid biosynthesis, lipid synthesis and visceral fat deposition and metabolic syndrome. This unique gene expression pattern is probably due to the absence of AGL, which potentially accounts for the observed clinical phenotypes of hyperlipidemia and hepatocyte steatosis in glycogen storage disease type IIIa.

  18. Interleukin 6 stimulates hepatic glucose release from prelabeled glycogen pools

    International Nuclear Information System (INIS)

    Ritchie, D.G.

    1990-01-01

    Cytokines, derived from a wide variety of cell types, are now believed to initiate many of the physiological responses accompanying the inflammatory phase that follows either Gram-negative septicemia or thermal injury. Because hypoglycemia (after endotoxic challenge) and hyperglycemia (after thermal injury) represent well-characterized responses to these injuries, we sought to determine whether hepatic glycogen metabolism could be altered by specific cytokines. Cultured adult rat hepatocytes were prelabeled with [ 14 C]glucose for 24 h, a procedure that resulted in the labeling of hepatic glycogen pools that subsequently could be depleted (with concomitant [ 14 C]glucose release) by either glucagon or norepinephrine. After the addition of a highly concentrated human monocyte-conditioned medium (MCM) or various cytokines to these prelabeled cells, [ 14 C]glucose release was stimulated by MCM and recombinant human interleukin 6 (IL-6) but was not stimulated by other cytokines tested. Furthermore, only antisera to IL-6 were capable of reducing the glucose-releasing factor activity found in MCM. These data therefore suggest a novel glucoregulatory role for IL-6

  19. Enhanced Glycogen Storage of a Subcellular Hot Spot in Human Skeletal Muscle during Early Recovery from Eccentric Contractions

    DEFF Research Database (Denmark)

    Nielsen, Joachim; Farup, Jean; Rahbek, Stine Klejs

    2015-01-01

    Unaccustomed eccentric exercise is accompanied by muscle damage and impaired glucose uptake and glycogen synthesis during subsequent recovery. Recently, it was shown that the role and regulation of glycogen in skeletal muscle are dependent on its subcellular localization, and that glycogen synthe...

  20. The nutritional status of Methanosarcina acetivorans regulates glycogen metabolism and gluconeogenesis and glycolysis fluxes.

    Science.gov (United States)

    Santiago-Martínez, Michel Geovanni; Encalada, Rusely; Lira-Silva, Elizabeth; Pineda, Erika; Gallardo-Pérez, Juan Carlos; Reyes-García, Marco Antonio; Saavedra, Emma; Moreno-Sánchez, Rafael; Marín-Hernández, Alvaro; Jasso-Chávez, Ricardo

    2016-05-01

    Gluconeogenesis is an essential pathway in methanogens because they are unable to use exogenous hexoses as carbon source for cell growth. With the aim of understanding the regulatory mechanisms of central carbon metabolism in Methanosarcina acetivorans, the present study investigated gene expression, the activities and metabolic regulation of key enzymes, metabolite contents and fluxes of gluconeogenesis, as well as glycolysis and glycogen synthesis/degradation pathways. Cells were grown with methanol as a carbon source. Key enzymes were kinetically characterized at physiological pH/temperature. Active consumption of methanol during exponential cell growth correlated with significant methanogenesis, gluconeogenic flux and steady glycogen synthesis. After methanol exhaustion, cells reached the stationary growth phase, which correlated with the rise in glycogen consumption and glycolytic flux, decreased methanogenesis, negligible acetate production and an absence of gluconeogenesis. Elevated activities of carbon monoxide dehydrogenase/acetyl-CoA synthetase complex and pyruvate: ferredoxin oxidoreductase suggested the generation of acetyl-CoA and pyruvate for glycogen synthesis. In the early stationary growth phase, the transcript contents and activities of pyruvate phosphate dikinase, fructose 1,6-bisphosphatase and glycogen synthase decreased, whereas those of glycogen phosphorylase, ADP-phosphofructokinase and pyruvate kinase increased. Therefore, glycogen and gluconeogenic metabolites were synthesized when an external carbon source was provided. Once such a carbon source became depleted, glycolysis and methanogenesis fed by glycogen degradation provided the ATP supply. Weak inhibition of key enzymes by metabolites suggested that the pathways evaluated were mainly transcriptionally regulated. Because glycogen metabolism and glycolysis/gluconeogenesis are not present in all methanogens, the overall data suggest that glycogen storage might represent an environmental

  1. Astrocytic glycogen-derived lactate fuels the brain during exhaustive exercise to maintain endurance capacity.

    Science.gov (United States)

    Matsui, Takashi; Omuro, Hideki; Liu, Yu-Fan; Soya, Mariko; Shima, Takeru; McEwen, Bruce S; Soya, Hideaki

    2017-06-13

    Brain glycogen stored in astrocytes provides lactate as an energy source to neurons through monocarboxylate transporters (MCTs) to maintain neuronal functions such as hippocampus-regulated memory formation. Although prolonged exhaustive exercise decreases brain glycogen, the role of this decrease and lactate transport in the exercising brain remains less clear. Because muscle glycogen fuels exercising muscles, we hypothesized that astrocytic glycogen plays an energetic role in the prolonged-exercising brain to maintain endurance capacity through lactate transport. To test this hypothesis, we used a rat model of exhaustive exercise and capillary electrophoresis-mass spectrometry-based metabolomics to observe comprehensive energetics of the brain (cortex and hippocampus) and muscle (plantaris). At exhaustion, muscle glycogen was depleted but brain glycogen was only decreased. The levels of MCT2, which takes up lactate in neurons, increased in the brain, as did muscle MCTs. Metabolomics revealed that brain, but not muscle, ATP was maintained with lactate and other glycogenolytic/glycolytic sources. Intracerebroventricular injection of the glycogen phosphorylase inhibitor 1,4-dideoxy-1,4-imino-d-arabinitol did not affect peripheral glycemic conditions but suppressed brain lactate production and decreased hippocampal ATP levels at exhaustion. An MCT2 inhibitor, α-cyano-4-hydroxy-cinnamate, triggered a similar response that resulted in lower endurance capacity. These findings provide direct evidence for the energetic role of astrocytic glycogen-derived lactate in the exhaustive-exercising brain, implicating the significance of brain glycogen level in endurance capacity. Glycogen-maintained ATP in the brain is a possible defense mechanism for neurons in the exhausted brain.

  2. Skeletal muscle metabolism is impaired during exercise in glycogen storage disease type III

    DEFF Research Database (Denmark)

    Preisler, Nicolai; Laforêt, Pascal; Madsen, Karen Lindhardt

    2015-01-01

    /kg/min (p = 0.024). Fructose ingestion improved exercise tolerance in the patients. CONCLUSION: Similar to patients with McArdle disease, in whom muscle glycogenolysis is also impaired, GSDIIIa is associated with a reduced skeletal muscle oxidation of carbohydrates and a compensatory increase in fatty acid......OBJECTIVE: Glycogen storage disease type IIIa (GSDIIIa) is classically regarded as a glycogenosis with fixed weakness, but we hypothesized that exercise intolerance in GSDIIIa is related to muscle energy failure and that oral fructose ingestion could improve exercise tolerance in this metabolic...... myopathy. METHODS: We challenged metabolism with cycle-ergometer exercise and measured substrate turnover and oxidation rates using stable isotope methodology and indirect calorimetry in 3 patients and 6 age-matched controls on 1 day, and examined the effect of fructose ingestion on exercise tolerance...

  3. Hepatic Glucose Production Increases in Response to Metformin Treatment in the Glycogen-depleted State

    DEFF Research Database (Denmark)

    Christensen, Mette Marie Hougaard; Højlund, Kurt; Hother-Nielsen, Ole

    with two reduced-function alleles) were fasted for 42 h twice. In one of the periods, before the fasting, the volunteers were titrated to steady-state with 1 g metformin twice daily for seven days. Parameters of whole-body glucose metabolism were assessed using [3-3^H] glucose, indirect calorimetry......Metformin is believed to reduce glucose levels primarily by inhibiting hepatic glucose production, but at the same time do not cause hypoglycemia. Recent data indicate that metformin antagonizes the major glucose counterregulatory hormone, glucagon suggesting that other mechanisms protect against...... hypoglycemia. Here, we examined the effect of metformin on whole-body glucose metabolism after a glycogen-depleting 40 h fast and the role of reduced-function alleles in OCT1. In a randomized cross-over trial, 34 healthy volunteers with known OCT1 genotypes (12 with two wild-type alleles, 13 with one and 9...

  4. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  5. Rerouting of carbon flux in a glycogen mutant of cyanobacteria assessed via isotopically non-stationary 13 C metabolic flux analysis.

    Science.gov (United States)

    Hendry, John I; Prasannan, Charulata; Ma, Fangfang; Möllers, K Benedikt; Jaiswal, Damini; Digmurti, Madhuri; Allen, Doug K; Frigaard, Niels-Ulrik; Dasgupta, Santanu; Wangikar, Pramod P

    2017-10-01

    Cyanobacteria, which constitute a quantitatively dominant phylum, have attracted attention in biofuel applications due to favorable physiological characteristics, high photosynthetic efficiency and amenability to genetic manipulations. However, quantitative aspects of cyanobacterial metabolism have received limited attention. In the present study, we have performed isotopically non-stationary 13 C metabolic flux analysis (INST- 13 C-MFA) to analyze rerouting of carbon in a glycogen synthase deficient mutant strain (glgA-I glgA-II) of the model cyanobacterium Synechococcus sp. PCC 7002. During balanced photoautotrophic growth, 10-20% of the fixed carbon is stored in the form of glycogen via a pathway that is conserved across the cyanobacterial phylum. Our results show that deletion of glycogen synthase gene orchestrates cascading effects on carbon distribution in various parts of the metabolic network. Carbon that was originally destined to be incorporated into glycogen gets partially diverted toward alternate storage molecules such as glucosylglycerol and sucrose. The rest is partitioned within the metabolic network, primarily via glycolysis and tricarboxylic acid cycle. A lowered flux toward carbohydrate synthesis and an altered distribution at the glucose-1-phosphate node indicate flexibility in the network. Further, reversibility of glycogen biosynthesis reactions points toward the presence of futile cycles. Similar redistribution of carbon was also predicted by Flux Balance Analysis. The results are significant to metabolic engineering efforts with cyanobacteria where fixed carbon needs to be re-routed to products of interest. Biotechnol. Bioeng. 2017;114: 2298-2308. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  6. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  7. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  8. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  9. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Science.gov (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  10. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  11. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Science.gov (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  12. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Science.gov (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  13. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Science.gov (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  14. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

    OpenAIRE

    Ahn, Sang-Joon; Burne, Robert A.

    2006-01-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  15. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  16. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  17. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  18. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    International Nuclear Information System (INIS)

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

    2010-01-01

    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  19. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    Science.gov (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  20. Insulin induces a positive relationship between the rates of ATP and glycogen changes in isolated rat liver in presence of glucose; a 31P and 13C NMR study

    Directory of Open Access Journals (Sweden)

    Gin Henri

    2005-11-01

    Full Text Available Abstract Background There is an emerging theory suggesting that insulin, which is known to be the predominant postprandial anabolic hormone, is also a major regulator of mitochondrial oxidative phosphorylation in human skeletal muscle. However, little is known about its effects in the liver. Since there is a theoretical relationship between glycogen metabolism and energy status, a simultaneous and continuous investigation of hepatic ATP and glycogen content was performed in intact and isolated perfused liver by 31P and 13C nuclear magnetic resonance (NMR The hepatic rates of ATP and glycogen changes were evaluated with different con