Role of GntR Family Regulatory Gene SCO1678 in Gluconate Metabolism in Streptomyces coelicolor M145
Directory of Open Access Journals (Sweden)
Olga Tsypik
2017-01-01
Full Text Available Here we report functional characterization of the Streptomyces coelicolor M145 gene SCO1678, which encodes a GntR-like regulator of the FadR subfamily. Bioinformatic analysis suggested that SCO1678 is part of putative operon (gnt involved in gluconate metabolism. Combining the results of SCO1678 knockout, transcriptional analysis of gnt operon, and Sco1678 protein-DNA electromobility shift assays, we established that Sco1678 protein controls the gluconate operon. It does so via repression of its transcription from a single promoter located between genes SCO1678 and SCO1679. The knockout also influenced, in a medium-dependent manner, the production of secondary metabolites by S. coelicolor. In comparison to the wild type, on gluconate-containing minimal medium, the SCO1678 mutant produced much less actinorhodin and accumulated a yellow-colored pigment, likely to be the cryptic polyketide coelimycin. Possible links between gluconate metabolism and antibiotic production are discussed.
The gntP Gene of Escherichia coli Involved in Gluconate Uptake
DEFF Research Database (Denmark)
Klemm, Per; Tong, S.; Nielsen, Henrik
1996-01-01
The gntP gene, located between the fim and uxu loci in Escherichia coli K-12, has been cloned and characterized. Nucleotide sequencing of a region encompassing the gntP gene revealed an open reading frame of 447 codons with significant homology to the Bacillus subtilis gluconate permease. Northern...
Directory of Open Access Journals (Sweden)
Gerasimos F Kremmydas
Full Text Available Pseudomonas fluorescens strain X, a bacterial isolate from the rhizosphere of bean seedlings, has the ability to suppress damping-off caused by the oomycete Pythium ultimum. To determine the genes controlling the biocontrol activity of strain X, transposon mutagenesis, sequencing and complementation was performed. Results indicate that, biocontrol ability of this isolate is attributed to gcd gene encoding glucose dehydrogenase, genes encoding its co-enzyme pyrroloquinoline quinone (PQQ, and two genes (sup5 and sup6 which seem to be organized in a putative operon. This operon (named supX consists of five genes, one of which encodes a non-ribosomal peptide synthase. A unique binding site for a GntR-type transcriptional factor is localized upstream of the supX putative operon. Synteny comparison of the genes in supX revealed that they are common in the genus Pseudomonas, but with a low degree of similarity. supX shows high similarity only to the mangotoxin operon of Ps. syringae pv. syringae UMAF0158. Quantitative real-time PCR analysis indicated that transcription of supX is strongly reduced in the gcd and PQQ-minus mutants of Ps. fluorescens strain X. On the contrary, transcription of supX in the wild type is enhanced by glucose and transcription levels that appear to be higher during the stationary phase. Gcd, which uses PQQ as a cofactor, catalyses the oxidation of glucose to gluconic acid, which controls the activity of the GntR family of transcriptional factors. The genes in the supX putative operon have not been implicated before in the biocontrol of plant pathogens by pseudomonads. They are involved in the biosynthesis of an antimicrobial compound by Ps. fluorescens strain X and their transcription is controlled by glucose, possibly through the activity of a GntR-type transcriptional factor binding upstream of this putative operon.
N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-09-01
Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.
Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.
2014-01-01
Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527
Directory of Open Access Journals (Sweden)
Loida López-Fernández
Full Text Available With the aim to decipher the molecular dialogue and cross talk between Fusarium oxysporum f.sp. lycopersci and its host during infection and to understand the molecular bases that govern fungal pathogenicity, we analysed genes presumably encoding N-acetylglucosaminyl transferases, involved in glycosylation of glycoproteins, glycolipids, proteoglycans or small molecule acceptors in other microorganisms. In silico analysis revealed the existence of seven putative N-glycosyl transferase encoding genes (named gnt in F. oxysporum f.sp. lycopersici genome. gnt2 deletion mutants showed a dramatic reduction in virulence on both plant and animal hosts. Δgnt2 mutants had αalterations in cell wall properties related to terminal αor β-linked N-acetyl glucosamine. Mutant conidia and germlings also showed differences in structure and physicochemical surface properties. Conidial and hyphal aggregation differed between the mutant and wild type strains, in a pH independent manner. Transmission electron micrographs of germlings showed strong cell-to-cell adherence and the presence of an extracellular chemical matrix. Δgnt2 cell walls presented a significant reduction in N-linked oligosaccharides, suggesting the involvement of Gnt2 in N-glycosylation of cell wall proteins. Gnt2 was localized in Golgi-like sub-cellular compartments as determined by fluorescence microscopy of GFP::Gnt2 fusion protein after treatment with the antibiotic brefeldin A or by staining with fluorescent sphingolipid BODIPY-TR ceramide. Furthermore, density gradient ultracentrifugation allowed co-localization of GFP::Gnt2 fusion protein and Vps10p in subcellular fractions enriched in Golgi specific enzymatic activities. Our results suggest that N-acetylglucosaminyl transferases are key components for cell wall structure and influence interactions of F. oxysporum with both plant and animal hosts during pathogenicity.
López-Fernández, Loida; Ruiz-Roldán, Carmen; Pareja-Jaime, Yolanda; Prieto, Alicia; Khraiwesh, Husam; Roncero, M. Isabel G.
2013-01-01
With the aim to decipher the molecular dialogue and cross talk between Fusarium oxysporum f.sp. lycopersci and its host during infection and to understand the molecular bases that govern fungal pathogenicity, we analysed genes presumably encoding N-acetylglucosaminyl transferases, involved in glycosylation of glycoproteins, glycolipids, proteoglycans or small molecule acceptors in other microorganisms. In silico analysis revealed the existence of seven putative N-glycosyl transferase encoding genes (named gnt) in F. oxysporum f.sp. lycopersici genome. gnt2 deletion mutants showed a dramatic reduction in virulence on both plant and animal hosts. Δgnt2 mutants had αalterations in cell wall properties related to terminal αor β-linked N-acetyl glucosamine. Mutant conidia and germlings also showed differences in structure and physicochemical surface properties. Conidial and hyphal aggregation differed between the mutant and wild type strains, in a pH independent manner. Transmission electron micrographs of germlings showed strong cell-to-cell adherence and the presence of an extracellular chemical matrix. Δgnt2 cell walls presented a significant reduction in N-linked oligosaccharides, suggesting the involvement of Gnt2 in N-glycosylation of cell wall proteins. Gnt2 was localized in Golgi-like sub-cellular compartments as determined by fluorescence microscopy of GFP::Gnt2 fusion protein after treatment with the antibiotic brefeldin A or by staining with fluorescent sphingolipid BODIPY-TR ceramide. Furthermore, density gradient ultracentrifugation allowed co-localization of GFP::Gnt2 fusion protein and Vps10p in subcellular fractions enriched in Golgi specific enzymatic activities. Our results suggest that N-acetylglucosaminyl transferases are key components for cell wall structure and influence interactions of F. oxysporum with both plant and animal hosts during pathogenicity. PMID:24416097
Niu, Chunhao; Song, Libing; Zhang, Yanna
2015-01-01
Background The β1,3-N-acetylglucosaminyltransferase-3 gene (B3GNT3) encodes a member of the B3GNT family that functions as the backbone structure of dimeric sialyl-Lewis A and is involved in L-selectin ligand biosynthesis, lymphocyte homing and lymphocyte trafficking. B3GNT3 has been implicated as an important element in the development of certain cancers. However, the characteristics of B3GNT3 in the development and progression of cancer remain largely unknown. Thus, our study aimed to investigate the expression pattern and the prognostic value of B3GNT3 in patients with early-stage cervical cancer. Methods The mRNA and protein levels of B3GNT3 expression were examined in eight cervical cancer cell lines and ten paired cervical cancer tumors, using real-time PCR and western blotting, respectively. Immunohistochemistry (IHC) was used to analyze B3GNT3 protein expression in paraffin-embedded tissues from 196 early-stage cervical cancer patients. Statistical analyses were applied to evaluate the association between B3GNT3 expression scores and clinical parameters, as well as patient survival. Results B3GNT3 expression was significantly upregulated in cervical cancer cell lines and lesions compared with normal cells and adjacent noncancerous cervical tissues. In the 196 cases of tested early-stage cervical cancer samples, the B3GNT3 protein level was positively correlated with high risk TYPES of human papillomavirus (HPV) infection (P = 0.026), FIGO stage (P cervical cancer patients. Conclusions Our study demonstrated that elevated B3GNT3 expression is associated with pelvic lymph node metastasis and poor outcome in early-stage cervical cancer patients. B3GNT3 may be a novel prognostic marker and therapeutic target for the treatment of cervical cancer. PMID:26709519
Directory of Open Access Journals (Sweden)
Ranjan Akash
2007-08-01
Full Text Available Abstract Background Mycobacterium smegmatis is fast growing non-pathogenic mycobacteria. This organism has been widely used as a model organism to study the biology of other virulent and extremely slow growing species like Mycobacterium tuberculosis. Based on the homology of the N-terminal DNA binding domain, the recently sequenced genome of M. smegmatis has been shown to possess several putative GntR regulators. A striking characteristic feature of this family of regulators is that they possess a conserved N-terminal DNA binding domain and a diverse C-terminal domain involved in the effector binding and/or oligomerization. Since the physiological role of these regulators is critically dependent upon effector binding and operator sites, we have analysed and classified these regulators into their specific subfamilies and identified their potential binding sites. Results The sequence analysis of M. smegmatis putative GntRs has revealed that FadR, HutC, MocR and the YtrA-like regulators are encoded by 45, 8, 8 and 1 genes respectively. Further out of 45 FadR-like regulators, 19 were classified into the FadR group and 26 into the VanR group. All these proteins showed similar secondary structural elements specific to their respective subfamilies except MSMEG_3959, which showed additional secondary structural elements. Using the reciprocal BLAST searches, we further identified the orthologs of these regulators in Bacillus subtilis and other mycobacteria. Since the expression of many regulators is auto-regulatory, we have identified potential operator sites for a number of these GntR regulators by analyzing the upstream sequences. Conclusion This study helps in extending the annotation of M. smegmatis GntR proteins. It identifies the GntR regulators of M. smegmatis that could serve as a model for studying orthologous regulators from virulent as well as other saprophytic mycobacteria. This study also sheds some light on the nucleotide preferences in the
Sodium Ferric Gluconate Injection
Sodium ferric gluconate injection is used to treat iron-deficiency anemia (a lower than normal number of ... are also receiving the medication epoetin (Epogen, Procrit). Sodium ferric gluconate injection is in a class of ...
Li, Zhiqiang; Wang, Shuli; Zhang, Hui; Zhang, Jinliang; Xi, Li; Zhang, Junbo; Chen, Chuangfu
2017-03-01
The pathogenic mechanisms of Brucella are still poorly understood. GntR is a transcriptional regulator and plays an important role in the intracellular survival of Brucella. To investigate whether GntR is involved in the cytotoxicity of Brucella abortus (B. abortus), we created a 2308ΔgntR mutant of B. abortus 2308 (S2308). Lactate dehydrogenase (LDH) cytotoxicity assays using a murine macrophage cell line (RAW 264.7) show that high-dose infection with the parental strain produces a high level of cytotoxicity to macrophages, but the 2308ΔgntR mutant exhibits a very low level of cytotoxicity, indicating that mutation of GntR impairs the cytotoxicity of B. abortus to macrophages. After the macrophages are infected with 2308ΔgntR, the levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-8 (IL-8) increase and are slightly higher than that for the S2308 infected group, indicating that the 2308ΔgntR mutant could induce the secretion of inflammatory cytokines. The virulence factor detection experiments indicate that genes involved in the type IV secretion system (T4SS) and quorum sensing system (QSS) are down-regulated in 2308ΔgntR. The lower levels of survival of 2308ΔgntR under various stress conditions and the increased sensitivity of 2308ΔgntR to polymyxin B suggest that GntR is a virulence factor and that deletion of gntR reduces of B. abortus to stress conditions. Taken together, our results demonstrate that GntR is involved in the cytotoxicity, virulence and intracellular survival of B. abortus during its infection.
Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin
2016-03-18
In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.
Gluconic Acid: Properties, Applications and Microbial Production
Directory of Open Access Journals (Sweden)
Sumitra Ramachandran
2006-01-01
Full Text Available Gluconic acid is a mild organic acid derived from glucose by a simple oxidation reaction. The reaction is facilitated by the enzyme glucose oxidase (fungi and glucose dehydrogenase (bacteria such as Gluconobacter. Microbial production of gluconic acid is the preferred method and it dates back to several decades. The most studied and widely used fermentation process involves the fungus Aspergillus niger. Gluconic acid and its derivatives, the principal being sodium gluconate, have wide applications in food and pharmaceutical industry. This article gives a review of microbial gluconic acid production, its properties and applications.
Inert Reassessment Document for Gluconic Acid and Sodium Salt
Gluconic acid and D-gluconic acid are classified as List 3 inert ingredients, sodium gluconate is classified as a List 4B inert ingredient, and D-gluconic acid, sodium salt has not been categorized as to inert ingredient list classification status.
Magnesium gluconate is used to treat low blood magnesium. Low blood magnesium is caused by gastrointestinal disorders, prolonged vomiting or ... disease, or certain other conditions. Certain drugs lower magnesium levels as well.This medication is sometimes prescribed ...
Energy Technology Data Exchange (ETDEWEB)
Esterbauer, H; Schubert, J; Sanders, E B; Sweeley, C C [Pittsburgh Univ., Pa. (USA); Michigan State Univ., East Lansing (USA). Dept. of Biochemistry)
1977-03-01
The yields of 2-deoxy-D-gluconic, D-gluconic and other sugar acids from /sup 60/Co-gamma irradiated (dose-rate = 4 Krads/min) D-glucose solutions are reported. The acids produced upon radiolysis were separated from glucose and neutral products by anion exchange, assayed by gas chromatography of the trimethylsilyl derivatives, and definitive identification made by mass spectrometry. In He degassed, irradiated 0.055 M glucose G(2-deoxy-D-gluconic acid) = 0.62 and G(D-gluconic acid) = 0.20. The approximate G values for the other identified acids are: glyceric acid 0.03, 2-deoxy-tetronic acid 0.04, tetronic acid 0.03, 4-deoxypentonic acid 0.02, deoxyketogluconic acid 0.17. In N/sub 2/O saturated glucose solutions D-gluconic acid yields increased by a factor of approximately 1.9 while that of 2-deoxy-D-gluconic acid increased by a factor of only approximately 1.1.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2005-11-18
Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2007-03-15
Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.
International Nuclear Information System (INIS)
Kubota, Keiko; Miyazono, Ken-ichi; Nagata, Koji; Toyama, Hirohide; Matsushita, Kazunobu; Tanokura, Masaru
2010-01-01
NADPH-dependent 5-keto-d-gluconate reductase from G. suboxydans IFO12528 (5KGR) was expressed, purified and crystallized with 5-keto-d-gluconate and NADPH using the sitting-drop vapour-diffusion method. Crystals of the 5KGR–NADPH complex and of the 5KGR–NADPH–5-keto-d-gluconate complex diffracted X-rays to 1.75 and 2.26 Å resolution, respectively. NADPH-dependent 5-keto-d-gluconate reductase from Gluconobacter suboxydans IFO12528 (5KGR) catalyzes oxidoreduction between 5-keto-d-gluconate and d-gluconate with high specificity. 5KGR was expressed in Escherichia coli, purified and crystallized with 5-keto-d-gluconate and NADPH using the sitting-drop vapour-diffusion method at 288 K. A crystal of the 5KGR–NADPH complex was obtained using reservoir solution containing PEG 4000 as a precipitant and diffracted X-rays to 1.75 Å resolution. The crystal of the complex belonged to space group P4 2 2 1 2, with unit-cell parameters a = b = 128.6, c = 62.9 Å. A crystal of the 5KGR–NADPH–5-keto-d-gluconate complex was prepared by soaking the 5KGR–NADPH complex crystal in reservoir solution supplemented with 100 mM 5-keto-d-gluconate and 10 mM NADPH for 20 min and diffracted X-rays to 2.26 Å resolution. The crystal of the ternary complex belonged to space group P4 2 2 1 2, with unit-cell parameters a = b = 128.7, c = 62.5 Å. Both crystals contained two molecules in the asymmetric unit
Inhibitive Action of Ferrous Gluconate on Aluminum Alloy in Saline Environment
Directory of Open Access Journals (Sweden)
Patricia Abimbola Idowu Popoola
2013-01-01
Full Text Available The corrosion of aluminum in saline environment in the presence of ferrous gluconate was studied using weight loss and linear polarization methods. The corrosion rates were studied in different concentrations of ferrous gluconate 0.5, 1.0, 1.5, and 2.0 g/mL at 28°C. Experimental results revealed that ferrous gluconate in saline environment reduced the corrosion rate of aluminum alloy at the different concentrations studied. The minimum inhibition efficiency was obtained at 1.5 g/mL concentration of inhibitor while the optimum inhibition efficiency was achieved with 1.0 g/mL inhibitor concentration. The results showed that adsorption of ferrous gluconate on the aluminium alloy surface fits Langmuir adsorption isotherm. The potentiodynamic polarization results showed that ferrous gluconate is a mixed type inhibitor. Ferrous gluconate acted as an effective inhibitor for aluminium alloy within the temperature and concentration range studied. The data obtained from weight loss and potentiodynamic polarization methods were in good agreement.
Gluconate heart scan in angina pectoris patients
International Nuclear Information System (INIS)
Duska, F.; Novak, J.; Kvasnicka, J.; Vizda, J.; Kubicek, J.; Kafka, P.; Palicka, V.; Hlava, A.
1985-01-01
Scintigraphic examination using 99m Tc-gluconate was carried out of the condition of the myocardium in 6 patients with a clinical diagnosis of angina pectoris of diverse severity. In all six cases the scan was negative. The results confirmed the previous experimental findings. 99m Tc-gluconate is thereby not suitable for the scintigraphic diagnosis of angina pectoris. (author) 13 refs., 1 tab., 1 fig
Detecting uber-operons in prokaryotic genomes.
Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying
2006-01-01
We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.
New Pathway for Nonphosphorylated Degradation of Gluconate by Aspergillus niger
Elzainy, T. A.; Hassan, M. M.; Allam, A. M.
1973-01-01
A new nonphosphorylative pathway for gluconate degradation was found in extracts of a strain of Aspergillus niger. The findings indicate that gluconate is dehydrated into 2-keto-3-deoxy-gluconate (KDG), which then is cleaved into glyceraldehyde and pyruvate. 6-Phosphogluconate was not degraded under the same conditions. In addition, KDG was formed from glyceraldehyde and pyruvate. Very weak activity was obtained when glyceraldehyde 3-phosphate replaced glyceraldehyde in this reaction. PMID:4698214
Evidence against the selfish operon theory.
Pál, Csaba; Hurst, Laurence D
2004-06-01
According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.
Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.
Joshi, V D; Sreekantiah, K R; Manjrekar, S P
1996-01-01
A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.
REMap: Operon Map of M. tuberculosis
Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu
2016-01-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008
ProOpDB: Prokaryotic Operon DataBase.
Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique
2012-01-01
The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.
Efficacy of chlorhexidine gluconate ointment (Oronine H® for experimentally-induced comedones
Directory of Open Access Journals (Sweden)
Yamakoshi T
2012-07-01
Full Text Available Takako Yamakoshi,1 Teruhiko Makino,1 Kenji Matsunaga,1 Yoko Yoshihisa,1 Mati Ur Rehman,1 Taisuke Seki,2 Yoshito Hayashi,3 Tadamichi Shimizu11Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama-shi, Toyama; 2Seki Dermatological Clinic, Toyama-shi, Toyama; 3Otsuka Pharmaceutical Factory Inc, Naruto-shi, Tokushima, JapanBackground: Oronine H® ointment, which contains chlorhexidine gluconate as its active component, is a well known disinfectant, and has been widely used for treatment of acne in Japan. In this study, we investigated the inhibitory effect of this ointment on the formation of comedones induced by application of 50% oleic acid on the orifices of the external auditory canals of rabbits.Methods: The application sites were observed with a dermatoscope, and the area of the hair pores was measured using an Image analysis software program.Results: The chlorhexidine gluconate ointment inhibited comedone formation significantly more effectively than the liquid paraffin used as a control (P < 0.001. We also investigated the therapeutic effect of this ointment on comedones. After starting application of chlorhexidine gluconate ointment or liquid paraffin on the comedone area, the hair pore size was gradually decreased in the group treated with chlorhexidine gluconate ointment compared with the hair pore size at baseline.Conclusion: These results suggest that chlorhexidine gluconate ointment is effective for inhibiting comedone formation as well as for treating already formed comedones. Chlorhexidine gluconate ointment is a useful topical medicine for the treatment of early-stage acne and for preventing acne.Keywords: chlorhexidine gluconate ointment, comedones, dermatoscope, oleic acid
The relative value of operon predictions
Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.
For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,
Yadiki, Josna Vinutha; Jampanapalli, Sharada Reddy; Konda, Suhasini; Inguva, Hema Chandrika; Chimata, Vamsi Krishna
2016-01-01
Chlorhexidine gluconate is a widely used antimicrobial agent. Adding chlorhexidine and quaternary ammonium compounds to filling materials, such as composite resins, acrylic resins, and glass ionomer cements increases the antibacterial property of restorative materials. This study includes antibacterial property of glass ionomer restorative cements with chlorhexidine gluconate. The primary objective of our study was to compare the antimicrobial properties of two commercially available glass ionomer cements with and without chlorhexidine gluconate on strains of mutans streptococci. Two glass ionomers (Fuji II Conventional and Fuji IX) were used. Chlorhexidine gluconate was mixed with glass ionomer cements, and antimicrobial properties against mutans streptococci were assessed by agar diffusion. The tested bacterial strain was inhibited and the antimicrobial properties decreased with time. The highest amount of antimicrobial activity with mean inhibitory zone was found in Fuji II with chlorhexidine gluconate followed by Fuji IX with chlorhexidine gluconate, Fuji II without chlorhexidine gluconate, and Fuji IX without chlorhexidine gluconate. The results of the study confirmed that the addition of 5% chlorhexidine gluconate to Fuji II and Fuji IX glass ionomer cements resulted in a restorative material that had increased antimicrobial properties over the conventional glass ionomer cements alone for Streptococcus mutans. How to cite this article: Yadiki JV, Jampanapalli SR , Konda S, Inguva HC, Chimata VK. Comparative Evaluation of the Antimicrobial Properties of Glass Ionomer Cements with and without Chlorhexidine Gluconate. Int J Clin Pediatr Dent 2016;9(2):99-103.
Transcriptome dynamics-based operon prediction in prokaryotes.
Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario
2014-05-16
Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.
International Nuclear Information System (INIS)
Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.
1993-01-01
Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid
Problem-Solving Test: Tryptophan Operon Mutants
Szeberenyi, Jozsef
2010-01-01
This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…
Narang, Atul; Oehler, Stefan
2017-05-01
The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Wang, Zhihao; Liu, Jianming; Chen, Lin
2018-01-01
confirmed that the two mutations lead to alteration rather than elimination of function, and their introduction in the wild-type background resulted in a specific growth rate of 0.62h-1. The glycolytic and pentose phosphate pathway fluxes had both increased significantly, and a transcriptomic analyses......% improvement is the highest reported for C. glutamicum to date. By genome resequencing and inverse metabolic engineering, we were able to pinpoint two mutations contributing to most of the growth improvement, and these resided in the transcriptional regulators GntR1 (gntR1-E70K) and RamA (ramA-A52V). We...... was already fast. We also found that the mutations could improve the performance of resting cells, under oxygen-deprived conditions, where an increase in sugar consumption rate of around 30% could be achieved. In conclusion, we have demonstrated that it is feasible to reprogram C. glutamicum into growing...
Production of gluconic acid by using some irradiated microorganisms
Directory of Open Access Journals (Sweden)
Ashraf S. Ahmed
2015-07-01
Full Text Available The objective of this study was to isolate the potential fungal isolates have the ability for gluconic acid production by using some agro industrial byproducts as sugarcane molasses, banana-must and grape-must. The effect of gamma-irradiation on the most potent isolates and the fermentation conditions as pH, incubation temperature and incubation period was also investigated. Results showed that the most potential fungal isolates were Aspergillus niger, Penicillium puberulum and Penicillium frequentans whereas their gluconic acid production was 62.17, 56.25 and 39.69 g/L, respectively on Czapek's Dox media at 28 ± 1 °C, pH 6 for 7 days fermentation period. Irradiation of the three most potential isolates at 0.1, 0.2, 0.3, 0.4 and 0.5 kGy doses of gamma ray showed that 0.1 kGy dose caused an increase in gluconic acid production whereas it was 69.35, 60.17 and 40.31 g/L by the three potential isolates respectively. Data showed that utilization of sugarcane molasses, banana-must and grape-must as a sole carbon source in gluconic acid production by the three potential (0.1 kGy irradiated isolates at pH 6, 30 °C for a 7 days incubation period caused increasing in gluconic acid production whereas the productivity of the three (0.1 kGy irradiated isolates (A. niger, P. puberulum and P. frequentans was 69.87, 63.14 and 51.28 g/L by utilizing sugarcane molasses, 61.28, 56.37, 47.15 g/L by utilizing banana-must and 54.25, 52.75 and 44.75 g/L by utilizing grape-must.
Campuzano, S; Gamella, M; Serra, B; Reviejo, A J; Pingarrón, J M
2007-03-21
An integrated amperometric gluconic acid biosensor constructed using a gold electrode (AuE) modified with a self-assembled monolayer (SAM) of 3-mercaptopropionic acid (MPA) on which gluconate dehydrogenase (GADH, 0.84 U) and the mediator tetrathiafulvalene (TTF, 1.5 micromol) were coimmobilized by covering the electrode surface with a dialysis membrane is reported. The working conditions selected were Eapp=+0.15 V and 25+/-1 degrees C. The useful lifetime of one single TTF-GADH-MPA-AuE was surprisingly long. After 53 days of continuous use, the biosensor exhibited 86% of the original sensitivity. A linear calibration plot was obtained for gluconic acid over the 6.0x10(-7) to 2.0x10(-5) M concentration range, with a limit of detection of 1.9x10(-7) M. The effect of potential interferents (glucose, fructose, galactose, arabinose, and tartaric, citric, malic, ascorbic, gallic, and caffeic acids) on the biosensor response was evaluated. The behavior of the biosensor in a flow-injection system in connection with amperometric detection was tested. The analytical usefulness of the biosensor was evaluated by determining gluconic acid in wine and must samples, and the results obtained were validated by comparison with those provided by using a commercial enzyme test kit.
Engineering Escherichia coli for improved ethanol production from gluconate.
Hildebrand, Amanda; Schlacta, Theresa; Warmack, Rebeccah; Kasuga, Takao; Fan, Zhiliang
2013-10-10
We report on engineering Escherichia coli to produce ethanol at high yield from gluconic acid (gluconate). Knocking out genes encoding for the competing pathways (l-lactate dehydrogenase and pyruvate formate lyase A) in E. coli KO11 eliminated lactate production, lowered the carbon flow toward acetate production, and improved the ethanol yield from 87.5% to 97.5% of the theoretical maximum, while the growth rate of the mutant strain was about 70% of the wild type. The corresponding genetic modifications led to a small improvement of ethanol yield from 101.5% to 106.0% on glucose. Deletion of the pyruvate dehydrogenase gene (pdh) alone improved the ethanol yield from 87.5% to 90.4% when gluconate was a substrate. The growth rate of the mutant strain was identical to that of the wild type. The corresponding genetic modification led to no improvements on ethanol yield on glucose. Copyright © 2013 Elsevier B.V. All rights reserved.
Stochastic simulations of the tetracycline operon
2011-01-01
Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular
Stochastic simulations of the tetracycline operon
Directory of Open Access Journals (Sweden)
Kaznessis Yiannis N
2011-01-01
Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the
International Nuclear Information System (INIS)
Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.
2009-01-01
Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR-C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni 2+ ions but that it is able to bind Zn 2+ with K d < 70 nM. It is concluded that Zn 2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors
Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy
2015-01-01
Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851
Metazoan operons accelerate recovery from growth arrested states
Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.
2011-01-01
Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799
The Bacillus subtilis GntR family repressor YtrA responds to cell wall antibiotics.
Salzberg, Letal I; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D
2011-10-01
The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σ(M). Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses.
Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.
Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale
2015-05-25
Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.
Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh
2016-04-01
Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.
Energy Technology Data Exchange (ETDEWEB)
Mishelevich, Alexander [Department of Chemical Engineering, Ben Gurion University of the Negev, Beer Sheva 84105 (Israel); Apelblat, Alexander [Department of Chemical Engineering, Ben Gurion University of the Negev, Beer Sheva 84105 (Israel)], E-mail: apelblat@bgu.ac.il
2008-05-15
The solubility in water of magnesium-L-ascorbate, calcium-L-ascorbate, magnesium-L-glutamate, magnesium-D-gluconate, calcium-D-gluconate, calcium-D-heptagluconate, L-aspartic acid, and 3-nitrobenzoic acid was determined in the 278.15 K to 343.15 K temperature range. The solubility of these compounds served to permit the evaluation of the apparent molar enthalpies of solution.
International Nuclear Information System (INIS)
Mishelevich, Alexander; Apelblat, Alexander
2008-01-01
The solubility in water of magnesium-L-ascorbate, calcium-L-ascorbate, magnesium-L-glutamate, magnesium-D-gluconate, calcium-D-gluconate, calcium-D-heptagluconate, L-aspartic acid, and 3-nitrobenzoic acid was determined in the 278.15 K to 343.15 K temperature range. The solubility of these compounds served to permit the evaluation of the apparent molar enthalpies of solution
Directory of Open Access Journals (Sweden)
Mahendra Kumar Trivedi
2017-10-01
Full Text Available Magnesium gluconate is a classical organometallic pharmaceutical compound used for the prevention and treatment of hypomagnesemia as a source of magnesium ion. The present research described the in-depth study on solid state properties viz. physicochemical and thermal properties of magnesium gluconate using sophisticated analytical techniques like PXRD, PSA, FT-IR, UV–Vis spectroscopy, TGA/DTG, and DSC. Magnesium gluconate was found to be crystalline in nature along with the crystallite size ranging from 14.10 to 47.35 nm. The particle size distribution was at d(0.1=6.552 µm, d(0.5=38.299 µm, d(0.9=173.712 µm and D(4,3=67.122 µm along with the specific surface area of 0.372 m2/g. The wavelength for the maximum absorbance was at 198.0 nm. Magnesium gluconate exhibited 88.51% weight loss with three stages of thermal degradation process up to 895.18 °C from room temperature. The TGA/DTG thermograms of the analyte indicated that magnesium gluconate was thermally stable up to around 165 °C. Consequently, the melting temperature of magnesium gluconate was found to be 169.90 °C along with the enthalpy of fusion of 308.7 J/g. Thus, the authors conclude that the achieved results from this study are very useful in pharmaceutical and nutraceutical industries for the identification, characterization and qualitative analysis of magnesium gluconate for preformulation studies and also for developing magnesium gluconate based novel formulation.
Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio
2016-01-01
The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.
Rodriguez, Hilda; Gonzalez, Tania; Goire, Isabel; Bashan, Yoav
2004-11-01
In vitro gluconic acid formation and phosphate solubilization from sparingly soluble phosphorus sources by two strains of the plant growth-promoting bacteria A. brasilense (Cd and 8-I) and one strain of A. lipoferum JA4 were studied. Strains of A. brasilense were capable of producing gluconic acid when grown in sparingly soluble calcium phosphate medium when their usual fructose carbon source is amended with glucose. At the same time, there is a reduction in pH of the medium and release of soluble phosphate. To a greater extent, gluconic acid production and pH reduction were observed for A. lipoferum JA4. For the three strains, clearing halos were detected on solid medium plates with calcium phosphate. This is the first report of in vitro gluconic acid production and direct phosphate solubilization by A. brasilense and the first report of P solubilization by A. lipoferum. This adds to the very broad spectrum of plant growth-promoting abilities of this genus.
The Bacillus subtilis GntR Family Repressor YtrA Responds to Cell Wall Antibiotics▿§
Salzberg, Letal I.; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D.
2011-01-01
The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σM. Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses. PMID:21856850
Institute of Scientific and Technical Information of China (English)
#
2017-01-01
Magnesium gluconate is a classical organometallic pharmaceutical compound used for the prevention and treatment of hypomagnesemia as a source of magnesium ion. The present research described the in-depth study on solid state properties viz. physicochemical and thermal properties of magnesium gluconate using sophisticated analytical techniques like Powder X-ray diffraction (PXRD), particle size analysis ( PSA), Fourier transform infrared (FT-IR) spectrometry, ultraviolet–visible (UV–Vis) spectroscopy, thermogravimetric analysis (TGA)/differential thermogravimetric analysis (DTG), and differential scanning calorimetry (DSC). Magnesium gluconate was found to be crystalline in nature along with the crystallite size ranging from 14.10 to 47.35 nm. The particle size distribution was at d(0.1)=6.552 μm, d(0.5)=38.299 μm, d(0.9)=173.712 μm and D(4,3)=67.122 μm along with the specific surface area of 0.372 m2/g. The wavelength for the maximum absorbance was at 198.0 nm. Magnesium gluconate exhibited 88.51% weight loss with three stages of thermal degradation process up to 895.18 ℃ from room temperature. The TGA/DTG thermograms of the analyte indicated that magnesium gluconate was thermally stable up to around 165 ℃. Consequently, the melting temperature of magnesium gluconate was found to be 169.90 ℃ along with the enthalpy of fusion of 308.7 J/g. Thus, the authors conclude that the achieved results from this study are very useful in pharmaceutical and nutraceutical industries for the identification, characterization and qualitative analysis of magnesium gluconate for preformulation studies and also for developing magnesium gluconate based novel formulation.
The effects of agitation and aeration on the production of gluconic acid by Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Dronawat, S.N.; Svihla, C.K.; Hanley, T.R. [Univ. of Louisville, KY (United States)
1995-12-31
The effects of agitation and aeration in the production of gluconic acid by Aspergillus niger from a glucose medium were investigated. Experiments were conducted at aeration rates of 5.0 and 10.0 L/min. Four different agitation speeds were investigated for each aeration rate. Gluconic acid concentration and biomass concentration were analyzed, and the rate of consumption of substrate by A. niger was noted. The main purpose of this work was to find the optimal conditions of agitation and aeration for the growth of A. niger and production of gluconic acid in submerged culture in a batch fermentor at a bench-top scale. The oxygen-transfer rates at different agitation and aeration rates were calculated. The gluconic acid concentration and rate of growth of A. niger increased with increase in the agitation and aeration rates.
Aluminum and Phthalates in Calcium Gluconate: Contribution From Glass and Plastic Packaging.
Yokel, Robert A; Unrine, Jason M
2017-01-01
Aluminum contamination of parenteral nutrition solutions has been documented for 3 decades. It can result in elevated blood, bone, and whole body aluminum levels associated with neurotoxicity, reduced bone mass and mineral content, and perhaps hepatotoxicity. The primary aluminum source among parenteral nutrition components is glass-packaged calcium gluconate, in which aluminum concentration in the past 3 decades has averaged approximately 4000 μg/L, compared with nutrition solutions; 2 packaged in glass (from France and the United States) and 1 in plastic (from Germany); in a recently released plastic-packaged solution (from the United States); and in the 2 glass containers. Phthalate concentration was determined in selected samples of each product and leachate of the plastic containers. The initial aluminum concentration was approximately 5000 μg/L in the 2 glass-packaged products and approximately 20 μg/L in the plastic-packaged product, and increased approximately 30%, 50%, and 100% in 2 years, respectively. The aluminum concentration in a recently released Calcium Gluconate Injection USP was approximately 320 μg/L. Phthalates were not detected in any calcium gluconate solutions or leachates. Plastic packaging greatly reduces the contribution of aluminum to parenteral nutrition solutions from calcium gluconate compared with the glass-packaged product.
Comparison of pyrophosphate and gluconate scan of dog hearts with experimental cardiomyopathy
International Nuclear Information System (INIS)
Duska, F.; Novak, J.; Kafka, P.; Kubicek, J.; Vizda, J.; Mazurova, Y.; Veverkova, O.
1983-01-01
High intravenous doses of theophylline with adrenalin were used to produce experimental cardiomyopathy in dogs. This damage was visualized scintigraphically using either sup(99m)Tc-pyrophosphate (10 dogs) or sup(99m)Tc-gluconate (another 10 dogs). Scintigraphic examinations using sup(99m)Tc-pyrophosphate were carried out 48 hours after the damage had developed: in two dogs the examination was negative, in two cases boundary, in 6 cases the scintigraphic finding was clearly positive. sup(99m)Tc-gluconate was used in the examination of 5 animals four hours after the damage had developed. In this case the scan was significantly positive in all cases. The gluconate scan was made 24 hours after damage, again in 5 dogs. Here the positive change was less explicit, in one case the finding was negative. Histological examination of the affected myocardium showed in all cases a very light damage, in many instances on the limit of resolution by light microscopy. The findings were always degenerative (dystrophic) changes and microcirculation disorders without any necrosis. The work showed that both studied radiopharmaceutical preparations are a very sensitive but nonspecific indicator of non-ischemic disorders of the myocardium. For sup(99m)Tc-gluconate this is an original finding. (author)
Teaching the Big Ideas of Biology with Operon Models
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.
2005-04-12
Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.
Li, Can; Lin, Jianqun; Gao, Ling; Lin, Huibin; Lin, Jianqiang
2018-04-01
Production of gluconic acid by using immobilized enzyme and continuous stirred tank reactor-plug flow tubular reactor (CSTR-PFTR) circulation reaction system. A production system is constructed for gluconic acid production, which consists of a continuous stirred tank reactor (CSTR) for pH control and liquid storage and a plug flow tubular reactor (PFTR) filled with immobilized glucose oxidase (GOD) for gluconic acid production. Mathematical model is developed for this production system and simulation is made for the enzymatic reaction process. The pH inhibition effect on GOD is modeled by using a bell-type curve. Gluconic acid can be efficiently produced by using the reaction system and the mathematical model developed for this system can simulate and predict the process well.
Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.
Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan
2017-01-01
Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.
Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A
2011-11-01
HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.
Sequence and features of the tryptophan operon of Vibrio parahemolyticus.
Crawford, I P; Han, C Y; Silverman, M
1991-01-01
The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.
Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.
Lawrence, J
1999-12-01
The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.
Evolution and Biophysics of the Escherichia coli lac Operon
Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor
2011-03-01
To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.
Bagis, Bora; Baltacioglu, Esra; Özcan, Mutlu; Ustaomer, Seda
2011-03-01
To investigate the persistence of staining after the use of chlorhexidine gluconate mouthrinse. Twenty-four subjects (nine women and 15 men) who underwent periodontal therapy and were prescribed the use of 0.2% chlorhexidine gluconate mouthrinse participated in this study. Color values of maxillary central incisors, canines, and first molars were recorded at baseline; 3 days; and 1, 2, and 3 weeks of twice-daily chlorhexidine gluconate use with a digital intraoral colorimeter according to the CIE L*a*b* coordinates. While color-change (Delta E) values showed significant differences (P=.020) at different time points (10.1, 8.9, 8.9, 9.4, after 3 days and 1, 2, and 3 weeks, respectively), the duration of chlorhexidine gluconate use did not significantly affect the results (P=.873) (two-way ANOVA, Tukey test). No significant difference was found among Delta L* (P=.070), Delta a* (P=.169), and Delta b* (P=.691) values at any time point (one-way ANOVA). Measurements of baseline to day 3 differences showed significantly higher Delta E values than those at other time points (P.05) (Tukey test). The highest visible staining occurred on the first molars at all time points (83%, 79%, 79%, and 96% after 3 days and 1, 2, and 3 weeks, respectively) compared to the other teeth evaluated. The staining effect of chlorhexidine gluconate mouthrinse on natural dentition should be expected to be the highest in the first few days of use.
Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius
Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena
2013-01-01
Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are
Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales
Directory of Open Access Journals (Sweden)
Gogarten J Peter
2008-01-01
Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to
Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.
Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti
2017-01-01
The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.
In vitro susceptibility of gram-negative bacterial isolates to chlorhexidine gluconate.
Mengistu, Y; Erge, W; Bellete, B
1999-05-01
To investigate the susceptibility of clinical isolates of gram-negative bacteria to chlorhexidine gluconate. Prospective laboratory study. Tikur Anbessa Hospital, Addis Ababa, Ethiopia. Clinical specimens from 443 hospital patients. Significant number of gram negative bacteria were not inhibited by chlorhexidine gluconate (0.02-0.05%) used for antisepsis. Four hundred and forty three strains of gram-negative bacteria were isolated from Tikur Anbessa Hospital patients. Escherichia coli (31.6%) and Klebsiella pneumoniae (23%) were the most frequently isolated bacteria followed by Proteus species (13.3%), Pseudomonas species (9.2%), and Citrobacter species (6.1%). Each organism was tested to chlorhexidine gluconate (CHG), minimum inhibitory concentration (MIC) ranging from 0.0001% to 1%w/v. All Salmonella species and E. coli were inhibited by CHG, MIC or = 0.1%). Our results showed that a significant number of the gram-negative bacterial isolates were not inhibited by CHG at the concentration used for disinfection of wounds or instruments (MIC 0.02-0.05% w/v). It is therefore important to select appropriate concentration of this disinfectant and rationally use it for disinfection and hospital hygiene. Continuing follow up and surveillance is also needed to detect resistant bacteria to chlorhexidine or other disinfectants in time.
Edmiston, Charles E; Lee, Cheong J; Krepel, Candace J; Spencer, Maureen; Leaper, David; Brown, Kellie R; Lewis, Brian D; Rossi, Peter J; Malinowski, Michael J; Seabrook, Gary R
2015-11-01
To reduce the amount of skin surface bacteria for patients undergoing elective surgery, selective health care facilities have instituted a preadmission antiseptic skin cleansing protocol using chlorhexidine gluconate. A Cochrane Collaborative review suggests that existing data do not justify preoperative skin cleansing as a strategy to reduce surgical site infection. To develop and evaluate the efficacy of a standardized preadmission showering protocol that optimizes skin surface concentrations of chlorhexidine gluconate and to compare the findings with the design and methods of published studies on preoperative skin preparation. A randomized prospective analysis in 120 healthy volunteers was conducted at an academic tertiary care medical center from June 1, 2014, to September, 30, 2014. Data analysis was performed from October 13, 2014, to October 27, 2014. A standardized process of dose, duration, and timing was used to maximize antiseptic skin surface concentrations of chlorhexidine gluconate applied during preoperative showering. The volunteers were randomized to 2 chlorhexidine gluconate, 4%, showering groups (2 vs 3 showers), containing 60 participants each, and 3 subgroups (no pause, 1-minute pause, or 2-minute pause before rinsing), containing 20 participants each. Volunteers used 118 mL of chlorhexidine gluconate, 4%, for each shower. Skin surface concentrations of chlorhexidine gluconate were analyzed using colorimetric assay at 5 separate anatomic sites. Individual groups were analyzed using paired t test and analysis of variance. Preadmission showers using chlorhexidine gluconate, 4%. The primary outcome was to develop a standardized approach for administering the preadmission shower with chlorhexidine gluconate, 4%, resulting in maximal, persistent skin antisepsis by delineating a precise dose (volume) of chlorhexidine gluconate, 4%; duration (number of showers); and timing (pause) before rinsing. The mean (SD) composite chlorhexidine gluconate
REMap: Operon map of M. tuberculosis based on RNA sequence data.
Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu
2016-07-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.
Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.
Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong
2012-01-01
During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.
Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization
Ray, J. Christian J; Igoshin, Oleg A.
2012-01-01
Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903
The Genomic Pattern of tDNA Operon Expression in E. coli.
Directory of Open Access Journals (Sweden)
2005-06-01
Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.
Solving a discrete model of the lac operon using Z3
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†
Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.
2003-01-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Ancient origin of the tryptophan operon and the dynamics of evolutionary change.
Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A
2003-09-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
International Nuclear Information System (INIS)
Nick Evans; Peter Warwick; Monica Felipe-Sotelo
2012-01-01
The purpose of this study was to investigate the effects of competition between cobalt, europium and strontium for isosaccharinate, gluconate and picolinate. Systems where results indicated that competitive effects were significant have been identified. Thermodynamic calculations were performed for each system for comparison with the experimental results. Some exceptions may be due to precipitation of some species, or presence of species not in databases, or formation of mixed-metal complexes, or sorption to the solid phase(s). In some of the experiments, the complexity of the systems studied caused difficulty in identifying consistent trends. By concentrating on the results for simpler systems (i.e. for solubilities in the presence and absence of organic complexants and with just one competing metal ion), the evidence for competition effects has been investigated. Evidence for solubility enhancement due to organic ligands was apparent in the data for the systems Co with gluconate and Eu with isosaccharinate and gluconate. Of these above cases, the systems in which the effects of the competing ion are consistent with competition were limited to the cases of Eu with isosaccharinate and Sr as the competing ion, and Eu with gluconate and either Co or Sr as the competing ion. (author)
Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.
García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L
2017-09-01
Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization
Igoshin, Oleg
2011-03-01
Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.
Rapid customised operon assembly by yeast recombinational cloning.
Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R
2017-06-01
We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.
Effects of calcium gluconate and ascorbic acid on controlling shoot ...
African Journals Online (AJOL)
In vitro shoot necrosis is a quite widespread disorder affecting raspberry micropropagation. This study was conducted to investigate effects of calcium gluconate and ascorbic acid on shoot necrosis and dieback of raspberry shoots during micropropagation. Nodal segments of primocane-fruiting raspberry cultivars 'Allgold', ...
An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.
Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula
2013-07-01
The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
CONDOP: an R package for CONdition-Dependent Operon Predictions.
Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario
2016-10-15
The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.
Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio
2012-01-01
Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.
Ellepola, Arjuna N.B.; Samaranayake, Lakshman P.
2011-01-01
The post-antifungal effect (PAFE) is defined as the suppression of growth that persists following brief exposure of yeasts and other fungi to antimycotics and subsequent removal of the drug. There is no data available on the PAFE of chlorhexidine gluconate on oral isolates of Candida albicans. As chlorhexidine gluconate is by far the commonest antiseptic mouth wash prescribed in dentistry, the main aim of this investigation was to measure the PAFE of 10 oral isolates of C. albicans following ...
An, Kehong; Hu, Fengxian; Bao, Jie
2013-12-01
A new bioprocess for production of sorbitol and gluconic acid from two low-cost feedstocks, inulin and cassava starch, using a commercially available enzyme was proposed in this study. The commercial glucoamylase GA-L NEW from Genencor was found to demonstrate a high inulinase activity for hydrolysis of inulin into fructose and glucose. The glucoamylase was used to replace the expensive and not commercially available inulinase enzyme for simultaneous saccharification of inulin and starch into high titer glucose and fructose hydrolysate. The glucose and fructose in the hydrolysate were converted into sorbitol and gluconic acid using immobilized whole cells of the recombinant Zymomonas mobilis strain. The high gluconic acid concentration of 193 g/L and sorbitol concentration of 180 g/L with the overall yield of 97.3 % were obtained in the batch operations. The present study provided a practical production method of sorbitol and gluconic acid from low cost feedstocks and enzymes.
The pyrimidine operon pyrRPB-carA from Lactococcus lactis
DEFF Research Database (Denmark)
Martinussen, Jan; Schallert, J.; Andersen, Birgit
2001-01-01
The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...
DEFF Research Database (Denmark)
Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten
1994-01-01
Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...
Giles, Courtney D; Hsu, Pei-Chun Lisa; Richardson, Alan E; Hurst, Mark R H; Hill, Jane E
2015-12-01
Organic phosphorus (P) is abundant in most soils but is largely unavailable to plants. Pseudomonas spp. can improve the availability of P to plants through the production of phytases and organic anions. Gluconate is a major component of Pseudomonas organic anion production and may therefore play an important role in the mineralization of insoluble organic P forms such as calcium-phytate (CaIHP). Organic anion and phytase production was characterized in 2 Pseudomonas spp. soil isolates (CCAR59, Ha200) and an isogenic mutant of strain Ha200, which lacked a functional glucose dehydrogenase (Gcd) gene (strain Ha200 gcd::Tn5B8). Wild-type and mutant strains of Pseudomonas spp. were evaluated for their ability to solubilize and hydrolyze CaIHP and to promote the growth and assimilation of P by tobacco plants. Gluconate, 2-keto-gluconate, pyruvate, ascorbate, acetate, and formate were detected in Pseudomonas spp. supernatants. Wild-type pseudomonads containing a functional gcd could produce gluconate and mineralize CaIHP, whereas the isogenic mutant could not. Inoculation with Pseudomonas improved the bioavailability of CaIHP to tobacco plants, but there was no difference in plant growth response due to Gcd function. Gcd function is required for the mineralization of CaIHP in vitro; however, further studies will be needed to quantify the relative contribution of specific organic anions such as gluconate to plant growth promotion by soil pseudomonads.
Genipin Cross-Linked Glucose Oxidase and Catalase Multi-enzyme for Gluconic Acid Synthesis.
Cui, Caixia; Chen, Haibin; Chen, Biqiang; Tan, Tianwei
2017-02-01
In this work, glucose oxidase (GOD) and catalase (CAT) were used simultaneously to produce gluconic acid from glucose. In order to reduce the distance between the two enzymes, and therefore improve efficiency, GOD and CAT were cross-linked together using genipin. Improvements in gluconic acid production were due to quick removal of harmful intermediate hydrogen peroxide by CAT. GOD activity was significantly affected by the proportion of CAT in the system, with GOD activity in the cross-linked multi-enzyme (CLME) being 10 times higher than that in an un-cross-linked GOD/CAT mixture. The glucose conversion rate after 15 h using 15 % glucose was also 10 % higher using the CLME than was measured using a GOD/CAT mixture.
Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.
Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L
2016-01-01
Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase
The post-transcriptional operon
DEFF Research Database (Denmark)
Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik
2011-01-01
model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....
Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.
Stewart, V; Yanofsky, C
1986-01-01
We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
International Nuclear Information System (INIS)
St Hill, Catherine A; Farooqui, Mariya; Mitcheltree, Gregory; Gulbahce, H Evin; Jessurun, Jose; Cao, Qing; Walcheck, Bruce
2009-01-01
The metastasis of cancer cells and leukocyte extravasation into inflamed tissues share common features. Specialized carbohydrates modified with sialyl Lewis x (sLe x ) antigens on leukocyte membranes are ligands for selectin adhesion molecules on activated vascular endothelial cells at inflammatory sites. The activity of the enzyme core 2 β1,6 N-acetylglucosaminyltransferase (C2GnT1) in leukocytes greatly increases their ability to bind to endothelial selectins. C2GnT1 is essential for the synthesis of core 2-branched O-linked carbohydrates terminated with sLe x (C2-O-sLe x ). Our goal was to determine the expression profiles of C2-O-sLe x in the malignant progression and metastasis of colorectal adenocarcinomas. The well characterized CHO-131 monoclonal antibody (mAb) specifically recognizes C2-O-sLe x present in human leukocytes and carcinoma cells. Using CHO-131 mAb, we investigated whether C2-O-sLe x was present in 113 human primary colorectal adenocarcinomas, 10 colorectal adenomas, 46 metastatic liver tumors, 28 normal colorectal tissues, and 5 normal liver tissues by immunohistochemistry. We also examined mRNA levels of the enzyme core 2 β1,6-N-acetylglucosaminyltransferase (C2GnT1) in 20 well, 15 moderately, and 2 poorly differentiated colorectal adenocarcinomas, and in 5 normal colorectal tissues by using quantitative real-time polymerase chain reactions (RT-PCR). We observed high reactivity with CHO-131 mAb in approximately 70% of colorectal carcinomas and 87% of metastatic liver tumors but a lack of reactivity in colorectal adenomas and normal colonic and liver tissues. Positive reactivity with CHO-131 mAb was very prominent in neoplastic colorectal glands of well to moderately differentiated adenocarcinomas. The most intense staining with CHO-131 mAb was observed at the advancing edge of tumors with the deepest invasive components. Finally, we analyzed C2GnT1 mRNA levels in 37 colorectal adenocarcinomas and 5 normal colorectal tissues by RT
Energy Technology Data Exchange (ETDEWEB)
Zheng, Meiying; Cooper, David; Grossoehmerb, Nickolas; Yu, Minmin; Hung, Li-Wei; Cieslik, Murcin; Derewendaro, Urszula; Lesley, Scott; Wilson, Ian; Giedrocb, David; Derewenda, Zygmunt
2009-06-06
The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged helix (WH) DNA-binding domains and diverse C-terminal, regulatory domains, which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all a-helical regulatory domains classified into two related Pfam families: FadR{_}C and FCD. Only two crystal structures of the FadR family members, i.e. the E. coli FadR protein and the LldR from C. glutamicum, have been described to date in literature. Here we describe the crystal structure of TM0439, a GntR regulator with an FCD domain, found in the Thermotoga maritima genome. The FCD domain is similar to that of the LldR regulator, and contains a buried metal binding site. Using atomic absorption spectroscopy and Trp fluorescence, we show that the recombinant protein contains bound Ni{sup 2+} ions, but it is able to bind Zn{sup 2+} with K{sub D} < 70 nM . We conclude that Zn{sup 2+} is the likely physiological metal, where it may perform either or both structural and regulatory roles. Finally, we compare the TM0439 structure to two other FadR family structures recently deposited by Structural Genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.
Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm
Directory of Open Access Journals (Sweden)
Dharmesh Harwani
2014-12-01
Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.
Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.
Harwani, Dharmesh
2014-01-01
Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.
Operon Gene Order Is Optimized for Ordered Protein Complex Assembly
Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.
2016-01-01
Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901
Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.
Directory of Open Access Journals (Sweden)
Catherine E Dana
Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...
Mathematical model of gluconic acid fermentation by Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Takamatsu, T.; Shioya, S.; Furuya, T.
1981-11-01
A mathematical model for the study of gluconic acid fermentation by Aspergillus niger has been developed. The model has been deduced from the basic biological concept of multicellular filamentous microorganisms, i.e. cell population balance. It can be used to explain the behaviour of both batch and continuous cultures, even when in a lag phase. A new characteristic, involving the existence of dual equilibrium stages during fermentation, has been predicted using this mathematical model. (Refs. 6).
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
International Nuclear Information System (INIS)
Djokowidodo; Bambang-Edi HB; Budi-Setiawan
1996-01-01
The modified of Borate-Gluconate solution has been used for the separation of nitrate, phosphate, sulfate anions with methanol and acetonitrile additions. The addition of acetonitrile increased the resolution of nitrate-phosphate, meanwhile the resolution of phosphate-sulfate decreased. The addition of methanol increased the resolutions of nitrate-phosphate, and phosphate-sulfate. The best separation of nitrate, phosphate and sulfate anions with IC. A column were done at the mixture of eluent Natrium Borate Gluconate:Butanol:Acetonitril:water = 1: 1: 10: 38. The best resolution of nitrate-phosphate was 2.4 with the eluent mixture at the ratio of 1 part of borate-gluconate, 1 part of butanol, and 10 part of acetonitrile, and the best resolution of the phosphate-sulfate, was done by the eluent mixture at the with of 1 part of borate-gluconate, 1 part of butanol, and 10 parts of methanol
[Effects of carbon and nitrogen sources on 5-keto-gluconic acid production].
Tan, Zhilei; Wang, Hongcui; Wei, Yuqiao; Li, Yanyan; Zhong, Cheng; Jia, Shiru
2014-01-01
Gluconobacter oxydans is known to oxidize glucose to gluconic acid (GA), and subsequently, to 2-keto-gluconic acid (2KGA) and 5-keto-gluconic acid (5KGA), while 5KGA can be converted to L-(+)-tartaric acid. In order to increase the production of 5KGA, Gluconobacter oxydans HGI-1 that converts GA to 5KGA exclusively was chosen in this study, and effects of carbon sources (lactose, maltose, sucrose, amylum and glucose) and nitrogen sources (yeast extract, fish meal, corn steep liquor, soybean meal and cotton-seed meal) on 5KGA production were investigated. Results of experiment in 500 mL shake-flask show that the highest yield of 5KGA (98.20 g/L) was obtained using 100 g/L glucose as carbon source. 5KGA reached 100.20 g/L, 109.10 g/L, 99.83 g/L with yeast extract, fish meal and corn steep liquor as nitrogen source respectively, among which the optimal nitrogen source was fish meal. The yield of 5KGA by corn steep liquor is slightly lower than that by yeast extract. For the economic reason, corn steep liquor was selected as nitrogen source and scaled up to 5 L stirred-tank fermentor, and the final concentration of 5KGA reached 93.80 g/L, with its maximum volumetric productivity of 3.48 g/(L x h) and average volumetric productivity of 1.56 g/(L x h). The result obtained in this study showed that carbon and nitrogen sourses for large-scale production of 5KGA by Gluconobacter oxydans HGI-1 were glucose and corn steep liquor, respectively, and the available glucose almost completely (85.93%) into 5KGA.
Protonation of D-gluconate and its complexation with Np(V) in acidic to nearly neutral solutions
International Nuclear Information System (INIS)
Zhang, Z.; Clark, S.B.; Tian, G.; Rao, L.; Zanonato, P.L.
2006-01-01
Thermodynamic properties of the protonation of D-gluconic acid (HGH 4 (aq)) and its complexation with Np(V) have been studied in acidic to nearly neutral solutions at t = 25 C and I = 1 M NaClO 4 by potentiometry, spectrophotometry and calorimetry. The protonation constant (log K H ) and enthalpy (ΔH H ) of the carboxylate group are determined to be (3.30 ± 0.10) and -(4.03 ± 0.07) kJ mol -1 , respectively. Gluconate forms two Np(V) complexes in nearly neutral solutions. The formation constants and enthalpies of complexation are: log β 1 = (1.48 ± 0.03) and ΔH 1 = -(7.42 ± 0.13) kJ mol -1 for NpO 2 (GH 4 )(aq), log β = (2.14 ± 0.09) and ΔH 2 = -(12.08 ± 0.45) kJ mol -1 for NpO 2 (GH 4 ) 2 - . The thermodynamic parameters indicate that gluconic acid, like isosaccharinic acid and other α-hydroxycarboxylic acids, is a slightly stronger acid and forms stronger complexes with Np(V) than simple monocarboxylic acids. (orig.)
UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD
International Nuclear Information System (INIS)
Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.
1994-01-01
UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent
Egan, Muireann; O'Connell Motherway, Mary; van Sinderen, Douwe
2015-02-01
Bifidobacterium breve strains are numerically prevalent among the gut microbiota of healthy, breast-fed infants. The metabolism of sialic acid, a ubiquitous monosaccharide in the infant and adult gut, by B. breve UCC2003 is dependent on a large gene cluster, designated the nan/nag cluster. This study describes the transcriptional regulation of the nan/nag cluster and thus sialic acid metabolism in B. breve UCC2003. Insertion mutagenesis and transcriptome analysis revealed that the nan/nag cluster is regulated by a GntR family transcriptional repressor, designated NanR. Crude cell extract of Escherichia coli EC101 in which the nanR gene had been cloned and overexpressed was shown to bind to two promoter regions within this cluster, each of which containing an imperfect inverted repeat that is believed to act as the NanR operator sequence. Formation of the DNA-NanR complex is prevented in the presence of sialic acid, which we had previously shown to induce transcription of this gene cluster. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Cop-like operon: Structure and organization in species of the Lactobacillale order
Directory of Open Access Journals (Sweden)
ANGÉLICA REYES
2006-01-01
Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.
Elucidation of Operon Structures across Closely Related Bacterial Genomes
Li, Guojun
2014-01-01
About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722
Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin
2015-03-17
Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal
A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.
Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo
2014-01-01
The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.
77 FR 65824 - Calcium Gluconate; Exemption From the Requirement of a Tolerance
2012-10-31
..., rabbit and hamster with LD 50 values ranging from >2,000 milligrams/kilogram (mg/kg) to 7,850 mg/kg... gluconate was not mutagenic in an in vitro chromosome aberration test, bacterial gene mutation test. In...- ....... Sequestrant. 28-5). * * * * * * * * * * [FR Doc. 2012-26523 Filed 10-30-12; 8:45 am] BILLING CODE 6560-50-P ...
Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia
2011-10-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.
Elseweidy, Mohamed M; Ali, Abdel-Moniem A; Elabidine, Nabila Zein; Mursey, Nada M
2017-11-01
The relationship between zinc homeostasis and pancreatic function had been established. In this study we aimed firstly to configure the inflammatory pattern and hyperglycemia in zinc deficient diabetic rats. Secondly to illustrate the effect of two selected agents namely Zinc gluconate and sage oil (Salvia Officinalis, family Lamiaceae). Rats were fed on Zinc deficient diet, deionized water for 28days along with Zinc level check up at intervals to achieve zinc deficient state then rats were rendered diabetic through receiving one dose of alloxan monohydrate (120mg/kg) body weight, classified later into 5 subgroups. Treatment with sage oil (0.042mg/kg IP) and Zinc gluconate orally (150mg/kg) body weight daily for 8 weeks significantly reduced serum glucose, C-reactive protein (CRP), Tumor necrosis factor alpha (TNF- α), interleukins-6 1 β, inflammatory8 (IFN ȣ), pancreatic 1L1-β along with an increase in serum Zinc and pancreatic Zinc transporter 8 (ZNT8). Histopathological results of pancreatic tissues showed a good correlation with the biochemical findings. Both sage oil and zinc gluconate induced an improvement in the glycemic and inflammatory states. This may be of value like the therapeutic agent for diabetes. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Dynamic model of gene regulation for the lac operon
International Nuclear Information System (INIS)
Angelova, Maia; Ben-Halim, Asma
2011-01-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Dynamic model of gene regulation for the lac operon
Energy Technology Data Exchange (ETDEWEB)
Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)
2011-03-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.
Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan
2017-10-01
One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple
Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.
Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula
2016-09-01
The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
clpC operon regulates cell architecture and sporulation in Bacillus anthracis.
Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra
2015-03-01
The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073
Mounir, Majid; Shafiei, Rasoul; Zarmehrkhorshid, Raziyeh; Hamouda, Allal; Ismaili Alaoui, Mustapha; Thonart, Philippe
2016-02-01
The activity of bacterial strains significantly influences the quality and the taste of vinegar. Previous studies of acetic acid bacteria have primarily focused on the ability of bacterial strains to produce high amounts of acetic acid. However, few studies have examined the production of gluconic acid during acetous fermentation at high temperatures. The production of vinegar at high temperatures by two strains of acetic acid bacteria isolated from apple and cactus fruits, namely AF01 and CV01, respectively, was evaluated in this study. The simultaneous production of gluconic and acetic acids was also examined in this study. Biochemical and molecular identification based on a 16s rDNA sequence analysis confirmed that these strains can be classified as Acetobacter pasteurianus. To assess the ability of the isolated strains to grow and produce acetic acid and gluconic acid at high temperatures, a semi-continuous fermentation was performed in a 20-L bioreactor. The two strains abundantly grew at a high temperature (41°C). At the end of the fermentation, the AF01 and CV01 strains yielded acetic acid concentrations of 7.64% (w/v) and 10.08% (w/v), respectively. Interestingly, CV01 was able to simultaneously produce acetic and gluconic acids during acetic fermentation, whereas AF01 mainly produced acetic acid. In addition, CV01 was less sensitive to ethanol depletion during semi-continuous fermentation. Finally, the enzymatic study showed that the two strains exhibited high ADH and ALDH enzyme activity at 38°C compared with the mesophilic reference strain LMG 1632, which was significantly susceptible to thermal inactivation. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum
Directory of Open Access Journals (Sweden)
Marasco Rosangela
2006-11-01
Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro
Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.
Cortes, Teresa; Cox, Robert Ashley
2015-04-01
Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.
DEFF Research Database (Denmark)
Danielsen, S; Kilstrup, M; Barilla, K
1992-01-01
. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...
Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao
2013-10-01
The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
International Nuclear Information System (INIS)
Apelblat, Alexander; Korin, Eli
2008-01-01
Vapour pressures of water over saturated solutions of DL-2-aminobutyric acid, 4-aminobutyric acid, sodium-D-gluconate, sodium hippurate, and potassium magnesium-L-aspartate were determined over the (278 to 322) K temperature range. The determined vapour pressures were used to obtain the water activities, the molar enthalpies of vaporization, and the osmotic coefficients of sodium-D-gluconate
Energy Technology Data Exchange (ETDEWEB)
Apelblat, Alexander [Department of Chemical Engineering, Ben Gurion University of the Negev, Beer Sheva 84105 (Israel)], E-mail: apelblat@bgu.ac.il; Korin, Eli [Department of Chemical Engineering, Ben Gurion University of the Negev, Beer Sheva 84105 (Israel)
2008-05-15
Vapour pressures of water over saturated solutions of DL-2-aminobutyric acid, 4-aminobutyric acid, sodium-D-gluconate, sodium hippurate, and potassium magnesium-L-aspartate were determined over the (278 to 322) K temperature range. The determined vapour pressures were used to obtain the water activities, the molar enthalpies of vaporization, and the osmotic coefficients of sodium-D-gluconate.
vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates
DEFF Research Database (Denmark)
Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria
2014-01-01
We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....
Structural characterization of the Salmonella typhimurium LT2 umu operon
International Nuclear Information System (INIS)
Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.
1990-01-01
The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity
Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes
Directory of Open Access Journals (Sweden)
Jan Ewald
2015-04-01
Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.
Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli
Directory of Open Access Journals (Sweden)
Sun Yuan
2006-02-01
Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
2015-01-01
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.
Energy Technology Data Exchange (ETDEWEB)
Subba Rao, D. (Div. of Biochemical Engineering, Dept. of Chemical Engineering, Indian Inst. of Tech., Madras (India)); Panda, T. (Div. of Biochemical Engineering, Dept. of Chemical Engineering, Indian Inst. of Tech., Madras (India))
1994-10-01
To compare the efficiency of various whole cell immobilization techniques for the production of gluconic acid by Aspergillus niger were investigated using potassium ferrocyanide-treated cane molasses as the substrate. The techniques followed were: (1) Calcium alginate entrapment, (2) cross-linking with glutaraldehyde after cell permeabilization with (a) acetone, (b) toluene and (c) isopropanol and (3) development of granular catalyst. A comparative analysis of yield has revealed that calcium alginate entrapment was the most suitable technique as it had given the maximum product yield (0.40 g gluconic acid/g total reducing sugar supplied). The properties of immobilized A. niger in sodium alginate gel have been thoroughly investigated and compared with those of free cells under most suitable conditions of fermentation. (orig.)
Decreases in average bacterial community rRNA operon copy number during succession.
Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R
2016-05-01
Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.
Riyanti, Eny Ida; Rogers, Peter L
2009-01-01
Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...
Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh
2014-10-01
Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.
Directory of Open Access Journals (Sweden)
Robert K. Huston
2018-02-01
Full Text Available There are no compatibility studies for neonatal parenteral nutrition solutions without cysteine containing calcium chloride or calcium gluconate using light obscuration as recommended by the United States Pharmacopeia (USP. The purpose of this study was to do compatibility testing for solutions containing calcium chloride and calcium gluconate without cysteine. Solutions of TrophAmine and Premasol (2.5% amino acids, containing calcium chloride or calcium gluconate were compounded without cysteine. Solutions were analyzed for particle counts using light obscuration. Maximum concentrations tested were 15 mmol/L of calcium and 12.5 mmol/L of phosphate. If the average particle count of three replicates exceeded USP guidelines, the solution was determined to be incompatible. This study found that 12.5 and 10 mmol/L of calcium and phosphate, respectively, are compatible in neonatal parenteral nutrition solutions compounded with 2.5% amino acids of either TrophAmine or Premasol. There did not appear to be significant differences in compatibility for solutions containing TrophAmine or Premasol when solutions were compounded with either CaCl2 or CaGlu-Pl. This study presents data in order to evaluate options for adding calcium and phosphate to neonatal parenteral nutrition solutions during shortages of calcium and cysteine.
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...
Directory of Open Access Journals (Sweden)
Silva Raul F
2012-07-01
Full Text Available Abstract Background The clinical use of autologous platelet concentrates (also known as platelet-rich plasma on the field of regenerative therapy, in the last decade has been the subject of several studies especially in equine medicine and surgery. The objectives of this study was: 1 to describe and compare the cellular population in whole blood, lower fraction (A and upper fraction (B of platelet concentrates, 2 to measure and compare the transforming growth factor beta 1 (TGF-β1 concentration in plasma and both platelet concentrates after be activated with calcium gluconate or batroxobin plus calcium gluconate and, 3 to determine correlations between cell counts in platelet concentrates and concentrations of TGF-β1. Blood samples were taken from 16 dogs for complete blood count, plasma collection and platelet concentrates preparation. The platelet concentrates (PC were arbitrarily divided into two fractions, specifically, PC-A (lower fraction and PC-B (upper fraction. The Platelet concentrates were analyzed by hemogram. After activated with calcium gluconate or batroxobin plus calcium gluconate, TGF-β1 concentration was determined in supernatants of platelet concentrates and plasma. Results There were differences statistically significant (P 1 concentration between whole blood, plasma and both platelet concentrates. A significant correlation was found between the number of platelets in both platelet concentrates and TGF-β1 concentration. Platelet collection efficiency was 46.34% and 28.16% for PC-A and PC-B, respectively. TGF-β1 concentration efficiency for PC activated with calcium gluconate was 47.75% and 31.77%, for PC-A and PC-B, respectively. PC activated with batroxobin plus CG showed 46.87% and 32.24% for PC-A and PC-B, respectively. Conclusions The methodology used in this study allows the concentration of a number of platelets and TGF-β1 that might be acceptable for a biological effect for clinical or experimental use as a
Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M
2014-12-01
Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.
Eucaryotic operon genes can define highly conserved syntenies
Czech Academy of Sciences Publication Activity Database
Trachtulec, Zdeněk
2004-01-01
Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004
Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús
2013-02-01
Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.
Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O
2015-02-01
Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Qinna Cui
Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased
Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C
2015-07-07
Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.
Kim, Moonjeong; Kim, Kwang-Sun
2017-07-06
The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Viswanathan Shanti
2016-07-01
Full Text Available There has been an increase in the consumption of energy drinks in the last decade which raises a concern regarding its safety. Glucose improves information processing and cognition. But research on only glucose containing drink is lacking. In the present study, we evaluated the effect of Red Bull,a caffeine containing energy drink and Glucon D on visual and auditory reaction time in medical students. A total of 30 students,15 boys and 15 girls, in the age group 18 to 22 yrs were recruited for the study after taking approval from the Institutional Ethical Committee. At the beginning, a baseline record of pulse, blood pressure, ART and VRT were taken for all students. The students were given Red Bull and readings were taken after 30 minutes. After an interval of five days the same procedure was repeated with Glucon D. All readings were taken between 10-12 a.m. On comparing the effect of Red Bull on either sex, there was no significant difference. On comparing the effect of the two energy drinks, the p value between the effect of Red Bull and Glucon D on ART was 0.457 and on VRT was 0.314.Both were not statistically significant. There was a significant increase in pulse rate with Red Bull (P=0.036. The mean DBP increased marginally with Red Bull which was not significant (P=0.496.
Chung, T; Resnik, E; Stueland, C; LaPorte, D C
1993-01-01
Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...
Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria
2016-01-01
The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the
KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G
Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira
2013-07-01
Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Boyd, D A; Mulvey, M R
2013-02-01
To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.
Sequence analysis of the Legionella micdadei groELS operon
DEFF Research Database (Denmark)
Hindersson, P; Høiby, N; Bangsborg, Jette Marie
1991-01-01
shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...
Directory of Open Access Journals (Sweden)
Zinn Manfred
2011-04-01
Full Text Available Abstract Background The substitution of plastics based on fossil raw material by biodegradable plastics produced from renewable resources is of crucial importance in a context of oil scarcity and overflowing plastic landfills. One of the most promising organisms for the manufacturing of medium-chain-length polyhydroxyalkanoates (mcl-PHA is Pseudomonas putida KT2440 which can accumulate large amounts of polymer from cheap substrates such as glucose. Current research focuses on enhancing the strain production capacity and synthesizing polymers with novel material properties. Many of the corresponding protocols for strain engineering rely on the rifampicin-resistant variant, P. putida KT2442. However, it remains unclear whether these two strains can be treated as equivalent in terms of mcl-PHA production, as the underlying antibiotic resistance mechanism involves a modification in the RNA polymerase and thus has ample potential for interfering with global transcription. Results To assess PHA production in P. putida KT2440 and KT2442, we characterized the growth and PHA accumulation on three categories of substrate: PHA-related (octanoate, PHA-unrelated (gluconate and poor PHA substrate (citrate. The strains showed clear differences of growth rate on gluconate and citrate (reduction for KT2442 > 3-fold and > 1.5-fold, respectively but not on octanoate. In addition, P. putida KT2442 PHA-free biomass significantly decreased after nitrogen depletion on gluconate. In an attempt to narrow down the range of possible reasons for this different behavior, the uptake of gluconate and extracellular release of the oxidized product 2-ketogluconate were measured. The results suggested that the reason has to be an inefficient transport or metabolization of 2-ketogluconate while an alteration of gluconate uptake and conversion to 2-ketogluconate could be excluded. Conclusions The study illustrates that the recruitment of a pleiotropic mutation, whose effects might
Sahukhal, Gyan S; Elasri, Mohamed O
2014-06-11
Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Unknown
[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.
Characterization of the Leptospira interrogans S10-spc-alpha operon
Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.
2000-01-01
A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an
Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan
2014-01-01
Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory
Corrosion Inhibition by Sodium Gluconate-Zn2+-DTPMP System
Directory of Open Access Journals (Sweden)
P. Manjula
2009-01-01
Full Text Available The inhibition efficiency of a phosphonic acid, Diethylene Triamine Pentamethylene Phosphonic acid (DTPMP in controlling corrosion of carbon steel immersed in an aqueous solution containing 60 ppm of Cl- has been evaluated by weight loss method in the absence and presence of Zn2+. The formulation consisting of DTPMP and Zn2+ has excellent inhibition efficiency (IE. A synergistic effect is noticed between Zn2+ and DTPMP. Addition of sodium gluconate (SG enhances the IE of Zn2+ and DTPMP system. The DTPMP-Zn2+-SG system function as a mixed inhibitor as revealed by polarization study. AC impedance spectrum, optical and atomic force micrographs reveal the formation of a protective film on the metal surface. FTIR spectra reveal that the protective film consists of Fe2+-DTPMP complex, Fe2+-SG complex and Zn(OH2.
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.
Directory of Open Access Journals (Sweden)
Arkin Adam P
2006-01-01
Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.
Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.
Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki
2015-11-17
rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
Shen, Yuting; Tian, Xiwei; Zhao, Wei; Hang, Haifeng; Chu, Ju
2018-01-01
Different concentrations of oxygen-enriched air were utilized for sodium gluconate (SG) fermentation by Aspergillus niger. The fermentation time shortened from 20 to 15.5 h due to the increase of volumetric oxygen transfer coefficient (K L a) and the formation of more dispersed mycelia when inlet oxygen concentration ascended from 21 to 32%. According to metabolic flux analysis, during the growth phase, extracellular glucose for SG synthesis accounted for 79.0 and 85.3% with air and oxygen-enriched air (25%), respectively, whereas the proportions were 89.4 and 93.0% in the stationary phase. Intracellular glucose consumption decreased in oxygen-enriched fermentation, as cell respiration was more high-efficiently performed. Metabolic profiling indicated that most intermediates in TCA cycle and EMP pathway had smaller pool sizes in oxygen-enriched fermentations. Moreover, the main by-product of citric acid dramatically decreased from 1.36 to 0.34 g L -1 in oxygen-enriched fermentation. And the sodium gluconate yield increased from 0.856 to 0.903 mol mol -1 .
Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E
2016-01-01
An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.
Energy Technology Data Exchange (ETDEWEB)
Rahman, Shekh M. [Department of Chemical, Biological and Bioengineering, North Carolina A& T State University, 1601 East Market Street, Greensboro, NC 27411 (United States); NSF Engineering Research Center for Revolutionizing Metallic Biomaterials, North Carolina A& T State University, Greensboro, NC 27411 (United States); Mahoney, Christopher [Department of Bioengineering, University of Pittsburgh, 4200 Fifth Avenue, Pittsburgh, PA 15250 (United States); Sankar, Jagannathan [NSF Engineering Research Center for Revolutionizing Metallic Biomaterials, North Carolina A& T State University, Greensboro, NC 27411 (United States); Department of Mechanical Engineering, North Carolina A& T State University, 1601 East Market Street, Greensboro, NC 27411 (United States); Marra, Kacey G. [NSF Engineering Research Center for Revolutionizing Metallic Biomaterials, North Carolina A& T State University, Greensboro, NC 27411 (United States); Department of Bioengineering, University of Pittsburgh, 4200 Fifth Avenue, Pittsburgh, PA 15250 (United States); Department of Plastic Surgery, University of Pittsburgh, 200 Lothrop Street, Pittsburgh, PA 15250 (United States); McGowan Institute for Regenerative Medicine, University of Pittsburgh, 450 Technology Drive, Pittsburgh, PA 15250 (United States); Bhattarai, Narayan, E-mail: nbhattar@ncat.edu [Department of Chemical, Biological and Bioengineering, North Carolina A& T State University, 1601 East Market Street, Greensboro, NC 27411 (United States); NSF Engineering Research Center for Revolutionizing Metallic Biomaterials, North Carolina A& T State University, Greensboro, NC 27411 (United States)
2016-01-15
Graphical abstract: - Highlights: • Magnesium gluconate contained PLGA/chitosan microspheres were fabricated. • In vitro release of magnesium ions was performed using Xylidyl Blue assay. • Chitosan coated PLGA can significantly control the release of magnesium ions. • Cellular compatibility was tested using adipose-derived stem cells and PC12 cells. • The cells encounter acceptably low levels of damage in contact with microspheres. - Abstract: The goal of this study was to fabricate and investigate the chitosan coated poly(lactic-co-glycolic acid) (PLGA) microspheres for the development of controlled release magnesium delivery system. PLGA based microspheres are ideal vehicles for many controlled release drug delivery applications. Chitosan is a naturally occurring biodegradable and biocompatible polysaccharide, which can coat the surface of PLGA to alter the release of drugs. Magnesium gluconate (MgG) was encapsulated in the PLGA and PLGA/chitosan microspheres by utilizing the double emulsion solvent evaporation technique for controlled release study. The microspheres were tested with respect to several physicochemical and biological properties, including morphology, chemical structure, chitosan adsorption efficiency, magnesium encapsulation efficiency, in vitro release of magnesium ions, and cellular compatibility using both human adipose-derived stem cells (ASCs) and PC12 cells. Chitosan coated PLGA microspheres can significantly control the release of magnesium ions compared to uncoated PLGA microspheres. Both coated and uncoated microspheres showed good cellular compatibility.
Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon
2014-01-01
Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.
Ray, Sujay; Banerjee, Arundhati
2015-10-01
Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter
2008-01-01
Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of
RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.
Pérez-Oseguera, Angeles; Cevallos, Miguel A
2013-11-01
Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Terezinha Knöbl
2006-06-01
Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.
International Nuclear Information System (INIS)
Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.
1988-01-01
The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis
Bactericidal Effects and Mechanism of Action of Olanexidine Gluconate, a New Antiseptic
Iwata, Koushi; Nii, Takuya; Nakata, Hikaru; Tsubotani, Yoshie; Inoue, Yasuhide
2015-01-01
Olanexidine gluconate [1-(3,4-dichlorobenzyl)-5-octylbiguanide gluconate] (development code OPB-2045G) is a new monobiguanide compound with bactericidal activity. In this study, we assessed its spectrum of bactericidal activity and mechanism of action. The minimal bactericidal concentrations of the compound for 30-, 60-, and 180-s exposures were determined with the microdilution method using a neutralizer against 320 bacterial strains from culture collections and clinical isolates. Based on the results, the estimated bactericidal olanexidine concentrations with 180-s exposures were 869 μg/ml for Gram-positive cocci (155 strains), 109 μg/ml for Gram-positive bacilli (29 strains), and 434 μg/ml for Gram-negative bacteria (136 strains). Olanexidine was active against a wide range of bacteria, especially Gram-positive cocci, including methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci, and had a spectrum of bactericidal activity comparable to that of commercial antiseptics, such as chlorhexidine and povidone-iodine. In vitro experiments exploring its mechanism of action indicated that olanexidine (i) interacts with the bacterial surface molecules, such as lipopolysaccharide and lipoteichoic acid, (ii) disrupts the cell membranes of liposomes, which are artificial bacterial membrane models, (iii) enhances the membrane permeability of Escherichia coli, (iv) disrupts the membrane integrity of S. aureus, and (v) denatures proteins at relatively high concentrations (≥160 μg/ml). These results indicate that olanexidine probably binds to the cell membrane, disrupts membrane integrity, and its bacteriostatic and bactericidal effects are caused by irreversible leakage of intracellular components. At relatively high concentrations, olanexidine aggregates cells by denaturing proteins. This mechanism differs slightly from that of a similar biguanide compound, chlorhexidine. PMID:25987609
A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport
Chopra, Paras; Bender, Andreas
The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.
Chowdhury, Nilkanta; Bagchi, Angshuman
2017-07-01
Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.
Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato
2018-01-01
Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.
Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo
2014-12-01
The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.
Dynamics and bistability in a reduced model of the lac operon
Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.
2004-06-01
It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.
Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito
2014-09-01
Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert
2015-05-01
Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.
2015-01-01
encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....
Wu, Sau-Ching; Wong, Sui-Lam
2002-03-01
Streptavidin is a biotin-binding protein which has been widely used in many in vitro and in vivo applications. Because of the ease of protein recovery and availability of protease-deficient strains, the Bacillus subtilis expression-secretion system is an attractive system for streptavidin production. However, attempts to produce streptavidin using B. subtilis face the problem that cells overproducing large amounts of streptavidin suffer poor growth, presumably because of biotin deficiency. This problem cannot be solved by supplementing biotin to the culture medium, as this will saturate the biotin binding sites in streptavidin. We addressed this dilemma by engineering a B. subtilis strain (WB800BIO) which overproduces intracellular biotin. The strategy involves replacing the natural regulatory region of the B. subtilis chromosomal biotin biosynthetic operon (bioWAFDBIorf2) with an engineered one consisting of the B. subtilis groE promoter and gluconate operator. Biotin production in WB800BIO is induced by gluconate, and the level of biotin produced can be adjusted by varying the gluconate dosage. A level of gluconate was selected to allow enhanced intracellular production of biotin without getting it released into the culture medium. WB800BIO, when used as a host for streptavidin production, grows healthily in a biotin-limited medium and produces large amounts (35 to 50 mg/liter) of streptavidin, with over 80% of its biotin binding sites available for future applications.
Roy, Ajit; Ranjan, Akash
2016-02-23
Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.
International Nuclear Information System (INIS)
Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.
2007-01-01
The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Directory of Open Access Journals (Sweden)
Lindblad Peter
2008-04-01
Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the
International Nuclear Information System (INIS)
Ganji, Yasaman; Kasra, Mehran; Salahshour Kordestani, Soheila; Bagheri Hariri, Mohiedin
2014-01-01
Gold nanotubes/nanowires (GNT/NW) were synthesized by using the template-assisted electrodeposition technique and mixed with castor oil–polyethylene glycol based polyurethane (PU) to fabricate porous composite scaffolds for biomedical application. 100 and 50 ppm of GNT/NW were used to synthesize composites. The composite scaffolds were characterized by Fourier transform infrared spectroscopy, dynamic mechanical thermal analysis, differential scanning calorimetry, and scanning electron microscopy. Cell attachment on polyurethane–GNT/NW composites was investigated using fat-derived mesenchymal stem cells. Addition of 50 or 100 ppm GNT/NW had significant effects on thermal, mechanical, and cell attachment of polyurethane. Higher crosslink density and better cell attachment and proliferation were observed in polyurethane containing 50 ppm GNT/NW. The results revealed that GNT/NW formed hydrogen bonding with the polyurethane matrix and improved the thermomechanical properties of nanocomposites. Compared with pure PU, better cellular attachment on polyurethane–GNT/NW composites was observed resulting from the improved surface properties of composites. - Highlights: • Polyurethane–gold nanotubes/nanowires (GNT/NWs) composites were synthesized. • Tan δ, E′ and E″ were increased upon addition of 50 ppm of GNT/NW. • Better cell attachment was observed in composites containing 50 ppm of GNT/NW. • GNT/NWs can make a bridge between the pores of the porous polymeric scaffolds. • GNT/NWs increased the crosslink density of the polymeric matrix
Energy Technology Data Exchange (ETDEWEB)
Ganji, Yasaman, E-mail: y.ganji@aut.ac.ir [Faculty of Biomedical Engineering, Amirkabir University of Technology, 424 Hafez Ave., Tehran (Iran, Islamic Republic of); Kasra, Mehran, E-mail: mkasra@aut.ac.ir [Faculty of Biomedical Engineering, Amirkabir University of Technology, 424 Hafez Ave., Tehran (Iran, Islamic Republic of); Salahshour Kordestani, Soheila, E-mail: s.kordestani@aut.ac.ir [Faculty of Biomedical Engineering, Amirkabir University of Technology, 424 Hafez Ave., Tehran (Iran, Islamic Republic of); Bagheri Hariri, Mohiedin, E-mail: mohibagheri@gmail.com [Materials Science and Engineering Department, Sharif University of Technology, Azadi Ave., Tehran (Iran, Islamic Republic of)
2014-09-01
Gold nanotubes/nanowires (GNT/NW) were synthesized by using the template-assisted electrodeposition technique and mixed with castor oil–polyethylene glycol based polyurethane (PU) to fabricate porous composite scaffolds for biomedical application. 100 and 50 ppm of GNT/NW were used to synthesize composites. The composite scaffolds were characterized by Fourier transform infrared spectroscopy, dynamic mechanical thermal analysis, differential scanning calorimetry, and scanning electron microscopy. Cell attachment on polyurethane–GNT/NW composites was investigated using fat-derived mesenchymal stem cells. Addition of 50 or 100 ppm GNT/NW had significant effects on thermal, mechanical, and cell attachment of polyurethane. Higher crosslink density and better cell attachment and proliferation were observed in polyurethane containing 50 ppm GNT/NW. The results revealed that GNT/NW formed hydrogen bonding with the polyurethane matrix and improved the thermomechanical properties of nanocomposites. Compared with pure PU, better cellular attachment on polyurethane–GNT/NW composites was observed resulting from the improved surface properties of composites. - Highlights: • Polyurethane–gold nanotubes/nanowires (GNT/NWs) composites were synthesized. • Tan δ, E′ and E″ were increased upon addition of 50 ppm of GNT/NW. • Better cell attachment was observed in composites containing 50 ppm of GNT/NW. • GNT/NWs can make a bridge between the pores of the porous polymeric scaffolds. • GNT/NWs increased the crosslink density of the polymeric matrix.
Brito, Leonardo F C; Sertich, Patricia L; Rives, William; Knobbe, Marc; Del Piero, Fabio; Stull, Gordon B
2011-05-01
Eight adult American black bears were used to evaluate the effects of chemical castration by intratesticular zinc gluconate treatment on testicular dimensions, echodensity, histology, sperm production, and testosterone secretion. Treatment did not affect testicular dimensions and did not result in decreased resting or GnRH-stimulated testosterone secretion. Multifocal hyperchoic areas in the testicular parenchyma were observed on ultrasound examination, and white foci were observed on gross pathology examination after zinc gluconate treatment. Histologically, there were normal seminiferous tubules containing either round or elongated spermatids, along with abnormal tubules in all bears after treatment. Vacuolation of the seminiferous epithelium, sloughing of germ cells into the tubules' lumen, presence of multinuclear giant cells, and reduced height of the seminiferous epithelium with missing generations of germ cells were commonly observed. The most severe testicular changes were multifocal and included fibrosis, complete degeneration of the seminiferous epithelium with shrinkage of the tubule, and sperm stasis. Epididymal sperm reserve was 982.74 ± 654.16 × 10(6) sperm (mean ± SEM) and motile sperm were observed in the epididymis of all but one of the bears. In conclusion, although intratesticular zinc gluconate treatment in black bears resulted in testicular degenerative changes detected by ultrasound and histology examinations, sperm production was not completely ablated. We inferred that normal fertility might have been compromised, but treatment unlikely resulted in sterility. Copyright © 2011. Published by Elsevier Inc.
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel
2015-01-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent
2015-09-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Lifescience Database Archive (English)
Full Text Available rate is as high as 90% and there is no prophylaxis or cure. It is endemic in Central Africa. Infectious disease ... Zaire ebola...virus [GN:T40012] Reston ebolavirus [GN:T40013] Sudan ebolaviru...s [GN:T40014] Bundibugyo virus [GN:T40121] Tai Forest ebolavirus [GN:T40125] ... ICD-10: A98.4 MeSH: D01914
The effect of stochasticity on the lac operon: an evolutionary perspective.
Directory of Open Access Journals (Sweden)
Milan van Hoek
2007-06-01
Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel
Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.
Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W
1993-01-01
CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...
Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong
2015-10-23
The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.
Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J
2017-05-01
Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Kim, Dae Hun; Ko, Kwan Soo
2015-07-01
To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hiraku Takada
Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
DEFF Research Database (Denmark)
Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal
2008-01-01
The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...
Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.
Directory of Open Access Journals (Sweden)
T Sabari Sankar
2009-03-01
Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.
DEFF Research Database (Denmark)
Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin
1996-01-01
Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...
Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W
2015-11-01
Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Eberl, L; Christiansen, Gunna; Molin, S
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...
Directory of Open Access Journals (Sweden)
Potrich D.P.
2001-01-01
Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.
Deaner, Matthew; Holzman, Allison; Alper, Hal S
2018-04-16
Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis
Czech Academy of Sciences Publication Activity Database
Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav
2007-01-01
Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.
de Oliveira, Rafael R; Nicholson, Wayne L
2016-01-01
To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.
Spaziani, Erasmo; Di Filippo, Annalisa; Orelli, Simone; Fiorini, Flavia; Spaziani, Martina; Tintisona, Orlando; Torcasio, Angelo; De Cesare, Alessandro; Picchio, Marcello
2018-04-01
Skin preparation with antiseptic agents is commonly recommended for incisional site cleansing before surgery. We present the result of a prospective case series submitted to a scheduled pre-operative antiseptic procedure combining chlorhexidine gluconate and povidone-iodine before elective laparoscopic cholecystectomy. Consecutive patients underwent pre-operative standardized cleansing of the operation site combining chlorhexidine gluconate and povidone-iodine. Patients were reviewed one week and four weeks post-operatively. Post-operative infection was observed in seven patients (4.3%). All observed infections were port-site infections, always located at the level of the umbilical incision. In all cases infections involved skin and subcutaneous tissue. Staphylococcus aureus was isolated in five patients (71.4%) and miscellaneous aerobic gram-positive bacteria in two subjects (28.6%). Post-operative hospital stay was the only factor significantly associated with the development of port-site infections. Port-site infections are a common complication after elective laparoscopic cholecystectomy. The proposed pre-operative disinfection procedure is effective in reducing port-site infections. Reducing hospital stay may contribute to limiting the occurrence of this complication.
Stefanski, Katherine M.
A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.
Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia
2016-08-01
To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016
Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.
2013-11-01
Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.
Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R
2001-01-01
Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).
Frías, José E; Flores, Enrique
2015-07-01
Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria
Tadmor, Arbel
2009-03-01
In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.
Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando
2015-02-27
It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.
The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus
Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.
2006-01-01
The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and
Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine
2014-10-01
The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Pharmacokinetics of chlorhexidine gluconate 0.02% in the rabbit cornea.
Xuguang, Sun; Yanchuang, Liang; Feng, Zhang; Shiyun, Luo; Xiaotang, Yin
2006-08-01
The aim of this study was to determine the pharmacokinetic parameters of chlorhexidine gluconate (CHG) in the rabbit cornea. Each eye of 16 New Zealand white rabbits were topically instilled with 50 microL of CHG 0.02% eye drops twice with a 5-min interval. Four (4) corneas of 2 rabbits were harvested at each time point. The concentration of CHG in the cornea was determined with high-performance liquid chromatography (HPLC) and 387 software to simulate the pharmacokinetic parameters. The concentration of CHG in the cornea displayed an open two-compartment model. Tmax was 13.75 min, Cmax 0.713 microg.g1, clearance rate 1.64 microg.g-1.min-1, and t1/2alpha, t1/2beta, and t1/2ka was 2.65, 48.72, and 2.67 min, respectively. The concentration of CHG in the rabbit cornea could be determined by means of HPLC. The maximum concentration of CHG in the corneal tissue was much higher than the trophozoite minimum amoebicidal concentration (TMAC) in vitro.
Effect of Manuka honey, chlorhexidine gluconate and xylitol on the clinical levels of dental plaque
Directory of Open Access Journals (Sweden)
Prathibha A Nayak
2010-01-01
Full Text Available Aims: To compare the effect of Manuka honey, chlorhexidine gluconate (0.2% mouthwash and xylitol chewing gum on the dental plaque levels. Materials and Methods: Sixty healthy male dental students aged between 21 and 25 years (mean age 23.4 years participated in the study. All the subjects received a professional prophylaxis at the start of the study, with the purpose of making the dentition 100% free of plaque and calculus. The subjects were then randomly divided into three groups, i.e. the Manuka honey group, the chlorhexidine gluconate mouthwash group and the xylitol chewing gum group. Rinsing with water or any other fluid after the procedure was not allowed as also any form of mechanical oral hygiene for all the subjects during the experimental period of 72 h. After the experimental period, the plaque was disclosed using disclosing solution and their scores were recorded at six sites per tooth using the Quigley and Hein plaque index modified by Turesky-Gilmore-Glickman. Results: The mean plaque scores for Groups I, II and III were 1.37, 1.35 and 1.57, respectively. The ANOVA revealed that between-group comparison was significant, with an F-value of 5.99 and a probability value of 0.004. The T-test was carried out to evaluate the inter-group significance, which revealed that the plaque inhibition by Manuka honey was similar to that of chlorhexidine mouthwash. Both Manuka honey and chlorhexidine mouthwash reduced plaque formation significantly, better than the xylitol chewing gum. Conclusion: Manuka honey and chlorhexidine mouthwash reduced plaque formation significantly better than xylitol chewing gum.
Ghosh, Semanti; Bagchi, Angshuman
2015-12-01
Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio
Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T
2017-11-01
Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.
Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L
2017-01-01
Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Directory of Open Access Journals (Sweden)
Kathleen Jwanoswki
Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.
Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D
2015-01-01
Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage
Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.
da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A
2017-07-01
One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions
Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon
Nouwen, N; Driessen, AJM
2005-01-01
Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.
Directory of Open Access Journals (Sweden)
Min Wu
2017-12-01
Full Text Available Iron deficiency anemia is a common clinical consequence for people who suffer from chronic kidney disease, especially those requiring dialysis. Intravenous (IV iron therapy is a widely accepted safe and efficacious treatment for iron deficiency anemia. Numerous IV iron drugs have been approved by U.S. Food and Drug Administration (FDA, including a single generic product, sodium ferric gluconate complex in sucrose. In this study, we compared the cellular iron uptake profiles of the brand (Ferrlecit® and generic sodium ferric gluconate (SFG products. We used a colorimetric assay to examine the amount of iron uptake by three human macrophage cell lines. This is the first published study to provide a parallel evaluation of the cellular uptake of a brand and a generic IV iron drug in a mononuclear phagocyte system. The results showed no difference in iron uptake across all cell lines, tested doses, and time points. The matching iron uptake profiles of Ferrlecit® and its generic product support the FDA’s present position detailed in the draft guidance on development of SFG complex products that bioequivalence can be based on qualitative (Q1 and quantitative (Q2 formulation sameness, similar physiochemical characterization, and pharmacokinetic bioequivalence studies.
Ganji, Yasaman; Kasra, Mehran; Salahshour Kordestani, Soheila; Bagheri Hariri, Mohiedin
2014-09-01
Gold nanotubes/nanowires (GNT/NW) were synthesized by using the template-assisted electrodeposition technique and mixed with castor oil-polyethylene glycol based polyurethane (PU) to fabricate porous composite scaffolds for biomedical application. 100 and 50 ppm of GNT/NW were used to synthesize composites. The composite scaffolds were characterized by Fourier transform infrared spectroscopy, dynamic mechanical thermal analysis, differential scanning calorimetry, and scanning electron microscopy. Cell attachment on polyurethane-GNT/NW composites was investigated using fat-derived mesenchymal stem cells. Addition of 50 or 100 ppm GNT/NW had significant effects on thermal, mechanical, and cell attachment of polyurethane. Higher crosslink density and better cell attachment and proliferation were observed in polyurethane containing 50 ppm GNT/NW. The results revealed that GNT/NW formed hydrogen bonding with the polyurethane matrix and improved the thermomechanical properties of nanocomposites. Compared with pure PU, better cellular attachment on polyurethane-GNT/NW composites was observed resulting from the improved surface properties of composites. Copyright © 2014 Elsevier B.V. All rights reserved.
Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann
2015-01-01
The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.
Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.
Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard
2010-07-01
Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.
Directory of Open Access Journals (Sweden)
Aleksandra Wojciechowska
2017-01-01
Full Text Available Bionic acids are bioactive compounds demonstrating numerous interesting properties. They are widely produced by chemical or enzymatic oxidation of disaccharides. This paper focuses on the galactosyl derivative of gluconic acid as a result of a new method of bionic acid synthesis which utilises the transglycosylation properties of β-galactosidase and introduces lactose as a substrate. Products obtained in such a process are characterised by different structures (and, potentially, properties than those resulting from traditional oxidation of disaccharides. The aim of this study is to determine the effect of selected parameters (concentration and ratio of substrates, dose of the enzyme, time, pH, presence of salts on the course of the reaction carried out with the enzymatic preparation Lactozym, containing β-galactosidase from Kluyveromyces lactis. Research has shown that increased dry matter content in the baseline solution (up to 50 %, by mass per volume and an addition of NaCl contribute to higher yield. On the other hand, reduced content of the derivative is a result of increased pH from 7.0 to 9.0 and an addition of magnesium and manganese salts. Moreover, exceeding the β-galactosidase dose over approx. 35 000 U per 100 g of lactose also leads to reduced yield of the process. The most favourable molar ratio of sodium gluconate to lactose is 2.225:0.675. Depending on the conditions of the synthesis, the product concentration ranged between 17.3 and 118.3 g/L of the reaction mixture, which corresponded to the mass fraction of 6.64–23.7 % of dry matter. The data obtained as a result of the present study may be useful for designing an industrial process.
2012-01-01
Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433
Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.
The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises
Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M
2015-12-29
Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.
Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon
2016-05-18
Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.
Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander
2015-02-01
Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène
2018-01-22
Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.
Directory of Open Access Journals (Sweden)
Johanna Rintahaka
Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we
Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar
2014-01-01
A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016
Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.
2005-01-01
Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons
Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M
2017-01-15
The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize
Linka, Wojciech Andrzej; Golenia, Ewa; Zgoda, Marian Mikołaj; Kołodziejczyk, Michał Krzysztof
2014-01-01
Halitosis and gingivitis are most common pathologies (15-60% of population) which, if left untreated, lead to periodontal diseases and tooth loss. The aim of this study was to develop, based on polymers of dry sage extract and zinc gluconate, tablets intended for sucking and chewing that can be applied in the treatment of halitosis and gingivitis. Dried aqueous sage extract, zinc gluconate, Pharmagum M, Prosolv SMCC90 and SMCCHD90, Vivapur 102, sorbitol, mannitol, ludipress. Direct tableting. Testing pharmacopeial parameters and pharmaceutical availability (using basket and rotating disk methods) of tablets intended for sucking and chewing. Approximation of the obtained results. Grey and green color tablets were obtained with smooth and uniform surface, without stains, spalls or mechanical damage. The determined average mass (weight) of a tablet complied with the standard. The friability and crushing strength test revealed that tablets containing Prosolv SMCCHD90, Vivapur 102 and mannitol demonstrated the highest mechanical strength. Tablets containing these substances and intended for sucking had prolonged disintegration and release time. Tablets intended for chewing had a hardness at the level of 124 N.They demonstrated compressibility, low friability and prolonged release. The release profiles of tablets intended for sucking (v2) and those for chewing, obtained by basket and rotating disk methods, were similar. The addition of Prosolv SMCCHD90, Vivapur 102 and mannitol increased significantly the mechanical strength (higher hardness, lower friability), prolonged the disintegration time and slowed the release from the obtained tablets intended for sucking and chewing. The application of Prosolv SMCCHD90 in the formulation of tablets for chewing carries the risk for sorption of active components to the polymer structure. This process takes place in the early stage of the release. Rotating disk method used in pharmaceutical availability testing gives better results
Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng
2015-10-01
To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.
RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.
Lei, Mei G; Lee, Chia Y
2015-12-01
Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation
Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds
Directory of Open Access Journals (Sweden)
Cataldi Angel A
2011-07-01
Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are
Directory of Open Access Journals (Sweden)
Enrico eMuhr
2016-01-01
Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.
Directory of Open Access Journals (Sweden)
Alexander William Eastman
2015-01-01
Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing
Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban
2017-07-17
Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway
Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M
2016-11-08
Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10
International Nuclear Information System (INIS)
Lucsko, M.; Akerman, M.; Tovar, G. de; Aubert, P.; Chaignon, M.; Le Duc, A.; Guedon, J.; Beaufils, H.
1981-01-01
The value of sequential Tc-99m gluconate scintigraphy investigations following renal transplantation is illustrated with reference to 25 cases. Scintigraphy images are recorded on instantaneous photographic paper and radiological film (early vascular images, early and late static images). Results in various clinical situations are analysed: functioning renal transplants, acute postoperative tubulopathy, reversible acute reject hyperacute reject, chronic reject, lower pole arterial thrombosis, renal artery stenosis, ruptured excretory pathway. Isotopic exploration of this type is simple to conduct, and can be repeated without provoking excessive irradiation of the organism. Comparative analysis of several scintigraphic recordings from the same patient is of diagnostic value in cases of acute rejection, renal artery thrombosis, and ruptured excretory pathways. Renal artery stenosis is poorly demonstrated by this type of investigation [fr
2011-01-01
Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to
Directory of Open Access Journals (Sweden)
Langhoff Jens D
2007-05-01
Full Text Available Abstract Background Several diseases affect bone healing and physiology. Many drugs that are commonly used in orthopaedics as "analgesics" or anti-inflammatory agents impair bone healing. Stressful conditions are associated with decreased serum osteocalcin concentration. High endorphin levels alter calcium metabolism, blocking the membrane channels by which calcium normally enters cells. The consequent decrease of intracellular calcium impairs the activities of calcium-related enzymes. Naloxone is a pure opioid antagonist. Morphine-induced osteocalcin inhibition was abolished when osteoblasts were incubated with naloxone. Naloxone restored the altered cellular and tissue physiology by removing β-endorphins from specific receptors. However, this is only possible if the circulating Ca concentration is adequate. The aim of the present study was to evaluate the efficacy of parenteral naloxone administration in inducing fast mineralization and callus remodelling in a group of sheep with a standardised bone lesion. Methods Twenty ewes were randomly assigned to 4 treatment groups. Group A acted as control, group B received a solution of calcium gluconate, group C a solution of naloxone, and group D a solution of calcium gluconate and naloxone. A transverse hole was drilled in the left metacarpus, including both cortices, then parenteral treatment was administered intramuscularly, daily for four weeks. Healing was evaluated by weekly radiographic examination for eight weeks. For quantitative evaluation, the ratio of the radiographic bone density between the drill area and the adjacent cortical bone was calculated. After eight weeks the sheep were slaughtered and a sample of bone was collected for histopathology Results Group D showed a higher radiographic ratio than the other groups. Sheep not treated with naloxone showed a persistently lower ratio in the lateral than the medial cortex (P Conclusion A low-dose parenteral regimen of naloxone enhances
Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana
2018-04-16
Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for
Directory of Open Access Journals (Sweden)
Astha Agarwal
2013-01-01
Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.
Salimi, Ahmad; Alami, Bahare; Pourahmad, Jalal
2017-08-01
The aim of this study was to assess the cytotoxicity of chlorhexidine gluconate (CHG) on human blood lymphocytes as a useful ex vivo model for accelerated human toxicity studies. Using biochemical and flow cytometry assessments, we demonstrated that addition of CHG at 1 μM concentration to human blood lymphocytes induced cytotoxicity following 6 h. The CHG-induced cytotoxicity on human blood lymphocytes was associated with intracellular reactive oxygen species generation, mitochondrial membrane potential collapse, lysosomal membrane injury, lipid peroxidation, and depletion of glutathione. According to our results, CHG triggers oxidative stress and organelles damages in lymphocytes which are important cells in defense against foreign agents. Finally our findings suggest that using of antioxidants and mitochondrial/lysosomal protective agents could be of benefit for the people in the exposure with CHG. © 2017 Wiley Periodicals, Inc.
Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier
2014-01-01
The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.
Nuntnarumit, Pracha; Sangsuksawang, Nartsiri
2013-04-01
We conducted a randomized controlled trial in neonates with birth weight greater than or equal to 1,500 g that compared 1% aqueous chlorhexidine gluconate (CHG) with 10% povidone-iodine (PI) as a topical antiseptic. We found 1% CHG to be more effective than 1% PI in reducing blood culture contamination rates, and no contact dermatitis was observed.
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari
2012-09-28
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari
2012-01-01
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963
Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin
2013-01-01
The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
Lifescience Database Archive (English)
Full Text Available g children lead to acute diarrhea. Symptoms of rotavirus infection are non-specif...nfectious disease ... Rotavirus A [GN:T40092] Human rotavirus B [GN:T40123] Rotavirus C [GN:T40094] Rotavirus...iption, env_factor) ... AUTHORS ... Bishop RF ... TITLE ... Natural history of human rotavirus...toxins: paradigms for microbial-mucosal interactions. VIII. Pathological consequences of rotavirus
Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich
2016-05-01
Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted
DEFF Research Database (Denmark)
Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence
2005-01-01
Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...
Hambire, Chaitali U; Jawade, Rashmi; Patil, Amol; Wani, Vaibhav R; Kulkarni, Ankur A; Nehete, Parag B
2015-01-01
Dental caries is a multifactorial disease which requires a susceptible host, a cariogenic microflora, and a suitable substrate that must be present for a sufficient length of time. Tea is prepared by the infusion of dried leaves of the tea plant, Camellia sinensis, which contains bioactive compounds like polyphenols, flavonoids, and catechins that are thought to be responsible for the health benefits that have traditionally been attributed to tea. These compounds have multidimensional effects such as antibacterial action, inhibitory action on the bacterial and salivary amylase, and inhibition of acid production. The aim of this study is to compare the antiplaque efficacy of 0.5% C. sinensis extract, 0.05% sodium fluoride, and 0.2% chlorhexidine gluconate mouthwash in children. A randomized blinded controlled trial with 60 healthy children of age group 9-14 years was carried out. The subjects were randomly assigned to three groups, i.e. group A - 0.2% chlorhexidine gluconate, group B - 0.05% sodium fluoride, and group C - 0.5% C. sinensis extract, with 20 subjects per group. Plaque accumulation and gingival condition were recorded using plaque index and gingival index. Oral hygiene was assessed by simplified oral hygiene index (OHIS). Salivary pH was assessed using indikrom pH strips. Plaque, gingival, and simplified OHI scores as well as salivary pH were recorded at baseline, immediately after first rinse, after 1 week, and in the 2(nd) week. The data were analyzed using a computer software program (SPSS version 17). Analysis of variance (ANOVA) tests were used to identify significant differences between the means of the study groups. Finally, paired t-tests were used to assess the significance of changes within each group between time periods. Critical P values of significance were set at 0.05 and the confidence level set at 95%. Mean plaque and gingival scores were reduced over the 2-week trial period in the experimental groups. Antiplaque effectiveness was
Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent
2000-01-01
In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...
Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade
Czech Academy of Sciences Publication Activity Database
Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav
2015-01-01
Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015
Purification and crystallization of Phd, the antitoxin of the phd/doc operon
International Nuclear Information System (INIS)
Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy
2010-01-01
The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein
fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.
Khun, H H; Deved, V; Wong, H; Lee, B C
2000-12-01
The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.
Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA
DEFF Research Database (Denmark)
Poulsen, Peter; Jensen, Kaj Frank
1992-01-01
We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...
Directory of Open Access Journals (Sweden)
Mariana Noelia Viale
2014-01-01
Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.
Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.
Marincola, Gabriella; Wolz, Christiane
2017-06-02
In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
María del Carmen Caamaño
2017-02-01
Full Text Available Objective: To evaluate the effect of intra-articular injections of sodium bicarbonate with a single (SBCG1 or double dose (SBCG2 of calcium gluconate administered monthly compared with methylprednisolone (MP for treatment of knee osteoarthritis. Methods: A 3-month, randomized, double-blind clinical trial with patients diagnosed with knee osteoarthritis (OA. The outcome variables were the Western Ontario-McMaster University Osteoarthritis Index (WOMAC and the Lequesne functional index. Results: After 3 months, all treatments significantly improved in overall WOMAC and Lequesne scores. Mean changes (95% confidence interval in WOMAC total score and the Lequesne index, respectively, for SBCG1 (−12.5 [−14.3, −10.7]; −9.0 [−11.4, −6.7] and SBCG2 (−12.3 [−14.3, −10.4]; −8.9 [−10.4, −7.4] were significantly greater than for MP (−5.0 [−7.2, −2.8]; −3.2 [−4.9, −1.5] ( P < .001. Conclusions: Intra-articular injections of sodium bicarbonate and calcium gluconate are useful for short-term relief of OA symptoms in patients with bilateral knee osteoarthritis. Both treatments are more effective than MP injections in the reduction of knee OA symptoms. Trial Registration: Clinicaltrials.gov NCT00977444
Tirali, Resmiye E; Bodur, Haluk; Sipahi, Bilge; Sungurtekin, Elif
2013-04-01
The objective of this study was to compare the antimicrobial activity of sodium hypochlorite (NaOCl), chlorhexidine gluconate (CHX) and octenidine hydrochloride (OCT) in different concentrations against endodontic pathogens in vitro. Agar diffusion procedure was used to determine the antimicrobial activity of the tested materials. Enterococcus faecalis, Candida albicans and the mixture of these were used for this study. In the agar diffusion test, 5.25% NaOCl exhibited better antimicrobial effect than the other concentrations of NaOCl for all strains. All concentrations of OCT were effective against C. albicans and E. faecalis. Some 0.2% CHX was ineffective on all microorganisms. Antibacterial effectiveness of all experimental solutions decreased on the mixture of all strains. Decreasing concentrations of NaOCl resulted in significantly reduced antimicrobial effect. © 2010 The Authors. Australian Endodontic Journal © 2010 Australian Society of Endodontology.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG
Directory of Open Access Journals (Sweden)
Orlando Díaz-Hernández
2010-07-01
Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions
Burbank, Lindsey P.; Van Horn, Christopher R.
2017-01-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...
Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi
2016-06-01
To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.
Rajagopalan, Ramya; Kroos, Lee
2017-05-15
Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent
Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.
2015-01-01
ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans
Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G
2015-08-01
In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop
DEFF Research Database (Denmark)
Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.
2011-01-01
Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...
Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha
2014-11-01
Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.
Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn
2016-10-01
Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.
Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim
2014-01-01
The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432
Directory of Open Access Journals (Sweden)
Ziqing eDeng
2013-07-01
Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
DEFF Research Database (Denmark)
Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian
1994-01-01
specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...
A case report on a systemic toxicity following ingestion of 20% chlorhexidine gluconate solution
Directory of Open Access Journals (Sweden)
Koiahi-e-Kazerani J
2003-07-01
Full Text Available Chlorhexidine is bonded well to the oral mucosa and dental pellicle and is poorly absorbed from the astrointestinal tract, but in high concentration it is absorbed enough to produce liver necrosis. In this case a dentistry student accidentally ingested a shot of 20% chlorhexidine gluconate solution. Treatments included washing the oral cavity with lots of tooth paste, drinking of 5% alginate syrup and ingestion of 5g small pieces of cork .The following adverse effects were experienced: headache, giddiness, mild mist, euphoria, stomachache, diarrhea and complete loss of taste sensation for 8h, which recurred gradually during the last 48 hours. According to the poor absorption, low toxicity and low concentration of conventional mouthwashes, systemic toxicity following drinking of some shots of this solution is rare. Ultimately if may cause gastritis. Other treatments which are helpful in the same cases are: drinking of hard water, kaolin and tragacant syrup, bicarbonates such as baking soda, carbonates such as beverage , citrates such as lemon-juice and chlorides such as brine and so on.
Lifescience Database Archive (English)
Full Text Available (50-100%). Infectious disease ... Hendra virus [GN:T40046] Nipah virus [GN:T40047...] ... Vector: Pteropus bats (flying foxex) MeSH: D045464 PMID:22483665 (description) ... AUTHORS ... Marsh GA, W
Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model
Cao, Xin; Song, Yongli; Zhang, Tonghua
In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.
Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.
Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef
2016-10-15
Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is
Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P
2000-10-01
Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.
Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.
2011-01-01
The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596
UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon
International Nuclear Information System (INIS)
Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.
1988-01-01
Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs
Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.
Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo
Directory of Open Access Journals (Sweden)
Sweta Shah
2014-01-01
Full Text Available Aim: A prospective study was undertaken to evaluate the use of 2% (w/v alcoholic chlorhexidine gluconate (2% AlcCHG in donor arm preparation, to monitor the contamination rate of blood products after the collection and to find incidence of transfusion associated bacteremia. Settings and Design: Optimal skin antisepsis of the phlebotomy site is essential to minimize the risk of contamination. Food and Drug Administration (FDA in India has recommended antisepsis with three-step regimen of spirit-10% povidone iodine-spirit for donor arm antisepsis, but not with chlorhexidine, which is recommended by many other authors. Material and Methods: A total of 795 donors were studied from July 2011 to January 2012. Spirit-10% povidone iodine-spirit was used for 398 donors and 2% AlcCHG was used for 397 donors with the two-step method for arm antisepsis. Swabs were collected before and after use of antiseptic agents for all the donors. All the blood products collected from donors with growth in post-antisepsis swabs were cultured. A total of 123 various blood products were cultured irrespective of the method and result of antisepsis was observed. A total of seven patients had mild transfusion reaction. The transfused blood products, blood and urine specimen of the patients who had transfusion reaction were also cultured. Results: Seven donors out of 398 donors had growth in post-antisepsis swab with spirit-10% povidone iodine-spirit protocol and three donors out of 397 donors had growth in post-antisepsis swab with 2% AlcCHG protocol. All blood products collected from donors who had growth in post-antisepsis swabs when cultured had no growth. There was no contamination of blood products. Conclusions: Two percent (w/v alcoholic chlorhexidine gluconate with two-step protocol can be used as an antiseptic agent for donor arm preparation without considerable cost difference. It is at par with spirit 10% povidone iodine spirit protocol as suggested by FDA in India
International Nuclear Information System (INIS)
Giroux, Sebastien
1999-01-01
This work deals with the complexation of lanthanide(III) ions by different molecules and with the synthesis of hydrophobic molecules able to extract them of an aqueous solution. Its aim is to describe the systems obtained by the determination of the formation constants of the species and by the description of their structure. The aim of this work is also to obtain a selective complexation of lanthanides(III) towards actinides(III), because this aim presents a great interest in the reprocessing of radioactive wastes. The complexation studies have been followed by potentiometry, NMR, UV-visible spectroscopy and circular dichroism. The first mixtures studied are the couples: lanthanide(III)-gluconic acid (LH). The complexes system they formed has been described and the structures have been specified; a strong complexation has been revealed. The MLH -2 specie induces a selectivity between the lanthanides(III) equivalent to those obtained with EDTA and its uncharged character allows to consider the use of gluconic acid as extractant. The use of ligands as glucosaminic acid or glucamine slows the beginning of the complexation until pH= 6-7. The neutral specie MLH -2 is formed too. In order to use the complexing properties of gluconic acid and its selective character towards lanthanides(III), the synthesis of molecules derived containing a long alkyl chain with a hydrophobic character has been carried out for using them as extracting agents. An original method of the preparation of tartramides is presented. This preparation consists of an amidation of one of the carboxylic functions of the tartaric acid by a fatty amine. These molecules, surface-active, complex the lanthanides(III) and extract them in an organic phase using the tri-n-butyl phosphate as co-extractant. (O.M.)
Role of the Escherichia coli glnALG operon in regulation of ammonium transport
International Nuclear Information System (INIS)
Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.
1986-01-01
Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt
Value of prophylactic epilepsy surgery in contemporary neurosurgical practice
International Nuclear Information System (INIS)
Sugano, Hidenori; Arai, Hajime
2010-01-01
We have examined the value of prophylactic epilepsy surgery in diseases leading to intractable epilepsy. We reviewed 11 glioneuronal tumors (GNT) including gangliogliomas and dysembryoplastic neuroepithelial tumors, 11 cortical dysplasia (CD), and 33 cavernous angiomas (CA) diagnosed with MRI between the years 2000 and 2008 at the Department of Neurosurgery of Juntendo University in this study. We analyzed retrospectively the followings. Age of seizure onset and seizure severity. Region of each disease leading to intractable epilepsy. Seizure outcome after the surgery. Surgical morbidity. Ages of seizure onset of GNT, CD, and CA were 21.0±12.1, 1.3±7.5, 24.8±18.1 years, respectively. 81.8% of CD and GNT were intractable, however CA progresses to intractable epilepsy in 48.5%. The 66.7% of GNT with intractable seizures located in the mesial temporal lobe and 66.7% of CD had entra-temporal location. CA located in the mesial temporal lobe progressed to intractable epilepsy in 80%. Seizure free ratios of GNT, CD, and CA were 87.5%, 50.0%, 81.3%, respectively. In CDs where was impossible to carry out complete resection resulted in residual seizures. Neurological sequelae after surgery were observed in 3 cases. Morbidity ratios of motor weakness, speech difficulty, and memory disturbances are 4.6%, 4.6%, 2.3%, respectively. Majority of CD, GNT, and CA located in the mesial temporal lobe progress towards intractable epilepsy. Prophylactic epilepsy surgery by experienced surgeon with low complication rates can be an acceptable alternative for these pathological conditions. Seizure outcome of surgery for CD does not reach the success rates of those in GNT and CA. The cause of the unfavorable result in CD is the inapplicability to eloquent areas. Aggressive early surgery for CD may improve outcome considering neuronal plasticity of childhood. (author)
Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...
Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan
2014-11-01
The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.
Archana, G.; Naresh Kumar, G.
2014-01-01
Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024
Directory of Open Access Journals (Sweden)
Kavita Yadav
Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.
Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari
2017-03-01
In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.
Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul
2015-08-18
Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis
Ahn, Sang-Joon; Burne, Robert A.
2006-01-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...
Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro
2015-12-28
The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological
Directory of Open Access Journals (Sweden)
Silvia Dossena
2013-12-01
Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.
Directory of Open Access Journals (Sweden)
Altenbuchner Josef
2011-10-01
Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on
International Nuclear Information System (INIS)
Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.
2011-01-01
Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein
Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.
Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S
2006-03-01
Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.
Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka
2017-08-15
Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the
Directory of Open Access Journals (Sweden)
Keyhani Nemat O
2004-06-01
Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered
Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575
DEFF Research Database (Denmark)
Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø
1997-01-01
A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...
Directory of Open Access Journals (Sweden)
Bianca Schwartbeck
2016-11-01
Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.
Lifescience Database Archive (English)
Full Text Available ) Enterovirus B [GN:T40104] Enterovirus C [GN:T40105] Enterovirus D [GN:T40106] Human echovirus 1 Human enterovirus...ong SC, Lewthwaite P, Cardosa MJ, Solomon T ... TITLE ... Clinical features, diagnosis, and management of enterovirus...Epidemiologic features of hand-foot-mouth disease and herpangina caused by enterovirus 71 in Taiwan, 1998-2005. ... JOURNAL ... Pediatrics 120:e244-52 (2007) DOI:10.1542/peds.2006-3331 ...se RNA viruses from the enterovirus genus in the family Picornaviridae. They are major public health issues ... H00393 Enterovirus infection Enteroviruses (EVs) are single-stranded, positive-sen
Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S
2000-01-01
A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln
Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...
International Nuclear Information System (INIS)
Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.
1988-01-01
We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Economic impact of Tegaderm chlorhexidine gluconate (CHG) dressing in critically ill patients.
Thokala, Praveen; Arrowsmith, Martin; Poku, Edith; Martyn-St James, Marissa; Anderson, Jeff; Foster, Steve; Elliott, Tom; Whitehouse, Tony
2016-09-01
To estimate the economic impact of a Tegaderm TM chlorhexidine gluconate (CHG) gel dressing compared with a standard intravenous (i.v.) dressing (defined as non-antimicrobial transparent film dressing), used for insertion site care of short-term central venous and arterial catheters (intravascular catheters) in adult critical care patients using a cost-consequence model populated with data from published sources. A decision analytical cost-consequence model was developed which assigned each patient with an indwelling intravascular catheter and a standard dressing, a baseline risk of associated dermatitis, local infection at the catheter insertion site and catheter-related bloodstream infections (CRBSI), estimated from published secondary sources. The risks of these events for patients with a Tegaderm CHG were estimated by applying the effectiveness parameters from the clinical review to the baseline risks. Costs were accrued through costs of intervention (i.e. Tegaderm CHG or standard intravenous dressing) and hospital treatment costs depended on whether the patients had local dermatitis, local infection or CRBSI. Total costs were estimated as mean values of 10,000 probabilistic sensitivity analysis (PSA) runs. Tegaderm CHG resulted in an average cost-saving of £77 per patient in an intensive care unit. Tegaderm CHG also has a 98.5% probability of being cost-saving compared to standard i.v. dressings. The analyses suggest that Tegaderm CHG is a cost-saving strategy to reduce CRBSI and the results were robust to sensitivity analyses.
Effects of single intratracheal exposure to chlorhexidine gluconate on the rat lung.
Orito, Kensuke; Hashida, Masaru; Hirata, Kiyotaka; Kurokawa, Akira; Shirai, Mitsuyuki; Akahori, Fumiaki
2006-01-01
Chlorhexidine gluconate (CHX) is an antiseptic that has been widely used for disinfection of cutaneous wound and gingivae. Recently, a patient who inhaled CHX solution died from acute respiratory distress syndrome (ARDS). Although it is highly possible that direct pulmonary damage might be the cause of ARDS, there is no preclinical information about the pulmonary toxicity of CHX. In the current study, the acute direct action of CHX to the lung was evaluated in rats. We successfully exposed the left but not the right lung either to CHX at concentrations of 1%, 0.1%, and 0.01% or to saline using a curved-tip administration tube. At the higher concentrations of CHX (0.1% and 1%), severe congestion to the alveoli and capillaries and perivascular and intra-alveolar hemorrhages were observed 1 day after exposure. Aniline blue-stained collagen fibers with an infiltration of inflammatory cells were present 7 days after exposure. The fibrotic changes and intra-alveolar inflammatory cells had decreased but were still observed sporadically 28 and 84 days after exposure. These detrimental effects were more severe at 1% than at 0.1% CHX. No remarkable effect was observed after exposures to 0.01% CHX and saline. We were able to evaluate the time-course changes in the pulmonary toxicity of CHX by exposures limited to the left lung. It is highly possible that CHX at a concentration of more than 0.1% might directly induce ARDS when aspirated and reaching to the alveoli.
Directory of Open Access Journals (Sweden)
Carlos F. Araujo-Lima
2017-01-01
Full Text Available Sclerosing agents as zinc gluconate-based chemical sterilants (Infertile® are used for chemical castration. This solution is injected into the animal testis, but there are not enough evidences of its safety profiles for the receivers. The present work aimed to establish the pharmacokinetics and toxicological activity of Infertile, using in vitro and in silico approaches. The evaluation at the endpoint showed effects in a dose-dependent manner. Since necrosis is potentially carcinogenic, the possible cell death mechanism could be apoptosis. Our data suggested that Infertile at 60 mM presented risk for animal health. Even though Infertile is a licensed product by the Brazilian Ministry of Agriculture, Livestock and Supply, it presented a high mutagenic potential. We suggest that the optimal dose must be less than 6 mM, once, at this concentration, no mutagenicity or genotoxicity was observed.
Directory of Open Access Journals (Sweden)
Gary Tran
2016-07-01
Full Text Available Chlorhexidine gluconate (CHG is a widely used antiseptic agent for skin and wound disinfection. The cationic properties of CHG may allow its inactivation and precipitation by anionic agents in commonly used topical agents. We conducted a systematic review by searching through PubMed, Cochrane Library, and Web of Science databases and selected original research articles reporting on CHG incompatibility, defined as inactivation or precipitation. The search yielded 22 publications that demonstrated CHG incompatibility via: 1 reduced antibacterial activity (carbomer, acrylates/C10-C30 alkyl acrylate crosspolymer, dentin, bovine serum albumin, copolymer M239144, sodium lauryl sulfate, heat-killed microbes, triethanolamine, and bark cork; and 2 visible precipitate formation (sodium hypochlorite, EDTA, saline, ethanol, andnystatin. Only three publications reported on CHG incompatibility in dermatology, specifically for carbomer, triethanolamine, and acrylates/C10-C30 alkyl acrylate crosspolymer. Although limited evidence linking CHG incompatibility and anionic agents exists, clinicians should carefully consider the nature of topical agents used if CHG is concurrently applied. Increased awareness of CHG incompatibility may result in better antibacterial activity thus ensuring optimal patient management.
Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier
2017-07-01
Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.
MEIJER, WG
1994-01-01
During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic
Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia
2016-08-01
Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
DEFF Research Database (Denmark)
Larsen, Jesper; Kuhnert, Peter; Frey, Joachim
2007-01-01
subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...
Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W
2011-12-01
Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.
Burbank, Lindsey P; Van Horn, Christopher R
2017-11-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence
DEFF Research Database (Denmark)
Revelles, O.; Espinosa-Urgel, M.; Molin, Søren
2004-01-01
-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...
Lifescience Database Archive (English)
Full Text Available H00378 Lyssavirus infection; Rabies-related virus infection Lyssaviruses are a gro...up of viruses that includes rabies virus and other rabies-related bat lyssaviruses. Rabies-related lyssaviru...23] European bat lyssavirus 1 [GN:T40024] European bat lyssavirus 2 [GN:T40025] ... Rabies vaccine [DR:D06504] Rabies
Lifescience Database Archive (English)
Full Text Available H00379 Mosquito-borne viral encephalitis, including: Japanese encephalitis [DS:H01533]; Western equine... encephalitis [DS:H01534]; Eastern equine encephalitis [DS:H01535]; Australian encephali...0052] (Japanese encephalitis) Western equine encephalitis virus [GN:T40053] (Western equine encephalitis) Eastern equine... encephalitis virus [GN:T40054] (Eastern equine encephalitis) Murray
Directory of Open Access Journals (Sweden)
Uzma Qaisar
Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.
Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M
2001-04-01
We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.
Dash, Hirak R; Basu, Subham; Das, Surajit
2017-04-01
Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.
Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V
2016-05-13
Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Álvarez-Morales Ariel
2011-05-01
Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.
The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.
Ahn, Sang-Joon; Burne, Robert A
2006-10-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.
Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H
2014-02-01
A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier
2017-01-01
The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.
HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.
Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong
2016-01-01
Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A
2017-11-01
The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and
Directory of Open Access Journals (Sweden)
Opsata Mona
2010-08-01
Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.
Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar
2011-06-10
The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.
Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon
DEFF Research Database (Denmark)
van Wezel, G P; Krab, I M; Douthwaite, S
1994-01-01
Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...
Directory of Open Access Journals (Sweden)
April M Sapp
Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and
Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel
2014-01-01
Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.
Hsieh, Ching-Shui; Cheng, Hsiu-Chi; Lin, Jen-Shiou; Kuo, Shou-Jen; Chen, Yao-Li
2014-01-01
This trial was designed to compare the efficacy of 4% chlorhexidine gluconate (CHG) with normal saline (NS) as a predisinfection skin-scrub solution prior to standard presurgical skin preparation. Data was collected at a single transplantation center where patients electing resection of hepatic tumors were recruited between October 2011 and September 2012. In total, 100 patients were consecutively enrolled for random assignment to either 4% CHG or NS as a predisinfection skin-scrub solution prior to surgery. Our aim was to assess the comparative antiseptic efficacy of CHG in this setting, focusing on cutaneous microbial colonization (at baseline, preoperatively, and postoperatively) and postsurgical site infections as primary outcome measures. Positivity rates of baseline, preoperative, and postoperative cultures were similar for both groups, showing significant declines (relative to baseline) after skin preparation and no significant postsurgical rebound. Rates of surgical site infection were also similar in both groups (CHG, 6.0%; NS, 4.1%; P = 1.0). For patients with hepatic tumors undergoing hepatectomy, the effect of 4% CHG as a predisinfection scrub solution was similar to that of NS in terms of skin decontamination and surgical site infections.
Directory of Open Access Journals (Sweden)
Jaykumar R Gade
2011-01-01
Full Text Available Denture stomatitis is a condition associated with wearing of a denture. The predisposing factor leading to denture stomatitis could be poor oral hygiene, ill-fitting denture and relief areas. Around 30 patients with denture stomatitis were advised to rinse with chlorhexidine gluconate mouthwash for 14 days and were directed to immerse the upper denture in the chlorhexidine solution for 8 hours. The samples were collected by scraping maxillary denture in saline at three intervals, prior to, at the end of 24 hours and after 14 days of treatment, then were inoculated and quantitative estimation of the yeast growth on Sabouraud′s dextrose agar plate was done. It was observed that after a period of 14 days, there was a reduction in the growth of yeast and also improvement in the clinical picture of the oral mucosa
International Nuclear Information System (INIS)
Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo
2005-01-01
The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory
Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546
Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul
2017-07-15
The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory
Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression
Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet
2015-01-01
Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450
Meijer, W.G; van den Bergh, E.R E; Smith, L.M
In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence
Directory of Open Access Journals (Sweden)
Kolahi Kazerani G
2003-08-01
Full Text Available Statement of Problem: The role of the microbial plaque in caries etiology and periodontal diseases has been"nproved and the mechanical methods for plaque control have special limitations, consequently, chemical"nmethods have been suggested. One of the most effective materials is Chlorhexidine Gluconate that is"ncommonly used as mouth rinses. However, the medicated formulations of chewing gums, due to several"nproperties, have been paid attention. It should be noted that a new formulation to satisfy the consumers' taste"nseems necessary."nPurpose: The aim of this study was to present a new formulation for chewing gums containing chlorhexidine"nto achieve a pleasant taste coupled with their effectiveness and anti-plaque properties maintenance."nMaterials and Methods: In this double blind, crossover, prospective clinical trial, 18 volunteers were"ninvestigated. Chlorhexidine Gluconate was used and added to the gum-base by Manitole. In order to cover the"nbitter taste of the drug Aspartam, mint essence and Mentole were used. After gums production, the profile of"ndrug dissolution was evaluated by jaw movement simulating system. It took 5 days to study each type of"nchewing gums without any mechanical plaque control method. Medicated and placebo chewing gums were"nidentical in shape, size, color and formulation. The washout period was 2 days. Chewing gums were used"nevery 12 hours for 20 minutes. To determine plaque score, Turesky- Gilmore- Glickman modification index"nwas used. Other variables including: subjective evaluation of taste, cleansing effect and taste disturbance were"nassessed through filling a checklist. The data were analyzed by Paired t test and Wilcoxon test."nResults: During 20 mins, 80% of the drug was released from the gum-base. The mean difference of plaque"nscore between the initial and final stages at the first trial was -0.1589 and at the second trial was 2.994 which"nwas statistically significant (P<0.001. Subjective
Induction of the mar operon by miscellaneous groceries.
Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P
2004-01-01
To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
When a liquid culture of Serratia spp. reaches the last part of the logarithmic phase of growth it induces the synthesis of several extracellular hydrolytic enzymes. In this communication we show that synthesis and secretion of the extracellular phospholipase is coupled to expression of flagella....... Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...
Feng, Youjun; Kumar, Ritesh; Ravcheev, Dmitry A; Zhang, Huimin
2015-08-01
Recently, we determined that BioR, the GntR family of transcription factor, acts as a repressor for biotin metabolism exclusively distributed in certain species of α-proteobacteria, including the zoonotic agent Brucella melitensis and the plant pathogen Agrobacterium tumefaciens. However, the scenario is unusual in Paracoccus denitrificans, another closely related member of the same phylum α-proteobacteria featuring with denitrification. Not only does it encode two BioR homologs Pden_1431 and Pden_2922 (designated as BioR1 and BioR2, respectively), but also has six predictive BioR-recognizable sites (the two bioR homolog each has one site, whereas the two bio operons (bioBFDAGC and bioYB) each contains two tandem BioR boxes). It raised the possibility that unexpected complexity is present in BioR-mediated biotin regulation. Here we report that this is the case. The identity of the purified BioR proteins (BioR1 and BioR2) was confirmed with LC-QToF-MS. Phylogenetic analyses combined with GC percentage raised a possibility that the bioR2 gene might be acquired by horizontal gene transfer. Gel shift assays revealed that the predicted BioR-binding sites are functional for the two BioR homologs, in much similarity to the scenario seen with the BioR site of A. tumefaciens bioBFDAZ. Using the A. tumefaciens reporter system carrying a plasmid-borne LacZ fusion, we revealed that the two homologs of P. denitrificans BioR are functional repressors for biotin metabolism. As anticipated, not only does the addition of exogenous biotin stimulate efficiently the expression of bioYB operon encoding biotin transport/uptake system BioY, but also inhibits the transcription of the bioBFDAGC operon resembling the de novo biotin synthetic pathway. EMSA-based screening failed to demonstrate that the biotin-related metabolite is involved in BioR-DNA interplay, which is consistent with our former observation with Brucella BioR. Our finding defined a complex regulatory network for biotin
Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism
Xu, Jie; Zhang, Huimin; Srinivas, Swaminath
2013-01-01
The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of
Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A
2015-09-01
Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Rathi S
2003-11-01
Full Text Available BACKGROUND: Drugs used in PKDL include parenteral sodium antimony gluconate (SAG, amphotericin-B, pentamidine, and ketoconazole (KTZ. SAG is the most effective one. Given alone, SAG has to be given for a long duration, leading to poor patient compliance and treatment failure. This study was carried out to compare the effectiness of SAG alone and a combination of SAG and KTZ for sixty days. METHODS: Ten patients of PKDL were included in the study. Five patients (Group A were given SAG intravenously, in the dose of 20 mg/kg per day and five (Group B were given SAG (intravenously 20 mg/kg per day and KTZ (200 mg twice daily orally. Both treatment regimens were given for sixty days. RESULTS: In Group A, the nodules and/or plaques showed approximate 80-85% clinical improvement, and macules showed 25-30% improvement. In group B (SAG + KTZ, there was 90-95% clinical improvement in the nodules and/or plaques and 25-30% in macules. CONCLUSION: This study suggests the therapeutic superiority of the combination treatment regimen in a shorter duration but is not conclusive as the number of patients was low. Further trials are recommended.
Wang, Xun; Ji, Sang Chun; Yun, Sang Hoon; Jeon, Heung Jin; Kim, Si Wouk
2014-01-01
The gal operon of Escherichia coli has 4 cistrons, galE, galT, galK, and galM. In our previous report (H. J. Lee, H. J. Jeon, S. C. Ji, S. H. Yun, H. M. Lim, J. Mol. Biol. 378:318–327, 2008), we identified 6 different mRNA species, mE1, mE2, mT1, mK1, mK2, and mM1, in the gal operon and mapped these mRNAs. The mRNA map suggests a gradient of gene expression known as natural polarity. In this study, we investigated how the mRNAs are generated to understand the cause of natural polarity. Results indicated that mE1, mT1, mK1, and mM1, whose 3′ ends are located at the end of each cistron, are generated by transcription termination. Since each transcription termination is operating with a certain frequency and those 4 mRNAs have 5′ ends at the transcription initiation site(s), these transcription terminations are the basic cause of natural polarity. Transcription terminations at galE-galT and galT-galK junctions, making mE1 and mT1, are Rho dependent. However, the terminations to make mK1 and mM1 are partially Rho dependent. The 5′ ends of mK2 are generated by an endonucleolytic cleavage of a pre-mK2 by RNase P, and the 3′ ends are generated by Rho termination 260 nucleotides before the end of the operon. The 5′ portion of pre-mK2 is likely to become mE2. These results also suggested that galK expression could be regulated through mK2 production independent from natural polarity. PMID:24794565
Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions
Römling, Ute; Galperin, Michael Y.
2015-01-01
Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867
Yadav, Kavita; Kumar, Chanchal; Archana, G.; Naresh Kumar, G.
2014-01-01
Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) s...
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
Taller, S H
1993-01-01
The purpose of this study was to determine the effectiveness of a baking soda/hydrogen peroxide dentifrice, Mentadent, and a 0.12 percent chlorhexidine gluconate mouthrinse, Peridex, in reducing gingival bleeding. Forty subjects were divided into three groups; the baking soda group, the chlorhexidine group and the control group. All groups received oral hygiene instruction and brushed and flossed three times per day. Bleeding point scores were evaluated at baseline and at five weeks. The baking soda/hydrogen peroxide group used the supplied dentifrice as their sole toothpaste. The 0.12 percent chlorhexidine group used the mouthrinse twice per day. The control group performed oral hygiene as instructed. At five weeks, the 0.12 percent chlorhexidine mouthrinse significantly reduced gingival bleeding. The dentifrice and control groups revealed no statistically significant reductions. The results indicate that the 0.12 percent chlorhexidine mouthrinse is useful in improving oral health, whereas the baking soda/hydrogen peroxide dentifrice offered no advantages to conventional oral hygiene.
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....
Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D
2011-04-01
An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.
Mn bioavailability by polarized Caco-2 cells: comparison between Mn gluconate and Mn oxyprolinate
Directory of Open Access Journals (Sweden)
Fulgenzi Alessandro
2011-07-01
Full Text Available Abstract Background Micronutrient inadequate intake is responsible of pathological deficiencies and there is a need of assessing the effectiveness of metal supplementation, frequently proposed to rebalance poor diets. Manganese (Mn is present in many enzymatic intracellular systems crucial for the regulation of cell metabolism, and is contained in commercially available metal supplements. Methods We compared the effects of two different commercial Mn forms, gluconate (MnGluc and oxyprolinate (MnOxP. For this purpose we used the polarized Caco-2 cells cultured on transwell filters, an established in vitro model of intestinal epithelium. Since micronutrient deficiency may accelerate mitochondrial efficiency, the mitochondrial response of these cells, in the presence of MnGluc and MnOxP, by microscopy methods and by ATP luminescence assay was used. Results In the presence of both MnOxP and MnGluc a sustained mitochondrial activity was shown by mitoTraker labeling (indicative of mitochondrial respiration, but ATP intracellular content remained comparable to untreated cells only in the presence of MnOxP. In addition MnOxP transiently up-regulated the antioxidant enzyme Mn superoxide dismutase more efficiently than MnGluc. Both metal treatments preserved NADH and βNADPH diaphorase oxidative activity, avoided mitochondrial dysfunction, as assessed by the absence of a sustained phosphoERK activation, and were able to maintain cell viability. Conclusions Collectively, our data indicate that MnOxP and MnGluc, and primarily the former, produce a moderate and safe modification of Caco-2 cell metabolism, by activating positive enzymatic mechanisms, thus could contribute to long-term maintenance of cell homeostasis.
Marbach, Anja; Bettenbrock, Katja
2012-01-01
Most commonly used expression systems in bacteria are based on the Escherichia coli lac promoter. Furthermore, lac operon elements are used today in systems and synthetic biology. In the majority of the cases the gratuitous inducers IPTG or TMG are used. Here we report a systematic comparison of lac promoter induction by TMG and IPTG which focuses on the aspects inducer uptake, population heterogeneity and a potential influence of the transacetylase, LacA. We provide induction curves in E. coli LJ110 and in isogenic lacY and lacA mutant strains and we show that both inducers are substrates of the lactose permease at low inducer concentrations but can also enter cells independently of lactose permease if present at higher concentrations. Using a gfp reporter strain we compared TMG and IPTG induction at single cell level and showed that bimodal induction with IPTG occurred at approximately ten-fold lower concentrations than with TMG. Furthermore, we observed that lac operon induction is influenced by the transacetylase, LacA. By comparing two Plac-gfp reporter strains with and without a lacA deletion we could show that in the lacA(+) strain the fluorescence level decreased after few hours while the fluorescence further increased in the lacA(-) strain. The results indicate that through the activity of LacA the IPTG concentration can be reduced below an inducing threshold concentration-an influence that should be considered if low inducer amounts are used. Copyright © 2011 Elsevier B.V. All rights reserved.
Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C
2018-06-01
Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Lewis, Jeffrey A; Boyd, Jeffrey M; Downs, Diana M; Escalante-Semerena, Jorge C
2009-04-01
In Salmonella enterica, tricarballylate (Tcb) catabolism requires function of TcuB, a membrane-bound protein that contains [4Fe-4S] clusters and heme. TcuB transfers electrons from reduced flavin adenine dinucleotide in the Tcb dehydrogenase (TcuA) to electron acceptors in the membrane. We recently showed that functions needed to assemble [Fe-S] clusters (i.e., the iscRSUA-hscBA-fdx operon) compensate for the lack of ApbC during growth of an apbC strain on Tcb. ApbC had been linked to [Fe-S] cluster metabolism, and we showed that an apbC strain had decreased TcuB activity. Here we report findings that expand our understanding of the regulation of expression of the iscRSUA genes in Salmonella enterica. We investigated why low levels of glucose or other saccharides restored growth of an apbC strain on Tcb. Here we report the following findings. (i) A Cra. (iv) Putative Cra binding sites are present in the regulatory region of the iscRSUA operon. (v) Cra protein binds to all three sites in the iscRSUA promoter region in a concentration-dependent fashion. To our knowledge, this is the first report of the involvement of Cra in [Fe-S] cluster assembly.
Directory of Open Access Journals (Sweden)
Dajun Sun
2018-01-01
Full Text Available The objective of this study was to evaluate physicochemical equivalence between brand (i.e., Ferrlecit and generic sodium ferric gluconate (SFG in sucrose injection by conducting a series of comparative in vitro characterizations using advanced analytical techniques. The elemental iron and carbon content, thermal properties, viscosity, particle size, zeta potential, sedimentation coefficient, and molecular weight were determined. There was no noticeable difference between brand and generic SFG in sucrose injection for the above physical parameters evaluated, except for the sedimentation coefficient determined by sedimentation velocity analytical ultracentrifugation (SV-AUC and molecular weight by asymmetric field flow fractionation-multi-angle light scattering (AFFF-MALS. In addition, brand and generic SFG complex products showed comparable molecular weight distributions when determined by gel permeation chromatography (GPC. The observed minor differences between brand and generic SFG, such as sedimentation coefficient, do not impact their biological activities in separate studies of in vitro cellular uptake and rat biodistribution. Coupled with the ongoing clinical study comparing the labile iron level in healthy volunteers, the FDA-funded post-market studies intended to illustrate comprehensive surveillance efforts ensuring safety and efficacy profiles of generic SFG complex in sucrose injection, and also to shed new light on the approval standards on generic parenteral iron colloidal products.
Sizemore, C; Geissdörfer, W; Hillen, W
1993-03-01
The luxA,B genes from the Gram-negative marine bacterium Vibrio harveyi MAV were used in Staphylococcus carnosus TM300 as a reporter system for regulated expression of xylose utilization. The luciferase genes were fused to the xyl operon from Staphylococcus xylosus C2a. Expression of bioluminescence was induced through addition of xylose and repressed in the presence of glucose. A method to quantitate bioluminescence directly from the culture is described.
DEFF Research Database (Denmark)
Hilden, Ida; Krath, Britta N.; Hove-Jensen, Bjarne
1995-01-01
The gcaD, prs, and ctc genes were shown to be organized as a tricistronic operon. The transcription of the prs gene, measured as phosphoribosyl diphosphate synthetase activity, and of the ctc gene, measured as β-galactosidase activity specified by a ctc-lacZ protein fusion, were dependent...
Directory of Open Access Journals (Sweden)
Tingting Xu
Full Text Available Expression of autonomous bioluminescence from human cells was previously reported to be impossible, suggesting that all bioluminescent-based mammalian reporter systems must therefore require application of a potentially influential chemical substrate. While this was disproven when the bacterial luciferase (lux cassette was demonstrated to function in a human cell, its expression required multiple genetic constructs, was functional in only a single cell type, and generated a significantly reduced signal compared to substrate-requiring systems. Here we investigate the use of a humanized, viral 2A-linked lux genetic architecture for the efficient introduction of an autobioluminescent phenotype across a variety of human cell lines.The lux cassette was codon optimized and assembled into a synthetic human expression operon using viral 2A elements as linker regions. Human kidney, breast cancer, and colorectal cancer cell lines were both transiently and stably transfected with the humanized operon and the resulting autobioluminescent phenotype was evaluated using common imaging instrumentation. Autobioluminescent cells were screened for cytotoxic effects resulting from lux expression and their utility as bioreporters was evaluated through the demonstration of repeated monitoring of single populations over a prolonged period using both a modified E-SCREEN assay for estrogen detection and a classical cytotoxic compound detection assay for the antibiotic Zeocin. Furthermore, the use of self-directed bioluminescent initiation in response to target detection was assessed to determine its amenability towards deployment as fully autonomous sensors. In all cases, bioluminescent measurements were supported with traditional genetic and transcriptomic evaluations.Our results demonstrate that the viral 2A-linked, humanized lux genetic architecture successfully produced autobioluminescent phenotypes in all cell lines tested without the induction of cytotoxicity
DEFF Research Database (Denmark)
Johansen, L.E.; Nygaard, P.; Lassen, C.
2003-01-01
In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt...
Bettin, K; Clabots, C; Mathie, P; Willard, K; Gerding, D N
1994-11-01
To compare liquid soap versus 4% chlorhexidine gluconate in 4% alcohol for the decontamination of bare or gloved hands inoculated with an epidemic strain of Clostridium difficile. C difficile (6.7 log10 colony-forming units [CFU], 47% spores), was seeded onto bare or latex gloved hands of ten volunteers and allowed to dry. Half the volunteers initially washed with soap and half with chlorhexidine, followed by the other agent 1 week later. Cultures were done with Rodac plates at three sites on the hand: finger/thumbtips, the palmar surfaces of the fingers, and the palm. Statistical comparison was by paired Student's t test. On bare hands, soap and chlorhexidine did not differ in residual bacterial counts on the finger/thumbtips (log10 CFU, 2.0 and 2.1, P = NS) and fingers (log10 CFU, 2.4 and 2.5, P = NS). Counts were too high on bare palms to quantitate. On gloved hands, soap was more effective than chlorhexidine on fingers (log10 CFU 1.3 and 1.7, P soap wash than following chlorhexidine wash. These observations support the use of either soap or chlorhexidine as a handwash for removal of C difficile, but efficacy in the prevention of C difficile transmission must be determined by prospective clinical trials.
Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya
2015-01-01
Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.
Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis
DEFF Research Database (Denmark)
Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal
2005-01-01
control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...
Energy Technology Data Exchange (ETDEWEB)
Priyadarshini, Balasankar Meera; Fawzy, Amr S., E-mail: denasfmf@nus.edu.sg [National University of Singapore, Discipline of Oral Sciences, Faculty of Dentistry (Singapore)
2017-04-15
In this work, the commercial polyvinylpyrrolidone (PVP)-capped silver nanospheres (Ag-NSP) were surface decorated with chlorhexidine gluconate (CHXg) for potentiating the antibacterial properties of Ag-NSP. Different formulations of CHXg-loaded Ag-NSP (Ag-NSP/CHXg) were prepared by varying the incubation times (0.5, 1.5, and 3 h). A thorough characterization of Ag-NSP/CHXg nanospheres has been carried out by dynamic light scattering (DLS), transmission electron microscopy (TEM), energy-dispersive surface elemental composition spectral analysis (SEM/EDX), Fourier transform infrared spectroscopy (FTIR), percentage (%) CHXg loading efficiency (LE), in vitro CHXg and Ag{sup +} ion release, antibacterial/biofilm inhibition assay, and human mesenchymal stem cells (hMSCs) cytotoxicity evaluation. DLS measured nanospheres to be <160 nm and indicated that CHXg treatment drastically shifted the surface charge from negative to high positive values, with homogenous distribution. TEM revealed spherical Ag-NSP/CHXg nanospheres with a clearly visible surface coating of CHXg. FTIR confirmed association of CHXg with Ag-NSP nanospheres, whereas SEM/EDX data verified presence of spectral peaks specific to silver (Ag), CHXg, and PVP. The %LE gradually increased with increasing incubation times. In vitro CHXg release exhibited a bi-phasic fashion showing maximum release of ~74.83 ± 20.67% from Ag-NSP/CHXg-3h at 14 days. A slow release of Ag{sup +} ions was detected; however, the surface decoration of Ag-NSP substantially hampered/restricted the liberation of ions. Agar well diffusion, MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl) -2H–tetrazolium), and crystal violet assay suggested good antibacterial/antibiofilm activity of Ag-NSP/CHXg that correlated with the increasing %LE of nanospheres. hMSCs cytotoxicity study showed low toxicity properties of all nanosphere formulations, except for Ag-NSP/CHXg-3h, affecting the cell viability at all
Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J
2015-06-19
The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and
Varmanen, P; Rantanen, T; Palva, A
1996-12-01
A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.
International Nuclear Information System (INIS)
Kuzmann, E.; Stichleutner, S.; Homonnay, Z.; Vertes, A.; Doyle, O.; Chisholm, C.U.; El-Sharif, M.
2005-01-01
Constant current technique was applied to electrodeposit tin-containing coatings such as tin-cobalt (Sn-Co), tin-iron (Sn-Fe) and a novel tin-cobalt-iron (Sn-Co-Fe) from a gluconate bath. The effect of plating parameters (current density, deposition time at an electrolyte temperature of 60 deg. C and pH=7.0) on phase composition, crystal structure and magnetic anisotropy of alloy deposits has been investigated mainly by 57Fe CEMS, 119Sn CEMS and transmission Moessbauer Spectroscopy as well as XRD. 57Fe and 119Sn CEM spectra and XRD reflect that the dominant phases of the deposits are orthorhombic Co3Sn2, tetragonal FeSn2 or amorphous Fe-Sn and amorphous Sn-Co-Fe in Sn-Co, Sn-Fe and Sn-Co-Fe coatings, respectively. Furthermore, the relative area of the 2nd and 5th lines of the sextets representing the magnetic iron containing phases decreases continuously with increasing current density in all Fe-containing deposits. At the same time, no essential change in the magnetic anisotropy can be found with the plating time. 119Sn spectra reveal the presence of small amount of β-Sn besides the main phases in Sn-Fe and in the Sn-Co coatings. Magnetically split 119Sn spectra reflecting transferred hyperfine field were observed in the case of Co-Sn-Fe coatings
Energy Technology Data Exchange (ETDEWEB)
Kuzmann, E; Stichleutner, S; Homonnay, Z; Vertes, A [Department of Nulear Chemistry, Hungarian Academy of Sciences, Eoetvoes University, Budapest (Hungary); Research Group for Nuclear Methods in Structural Chemistry, Hungarian Academy of Sciences, Eoetvoes University, Budapest (Hungary); Doyle, O; Chisholm, C U; El-Sharif, M [Glasgow Caledonian University, Glasgow, Scotland (United Kingdom)
2005-04-26
Constant current technique was applied to electrodeposit tin-containing coatings such as tin-cobalt (Sn-Co), tin-iron (Sn-Fe) and a novel tin-cobalt-iron (Sn-Co-Fe) from a gluconate bath. The effect of plating parameters (current density, deposition time at an electrolyte temperature of 60 deg. C and pH=7.0) on phase composition, crystal structure and magnetic anisotropy of alloy deposits has been investigated mainly by 57Fe CEMS, 119Sn CEMS and transmission Moessbauer Spectroscopy as well as XRD. 57Fe and 119Sn CEM spectra and XRD reflect that the dominant phases of the deposits are orthorhombic Co3Sn2, tetragonal FeSn2 or amorphous Fe-Sn and amorphous Sn-Co-Fe in Sn-Co, Sn-Fe and Sn-Co-Fe coatings, respectively. Furthermore, the relative area of the 2nd and 5th lines of the sextets representing the magnetic iron containing phases decreases continuously with increasing current density in all Fe-containing deposits. At the same time, no essential change in the magnetic anisotropy can be found with the plating time. 119Sn spectra reveal the presence of small amount of {beta}-Sn besides the main phases in Sn-Fe and in the Sn-Co coatings. Magnetically split 119Sn spectra reflecting transferred hyperfine field were observed in the case of Co-Sn-Fe coatings.
Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.
Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M
2016-09-12
The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .
Application of glucose oxidase for the production of metal ...
African Journals Online (AJOL)
Chem
2013-11-27
Nov 27, 2013 ... Sulphuric and oxalic acids method were employed for the production of gluconic acid. Derivatives of gluconic acid that is, calcium lactate gluconate, sodium gluconate .... the content was filtered to remove calcium oxalate.
Lu, Fei; Li, Chao; Wang, Zejian; Zhao, Wei; Chu, Ju; Zhuang, Yingping; Zhang, Siliang
2016-11-01
In this paper, a system of cell-recycle continuous fermentation for sodium gluconate (SG) production by Aspergillus niger (A. niger) was established. Based on initial continuous fermentation result (100.0h) with constant feed rate, an automatic feedback strategy to regulate feed rate using on-line physiological parameters (OUR and DO) was proposed and applied successfully for the first time in the improved continuous fermentation (240.5h). Due to less auxiliary time, highest SG production rate (31.05±0.29gL(-1)h(-1)) and highest yield (0.984±0.067molmol(-1)), overall SG production capacity (975.8±5.8gh(-1)) in 50-L fermentor of improved continuous fermentation increased more than 300.0% compared to that of batch fermentation. Improvement of mass transfer and dispersed mycelia morphology were the two major reasons responsible for the high SG production rate. This system had been successfully applied to industrial fermentation and SG production was greatly improved. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.
2011-01-01
An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565
Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores
Directory of Open Access Journals (Sweden)
Løvdal Irene S
2012-03-01
Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.
Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores
2012-01-01
Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404
Kuzmann, E.; Stichleutner, S.; Doyle, O.; Chisholm, C. U.; El-Sharif, M.; Homonnay, Z.; Vértes, A.
2005-04-01
Constant current technique was applied to electrodeposit tin-containing coatings such as tin-cobalt (Sn-Co), tin-iron (Sn-Fe) and a novel tin-cobalt-iron (Sn-Co-Fe) from a gluconate bath. The effect of plating parameters (current density, deposition time at an electrolyte temperature of 60°C and pH=7.0) on phase composition, crystal structure and magnetic anisotropy of alloy deposits has been investigated mainly by 57Fe CEMS, 119Sn CEMS and transmission Mössbauer Spectroscopy as well as XRD. 57Fe and 119Sn CEM spectra and XRD reflect that the dominant phases of the deposits are orthorhombic Co3Sn2, tetragonal FeSn2 or amorphous Fe-Sn and amorphous Sn-Co-Fe in Sn-Co, Sn-Fe and Sn-Co-Fe coatings, respectively. Furthermore, the relative area of the 2nd and 5th lines of the sextets representing the magnetic iron containing phases decreases continuously with increasing current density in all Fe-containing deposits. At the same time, no essential change in the magnetic anisotropy can be found with the plating time. 119Sn spectra reveal the presence of small amount of β-Sn besides the main phases in Sn-Fe and in the Sn-Co coatings. Magnetically split 119Sn spectra reflecting transferred hyperfine field were observed in the case of Co-Sn-Fe coatings.
Directory of Open Access Journals (Sweden)
Hasnain Seyed
2004-09-01
Full Text Available Abstract Background The diphtheria toxin repressor, DtxR, of Corynebacterium diphtheriae has been shown to be an iron-activated transcription regulator that controls not only the expression of diphtheria toxin but also of iron uptake genes. This study aims to identify putative binding sites and operons controlled by DtxR to understand the role of DtxR in patho-physiology of Corynebacterium diphtheriae. Result Positional Shannon relative entropy method was used to build the DtxR-binding site recognition profile and the later was used to identify putative regulatory sites of DtxR within C. diphtheriae genome. In addition, DtxR-regulated operons were also identified taking into account the predicted DtxR regulatory sites and genome annotation. Few of the predicted motifs were experimentally validated by electrophoretic mobility shift assay. The analysis identifies motifs upstream to the novel iron-regulated genes that code for Formamidopyrimidine-DNA glycosylase (FpG, an enzyme involved in DNA-repair and starvation inducible DNA-binding protein (Dps which is involved in iron storage and oxidative stress defense. In addition, we have found the DtxR motifs upstream to the genes that code for sortase which catalyzes anchoring of host-interacting proteins to the cell wall of pathogenic bacteria and the proteins of secretory system which could be involved in translocation of various iron-regulated virulence factors including diphtheria toxin. Conclusions We have used an in silico approach to identify the putative binding sites and genes controlled by DtxR in Corynebacterium diphtheriae. Our analysis shows that DtxR could provide a molecular link between Fe+2-induced Fenton's reaction and protection of DNA from oxidative damage. DtxR-regulated Dps prevents lethal combination of Fe+2 and H2O2 and also protects DNA by nonspecific DNA-binding. In addition DtxR could play an important role in host interaction and virulence by regulating the levels of sortase
Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii
Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard
2002-01-01
Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052
Mochizuki, Shogo; Nishiyama, Ryuji; Inoue, Akira; Ojima, Takao
2015-12-25
Abalone feeds on brown seaweeds and digests seaweeds' alginate with alginate lyases (EC 4.2.2.3). However, it has been unclear whether the end product of alginate lyases (i.e. unsaturated monouronate-derived 4-deoxy-L-erythro-5-hexoseulose uronic acid (DEH)) is assimilated by abalone itself, because DEH cannot be metabolized via the Embden-Meyerhof pathway of animals. Under these circumstances, we recently noticed the occurrence of an NADPH-dependent reductase, which reduced DEH to 2-keto-3-deoxy-D-gluconate, in hepatopancreas extract of the pacific abalone Haliotis discus hannai. In the present study, we characterized this enzyme to some extent. The DEH reductase, named HdRed in the present study, could be purified from the acetone-dried powder of hepatopancreas by ammonium sulfate fractionation followed by conventional column chromatographies. HdRed showed a single band of ∼ 40 kDa on SDS-PAGE and reduced DEH to 2-keto-3-deoxy-D-gluconate with an optimal temperature and pH at around 50 °C and 7.0, respectively. HdRed exhibited no appreciable activity toward 28 authentic compounds, including aldehyde, aldose, ketose, α-keto-acid, uronic acid, deoxy sugar, sugar alcohol, carboxylic acid, ketone, and ester. The amino acid sequence of 371 residues of HdRed deduced from the cDNA showed 18-60% identities to those of aldo-keto reductase (AKR) superfamily enzymes, such as human aldose reductase, halophilic bacterium reductase, and sea hare norsolorinic acid (a polyketide derivative) reductase-like protein. Catalytic residues and cofactor binding residues known in AKR superfamily enzymes were fairly well conserved in HdRed. Phylogenetic analysis for HdRed and AKR superfamily enzymes indicated that HdRed is an AKR belonging to a novel family. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Mochizuki, Shogo; Nishiyama, Ryuji; Inoue, Akira; Ojima, Takao
2015-01-01
Abalone feeds on brown seaweeds and digests seaweeds' alginate with alginate lyases (EC 4.2.2.3). However, it has been unclear whether the end product of alginate lyases (i.e. unsaturated monouronate-derived 4-deoxy-l-erythro-5-hexoseulose uronic acid (DEH)) is assimilated by abalone itself, because DEH cannot be metabolized via the Embden-Meyerhof pathway of animals. Under these circumstances, we recently noticed the occurrence of an NADPH-dependent reductase, which reduced DEH to 2-keto-3-deoxy-d-gluconate, in hepatopancreas extract of the pacific abalone Haliotis discus hannai. In the present study, we characterized this enzyme to some extent. The DEH reductase, named HdRed in the present study, could be purified from the acetone-dried powder of hepatopancreas by ammonium sulfate fractionation followed by conventional column chromatographies. HdRed showed a single band of ∼40 kDa on SDS-PAGE and reduced DEH to 2-keto-3-deoxy-d-gluconate with an optimal temperature and pH at around 50 °C and 7.0, respectively. HdRed exhibited no appreciable activity toward 28 authentic compounds, including aldehyde, aldose, ketose, α-keto-acid, uronic acid, deoxy sugar, sugar alcohol, carboxylic acid, ketone, and ester. The amino acid sequence of 371 residues of HdRed deduced from the cDNA showed 18–60% identities to those of aldo-keto reductase (AKR) superfamily enzymes, such as human aldose reductase, halophilic bacterium reductase, and sea hare norsolorinic acid (a polyketide derivative) reductase-like protein. Catalytic residues and cofactor binding residues known in AKR superfamily enzymes were fairly well conserved in HdRed. Phylogenetic analysis for HdRed and AKR superfamily enzymes indicated that HdRed is an AKR belonging to a novel family. PMID:26555267
Tsai, Ming-Liao; Lu, Yi-Fang; Do, Jing-Shan
Dextrose and its derivatives (e.g. glucose, gluconic acid and gluconic lactone) are added to modify the characteristics of electrolytes used in aluminum electrolytic capacitors. The results show that the conductivity and sparking voltage of the electrolytes are severely affected by the concentration of dextrose gluconic acid and gluconic lactone. In addition, the pH of the electrolyte is only slightly affected by the quantity of gluconic acid and gluconic lactone. The capacitance, dissipation factor, and leakage current of capacitors impregnated with the electrolytes prepared in this work are periodically measured under storage conditions and loading at 105 °C.
Passerieux, Emilie; Hayot, Maurice; Jaussent, Audrey; Carnac, Gilles; Gouzi, Fares; Pillard, Fabien; Picot, Marie-Christine; Böcker, Koen; Hugon, Gerald; Pincemail, Joel; Defraigne, Jean O; Verrips, Theo; Mercier, Jacques; Laoudj-Chenivesse, Dalila
2015-04-01
Facioscapulohumeral muscular dystrophy (FSHD) is an autosomal dominant disease characterized by progressive weakness and atrophy of specific skeletal muscles. As growing evidence suggests that oxidative stress may contribute to FSHD pathology, antioxidants that might modulate or delay oxidative insults could help in maintaining FSHD muscle function. Our primary objective was to test whether oral administration of vitamin C, vitamin E, zinc gluconate, and selenomethionine could improve the physical performance of patients with FSHD. Adult patients with FSHD (n=53) were enrolled at Montpellier University Hospital (France) in a randomized, double-blind, placebo-controlled pilot clinical trial. Patients were randomly assigned to receive 500 mg vitamin C, 400mg vitamin E, 25mg zinc gluconate and 200 μg selenomethionine (n=26), or matching placebo (n=27) once a day for 17 weeks. Primary outcomes were changes in the two-minute walking test (2-MWT), maximal voluntary contraction, and endurance limit time of the dominant and nondominant quadriceps (MVCQD, MVCQND, TlimQD, and TlimQND, respectively) after 17 weeks of treatment. Secondary outcomes were changes in the antioxidant status and oxidative stress markers. Although 2-MWT, MVCQ, and TlimQ were all significantly improved in the supplemented group at the end of the treatment compared to baseline, only MVCQ and TlimQ variations were significantly different between groups (MVCQD: P=0.011; MVCQND: P=0.004; TlimQD: P=0.028; TlimQND: P=0.011). Similarly, the vitamin C (P<0.001), vitamin E as α-tocopherol (P<0.001), vitamin C/vitamin E ratio (P=0.017), vitamin E γ/α ratio (P=0.022) and lipid peroxides (P<0.001) variations were significantly different between groups. In conclusion, vitamin E, vitamin C, zinc, and selenium supplementation has no significant effect on the 2-MWT, but improves MVCQ and TlimQ of both quadriceps by enhancing the antioxidant defenses and reducing oxidative stress. This trial was registered at
The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis
Kessler, Peter S.; Blank, Carrine; Leigh, John A.
1998-01-01
Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920
Kahramanoglou, Christina; Webster, Christine L.; el-Robh, Mohamed Samir; Belyaeva, Tamara A.; Busby, Stephen J. W.
2006-01-01
Transcription of the Escherichia coli melAB operon is regulated by the MelR protein, an AraC family member whose activity is modulated by the binding of melibiose. In the absence of melibiose, MelR is unable to activate the melAB promoter but autoregulates its own expression by repressing the melR promoter. Melibiose triggers MelR-dependent activation of the melAB promoter and relieves MelR-dependent repression of the melR promoter. Twenty-nine single amino acid substitutions in MelR that res...
Hsu, Pei-Chun Lisa; Condron, Leo; O'Callaghan, Maureen; Hurst, Mark R H
2015-12-01
The bacterium Burkholderia sp. Ha185 readily solubilizes inorganic phosphate by releasing the low molecular weight organic anion, 2-ketogluconate. Using random transposon mutagenesis and in silico analysis, a mutation that caused almost complete abolition of phosphate solubilization was located within hemX, which is part of the hem operon. Burkholderia sp. Ha185 HemX is a multidomain protein, predicted to encode a bifunctional uroporphyrinogen-III synthetase/uroporphyrin-III C-methyltransferase, which has not previously been implicated in phosphate solubilization. Complementation of hemX restored the ability of the mutant to solubilize phosphate in both plate and liquid cultures. Based on a combination of organic-anion profiling, quantitative polymerase chain reaction and in silico analyses, hemX was confirmed to be solely responsible for hydroxyapatite solubilization in Burkholderia sp. Ha185. It is proposed that the biosynthesis of a yet to be determined redox cofactor by HemX is the main pathway for generating 2-ketogluconate via a haem-dependent gluconate 2-dehydrogenase in Burkholderia sp. Ha185. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.
Lifescience Database Archive (English)
Full Text Available DG00135 Chemical ... DGroup Calcium gluconate ... D00935 ... Calcium gluconate (USP) ... D05463 ... Calcium... gluconate hydrate (JP17) ... ATC code: A12AA03 D11AX03 Calcium supplement ...
Directory of Open Access Journals (Sweden)
Abdelali Daddaoua
Full Text Available Homologs of the transcriptional regulator PtxS are omnipresent in Pseudomonas, whereas PtxR homologues are exclusively found in human pathogenic Pseudomonas species. In all Pseudomonas sp., PtxS with 2-ketogluconate is the regulator of the gluconate degradation pathway and controls expression from its own promoter and also from the P(gad and P(kgu for the catabolic operons. There is evidence that PtxS and PtxR play a central role in the regulation of exotoxin A expression, a relevant primary virulence factor of Pseudomonas aeruginosa. We show using DNaseI-footprint analysis that in P. aeruginosa PtxR binds to the -35 region of the P(toxA promoter in front of the exotoxin A gene, whereas PtxS does not bind to this promoter. Bioinformatic and DNaseI-footprint analysis identified a PtxR binding site in the P(kgu and P(gad promoters that overlaps the -35 region, while the PtxS operator site is located 50 bp downstream from the PtxR site. In vitro, PtxS recognises PtxR with nanomolar affinity, but this interaction does not occur in the presence of 2-ketogluconate, the specific effector of PtxS. DNAaseI footprint assays of P(kgu and P(gad promoters with PtxS and PtxR showed a strong region of hyper-reactivity between both regulator binding sites, indicative of DNA distortion when both proteins are bound; however in the presence of 2-ketogluconate no protection was observed. We conclude that PtxS modulates PtxR activity in response to 2-ketogluconate by complex formation in solution in the case of the P(toxA promoter, or via the formation of a DNA loop as in the regulation of gluconate catabolic genes. Data suggest two different mechanisms of control exerted by the same regulator.
Tanaka, Ippei; Watanabe, Kiyoshi; Nakaminami, Hidemasa; Azuma, Chihiro; Noguchi, Norihisa
2014-01-01
Recently, the procedure for surgical hand hygiene has been switching to a two-stage method and hand-rubbing method from the traditional hand-scrubbing method. Both the two-stage and hand-rubbing methods use alcohol-based hand-rubbing after hand washing. The former requires 5 min of antiseptic hand washing, and the latter 1 min of nonantiseptic hand washing. For a prolonged bactericidal effect in terms of surgical hand hygiene, chlorhexidine gluconate (CHG) has been noted due to its residual activity. However, no detailed study comparing the disinfection efficacy and prolonged effects according to different contents of CHG and the usage of alcohol-based hand-rubbing has been conducted. The glove juice method is able to evaluate disinfection efficacy and prolonged effects of the disinfectants more accurately because it can collect not only transitory bacteria but also normal inhabitants on hands. In the present study, we examined the disinfection efficacy and prolonged effects on alcohol-based hand-rubbing containing CHG by six hand-rubbing methods and three two-stage methods using the glove juice method. In both methods, 3 mL (one pump dispenser push volume) alcohol-based hand-rubbing solution containing 1% (w/v) CHG showed the highest disinfection efficacy and prolonged effects, and no significant difference was found between the hand-rubbing and two-stage methods. In the two methods of hand hygiene, the hand-rubbing method was able to save time and cost. Therefore, the data strongly suggest that the hand-rubbing method using a one pump dispenser push volume of alcohol-based hand-rubbing solution containing 1% (w/v) CHG is suitable for surgical hand hygiene.
Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.
2016-01-01
Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724
Kim, Joo-Wan; Choi, Jae-Suk; Ha, Yu-Mi; Choi, In Soon; Kim, Ki-Young; Cho, Hyung-rae; Rha, Chae-hun; Ku, Sae-Kwang
2013-11-01
The object of this study was to obtain acute oral toxicity information of Polycalcium, a mixed composition of Polycan and Calcium lactate-gluconate 1:9 (g/g), in Sprague-Dawely (SD) rats. In order to investigate the toxicity and identify target organs, Polycalcium were once orally administered to female and male SD rats at dose levels of 2000, 1000, 500 and 0 (control) mg/kg body weights. The mortality, changes on body weight and clinical signs were monitored during 14 days after treatment with gross observation, changes on the organ weights and histopathology of principle organs and treatment sites based on the recommendation of KFDA Guidelines [2009-116, 2009]. As the results of single oral treatment of Polycalcium, no treatment related mortalities were observed within 14 days after end of treatment up to 2000 mg/kg, the limited dosage of rodents in the both genders. In addition, no Polycalcium treatment related changes on the body and organ weights, clinical signs, necropsy and histopathological findings were detected. The results obtained in this study suggest that the Polycalcium is non-toxic in rats. The LD50 and approximate LD in rats after single oral dose of Polycalcium were considered over 2000 mg/kg in both female and male, respectively.
Lifescience Database Archive (English)
Full Text Available ine hemorrhagic fever; Bolivian haemorrhagic fever; Venezuelan hemorrhagic fever; Brazilian hemorrhagic feve...morrhagic fever) Sabia mammarenavirus [GN:T40008] (Brazilian hemorrhagic fever) Tacaribe mammarenavirus [GN:
DEFF Research Database (Denmark)
Wang, Zhihao; Chan, Siu Hung Joshua; Sudarsan, Suresh
2016-01-01
is linked to redox and to the general metabolism. We here provide new insights into the regulation of the metabolism of this important platform organism by systematically characterizing mutants carrying various lesions in the fructose operon. Initially, we found that a strain where the dedicated fructose...... uptake system had been inactivated (KO-ptsF) was hampered in growth on sucrose minimal medium, and suppressor mutants appeared readily. Comparative genomic analysis in conjunction with enzymatic assays revealed that suppression was linked to inactivation of the pfkB gene, encoding a fructose-1-phosphate...... kinase. Detailed characterization of KO-ptsF, KO-pfkB and double knock-out (DKO) derivatives revealed a strong role for sugar-phosphates, especially fructose-1-phosphate (F1P), in governing sugar as well as redox metabolism due to effects on transcriptional regulation of key genes. These findings allowed...
Directory of Open Access Journals (Sweden)
Ashishkumar Kyada
2017-12-01
Full Text Available Antiurolithiatic acitivity of magnesium lactate gluconate (MLG and aqueous extract of Garcinia cambogia (GC fruit was studied. Methods: Study was performed during December 2016 to April 2017. Urolithiasis was induced in male Wistar rats by administration of 0.75 % v/v ethylene glycol for 21 days. From 8th day onwards, intervention with MLG (200 and 400 mg/kg b.w. and GC (100 and 200 mg/kg b.w. was started. At the end of treatment period, biochemical parameters affecting renal stone formation were estimated in serum, urine, kidney homogenate and histopathology of harvested kidneys was performed. Results: From in vivo evaluation, it was observed that MLG 400 mg/kg b.w., GC 100 mg/kg b.w. and GC 200 mg/kg b.w. significantly reduced nitrogenous waste products in serum (blood urea nitrogen, creatinine, uric acid as well as calculogenic promoters in urine (phosphate, oxalate and kidney homogenate (calcium, phosphate, oxalate when compared to disease control animals. The MLG 200 and MLG 400 were ineffective in restoring superoxide dismutase (SOD and catalase (CAT enzyme activity whereas GC 100, GC 200 and Cystone® 400 mg/kg b.w. significantly elevated SOD and CAT enzymes in urolithiatic rat kidney. Conclusions: MLG and GC extract are capable of preventing calcium oxalate (CaOx crystal formation and subsequent deposition in renal tubules. The principle mechanism underlying nephroprotective effect of test drugs might be attributed to their calcium ion cheating ability and CaOx crystallization inhibitory activity. It is further asserted that GC was more potent than MLG in overall kidney protection by virtue of its antioxidant potential. [J Complement Med Res 2017; 6(4.000: 378-384
Directory of Open Access Journals (Sweden)
pouya Mehmandoust
2016-03-01
Full Text Available Introduction: This in vitro study aimed to compare the antimicrobial effect of lavandula -0fficinalis extract, with sodium hypochlorite (NaOCL and chlorhexidine gluconate (CHX, as root canal irrigants, on Enterococcus faecalis (EF. Materials &Methods: Seventy five extracted single-rooted premolars were selected. Root canals were prepared using rotary ProTaper system and were infected with the culture of E. faecalis. Specimens were randomly divided into five groups (n = 15, Group 1, 2: lavandula extracts (0.26 and 0.52 mg/mL, Group 3: 2.5%NaOCL, Group 4: 2%CHX, Group 5: Normal Saline. Irrigation was performed for each group for 5, 10 and 15 min. The viable bacteria obtained by collecting the canal dentin chips. Data analysis was performed with Kruskal-Wallis and Mann-Whitney u tests. Results: The mean number of viable bacteria was significantly reduced after 5 min exposure to lavandula solutions (p<0.05. A significant difference also existed between different times in the NaOCL group, being significant between 5 and 15 min (p<0.05, but there was no significant difference between different times in the CHX group. Comparison of the mean number of viable bacteria between different groups at different exposure times revealed that the difference between lavandula and NaOCL solutions with CHX was significant at 5 and 10 min (p<0.05, however, no statistically significant difference was observed between lavandula solutions and NaOCL. Conclusion: lavandula extract was effective in killing of EF. Further studies are necessary to fully understand its other properties such as tissue solubility, removal of smear layer and impact on dentin structure.
Henke, Sarah K; Cronan, John E
2016-11-01
Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.
Efficiency of an automated reception and turnaround time management system for the phlebotomy room.
Yun, Soon Gyu; Shin, Jeong Won; Park, Eun Su; Bang, Hae In; Kang, Jung Gu
2016-01-01
Recent advances in laboratory information systems have largely been focused on automation. However, the phlebotomy services have not been completely automated. To address this issue, we introduced an automated reception and turnaround time (TAT) management system, for the first time in Korea, whereby the patient's information is transmitted directly to the actual phlebotomy site and the TAT for each phlebotomy step can be monitored at a glance. The GNT5 system (Energium Co., Ltd., Korea) was installed in June 2013. The automated reception and TAT management system has been in operation since February 2014. Integration of the automated reception machine with the GNT5 allowed for direct transmission of laboratory order information to the GNT5 without involving any manual reception step. We used the mean TAT from reception to actual phlebotomy as the parameter for evaluating the efficiency of our system. Mean TAT decreased from 5:45 min to 2:42 min after operationalization of the system. The mean number of patients in queue decreased from 2.9 to 1.0. Further, the number of cases taking more than five minutes from reception to phlebotomy, defined as the defect rate, decreased from 20.1% to 9.7%. The use of automated reception and TAT management system was associated with a decrease of overall TAT and an improved workflow at the phlebotomy room.
Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon
Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.
2008-12-01
Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.
Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison
2016-05-25
Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.
ORF Alignment: NC_003228 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available NC_003228 gi|60681683 >1gntA 1 551 3 543 0.0 ... emb|CAH07898.1| hydroxylamine reduct...ase [Bacteroides fragilis NCTC 9343] ... ref|YP_211827.1| hydroxylamine reductase [Bacteroides ...
Enhancing blood donor skin disinfection using natural oils.
Alabdullatif, Meshari; Boujezza, Imen; Mekni, Mohamed; Taha, Mariam; Kumaran, Dilini; Yi, Qi-Long; Landoulsi, Ahmed; Ramirez-Arcos, Sandra
2017-12-01
Effective donor skin disinfection is essential in preventing bacterial contamination of blood components with skin flora bacteria like Staphylococcus epidermidis. Cell aggregates of S. epidermidis (biofilms) are found on the skin and are resistant to the commonly used donor skin disinfectants chlorhexidine-gluconate and isopropyl alcohol. It has been demonstrated that essential oils synergistically enhance the antibacterial activity of chlorhexidine-gluconate. The objective of this study was to test plant-extracted essential oils in combination with chlorhexidine-gluconate or chlorhexidine-gluconate plus isopropyl alcohol for their ability to eliminate S. epidermidis biofilms. The composition of oils extracted from Artemisia herba-alba, Lavandula multifida, Origanum marjoram, Rosmarinus officinalis, and Thymus capitatus was analyzed using gas chromatography-mass spectrometry. A rabbit model was used to assess skin irritation caused by the oils. In addition, the anti-biofilm activity of the oils used alone or in combination with chlorhexidine-gluconate or chlorhexidine-gluconate plus isopropyl alcohol was tested against S. epidermidis biofilms. Essential oil concentrations 10%, 20%, and 30% were chosen for anti-biofilm assays, because skin irritation was observed at concentrations greater than 30%. All oils except for O. marjoram had anti-biofilm activity at these three concentrations. L. multifida synergistically enhanced the anti-biofilm activity of chlorhexidine-gluconate and resulted in the highest anti-biofilm activity observed when combined with chlorhexidine-gluconate plus isopropyl alcohol. Gas chromatography-mass spectrometry revealed that the main component contributing to the activity of L. multifida oil was a natural terpene alcohol called linalool. The anti-biofilm activity of chlorhexidine-gluconate plus isopropyl alcohol can be greatly enhanced by L. multifida oil or linalool. Therefore, these components could potentially be used to improve blood
Lowe, Christopher F; Lloyd-Smith, Elisa; Sidhu, Baljinder; Ritchie, Gordon; Sharma, Azra; Jang, Willson; Wong, Anna; Bilawka, Jennifer; Richards, Danielle; Kind, Thomas; Puddicombe, David; Champagne, Sylvie; Leung, Victor; Romney, Marc G
2017-03-01
Daily bathing with chlorhexidine gluconate (CHG) is increasingly used in intensive care units to prevent hospital-associated infections, but limited evidence exists for noncritical care settings. A prospective crossover study was conducted on 4 medical inpatient units in an urban, academic Canadian hospital from May 1, 2014-August 10, 2015. Intervention units used CHG over a 7-month period, including a 1-month wash-in phase, while control units used nonmedicated soap and water bathing. Rates of hospital-associated methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococcus (VRE) colonization or infection were the primary end point. Hospital-associated S. aureus were investigated for CHG resistance with a qacA/B and smr polymerase chain reaction (PCR) and agar dilution. Compliance with daily CHG bathing was 58%. Hospital-associated MRSA and VRE was decreased by 55% (5.1 vs 11.4 cases per 10,000 inpatient days, P = .04) and 36% (23.2 vs 36.0 cases per 10,000 inpatient days, P = .03), respectively, compared with control cohorts. There was no significant difference in rates of hospital-associated Clostridium difficile. Chlorhexidine resistance testing identified 1 isolate with an elevated minimum inhibitory concentration (8 µg/mL), but it was PCR negative. This prospective pragmatic study to assess daily bathing for CHG on inpatient medical units was effective in reducing hospital-associated MRSA and VRE. A critical component of CHG bathing on medical units is sustained and appropriate application, which can be a challenge to accurately assess and needs to be considered before systematic implementation. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen
The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S
1994-10-25
DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.
Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen
2014-01-01
Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615
Tirali, Resmiye-Ebru; Bodur, Haluk; Ece, Gülden
2012-05-01
The aim of this study was to evaluate the effectiveness of different irrigation solutions at different time intervals for the elimination of E. faecalis and C. albicans penetrated into the dentine tubules of primary and permanent teeth in vitro. The 4 mm primary and permanent teeth sections were sterilized and contaminated with a mixture of E. faecalis and C. albicans strains. After the application of different irrigation solutions (Sodium hypochlorite, Chlorhexidine gluconate, Octenidine Dihydrochloride, saline) to the contaminated tooth sections according to study groups, neutralizers were applied for inactivation of the solutions after 30 sec, 1 min and 5 min. Dentine shavings were placed into TSB and 10 µL from each tube was inoculated on agar plates, followed by an incubation period of 24 h at 37°C. The colonies were counted macroscopically. The results were compared by using Kruskal-Wallis and Mann Whitney U tests, with a significance level at pteeth, the most effective one was found as 5-minute application of 0.1% Octenidine Dihydrochloride. The antibacterial effects of the tested solutions on the same time periods against C. albicans revealed no significant difference. There were no statistically significant differences between primary and permanent teeth with respect to the antimicrobial activity of the tested solutions. Moreover, Octenidine Dihydrochloride may be used as an alternative endodontic irrigant.
ORF Alignment: EHA1 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available EHA1 253.m00087 >1gntA 1 549 4 539 e-171 ... gb|EAL51411.1| hydroxylamine reductase, ...putative [Entamoeba histolytica HM-1:IMSS] ... gb|EAL44619.1| hydroxylamine reductase, putative ...
Lifescience Database Archive (English)
Full Text Available cations such as aseptic meningitis, pediatric deafness, and orchitis. Infectious disease ... Mumps virus [GN:T4...inflammation of parotid glands and fever. Mortality is rare, but it often accompanied by more serious compli
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Directory of Open Access Journals (Sweden)
Luke Czapla
Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
Interplay of protein and DNA structure revealed in simulations of the lac operon.
Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K
2013-01-01
The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.
A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.
Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor
2017-05-05
Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-01-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...
ORF Alignment: NC_006841 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available NC_006841 gi|59714046 >1gntA 1 552 1 553 0.0 ... ref|YP_206821.1| hydroxylamine reduc...tase [Vibrio fischeri ES114] gb|AAW87933.1| ... hydroxylamine reductase [Vibrio fischeri ES114] ...
ORF Alignment: EHA1 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available EHA1 8.m00410 >1gntA 1 549 4 539 e-171 ... gb|EAL51411.1| hydroxylamine reductase, pu...tative [Entamoeba histolytica HM-1:IMSS] ... gb|EAL44619.1| hydroxylamine reductase, putative ...
Directory of Open Access Journals (Sweden)
Sreegowri
2013-01-01
Full Text Available Aim: The aim of this study was to evaluate the sealing ability of white and gray mineral trioxide aggregate (MTA mixed with distilled water and 0.12% chlorhexidine (CHX gluconate when used as a root-end filling material using the dye-penetration technique. Materials and Methods: A total of 48 single-rooted human teeth were cleaned, shaped, and obturated with gutta-percha and AH Plus sealer. The apical 3 mm of each root was resected, and 3-mm deep root-end cavity preparations were made. The teeth were randomly divided into 4 experimental groups, each containing 8 teeth, and 2 negative and positive control groups, each containing 8 teeth. Root-end cavities in the experimental groups were filled with the experimental materials. After application of nail polish, the teeth were exposed to India ink for 72 h and longitudinally sectioned, and the extent of dye penetration was measured with a stereomicroscope. Results : No statistically significant differences were observed in the sealing ability of gray and white MTA mixed with distilled water and 0.12% CHX. Conclusion : CHX appears to be a good alternative to replace distilled water, as a solution to be mixed with MTA.
Directory of Open Access Journals (Sweden)
Lisa M Starr
Full Text Available Pentachlorophenol (PCP induced expression of the NalC repressor-regulated PA3720-armR operon and the MexR repressor-controlled mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa. PCP's induction of PA3720-armR resulted from its direct modulation of NalC, the repressor's binding to PA3720-armR promoter-containing DNA as seen in electromobility shift assays (EMSAs being obviated in the presence of this agent. The NalC binding site was localized to an inverted repeat (IR sequence upstream of PA3720-armR and overlapping a promoter region whose transcription start site was mapped. While modulation of MexR by the ArmR anti-repressor explains the upregulation of mexAB-oprM in nalC mutants hyperexpressing PA3720-armR, the induction of mexAB-oprM expression by PCP is not wholly explainable by PCP induction of PA3720-armR and subsequent ArmR modulation of MexR, inasmuch as armR deletion mutants still showed PCP-inducible mexAB-oprM expression. PCP failed, however, to induce mexAB-oprM in a mexR deletion strain, indicating that MexR was required for this, although PCP did not modulate MexR binding to mexAB-oprM promoter-containing DNA in vitro. One possibility is that MexR responds to PCP-generated in vivo effector molecules in controlling mexAB-oprM expression in response to PCP. PCP is an unlikely effector and substrate for NalC and MexAB-OprM--its impact on NalC binding to the PA3720-armR promoter DNA occurred only at high µM levels--suggesting that it mimics an intended phenolic effector/substrate(s. In this regard, plants are an abundant source of phenolic antimicrobial compounds and, so, MexAB-OprM may function to protect P. aeruginosa from plant antimicrobials that it encounters in nature.
Wu, Yang; Liu, Jingran; Jiang, Juan; Hu, Jian; Xu, Tao; Wang, Jiaxue; Qu, Di
2014-11-01
The ica operon and aap gene are important factors for Staphylococcus epidermidis biofilm formation. However, we found 15 out of 101 S. epidermidis strains isolated from patients had both the ica operon and the aap gene in the genome but could not form biofilms (ica(+)aap(+)/BF(-) isolates). Compared with standard strain RP62A, the 15 ica(+)aap(+)/BF(-) isolates had similar growth curves and initial attachment abilities, but had much lower apparent transcription levels of the icaA gene and significantly less production of polysaccharide intercellular adhesion (PIA). Furthermore, the expression of accumulation-associated protein in ica(+)aap(+)/BF(-) isolates was much weaker than in RP62A. The mRNA levels of icaADBC transcription-related regulatory genes, including icaR, sarA, rsbU, srrA, arlRS and luxS, were measured in the 15 ica(+)aap(+)/BF(-) clinical isolates. The mRNA levels of arlR and rsbU in all of the ica(+)aap(+)/BF(-) isolates were lower than in RP62A at 4 h. At 10 h, 14/15 of the isolates showed lower mRNA levels of arlR and rsbU than shown by RP62A. However, expression of sarA, luxS, srrA and icaR varied in different ica(+)aap(+)/BF(-) isolates. To further investigate the role of arlRS in biofilm formation, we analyzed icaA, sarA and rsbU transcription, PIA synthesis, Aap expression and biofilm formation in an arlRS deletion mutant of S. epidermidis strain 1457 and all were much less than in the wild type strain. This is consistent with the hypothesis that ArlRS may play an important role in regulating biofilm formation by the ica(+)aap(+)/BF(-)S. epidermidis clinical isolates and operate via both ica-dependent and Aap-dependent pathways. Copyright © 2014 Elsevier Ltd. All rights reserved.
76 FR 76409 - Notice of Debarment
2011-12-07
... available on the FCC's Web site at http://www.fcc.gov . The text may also be purchased from the Commission's...,500 in bribes to school officials in exchange for steering E-Rate contract work to GNT.\\6\\ In...
International Nuclear Information System (INIS)
Knapik, Aleksandra Alicja; Petkowski, Janusz Jurand; Otwinowski, Zbyszek; Cymborowski, Marcin Tadeusz; Cooper, David Robert; Chruszcz, Maksymilian; Krajewska, Wanda Małgorzata; Minor, Wladek
2012-01-01
The structure of the putative aminoacrylate peracid reductase RutC of the rut operon, a member of the YjgF family, is reported. RutC is the third enzyme in the Escherichia coli rut pathway of uracil degradation. RutC belongs to the highly conserved YjgF family of proteins. The structure of the RutC protein was determined and refined to 1.95 Å resolution. The crystal belonged to space group P2 1 2 1 2 and contained six molecules in the asymmetric unit. The structure was solved by SAD phasing and was refined to an R work of 19.3% (R free = 21.7%). The final model revealed that this protein has a Bacillus chorismate mutase-like fold and forms a homotrimer with a hydrophobic cavity in the center of the structure and ligand-binding clefts between two subunits. A likely function for RutC is the reduction of peroxy-aminoacrylate to aminoacrylate as a part of a detoxification process
A new tessera into the interactome of the isc operon:A novel interaction between HscB and IscS
Directory of Open Access Journals (Sweden)
Annalisa Pastore
2016-09-01
Full Text Available Iron sulfur clusters are essential universal prosthetic groups which can be formed inorganically but, in biology, are bound to proteins and produced enzymatically. Most of the components of the machine that produces the clusters are conserved throughout evolution. In bacteria, they are encoded in the isc operon. Previous reports provide information on the role of specific components but a clear picture of how the whole machine works is still missing. We have carried out a study of the effects of the co-chaperone HscB from the model system E. coli. We document a previously undetected weak interaction between the chaperone HscB and the desulfurase IscS, one of the two main players of the machine. The binding site involves a region of HscB in the longer stem of the approximately L-shaped molecules, whereas the interacting surface of IscS overlaps with the surface previously involved in binding other proteins, such as ferredoxin and frataxin. Our findings provide an entirely new perspective to our comprehension of the role of HscB and propose this protein as a component of the IscS complex.
Seifi, Massoud; Hamedi, Roya; Khavandegar, Zohre
2015-03-01
A major objective of investigators is to clarify the role of metabolites in achievement of maximum tooth movement with minimal root damage during orthodontic tooth movement (OTM). The aim of this study was to determine the effect of administration of thyroid hormone, prostaglandin E2, and calcium on orthodontic tooth movement and root resorption in rats. Sixty four male Wistar rats were randomly divided into 8 groups of eight rats each: 1- 20µg/kg thyroxine was injected in traperitoneally after installation of the orthodontic appliance. 2- 0.1 ml of 1 mg/ml prostaglandin E2 was injected submucosally. 3- 10% (200 mg/kg) calcium gluconate was injected. 4- Prostaglandin E2 was injected submucosally and 10% calcium was injected intraperitoneally. 5- Thyroxine was injected intraperitoneally and prostaglandin E2 was injected submucosally. 6- 20µg/kg thyroxine with calcium was injected. 7- Prostaglandin E2 was injected submucosally with calcium and thyroxine. 8- Distilled water was used in control group. The orthodontic appliances comprised of a NiTi closed coil were posteriorly connected to the right first molar and anteriorly to the upper right incisor. OTM was measured with a feeler gauge. The mid-mesial root of the first molar and the adjacent tissues were histologically evaluated. The Data were analyzed by one-way ANOVA and Student-Newman-Keuls test. The highest mean OTM was observed in the thyroxine and prostaglandin E2 group (Mean±SD = 0.7375±0.1359 mm) that was significantly different (proot resorption was observed between the prostaglandin E2 (0.0192±0.0198 mm(2)) and the other groups. It seems that the combination of thyroxine and prostaglandin E2, with a synergistic effect, would decrease the root resorption and increase the rate of orthodontic tooth movement in rats.
What can governance theory learn from complexity theory? Mirroring two perspectives
J.F.M. Koppenjan (Joop); E-H. Klijn (Erik-Hans)
2013-01-01
markdownabstractAbstract Recently the New Public Governance (NPG) has been suggested as an alternative paradigm to the traditional Public Administration Model (PAM) and New Public Management (NPM). NPG strongly builds upon Governance Network Theory (GNT). This suggestion assumes that the
Governance network theory: Past, present and future
E-H. Klijn (Erik-Hans); J.F.M. Koppenjan (Joop)
2012-01-01
markdownabstract__Abstract__ This article argues that governance network theory (GNT) has developed into a fullyfledged theory that has gained prominence within public administration. The emergence of New Public Governance opens up new challenges, however, and instead of governance networks and
Anion-sensitive regions of L-type CaV1.2 calcium channels expressed in HEK293 cells.
Directory of Open Access Journals (Sweden)
Norbert Babai
2010-01-01
Full Text Available L-type calcium currents (I(Ca are influenced by changes in extracellular chloride, but sites of anion effects have not been identified. Our experiments showed that CaV1.2 currents expressed in HEK293 cells are strongly inhibited by replacing extracellular chloride with gluconate or perchlorate. Variance-mean analysis of I(Ca and cell-attached patch single channel recordings indicate that gluconate-induced inhibition is due to intracellular anion effects on Ca(2+ channel open probability, not conductance. Inhibition of CaV1.2 currents produced by replacing chloride with gluconate was reduced from approximately 75%-80% to approximately 50% by omitting beta subunits but unaffected by omitting alpha(2delta subunits. Similarly, gluconate inhibition was reduced to approximately 50% by deleting an alpha1 subunit N-terminal region of 15 residues critical for beta subunit interactions regulating open probability. Omitting beta subunits with this mutant alpha1 subunit did not further diminish inhibition. Gluconate inhibition was unchanged with expression of different beta subunits. Truncating the C terminus at AA1665 reduced gluconate inhibition from approximately 75%-80% to approximately 50% whereas truncating it at AA1700 had no effect. Neutralizing arginines at AA1696 and 1697 by replacement with glutamines reduced gluconate inhibition to approximately 60% indicating these residues are particularly important for anion effects. Expressing CaV1.2 channels that lacked both N and C termini reduced gluconate inhibition to approximately 25% consistent with additive interactions between the two tail regions. Our results suggest that modest changes in intracellular anion concentration can produce significant effects on CaV1.2 currents mediated by changes in channel open probability involving beta subunit interactions with the N terminus and a short C terminal region.
Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.
Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W
2014-05-01
During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.
Ast, Jennifer C; Dunlap, Paul V
2004-05-01
The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).
The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.
Directory of Open Access Journals (Sweden)
Jin Hwan Park
2015-09-01
Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.
Directory of Open Access Journals (Sweden)
Yi-Che Lee
2015-01-01
Full Text Available Background. Peritoneal dialysis (PD can induce fibrosis and functional alterations in PD patients’ peritoneal membranes, due to long-term unphysiological dialysate exposure, partially occurring via triggering of epithelial-to-mesenchymal transition (EMT in peritoneal mesothelial cells (MCs. Vitamin D can ameliorate these negative effects; however, the mechanism remains unexplored. Therefore, we investigated its possible links to MCs EMT inhibition. Methods. Peritoneal fibrosis was established in Sprague-Dawley rats by chlorhexidine gluconate (CG intraperitoneal injection for 21 days, with and without 1α,25(OH2D3 treatment. Morphological and functional evaluation and western blot analysis of EMT marker were performed upon peritoneum tissue. In vitro study was also performed in a primary human peritoneal MC culture system; MCs were incubated with transforming growth factor-β1 (TGF-β1 in the absence or presence of 1α,25(OH2D3. EMT marker expression, migration activities, and cytoskeleton redistribution of MCs were determined. Results. 1α,25(OH2D3 ameliorated CG-induced morphological and functional deterioration in animal model, along with CG-induced upregulation of α-SMA and downregulation of E-cadherin expression. Meanwhile, 1α,25(OH2D3 also ameliorated TGF-β1-induced decrease in E-cadherin expression, increase in Snai1 and α-SMA expression, intracellular F-actin redistribution, and migration activity in vitro. Conclusion. 1α,25(OH2D3 can ameliorate CG-induced peritoneal fibrosis and attenuate functional deterioration through inhibiting MC EMT.
Lifescience Database Archive (English)
Full Text Available H01534 Western equine encephalitis Western equine encephalitis virus (WEEV) is an ..., and death. Infectious disease ... Western equine encephalitis virus [GN:T40053] ... See also H00379 ... Mosquito...eaver SC ... TITLE ... Structure of the recombinant alphavirus Western equine encep
Yavuz, Sevil; Warren, Graham
2017-01-01
A single Golgi stack is duplicated and partitioned into two daughter cells during the cell cycle of the protozoan parasite Trypanosoma brucei. The source of components required to generate the new Golgi and the mechanism by which it forms are poorly understood. Using photoactivatable GFP, we show that the existing Golgi supplies components directly to the newly forming Golgi in both intact and semipermeabilized cells. The movement of a putative glycosyltransferase, GntB, requires the Sar1 and ARF1 GTPases in intact cells. In addition, we show that transfer of GntB from the existing Golgi to the new Golgi can be recapitulated in semipermeabilized cells and is sensitive to the GTP analogue GTPγS. We suggest that the existing Golgi is a key source of components required to form the new Golgi and that this process is regulated by small GTPases. PMID:28495798
Directory of Open Access Journals (Sweden)
Reeja Maria Cherian
2015-08-01
Full Text Available Sialylated glycans serve as key elements of receptors for many viruses, bacteria, and bacterial toxins. The microbial recognition and their binding specificity can be affected by the linkage of the terminal sugar residue, types of underlying sugar chains, and the nature of the entire glycoconjugate. Owing to the pathobiological significance of sialylated glycans, we have engineered Chinese hamster ovary (CHO cells to secrete mucin-type immunoglobulin-fused proteins carrying terminal α2,3- or α2,6-linked sialic acid on defined O-glycan core saccharide chains. Besides stably expressing P-selectin glycoprotein ligand-1/mouse immunoglobulin G2b cDNA (PSGL-1/mIgG2b, CHO cells were stably transfected with plasmids encoding glycosyltransferases to synthesize core 2 (GCNT1, core 3 (B3GNT6, core 4 (GCNT1 and B3GNT6, or extended core 1 (B3GNT3 chains with or without the type 1 chain-encoding enzyme B3GALT5 and ST6GAL1. Western blot and liquid chromatography-mass spectrometry analysis confirmed the presence of core 1, 2, 3, 4, and extended core 1 chains carrying either type 1 (Galb3GlcNAc or type 2 (Galb4GlcNAc outer chains with or without α2,6-linked sialic acids. This panel of recombinant mucins carrying a repertoire of sialylated O-glycans will be important tools in studies aiming at determining the fine O-glycan binding specificity of sialic acid-specific microbial adhesins and mammalian lectins.
GenBank blastx search result: AK060423 [KOME
Lifescience Database Archive (English)
Full Text Available AK060423 001-010-H01 AY498612.1 Rhodococcus opacus putative GntR type regulator of taurine... degradation (tauR) gene, partial cds; and alanine dehydrogenase (ald) and taurine-pyruvate aminotransferase (tpa) genes, complete cds.|BCT BCT 7e-32 +3 ...
Directory of Open Access Journals (Sweden)
Mohd eKhubaib
2016-05-01
Full Text Available PE/PPE genes, present in cluster with ESAT-6 like genes, are suspected to have a role in antigenic variation and virulence of Mycobacterium tuberculosis. Their roles in immune evasion and immune modulation of host are also well documented. We present evidence that PE32/PPE65 present within the RD8 region are co-operonic, co-transcribed and co-translated, and play role in modulating host immune responses. Experiments with macrophage cell lines revealed that this protein complex suppresses pro-inflammatory cytokines such as TNF-α and IL-6 whereas also inducing high expression of anti-inflammatory IL-10. Immunization of mice with these recombinant proteins dampens an effective Th1 response as evident from reduced frequency of IFN-g and IL-2 producing CD4+ and CD8+ T cells. IgG sub-typing from serum of immunized mice revealed high levels of IgG1 when compared with IgG2a and IgG2b. Further IgG1/IgG2a ratio clearly demonstrated that the protein complex manipulates the host immune response favourable to the pathogen. Our results demonstrate that the co-transcribed and co-translated PE32 and PPE65 antigens are involved specifically in modulating anti-mycobacterial host immune response by hampering Th1 response.
Römling, Ute; Bian, Zhao; Hammar, Mårten; Sierralta, Walter D.; Normark, Staffan
1998-01-01
Mouse-virulent Salmonella typhimurium strains SR-11 and ATCC 14028-1s express curli fibers, thin aggregative fibers, at ambient temperature on plates as judged by Western blot analysis and electron microscopy. Concomitantly with curli expression, cells develop a rough and dry colony morphology and bind the dye Congo red (called the rdar morphotype). Cloning and characterization of the two divergently transcribed operons required for curli biogenesis, csgBA(C) and csgDEFG, from S. typhimurium SR-11 revealed the same gene order and flanking genes as in Escherichia coli. The divergence of the curli region between S. typhimurium and E. coli at the nucleotide level is above average (22.4%). However, a high level of conservation at the protein level, which ranged from 86% amino acid homology for the fiber subunit CsgA to 99% homology for the lipoprotein CsgG, implies functional constraints on the gene products. Consequently, S. typhimurium genes on low-copy-number plasmids were able to complement respective E. coli mutants, although not always to wild-type levels. rpoS and ompR are required for transcriptional activation of (at least) the csgD promoter. The high degree of conservation at the protein level and the identical regulation patterns in E. coli and S. typhimurium suggest similar roles of curli fibers in the same ecological niche in the two species. PMID:9457880
Directory of Open Access Journals (Sweden)
Arun Kumar Haldar
2010-05-01
Full Text Available The inability of sodium antimony gluconate (SAG-unresponsive kala-azar patients to clear Leishmania donovani (LD infection despite SAG therapy is partly due to an ill-defined immune-dysfunction. Since dendritic cells (DCs typically initiate anti-leishmanial immunity, a role for DCs in aberrant LD clearance was investigated. Accordingly, regulation of SAG-induced activation of murine DCs following infection with LD isolates exhibiting two distinct phenotypes such as antimony-resistant (Sb(RLD and antimony-sensitive (Sb(SLD was compared in vitro. Unlike Sb(SLD, infection of DCs with Sb(RLD induced more IL-10 production and inhibited SAG-induced secretion of proinflammatory cytokines, up-regulation of co-stimulatory molecules and leishmanicidal effects. Sb(RLD inhibited these effects of SAG by blocking activation of PI3K/AKT and NF-kappaB pathways. In contrast, Sb(SLD failed to block activation of SAG (20 microg/ml-induced PI3K/AKT pathway; which continued to stimulate NF-kappaB signaling, induce leishmanicidal effects and promote DC activation. Notably, prolonged incubation of DCs with Sb(SLD also inhibited SAG (20 microg/ml-induced activation of PI3K/AKT and NF-kappaB pathways and leishmanicidal effects, which was restored by increasing the dose of SAG to 40 microg/ml. In contrast, Sb(RLD inhibited these SAG-induced events regardless of duration of DC exposure to Sb(RLD or dose of SAG. Interestingly, the inhibitory effects of isogenic Sb(SLD expressing ATP-binding cassette (ABC transporter MRPA on SAG-induced leishmanicidal effects mimicked that of Sb(RLD to some extent, although antimony resistance in clinical LD isolates is known to be multifactorial. Furthermore, NF-kappaB was found to transcriptionally regulate expression of murine gammaglutamylcysteine synthetase heavy-chain (mgammaGCS(hc gene, presumably an important regulator of antimony resistance. Importantly, Sb(RLD but not Sb(SLD blocked SAG-induced mgammaGCS expression in DCs by
van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M
1993-02-01
Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.
International Nuclear Information System (INIS)
Lu, Yang; Hao, Tongfan; Zhou, Yan; Han, Juan; Tan, Zhenjiang; Yan, Yongsheng
2014-01-01
Highlights: • The phase diagrams of POELE10-organic salts ATPSs were determined experimentally. • The experiential equations were used to correlate the binodal data. • The effect of salt on the binodal curve for the studied systems has been discussed. • The LLE data were correlated using the thermodynamic model. -- Abstract: The binodal data for the systems containing the POELE10 and KC 6 H 11 O 7 /K 2 C 2 O 4 /K 3 C 6 H 5 O 7 were determined at the T = (288.15, 298.15, 308.15) K. The three experiential equations were used to fit the binodal data and they achieved the satisfactory fitting effect. The effect of salt type on the phase-seperation ability of salt was studied. It was found that the phase-seperation ability of the salt with the higher valence anion is stronger than that with lower valence anion, namely, the order of the phase-seperation ability for the investigated salts is potassium citrate > potassium oxalate > potassium gluconate, which is also validated by the effective excluded volume (EEV). The (liquid + liquid) equilibrium data for the studied systems were determined and correlated by using the Pitzer–Debye–Hückel equation and Chen-NRTL model along with the Flory–Huggins equation, and good agreement was obtained with using these thermodynamic models
NCBI nr-aa BLAST: CBRC-AGAM-02-0116 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-AGAM-02-0116 ref|ZP_00539486.1| Gluconate transporter [Exiguobacterium sibiric...um 255-15] gb|EAM87290.1| Gluconate transporter [Exiguobacterium sibiricum 255-15] ZP_00539486.1 1.8 41% ...
Yuan, Jianfeng; Wu, Mianbin; Lin, Jianping; Yang, Lirong
2016-05-17
L-(+)-tartaric acid (L-TA) is an important organic acid, which is produced from the cream of tartar or stereospecific hydrolysis of the cis-epoxysuccinate. The former method is limited by the availability of raw material and the latter is dependent on the petrochemical material. Thus, new processes for the economical preparation of L-TA from carbohydrate or renewable resource would be much more attractive. Production of 5-keto-D-gluconate (5-KGA) from glucose by Gluconobacter oxydans is the first step to produce L-TA. The aim of this work is to enhance 5-KGA accumulation using combinatorial metabolic engineering strategies in G. oxydans. The sldAB gene, encoding sorbitol dehydrogenase, was overexpressed in an industrial strain G. oxydans ZJU2 under a carefully selected promoter, P0169. To enhance the efficiency of the oxidation by sldAB, the coenzyme pyrroloquinoline quinone (PQQ) and respiratory chain were engineered. Besides, the role in sldAB overexpression, coenzyme and respiratory chain engineering and their subsequent effects on 5-KGA production were investigated. An efficient, stable recombinant strain was constructed, whereas the 5-KGA production could be enhanced. By self-overexpressing the sldAB gene in G. oxydans ZJU2 under the constitutive promoter P0169, the resulting strain, G. oxydans ZJU3, produced 122.48 ± 0.41 g/L of 5-KGA. Furthermore, through the coenzyme and respiratory chain engineering, the titer and productivity of 5-KGA reached 144.52 ± 2.94 g/L and 2.26 g/(L · h), respectively, in a 15 L fermenter. It could be further improved the 5-KGA titer by 12.10 % through the fed-batch fermentation under the pH shift and dissolved oxygen tension (DOT) control condition, obtained 162 ± 2.12 g/L with the productivity of 2.53 g/(L · h) within 64 h. The 5-KGA production could be significantly enhanced with the combinatorial metabolic engineering strategy in Gluconobacter strain, including sldAB overexpression, coenzyme
Bioleaching of copper, cobalt and zinc from black shale by ...
African Journals Online (AJOL)
STORAGESEVER
2009-10-05
Oct 5, 2009 ... duce organic acid metabolites which include citric, oxalic and gluconic acids during ... acid metabolites like citric, oxalic, malic gluconic acids used for bioleaching of ..... polluted soils using oxalate. J. Water, Air, Soil Pollut.
International Nuclear Information System (INIS)
Eng, W.H.; Aziz, M.A.; Sinniah, U.R.
2014-01-01
This study was carried out to establish an optimum In vitro shoot multiplication system using shoot tip explants derived from 7 week-old seedlings of Citrus hystrix. In the first experiment, shoot tips were cultured on Murashige and Skoog (MS) medium supplemented with 0-13.33 mu M 6-benzylaminopurine (BAP) for 8 weeks. Shoot tips cultured on 2.22 mu M BAP produced the highest mean number of shoots (3.42 shoots) but the shoots had low number of leaves (1.14 leaves) due to the occurrence of premature leaf senescence and callus formation. Meanwhile, the medium devoid of BAP produced the lowest mean number of shoots (1.50 shoots) but highest mean number of leaves (5.41 leaves) indicating that BAP was likely responsible for the premature leaf senescence. In order to overcome the occurrence of premature leaf senescence on medium with BAP, a second experiment was carried out whereby shoot tips were cultured on medium containing 2.22 micro M BAP fortified with 2.00, 4.00 and 6.00 mM calcium gluconate (Ca-glu) and a control treatment with 2.22 mu M BAP. The shoot and leaf numbers were increased with the addition of 4.00 and 6.00 mM Ca-glu. The presence of Ca-glu reduced premature leaf senescence and callus formation to some extent. In the third experiment, the addition of silver nitrate (AgNO/sub 3/) at 10-80 micro M in media with 2.22 micro M BAP and 2.22 micro M BAP + 4 mM Ca-glu could totally overcome premature leaf senescence and callus formation. Media supplemented with 2.22 mirco M BAP + 4 mM Ca-glu + 20 micro M AgNOsub 3/ significantly induced among the highest mean number of shoots and highest mean number of leaves per shoot. (author)
Directory of Open Access Journals (Sweden)
Ankita Jain
2015-01-01
Full Text Available Aim: To compare the effect of honey, chlorhexidine mouthwash and combination of xylitol chewing gum and chlorhexidine mouthwash on the dental plaque level. Materials and Methods: Ninety healthy dental students, both male and female, aged between 21 to 25 years participated in the study. The subjects were randomly divided into three groups, i.e. the honey group, the chlorhexidine gluconate mouthwash group and the combination of xylitol chewing gum and chlorhexidine (CHX mouthwash group. The data was collected at the baseline, 15 th day and 30 th day; the plaque was disclosed using disclosing solution and their scores were recorded at six sites per tooth using the Quigley and Hein plaque index modified by Turesky-Gilmore-Glickman. Statistical analysis was carried out later to compare the effect of all the three groups. P ≤ 0.05 was considered as statistically significant. Results: Our result showed that all the three groups were effective in reducing the plaque but post-hoc LSD (Least Significant Difference showed that honey group and chlorhexidine + xylitol group were more effective than chlorhexidine group alone. The results demonstrated a significant reduction of plaque indices in honey group and chlorhexidine + xylitol group over a period of 15 and 30 days as compared to chlorhexidine.
Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2007-01-01
Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.
Baribeault, David
2011-08-01
Parenteral sodium ferric gluconate in complex (Ferrlecit [branded SFG]) is used to treat patients with iron deficiency anemia undergoing chronic hemodialysis and receiving supplemental epoetin. This comparative pharmacokinetic study (GeneraMedix, Inc., Study 17909) evaluates whether the recently approved generic product Nulecit (generic SFG) and the branded product Ferrlecit (branded SFG) are bioequivalent. In this open-label study, 240 healthy volunteers in a fasting state were assigned randomly to a single 10-min intravenous (IV) infusion of 125 mg of generic or branded SFG. Total and transferrin-bound iron concentrations were determined for the 36-h period after infusion and corrected for pretreatment levels. Maximum concentration (Cmax) and area under the concentration-time curve of 0 to 36 h (AUC[0-36]) were compared between the two products. Demonstration of bioequivalence required that the 90% confidence intervals of each parameter evaluated for generic SFG were within 80% to 125% of the corresponding values for branded SFG. Uncorrected and baseline-corrected mean serum concentrations of total serum iron during the 36-h assessment period were similar for generic and branded SFG. For total serum iron, the geometric mean ratios of corrected Cmax and AUC[0-36] were 100%. For transferrin-bound iron, the geometric mean ratios were 87% for corrected Cmax and 92% for corrected AUC[0-36]. All associated 90% confidence intervals were within the range of 80% to 125%. A new generic SFG in complex for IV infusion is bioequivalent to the branded SFG in complex for IV infusion. The generic SFG is AB rated by the FDA and considered therapeutically equivalent to the branded product.
Börsile? Miks ka mitte! / Gea Velthut-Sokka
Velthut-Sokka, Gea, 1977-
2004-01-01
Infotehnoloogiakaupade hulgimüügifirma TD Baltic kavandab börsile minekut, et teenida raha Venemaa turule laienemiseks. Diagramm: TD Baltic ootab üle 15% kasvu. Lisa: Kuidas Computer 2000 Eestist TD Baltic sai. Kommentaarid Äripäeva toimetajalt Tõnis Ojalt ja konkureeriva arvutifirma GNT Eesti tegevjuhilt Anti Kuivalt
Lifescience Database Archive (English)
Full Text Available se may be complicated by myocarditis. Infectious disease ... Human enterovirus 71 Enterovirus A [GN:T40103] ... ...nd-foot-mouth disease and herpangina caused by enterovirus 71 in Taiwan, 1998-200...ORS ... Wong SS, Yip CC, Lau SK, Yuen KY ... TITLE ... Human enterovirus 71 and hand, foot and mouth disease. ...
Maldonado-Barragán, Antonio; Caballero-Guerrero, Belén; Lucena-Padrós, Helena; Ruiz-Barba, José Luis
2013-02-01
We describe the bacteriocin-production phenotype in a group of eight singular bacteriocinogenic Lactobacillus plantarum strains with three distinct genotypes regarding the plantaricin locus. Genotyping of these strains revealed the existence of two different plantaricin-production regulatory operons, plNC8-plNC8HK-plnD or plnABCD, involving three-component systems controlled each of them by a specific autoinducer peptide (AIP), i.e. PLNC8IF or PlnA. While all of the strains produced antimicrobial activity when growing on solid medium, most of them halted this production when cultured in broth, thus reflecting the functionality of regulatory mechanisms. Antimicrobial activity in broth cultures was re-established or enhanced when the specific AIP was added to the culture or by coculturing with specific bacterial strains. The latter trait appeared to be widespread in bacteriocinogenic L. plantarum strains independently of the regulatory system used to regulate bacteriocin production or the specific bacteriocins produced. The induction spectrum through coculture, i.e. the pattern of bacterial strains able to induce bacteriocin production, was characteristic of each individual L. plantarum strain. Also, the ability of some bacteria to induce bacteriocin production in L. plantarum by coculture appeared to be strain specific. The fact that induction of bacteriocin production by coculturing appeared to be a common feature in L. plantarum can be exploited accordingly to enhance the viability of this species in food and feed fermentations, as well as to contribute to probiotic functionality when colonising the gastrointestinal tract. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Tel' zhenskaya, P N; Shvarts, E M; Vitola, I M [AN Latvijskoj SSR, Riga (USSR). Inst. Neorganicheskoj Khimii
1990-01-01
Boron compounds with gluconic acid and monoethanol- and benzylamines are synthesized and investigated by physicochemical methods (IR-spectroscopy, thermal decomposition, conductometry, Fischer titration). Tetracoordinated boron has two free hydroxyl groups, dimer of boron-gluconate anion is held by hydrogen bonds, sodium ions and ammonium protonated salts are cations.
Sodium benzyl(monoethanol)ammonium bis(gluconatoborate)
International Nuclear Information System (INIS)
Tel'zhenskaya, P.N.; Shvarts, E.M.; Vitola, I.M.
1990-01-01
Boron compounds with gluconic acid and monoethanol- and benzylamines are synthesized and investigated by physicochemical methods (IR-spectroscopy, thermal decomposition, conductometry, Fischer titration). Tetracoordinated boron has two free hydroxyl groups, dimer of boron-gluconate anion is held by hydrogen bonds, sodium ions and ammonium protonated salts are cations
Lifescience Database Archive (English)
Full Text Available infection is only found in a subgroup of individuals simultaneously infected with the hepatitis B virus (HBV...), because HDV is a defective RNA agent needing the presence of HBV to produce its own coat. HDV may worsen an existing chronic hepat...itis B. Infectious disease ... Hepatitis delta virus [GN:T4
Towards novel amino acid-base contacts in gene regulatory proteins: AraR--a case study.
Directory of Open Access Journals (Sweden)
Isabel Lopes Correia
Full Text Available AraR is a transcription factor involved in the regulation of carbon catabolism in Bacillus subtilis. This regulator belongs to the vast GntR family of helix-turn-helix (HTH bacterial metabolite-responsive transcription factors. In this study, AraR-DNA specific interactions were analysed by an in vitro missing-contact probing and validated using an in vivo model. We show that amino acid E30 of AraR, a highly conserved residue in GntR regulators, is indirectly responsible for the specificity of amino acid-base contacts, and that by mutating this residue it will be possible to achieve new specificities towards DNA contacts. The results highlight the importance in DNA recognition and binding of highly conserved residues across certain families of transcription factors that are located in the DNA-binding domain but not predicted to specifically contact bases on the DNA. These new findings not only contribute to a more detailed comprehension of AraR-operator interactions, but may also be useful for the establishment of a framework of rules governing protein-DNA recognition.
Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C
2018-01-01
Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.
Directory of Open Access Journals (Sweden)
Leonardo N. Andrade
2018-03-01
Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.
GenBank blastx search result: AK104780 [KOME
Lifescience Database Archive (English)
Full Text Available AK104780 001-039-C06 AY026914.1 Pseudomonas putida strain P111 czrBA operon, partial sequence; ben operon... and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene.|BCT BCT 3e-11 +2 ...
GenBank blastx search result: AK287557 [KOME
Lifescience Database Archive (English)
Full Text Available AK287557 J065021C17 AY026914.1 AY026914 Pseudomonas putida strain P111 czrBA operon..., partial sequence; ben operon and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene. BCT 0.0 0 ...
GenBank blastx search result: AK109330 [KOME
Lifescience Database Archive (English)
Full Text Available AK109330 006-201-C10 AY026914.1 Pseudomonas putida strain P111 czrBA operon, partial sequence; ben operon... and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene.|BCT BCT 3e-11 +2 ...
GenBank blastx search result: AK289020 [KOME
Lifescience Database Archive (English)
Full Text Available AK289020 J090090F09 AY026914.1 AY026914 Pseudomonas putida strain P111 czrBA operon..., partial sequence; ben operon and ant operon, complete sequence; and catRBCA operon, partial sequence; and unknown gene. BCT 0.0 0 ...
International Nuclear Information System (INIS)
Horn, J.M.; Ohman, D.E.
1988-01-01
A promoterless chloramphenicol acetyltransferase gene (cat) was used to construct recA-cat operon fusions to quantitatively examine the transcriptional regulation of the Pseudomonas aeruginosa recA gene in P. aeruginosa PAO. Wild-type P. aeruginosa containing the recA8-cat fusion was treated with methyl methanesulfonate (MMS) and showed immediate induction of chloramphenicol acetyltransferase (CAT) specific activity, whereas a recA::Tn501 mutant of P. aeruginosa containing recA8-cat showed no induction with MMS. This indicated that a functional copy of recA was required for derepression of recA transcription and that P. aeruginosa recA protein was a positive regulatory factor promoting its own expression. Compared with that in the wild type, the uninduced level of CAT in recA8-cat-containing cells was reduced by approximately one-half in the recA::Tn501 mutant, indicating that recA+-dependent spontaneous induction contributes to the uninduced levels of recA expression in P. aeruginosa. MMS (0.012%) caused recA-directed CAT synthesis to increase almost immediately, with maximum CAT activity, fourfold higher than uninduced levels, attained at 60 min postinduction. The kinetics of recA8-cat fusion activity were shown to be directly related to the MMS doses used. Another fusion called recAa1-cat, where cat was located between the two transcriptional terminators of the P. aeruginosa recA gene, also showed dose-dependent induction by MMS, but the CAT activity from recAa1-cat was only one-half of that obtained with recA8-cat under the same conditions. Treatment of recA+ P. aeruginosa containing recA8-cat with UV irradiation produced an immediate effect on recA8-cat transcription and showed little UV dose dependency at doses of 5 J/m2 or greater
2012-01-01
Background The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. Results By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. Conclusions The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation. PMID:22243621
Becerra, Jimmy E; Yebra, María J; Monedero, Vicente
2015-06-01
L-Fucose is a sugar present in human secretions as part of human milk oligosaccharides, mucins, and other glycoconjugates in the intestinal epithelium. The genome of the probiotic Lactobacillus rhamnosus GG (LGG) carries a gene cluster encoding a putative L-fucose permease (fucP), L-fucose catabolic pathway (fucI, fucK, fucU, and fucA), and a transcriptional regulator (fucR). The metabolism of L-fucose in LGG results in 1,2-propanediol production, and their fucI and fucP mutants displayed a severe and mild growth defect on L-fucose, respectively. Transcriptional analysis revealed that the fuc genes are induced by L-fucose and subject to a strong carbon catabolite repression effect. This induction was triggered by FucR, which acted as a transcriptional activator necessary for growth on L-fucose. LGG utilized fucosyl-α1,3-N-acetylglucosamine and contrarily to other lactobacilli, the presence of fuc genes allowed this strain to use the L-fucose moiety. In fucI and fucR mutants, but not in fucP mutant, L-fucose was not metabolized and it was excreted to the medium during growth on fucosyl-α1,3-N-acetylglucosamine. The fuc genes were induced by this fucosyl-disaccharide in the wild type and the fucP mutant but not in a fucI mutant, showing that FucP does not participate in the regulation of fuc genes and that L-fucose metabolism is needed for FucR activation. The l-fucose operon characterized here constitutes a new example of the many factors found in LGG that allow this strain to adapt to the gastrointestinal conditions. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Schneider, Jens; Peters-Wendisch, Petra; Stansen, K Corinna; Götker, Susanne; Maximow, Stanislav; Krämer, Reinhard; Wendisch, Volker F
2012-01-13
The amino acid-producing Gram-positive Corynebacterium glutamicum is auxotrophic for biotin although biotin ring assembly starting from the precursor pimeloyl-CoA is still functional. It possesses AccBC, the α-subunit of the acyl-carboxylases involved in fatty acid and mycolic acid synthesis, and pyruvate carboxylase as the only biotin-containing proteins. Comparative genome analyses suggested that the putative transport system BioYMN encoded by cg2147, cg2148 and cg2149 might be involved in biotin uptake by C. glutamicum. By comparison of global gene expression patterns of cells grown with limiting or excess supply of biotin or with dethiobiotin as supplement replacing biotin revealed that expression of genes coding for enzymes of biotin ring assembly and for the putative uptake system was regulated according to biotin availability. RT-PCR and 5'-RACE experiments demonstrated that the genes bioY, bioM, and bioN are transcribed from one promoter as a single transcript. Biochemical analyses revealed that BioYMN catalyzes the effective uptake of biotin with a concentration of 60 nM biotin supporting a half-maximal transport rate. Maximal biotin uptake rates were at least five fold higher in biotin-limited cells as compared to cells grown with excess biotin. Overexpression of bioYMN led to an at least 50 fold higher biotin uptake rate as compared to the empty vector control. Overproduction of BioYMN alleviated biotin limitation and interfered with triggering L-glutamate production by biotin limitation. The operon bioYMN from C. glutamicum was shown to be induced by biotin limitation. Transport assays with radio-labeled biotin revealed that BioYMN functions as a biotin uptake system. Overexpression of bioYMN affected L-glutamate production triggered by biotin limitation.
No Clear Benefit of Chlorhexidine Use at Home Before Surgical Preparation
Jegede, Kolawole; Lombardi, Joseph; Whittier, Susan; Gorroochurn, Prakash; Lehman, Ronald A.; Riew, K. Daniel
2018-01-01
Introduction: Several studies have evaluated the efficacy of home use of chlorhexidine before surgery to reduce bacterial colonization. However, these studies have provided conflicting evidence about the potential efficacy of this strategy in decreasing bacterial loads and infection rates across surgical populations, and no prior study has analyzed the benefit of this intervention before spine surgery. We prospectively analyzed the effectiveness of chlorhexidine gluconate wipes for decreasing bacterial counts on the posterior neck. Methods: Sixteen healthy adults participated in this prospective study. The right side of each participant’s neck was wiped twice (the night before and the morning of the experiment) with chlorhexidine gluconate wipes. The left side was used as the control region. Bacterial swabs were obtained as a baseline upon enrollment in the study, then upon arrival at the hospital, and, finally, after both sides of the neck had received standard preoperative scrubbing. Results: All patients had positive baseline bacterial growth (median >1,000 colonies/mL). When chlorhexidine gluconate wipes were used, decreased bacterial counts were noted before the preoperative scrub, but this finding was not statistically significant (P = 0.059). All patients had zero bacteria identified on either side of their neck after completion of the preoperative scrub. Conclusion: At-home use of chlorhexidine gluconate wipes did not decrease the topical bacterial burden. Therefore, using chlorhexidine gluconate wipes at home before surgery may offer no added benefit. PMID:29227322