DEFF Research Database (Denmark)
D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene
2008-01-01
cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...
An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.
Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.
2004-01-01
(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae
Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.
1999-01-01
β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are
Oliveira-Garcia, Ely; Deising, Holger B
2016-08-01
In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong
2017-11-01
The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri
Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...
Exopolysaccharide (EPS synthesis by Oenococcus oeni: from genes to phenotypes.
Directory of Open Access Journals (Sweden)
Maria Dimopoulou
Full Text Available Oenococcus oeni is the bacterial species which drives malolactic fermentation in wine. The analysis of 50 genomic sequences of O. oeni (14 already available and 36 newly sequenced ones provided an inventory of the genes potentially involved in exopolysaccharide (EPS biosynthesis. The loci identified are: two gene clusters named eps1 and eps2, three isolated glycoside-hydrolase genes named dsrO, dsrV and levO, and three isolated glycosyltransferase genes named gtf, it3, it4. The isolated genes were present or absent depending on the strain and the eps gene clusters composition diverged from one strain to another. The soluble and capsular EPS production capacity of several strains was examined after growth in different culture media and the EPS structure was determined. Genotype to phenotype correlations showed that several EPS biosynthetic pathways were active and complementary in O. oeni. Can be distinguished: (i a Wzy-dependent synthetic pathway, allowing the production of heteropolysaccharides made of glucose, galactose and rhamnose, mainly in a capsular form, (ii a glucan synthase pathway (Gtf, involved in β-glucan synthesis in a free and a cell-associated form, giving a ropy phenotype to growth media and (iii homopolysaccharide synthesis from sucrose (α-glucan or β-fructan by glycoside-hydrolases of the GH70 and GH68 families. The eps gene distribution on the phylogenetic tree was examined. Fifty out of 50 studied genomes possessed several genes dedicated to EPS metabolism. This suggests that these polymers are important for the adaptation of O. oeni to its specific ecological niche, wine and possibly contribute to the technological performance of malolactic starters.
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick
2012-06-01
A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.
Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça
2017-03-07
The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
β-1,3-glucan in developing cotton fibers
International Nuclear Information System (INIS)
Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.
1979-01-01
Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis
Efficient screening methods for glucosyltransferase genes in Lactobacillus strains
Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L
2003-01-01
Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...
Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.
Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P
2017-11-01
Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs
Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert
2016-01-20
α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.
Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon
2014-11-01
The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.
International Nuclear Information System (INIS)
Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo
2015-01-01
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber
Energy Technology Data Exchange (ETDEWEB)
Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)
2015-02-27
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.
DEFF Research Database (Denmark)
Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo
2008-01-01
Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...
Plants with elevated levels of glucan
Energy Technology Data Exchange (ETDEWEB)
Pauly, Markus; Kraemer, Florian J.; Hake, Sarah
2018-03-20
The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.
Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.
Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David
2014-10-22
Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.
Theuwissen, Elke; Mensink, Ronald P
2007-03-01
Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.
Oliveira-Garcia, Ely; Deising, Holger B.
2013-01-01
β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).
Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio
2008-01-01
Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.
Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki
2015-01-01
We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.
DEFF Research Database (Denmark)
Munck, L.; Møller, B.; Jacobsen, Susanne
2004-01-01
-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....
Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang
2017-07-28
The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.
Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction
Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar
2013-01-01
Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938
Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert
Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical
Visual effects of β-glucans on wound healing in fish
DEFF Research Database (Denmark)
Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær
2011-01-01
Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...
Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.
Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G
2017-08-15
Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Watanabe, Daisuke; Zhou, Yan; Hirata, Aiko; Sugimoto, Yukiko; Takagi, Kenichi; Akao, Takeshi; Ohya, Yoshikazu; Takagi, Hiroshi; Shimoi, Hitoshi
2016-01-01
The high fermentation rate of Saccharomyces cerevisiae sake yeast strains is attributable to a loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-family protein kinase that is conserved among eukaryotes. In the present study, we performed intracellular metabolic profiling analysis and revealed that deletion of the RIM15 gene in a laboratory strain impaired glucose-anabolic pathways through the synthesis of UDP-glucose (UDPG). Although Rim15p is required for the synthesis of trehalose and glycogen from UDPG upon entry of cells into the quiescent state, we found that Rim15p is also essential for the accumulation of cell wall β-glucans, which are also anabolic products of UDPG. Furthermore, the impairment of UDPG or 1,3-β-glucan synthesis contributed to an increase in the fermentation rate. Transcriptional induction of PGM2 (phosphoglucomutase) and UGP1 (UDPG pyrophosphorylase) was impaired in Rim15p-deficient cells in the early stage of fermentation. These findings demonstrate that the decreased anabolism of glucose into UDPG and 1,3-β-glucan triggered by a defect in the Rim15p-mediated upregulation of PGM2 and UGP1 redirects the glucose flux into glycolysis. Consistent with this, sake yeast strains with defective Rim15p exhibited impaired expression of PGM2 and UGP1 and decreased levels of β-glucans, trehalose, and glycogen during sake fermentation. We also identified a sake yeast-specific mutation in the glycogen synthesis-associated glycogenin gene GLG2, supporting the conclusion that the glucose-anabolic pathway is impaired in sake yeast. These findings demonstrate that downregulation of the UDPG synthesis pathway is a key mechanism accelerating alcoholic fermentation in industrially utilized S. cerevisiae sake strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R
2018-04-03
Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which
Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick
2017-04-01
Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya
2017-07-01
We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B
2016-04-05
Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.
A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.
Directory of Open Access Journals (Sweden)
Heather T Taff
Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.
Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan
2017-04-01
Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable
Thao, Cao Phuong; Tien, Le Thi Thuy
2017-09-01
β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.
Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers
International Nuclear Information System (INIS)
Dugger, W.M.; Palmer, R.L.
1986-01-01
The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system
Directory of Open Access Journals (Sweden)
Chiraphon Chaikliang
2015-11-01
Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of
Malik, Amarila; Radji, Maksum; Kralj, Slavko; Dijkhuizen, Lubbert
2009-01-01
Homopolysaccharide (glucan and fructan) synthesis from sucrose by sucrase enzymes in lactic acid bacteria (LAB) has been well studied in the genera Leuconostoc, Streptococcus and Lactobacillus. This study aimed to identify and characterize genes encoding glucansucrase/glucosyltransferase (GTF) and
Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.
Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A
2018-05-01
Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.
Bontemps-Gallo, Sébastien; Madec, Edwige; Lacroix, Jean-Marie
2014-04-01
Dickeya dadantii is a phytopathogenic enterobacterium that causes soft rot disease in a wide range of plant species. Maceration, an apparent symptom of the disease, is the result of the synthesis and secretion of a set of plant cell wall-degrading enzymes (PCWDEs), but many additional factors are required for full virulence. Among these, osmoregulated periplasmic glucans (OPGs) and the PecS transcriptional regulator are essential virulence factors. Several cellular functions are controlled by both OPGs and PecS. Strains devoid of OPGs display a pleiotropic phenotype including total loss of virulence, loss of motility and severe reduction in the synthesis of PCWDEs. PecS is one of the major regulators of virulence in D. dadantii, acting mainly as a repressor of various cellular functions including virulence, motility and synthesis of PCWDEs. The present study shows that inactivation of the pecS gene restored virulence in a D. dadantii strain devoid of OPGs, indicating that PecS cannot be de-repressed in strains devoid of OPGs.
Synthesis of cell wall xylans and glucans by golgi membranes
International Nuclear Information System (INIS)
Gibeaut, D.M.; Carpita, N.C.
1989-01-01
We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus
Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G
2011-03-01
This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Defining Starch Binding by Glucan Phosphatases
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2015-01-01
Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...
van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.
Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).
DEFF Research Database (Denmark)
Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig
2017-01-01
binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...
Industrial scale gene synthesis.
Notka, Frank; Liss, Michael; Wagner, Ralf
2011-01-01
The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery. Copyright © 2011 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Satoh, S; Matsuda, K; Tamari, K
1976-12-01
A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.
Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi
2008-06-01
Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.
Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki
2015-01-01
We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10オ (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol...
Glucan: mechanisms involved in its radioprotective effect
International Nuclear Information System (INIS)
Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.
1987-01-01
It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested
First principles insight into the α-glucan structures of starch
DEFF Research Database (Denmark)
Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas
2010-01-01
A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....
Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.
UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity
International Nuclear Information System (INIS)
Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.
1989-01-01
A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains
Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.
Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza
2008-03-20
Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave
2013-03-01
The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All
Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan
2015-01-01
Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939
6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.
Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu
2016-02-12
With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.
β-glucan extract from oat bran and its industrial importance
Ibrahim, M. N. G.; Selezneva, I. S.
2017-09-01
The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave
2014-08-01
The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)
2010-08-01
In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht
For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...
International Nuclear Information System (INIS)
Roeber, B.; Reuter, G.
1982-01-01
Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)
We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...
Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi
Directory of Open Access Journals (Sweden)
Akira Yoshimi
2017-11-01
Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave
2014-01-01
The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...
Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert
2016-01-01
α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were
Preparation, characterization, and biological properties of β-glucans
Directory of Open Access Journals (Sweden)
Sandeep Rahar
2011-01-01
Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome
Directory of Open Access Journals (Sweden)
D. El Khoury
2012-01-01
Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.
Directory of Open Access Journals (Sweden)
Vivekanand Vivekanand
2010-05-01
Full Text Available Abstract Background Oat, Avena sativa is the sixth most important cereal in the world. Presently oat is mostly used as feed for animals. However, oat also has special properties that make it beneficial for human consumption and has seen a growing importance as a food crop in recent decades. Increased demand for novel oat products has also put pressure on oat breeders to produce new oat varieties with specific properties such as increased or improved β-glucan-, antioxidant- and omega-3 fatty acid levels, as well as modified starch and protein content. To facilitate this development we have produced a TILLING (Targeting Induced Local Lesions IN Genomes population of the spring oat cultivar SW Belinda. Results Here a population of 2600 mutagenised M2 lines, producing 2550 M3 seed lots were obtained. The M2 population was initially evaluated by visual inspection and a number of different phenotypes were seen ranging from dwarfs to giants, early flowering to late flowering, leaf morphology and chlorosis. Phloroglucinol/HCl staining of M3 seeds, obtained from 1824 different M2 lines, revealed a number of potential lignin mutants. These were later confirmed by quantitative analysis. Genomic DNA was prepared from the M2 population and the mutation frequency was determined. The estimated mutation frequency was one mutation per 20 kb by RAPD-PCR fingerprinting, one mutation per 38 kb by MALDI-TOF analysis and one mutation per 22.4 kb by DNA sequencing. Thus, the overall mutation frequency in the population is estimated to be one mutation per 20-40 kb, depending on if the method used addressed the whole genome or specific genes. During the investigation, 6 different mutations in the phenylalanine ammonia-lyase (AsPAL1 gene and 10 different mutations in the cellulose synthase-like (AsCslF6 β-glucan biosynthesis gene were identified. Conclusion The oat TILLING population produced in this work carries, on average, hundreds of mutations in every individual
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Directory of Open Access Journals (Sweden)
Sharon Avni
2017-07-01
Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.
Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij
2015-07-20
Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
Energy Technology Data Exchange (ETDEWEB)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2010-07-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
International Nuclear Information System (INIS)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon
2010-01-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity
Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan
Directory of Open Access Journals (Sweden)
JD Biller-Takahashi
Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.
Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.
Suppressing effects of glucan on micronuclei induced by Co60 in mice
International Nuclear Information System (INIS)
Chorvatovicova, D.
1991-01-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de
Efficient screening methods for glucosyltransferase genes in Lactobacillus strains
Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L
Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate
Efficient screening methods for glucosyltransferase genes in Lactobacillus strains
Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2003-01-01
Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-07-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
International Nuclear Information System (INIS)
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-01-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Homeobox genes and melatonin synthesis
DEFF Research Database (Denmark)
Rohde, Kristian; Møller, Morten; Rath, Martin Fredensborg
2014-01-01
Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a cAMP-based indu......Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a c......AMP-based induction of Aanat transcription. However, additional transcriptional control mechanisms exist. Homeobox genes, which are generally known to encode transcription factors controlling developmental processes, are also expressed in the mature rodent pineal gland. Among these, the cone-rod homeobox (CRX......) transcription factor is believed to control pineal-specific Aanat expression. Based on recent advances in our understanding of Crx in the rodent pineal gland, we here suggest that homeobox genes play a role in adult pineal physiology both by ensuring pineal-specific Aanat expression and by facilitating c...
Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I
International Nuclear Information System (INIS)
Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.
1998-01-01
The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains
Czech Academy of Sciences Publication Activity Database
Šíma, Petr; Vannucci, Luca; Větvička, V.
2017-01-01
Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016
Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice
Energy Technology Data Exchange (ETDEWEB)
Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)
1991-10-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).
Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation
Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.
2015-01-01
β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the
Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J
2009-10-14
To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.
Effects of gamma irradiation on the physical and structural properties of β-glucan
International Nuclear Information System (INIS)
Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon
2008-01-01
This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility
Recent insight in α-glucan metabolism in probiotic bacteria
DEFF Research Database (Denmark)
Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm
2014-01-01
α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...
β-Glucans: Relationships between Modification, Conformation and Functional Activities
Directory of Open Access Journals (Sweden)
Qiang Wang
2017-02-01
Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.
Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.
Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro
2013-12-15
A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.
Study on the immuno stimulation of radiation degraded β-glucan in swiss mice
International Nuclear Information System (INIS)
Nguyen Thanh Long; Le Quang Luan
2015-01-01
The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)
Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia
International Nuclear Information System (INIS)
Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu
2013-01-01
Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)
Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H
2016-01-01
Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Structure and function of α-glucan debranching enzymes
DEFF Research Database (Denmark)
Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte
2016-01-01
α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....
Effect of purified oat β-glucan on fermentation of set-style yogurt mix.
Singh, Mukti; Kim, Sanghoon; Liu, Sean X
2012-08-01
Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.
Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2016-01-01
was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...
Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.
Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan
2013-05-01
The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
KUSMIATI
2007-04-01
Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both
Directory of Open Access Journals (Sweden)
Taiki Kobayashi
Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.
Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher
2017-06-15
Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a
Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.
Gomaa, K; Kraus, J; Franz, G; Röper, H
1991-09-18
Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.
The structure of cell wall alpha-glucan from fission yeast
Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
The structure of cell wall alpha-glucan from fission yeast.
Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
Directory of Open Access Journals (Sweden)
Claudia Zielke
Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.
Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods
Directory of Open Access Journals (Sweden)
Vesna Zechner-Krpan
2010-01-01
Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.
Zheng, Xueling; Li, Limin; Wang, Qi
2011-01-01
Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.
Enzymology and Molecular Biology of Cell Wall Biosynthesis. Final Technical Report
Energy Technology Data Exchange (ETDEWEB)
Dr. Peter M. Ray
2000-04-01
The following aspects of enzymology of cell wall synthesis were pursued under this cited grant: (1) Isolation of plasma membrane-localized glucan synthase II (GS-II) of pea; (2) Cloning of genes for possible plant GS-II components; (3) Golgi glucan synthase-I (GS-I); and (4) Golgi reversibly glycosylated protein 1 (RGP1).
Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus
Directory of Open Access Journals (Sweden)
Ira Widjiastuti
2017-03-01
Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of
Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.
Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa
2014-06-01
Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.
Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.
Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G
1992-01-01
The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.
DNA repair synthesis dependent on the uvrA,B gene products
International Nuclear Information System (INIS)
Moses, R.E.; Moody, E.E.M.
1975-01-01
Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required
Antibiotic resistance and ndvB gene expression among biofilm ...
African Journals Online (AJOL)
A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...
Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A
2016-01-01
Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.
Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou
2004-03-26
The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.
New perspectives on the role of α- and β-amylases in transient starch synthesis.
Wu, Alex Chi; Ral, Jean-Philippe; Morell, Matthew K; Gilbert, Robert G
2014-01-01
Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (bio)synthesis of the chain-length distribution (CLD) of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.
Directory of Open Access Journals (Sweden)
Robert T Wheeler
2008-12-01
Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.
Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder
2017-07-18
Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.
Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.
Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang
2016-01-01
Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.
Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329
Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos
2013-01-01
Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729
New perspectives on the role of α- and β-amylases in transient starch synthesis.
Directory of Open Access Journals (Sweden)
Alex Chi Wu
Full Text Available Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (biosynthesis of the chain-length distribution (CLD of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.
Glucan Particles for Macrophage Targeted Delivery of Nanoparticles
Directory of Open Access Journals (Sweden)
Ernesto R. Soto
2012-01-01
Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.
Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide
Directory of Open Access Journals (Sweden)
E. Y. Choi
2016-11-01
Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.
Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria
Directory of Open Access Journals (Sweden)
Mattia P. Arena
2014-02-01
Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.
Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S
2013-03-01
β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.
Modulation of the immune response of porcine neutrophils by different β-glucan preparations
DEFF Research Database (Denmark)
Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard
2010-01-01
β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...
Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Directory of Open Access Journals (Sweden)
AHMAD THONTOWI
2007-10-01
Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.
Beta-glucans in the treatment of diabetes and associated cardiovascular risks
Directory of Open Access Journals (Sweden)
Jiezhong Chen
2008-12-01
Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis
Directory of Open Access Journals (Sweden)
Matthew J. Elder
2017-07-01
Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.
Various roles of beta-glucan in invertebrates
Czech Academy of Sciences Publication Activity Database
Větvička, V.; Šíma, Petr
2017-01-01
Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016
Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L
2014-02-07
The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.
Directory of Open Access Journals (Sweden)
Fhernanda R Smiderle
Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.
Directory of Open Access Journals (Sweden)
Antonio Francioso
2017-05-01
Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.
Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu
2017-07-01
The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ethylene-induced senescence-related gene expression requires protein synthesis
International Nuclear Information System (INIS)
Lawton, K.A.; Raghothama, K.G.; Woodson, W.R.
1990-01-01
We have investigated the effects of inhibiting protein synthesis on the ethylene-induced expression of 3 carnation senescence-related genes, pSR5, pSR8, and pSR12. Treatment of preclimacteric carnation petal discs with 1μg/ml of cycloheximide, a cytoplasmic protein synthesis inhibitor, for 3h inhibited protein synthesis by >80% as quantitated by the incorporation of [35S]methionine into protein. Pre-treatment of petal discs with cycloheximide prevented ethylene-induced SR transcript accumulation. Cycloheximide treatment of petal discs held in air did not result in increased levels of SR mRNA. These results indicate that ethylene does not interact with pre-formed factors but rather that the activation of SR gene expression by ethylene is mediated by labile protein factor(s) synthesized on cytoplasmic ribosomes. Experiments are currently underway to determine if cycloheximide exerts its effect at the transcriptional or post-transcriptional level
Expression of genes associated with carbohydrate metabolism in cotton stems and roots
Directory of Open Access Journals (Sweden)
Scheffler Jodi
2009-01-01
Full Text Available Abstract Background Cotton (Gossypium hirsutum L is an important crop worldwide that provides fiber for the textile industry. Cotton is a perennial plant that stores starch in stems and roots to provide carbohydrates for growth in subsequent seasons. Domesticated cotton makes these reserves available to developing seeds which impacts seed yield. The goals of these analyses were to identify genes and physiological pathways that establish cotton stems and roots as physiological sinks and investigate the role these pathways play in cotton development during seed set. Results Analysis of field-grown cotton plants indicated that starch levels peaked about the time of first anthesis and then declined similar to reports in greenhouse-grown cotton plants. Starch accumulated along the length of the stem and the shape and size of the starch grains from stems were easily distinguished from transient starch. Microarray analyses compared gene expression in tissues containing low levels of starch with tissues rapidly accumulating starch. Statistical analysis of differentially expressed genes indicated increased expression among genes associated with starch synthesis, starch degradation, hexose metabolism, raffinose synthesis and trehalose synthesis. The anticipated changes in these sugars were largely confirmed by measuring soluble sugars in selected tissues. Conclusion In domesticated cotton starch stored prior to flowering was available to support seed production. Starch accumulation observed in young field-grown plants was not observed in greenhouse grown plants. A suite of genes associated with starch biosynthesis was identified. The pathway for starch utilization after flowering was associated with an increase in expression of a glucan water dikinase gene as has been implicated in utilization of transient starch. Changes in raffinose levels and levels of expression of genes controlling trehalose and raffinose biosynthesis were also observed in vegetative
Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil
Chang, I.; Cho, G.
2012-12-01
Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.
Directory of Open Access Journals (Sweden)
Jenneke Leentjens
Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.
Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis
Directory of Open Access Journals (Sweden)
Tomoko Jippo
2015-02-01
Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases
Directory of Open Access Journals (Sweden)
Fulcher R Gary
2007-03-01
Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other
International Nuclear Information System (INIS)
Schmidt, W.E.; Ebel, J.
1987-01-01
Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay
Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats
International Nuclear Information System (INIS)
Salama, S.F.
2011-01-01
1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications
Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen
2004-10-01
Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.
A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.
Das, Deeplina; Baruah, Rwivoo; Goyal, Arun
2014-08-01
An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.
Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast
Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans
2007-01-01
The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential
Long-lived effects of administering β-glucans
Petit, Jules; Wiegertjes, Geert F.
2016-01-01
Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a
Effect of purified oat ß-glucan on fermentation of set-style yogurt mix
Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...
Rosburg, Valerie; Boylston, Terri; White, Pamela
2010-06-01
Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.
Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.
Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui
2016-12-01
β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.
2017-01-01
-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....
Energy Technology Data Exchange (ETDEWEB)
Peng, Zhaohua PEng [Mississippi State University; Ronald, Palmela [UC-Davis; Wang, Guo-Liang [The Ohio State University
2013-04-26
This project aims to identify the regulatory genes of rice cell wall synthesis pathways using a cell wall removal and regeneration system. We completed the gene expression profiling studies following the time course from cell wall removal to cell wall regeneration in rice suspension cells. We also completed, total proteome, nuclear subproteome and histone modification studies following the course from cell wall removal and cell wall regeneration process. A large number of differentially expressed regulatory genes and proteins were identified. Meanwhile, we generated RNAi and over-expression transgenic rice for 45 genes with at least 10 independent transgenic lines for each gene. In addition, we ordered T-DNA and transposon insertion mutants for 60 genes from Korea, Japan, and France and characterized the mutants. Overall, we have mutants and transgenic lines for over 90 genes, exceeded our proposed goal of generating mutants for 50 genes. Interesting Discoveries a) Cell wall re-synthesis in protoplasts may involve a novel cell wall synthesis mechanism. The synthesis of the primary cell wall is initiated in late cytokinesis with further modification during cell expansion. Phragmoplast plays an essential role in cell wall synthesis. It services as a scaffold for building the cell plate and formation of a new cell wall. Only one phragmoplast and one new cell wall is produced for each dividing cell. When the cell wall was removed enzymatically, we found that cell wall re-synthesis started from multiple locations simultaneously, suggesting that a novel mechanism is involved in cell wall re-synthesis. This observation raised many interesting questions, such as how the starting sites of cell wall synthesis are determined, whether phragmoplast and cell plate like structures are involved in cell wall re-synthesis, and more importantly whether the same set of enzymes and apparatus are used in cell wall re-synthesis as during cytokinesis. Given that many known cell wall
Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans
DEFF Research Database (Denmark)
Mikkelsen, Mette Skau
-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...
Kumari, J; Sahoo, P K
2006-02-01
This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy
DEFF Research Database (Denmark)
Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling
2010-01-01
To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...
Directory of Open Access Journals (Sweden)
Jae Gil Lee
2016-06-01
Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.
Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.
2018-03-01
Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.
A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.
Semedo, Magda C; Karmali, Amin; Fonseca, Luís
2015-02-01
Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.
Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John
2012-01-01
ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739
Directory of Open Access Journals (Sweden)
Đukić Nevena H.
2014-01-01
Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092
Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.
Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong
2017-02-01
(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis
Immunostimulatory properties and antitumor activities of glucans (Review)
Czech Academy of Sciences Publication Activity Database
Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.
2013-01-01
Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013
Synthesis of S-linked cello-oligosaccharides
DEFF Research Database (Denmark)
Nami, Faranak
, structurally well-defined oligosaccharides made via chemical synthesis can be used as models for the more complex polysaccharides in the investigation of properties such as polysaccharide biosynthesis, degradation and protein-carbohydrate interactions. For this purpose, non-natural substrate analogues forming...... irreversible binding to the enzyme can be employed. Thio-oligosaccharides represent the largest class of specific non-natural inhibitors for glycanases. In this thesis the chemical synthesis of some thio-glucans is presented. The formation of thio-linkages using a classical and non-classical method...... is investigated. Two strategies, relying on either a linear or a convergent strategy, have been employed in the synthesis towards two target molecules. Furthermore, the activity of a glycosyltransferase responsible for the elongation of a pectic polysaccharide has been investigated and partially characterized....
The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.
Directory of Open Access Journals (Sweden)
Chad Steele
2005-12-01
Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.
Directory of Open Access Journals (Sweden)
Henky Manoppo
2010-06-01
Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.
Directory of Open Access Journals (Sweden)
Ľubomír Mikuš
2013-02-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too. At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258
Michel, Gurvan; Tonon, Thierry; Scornet, Delphine; Cock, J Mark; Kloareg, Bernard
2010-10-01
• Brown algae exhibit a unique carbon (C) storage metabolism. The photoassimilate D-fructose 6-phosphate is not used to produce sucrose but is converted into D-mannitol. These seaweeds also store C as β-1,3-glucan (laminarin), thus markedly departing from most living organisms, which use α-1,4-glucans (glycogen or starch). • Using a combination of bioinformatic and phylogenetic approaches, we identified the candidate genes for the enzymes involved in C storage in the genome of the brown alga Ectocarpus siliculosus and traced their evolutionary origins. • Ectocarpus possesses a complete set of enzymes for synthesis of mannitol, laminarin and trehalose. By contrast, the pathways for sucrose, starch and glycogen are completely absent. • The synthesis of β-1,3-glucans appears to be a very ancient eukaryotic pathway. Brown algae inherited the trehalose pathway from the red algal progenitor of phaeoplasts, while the mannitol pathway was acquired by lateral gene transfer from Actinobacteria. The starch metabolism of the red algal endosymbiont was entirely lost in the ancestor of Stramenopiles. In light of these novel findings we question the validity of the 'Chromalveolate hypothesis'.
Directory of Open Access Journals (Sweden)
Silvia Argimón
Full Text Available Glucosyltransferases (Gtfs catalyze the synthesis of glucans from sucrose and are produced by several species of lactic-acid bacteria. The oral bacterium Streptococcus mutans produces large amounts of glucans through the action of three Gtfs. GtfD produces water-soluble glucan (WSG, GtfB synthesizes water-insoluble glucans (WIG and GtfC produces mainly WIG but also WSG. These enzymes, especially those synthesizing WIG, are of particular interest because of their role in the formation of dental plaque, an environment where S. mutans can thrive and produce lactic acid, promoting the formation of dental caries. We sequenced the gtfB, gtfC and gtfD genes from several mutans streptococcal strains isolated from the oral cavity of humans and searched for their homologues in strains isolated from chimpanzees and macaque monkeys. The sequence data were analyzed in conjunction with the available Gtf sequences from other bacteria in the genera Streptococcus, Lactobacillus and Leuconostoc to gain insights into the evolutionary history of this family of enzymes, with a particular emphasis on S. mutans Gtfs. Our analyses indicate that streptococcal Gtfs arose from a common ancestral progenitor gene, and that they expanded to form two clades according to the type of glucan they synthesize. We also show that the clade of streptococcal Gtfs synthesizing WIG appeared shortly after the divergence of viviparous, dentate mammals, which potentially contributed to the formation of dental plaque and the establishment of several streptococci in the oral cavity. The two S. mutans Gtfs capable of WIG synthesis, GtfB and GtfC, are likely the product of a gene duplication event. We dated this event to coincide with the divergence of the genomes of ancestral early primates. Thus, the acquisition and diversification of S. mutans Gtfs predates modern humans and is unrelated to the increase in dietary sucrose consumption.
Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults
DEFF Research Database (Denmark)
Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe
2013-01-01
for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...
Kupetz, M; Sacher, B; Becker, T
2016-06-05
Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.
Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael
2001-01-01
(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...
Directory of Open Access Journals (Sweden)
Ernesto R. Soto
2016-01-01
Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.
Poly(3-Hydroxybutyrate) Synthesis Genes in Azotobacter sp. Strain FA8
Pettinari, M. Julia; Vázquez, Gustavo J.; Silberschmidt, Daniel; Rehm, Bernd; Steinbüchel, Alexander; Méndez, Beatriz S.
2001-01-01
Genes responsible for the synthesis of poly(3-hydroxybutyrate) (PHB) in Azotobacter sp. FA8 were cloned and analyzed. A PHB polymerase gene (phbC) was found downstream from genes coding for β-ketothiolase (phbA) and acetoacetyl-coenzyme A reductase (phbB). A PHB synthase mutant was obtained by gene inactivation and used for genetic studies. The phbC gene from this strain was introduced into Ralstonia eutropha PHB-4 (phbC-negative mutant), and the recombinant accumulated PHB when either glucos...
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas
2012-01-01
Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...
Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie
2018-06-19
The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.
Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P
1989-05-01
A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.
Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H
1990-04-01
Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.
Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols
Directory of Open Access Journals (Sweden)
A. Korpi
2003-01-01
Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.
The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice
Directory of Open Access Journals (Sweden)
Fengdan Jin
2014-01-01
Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.
Combined effects of added beta glucan and black tea in breads on starch functionality.
Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L
2015-03-01
Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.
Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.
Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the
International Nuclear Information System (INIS)
Skorupska, A.; Derylo, M.
1993-01-01
A 5.4 kb BamHI fragment of Rhizobium leguminosarum (R.l.) bv. trifolii TA1 was found to carry genes involved in exopolysaccharide synthesis (exo genes). This fragment was strongly hybridized to the total DNA from DNA from R.l. bv. viciae and bv. phaseoli digested with EcoRI. No homology was found with total DNA of R. melilotic and Rhizobium sp. NGR 234. The exo genes R.l. bv. trifolii TA1 conjugally introduced into R.l. bv. viciae 1302 considerably affected the symbiosis: the nodules induced on vetch were abortive and did not fix nitrogen. On the other hand, Phaseolus beans infected with R.l. bv. trifolii exo genes formed the nitrogen-fixing nodules. It can be conduced that additional copies of exo genes introduced into wild type R.l. strains can disturb the synthesis of acidic exopolysaccharides and affect symbiosis of the plants forming indeterminate nodules, but do not affect symbiosis of the plants forming the determinate nodules. (author). 29 refs, 2 figs, 2 tabs
Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms
Directory of Open Access Journals (Sweden)
Daniela Fiocco
2012-05-01
Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.
Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum
2010-01-01
Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB
DEFF Research Database (Denmark)
Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.
2012-01-01
Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...
Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.
Directory of Open Access Journals (Sweden)
Reshma Davidson
Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.
Directory of Open Access Journals (Sweden)
Anna C. Seybold
2017-12-01
Full Text Available Panagrolaimus sp. DAW1 is a freeze-tolerant Antarctic nematode which survives extensive intracellular ice formation. The molecular mechanisms of this extreme adaptation are still poorly understood. We recently showed that desiccation-enhanced RNA interference (RNAi soaking can be used in conjunction with quantitative polymerase chain reaction (qPCR to screen for phenotypes associated with reduced expression of candidate genes in Panagrolaimus sp. DAW1. Here, we present the use of this approach to investigate the role of trehalose synthesis genes in this remarkable organism. Previous studies have shown that acclimating Panagrolaimus sp. DAW1 at 5°C before freezing or desiccation substantially enhances survival. In this study, the expression of tps-2 and other genes associated with trehalose metabolism, as well as lea-1, hsp-70 and gpx-1, in cold-acclimated and non-acclimated nematodes was analyzed using qPCR. Pd-tps-2 and Pd-lea-1 were significantly upregulated after cold acclimation, indicating an inducible expression in the cold adaptation of Panagrolaimus sp. DAW1. The role of trehalose synthesis genes in Panagrolaimus sp. DAW1 was further investigated by RNAi. Compared to the controls, Pd-tps-2a(RNAi-treated and cold-acclimated nematodes showed a significant decrease in mRNA, but no change in trehalose content or freezing survival. The involvement of two other trehalose synthesis genes (tps-2b and gob-1 was also investigated. These findings provide the first functional genomic investigation of trehalose synthesis genes in the non-model organism Panagrolaimus sp. DAW1. The presence of several trehalose synthesis genes with different RNAi sensitivities suggests the existence of multiple backup systems in Panagrolaimus sp. DAW1, underlining the importance of this sugar in preparation for freezing.
The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.
Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum
2014-04-01
Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.
Stimulation of the synthesis of bacteriophage T4 gene 32 protein by ultraviolet light irradiation
International Nuclear Information System (INIS)
Krisch, H.M.; Van Houwe, G.
1976-01-01
The synthesis of bacteriophage T4 gene 32 product, P32, has been followed by gel electrophoresis of lysates of infected cells which have been irradiated with ultraviolet light. In wild-type infections irradiation after the commencement of late gene expression results in a rapid stimulation of the rate of P32 synthesis. Within four minutes after irradiation P32 is synthesized at 11 times the rate of the unirradiated control infection. P32 seems to be the only T4 protein which exhibits such u.v. inducibility. This inducibility is dependent on the function of genes 46 and 47 and to a lesser extent on several other T4 genes thought to be involved in repair (P43, w and y). An infection defective in both P43 and P46 shows essentially no stimulation of the rate of P32 synthesis after irradiation. In the absence of DNA replication the parental DNA is degraded after irradiation in a dose-dependent manner. The extent of P32 induction in such an infection is also proportional to the dose. It is suggested that the production of gaps during repair of u.v.-irradiated DNA is responsible for the stimulation of P32 synthesis. A model is proposed in which such regions of single-stranded DNA compete for P32 by binding it nonspecifically, thus reducing the amount of P32 free to block the expression of gene 32. Because the expression of gene 32 is self-regulatory this would result in increased P32 synthesis. The possible role of P32 in the repair of u.v.-damaged DNA is discussed. (author)
Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun
2016-01-01
An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.
Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S
2013-10-01
Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.
Cell Wall Composition and Candidate Biosynthesis Gene Expression During Rice Development
Energy Technology Data Exchange (ETDEWEB)
Lin, Fan; Manisseri, Chithra; Fagerström, Alexandra; Peck, Matthew L.; Vega-Sánchez, Miguel E.; Williams, Brian; Chiniquy, Dawn M.; Saha, Prasenjit; Pattathil, Sivakumar; Conlin, Brian; Zhu, Lan; Hahn, Michael G.; Willats, William G. T.; Scheller, Henrik V.; Ronald, Pamela C.; Bartley, Laura E.
2016-08-01
Cell walls of grasses, including cereal crops and biofuel grasses, comprise the majority of plant biomass and intimately influence plant growth, development and physiology. However, the functions of many cell wall synthesis genes, and the relationships among and the functions of cell wall components remain obscure. To better understand the patterns of cell wall accumulation and identify genes that act in grass cell wall biosynthesis, we characterized 30 samples from aerial organs of rice (Oryza sativa cv. Kitaake) at 10 developmental time points, 3-100 d post-germination. Within these samples, we measured 15 cell wall chemical components, enzymatic digestibility and 18 cell wall polysaccharide epitopes/ligands. We also used quantitative reverse transcription-PCR to measure expression of 50 glycosyltransferases, 15 acyltransferases and eight phenylpropanoid genes, many of which had previously been identified as being highly expressed in rice. Most cell wall components vary significantly during development, and correlations among them support current understanding of cell walls. We identified 92 significant correlations between cell wall components and gene expression and establish nine strong hypotheses for genes that synthesize xylans, mixed linkage glucan and pectin components. This work provides an extensive analysis of cell wall composition throughout rice development, identifies genes likely to synthesize grass cell walls, and provides a framework for development of genetically improved grasses for use in lignocellulosic biofuel production and agriculture.
DEFF Research Database (Denmark)
Jacobsen, Susanne; Søndergaard, Ib; Møller, Birthe
2005-01-01
Analysis (PCA). Riso mutants R-13, R-29 high (I -> 3, 1 -> 4)-beta-glucan, low starch and R-1508 (high lysine, reduced starch), near isogeneic controls and normal lines and recombinants were studied. Based on proteome analysis results, six antimicrobial proteins were followed during endosperm development...... revealing pleiotropic gene effects in expression timing that supporting the gene classification. To verify that NIR spectroscopy data represents a physio-chemical fingerprint of the barley seed, physical and chemical spectral components were partially separated by Multiple Scatter Correction...... and their genetic classification ability verified. Wavelength bands with known water binding and (I -> 3, 1 -> 4)-beta-glucan assignments were successfully predicted by partial least squares regression giving insight into how NIR-data works in classification. Highly reproducible gene-specific, covariate...
Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.
Shiota, E; Maekawa, M; Kono, T
2001-12-01
Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.
DEFF Research Database (Denmark)
Madsen, A. M.; Tendal, K.; Thilsing, T.
2013-01-01
occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...
Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua
2016-10-01
This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.
Matsumi, Y; Fujita, K; Takashima, Y; Yanagida, K; Morikawa, Y; Matsumoto-Nakano, M
2015-06-01
Glucan-binding proteins (Gbps) of Streptococcus mutans, a major pathogen of dental caries, mediate the binding of glucans synthesized from sucrose by the action of glucosyltransferases (GTFs) encoded by gtfB, gtfC, and gtfD. Several stress proteins, including DnaK and GroEL encoded by dnaK and groEL, are related to environmental stress tolerance. The contribution of Gbp expression to biofilm formation was analyzed by focusing on the expression levels of genes encoding GTFs and stress proteins. Biofilm-forming assays were performed using GbpA-, GbpB-, and GbpC-deficient mutant strains and the parental strain MT8148. The expression levels of gtfB, gtfC, gtfD, dnaK, and groEL were evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Furthermore, the structure of biofilms formed by these Gbp-deficient mutant strains was observed using confocal laser scanning microscopy (CLSM). Biofilm-forming assay findings demonstrated that the amount formed by the GbpA-deficient mutant strain (AD1) was nearly the same as that by the parental strain, while the GbpB- and GbpC-deficient mutant strains produced lower amounts than MT8148. Furthermore, RT-qPCR assay results showed that the expressions of gtfB, dnaK, and groEL in AD1 were elevated compared with MT8148. CLSM also revealed that the structure of biofilm formed by AD1 was prominently different compared with that formed by the parental strain. These results suggest that a defect in GbpA influences the expression of genes controlling biofilm formation, indicating its importance as a protein for firm and stable biofilm formation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Santos, Glaciane D; Ferri, Pedro H; Santos, Suzana C; Bao, Sônia N; Soares, Célia M A; Pereira, Maristela
2007-11-01
The fungus Paracoccidioides brasiliensis is the causative agent of paracoccidioidomycosis (PCM), the most prevalent human systemic mycosis in Latin America. Drug toxicity and the appearance of resistant strains have created the need to search for new therapeutic approaches. Plants with reputed antimicrobial properties represent a rich screening source of potential antifungal compounds. In this work, the growth of P. brasiliensis yeast cells was evaluated in the presence of oenothein B extracted from Eugenia uniflora. The oenothein B dosage that most effectively inhibited the development (74%) of P. brasiliensis yeast cells in vitro was 500 microg/ml. To verify if oenothein B interferes with cell morphology, we observed oenothein B-treated yeast cells by electron microscopy. The micrographs showed characteristic cell changes noted with glucan synthesis inhibition, including squashing, rough surface, cell wall rupture and cell membrane recess. The expression of P. brasiliensis genes was evaluated in order to investigate the action of oenothein B. Here we report that oenothein B inhibits 1,3-beta-glucan synthase (PbFKS1) transcript accumulation. The results indicate that oenothein B interferes with the cell morphology of P. brasiliensis, probably by inhibiting the transcription of 1,3-beta-glucan synthase gene, which is involved in the cell wall synthesis.
Probing interactions between B-glucan and bile salts at atomic detail by 1H-13C NMR assays
DEFF Research Database (Denmark)
Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G
2014-01-01
Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
DEFF Research Database (Denmark)
Jiménez, Natalia Ivonne Vera
by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...
Institute of Scientific and Technical Information of China (English)
MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu
2015-01-01
This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.
Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.
Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish
2012-09-04
Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.
Towards a more versatile alpha-glucan biosynthesis in plants
Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.
2003-01-01
Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated
Induced tubulin synthesis is caused by induced gene transcription in Tetrahymena
International Nuclear Information System (INIS)
Seyfert, H.M.; Kohle, D.; Jenovai, S.
1987-01-01
Tubulin synthesis and tubulin mRNA concentrations increase to variable extents during ciliary regeneration in the ciliate Tetrahymena. Experiments described here were carried out to determine whether the increased tubulin mRNa concentrations are due to induced transcription of tubulin genes or to stabilization of tubulin mRNA. In vivo labeling experiments with [ 3 H]uridine and in vitro transcription assays suggest that under conditions of increased protein and tubulin synthesis the rate of transcription is enhanced. Hybridization assays of in vitro transcribed RNA also demonstrate qualitatively that the tubulin genes are transcribed at higher rates when tubulin synthesis is stimulated during ciliary regeneration. This observation is supported by measurements of the half-life of tubulin mRNA molecules in nondeciliated cells: This is approximately 2 h. Since the concentration of tubulin mRNA in cells engaged in cilia regeneration increases from 5 to 19-fold during the first hour of the regeneration period, even a complete stabilization of the tubulin mRNA molecules could not account for an increase in tubulin mRNA concentration of this magnitude
Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah
2012-06-01
Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.
(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.
Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin
2017-03-01
A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.
Directory of Open Access Journals (Sweden)
A.C.C.F.F. De Paula
2005-06-01
Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
International Nuclear Information System (INIS)
Billen, D.; Hellermann, G.R.
1977-01-01
An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)
Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang
2018-07-15
A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.
Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.
2010-01-01
An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.
Directory of Open Access Journals (Sweden)
Héctor Villalobos-Duno
Full Text Available α-1,3-Glucan is present as the outermost layer of the cell wall in the pathogenic yeastlike (Y form of Paracoccidioides brasiliensis. Based on experimental evidence, this polysaccharide has been proposed as a fungal virulence factor. To degrade α-1,3-glucan and allow remodeling of the cell wall, α-1,3-glucanase is required. Therefore, the study of this enzyme, its encoding gene, and regulatory mechanisms, might be of interest to understand the morphogenesis and virulence process in this fungus. A single gene, orthologous to other fungal α-1,3-glucanase genes, was identified in the Paracoccidioides genome, and labeled AGN1. Transcriptional levels of AGN1 and AGS1 (α-1,3-glucan synthase-encoding gene increased sharply when the pathogenic Y phase was cultured in the presence of 5% horse serum, a reported booster for cell wall α-1,3-glucan synthesis in this fungus. To study the biochemical properties of P. brasiliensis Agn1p, the enzyme was heterologously overexpressed, purified, and its activity profile determined by means of the degradation of carboxymethyl α-1,3-glucan (SCMG, chemically modified from P. brasiliensis α-1,3-glucan, used as a soluble substrate for the enzymatic reaction. Inhibition assays, thin layer chromatography and enzymatic reactions with alternative substrates (dextran, starch, chitin, laminarin and cellulose, showed that Agn1p displays an endolytic cut pattern and high specificity for SCMG. Complementation of a Schizosaccharomyces pombe agn1Δ strain with the P. brasiliensis AGN1 gene restored the wild type phenotype, indicating functionality of the gene, suggesting a possible role of Agn1p in the remodeling of P. brasiliensis Y phase cell wall. Based on amino acid sequence, P. brasiliensis Agn1p, groups within the family 71 of fungal glycoside hydrolases (GH-71, showing similar biochemical characteristics to other members of this family. Also based on amino acid sequence alignments, we propose a subdivision of fungal
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions
International Nuclear Information System (INIS)
Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian
2012-01-01
Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)
Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning
2017-03-01
The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children
DEFF Research Database (Denmark)
Holst, Gitte Juel; Høst, Arne; Doekes, G
2015-01-01
Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...
Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels
Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.
2014-01-01
Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183
Directory of Open Access Journals (Sweden)
Gordon D Ross
2007-06-01
Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.
Cabib, Enrico; Blanco, Noelia; Arroyo, Javier
2012-04-01
Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.
Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang
2014-01-01
Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.
Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S
2015-08-01
A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Knudsen, Knud Erik Bach
The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...
Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.
Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena
2015-04-01
Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.
Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A
2015-10-02
Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were
Liu, Taibo; Huang, Binbin; Chen, Lin; Xian, Zhiqiang; Song, Shiwei; Chen, Riyuan; Hao, Yanwei
2018-06-30
Polyamines (PAs), including putrescine (Put), spermidine (Spd), spermine (Spm), and thermospermine (T-Spm), play key roles in plant development, including fruit setting and ripening, morphogenesis, and abiotic/biotic stress. Their functions appear to be intimately related to their synthesis, which occurs via arginine/ornithine decarboxylase (ADC/ODC), Spd synthase (SPDS), Spm synthase (SPMS), and Acaulis5 (ACL5), respectively. Unfortunately, the expression and function of these PA synthesis-relate genes during specific developmental process or under stress have not been fully elucidated. Here, we present the results of a genome-wide analysis of the PA synthesis genes (ADC, ODC, SPDS, SPMS, ACL5) in the tomato (Solanum lycopersicum). In total, 14 PA synthesis-related genes were identified. Further analysis of their structures, conserved domains, phylogenetic trees, predicted subcellular localization, and promoter cis-regulatory elements were analyzed. Furthermore, we also performed experiments to evaluate their tissue expression patterns and under hormone and various stress treatments. To our knowledge, this is the first study to elucidate the mechanisms underlying PA function in this variety of tomato. Taken together, these data provide valuable information for future functional characterization of specific genes in the PA synthesis pathway in this and other plant species. Although additional research is required, the insight gained by this and similar studies can be used to improve our understanding of PA metabolism ultimately leading to more effective and consistent plant cultivation. Copyright © 2018 Elsevier B.V. All rights reserved.
Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar
2017-03-01
Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.
High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer
Directory of Open Access Journals (Sweden)
Hirokazu Tokuyasu
2010-09-01
Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran
Directory of Open Access Journals (Sweden)
Harry J. Wichers
2010-08-01
Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.
Directory of Open Access Journals (Sweden)
Rodrigo Juliano Oliveira
2013-01-01
Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.
Directory of Open Access Journals (Sweden)
Jiang-Ke Yang
Full Text Available In vitro gene chemical synthesis is a powerful tool to improve the expression of gene in heterologous system. In this study, a two-step gene synthesis strategy that combines an assembly PCR and an overlap extension PCR (AOE was developed. In this strategy, the chemically synthesized oligonucleotides were assembled into several 200-500 bp fragments with 20-25 bp overlap at each end by assembly PCR, and then an overlap extension PCR was conducted to assemble all these fragments into a full length DNA sequence. Using this method, we de novo designed and optimized the codon of Rhizopus oryzae lipase gene ROL (810 bp and Aspergillus niger phytase gene phyA (1404 bp. Compared with the original ROL gene and phyA gene, the codon-optimized genes expressed at a significantly higher level in yeasts after methanol induction. We believe this AOE method to be of special interest as it is simple, accurate and has no limitation with respect to the size of the gene to be synthesized. Combined with de novo design, this method allows the rapid synthesis of a gene optimized for expression in the system of choice and production of sufficient biological material for molecular characterization and biotechnological application.
International Nuclear Information System (INIS)
Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.
1989-01-01
The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex
DEFF Research Database (Denmark)
Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena
2013-01-01
.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...
DEFF Research Database (Denmark)
Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun
2005-01-01
Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...
Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh
2017-12-05
Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
RISHIKESH SHUKLA
2012-01-01
Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.
International Nuclear Information System (INIS)
Tran, Huu Vinh
1983-01-01
After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans
Guo, Yichen; Shen, Ouxi; Han, Jingjing; Duan, Hongyu; Yang, Siyuan; Zhu, Zhenghong; Tong, Jian; Zhang, Jie
2017-01-01
Fenvalerate (Fen), a widely used pesticide, is known to impair male reproductive functions by mechanisms that remain to be elucidated. Recent studies indicated that circadian clock genes may play an important role in successful male reproduction. The aim of this study was to determine the effects of Fen on circadian clock genes involved in the biosynthesis of testosterone using TM3 cells derived from mouse Leydig cells. Data demonstrated that the circadian rhythm of testosterone synthesis in TM3 cells was disturbed following Fen treatment as evidenced by changes in the circadian rhythmicity of core clock genes (Bmal1, Rev-erbα, Rorα). Further, the observed altered rhythms were accompanied by increased intracellular Ca 2+ levels and modified steroidogenic acute regulatory (StAR) mRNA expression. Thus, data suggested that Fen inhibits testosterone synthesis via pathways involving intracellular Ca 2+ and clock genes (Bmal1, Rev-Erbα, Rorα) as well as StAR mRNA expression in TM3 cells.
Ohmine, Yuta; Satoh, Yukari; Kiyokawa, Kazuya; Yamamoto, Shinji; Moriguchi, Kazuki; Suzuki, Katsunori
2016-04-02
Plant pathogenic Agrobacterium strains can transfer T-DNA regions of their Ti plasmids to a broad range of eukaryotic hosts, including fungi, in vitro. In the recent decade, the yeast Saccharomyces cerevisiae is used as a model host to reveal important host proteins for the Agrobacterium-mediated transformation (AMT). Further investigation is required to understand the fundamental mechanism of AMT, including interaction at the cell surface, to expand the host range, and to develop new tools. In this study, we screened a yeast mutant library for low AMT mutant strains by advantage of a chromosome type T-DNA, which transfer is efficient and independent on integration into host chromosome. By the mutant screening, we identified four mutant strains (srs2Δ, rad52Δ, smi1Δ and erg28Δ), which showed considerably low AMT efficiency. Structural analysis of T-DNA product replicons in AMT colonies of mutants lacking each of the two DNA repair genes, SRS2 and RAD52, suggested that the genes act soon after T-DNA entry for modification of the chromosomal T-DNA to stably maintain them as linear replicons and to circularize certain T-DNA simultaneously. The cell wall synthesis regulator SMI1 might have a role in the cell surface interaction between the donor and recipient cells, but the smi1Δ mutant exhibited pleiotropic effect, i.e. low effector protein transport as well as low AMT for the chromosomal T-DNA, but relatively high AMT for integrative T-DNAs. The ergosterol synthesis regulator/enzyme-scaffold gene ERG28 probably contributes by sensing a congested environment, because growth of erg28Δ strain was unaffected by the presence of donor bacterial cells, while the growth of the wild-type and other mutant yeast strains was suppressed by their presence. RAD52 and the DNA helicase/anti-recombinase gene SRS2 are necessary to form and maintain artificial chromosomes through the AMT of chromosomal T-DNA. A sterol synthesis scaffold gene ERG28 is important in the high
D'Hulst, Christophe; Mérida, Angel
2010-10-01
Starch is the main polymer in which carbon and energy are stored in land plants, algae and some cyanobacteria. It plays a crucial role in the physiology of these organisms and also represents an important polymer for humans, in terms of both diet and nonfood industry uses. Recent efforts have elucidated most of the steps involved in the synthesis of starch. However, the process that initiates the synthesis of the starch granule remains unclear. Here, we outline the similarities between the synthesis of starch and the synthesis of glycogen, the other widespread and abundant glucose-based polymer in living cells. We place special emphasis on the mechanisms of initiation of the glycogen granule and current knowledge concerning the initiation of the starch granule. We also discuss recent discoveries regarding the function of starch synthases in the priming of the starch granule and possible interactions with other elements of the starch synthesis machinery.
Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José
2016-12-17
Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.
Wring, Stephen A; Randolph, Ryan; Park, SeongHee; Abruzzo, George; Chen, Qing; Flattery, Amy; Garrett, Graig; Peel, Michael; Outcalt, Russell; Powell, Kendall; Trucksis, Michelle; Angulo, David; Borroto-Esoda, Katyna
2017-04-01
SCY-078 (MK-3118) is a novel, semisynthetic derivative of enfumafungin and represents the first compound of the triterpene class of antifungals. SCY-078 exhibits potent inhibition of β-(1,3)-d-glucan synthesis, an essential cell wall component of many pathogenic fungi, including Candida spp. and Aspergillus spp. SCY-078 is currently in phase 2 clinical development for the treatment of invasive fungal diseases. In vitro disposition studies to assess solubility, intestinal permeability, and metabolic stability were predictive of good oral bioavailability. Preclinical pharmacokinetic studies were consistent with once-daily administration to humans. After intravenous delivery, plasma clearance in rodents and dogs was low, representing candidiasis, exceeded plasma by 20- to 25-fold for the area under the concentration-time curve from 0 h to infinity (AUC 0-∞ ) and C max SCY-078 achieved efficacy endpoints following oral delivery across multiple murine models of disseminated candidiasis. The pharmacokinetic/pharmacodynamic indices C max /MIC and AUC/MIC correlated with outcome. Target therapeutic exposure, expressed as the plasma AUC 0-24 , was comparable across models, with an upper value of 11.2 μg·h/ml (15.4 μM·h); the corresponding mean value for free drug AUC/MIC was ∼0.75. Overall, these results demonstrate that SCY-078 has the oral and intravenous (i.v.) pharmacokinetic properties and potency in murine infection models of disseminated candidiasis to support further investigation as a novel i.v. and oral treatment for invasive fungal diseases. Copyright © 2017 Wring et al.
Randolph, Ryan; Park, SeongHee; Abruzzo, George; Chen, Qing; Flattery, Amy; Garrett, Graig; Peel, Michael; Outcalt, Russell; Powell, Kendall; Trucksis, Michelle; Angulo, David; Borroto-Esoda, Katyna
2017-01-01
ABSTRACT SCY-078 (MK-3118) is a novel, semisynthetic derivative of enfumafungin and represents the first compound of the triterpene class of antifungals. SCY-078 exhibits potent inhibition of β-(1,3)-d-glucan synthesis, an essential cell wall component of many pathogenic fungi, including Candida spp. and Aspergillus spp. SCY-078 is currently in phase 2 clinical development for the treatment of invasive fungal diseases. In vitro disposition studies to assess solubility, intestinal permeability, and metabolic stability were predictive of good oral bioavailability. Preclinical pharmacokinetic studies were consistent with once-daily administration to humans. After intravenous delivery, plasma clearance in rodents and dogs was low, representing candidiasis, exceeded plasma by 20- to 25-fold for the area under the concentration-time curve from 0 h to infinity (AUC0–∞) and Cmax. SCY-078 achieved efficacy endpoints following oral delivery across multiple murine models of disseminated candidiasis. The pharmacokinetic/pharmacodynamic indices Cmax/MIC and AUC/MIC correlated with outcome. Target therapeutic exposure, expressed as the plasma AUC0–24, was comparable across models, with an upper value of 11.2 μg·h/ml (15.4 μM·h); the corresponding mean value for free drug AUC/MIC was ∼0.75. Overall, these results demonstrate that SCY-078 has the oral and intravenous (i.v.) pharmacokinetic properties and potency in murine infection models of disseminated candidiasis to support further investigation as a novel i.v. and oral treatment for invasive fungal diseases. PMID:28137806
Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B
2017-09-05
Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai
2015-01-01
Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)
Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet
Directory of Open Access Journals (Sweden)
Jie Zheng
2013-12-01
Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.
International Nuclear Information System (INIS)
Le Quang Luan; Nguyen Thanh Long
2015-01-01
The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)
Directory of Open Access Journals (Sweden)
João M P Alves
Full Text Available It has been known for decades that some insect-infecting trypanosomatids can survive in culture without heme supplementation while others cannot, and that this capability is associated with the presence of a betaproteobacterial endosymbiont in the flagellate's cytoplasm. However, the specific mechanisms involved in this process remained obscure. In this work, we sequence and phylogenetically analyze the heme pathway genes from the symbionts and from their hosts, as well as from a number of heme synthesis-deficient Kinetoplastida. Our results show that the enzymes responsible for synthesis of heme are encoded on the symbiont genomes and produced in close cooperation with the flagellate host. Our evidence suggests that this synergistic relationship is the end result of a history of extensive gene loss and multiple lateral gene transfer events in different branches of the phylogeny of the Trypanosomatidae.
Shao, Yujing; Guo, Yuming; Wang, Zhong
2013-07-01
This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.
2015-01-01
The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983
Das, Deeplina; Goyal, Arun
2014-03-15
Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.
ALGEBRAIC STRUCTURES AND SYNTHESIS PROTEIN: A DESCRIPTION OF GENE CAPN10
Directory of Open Access Journals (Sweden)
Obidio Rubio
2016-06-01
Full Text Available This article mainly informative, some ways of algebraic modeling of human genome sequences is presented, with special emphasis on describing mutations in the genes, which by modifying protein synthesis involve genetic diseases such as Diabetes Mellitus. Mutations as endomorphisms on an R-module, which consists of a direct sum of groups of sequences 2q37.3 gene, on the rings Z64 and Z125, where el haplotype compound for the polymorphisms SNP43, SNP19 and SNP63 occur.
Molla, Mijanur R; Böser, Alexander; Rana, Akshita; Schwarz, Karina; Levkin, Pavel A
2018-04-18
Efficient delivery of nucleic acids into cells is of great interest in the field of cell biology and gene therapy. Despite a lot of research, transfection efficiency and structural diversity of gene-delivery vectors are still limited. A better understanding of the structure-function relationship of gene delivery vectors is also essential for the design of novel and intelligent delivery vectors, efficient in "difficult-to-transfect" cells and in vivo clinical applications. Most of the existing strategies for the synthesis of gene-delivery vectors require multiple steps and lengthy procedures. Here, we demonstrate a facile, three-component one-pot synthesis of a combinatorial library of 288 structurally diverse lipid-like molecules termed "lipidoids" via a thiolactone ring opening reaction. This strategy introduces the possibility to synthesize lipidoids with hydrophobic tails containing both unsaturated bonds and reducible disulfide groups. The whole synthesis and purification are convenient, extremely fast, and can be accomplished within a few hours. Screening of the produced lipidoids using HEK293T cells without addition of helper lipids resulted in identification of highly stable liposomes demonstrating ∼95% transfection efficiency with low toxicity.
International Nuclear Information System (INIS)
Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.
2004-01-01
Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex
Directory of Open Access Journals (Sweden)
Lei Anping
2012-03-01
Full Text Available Abstract Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP, 3-ketoacyl-ACP-synthase (KAS, and acyl-ACP thioesterase (FATA gene expression had significant correlations with monounsaturated FA (MUFA synthesis and polyunsaturated FA (PUFA synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production.
Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.
2017-01-01
This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456
Directory of Open Access Journals (Sweden)
Md Kausar Alam
Full Text Available Deletion or repression of Aspergillus nidulans ugmA (AnugmA, involved in galactofuranose biosynthesis, impairs growth and increases sensitivity to Caspofungin, a β-1,3-glucan synthesis antagonist. The A. fumigatus UgmA (AfUgmA crystal structure has been determined. From that study, AfUgmA mutants with altered enzyme activity were transformed into AnugmA▵ to assess their effect on growth and wall composition in A. nidulans. The complemented (AnugmA::wild type AfugmA strain had wild type phenotype, indicating these genes had functional homology. Consistent with in vitro studies, AfUgmA residues R182 and R327 were important for its function in vivo, with even conservative amino (RK substitutions producing AnugmA? phenotype strains. Similarly, the conserved AfUgmA loop III histidine (H63 was important for Galf generation: the H63N strain had a partially rescued phenotype compared to AnugmA▵. Collectively, A. nidulans strains that hosted mutated AfUgmA constructs with low enzyme activity showed increased hyphal surface adhesion as assessed by binding fluorescent latex beads. Consistent with previous qPCR results, immunofluorescence and ELISA indicated that AnugmA▵ and AfugmA-mutated A. nidulans strains had increased α-glucan and decreased β-glucan in their cell walls compared to wild type and AfugmA-complemented strains. Like the AnugmA▵ strain, A. nidulans strains containing mutated AfugmA showed increased sensitivity to antifungal drugs, particularly Caspofungin. Reduced β-glucan content was correlated with increased Caspofungin sensitivity. Aspergillus nidulans wall Galf, α-glucan, and β-glucan content was correlated in A. nidulans hyphal walls, suggesting dynamic coordination between cell wall synthesis and cell wall integrity.
Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard
2007-01-01
Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522
Directory of Open Access Journals (Sweden)
Anna Bzducha-Wróbel
2014-12-01
Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.
A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley
Energy Technology Data Exchange (ETDEWEB)
Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara; Jin, Lu; Gohil, Suresh; Sandström, Corine; Olsson, Helena; Persson, Cecilia; Höglund, Anna-Stina; Fransson, Gunnel; Ruan, Ying; Åman, Per; Jansson, Christer; Liu, Chunlin; Andersson, Roger; Sun, Chuanxin
2017-12-01
Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding how plants allocate photosynthates and how they prioritize synthesis of different carbohydrates during development is essential in efforts to improve cereals for increased stress tolerance and for desirable carbohydrate compositions in food and feed. We report the coordinated synthesis of starch and fructan in barley, orchestrated by two functionally opposing transcription factors encoded from two alternative promoters, one intronic/exonic, harbored on a single gene. . This dual-transcription factor system employs an autoregulatory, antagonsitic mechanism in sensing sucrose at one promoter, potentially via sucrose/glucose/fructose/trehalose 6-phosphate signaling, and conduct a coordinated synthesis of starch and fructan synthesis by competitive transcription factor binding to the second promoter The finding of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, contributes to our appreciation of the complexity of the plant genome As a case in point for the physiological role of the antagonistic transcription factor system, we have demonstrated that it can be exploited in breeding barley with tailored amounts of fructan for production of specialty food ingredients.
Directory of Open Access Journals (Sweden)
Vishukumar Aimanianda
2017-06-01
Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.
Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P
2001-07-01
Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.
Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.
1999-01-01
Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique
Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.
Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique
A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.
Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji
2011-06-07
The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur
Directory of Open Access Journals (Sweden)
Samir Jawhara
Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the
Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song
2017-01-01
Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.
Klein, Marlise I.; Xiao, Jin; Lu, Bingwen; Delahunty, Claire M.; Yates, John R.; Koo, Hyun
2012-01-01
Biofilms formed on tooth surfaces are comprised of mixed microbiota enmeshed in an extracellular matrix. Oral biofilms are constantly exposed to environmental changes, which influence the microbial composition, matrix formation and expression of virulence. Streptococcus mutans and sucrose are key modulators associated with the evolution of virulent-cariogenic biofilms. In this study, we used a high-throughput quantitative proteomics approach to examine how S. mutans produces relevant proteins that facilitate its establishment and optimal survival during mixed-species biofilms development induced by sucrose. Biofilms of S. mutans, alone or mixed with Actinomyces naeslundii and Streptococcus oralis, were initially formed onto saliva-coated hydroxyapatite surface under carbohydrate-limiting condition. Sucrose (1%, w/v) was then introduced to cause environmental changes, and to induce biofilm accumulation. Multidimensional protein identification technology (MudPIT) approach detected up to 60% of proteins encoded by S. mutans within biofilms. Specific proteins associated with exopolysaccharide matrix assembly, metabolic and stress adaptation processes were highly abundant as the biofilm transit from earlier to later developmental stages following sucrose introduction. Our results indicate that S. mutans within a mixed-species biofilm community increases the expression of specific genes associated with glucan synthesis and remodeling (gtfBC, dexA) and glucan-binding (gbpB) during this transition (Pmutans up-regulates specific adaptation mechanisms to cope with acidic environments (F1F0-ATPase system, fatty acid biosynthesis, branched chain amino acids metabolism), and molecular chaperones (GroEL). Interestingly, the protein levels and gene expression are in general augmented when S. mutans form mixed-species biofilms (vs. single-species biofilms) demonstrating fundamental differences in the matrix assembly, survival and biofilm maintenance in the presence of other
An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans
DEFF Research Database (Denmark)
Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher
2008-01-01
alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...
Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi
2018-05-14
Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.
Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.
Alwis, K U; Mandryk, J; Hocking, A D
1999-09-01
Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.
Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe
2017-01-01
Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Weitberg Alan B
2008-09-01
Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.
DEFF Research Database (Denmark)
Issinger, O G; Hausmann, R
1973-01-01
During nonpermissive infection by a T7 amber mutant in gene 1 (phage RNA polymerase-deficient), synthesis of the products of the phage genes 3 (endonuclease), 3, 5 (lysozyme), 5 (DNA polymerase), and 17 (serum blocking power) was shown to occur at about half the rate as during wild-type infection...
Directory of Open Access Journals (Sweden)
R.C.Shendare
2008-01-01
Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15
International Nuclear Information System (INIS)
Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.; Yankovskii, N.K.; Debabov, V.G.
1989-01-01
Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector λpSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB + clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA + transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmids consistently transduced the markers thrB + and lysA + . The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes
Ancestral gene reconstruction and synthesis of ancient rhodopsins in the laboratory.
Chang, Belinda S W
2003-08-01
Laboratory synthesis of ancestral proteins offers an intriguing opportunity to study the past directly. The development of Bayesian methods to infer ancestral sequences, combined with advances in models of molecular evolution, and synthetic gene technology make this an increasingly promising approach in evolutionary studies of molecular function. Visual pigments form the first step in the biochemical cascade of events in the retina in all animals known to possess visual capabilities. In vertebrates, the necessity of spanning a dynamic range of light intensities of many orders of magnitude has given rise to two different types of photoreceptors, rods specialized for dim-light conditions, and cones for daylight and color vision. These photoreceptors contain different types of visual pigment genes. Reviewed here are methods of inferring ancestral sequences, chemical synthesis of artificial ancestral genes in the laboratory, and applications to the evolution of vertebrate visual systems and the experimental recreation of an archosaur rod visual pigment. The ancestral archosaurs gave rise to several notable lineages of diapsid reptiles, including the birds and the dinosaurs, and would have existed over 200 MYA. What little is known of their physiology comes from fossil remains, and inference based on the biology of their living descendants. Despite its age, an ancestral archosaur pigment was successfully recreated in the lab, and showed interesting properties of its wavelength sensitivity that may have implications for the visual capabilities of the ancestral archosaurs in dim light.
Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando
2016-01-01
In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.
Understanding the role of oat ß-glucan in oat-based dough systems
Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.
2015-01-01
B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat
Histone gene expression remains coupled to DNA synthesis during in vitro cellular senescence
International Nuclear Information System (INIS)
Zambetti, G.; Stein, G.; Stein, J.; Dell'Orco, R.
1987-01-01
Despite a decrease in the extent to which confluent monolayers of late compared to early passage CF3 human diploid fibroblasts can be stimulated to proliferate, the time course of DNA synthesis onset is similar regardless of the in vitro age of the cells. A parallel and stoichiometric relationship is maintained between the rate of DNA synthesis and the cellular levels of histone mRNA independent of the age of the cell cultures. Furthermore, DNA synthesis and cellular histone mRNA levels decline in a coordinate manner after inhibition of DNA replication by hydroxyurea treatment. These results indicate that while the proliferative activity of human diploid fibroblasts decreases with passage in culture, those cells that retain the ability to proliferate continue to exhibit a tight coupling of DNA replication and histone gene expression
Directory of Open Access Journals (Sweden)
Patricia de Souza Bonfim-Mendonça
Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.
Directory of Open Access Journals (Sweden)
Vidyasagar Devaprasad Dedeepiya
2012-01-01
Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.
Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru
2017-04-08
While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.
β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.
Directory of Open Access Journals (Sweden)
Sonja de Vries
Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.
Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K
2012-01-15
The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.
Betulin inhibits cariogenic properties of Streptococcus mutans by targeting vicRK and gtf genes.
Viszwapriya, Dharmaprakash; Subramenium, Ganapathy Ashwinkumar; Radhika, Solai; Pandian, Shunmugiah Karutha
2017-01-01
Streptococcus mutans, a multivirulent pathogen is considered the primary etiological agent in dental caries. Development of antibiotic resistance in the pathogen has created a need for novel antagonistic agents which can control the virulence of the organism and reduce resistance development. The present study demonstrates the in vitro anti-virulence potential of betulin (lup-20(29)-ene-3β,28-diol), an abundantly available plant triterpenoid against S. mutans UA159. Betulin exhibited significant dose dependent antibiofilm activity without affecting bacterial viability. At 240 µg/ml (biofilm inhibitory concentration), betulin inhibited biofilm formation and adherence to smooth glass surfaces by 93 and 71 % respectively. It reduced water insoluble glucan synthesis by 89 %, in conjunction with down regulation of gtfBC genes. Microscopic analysis confirmed the disruption in biofilm architecture and decreased exopolysaccharide production. Acidogenicity and aciduricity, key virulence factors responsible for carious lesions, were also notably affected. The induced auto-aggregation of cells upon treatment could be due to the down regulation of vicK. Results of gene expression analysis demonstrated significant down-regulation of virulence genes upon betulin treatment. Furthermore, the nontoxic effect of betulin on peripheral blood mononuclear cells even after 72 h treatment makes it a strong candidate for assessing its suitability to be used as a therapeutic agent.
Directory of Open Access Journals (Sweden)
Zenia Pardo Ruiz
2012-03-01
Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis
Baptista, Melisa J; O'Farrell, Casey; Daya, Sneha; Ahmad, Rili; Miller, David W; Hardy, John; Farrer, Matthew J; Cookson, Mark R
2003-05-01
Abnormal accumulation of alpha-synuclein in Lewy bodies is a neuropathological hallmark of both sporadic and familial Parkinson's disease (PD). Although mutations in alpha-synuclein have been identified in autosomal dominant PD, the mechanism by which dopaminergic cell death occurs remains unknown. We investigated transcriptional changes in neuroblastoma cell lines transfected with either normal or mutant (A30P or A53T) alpha-synuclein using microarrays, with confirmation of selected genes by quantitative RT-PCR. Gene products whose expression was found to be significantly altered included members of diverse functional groups such as stress response, transcription regulators, apoptosis-inducing molecules, transcription factors and membrane-bound proteins. We also found evidence of altered expression of dihydropteridine reductase, which indirectly regulates the synthesis of dopamine. Because of the importance of dopamine in PD, we investigated the expression of all the known genes in dopamine synthesis. We found co-ordinated downregulation of mRNA for GTP cyclohydrolase, sepiapterin reductase (SR), tyrosine hydroxylase (TH) and aromatic acid decarboxylase by wild-type but not mutant alpha-synuclein. These were confirmed at the protein level for SR and TH. Reduced expression of the orphan nuclear receptor Nurr1 was also noted, suggesting that the co-ordinate regulation of dopamine synthesis is regulated through this transcription factor.
Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections
Directory of Open Access Journals (Sweden)
Andreas F. Haag
2010-01-01
Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.
Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.
Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q
2011-09-01
EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.
Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress
Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...
Boulos, Samy; Nyström, Laura
2017-11-01
The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO
Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do
2017-02-01
Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.
Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong
2011-08-15
Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison
2016-05-25
Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.
Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi
2017-12-07
Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.
Directory of Open Access Journals (Sweden)
Natcha Phantuwong
2017-12-01
Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9
Energy Technology Data Exchange (ETDEWEB)
Burke-Agueero, D.H.
1992-08-01
Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight bch'' genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.
Energy Technology Data Exchange (ETDEWEB)
Burke-Agueero, Donald H. [Univ. of California, Berkeley, CA (United States)
1992-08-01
Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight ``bch`` genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.
Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa
2012-04-13
Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen (Platelia Aspergillus), nested PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp. The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders.
Lai, Yiling; Chen, Huan; Wei, Ge; Wang, Guandong; Li, Fang; Wang, Sibao
2017-08-01
The use of entomopathogenic fungi to control mosquitoes is a promising tool for reducing vector-borne disease transmission. To better understand infection stratagems of insect pathogenic fungi, we analyzed the global gene expression profiling of Beauveria bassiana at 36, 60, 84 and 108 h after topical infection of Anopheles stephensi adult mosquitoes using RNA sequencing (RNA-Seq). A total of 5,354 differentially expressed genes (DEGs) are identified over the course of fungal infection. When the fungus grows on the mosquito cuticle, up-regulated DEGs include adhesion-related genes involved in cuticle attachment, Pth11-like GPCRs hypothesized to be involved in host recognition, and extracellular enzymes involved in the degradation and penetration of the mosquito cuticle. Once in the mosquito hemocoel, the fungus evades mosquito immune system probably through up-regulating expression of β-1,3-glucan degrading enzymes and chitin synthesis enzymes for remodeling of cell walls. Moreover, six previous unknown SSCP (small secreted cysteine-rich proteins) are significantly up-regulated, which may serve as "effectors" to suppress host defense responses. B. bassiana also induces large amounts of antioxidant genes to mitigate host-generated exogenous oxidative stress. At late stage of infection, B. bassiana activates a broad spectrum of genes including nutrient degrading enzymes, some transporters and metabolism pathway components, to exploit mosquito tissues and hemolymph as a nutrient source for hyphal growth. These findings establish an important framework of knowledge for further comprehensive elucidation of fungal pathogenesis and molecular mechanism of Beauveria-mosquito interactions.
Concurrent synthesis and release of nod-gene-inducing flavonoids from alfalfa roots
International Nuclear Information System (INIS)
Maxwell, C.A.; Phillips, D.A.
1990-01-01
Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4',7-dihydroxyflavanone, 4',7-dihydroxyflavone, and 4,4'-dihydroxy-2'-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with [U- 14 C]-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained 14 C. In the presence of AOPP, 14 C labeling and release of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth
Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.
1979-01-01
A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of
Directory of Open Access Journals (Sweden)
Xin Chen
Full Text Available BACKGROUND: Hulless barley is attracting increasing attention due to its unique nutritional value and potential health benefits. However, the molecular biology of the barley grain development and nutrient storage are not well understood. Furthermore, the genetic potential of hulless barley has not been fully tapped for breeding. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we investigated the transcriptome features during hulless barley grain development. Using Illumina paired-end RNA-Sequencing, we generated two data sets of the developing grain transcriptomes from two hulless barley landraces. A total of 13.1 and 12.9 million paired-end reads with lengths of 90 bp were generated from the two varieties and were assembled to 48,863 and 45,788 unigenes, respectively. A combined dataset of 46,485 All-Unigenes were generated from two transcriptomes with an average length of 542 bp, and 36,278 among were annotated with gene descriptions, conserved protein domains or gene ontology terms. Furthermore, sequences and expression levels of genes related to the biosynthesis of storage reserve compounds (starch, protein, and β-glucan were analyzed, and their temporal and spatial patterns were deduced from the transcriptome data of cultivated barley Morex. CONCLUSIONS/SIGNIFICANCE: We established a sequences and functional annotation integrated database and examined the expression profiles of the developing grains of Tibetan hulless barley. The characterization of genes encoding storage proteins and enzymes of starch synthesis and (1-3;1-4-β-D-glucan synthesis provided an overview of changes in gene expression associated with grain nutrition and health properties. Furthermore, the characterization of these genes provides a gene reservoir, which helps in quality improvement of hulless barley.
Directory of Open Access Journals (Sweden)
Rodrigo Juliano Oliveira
2014-01-01
Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.
de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello
2017-12-20
A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5 Da with a random coil conformation for molecular weights below 1 × 10 6 Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.
β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake
Directory of Open Access Journals (Sweden)
Asli Akyol
2014-09-01
Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.
β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.
Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju
2014-09-23
The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.
Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi
2017-01-01
Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550
Directory of Open Access Journals (Sweden)
Yi-Huang Hsueh
2017-12-01
Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan
Directory of Open Access Journals (Sweden)
Eduardo Madrigal-Bujaidar
2015-06-01
Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.
Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.
Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong
2014-03-19
A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.
Czech Academy of Sciences Publication Activity Database
Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.
2016-01-01
Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016
Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C
2015-05-04
The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.
Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I
2011-01-01
The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.
Foletta, Victoria C; Brown, Erin L; Cho, Yoshitake; Snow, Rod J; Kralli, Anastasia; Russell, Aaron P
2013-12-01
The stress-responsive, tumor suppressor N-myc downstream-regulated gene 2 (Ndrg2) is highly expressed in striated muscle. In response to anabolic and catabolic signals, Ndrg2 is suppressed and induced, respectively, in mouse C2C12 myotubes. However, little is known about the mechanisms regulating Ndrg2 expression in muscle, as well as the biological role for Ndrg2 in differentiated myotubes. Here, we show that Ndrg2 is a target of a peroxisome proliferator-activated receptor-gamma coactivator-1α (PGC-1α) and estrogen-related receptor alpha (ERRα) transcriptional program and is induced in response to endurance exercise, a physiological stress known also to increase PGC-1α/ERRα activity. Analyses of global gene and protein expression profiles in C2C12 myotubes with reduced levels of NDRG2, suggest that NDRG2 affects muscle growth, contractile properties, MAPK signaling, ion and vesicle transport and oxidative phosphorylation. Indeed, suppression of NDRG2 in myotubes increased protein synthesis and the expression of fast glycolytic myosin heavy chain isoforms, while reducing the expression of embryonic myosin Myh3, other contractile-associated genes and the MAPK p90 RSK1. Conversely, enhanced expression of NDRG2 reduced protein synthesis, and furthermore, partially blocked the increased protein synthesis rates elicited by a constitutively active form of ERRα. In contrast, suppressing or increasing levels of NDRG2 did not affect mRNA expression of genes involved in mitochondrial biogenesis that are regulated by PGC-1α or ERRα. This study shows that in C2C12 myotubes Ndrg2 is a novel PGC-1α/ERRα transcriptional target, which influences protein turnover and the regulation of genes involved in muscle contraction and function. © 2013 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Sugaya, Shigeru; Nakanishi, Hiroshi; Tanzawa, Hideki; Sugita, Katsuo; Kita, Kazuko; Suzuki, Nobuo
2005-01-01
Fibroblast cells derived from nevoid basal carcinoma syndrome (NBCCS) patients show increased levels of DNA synthesis after X-ray irradiation. Genes, whose expression is modulated in association with the DNA synthesis induction, were searched by using PCR-based mRNA differential display analysis in one of the NBCCS cell lines, NBCCS1 cells. Decreased levels of SMT3A gene expression were found in X-ray-irradiated NBCCS1 cells. This decrease was also shown by RT-PCR analysis in another cell line, NBCCS3 cells. In addition to NBCCS cells, normal fibroblast cells showed the DNA synthesis induction after X-ray irradiation when they were treated with antisense oligonucleotides (AO) for SMT3A. However, treatment of normal fibroblasts with the random oligonucleotides (RO) resulted in decreased levels of DNA synthesis after X-ray irradiation. Thus, down-regulation of SMT3A gene expression may be involved in the DNA synthesis induction after X-ray irradiation in the NBCCS cells at least tested
Energy Technology Data Exchange (ETDEWEB)
Sugaya, Shigeru [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Nakanishi, Hiroshi [Department of Clinical Molecular Biology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Tanzawa, Hideki [Department of Clinical Molecular Biology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Sugita, Katsuo [Department of Clinical Medicine, Faculty of Education, Chiba University, 1-33 Yayoi, Inage-ku, Chiba 263-8522 (Japan); Kita, Kazuko [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Suzuki, Nobuo [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan)]. E-mail: nobuo@faculty.chiba-u.jp
2005-10-15
Fibroblast cells derived from nevoid basal carcinoma syndrome (NBCCS) patients show increased levels of DNA synthesis after X-ray irradiation. Genes, whose expression is modulated in association with the DNA synthesis induction, were searched by using PCR-based mRNA differential display analysis in one of the NBCCS cell lines, NBCCS1 cells. Decreased levels of SMT3A gene expression were found in X-ray-irradiated NBCCS1 cells. This decrease was also shown by RT-PCR analysis in another cell line, NBCCS3 cells. In addition to NBCCS cells, normal fibroblast cells showed the DNA synthesis induction after X-ray irradiation when they were treated with antisense oligonucleotides (AO) for SMT3A. However, treatment of normal fibroblasts with the random oligonucleotides (RO) resulted in decreased levels of DNA synthesis after X-ray irradiation. Thus, down-regulation of SMT3A gene expression may be involved in the DNA synthesis induction after X-ray irradiation in the NBCCS cells at least tested.
Genetic mapping of the regulator gene determining enterotoxin synthesis in Vibrio cholerae
International Nuclear Information System (INIS)
Smirnova, N.I.; Livanova, L.F.; Shaginyan, I.A.; Motin, V.L.
1986-01-01
Data on the genetic mapping of mutation tox-7 (the mutation affecting the synthesis of the cholera toxin) were obtained by conjugation crosses between the atoxigenic donor strain Vibrio cholerae Eltor and the toxigenic recipient strain V. cholera classica. The molecular and genetic analysis of the Tox - recombinants indicated that, when the synthesis of the cholera toxin is disrupted in these strains, the tox-7 mutation (which impairs the regulator gene tox) is gained. Close linkage between the tox-7 and pur-63 mutations was established (during the selection procedure there was 81.1% combined transfer with respect to marker pur-63 situated in the donor strain chromosome more proximal than mutation tox-7). The markers were localized in the following order in the region under investigation: asp-cys-nal-pur-61-trp-his-pur-63-tox-7-ile
Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul
2014-03-01
The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.
Marcos-Zambrano, Laura Judith; Gómez-Perosanz, Marta; Escribano, Pilar; Bouza, Emilio; Guinea, Jesús
2017-07-01
We studied the antifungal activity of SCY-078 (an orally bioavailable 1,3-β -d- glucan synthesis inhibitor), micafungin and fluconazole against the planktonic and sessile forms of 178 Candida and non- Candida isolates causing fungaemia in patients recently admitted to a large European hospital. The in vitro activity of SCY-078, micafungin and fluconazole against the planktonic form of the isolates was assessed using EUCAST EDef 7.3 and CLSI M27-A3. Antibiofilm activity was assessed using the XTT reduction assay. SCY-078 and micafungin showed potent in vitro activity against Candida and non- Candida isolates. The in vitro activity of both drugs was similar, but SYC-078 displayed significantly lower MIC values than micafungin against Candida parapsilosis and non- Candida isolates, whereas micafungin displayed significantly lower MIC values for the remaining species ( P Candida glabrata , in which the micafungin sessile MIC values were significantly lower ( P Candida isolates in both sessile and planktonic forms is comparable to that of micafungin. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren
2018-04-25
Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Teets, Nicholas M; Kawarasaki, Yuta; Lee, Richard E; Denlinger, David L
2013-02-01
The Antarctic midge, Belgica antarctica, experiences sub-zero temperatures and desiccating conditions for much of the year, and in response to these environmental insults, larvae undergo rapid shifts in metabolism, mobilizing carbohydrate energy reserves to promote synthesis of low-molecular-mass osmoprotectants. In this study, we measured the expression of 11 metabolic genes in response to thermal and dehydration stress. During both heat and cold stress, we observed upregulation of phosphoenolpyruvate carboxykinase (pepck) and glycogen phosphorylase (gp) to support rapid glucose mobilization. In contrast, there was a general downregulation of pathways related to polyol, trehalose, and proline synthesis during both high- and low-temperature stress. Pepck was likewise upregulated in response to different types of dehydration stress; however, for many of the other genes, expression patterns depended on the nature of dehydration stress. Following fast dehydration, expression patterns were similar to those observed during thermal stress, i.e., upregulation of gp accompanied by downregulation of trehalose and proline synthetic genes. In contrast, gradual, prolonged dehydration (both at a constant temperature and in conjunction with chilling) promoted marked upregulation of genes responsible for trehalose and proline synthesis. On the whole, our data agree with known metabolic adaptations to stress in B. antarctica, although a few discrepancies between gene expression patterns and downstream metabolite contents point to fluxes that are not controlled at the level of transcription.
Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello
2017-01-01
A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle
Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.
2011-01-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805
Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A
2011-03-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.
DEFF Research Database (Denmark)
Mikkelsen, U R; Schjerling, P; Helmark, Ida Carøe
2010-01-01
models, and inhibit the exercise-induced satellite cell proliferation and protein synthesis in humans. However, the cellular mechanisms eliciting these responses remain unknown. Eight healthy male volunteers performed 200 maximal eccentric contractions with each leg. To block prostaglandin synthesis...... locally in the skeletal muscle, indomethacin (NSAID) was infused for 7.5 h via microdialysis catheters into m. vastus lateralis of one leg. Protein synthesis was determined by the incorporation of 1,2-(13)C(2) leucine into muscle protein from 24 to 28 h post-exercise. Furthermore, mRNA expression...... of selected genes was measured in muscle biopsies (5 h and 8 days post-exercise) by real-time reverse transcriptase PCR. Myofibrillar and collagen protein synthesis were unaffected by the local NSAID infusion. Five hours post-exercise, the mRNA expression of cyclooxygenase-2 (COX2) was sixfold higher...
Directory of Open Access Journals (Sweden)
Hiroyuki Kono
2017-12-01
Full Text Available This article contains two-dimensional (2D NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG and a water-soluble β-(1â3, 1â6-glucan from Aureobasidium pullulans. Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers, entitled âNMR spectroscopic structural characterization of a water-soluble β-(1â3, 1â6-glucan from A. pullulansâ (Kono et al., 2017 [1]. Data can help to assign the 1H and 13C chemical shifts of the structurally complex polysaccharides. Keywords: NMR, β-(1â3, 1â6-glucan, Aureobasidium pullulans, Schizophyllan, Spectral data
Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs
Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava
2017-01-01
Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and
International Nuclear Information System (INIS)
Kim, Sunyoung; Baltimore, D.; Byrn, R.; Groopman, J.
1989-01-01
The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4 + lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes
Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut
2012-10-01
The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.
Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei
2010-12-01
Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.
Directory of Open Access Journals (Sweden)
Anna Kozajda
2013-12-01
Full Text Available Objectives: The study was aimed at assessment of exposure to endotoxins, (1→3-β-D-glucans and mite, cockroach, cat, dog allergens present in settled dust in premises of children as agents which may be significantly correlated with the occurrence of allergic symptoms and diseases in children. Materials and Methods: The study covered 50 homes of one- or two-year-old children in Poland. Samples of settled dust were taken from the floor and the child's bed. The levels of (1→3-β-D-glucans (floor, endotoxins (floor and allergens of mite, cat, dog and cockroach (floor and bed were analyzed. Results: Average geometric concentrations (geometric standard deviation of endotoxins, (1→3-β-D-glucans, Der p1, Fel d1, Can f1 and Bla g1 in children homes were on the floor 42 166.0 EU/g (3.2, 20 478.4 ng/g (2.38, 93.9 ng/g (6.58, 119.8 ng/g (13.0, 288.9 ng/g (3.4, 0.72 U/g (4.4 and in their beds (only allergens 597.8 ng/g (14.2, 54.1 ng/g (4.4, 158.6 ng/g (3.1 0.6 U/g (2.9, respectively. When the floor was covered with the carpet, higher concentrations of endotoxins, (1→3-β-D-glucans and allergens (each type were found in the settled dust (p < 0.05. The trend was opposite in case of allergens (except dog analyzed from bed dust and significantly higher concentrations were found in the rooms with smooth floor (p < 0.05. Conclusions: Among the analyzed factors only the type of floor significantly modified both the level of biological indicators and allergens. The results of this study could be the base for verifying a hypothesis that carpeting may have a protective role against high levels of cockroach, dog and cat allergens.
Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan
2016-01-01
The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124
International Nuclear Information System (INIS)
Le Quang Luan; Nguyen Huynh Phuong Uyen; Nguyen Thanh Vu; Nguyen Quoc Hien; Dang Van Phu; Vo Thi Thu Ha; To Van Loi; Le Dinh Don; Truong Phuoc Thien Hoang; Do Thi Phuong Linh
2015-01-01
The process for production of insoluble β-glucan product from brewer’s yeast cell wall collected from the discard waste of beer production was successfully established. Radiation was improved as a useful tool for preparation of low Mw β-glucan. The water soluble oligo-β-glucans with Mw ~ 18 - 25 kDa were found to have novel features for application as plant growth promoter, growth and immune stimulator additive for animals and functional food for prevention and therapy of diabetic, dyslipidemia, cancer, etc. The processes for large scale production of oligo-β-glucan as plant growth promoter. chicken additive and functional food by gamma Co-60 irradiation method have been set up for application. In addition, gold nanoparticles (AuNPs) with size of 10 - 50 nm stabilized in sericin and water soluble chitosan and silver nanoparticles (AgNPs) with size of 5-20 nm stabilized PVA, PVP, sericin and alginate were also successfully synthesized by gamma Co-60 irradiation method. While AuNPs product was found to be not toxic and can be used for bio-medicine and cosmetics, AgNPs exhibited highly antimicrobial activity for potentially use as new and safety antimicrobial agent. The processes for large scale production of AuNPs, AgNPs, cream/AgNPs and hand-wash solution/AgNPs products were also successfully developed within this project. (author)
Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S
1989-01-01
The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other a...
Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A
2016-11-01
At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.
Larkin, Emily; Hager, Christopher; Chandra, Jyotsna; Mukherjee, Pranab K; Retuerto, Mauricio; Salem, Iman; Long, Lisa; Isham, Nancy; Kovanda, Laura; Borroto-Esoda, Katyna; Wring, Steve; Angulo, David; Ghannoum, Mahmoud
2017-05-01
Candida auris , a new multidrug-resistant Candida spp. which is associated with invasive infection and high rates of mortality, has recently emerged. Here, we determined the virulence factors (germination, adherence, biofilm formation, phospholipase and proteinase production) of 16 C. auris isolates and their susceptibilities to 11 drugs belonging to different antifungal classes, including a novel orally bioavailable 1,3-β-d-glucan synthesis inhibitor (SCY-078). We also examined the effect of SCY-078 on the growth, ultrastructure, and biofilm-forming abilities of C. auris Our data showed that while the tested strains did not germinate, they did produce phospholipase and proteinase in a strain-dependent manner and had a significantly reduced ability to adhere and form biofilms compared to that of Candida albicans ( P = 0.01). C. auris isolates demonstrated reduced susceptibility to fluconazole and amphotericin B, while, in general, they were susceptible to the remaining drugs tested. SCY-078 had an MIC 90 of 1 mg/liter against C. auris and caused complete inhibition of the growth of C. auris and C. albicans Scanning electron microscopy analysis showed that SCY-078 interrupted C. auris cell division, with the organism forming abnormal fused fungal cells. Additionally, SCY-078 possessed potent antibiofilm activity, wherein treated biofilms demonstrated significantly reduced metabolic activity and a significantly reduced thickness compared to the untreated control ( P < 0.05 for both comparisons). Our study shows that C. auris expresses several virulence determinants (albeit to a lesser extent than C. albicans ) and is resistant to fluconazole and amphotericin B. SCY-078, the new orally bioavailable antifungal, had potent antifungal/antibiofilm activity against C. auris , indicating that further evaluation of this antifungal is warranted. Copyright © 2017 Larkin et al.
Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.
2015-01-01
Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399
Meng, Xiangfeng; Gangoiti, Joana; Bai, Yuxiang; Pijning, Tjaard; Van Leeuwen, Sander S; Dijkhuizen, Lubbert
2016-01-01
Lactic acid bacteria (LAB) are known to produce large amounts of α-glucan exopolysaccharides. Family GH70 glucansucrase (GS) enzymes catalyze the synthesis of these α-glucans from sucrose. The elucidation of the crystal structures of representative GS enzymes has advanced our understanding of their
Energy Technology Data Exchange (ETDEWEB)
Martyniuk, Christopher J. [Department of Physiological Sciences and Center for Environmental and Human Toxicology, University of Florida, Gainesville, FL 32611 (United States); Sanchez, Brian C. [Department of Forestry and Natural Resources and School of Civil Engineering, 195 Marsteller St., Purdue University, West Lafayette, IN 47907 (United States); Szabo, Nancy J.; Denslow, Nancy D. [Department of Physiological Sciences and Center for Environmental and Human Toxicology, University of Florida, Gainesville, FL 32611 (United States); Sepulveda, Maria S., E-mail: mssepulv@purdue.edu [Department of Forestry and Natural Resources and School of Civil Engineering, 195 Marsteller St., Purdue University, West Lafayette, IN 47907 (United States)
2009-10-19
Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens ({mu}g/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl{sub 2}) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 {mu}g/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 {mu}g/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 {mu}g/g) but increased cGnRH-II mRNA at the lowest dose (5 {mu}g/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants.
International Nuclear Information System (INIS)
Martyniuk, Christopher J.; Sanchez, Brian C.; Szabo, Nancy J.; Denslow, Nancy D.; Sepulveda, Maria S.
2009-01-01
Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens (μg/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl 2 ) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 μg/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 μg/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 μg/g) but increased cGnRH-II mRNA at the lowest dose (5 μg/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants.
Martyniuk, Christopher J; Sanchez, Brian C; Szabo, Nancy J; Denslow, Nancy D; Sepúlveda, Maria S
2009-10-19
Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens (microg/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl(2)) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 microg/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 microg/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 microg/g) but increased cGnRH-II mRNA at the lowest dose (5 microg/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants.
Energy Technology Data Exchange (ETDEWEB)
Bilik, V; Biely, P [Institute of Chemistry, Centre for Chemical Research, Slovak Academy of Sciences, Bratislava (Czechoslovakia); Kolina, J [Ustav pro Vyzkum, Vyrobu a Vyuziti Radioisotopu, Prague (Czechoslovakia)
1984-01-01
D-(U-/sup 14/C)glucose obtained in acid hydrolysis of ..cap alpha..-(U-/sup 14/C)glucan (2 M-HCl) was epimerized under a catalytic action of molybdate ions to D-(U-/sup 14/C)mannose isolated with a 20% yield. Oxidative degradation of 4-nitrophenylhydrazones of D-(U-/sup 14/C)arabinose and D-(U-/sup 14/C)xylose resulted in D-(U-/sup 14/C)erythrose and D-(U-/sup 14/C)threose, respectively, with a 15% yield relative to the starting aldopentoses. Nitromethane synthesis with D-(U-/sup 14/C)lyxose followed by oxidative decomposition of the corresponding nitrohexitols yielded /sup 14/C-labelled D-galactose. Described is also the preparation of D-(U-/sup 14/C)arabinose from D-(U-/sup 14/C)glucose and the conversion of D-(U-/sup 14/C)arabinose to D-(U-/sup 14/C)xylose and D-(U-/sup 14/C)lyxose.
Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité
2017-02-01
Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alexandre H. Fujita
2003-08-01
Full Text Available Foi utilizado o método enzimático recomendado pela AOAC para determinação de beta-glucanas em cereais e alimentos que os contém. O método, utiliza liquenase (EC 3.2.1.73 e beta-glucosidase (EC 3.2.1.21 para hidrólise debeta-glucanas, é rápido, fácil de executar e específico para beta-glucanas com ligações beta(1->3 e beta(1->4. As sementes analisadas foram subministradas pelo Instituto Agronômico de Campinas (IAC e os alimentos adquiridos nos supermercados. Aveia e cevada são os grãos com maior conteúdo de beta-glucanas. Na aveia os teores determinados foram 6,48 e 5,94%. Nos 10 cultivares de cevada os teores de beta-glucanas oscilaram entre 2,04 e 9,68%. Trigo e triticale apresentaram teores de b-glucanas menores que 1%. Nos produtos comerciais o teor de beta-glucanas estava relacionado ao tipo de cereal da fórmula. O produto comercial de maior conteúdo de beta-glucanas é o farelo de aveia. As beta-glucanas são ingredientes funcionais em potencial e a conveniência ou não de estimular sua incorporação em alimentos deve ser mais estudada. Quanto à composição centesimal dos grãos de cereais, o teor de proteínas foi o que apresentou a maior variação e isso se reflete na composição dos produtos comerciais.The method employed was the enzymatic one recommended by de AOAC for the determination of beta-glucans in cereals and in foodstuffs containing cereals in their formulation. The method, using lichenase (EC 3.2.1.73 and beta-glucosidase (EC 3.2.1.21 for the hydrolysis of beta-glucans, is quick and easy to execute, but is specific for beta-glucans with beta(1->3 and beta(1->4 bonds. The Agronomic Institute of Campinas (IAC supplied the seeds analyzed, and the foodstuffs were acquired in supermarkets. Oat and barley are the grains with the highest content of beta-glucans. In the oats, the determined values were 6.48 and 5.94%. In the 10 cultivars of barley, the content of beta-glucans varied between 2.04 and 9
Plant α-glucan phosphatases SEX4 and LSF2 display different affinity for amylopectin and amylose
DEFF Research Database (Denmark)
Wilkens, Casper; Auger, Kyle D.; Anderson, Nolan T.
2016-01-01
The plant glucan phosphatases Starch EXcess 4 (SEX4) and Like Sex Four2 (LSF2) apply different starch binding mechanisms. SEX4 contains a carbohydrate binding module, and LSF2 has two surface binding sites (SBSs). We determined KDapp for amylopectin and amylose, and KD for β-cyclodextrin and vali...
DEFF Research Database (Denmark)
Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.
2013-01-01
Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...
Ishii, Kenichi; Adachi, Tatsuo; Imamura, Katsutoshi; Takano, Shinya; Usui, Kimihito; Suzuki, Kazushi; Hamamoto, Hiroshi; Watanabe, Takeshi; Sekimizu, Kazuhisa
2012-01-01
Injection of Serratia marcescens into the blood (hemolymph) of the silkworm, Bombyx mori, induced the activation of c-Jun NH2-terminal kinase (JNK), followed by caspase activation and apoptosis of blood cells (hemocytes). This process impaired the innate immune response in which pathogen cell wall components, such as glucan, stimulate hemocytes, leading to the activation of insect cytokine paralytic peptide. S. marcescens induced apoptotic cell death of silkworm hemocytes and mouse peritoneal macrophages in vitro. We searched for S. marcescens transposon mutants with attenuated ability to induce apoptosis of silkworm hemocytes. Among the genes identified, disruption mutants of wecA (a gene involved in lipopolysaccharide O-antigen synthesis), and flhD and fliR (essential genes in flagella synthesis) showed reduced motility and impaired induction of mouse macrophage cell death. These findings suggest that S. marcescens induces apoptosis of host immune cells via lipopolysaccharide- and flagella-dependent motility, leading to the suppression of host innate immunity. PMID:22859304
DEFF Research Database (Denmark)
Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.
1993-01-01
The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...
Czech Academy of Sciences Publication Activity Database
Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.
2009-01-01
Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009
DEFF Research Database (Denmark)
Fakih, Dalia; Pilecki, Bartosz; Schlosser, Anders
2015-01-01
SP-D is a pulmonary collectin important in lung immunity. SP-D-deficient mice (Sftpd(-/-)) are reported to be susceptible to ovalbumin (OVA)- and fungal allergen-induced pulmonary inflammation, while treatment with exogenous SP-D has therapeutic effects in such disease models. β-glucans are a div...
Triethylene Glycol Up-Regulates Virulence-Associated Genes and Proteins in Streptococcus mutans.
Sadeghinejad, Lida; Cvitkovitch, Dennis G; Siqueira, Walter L; Santerre, J Paul; Finer, Yoav
2016-01-01
Triethylene glycol dimethacrylate (TEGDMA) is a diluent monomer used pervasively in dental composite resins. Through hydrolytic degradation of the composites in the oral cavity it yields a hydrophilic biodegradation product, triethylene glycol (TEG), which has been shown to promote the growth of Streptococcus mutans, a dominant cariogenic bacterium. Previously it was shown that TEG up-regulated gtfB, an important gene contributing to polysaccharide synthesis function in biofilms. However, molecular mechanisms related to TEG's effect on bacterial function remained poorly understood. In the present study, S. mutans UA159 was incubated with clinically relevant concentrations of TEG at pH 5.5 and 7.0. Quantitative real-time PCR, proteomics analysis, and glucosyltransferase enzyme (GTF) activity measurements were employed to identify the bacterial phenotypic response to TEG. A S. mutans vicK isogenic mutant (SMΔvicK1) and its associated complemented strain (SMΔvicK1C), an important regulatory gene for biofilm-associated genes, were used to determine if this signaling pathway was involved in modulation of the S. mutans virulence-associated genes. Extracted proteins from S. mutans biofilms grown in the presence and absence of TEG were subjected to mass spectrometry for protein identification, characterization and quantification. TEG up-regulated gtfB/C, gbpB, comC, comD and comE more significantly in biofilms at cariogenic pH (5.5) and defined concentrations. Differential response of the vicK knock-out (SMΔvicK1) and complemented strains (SMΔvicK1C) implicated this signalling pathway in TEG-modulated cellular responses. TEG resulted in increased GTF enzyme activity, responsible for synthesizing insoluble glucans involved in the formation of cariogenic biofilms. As well, TEG increased protein abundance related to biofilm formation, carbohydrate transport, acid tolerance, and stress-response. Proteomics data was consistent with gene expression findings for the selected
Hsieh, En-Jung; Waters, Brian M
2016-10-01
Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Tessari, Paolo; Lante, Anna
2017-03-17
Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.
Tessari, Paolo; Lante, Anna
2017-01-01
Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350
Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J
2014-09-01
The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.
Directory of Open Access Journals (Sweden)
Maria João Nunes
Full Text Available Cholesterol is an essential component of the central nervous system and increasing evidence suggests an association between brain cholesterol metabolism dysfunction and the onset of neurodegenerative disorders. Interestingly, histone deacetylase inhibitors (HDACi such as trichostatin A (TSA are emerging as promising therapeutic approaches in neurodegenerative diseases, but their effect on brain cholesterol metabolism is poorly understood. We have previously demonstrated that HDACi up-regulate CYP46A1 gene transcription, a key enzyme in neuronal cholesterol homeostasis. In this study, TSA was shown to modulate the transcription of other genes involved in cholesterol metabolism in human neuroblastoma cells, namely by up-regulating genes that control cholesterol efflux and down-regulating genes involved in cholesterol synthesis and uptake, thus leading to an overall decrease in total cholesterol content. Furthermore, co-treatment with the amphipathic drug U18666A that can mimic the intracellular cholesterol accumulation observed in cells of Niemman-Pick type C patients, revealed that TSA can ameliorate the phenotype induced by pathological cholesterol accumulation, by restoring the expression of key genes involved in cholesterol synthesis, uptake and efflux and promoting lysosomal cholesterol redistribution. These results clarify the role of TSA in the modulation of neuronal cholesterol metabolism at the transcriptional level, and emphasize the idea of HDAC inhibition as a promising therapeutic tool in neurodegenerative disorders with impaired cholesterol metabolism.
The evolution of the protein synthesis system. I - A model of a primitive protein synthesis system
Mizutani, H.; Ponnamperuma, C.
1977-01-01
A model is developed to describe the evolution of the protein synthesis system. The model is comprised of two independent autocatalytic systems, one including one gene (A-gene) and two activated amino acid polymerases (O and A-polymerases), and the other including the addition of another gene (N-gene) and a nucleotide polymerase. Simulation results have suggested that even a small enzymic activity and polymerase specificity could lead the system to the most accurate protein synthesis, as far as permitted by transitions to systems with higher accuracy.
Pfaller, Michael A; Messer, Shawn A; Rhomberg, Paul R; Borroto-Esoda, Katyna; Castanheira, Mariana
2017-08-01
SCY-078 (formerly MK-3118) is a novel orally active inhibitor of fungal β-(1,3)-glucan synthase (GS). SCY-078 is a derivative of enfumafungin and is structurally distinct from the echinocandin class of antifungal agents. We evaluated the in vitro activity of this compound against wild-type (WT) and echinocandin-resistant isolates containing mutations in the FKS genes of Candida spp. Against 36 Candida spp. FKS mutants tested, 30 (83.3%) were non-WT to 1 or more echinocandins, and only 9 (25.0%) were non-WT (MIC, >WT-upper limit) to SCY-078. Among C. glabrata isolates carrying FKS alterations, 84.0% were non-WT to the echinocandins versus only 24.0% for SCY-078. In contrast to the echinocandin comparators, the activity of SCY-078 was minimally affected by the presence of FKS mutations, suggesting that this agent is useful in the treatment of Candida infections due to echinocandin-resistant strains. Copyright © 2017 American Society for Microbiology.
Ho, Hoang V T; Sievenpiper, John L; Zurbau, Andreea; Blanco Mejia, Sonia; Jovanovski, Elena; Au-Yeung, Fei; Jenkins, Alexandra L; Vuksan, Vladimir
2016-10-01
Oats are a rich source of β-glucan, a viscous, soluble fibre recognised for its cholesterol-lowering properties, and are associated with reduced risk of CVD. Our objective was to conduct a systematic review and meta-analysis of randomised-controlled trials (RCT) investigating the cholesterol-lowering potential of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for the risk reduction of CVD. MEDLINE, Embase, CINAHL and Cochrane CENTRAL were searched. We included RCT of ≥3 weeks of follow-up, assessing the effect of diets enriched with oat β-glucan compared with controlled diets on LDL-cholesterol, non-HDL-cholesterol or apoB. Two independent reviewers extracted data and assessed study quality and risk of bias. Data were pooled using the generic inverse-variance method with random effects models and expressed as mean differences with 95 % CI. Heterogeneity was assessed by the Cochran's Q statistic and quantified by the I 2-statistic. In total, fifty-eight trials (n 3974) were included. A median dose of 3·5 g/d of oat β-glucan significantly lowered LDL-cholesterol (-0·19; 95 % CI -0·23, -0·14 mmol/l, Pcholesterol (-0·20; 95 % CI -0·26, -0·15 mmol/l, PLDL-cholesterol (I 2=79 %) and non-HDL-cholesterol (I 2=99 %). Pooled analyses showed that oat β-glucan has a lowering effect on LDL-cholesterol, non-HDL-cholesterol and apoB. Inclusion of oat-containing foods may be a strategy for achieving targets in CVD reduction.
Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.
For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular
Yeoh, Keat-Ai; Othman, Abrizah; Meon, Sariah; Abdullah, Faridah; Ho, Chai-Ling
2012-10-15
Glucanases are enzymes that hydrolyze a variety β-d-glucosidic linkages. Plant β-1,3-glucanases are able to degrade fungal cell walls; and promote the release of cell-wall derived fungal elicitors. In this study, three full-length cDNA sequences encoding oil palm (Elaeis guineensis) glucanases were analyzed. Sequence analyses of the cDNA sequences suggested that EgGlc1-1 is a putative β-d-glucan exohydolase belonging to glycosyl hydrolase (GH) family 3 while EgGlc5-1 and EgGlc5-2 are putative glucan endo-1,3-β-glucosidases belonging to GH family 17. The transcript abundance of these genes in the roots and leaves of oil palm seedlings treated with Ganoderma boninense and Trichoderma harzianum was profiled to investigate the involvement of these glucanases in oil palm during fungal infection. The gene expression of EgGlc1-1 in the root of oil palm seedlings was increased by T. harzianum but suppressed by G. boninense; while the gene expression of both EgGlc5-1 and EgGlc5-2 in the roots of oil palm seedlings was suppressed by G. boninense or/and T. harzianum. Copyright © 2012 Elsevier GmbH. All rights reserved.
Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan
Directory of Open Access Journals (Sweden)
Adrian Wiater
2016-09-01
Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.
Kim, Hyunsook; Turowski, Maciej; Anderson, W H Kerr; Young, Scott A; Kim, Yookyung; Yokoyama, Wallace
2011-07-27
We investigated in Syrian Golden hamsters the biological impact and its underlying mechanism of single whole grain breads supplemented with 2-3% hydroxypropyl methylcellulose (HPMC), a semisynthetic viscous soluble dietary fiber (SDF) as a substitute for gluten. Hamsters were fed high-fat diets supplemented with 48-65% (w/w) differently ground, freeze-dried single grain breads including whole grain wheat, barley, barley supplemented with HPMC, debranned oat, and oat supplemented with HPMC which were compared to a diet containing microcrystalline cellulose (control). All single grain breads significantly lowered plasma LDL-cholesterol concentrations compared to the control. Enrichment with HPMC further lowered plasma and hepatic cholesterol concentrations. Despite the reduced molecular weight of naturally occurring soluble (1--->3),(1--->4)-β-d-glucan (β-glucan) caused by the bread-making process, whole grain barley breads downregulated hepatic expression of CYP7A1 and HMG-CoAR genes that are responsible for bile acid and cholesterol synthesis, suggesting a possible role of bioactive compounds such as short-chain fatty acids and phenolic compounds from barley bread. Barley bread enriched with HPMC downregulated expression of ABCG5 gene. Taken together, it appears that distinctive modulation of synthesis and excretion of hepatic cholesterol and bile acid contributes to the cholesterol-lowering properties of whole grain barley breads and breads enriched with HPMC. These data suggests that alternative whole grain breads supplemented with HPMC may provide consumers with a staple food that can assist in cholesterol management.
Visual gene developer: a fully programmable bioinformatics software for synthetic gene optimization
Directory of Open Access Journals (Sweden)
McDonald Karen
2011-08-01
Full Text Available Abstract Background Direct gene synthesis is becoming more popular owing to decreases in gene synthesis pricing. Compared with using natural genes, gene synthesis provides a good opportunity to optimize gene sequence for specific applications. In order to facilitate gene optimization, we have developed a stand-alone software called Visual Gene Developer. Results The software not only provides general functions for gene analysis and optimization along with an interactive user-friendly interface, but also includes unique features such as programming capability, dedicated mRNA secondary structure prediction, artificial neural network modeling, network & multi-threaded computing, and user-accessible programming modules. The software allows a user to analyze and optimize a sequence using main menu functions or specialized module windows. Alternatively, gene optimization can be initiated by designing a gene construct and configuring an optimization strategy. A user can choose several predefined or user-defined algorithms to design a complicated strategy. The software provides expandable functionality as platform software supporting module development using popular script languages such as VBScript and JScript in the software programming environment. Conclusion Visual Gene Developer is useful for both researchers who want to quickly analyze and optimize genes, and those who are interested in developing and testing new algorithms in bioinformatics. The software is available for free download at http://www.visualgenedeveloper.net.
Li, Xiaojing; Ji, Na; Li, Man; Zhang, Shuangling; Xiong, Liu; Sun, Qingjie
2017-09-13
Starch nanoparticles were potential texture modifiers. However, they have strong tendency to aggregate and poor water dispersibility, which limited their application. The interaction between glucan (prepared from starch by enzymatic modification) and protein could significantly improve the dispersity of starch nanoparticles and, thus, enhance the rheological properties of food gels. In this work, glucan/protein hybrid nanoparticles were successfully developed for the first time using short linear glucan (SLG) and edible proteins [soy protein isolate (SPI), rice protein (RP), and whey protein isolate (WPI)]. The results showed that the SLG/SPI hybrid nanoparticles exhibited hollow structures, of which the smallest size was approximately 10-20 nm when the SLG/SPI ratio was 10:5. In contrast, SLG/RP nanoparticles displayed flower-like superstructures, and SLG/WPI nanoparticles presented stacked lamellar nanostructures with a width of 5-10 nm and a length of 50-70 nm. In comparison to bare SLG nanoparticles, SLG/SPI and SLG/WPI hybrid nanoparticles had higher melting temperatures. The addition of all nanoparticles greatly increased the storage modulus of corn starch gels and decreased loss tangent values. Importantly, the G' value of starch gels increased by 567% with the addition of flower-like SLG/RP superstructures.
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Jiménez, Natalia Ivonne Vera
2013-01-01
of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1b, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1b, IL-6 family member M17 and IL-8 were...
Choi, Jae Min; Jeong, Daham; Piao, Jinglan; Kim, Kyoungtea; Nguyen, Andrew Bao Loc; Kwon, Nak-Jung; Lee, Mi-Kyung; Lee, Im Soon; Yu, Jae-Hyuk; Jung, Seunho
2015-01-12
The removal of polycyclic aromatic hydrocarbons by soil washing using water is extremely difficult due to their intrinsic hydrophobic nature. In this study, the effective aqueous solubility enhancements of seven polycyclic aromatic hydrocarbons by chemically modified hydroxypropyl rhizobial cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimer have been investigated for the first time. In the presence of hydroxypropyl cyclic β-(1 → 2)-D-glucans, the solubility of benzo[a]pyrene is increased up to 38 fold of its native solubility. The solubility of pyrene and phenanthrene dramatically increased up to 160 and 359. Coronene, chrysene, perylene, and fluoranthene also show an increase of 11, 23, 23, and 97 fold, respectively, of enhanced solubility by complexation with synthetic epichlorohydrin β-cyclodextrin dimer. The physicochemical properties of the complex are characterized by Fourier-transform infrared spectra and differential scanning calorimetry. Utilizing a scanning electron microscopy, the morphological structures of native benzo[a]pyrene, pyrene, phenanthrene, coronene, chrysene, perylene, fluoranthene and their complex with novel carbohydrate-solubilizers are studied. These results elucidate that polycyclic aromatic hydrocarbons are able to form an efficient complex with hydroxypropyl cyclic β-(1 → 2)-D-glucans and β-cyclodextrin dimer, suggesting the potential usage of chemically modified novel carbohydrate-solubilizers. Copyright © 2014 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Toguri, T.; Umemoto, N.; Kobayashi, O.; Ohtani, T.
1993-01-01
Eggplant seedlings (Solanum melongena) grown under red light irradiation showed a normal morphology with green, fully expanded cotyledons. When the seedlings grown under red light were irradiated with ultraviolet-containing white light, anthocyanin synthesis was induced in the hypocotyl tissues, especially when a UV light supplement was added. The accumulation of pigments was closely associated with the expression of genes involved in flavonoid synthesis. These genes include chalcone synthase (CHS) and dihydroflavonol 4-reductase (DFR). Using subtracted probes, which had been enriched for the accumulated mRNA, one white light-responsive cDNA was identified as being a P450 gene by comparison with database sequences. The maximal amino acid homology this cDNA had with other P450s was 36%. This was with CYP71 from avocado (Persea americana). Thus it represents a new P-450 family, which has been named CYP75. The mRNA of this gene was localized in the hypocotyl tissues of eggplant seedlings, which had been white light-irradiated. The transcript was accumulated by changing the light source, as in the case of other flavonoid biosynthesis genes. In delphinidin producing petunia plants, the mRNAs corresponding to the eggplant P-450 and flavonoid biosynthesis genes such as CHS and DFR were most abundant during the mid stage of flower bud development, but could not be detected in leaf tissues. These results suggest that this P-450 gene encodes a hydroxylating enzyme involved in flavonoid biosynthesis. (author)
Dauelsberg, Patricia; Matus, José Tomás; Poupin, María Josefina; Leiva-Ampuero, Andrés; Godoy, Francisca; Vega, Andrea; Arce-Johnson, Patricio
2011-09-15
In the present work, the effect of assisted fertilization on anatomical, morphological and gene expression changes occurring in carpels and during early stages of berry development in Vitis vinifera were studied. Inflorescences were emasculated before capfall, immediately manually pollinated (EP) and fruit development was compared to emasculated but non-pollinated (ENP) and self-pollinated inflorescences (NESP). The diameter of berries derived from pollinated flowers (EP and NESP) was significantly higher than from non-pollinated flowers (ENP) at 21 days after emasculation/pollination (DAE), and a rapid increase in the size of the inner mesocarp, together with the presence of an embryo-like structure, were observed. The expression of gibberellin oxidases (GA20ox and GA2ox), anthranilate synthase (related to auxin synthesis) and cytokinin synthase coding genes was studied to assess the relationship between hormone synthesis and early berry development, while flower patterning genes were analyzed to describe floral transition. Significant expression changes were found for hormone-related genes, suggesting that their expression at early stages of berry development (13 DAE) is related to cell division and differentiation of mesocarp tissue at a later stage (21 DAE). Expression of hormone-related genes also correlates with the expression of VvHB13, a gene related to mesocarp expansion, and with an increased repression of floral patterning genes (PISTILLATA and TM6), which may contribute to prevent floral transition inhibiting fruit growth before fertilization takes place. Copyright © 2011 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Fatemeh Mokhtari
2018-04-01
Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.
Directory of Open Access Journals (Sweden)
Joana Gangoiti
Full Text Available Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4 glucan chains connected by alternating (α1→4/(α1→6 linkages and (α1→4,6 branching points. This enzyme constituted the single evidence for this reaction and product specificity in the GH70 family, mostly containing glucansucrases encoded by lactic acid bacteria (http://www.CAZy.org. In this work, 4 additional GtfD-like proteins were identified in taxonomically diverse plant-associated bacteria forming a new GH70 subfamily with intermediate characteristics between the evolutionary related GH13 and GH70 families. The GtfD enzyme encoded by Paenibacillus beijingensis DSM 24997 was characterized providing the first example of a reuteran-like polymer synthesizing 4,6-α-glucanotransferase in a Gram-positive bacterium. Whereas the A. chroococcum GtfD activity on amylose resulted in the synthesis of a high molecular polymer, in addition to maltose and other small oligosaccharides, two reuteran-like polymer distributions are produced by P. beijingensis GtfD: a high-molecular mass polymer and a low-molecular mass polymer with an average Mw of 27 MDa and 19 kDa, respectively. Compared to the A. chroooccum GtfD product, both P. beijingensis GtfD polymers contain longer linear (α1→4 sequences in their structure reflecting a preference for transfer of even longer glucan chains by this enzyme. Overall, this study provides new insights into the evolutionary history of GH70 enzymes, and enlarges the diversity of natural enzymes that can be applied for modification of the starch present in food into less and/or more slowly digestible carbohydrate structures.
Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M
2015-10-01
Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.
Energy Technology Data Exchange (ETDEWEB)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)
2013-07-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
International Nuclear Information System (INIS)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.
2013-01-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
International Nuclear Information System (INIS)
Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.
2013-01-01
Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)
Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka
2012-01-01
Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D-glucan
Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz
2012-01-01
Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.
Williams, Suzanne T.; Lockyer, Anne E.; Dyal, Patricia; Nakano, Tomoyuki; Churchill, Celia K. C.; Speiser, Daniel I.
2017-01-01
Very little is known about the evolution of molluskan shell pigments, although Mollusca is a highly diverse, species rich, and ecologically important group of animals comprised of many brightly colored taxa. The marine snail genus Clanculus was chosen as an exceptional model for studying the evolution of shell color, first, because in Clanculus margaritarius and Clanculus pharaonius both shell and foot share similar colors and patterns; and second, because recent studies have identified the pigments, trochopuniceus (pink-red), and trochoxouthos (yellow-brown), both comprised of uroporphyrin I and uroporphyrin III, in both shell and colored foot tissue of these species. These unusual characteristics provide a rare opportunity to identify the genes involved in color production because, as the same pigments occur in the shell and colored foot tissue, the same color-related genes may be simultaneously expressed in both mantle (which produces the shell) and foot tissue. In this study, the transcriptomes of these two Clanculus species along with a third species, Calliostoma zizyphinum, were sequenced to identify genes associated with the synthesis of porphyrins. Calliostoma zizyphinum was selected as a negative control as trochopuniceus and trochoxouthos were not found to occur in this species. As expected, genes necessary for the production of uroporphyrin I and III were found in all three species, but gene expression levels were consistent with synthesis of uroporphyrins in mantle and colored foot tissue only in Clanculus. These results are relevant not only to understanding the evolution of shell pigmentation in Clanculus but also to understanding the evolution of color in other species with uroporphyrin pigmentation, including (mainly marine) mollusks soft tissues and shells, annelid and platyhelminth worms, and some bird feathers.
Williams, Suzanne T.
2017-10-30
Very little is known about the evolution of molluskan shell pigments, although Mollusca is a highly diverse, species rich, and ecologically important group of animals comprised of many brightly colored taxa. The marine snail genus Clanculus was chosen as an exceptional model for studying the evolution of shell color, first, because in Clanculus margaritarius and Clanculus pharaonius both shell and foot share similar colors and patterns; and second, because recent studies have identified the pigments, trochopuniceus (pink-red), and trochoxouthos (yellow-brown), both comprised of uroporphyrin I and uroporphyrin III, in both shell and colored foot tissue of these species. These unusual characteristics provide a rare opportunity to identify the genes involved in color production because, as the same pigments occur in the shell and colored foot tissue, the same color-related genes may be simultaneously expressed in both mantle (which produces the shell) and foot tissue. In this study, the transcriptomes of these two Clanculus species along with a third species, Calliostoma zizyphinum, were sequenced to identify genes associated with the synthesis of porphyrins. Calliostoma zizyphinum was selected as a negative control as trochopuniceus and trochoxouthos were not found to occur in this species. As expected, genes necessary for the production of uroporphyrin I and III were found in all three species, but gene expression levels were consistent with synthesis of uroporphyrins in mantle and colored foot tissue only in Clanculus. These results are relevant not only to understanding the evolution of shell pigmentation in Clanculus but also to understanding the evolution of color in other species with uroporphyrin pigmentation, including (mainly marine) mollusks soft tissues and shells, annelid and platyhelminth worms, and some bird feathers.
Directory of Open Access Journals (Sweden)
Pai-Feng Kao
2012-01-01
Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.
Movement of food-borne pathogens on moist surfaces enables them to migrate towards more favorable niches and facilitate their survival for extended periods of time. Salmonella enterica serovar Typhimurium mutants defective in OPG synthesis are unable to exhibit motility on moist surfaces (swarming) ...
Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.
2013-01-01
α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades
Huong Le, Mai; Doan Do, Hai; Tran Thi, Hong Ha; Dung, Le Vu; Nguyen, Hoai Nam; Nhu Tran Thi, Hang; Dinh Nguyen, Luyen; Hoang, Chi Kim; Le, Huu Cuong; Huong Le Thi, Thu; Trinh, Hoang Trung; Thu Ha, Phuong
2016-12-01
Curcumin is a polyphenol from turmeric Curcuma longa L that has been proved to possess numerous biological and pharmaceutical activities, including anti-cancer properties. However, curcumin has only limited clinical applications due to the aqueous insolubility characteristic that reduces its biological availability. On the other hand, using nanoparticles as drug delivery system has potential as it increases solubility of hydrophobic substances such as curcumin. Furthermore, nanoparticles can protect and control release of drug. Therefore, the objective of this project is to prepare nanoparticles by polymeric encapsulating curcumin by 1-3/1-6 β-glucan extracted from Vietnamese mushrooms to increase drug delivery efficiency and biological effect. Method of the preparation is nano-precipitation. The produced curcumin-β-glucan-nanoparticles (NanoGluCur) takes spherical shape with 60-70 nm in diameter. As expected, water solubility of curcumin increases about 180 times, from 0.6 μg ml-1 to 0.11 mg ml-1. Loading capacity of NanoGluCur is 18.16%. In vitro cytotoxicity and anti-tumor promoting effects of NanoGluCur were also investigated. Results revealed that NanoGluCur is able to inhibit the growth of two human cancer cell lines Hep-G2 and LU-1 with IC50 values of 6.82 and 15.53 mg ml-1, respectively, while free curcumin expresses the activity with IC50 values of 7.41 and 18.82 mg ml-1. At the concentration of 40 mg ml-1, NanoGluCur showed anti-tumor promoting effects in reducing tumor size by 59.93% and tumor density by 40.52%, while the percentages caused by pristine curcumin were 41.36% and 29.14%, respectively. These results demonstrated dual effect of 1-3/1-6 β-glucan encapsulated curcumin nanoparticles: higher water solubility and better in vitro anti-cancer effects compared to free curcumin and 1-3/1-6 β-glucan, expectedly. This observation can potentially open a new approach in research and manufacture of functional foods from medicinal mushrooms.
Identification of sugarcane genes involved in the purine synthesis pathway
Directory of Open Access Journals (Sweden)
Mario A. Jancso
2001-12-01
Full Text Available Nucleotide synthesis is of central importance to all cells. In most organisms, the purine nucleotides are synthesized de novo from non-nucleotide precursors such as amino acids, ammonia and carbon dioxide. An understanding of the enzymes involved in sugarcane purine synthesis opens the possibility of using these enzymes as targets for chemicals which may be effective in combating phytopathogen. Such an approach has already been applied to several parasites and types of cancer. The strategy described in this paper was applied to identify sugarcane clusters for each step of the de novo purine synthesis pathway. Representative sequences of this pathway were chosen from the National Center for Biotechnology Information (NCBI database and used to search the translated sugarcane expressed sequence tag (SUCEST database using the available basic local alignment search tool (BLAST facility. Retrieved clusters were further tested for the statistical significance of the alignment by an implementation (PRSS3 of the Monte Carlo shuffling algorithm calibrated using known protein sequences of divergent taxa along the phylogenetic tree. The sequences were compared to each other and to the sugarcane clusters selected using BLAST analysis, with the resulting table of p-values indicating the degree of divergence of each enzyme within different taxa and in relation to the sugarcane clusters. The results obtained by this strategy allowed us to identify the sugarcane proteins participating in the purine synthesis pathway.A via de síntese de purino nucleotídeos é considerada uma via de central importância para todas as células. Na maioria dos organismos, os purino nucleotídeos são sintetizados ''de novo'' a partir de precursores não-nucleotídicos como amino ácidos, amônia e dióxido de carbono. O conhecimento das enzimas envolvidas na via de síntese de purinas da cana-de-açúcar vai abrir a possibilidade do uso dessas enzimas como alvos no desenho
Yin, Chao; Wang, Bin; He, Pan; Lin, Ying; Pan, Li
2014-05-15
Aspergillus niger is usually regarded as a beneficial species widely used in biotechnological industry. Obtaining the genome sequence of the widely used aconidial A. niger SH2 strain is of great importance to understand its unusual production capability. In this study we assembled a high-quality genome sequence of A. niger SH2 with approximately 11,517 ORFs. Relatively high proportion of genes enriched for protein expression related FunCat items verify its efficient capacity in protein production. Furthermore, genome-wide comparative analysis between A. niger SH2 and CBS513.88 reveals insights into unique properties of A. niger SH2. A. niger SH2 lacks the gene related with the initiation of asexual sporulation (PrpA), leading to its distinct aconidial phenotype. Frame shift mutations and non-synonymous SNPs in genes of cell wall integrity signaling, β-1,3-glucan synthesis and chitin synthesis influence its cell wall development which is important for its hyphal fragmentation during industrial high-efficiency protein production. Copyright © 2014 Elsevier B.V. All rights reserved.
Effects of Low Molecular Weight Yeast β-Glucan on Antioxidant and Immunological Activities in Mice
Directory of Open Access Journals (Sweden)
Na Lei
2015-09-01
Full Text Available To evaluate the antioxidant and immune effects of low molecular yeast β-glucan on mice, three sulfated glucans from Saccharomyces cerevisiae (sGSCs with different molecular weight (MW and degrees of sulfation (DS were prepared. The structures of the sGSCs were analyzed through high performance liquid chromatography-gel permeation chromatography (HPLC-GPC and Fourier transform infrared spectroscopy (FTIR. sGSC1, sGSC2, and sGSC3 had MW of 12.9, 16.5 and 19.2 kDa, respectively, and DS of 0.16, 0.24 and 0.27, respectively. In vitro and in vivo experiments were conducted to evaluate the antioxidant and immunological activities of the sGSCs. In vitro experiment, the reactive oxygen species (ROS scavenging activities were determined. In vivo experiment, 50 male BALB/c mice were divided into five groups. The sGSC1, sGSC2 and sGSC3 treatment groups received the corresponding sGSCs at 50 mg/kg/day each. The GSC (glucans from Saccharomyces cerevisiae treatment group received 50 mg/kg/day GSC. The normal control group received equal volume of physiological saline solution. All treatments were administered intragastrically for 14 day. Results showed that sGSC1, sGSC2 and sGSC3 can scavenge 1,1-diphenyl-2-picryl-hydrazyl (DPPH, superoxide, and hydroxyl radicals in vitro. The strength of the radical scavenging effects of the sGSCs was in the order of sGSC1 > sGSC2 > sGSC3. Oral administration of sGSC1 significantly improved serum catalase (CAT and glutathione peroxidase (GSH-Px activities and decreased malondialdehyde (MDA level in mice. sGSC1 significantly improved the spleen and thymus indexes and the lymphocyte proliferation, effectively enhanced the percentage of CD4+ T cells, decreased the percentage of CD8+ T cells, and elevated the CD4+/CD8+ ratio. sGSC1 significantly promoted the secretion of IL-2 and IFN-γ. These results indicate that sGSC1 with low MW and DS has better antioxidant and immunological activities than the other sGSCs, and sGSC1 could
DEFF Research Database (Denmark)
Chettri, Jiwan Kumar; Raida, Martin Kristian; Holten-Andersen, Lars
2011-01-01
) on the surface of the invader. Phagocytic cells are known to initiate a respiratory burst following an exposure to the pathogen, but the underlying and associated specific elements are poorly elucidated in fish. The present study describes the differential response of head kidney leukocytes from rainbow trout...... (Oncorhynchus mykiss) to different PAMPs mimicking viral (poly I:C), bacterial (flagellin and LPS) and fungal infections (zymosan and ß-glucan). Transcript of cytokines related to inflammation (IL-1ß, IL-6, IL-10 and TNF-a) was highly up-regulated following LPS exposure whereas flagellin or poly I:C induced...... merely moderate reactions. In contrast, IFN-¿ expression was significantly higher in the poly I:C stimulated group compared to the LPS group. When head kidney cells were exposed to zymosan or ß-glucan, genes encoding IL-1ß, TNF-a, IL-6 and IL-10 became up-regulated. Their level of up...
Directory of Open Access Journals (Sweden)
Bo-Hye Nam
2016-12-01
Full Text Available Antimicrobial peptides are a pivotal component of the invertebrate innate immune system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP gene from the pacific abalone Haliotis discus hannai (HDH, which is involved in the pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF encoding a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2. By substituting a positively charged amino acid and amidation at the C-terminus, the pI and net charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa, lung (A549, and colon (HCT 116 carcinoma cell lines but not much on human umbilical vein cell (HUVEC. Fluorescence-activated cell sorter (FACS analysis showed that HDH-LGBP analogs disturb the cancer cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs as multifunctional drugs.
Directory of Open Access Journals (Sweden)
Mamta Janmeda
2017-05-01
Full Text Available Aim: Aim of the study was to study the relative gene expression of genes associated with fatty acid synthesis at 60 days postpartum (pp in bovine mammary epithelial cells (MECs of Surti and Jafarabadi buffaloes. Materials and Methods: A total of 10 healthy Surti and Jafarabadi buffaloes of each breed were selected at random from Livestock Research Station, Navsari and Cattle Breeding Farm, Junagadh, Gujarat, respectively, for this study. Milk sample was collected from each selected buffalo at day 60 pp from these two breeds to study relative gene expression of major milk fat genes using non-invasive approach of obtaining primary bovine MECs (pBMEC from milk samples. Results: In this study overall, the relative expression of the six major milk lipogenic genes butyrophilin subfamily 1 member A1 (BTN1A1, stearoyl-CoA desaturase (SCD, lipoprotein lipase (LPL, glycerol-3-phosphate acyltransferase mitochondrial (GPAM, acetyl-coenzyme A carboxylase alpha (ACACA, and lipin (LPIN did not show changes in expression patterns at 60th day of lactation in both Surti and Jafarabadi buffaloes. Conclusion: The pBMEC can be successfully recovered from 1500 ml of milk of Surti and Jafarabadi buffaloes using antibody-mediated magnetic bead separation and can be further used for recovering RNA for down step quantification of major milk lipogenic gene expression. The relative expression of the six major milk lipogenic genes BTN1A1, SCD, LPL, GPAM, ACACA, and LPIN did not show changes in expression patterns in both Surti and Jafarabadi buffaloes, suggesting expression levels of lipogenic genes are maintained almost uniform till peak lactation without any significant difference.
Synthesis of substrates for gene therapy monitoring of HSV1-TK system
Energy Technology Data Exchange (ETDEWEB)
Choi, Tae Hyun; Ahn, Soon Hyuk; Choi, Chang Woon; Lim, Sang Moo; Awh, Ok Doo [College of Medicine, Yonsei Univ., Wonju (Korea, Republic of)
2002-04-01
In gene therapy, tumor cells expressing the herpes simplex virus thymidine kinase are sensitive to prodrugs. Potential prodrugs IVDU and IVFRU were synthesized and radiolabeled with radioiodine for noninvasive imaging of herpes simplex virus type 1 gene expression. 5-(2-trimethysilyl) vinyl-2'-deoxyuridine and 5-t(2-trimethylsilyl)vinyl-2'-fluoro-2'-deoxyuridine, precursors of 5-(2-iodo)viny 1-2'-deoxy uridine(IVDU) and 5-(2-iodo)-2'-vinyl-2'-deoxy-2'-fluorotibofuranosyl uracil(IVFRU), were synthesized from reaction of trans-1-trimethylsillyl-2-tri-n-butylstannylethylene with 5-iodo-2'-deoxyuridine and 5-iodo-2'-fluoro-2'-deoxyuridine, respectively, on the condition of Pd catalyst. These precursors were separated from reaction mixture by silica gel column chromatography method. Each precursor was radioiodinated with radioiodine by mixing with ICI oxidizing agent. These radioiodinated compounds were purified with HPLC. Radiohalogen exchange has been shown to be effective for the synthesis of products with lower specific activity. Similarly, carrier-added and high specific activity products have been isolated in respectable radiochemical yields using ICI method. Synthetic yield of precursors, IVDU and IVFRU were 43% and 18%, respectively. Radiochemical purity of both compunds was over 98%. We synthesized precursors of IVDU and IVFRU for monitoring of HSV1-tk gene expression. Radiotracers were radioiodinated with high radiolabeling yield by ICI method.
Vahid-Dastjerdi, Elahe; Monadi, Elham; Khalighi, Hamid Reza; Torshabi, Maryam
2016-01-01
In our previous studies, we showed the inhibitory effects of Punica granatum L. flower and Rhus coriaria L. fruit water extracts on dental plaque accumulation by several bacteria, especially Streptococcus mutans (S. mutans), on orthodontic wire by in-vitro assays. In this study, the anti-cariogenic properties of the extracts were evaluated by assessing their effects on expression of glycosyltransferase (gtf) genes, which are responsible for initial biofilm formation by S. mutans. In this study, the effect of herbal extracts on expression of gtfB, C (encoding enzymes that produce water-insoluble glucans) and D (encoding enzymes that produce water-soluble glucans) genes in S. mutans growing in planktonic state was evaluated quantitatively by real-time polymerase chain reaction (PCR) method. The minimum biofilm inhibitory concentration (MBIC) of understudied herbal water extracts significantly suppressed gtfB, C and D gene expression by 85.3 ± 7.5%, 33.3 ± 6.4% and 25 ± 14%, respectively for Punica granatum L. extract and 73.4 ± 7.3%, 93.8 ± 2.7% and 59.3 ± 9.8%, respectively for Rhus coriaria L. extract compared to the non-treated control group (P Punica granatum L. extract. These findings suggest that Punica granatum L. and especially Rhus coriaria L. maybe used as novel, natural antiplaque agents since they inhibit specific genes associated with bacterial biofilm formation without necessarily affecting the growth of oral bacteria.
Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming
2012-05-01
Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Succinoglycan Production Contributes to Acidic pH Tolerance in Sinorhizobium meliloti Rm1021.
Hawkins, Justin P; Geddes, Barney A; Oresnik, Ivan J
2017-12-01
In this work, the hypothesis that exopolysaccharide plays a role in the survival of Sinorhizobium meliloti at low pH levels is addressed. When S. meliloti was grown at pH 5.75, synthesis of succinoglycan increased, whereas synthesis of galactoglucan decreased. Succinoglycan that was isolated from cultures grown at low pH had a lower degree of polymerization relative to that which was isolated from cultures grown at neutral pH, suggesting that low-molecular weight (LMW) succinoglycan might play a role in adaptation to low pH. Mutants unable to produce succinoglycan or only able to produce high-molecular weight polysaccharide were found to be sensitive to low pH. However, strains unable to produce LMW polysaccharide were 10-fold more sensitive. In response to low pH, transcription of genes encoding proteins for succinoglycan, glycogen, and cyclic β(1-2) glucans biosynthesis increased, while those encoding proteins necessary for the biosynthesis of galactoglucan decreased. While changes in pH did not affect the production of glycogen or cyclic β(1-2) glucan, it was found that the inability to produce cyclic β(1-2) glucan did contribute to pH tolerance in the absence of succinoglycan. Finally, in addition to being sensitive to low pH, a strain carrying mutations in exoK and exsH, which encode the glycanases responsible for the cleavage of succinoglycan to LMW succinoglycan, exhibited a delay in nodulation and was uncompetitive for nodule occupancy. Taken together, the data suggest that the role for LMW succinoglycan in nodule development may be to enhance survival in the colonized curled root hair.
International Nuclear Information System (INIS)
Diaz de Cerio, O.; Hands, E.; Humble, J.; Cajaraville, M.P.; Craft, J.A.; Cancio, I.
2013-01-01
Highlights: ► Transcription responses in blue mussels exposed to styrene have been studied by SSH. ► 1440 Clones were obtained from which 287 were sequenced. ► Immune system, cancer-related and ribosomal genes identified as upregulated genes. ► Chitin and β-1-3-glucan metabolism genes highly represented in subtracted library. -- Abstract: Transcriptional profiling can elucidate adaptive/toxicity pathways participating in achieving homeostasis or leading to pathogenesis in marine biota exposed to chemical substances. With the aim of analyzing transcriptional responses in the mussel Mytilus edulis exposed to the corrosive and putatively carcinogenic hydrocarbon styrene (3–5 ppm, 3 days), a forward subtracted (SSH) cDNA library was produced. Female mussels were selected and digestive gland mRNA was isolated. A library with 1440 clones was produced and a total of 287 clones were sequenced, 53% being identified through BlastN analysis against Mytibase and DeepSeaVent databases. Those genes included GO terms such as ‘response to drugs’, ‘immune defense’ and ‘cell proliferation’. Furthermore, sequences related to chitin and beta-1-3-glucan metabolism were also up-regulated by styrene. Many of the obtained sequences could not be annotated constituting new mussel sequences. In conclusion, this SSH study reveals novel sequences useful to generate molecular biomarkers of styrene exposure in mussels
Wang, Sanhong; Yao, Quanhong; Tao, Jianmin; Qiao, Yushan; Zhang, Zhen
2007-12-01
The genes encoding the two enzymes choline monooxygenase (CMO) and betaine aldehyde dehydrogenase (BADH) of glycine betaine synthesis in Suaeda salsa were cloned and fused with the 2A region of foot-and-mouth disease virus in a single open reading frame. The fused genes were placed under the control of the alcohol oxidase (AOX1) promoter in pPIC3B and transformed into P. pastoris GS115. The expression of the fused genes in P. pastoris and the ability of recombinant yeasts to tolerate environmental stresses were studied. The results showed that induced with 0.5% methanol for 96 h, the maximal activities of CMO and BADH in the tested recombinant yeasts were 45- and 44-fold higher than those in the control yeast transformed empty vector only, respectively; the content of glycine betaine in the recombinant yeasts was 28- to 35-fold higher than that in the control. The fused genes linked by 2A region of foot-and-mouth disease virus were expressed in P. pastoris successfully and the polyprotein was 'cleaved' to each functional protein. The yeasts transformed the fused genes, which were more resistant to salt, methanol, and high temperature stresses than the control as result of glycine betaine synthesis genes introduced.
Directory of Open Access Journals (Sweden)
Magdia De Jesus
Full Text Available Glucan particles (GPs are 2-4 μm hollow, porous shells composed of 1,3-β-D-glucan that have been effectively used for oral targeted-delivery of a wide range of payloads, including small molecules, siRNA, DNA, and protein antigens. While it has been demonstrated that the transepithelial transport of GPs is mediated by Peyer's patch M cells, the fate of the GPs once within gut-associated lymphoid tissue (GALT is not known. Here we report that fluorescently labeled GPs administered to mice by gavage accumulate in CD11c+ DCs situated in Peyer's patch sub-epithelial dome (SED regions. GPs appeared in DCs within minutes after gavage and remained within the SED for days afterwards. The co-administration or sequential administration of GPs with differentially labeled GPs or poly(lactic-co-glycolic acid nanoparticles demonstrated that the SED DC subpopulation in question was capable of internalizing particles of different sizes and material compositions. Phenotypic analysis identified the GP-containing DCs as being CD8α- and CD11blo/-, suggesting they are the so-called myeloid and/or double negative (DN subset(s of PP DCs. A survey of C-type lectin receptors (CLRs known to be expressed by leukocytes within the intestinal mucosa revealed that GP-containing SED DCs were positive for Langerin (CD207, a CLR with specificity for β-D-glucan and that has been shown to mediate the internalization of a wide range of microbial pathogens, including bacteria, viruses and fungi. The presence of Langerin+ DCs in the SED as determined by immunofluorescence was confirmed using Langerin E-GFP transgenic mice. In summary, our results demonstrate that following M cell-mediated transepithelial transport, GPs (and other micro/nanoparticles are sampled by a population of SED DCs distinguished from other Peyer's patch DC subsets by their expression of Langerin. Future studies will be aimed at defining the role of Langerin in antigen sampling and antigen presentation within
Czech Academy of Sciences Publication Activity Database
Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin
2017-01-01
Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016
Directory of Open Access Journals (Sweden)
ali kargarirezapour
2013-08-01
Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p
Directory of Open Access Journals (Sweden)
Qiulan Wu
2018-06-01
Full Text Available β-1,3-Glucanase is considered as a useful enzymatic tool for β-1,3-glucan degradation to produce (1→3-linked β-glucan oligosaccharides with pharmacological activity properties. To validly isolate β-1,3-glucanase-producing microorganisms, the soil of Wolfiporia extensa, considered an environment rich in β-1,3-glucan-degrading microorganisms, was subjected to high throughput sequencing. The results demonstrated that the genera Streptomyces (1.90% and Arthrobacter (0.78% belonging to the order Actinomycetales (8.64% in the phylum Actinobacteria (18.64% were observed in soil for P. cocos cultivation (FTL1. Actinomycetes were considered as the candidates for isolation of glucan-degrading microorganisms. Out of 58 isolates, only 11 exhibited β-1,3-glucan-degrading activity. The isolate SYBCQL belonging to the genus Kitasatospora with β-1,3-glucan-degrading activity was found and reported for the first time and the isolate SYBC17 displayed the highest yield (1.02 U/mg among the isolates. To check the β-1,3-glucanase contribution to β-1,3-glucan-degrading activity, two genes, 17-W and 17-Q, encoding β-1,3-glucanase in SYBC17 and one gene QLK1 in SYBCQL were cloned and expressed for verification at the molecular level. Our findings collectively showed that the isolates able to secrete β-1,3-glucanase could be obtained with the assistance of high-throughput sequencing and genes expression analysis. These methods provided technical support for isolating β-1,3-glucanase-producing microorganisms.
Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua
2016-07-01
This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.
EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES
Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima
2017-01-01
The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...
Botes, D P; Qobose, M D; Corfield, V A
1991-09-15
A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.
Directory of Open Access Journals (Sweden)
T. Catalina Adarme-Vega
2014-06-01
Full Text Available With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA to C20:4 eicosatetraenoic acid (ETA, correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4, but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt.
Martin, Irene; Dohmen, Christian; Mas-Moruno, Carlos; Troiber, Christina; Kos, Petra; Schaffert, David; Lächelt, Ulrich; Teixidó, Meritxell; Günther, Michael; Kessler, Horst; Giralt, Ernest; Wagner, Ernst
2012-04-28
In the forthcoming era of cancer gene therapy, efforts will be devoted to the development of new efficient and non-toxic gene delivery vectors. In this regard, the use of Fmoc/Boc-protected oligo(ethane amino)acids as building blocks for solid-phase-supported assembly represents a novel promising approach towards fully controlled syntheses of effective gene vectors. Here we report on the synthesis of defined polymers containing the following: (i) a plasmid DNA (pDNA) binding domain of eight succinoyl-tetraethylenpentamine (Stp) units and two terminal cysteine residues; (ii) a central polyethylene glycol (PEG) chain (with twenty-four oxyethylene units) for shielding; and (iii) specific peptides for targeting towards cancer cells. Peptides B6 and c(RGDfK), which bind transferrin receptor and α(v)β(3) integrin, respectively, were chosen because of the high expression of these receptors in many tumoral cells. This study shows the feasibility of designing these kinds of fully controlled vectors and their success for targeted pDNA-based gene transfer. This journal is © The Royal Society of Chemistry 2012
DEFF Research Database (Denmark)
Andersen, Barbara Vad; Mielby, Line H.; Viemose, Ida
2017-01-01
apple-cherry fruit drinks with different levels of beta-glucans and different sweeteners, sucrose or Stevia rebaudiana. The aims were: 1) to study the hedonic sensory experience, 2) to study time and product effects on post-ingestive sensations and satisfaction, and 3) to study main drivers....... Satisfaction with sensory attributes was found to be the main driver of food satisfaction, while post-ingestive sensations drove satisfaction as well. While replacing sucrose with Stevia rebaudiana did not affect the hedonic and post-ingestive sensations, addition of beta glucan resulted in both positive...
Energy Technology Data Exchange (ETDEWEB)
Borkowski, Leszek, E-mail: leszek.borkowski@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek [Department of Animal Physiology, University of Life Sciences in Lublin, Akademicka 12, 20-033 Lublin (Poland); Polkowska, Izabela [Department and Clinic of Animal Surgery, University of Life Sciences in Lublin, Głęboka 30, 20-612 Lublin (Poland); Belcarz, Anna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Karpiński, Mirosław [Department of Companion and Wildlife Animals, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin (Poland); Słowik, Tymoteusz [Independent Radiology Unit at Lublin Small Animals Medical Centre, Stefczyka 11, 20-151 Lublin (Poland); Matuszewski, Łukasz [Children' s Orthopaedic Clinic and Rehabilitation Department, Medical University of Lublin, Chodzki 2, 20-093 Lublin (Poland); Ślósarczyk, Anna [Faculty of Materials Science and Ceramics, AGH-University of Science and Technology, Mickiewicza 30, 30-059 Krakow (Poland); Ginalska, Grażyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland)
2015-08-01
A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration.
International Nuclear Information System (INIS)
Borkowski, Leszek; Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek; Polkowska, Izabela; Belcarz, Anna; Karpiński, Mirosław; Słowik, Tymoteusz; Matuszewski, Łukasz; Ślósarczyk, Anna; Ginalska, Grażyna
2015-01-01
A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration
Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral
2018-04-01
The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Gene Synthesis with H G Khorana
Indian Academy of Sciences (India)
IAS Admin
student with Robert Letsinger at Northwestern University and had written to Gobind about a ... range aim must be the development of methods for the total synthesis of ... There is a good deal of evidence now to suggest that in addition to a.
Directory of Open Access Journals (Sweden)
A. S. Rozhdestvenskaya
2013-01-01
Full Text Available Abstract. Streptococcus agalactiae can cause variety of diseases of newborns and adults. For successful colonization of different human tissues and organs as well as for suppression of the host immune system S. agalactiae expresses numerous virulence factors. For coordinated expression of the virulence genes S. agalactiae employs regulatory molecules including regulatory proteins of two-component systems. Results of the present study demonstrated that in S. agalactiae strain A49V the natural mutation in the brgR gene encoding for BgrR regulatory protein, which is component of regulatory system BgrRS, resulted in the repression of Bac protein synthesis, a virulence factor of S. agalactiae. A single nucleotide deletion in the bgrR gene has caused a shift of the reading frame and the changes in the primary, secondary and tertiary structures of the BgrR protein. The loss of functional activity of BgrR protein in A49V strain and repression of Bac protein synthesis have increased virulence of the strain in experimental animal streptococcal infection.
A murC gene from coryneform bacteria.
Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K
1999-02-01
The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.
2011-01-01
Background Mannoproteins construct the outer cover of the fungal cell wall. The covalently linked cell wall protein Ccw12p is an abundant mannoprotein. It is considered as crucial structural cell wall component since in baker's yeast the lack of CCW12 results in severe cell wall damage and reduced mating efficiency. Results In order to explore the function of CCW12, we performed a Synthetic Genetic Analysis (SGA) and identified genes that are essential in the absence of CCW12. The resulting interaction network identified 21 genes involved in cell wall integrity, chitin synthesis, cell polarity, vesicular transport and endocytosis. Among those are PFD1, WHI3, SRN2, PAC10, FEN1 and YDR417C, which have not been related to cell wall integrity before. We correlated our results with genetic interaction networks of genes involved in glucan and chitin synthesis. A core of genes essential to maintain cell integrity in response to cell wall stress was identified. In addition, we performed a large-scale transcriptional analysis and compared the transcriptional changes observed in mutant ccw12Δ with transcriptomes from studies investigating responses to constitutive or acute cell wall damage. We identified a set of genes that are highly induced in the majority of the mutants/conditions and are directly related to the cell wall integrity pathway and cell wall compensatory responses. Among those are BCK1, CHS3, EDE1, PFD1, SLT2 and SLA1 that were also identified in the SGA. In contrast, a specific feature of mutant ccw12Δ is the transcriptional repression of genes involved in mating. Physiological experiments substantiate this finding. Further, we demonstrate that Ccw12p is present at the cell periphery and highly concentrated at the presumptive budding site, around the bud, at the septum and at the tip of the mating projection. Conclusions The combination of high throughput screenings, phenotypic analyses and localization studies provides new insight into the function of Ccw
Mekoue Nguela, Julie; Poncet-Legrand, Celine; Sieczkowski, N.; Vernhet, Aude
2016-01-01
At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored b...
Slamenová, Darina; Kováciková, Ines; Horváthová, Eva; Wsólová, Ladislava; Navarová, Jana
2010-10-01
A large number of functional foods, including those that contain β-d-glucans, have been shown to prevent human DNA against genotoxic effects and associated development of cancer and other chronic diseases. In this paper, carboxymethyl chitin-glucan (CM-CG) isolated from Aspergillus niger was investigated from two standpoints: (1) DNA-protective effects against oxidative DNA damage induced by H(2)O(2) and alkylating DNA damage induced by MMS and MNNG, and (2) a potential effect on rejoining of MMS- and MNNG-induced single strand DNA breaks. The results obtained by the comet assay in human cells cultured in vitro showed that CM-CG reduced significantly the level of oxidative DNA lesions induced by H(2)O(2) but did not change the level of alkylating DNA lesions induced by MMS or MNNG. On the other side, the efficiency of DNA-rejoining of single strand DNA breaks induced by MMS and MNNG was significantly higher in HepG2 cells pre-treated with CM-CG. The antioxidative activity of carboxymethyl chitin-glucan was confirmed by the DPPH assay. Copyright © 2010 Elsevier Ltd. All rights reserved.
Rosch, Christiane; Taverne, Nico; Venema, Koen; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.
2017-01-01
Scope: This study simulates the fermentation process of barley β-glucan and sugar beet pectin in the human colon and monitors the degradation products formed. Additionally, immune effects of the degradation products were investigated. Methods and results: Immunostimulatory activity of
Cellulose Synthesis in Agrobacterium tumefaciens
Energy Technology Data Exchange (ETDEWEB)
Alan R. White; Ann G. Matthysse
2004-07-31
We have cloned the celC gene and its homologue from E. coli, yhjM, in an expression vector and expressed the both genes in E. coli; we have determined that the YhjM protein is able to complement in vitro cellulose synthesis by extracts of A. tumefaciens celC mutants, we have purified the YhjM protein product and are currently examining its enzymatic activity; we have examined whole cell extracts of CelC and various other cellulose mutants and wild type bacteria for the presence of cellulose oligomers and cellulose; we have examined the ability of extracts of wild type and cellulose mutants including CelC to incorporate UDP-14C-glucose into cellulose and into water-soluble, ethanol-insoluble oligosaccharides; we have made mutants which synthesize greater amounts of cellulose than the wild type; and we have examined the role of cellulose in the formation of biofilms by A. tumefaciens. In addition we have examined the ability of a putative cellulose synthase gene from the tunicate Ciona savignyi to complement an A. tumefaciens celA mutant. The greatest difference between our knowledge of bacterial cellulose synthesis when we started this project and current knowledge is that in 1999 when we wrote the original grant very few bacteria were known to synthesize cellulose and genes involved in this synthesis were sequenced only from Acetobacter species, A. tumefaciens and Rhizobium leguminosarum. Currently many bacteria are known to synthesize cellulose and genes that may be involved have been sequenced from more than 10 species of bacteria. This additional information has raised the possibility of attempting to use genes from one bacterium to complement mutants in another bacterium. This will enable us to examine the question of which genes are responsible for the three dimensional structure of cellulose (since this differs among bacterial species) and also to examine the interactions between the various proteins required for cellulose synthesis. We have carried out one
Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes
Directory of Open Access Journals (Sweden)
Shewmaker Christine K
2010-10-01
Full Text Available Abstract Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD 2 and fatty acid elongase (FAE 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general
Yan, Huijie; Zhu, Dingcheng; Zhou, Zhuxian; Liu, Xin; Piao, Ying; Zhang, Zhen; Liu, Xiangrui; Tang, Jianbin; Shen, Youqing
2018-03-30
Cationic polymers are one of the main non-viral vectors for gene therapy, but their applications are hindered by the toxicity and inefficient transfection, particularly in the presence of serum or other biological fluids. While rational design based on the current understanding of gene delivery process has produced various cationic polymers with improved overall transfection, high-throughput parallel synthesis of libraries of cationic polymers seems a more effective strategy to screen out efficacious polymers. Herein, we demonstrate a novel platform for parallel synthesis of low cationic charge-density polyesters for efficient gene delivery. Unsaturated polyester poly(alkylene maleate) (PAM) readily underwent Michael-addition reactions with various mercaptamines to produce polyester backbones with pendant amine groups, poly(alkylene maleate mercaptamine)s (PAMAs). Variations of the alkylenes in the backbone and the mercaptamines on the side chain produced PAMAs with tunable hydrophobicity and DNA-condensation ability, the key parameters dominating transfection efficiency of the resulting polymer/DNA complexes (polyplexes). A semi-library of such PAMAs was exampled from 7 alkylenes and 18 mercaptamines, from which a lead PAMA, G-1, synthesized from poly(1,4-phenylene bis(methylene) maleate) and N,N-dimethylcysteamine, showed remarkable transfection efficiency even in the presence of serum, owing to its efficient lysosome-circumventing cellular uptake. Furthermore, G-1 polyplexes efficiently delivered the suicide gene pTRAIL to intraperitoneal tumors and elicited effective anticancer activity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Antifungal Properties of Cationic Phenylene Ethynylenes and Their Impact on β-Glucan Exposure.
Pappas, Harry C; Sylejmani, Rina; Graus, Matthew S; Donabedian, Patrick L; Whitten, David G; Neumann, Aaron K
2016-08-01
Candida species are the cause of many bloodstream infections through contamination of indwelling medical devices. These infections account for a 40% mortality rate, posing a significant risk to immunocompromised patients. Traditional treatments against Candida infections include amphotericin B and various azole treatments. Unfortunately, these treatments are associated with high toxicity, and resistant strains have become more prevalent. As a new frontier, light-activated phenylene ethynylenes have shown promising biocidal activity against Gram-positive and -negative bacterial pathogens, as well as the environmental yeast Saccharomyces cerevisiae In this study, we monitored the viability of Candida species after treatment with a cationic conjugated polymer [poly(p-phenylene ethynylene); PPE] or oligomer ["end-only" oligo(p-phenylene ethynylene); EO-OPE] by flow cytometry in order to explore the antifungal properties of these compounds. The oligomer was found to disrupt Candida albicans yeast membrane integrity independent of light activation, while PPE is able to do so only in the presence of light, allowing for some control as to the manner in which cytotoxic effects are induced. The contrast in killing efficacy between the two compounds is likely related to their size difference and their intrinsic abilities to penetrate the fungal cell wall. Unlike EO-OPE-DABCO (where DABCO is quaternized diazabicyclo[2,2,2]octane), PPE-DABCO displayed a strong propensity to associate with soluble β-glucan, which is expected to inhibit its ability to access and perturb the inner cell membrane of Candida yeast. Furthermore, treatment with PPE-DABCO unmasked Candida albicans β-glucan and increased phagocytosis by Dectin-1-expressing HEK-293 cells. In summary, cationic phenylene ethynylenes show promising biocidal activity against pathogenic Candida yeast cells while also exhibiting immunostimulatory effects. Copyright © 2016, American Society for Microbiology. All Rights
Directory of Open Access Journals (Sweden)
Vlatka Petravić-Tominac
2011-01-01
Full Text Available Particulate β-glucans were isolated from brewer’s yeast using three different procedures – alkaline (A, alkaline-acidic (AA and alkaline-acidic with mannoprotein removal (AAM and dried using three different methods – air drying (AD, lyophilization (L and spray drying (SD. In this work, the obtained β-glucan preparations were tested for their microstructure, rheological properties, swelling, water-holding and oil-binding capacities. According to their rheological properties, suspensions containing 1 and 2 % (by mass of spray-dried samples belong to the category of dilatant fluids. Among the spray-dried samples, rheological behaviour and water-holding capacity of the preparation AA-SD differed from those obtained by other two procedures (A-SD and AAM-SD. Concerning different drying methods applied, swelling was the lowest in the lyophilized samples and the most pronounced in the air-dried ones. Oil-binding capacity was the highest in the lyophilized preparations and increased proportionally to the number of processing steps applied in the isolation procedure.
International Nuclear Information System (INIS)
Fernández-Vega, Iván; García, Olivia; Crespo, Ainara; Castañón, Sonia; Menéndez, Primitiva; Astudillo, Aurora; Quirós, Luis M
2013-01-01
The expression of a specific set of genes controls the different structures of heparan sulfate proteoglycans (HSPGs), which are involved in the growth, invasion and metastatic properties of cancerous cells. The purpose of this study is to increase knowledge of HSPG alterations in breast cancer. Twenty-three infiltrating ductal adenocarcinomas (IDCs), both metastatic and non-metastatic were studied. A transcriptomic approach to the structure of heparan sulfate (HS) chains was used, employing qPCR to analyze both the expression of the enzymes involved in their biosynthesis and editing, as well as the proteoglycan core proteins. Since some of these proteoglycans can also carry chondroitin sulfate chains, we extended the study to include the genes involved in the biosynthesis of these glycosaminoglycans. Histochemical techniques were also used to analyze tissular expression of particular genes showing significant expression differences, of potential interest. No significant change in transcription was detected in approximately 70% of analyzed genes. However, 13 demonstrated changes in both tumor types (40% showing more intense deregulation in the metastatic), while 5 genes showed changes only in non-metastatic tumors. Changes were related to 3 core proteins: overexpression of syndecan-1 and underexpression of glypican-3 and perlecan. HS synthesis was affected by lower levels of some 3-O-sulfotransferase transcripts, the expression of NDST4 and, only in non metastatic tumors, higher levels of extracellular sulfatases. Furthermore, the expression of chondroitin sulfate also was considerably affected, involving both the synthesis of the saccharidic chains and sulfations at all locations. However, the pro-metastatic enzyme heparanase did not exhibit significant changes in mRNA expression, although in metastatic tumors it appeared related to increased levels of the most stable form of mRNA. Finally, the expression of heparanase 2, which displays anti-metastatic features
Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang
2015-09-01
Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Energy Technology Data Exchange (ETDEWEB)
Yu, C.-S. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China)]. E-mail: csyu@mx.nthu.edu.tw; Chiang, L.-W. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Wu, C.-H. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Wang, R.-T. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Chen, S.-W. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Wang, H.-Y. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Yeh, C.-H. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China)
2006-04-15
Tumor cells transduced with herpes simplex virus thymidine kinase gene has been intensively applied to the field of positron emission tomography via imaging of its substrate. As a pilot synthesis approach, a facial preparation of 5-[{sup 125}I]iodoarabinosyl uridine starting from commercial available uridine is reported herein. Interestingly, the tin group in 5-trimethylstannyl arabinosyluridine was easily removed during purification. The destannylation through the formation of a six-ligand coordination involving 2'-hydroxyl and tin was thereby proposed.
Boswell, Stacie G; Schnabel, Lauren V; Mohammed, Hussni O; Sundman, Emily A; Minas, Tom; Fortier, Lisa A
2014-01-01
Platelet-rich plasma (PRP) is used for the treatment of tendinopathy. There are numerous PRP preparations, and the optimal combination of platelets and leukocytes is not known. Within leukocyte-reduced PRP (lrPRP), there is a plateau effect of platelet concentration, with increasing platelet concentrations being detrimental to extracellular matrix synthesis. Controlled laboratory study. Different formulations of lrPRP with respect to the platelet:leukocyte ratio were generated from venous blood of 8 horses. Explants of the superficial digital flexor tendon were cultured in lrPRP products for 96 hours. Platelet-derived growth factor-BB (PDGF-BB), tumor necrosis factor-α (TNF-α), transforming growth factor-β1 (TGF-β1), and interleukin-1β (IL-1β) concentrations were determined in the media by enzyme-linked immunosorbent assay. Gene expression in tendon tissue for collagen type I and III (COL1A1 and COL3A1, respectively), matrix metalloproteinase-3 and -13 (MMP-3 and MMP-13, respectively), cartilage oligomeric matrix protein (COMP), and IL-1β was determined. Data were divided into 3 groups of lrPRP based on the ratio of platelets:leukocytes and evaluated to determine the effect of platelet concentration. Complete blood counts verified leukocyte reduction and platelet enrichment in all PRP preparations. In the lrPRP preparation, the anabolic growth factors PDGF-BB and TGF-β1 were increased with increasing platelet concentrations, and the catabolic cytokine IL-1β was decreased with increasing platelet concentrations. Increasing the platelet concentration resulted in a significant reduction in COL1A1 and COL3A1 synthesis in tendons. Increasing the platelet concentration within lrPRP preparations results in the delivery of more anabolic growth factors and less proinflammatory cytokines, but the biological effect on tendons is diminished metabolism as indicated by a decrease in the synthesis of both COL1A1 and COL3A1. Together, this information suggests that
Epithelial GM-CSF induction by Candida glabrata.
Li, L; Dongari-Bagtzoglou, A
2009-08-01
The main cytokine induced by the interaction of oral epithelial cells with C. glabrata is granulocyte monocyte colony-stimulating factor (GM-CSF); however, the mechanisms regulating this response are unknown. Based on previously published information on the interactions of C. albicans with oral epithelial cells, we hypothesized that interaction with viable C. glabrata triggers GM-CSF synthesis via NF-kappaB activation. We found that C. glabrata-induced GM-CSF synthesis was adhesion-dependent, enhanced by endocytosis, and required fungal viability. NF-kappaB activation was noted during interaction of epithelial cells with C. glabrata, and pre-treatment with an NF-kappaB inhibitor partly inhibited GM-CSF synthesis. Blocking TLR4 with anti-TLR4 antibody did not inhibit GM-CSF production. In contrast, an anti-CDw17 antibody triggered significant inhibition of NF-kappaB activation and GM-CSF synthesis. beta-glucans did not stimulate GM-CSF synthesis, suggesting that the CDw17/NF-kappaB/GM-CSF pathway may be beta-glucan-independent. This study provides new insights into the mechanism of GM-CSF induction by C. glabrata.
DEFF Research Database (Denmark)
Kurokawa, Yusuke; Nagai, Keisuke; Hung, Phung Danh
2018-01-01
Floods impede gas (O2and CO2) exchange between plants and the environment. A mechanism to enhance plant gas exchange under water comprises gas films on hydrophobic leaves, but the genetic regulation of this mechanism is unknown. We used a rice mutant (dripping wet leaf 7, drp7) which does...... not retain gas films on leaves, and its wild-type (Kinmaze), in gene discovery for this trait. Gene complementation was tested in transgenic lines. Functional properties of leaves as related to gas film retention and underwater photosynthesis were evaluated. Leaf Gas Film 1 (LGF1) was identified as the gene...... determining leaf gas films. LGF1 regulates C30 primary alcohol synthesis, which is necessary for abundant epicuticular wax platelets, leaf hydrophobicity and gas films on submerged leaves. This trait enhanced underwater photosynthesis 8.2-fold and contributes to submergence tolerance. Gene function...
Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...
A feeding trial was performed to screen three barley genotypes containing different levels of '-glucan for their ability to influence growth, immune function, and disease resistance of rainbow trout. Three experimental diets were prepared by substituting each of three barely genotypes containing dif...
Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas
2013-05-21
Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.
The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan.
Mittal, Nitish; Guimaraes, Joao C; Gross, Thomas; Schmidt, Alexander; Vina-Vilaseca, Arnau; Nedialkova, Danny D; Aeschimann, Florian; Leidel, Sebastian A; Spang, Anne; Zavolan, Mihaela
2017-09-06
In Saccharomyces cerevisiae, deletion of large ribosomal subunit protein-encoding genes increases the replicative lifespan in a Gcn4-dependent manner. However, how Gcn4, a key transcriptional activator of amino acid biosynthesis genes, increases lifespan, is unknown. Here we show that Gcn4 acts as a repressor of protein synthesis. By analyzing the messenger RNA and protein abundance, ribosome occupancy and protein synthesis rate in various yeast strains, we demonstrate that Gcn4 is sufficient to reduce protein synthesis and increase yeast lifespan. Chromatin immunoprecipitation reveals Gcn4 binding not only at genes that are activated, but also at genes, some encoding ribosomal proteins, that are repressed upon Gcn4 overexpression. The promoters of repressed genes contain Rap1 binding motifs. Our data suggest that Gcn4 is a central regulator of protein synthesis under multiple perturbations, including ribosomal protein gene deletions, calorie restriction, and rapamycin treatment, and provide an explanation for its role in longevity and stress response.The transcription factor Gcn4 is known to regulate yeast amino acid synthesis. Here, the authors show that Gcn4 also acts as a repressor of protein biosynthesis in a range of conditions that enhance yeast lifespan, such as ribosomal protein knockout, calorie restriction or mTOR inhibition.
Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K
1995-05-20
In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.
DEFF Research Database (Denmark)
Schachtschabel, Doreen; Arentshorst, Mark; Nitsche, Benjamin M
2013-01-01
The Tup1-Cyc8 (Ssn6) complex is a well characterized and conserved general transcriptional repressor complex in eukaryotic cells. Here, we report the identification of the Tup1 (TupA) homolog in the filamentous fungus Aspergillus niger in a genetic screen for mutants with a constitutive expression...... of the agsA gene. The agsA gene encodes a putative alpha-glucan synthase, which is induced in response to cell wall stress in A. niger. Apart from the constitutive expression of agsA, the selected mutant was also found to produce an unknown pigment at high temperatures. Complementation analysis...
Tsunashima, Hiroyuki; Miyake, Katsuhide; Motono, Makoto; Iijima, Shinji
2012-03-01
The capsular polysaccharide (CPS) of the important oral streptococcus Streptococcus anginosus, which causes endocarditis, and the genes for its synthesis have not been clarified. In this study, we investigated the gene locus required for CPS synthesis in S. anginosus. Southern hybridization using the cpsE gene of the well-characterized bacterium S. agalactiae revealed that there is a similar gene in the genome of S. anginosus. By using the colony hybridization technique and inverse PCR, we isolated the CPS synthesis (cps) genes of S. anginosus. This gene cluster consisted of genes containing typical regulatory genes, cpsA-D, and glycosyltransferase genes coding for glucose, rhamnose, N-acetylgalactosamine, and galactofuranose transferases. Furthermore, we confirmed that the cps locus is required for CPS synthesis using a mutant strain with a defective cpsE gene. The cps cluster was found to be located downstream the nrdG gene, which encodes ribonucleoside triphosphate reductase activator, as is the case in other oral streptococci such as S. gordonii and S. sanguinis. However, the location of the gene cluster was different from those of S. pneumonia and S. agalactiae. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn
2017-01-01
Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans....
DEFF Research Database (Denmark)
Fengquin, X; Nielsen, Henrik; Zhen, W
1993-01-01
between three domains (terminal spacer, transcribed region and central spacer) as defined by restriction enzyme analysis (BamHI and ClaI). It is furthermore shown that a dosage resulting in approximately one cross-link per rDNA molecule (21 kbp, two genes) is sufficient to block RNA synthesis. Finally......, it is shown that the cross-links in the rDNA molecules are repaired at equal rate in all three domains within 24 h and that RNA synthesis is partly restored during this repair period. The majority of the cells also go through one to two cell divisions in this period but do not survive....
Directory of Open Access Journals (Sweden)
Janaína A. Túrmina
2012-12-01
Full Text Available Studies evaluating the toxicity caused by fungal exopolysaccharides of the β-(1®6-D-glucan type are rare. In this study, the toxicological effects of sub-chronic treatments with lasiodiplodan (β-(1®6-D-glucan from Lasiodiplodia theobromae MMPI were evaluated in mice through the assessment of biochemical, hematological, and histopathological alterations. Thirty-two mice (16 male, 16 female were used in this study divided in two groups; one group received lasiodiplodan (50 mg/kg body weight daily for 28 days via gavage, and another (control group received saline during the same period. Blood samples were collected via cardiac puncture for hematological and biochemical analyses. Liver, heart, kidney, and spleen were collected for histopathological analysis. Statistical analysis was performed through one-way analysis of variance and only p < 0.05 F-values were presented. Significant reduction in blood glucose in the male group (35%; p < 0.01, transaminases activity in both sexes (AST and ALT; ~35%; p < 0.05, and urea (20%; p < 0.01 in the female group was observed with the lasiodiplodan treatment. The results showed that sub-chronic treatments with lasiodiplodan did not generate hematological and histopathological alterations leading to signs of toxicity in healthy mice, independent of gender.
Energy Technology Data Exchange (ETDEWEB)
Przekora, Agata, E-mail: agata.przekora@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodzki 1, 20-093 Lublin (Poland); Palka, Krzysztof [Department of Materials Engineering, Lublin University of Technology, Nadbystrzycka 36, 20-618 Lublin (Poland); Ginalska, Grazyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodzki 1, 20-093 Lublin (Poland)
2016-01-01
The aim of this work was to compare biomedical potential of chitosan/hydroxyapatite (chit/HA) and novel chitosan/β-1,3-glucan/hydroxyapatite (chit/glu/HA) materials as scaffolds for bone regeneration via characterization of their biocompatibility, porosity, mechanical properties, and water uptake behaviour. Biocompatibility of the scaffolds was assessed in direct-contact with the materials using normal human foetal osteoblast cell line. Cytotoxicity and osteoblast proliferation rate were evaluated. Porosity was assessed using computed microtomography analysis and mechanical properties were determined by compression testing. Obtained results demonstrated that chit/HA scaffold possessed significantly better mechanical properties (compressive strength: 1.23 MPa, Young's modulus: 0.46 MPa) than chit/glu/HA material (compressive strength: 0.26 MPa, Young's modulus: 0.25 MPa). However, addition of bacterial β-1,3-glucan to the chit/HA scaffold improved its flexibility and porosity. Moreover, chit/glu/HA scaffold revealed significantly higher water uptake capability (52.6% after 24 h of soaking) compared to the chit/HA (30.7%) and thus can serve as a very good drug delivery carrier. Chit/glu/HA scaffold was also more favourable to osteoblast survival (near 100% viability after 24-h culture), proliferation, and spreading compared to the chit/HA (63% viability). The chit/glu/HA possesses better biomedical potential than chit/HA scaffold. Nevertheless, poor mechanical properties of the chit/glu/HA limit its application to non-load bearing implantation area. - Highlights: • Chitosan/HA and chit/β-1,3-glucan/HA scaffolds for bone regeneration were compared. • Chit/HA significantly reduced osteoblast viability to 63% compared to chit/glu/HA. • Unlike chit/HA, chit/glu/HA favoured cell adhesion, spreading, and proliferation. • Chit/HA had better compressive strength and Young's modulus than chit/glu/HA. • Chit/glu/HA revealed significantly higher
Shi, Limin; Lin, Qinlu; Yang, Tao; Nie, Ying; Li, Xinhua; Liu, Bo; Shen, Junjun; Liang, Ying; Tang, Yiping; Luo, Feijun
2016-11-09
To evaluate the anti-inflammatory effect of β-glucans from Lentinus edodes, and its molecular mechanism, the dextran sulfate sodium salt (DSS) induced colitis model of mice and the LPS-stimulated RAW264.7 cell inflammation model were used in this study. 40 ICR male mice were randomly divided into 4 groups: Control, DSS (DSS treated only), DSS + low-βGs (500 mg kg -1 d -1 ) and DSS + high-βGs (1000 mg kg -1 d -1 ). The body weight of the mice with Lentinus edodes β-glucan supplementation increased significantly compared to the DSS group and the disease activity index (DAI) was improved in both βG-treated groups. Compared with the DSS group, histopathological analysis showed that the infiltration of inflammatory cells of both βG-treated groups decreased significantly in colonic tissues. Furthermore, oral administration of β-glucans decreases the concentration of malondialdehyde (MDA) and myeloperoxidase (MPO) and inhibits the expression of iNOS and several inflammatory factors: TNF-α, IL-1β and IL-6 as well as nitric oxide (NO) of the colonic tissues. The mitogen-activated protein kinase (MAPK) pathway is closely related to the expression of pro-inflammatory factors. In the DSS-induced colitis model and the LPS-stimulated RAW264.7 cell model, βGs inhibited the expression of pro-inflammatory factors and blocked the phosphorylation of JNK/ERK1/2 and p38; βGs also suppress the phosphorylation of Elk-1 at Ser84 and the phosphorylation of PPARγ at Ser112. Altogether, these results suggest that Lentinus edodes βGs could inhibit the DSS-induced ulcerative colitis and decrease inflammatory factor expressions. The molecular mechanism may be involved in suppressing MAPK signaling and inactivation of Elk-1 and activation of PPARγ.
Zhang, Jianxia; He, Chunmei; Wu, Kunlin; Teixeira da Silva, Jaime A.; Zeng, Songjun; Zhang, Xinhua; Yu, Zhenming; Xia, Haoqiang; Duan, Jun
2016-01-01
Dendrobium officinale is one of the most important Chinese medicinal herbs. Polysaccharides are one of the main active ingredients of D. officinale. To identify the genes that maybe related to polysaccharides synthesis, two cDNA libraries were prepared from juvenile and adult D. officinale, and were named Dendrobium-1 and Dendrobium-2, respectively. Illumina sequencing for Dendrobium-1 generated 102 million high quality reads that were assembled into 93,881 unigenes with an average sequence length of 790 base pairs. The sequencing for Dendrobium-2 generated 86 million reads that were assembled into 114,098 unigenes with an average sequence length of 695 base pairs. Two transcriptome databases were integrated and assembled into a total of 145,791 unigenes. Among them, 17,281 unigenes were assigned to 126 KEGG pathways while 135 unigenes were involved in fructose and mannose metabolism. Gene Ontology analysis revealed that the majority of genes were associated with metabolic and cellular processes. Furthermore, 430 glycosyltransferase and 89 cellulose synthase genes were identified. Comparative analysis of both transcriptome databases revealed a total of 32,794 differential expression genes (DEGs), including 22,051 up-regulated and 10,743 down-regulated genes in Dendrobium-2 compared to Dendrobium-1. Furthermore, a total of 1142 and 7918 unigenes showed unique expression in Dendrobium-1 and Dendrobium-2, respectively. These DEGs were mainly correlated with metabolic pathways and the biosynthesis of secondary metabolites. In addition, 170 DEGs belonged to glycosyltransferase genes, 37 DEGs were related to cellulose synthase genes and 627 DEGs encoded transcription factors. This study substantially expands the transcriptome information for D. officinale and provides valuable clues for identifying candidate genes involved in polysaccharide biosynthesis and elucidating the mechanism of polysaccharide biosynthesis. PMID:26904032
Live imaging of β-1,3-glucan synthase FKS-1 in Neurospora crassa hyphae.
Sánchez-León, Eddy; Riquelme, Meritxell
2015-09-01
The subcellular localization and dynamics of FKS-1, the putative catalytic subunit of the β-1,3-glucan synthase complex, was analyzed in growing hyphae of Neurospora crassa by live confocal microscopy. GFP-tagged FKS-1 accumulated at the outer layer of the Spitzenkörper (Spk), and at the apical plasma membrane (PM). Fluorescence recovery after photobleaching analysis revealed arrival of FKS-1-containing carriers first at the immediate surroundings of the core region of the Spk, and thereafter to the Spk most outer region. The results obtained here and previous data suggest that FKS-1 is transported to the Spk in macrovesicles. Copyright © 2015 Elsevier Inc. All rights reserved.
Prospective Evaluation of Serum β-Glucan Testing in Patients With Probable or Proven Fungal Diseases
Angebault, Cécile; Lanternier, Fanny; Dalle, Frédéric; Schrimpf, Cécile; Roupie, Anne-Laure; Dupuis, Aurélie; Agathine, Aurélie; Scemla, Anne; Paubelle, Etienne; Caillot, Denis; Neven, Bénédicte; Frange, Pierre; Suarez, Felipe; d'Enfert, Christophe; Lortholary, Olivier; Bougnoux, Marie-Elisabeth
2016-01-01
Background. Early diagnosis and treatment are crucial in invasive fungal diseases (IFD). Serum (1-3)-β-d-glucan (BG) is believed to be an early IFD marker, but its diagnostic performance has been ambiguous, with insufficient data regarding sensitivity at the time of IFD diagnosis (TOD) and according to outcome. Whether its clinical utility is equivalent for all types of IFD remains unknown. Methods. We included 143 patients with proven or probable IFD (49 invasive candidiasis, 45 invasive aspergillosis [IA], and 49 rare IFD) and analyzed serum BG (Fungitell) at TOD and during treatment. Results. (1-3)-β-d-glucan was undetectable at TOD in 36% and 48% of patients with candidemia and IA, respectively; there was no correlation between negative BG results at TOD and patients' characteristics, localization of infection, or prior antifungal use. Nevertheless, patients with candidemia due to Candida albicans were more likely to test positive for BG at TOD (odds ratio = 25.4, P = .01) than patients infected with other Candida species. In 70% of the patients with a follow-up, BG negativation occurred in >1 month for candidemia and >3 months for IA. A slower BG decrease in patients with candidemia was associated with deep-seated localizations (P = .04). Thirty-nine percent of patients with rare IFD had undetectable BG at TOD; nonetheless, all patients with chronic subcutaneous IFD tested positive at TOD. Conclusions. Undetectable serum BG does not rule out an early IFD, when the clinical suspicion is high. After IFD diagnostic, kinetics of serum BG are difficult to relate to clinical outcome. PMID:27419189
Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish
2017-10-01
We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.
Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.
Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K
2014-02-01
Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Hualin Wang
2018-04-01
Full Text Available The present study aims to investigate the protective effects of ω-3 polyunsaturated fatty acids (ω-3PUFAs against high-fat diet induced male mouse reproductive dysfunction and to explore circadian regulation mechanisms. Male C57BL/6 mice were randomly divided into three groups and fed a normal chow diet (control group, CON, a high-fat diet (HFD group or a HFD supplemented with fish oil (FO group for 12 weeks. After 12 weeks of feeding, the body weight and the ratio of perinephric and epididymal fat weight to body weight were significantly higher in the HFD group compared with the CON group. The supplement of fish oil rich in ω-3PUFAs only slightly reduced the HFD-induced obesity but remarkably ameliorated HFD-induced dyslipidemia, sexual hormones disorder, testicle lesions and germ cell apoptosis. Fish oil supplementation restored the expression of steroid synthesis associated genes in HFD fed mouse and flattened the HFD-induced oscillations in circadian genes’ expression. Fish oil supplementation prevented HFD-induced male mouse reproductive dysfunction and modified the rhythmic expression of testosterone synthesis related genes.
Xu, Linxiang; Cheng, Rui; Li, Jing; Wang, Yang; Zhu, Bin; Ma, Shihong; Zhang, Weiming; Dong, Wei; Wang, Shiming; Zhang, Jianfa
2017-01-01
Salecan, a soluble β-1,3-D-glucan produced by a salt-tolerant strain Agrobacterium sp. ZX09, has been the subject of considerable interest in recent years because of its multiple bioactivities and unusual rheological properties in solution. In this study, both succinyl and pyruvyl substituent groups on salecan were identified by an enzymatic hydrolysis following nuclear magnetic resonance (NMR), HPLC, and MS analysis. The putative succinyltransferase gene (sleA) and pyruvyltransferase gene (sleV) were determined and cloned. Disruption of the sleA gene resulted in the absence of succinyl substituent groups on salecan. This defect could be complemented by expressing the sleA cloned in a plasmid. Thus, the sleA and sleV genes located in a 19.6-kb gene cluster may be involved in salecan biosynthesis. Despite the lack of succinyl substituents, the molecular mass of salecan generated by the sleA mutant did not substantially differ from that generated by the wild-type strain. Loss of succinyl substituents on salecan changed its rheological characteristics, especially a decrease in intrinsic viscosity.
Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof
2013-12-01
The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0
Li, Lian; Wu, Jie; Luo, Man; Sun, Yu; Wang, Genlin
2016-05-01
Summer heat stress (HS) is a major contributing factor in low fertility in lactating dairy cows in hot environments. Heat stress inhibits ovarian follicular development leading to diminished reproductive efficiency of dairy cows during summer. Ovarian follicle development is a complex process. During follicle development, granulosa cells (GCs) replicate, secrete hormones, and support the growth of the oocyte. To obtain an overview of the effects of heat stress on GCs, digital gene expression profiling was employed to screen and identify differentially expressed genes (DEGs; false discovery rate (FDR) ≤ 0.001, fold change ≥2) of cultured GCs during heat stress. A total of 1211 DEGs including 175 upregulated and 1036 downregulated ones were identified, of which DEGs can be classified into Gene Ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The results suggested that heat stress triggers a dramatic and complex program of altered gene expression in GCs. We hypothesized that heat stress could induce the apoptosis and dysfunction of GCs. Real-time reverse transcription-polymerase chain reaction (RT-PCR) was used to evaluate the expression of steroidogenic genes (steroidogenic acute regulatory protein (Star), cytochrome P-450 (CYP11A1), CYP19A1, and steroidogenic factor 1 (SF-1)) and apoptosis-related genes (caspase-3, BCL-2, and BAX). Radio immunoassay (RIA) was used to analyze the level of 17β-estradiol (E2) and progesterone (P4). We also assessed the apoptosis of GCs by flow cytometry. Our data suggested that heat stress induced GC apoptosis through the BAX/BCL-2 pathway and reduced the steroidogenic gene messenger RNA (mRNA) expression and E2 synthesis. These results suggest that the decreased function of GCs may cause ovarian dysfunction and offer an improved understanding of the molecular mechanism responsible for the low fertility in cattle in summer.
Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga
2012-01-01
The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard
Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch
2015-01-01
Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.
International Nuclear Information System (INIS)
Lacerda, Camila Maria de Sousa
2016-01-01
Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with "3"2P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with "9"9"mTc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A "9"9"mTc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with "9"9"mTc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the "9"9"mTc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the target
Directory of Open Access Journals (Sweden)
Roberta M. de SÁ
2000-04-01
Full Text Available Com o crescente interesse em alimentos funcionais e nutracêuticos, a aveia (Avena sativa L. tem se destacado, devido ao seu teor de fibras alimentares e principalmente às beta-glucanas. As (1,3(1,4-beta-D-glucanas, fibras alimentares na maioria solúveis, atuam na redução do colesterol em indivíduos com hipercolesterolemia. Existem estudos para determinar as causas de variação do teor desta fibra em aveia, porém, pouco se sabe sobre a aveia cultivada no Brasil. O objetivo deste trabalho foi verificar se existem diferenças no conteúdo de beta-glucanas entre cultivares brasileiros e se há variação na porcentagem desta fibra devido ao ano de cultivo. Os cultivares IAC7, UFRGS14, UPF16 e UPF17 (3 amostras de cada, e ainda três amostras do cultivar IAC7 para cada ano de cultivo (97 e 98, foram analisados segundo os métodos da AACC (American Association of Cereal Chemists. Os teores médios (peso seco de beta-glucanas foram 6,50% (IAC7, 4,30% (UFRGS14, 3,51% (UPF16 e 3,78% (UPF17, com erro padrão de ±0,084 e coeficiente de variação de 7,89 %. Observou-se efeito significativo dos cultivares (p=0,03 e grande variabilidade entre as amostras (p=0,0001. O cultivar IAC7 apresentou média de beta-glucanas de 5,11% em 97 e 6,50 % em 98 (erro padrão ±0,14; CV=10,53% e observou-se efeito significativo do ano de cultivo.With the increasing interest in functional foods and nutraceuticals, oats (Avena sativa L. have received special attention because of their dietary fiber contents, and specially of their beta-glucans. The mostly soluble dietary fibers (1,3(1,4-beta-D-glucans, reduce serum cholesterol in individuals with hypercholesterolemia. There are studies about the causes of variation in the contents of this fiber in oats, however, very little is known about Brazilian cultivars. The objective of this work was to verify if there were differences in the beta-glucan contents among brazilian cultivars and if there was variation in the
Rodrigues, Célia F; Gonçalves, Bruna; Rodrigues, Maria Elisa; Silva, Sónia; Azeredo, Joana; Henriques, Mariana
2017-08-01
Candida glabrata is one of most prevalent yeast in fungal infections, especially in immunocompromised patients. Its azole resistance results in a low therapeutic response, particularly when associated with biofilms. The main goal of this work was to study the effectiveness of voriconazole (Vcz) against C. glabrata biofilms oral pathologies, as esophageal or oropharyngeal candidiasis. Antifungal susceptibilities were determined in pre-formed 24-h-biofilms and ERG genes expression was determined by qRT-PCR. Protein quantification was performed using BCA ® Kit, carbohydrate was estimated according to the Dubois assay and β-1,3 glucans concentration were determined using Glucatell ® kit. Finally, ergosterol, Vcz, and fluconazole (Flu) concentrations within the biofilm matrices were determined by RP-HPLC. Results showed that C. glabrata biofilms were more susceptible to Vcz than to Flu and that ERG genes expression evidenced an overexpression of the three ERG genes in the presence of both azoles. The matrix content presented a remarked decrease in proteins and an increase in carbohydrates, namely β-1,3 glucans. Ergosterol was successfully detected and quantified in the biofilm matrices, with no differences in all the considered conditions. Vcz demonstrated better diffusion through the biofilms and better cell penetration capacities, than Flu, indicating that the structure of the drug molecule fully influences its dissemination through the biofilm matrices. This work showed that Vcz is notably more effective than Flu for the treatment of resistant C. glabrata oral biofilms, which demonstrates a clinical relevance in its future use for the treatment of oropharyngeal/esophageal candidiasis caused by this species.
B-Glucan exacerbates allergic asthma independent of fungal ...
BackgroundAllergic sensitization to fungi has been associated with asthma severity. As a result, it has been largely assumed that the contribution of fungi to allergic disease is mediated through their potent antigenicity.ObjectiveWe sought to determine the mechanism by which fungi affect asthma development and severity.MethodsWe integrated epidemiologic and experimental asthma models to explore the effect of fungal exposure on asthma development and severity.ResultsWe report that fungal exposure enhances allergen-driven TH2 responses, promoting severe allergic asthma. This effect is independent of fungal sensitization and can be reconstituted with β-glucan and abrogated by neutralization of IL-17A. Furthermore, this severe asthma is resistant to steroids and characterized by mixed TH2 and TH17 responses, including IL-13+IL-17+CD4+ double-producing effector T cells. Steroid resistance is dependent on fungus-induced TH17 responses because steroid sensitivity was restored in IL-17rc−/− mice. Similarly, in children with asthma, fungal exposure was associated with increased serum IL-17A levels and asthma severity.ConclusionOur data demonstrate that fungi are potent immunomodulators and have powerful effects on asthma independent of their potential to act as antigens. Furthermore, our results provide a strong rationale for combination treatment strategies targeting IL-17A for this subgroup of fungus-exposed patients with difficult-to-treat asthma. To describe th
Zhao, Feng; Meng, Songsong; Zhou, Deqing
2016-02-04
To construct heptyl glycosyltransferase gene II (waaF) gene deletion mutant of Vibrio parahaemolyticus, and explore the function of the waaF gene in Vibrio parahaemolyticus. The waaF gene deletion mutant was constructed by chitin-based transformation technology using clinical isolates, and then the growth rate, morphology and serotypes were identified. The different sources (O3, O5 and O10) waaF gene complementations were constructed through E. coli S17λpir strains conjugative transferring with Vibrio parahaemolyticus, and the function of the waaF gene was further verified by serotypes. The waaF gene deletion mutant strain was successfully constructed and it grew normally. The growth rate and morphology of mutant were similar with the wild type strains (WT), but the mutant could not occurred agglutination reaction with O antisera. The O3 and O5 sources waaF gene complementations occurred agglutination reaction with O antisera, but the O10 sources waaF gene complementations was not. The waaF gene was related with O-antigen synthesis and it was the key gene of O-antigen synthesis pathway in Vibrio parahaemolyticus. The function of different sources waaF gene were not the same.
Genes and Gut Bacteria Involved in Luminal Butyrate Reduction Caused by Diet and Loperamide.
Hwang, Nakwon; Eom, Taekil; Gupta, Sachin K; Jeong, Seong-Yeop; Jeong, Do-Youn; Kim, Yong Sung; Lee, Ji-Hoon; Sadowsky, Michael J; Unno, Tatsuya
2017-11-28
Unbalanced dietary habits and gut dysmotility are causative factors in metabolic and functional gut disorders, including obesity, diabetes, and constipation. Reduction in luminal butyrate synthesis is known to be associated with gut dysbioses, and studies have suggested that restoring butyrate formation in the colon may improve gut health. In contrast, shifts in different types of gut microbiota may inhibit luminal butyrate synthesis, requiring different treatments to restore colonic bacterial butyrate synthesis. We investigated the influence of high-fat diets (HFD) and low-fiber diets (LFD), and loperamide (LPM) administration, on key bacteria and genes involved in reduction of butyrate synthesis in mice. MiSeq-based microbiota analysis and HiSeq-based differential gene analysis indicated that different types of bacteria and genes were involved in butyrate metabolism in each treatment. Dietary modulation depleted butyrate kinase and phosphate butyryl transferase by decreasing members of the Bacteroidales and Parabacteroides . The HFD also depleted genes involved in succinate synthesis by decreasing Lactobacillus . The LFD and LPM treatments depleted genes involved in crotonoyl-CoA synthesis by decreasing Roseburia and Oscilllibacter . Taken together, our results suggest that different types of bacteria and genes were involved in gut dysbiosis, and that selected treatments may be needed depending on the cause of gut dysfunction.
Smant, Geert; Stokkermans, Jack P. W. G.; Yan, Yitang; de Boer, Jan M.; Baum, Thomas J.; Wang, Xiaohong; Hussey, Richard S.; Gommers, Fred J.; Henrissat, Bernard; Davis, Eric L.; Helder, Johannes; Schots, Arjen; Bakker, Jaap
1998-01-01
β-1,4-Endoglucanases (EGases, EC 3.2.1.4) degrade polysaccharides possessing β-1,4-glucan backbones such as cellulose and xyloglucan and have been found among extremely variegated taxonomic groups. Although many animal species depend on cellulose as their main energy source, most omnivores and herbivores are unable to produce EGases endogenously. So far, all previously identified EGase genes involved in the digestive system of animals originate from symbiotic microorganisms. Here we report on the synthesis of EGases in the esophageal glands of the cyst nematodes Globodera rostochiensis and Heterodera glycines. From each of the nematode species, two cDNAs were characterized and hydrophobic cluster analysis revealed that the four catalytic domains belong to family 5 of the glycosyl hydrolases (EC 3.2.1, 3.2.2, and 3.2.3). These domains show 37–44% overall amino acid identity with EGases from the bacteria Erwinia chrysanthemi, Clostridium acetobutylicum, and Bacillus subtilis. One EGase with a bacterial type of cellulose-binding domain was identified for each nematode species. The leucine-rich hydrophobic core of the signal peptide and the presence of a polyadenylated 3′ end precluded the EGases from being of bacterial origin. Cyst nematodes are obligatory plant parasites and the identified EGases presumably facilitate the intracellular migration through plant roots by partial cell wall degradation. PMID:9560201
Association Mapping of Cell Wall Synthesis Regulatory Genes and Cell Wall Quality in Switchgrass
Energy Technology Data Exchange (ETDEWEB)
Bartley, Laura [Univ. of Oklahoma, Norman, OK (United States). Dept. of Microbiology and Plant Biology; Wu, Y. [Oklahoma State Univ., Stillwater, OK (United States); Zhu, L. [Oklahoma State Univ., Stillwater, OK (United States); Brummer, E. C. [Noble Foundation, Ardmore, OK (United States); Saha, M. [Noble Foundation, Ardmore, OK (United States)
2016-05-31
markers might be used to select switchgrass genotypes with improved composition in breeding programs for biofuel and forage production. Because the SSAC continues to be characterized by collaborators in the bioenergy community, the data generated will be used to identify additional markers in higher resolution genotyping data to approach identifying the genes and alleles that cause natural variation in switchgrass cell wall quality. For example, these markers can be surveyed in the 2100-member Oklahoma Southern and Northern Lowland switchgrass collections that this project also characterized. An orthogonal approach to biodiversity studies, using comparative functional genomics permits systematic querying of how much regulatory information is likely to be transferable from dicots to grasses and use of accumulated functional genomics resources for better-characterized grass species, such as rice, itself a biomass source in global agriculture and in certain regions. The project generated and tested a number of specific hypotheses regarding cell wall transcription factors and enzymes of grasses. To aid identification of cell wall regulators, the project assembled a novel, highdepth and -quality gene association network using a general linearized model scoring system to combine rice gene network data. Using known or putative orthologs of Arabidopsis cell wall biosynthesis genes and regulators, the project pulled from this network a cell wall sub-network that includes 96 transcription factors. Reverse genetics of a co-ortholog of the Arabidopsis MYB61 transcription factor in rice revealed that this regulatory node has evolved the ability to regulate grass-specific cell wall synthesis enzymes. A transcription factor with such activity has not been previously characterized to our knowledge, representing a major conclusion of this work. Changes in gene expression in a protoplast-based assay demonstrated positive or negative roles in cell wall regulation for eleven other
Sanders, Matthew; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John
2002-11-01
Post-transcriptional gene silencing (PTGS) is characterized by the accumulation of short interfering RNAs that are proposed to mediate sequence-specific degradation of cognate and secondary target mRNAs. In plants, it is unclear to what extent endogenous genes contribute to this process. Here, we address the role of the endogenous target genes in transgene-mediated PTGS of beta-1,3-glucanases in tobacco. We found that mRNA sequences of the endogenous glucanase glb gene with varying degrees of homology to the Nicotiana plumbaginifolia gn1 transgene are targeted by the silencing machinery, although less efficiently than corresponding transgene regions. Importantly, we show that endogene-specific nucleotides in the glb sequence provide specificity to the silencing process. Consistent with this finding, small sense and antisense 21- to 23-nucleotide RNAs homologous to the endogenous glb gene were detected. Combined, these data demonstrate that a co-suppressed endogenous glucan ase gene is involved in signal amplification and selection of homologous targets, and show that endogenous genes can actively participate in PTGS in plants. The findings are introduced as a further sophistication of the post-transciptional silencing model.
Bilandžija, Helena; Ma, Li; Parkhurst, Amy; Jeffery, William R
2013-01-01
Albinism, the loss of melanin pigmentation, has evolved in a diverse variety of cave animals but the responsible evolutionary mechanisms are unknown. In Astyanax mexicanus, which has a pigmented surface dwelling form (surface fish) and several albino cave-dwelling forms (cavefish), albinism is caused by loss of function mutations in the oca2 gene, which operates during the first step of the melanin synthesis pathway. In addition to albinism, cavefish have evolved differences in behavior, including feeding and sleep, which are under the control of the catecholamine system. The catecholamine and melanin synthesis pathways diverge after beginning with the same substrate, L-tyrosine. Here we describe a novel relationship between the catecholamine and melanin synthesis pathways in Astyanax. Our results show significant increases in L-tyrosine, dopamine, and norepinephrine in pre-feeding larvae and adult brains of Pachón cavefish relative to surface fish. In addition, norepinephrine is elevated in cavefish adult kidneys, which contain the teleost homologs of catecholamine synthesizing adrenal cells. We further show that the oca2 gene is expressed during surface fish development but is downregulated in cavefish embryos. A key finding is that knockdown of oca2 expression in surface fish embryos delays the development of pigmented melanophores and simultaneously increases L-tyrosine and dopamine. We conclude that a potential evolutionary benefit of albinism in Astyanax cavefish may be to provide surplus L-tyrosine as a precursor for the elevated catecholamine synthesis pathway, which could be important for adaptation to the challenging cave environment.
Directory of Open Access Journals (Sweden)
Helena Bilandžija
Full Text Available Albinism, the loss of melanin pigmentation, has evolved in a diverse variety of cave animals but the responsible evolutionary mechanisms are unknown. In Astyanax mexicanus, which has a pigmented surface dwelling form (surface fish and several albino cave-dwelling forms (cavefish, albinism is caused by loss of function mutations in the oca2 gene, which operates during the first step of the melanin synthesis pathway. In addition to albinism, cavefish have evolved differences in behavior, including feeding and sleep, which are under the control of the catecholamine system. The catecholamine and melanin synthesis pathways diverge after beginning with the same substrate, L-tyrosine. Here we describe a novel relationship between the catecholamine and melanin synthesis pathways in Astyanax. Our results show significant increases in L-tyrosine, dopamine, and norepinephrine in pre-feeding larvae and adult brains of Pachón cavefish relative to surface fish. In addition, norepinephrine is elevated in cavefish adult kidneys, which contain the teleost homologs of catecholamine synthesizing adrenal cells. We further show that the oca2 gene is expressed during surface fish development but is downregulated in cavefish embryos. A key finding is that knockdown of oca2 expression in surface fish embryos delays the development of pigmented melanophores and simultaneously increases L-tyrosine and dopamine. We conclude that a potential evolutionary benefit of albinism in Astyanax cavefish may be to provide surplus L-tyrosine as a precursor for the elevated catecholamine synthesis pathway, which could be important for adaptation to the challenging cave environment.
International Nuclear Information System (INIS)
Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.
1983-01-01
We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully
Evolution of saxitoxin synthesis in cyanobacteria and dinoflagellates.
Hackett, Jeremiah D; Wisecaver, Jennifer H; Brosnahan, Michael L; Kulis, David M; Anderson, Donald M; Bhattacharya, Debashish; Plumley, F Gerald; Erdner, Deana L
2013-01-01
Dinoflagellates produce a variety of toxic secondary metabolites that have a significant impact on marine ecosystems and fisheries. Saxitoxin (STX), the cause of paralytic shellfish poisoning, is produced by three marine dinoflagellate genera and is also made by some freshwater cyanobacteria. Genes involved in STX synthesis have been identified in cyanobacteria but are yet to be reported in the massive genomes of dinoflagellates. We have assembled comprehensive transcriptome data sets for several STX-producing dinoflagellates and a related non-toxic species and have identified 265 putative homologs of 13 cyanobacterial STX synthesis genes, including all of the genes directly involved in toxin synthesis. Putative homologs of four proteins group closely in phylogenies with cyanobacteria and are likely the functional homologs of sxtA, sxtG, and sxtB in dinoflagellates. However, the phylogenies do not support the transfer of these genes directly between toxic cyanobacteria and dinoflagellates. SxtA is split into two proteins in the dinoflagellates corresponding to the N-terminal portion containing the methyltransferase and acyl carrier protein domains and a C-terminal portion with the aminotransferase domain. Homologs of sxtB and N-terminal sxtA are present in non-toxic strains, suggesting their functions may not be limited to saxitoxin production. Only homologs of the C-terminus of sxtA and sxtG were found exclusively in toxic strains. A more thorough survey of STX+ dinoflagellates will be needed to determine if these two genes may be specific to SXT production in dinoflagellates. The A. tamarense transcriptome does not contain homologs for the remaining STX genes. Nevertheless, we identified candidate genes with similar predicted biochemical activities that account for the missing functions. These results suggest that the STX synthesis pathway was likely assembled independently in the distantly related cyanobacteria and dinoflagellates, although using some
DEFF Research Database (Denmark)
Yücel, Cigdem; Sotres, Javier; Rascón, Ana
2017-01-01
HYPOTHESIS: Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. EXPERIMENT: Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic...... force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured...
Amylomaltase of Pyrobaculum aerophilum IM2 produces thermoreversible starch gels
Kaper, T.; Talik, B.; Ettema, T.J.; Bos, H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2005-01-01
Amylomaltases are 4-α-glucanotransferases (EC 2.4.1.25) of glycoside hydrolase family 77 that transfer α-1,4-linked glucans to another acceptor, which can be the 4-OH group of an α-1,4-linked glucan or glucose. The amylomaltase-encoding gene (PAE1209) from the hyperthermophilic archaeon Pyrobaculum
Sun, Qi; Li, Minghui; Yang, Xiao; Xu, Xi; Wang, Junsong; Zhang, Jianfa
2017-09-01
Previous studies suggest that dietary salecan (a water-soluble β-glucan) effectively reduces high-fat-diet-induced adiposity through disturbing bile-acid-promoted emulsification in mice. However, the effects of salecan on metabolic genes and metabolites involved in lipid accumulation are mostly unknown. Here, we confirmed that dietary 3% and 6% salecan for 4 weeks markedly decreased fat accumulation in liver and adipose tissue in high-fat-diet rats, displaying a decrease in mRNA levels of SREBP1-C, FAS, SCD1 and ACC1 involved in de novo lipogenesis and a reduction of levels of GPAT1, DGAT1 and DGAT2 related to triglyceride synthesis. Dietary salecan also increased the mRNA levels of PPARα and CYP7A1, which are related to fatty acid oxidation and cholesterol decomposition, respectively. In the 1 H nuclear magnetic resonance metabolomic analysis, both the serum and liver metabolite profiles differed among the control groups, and the metabolic profiles of the salecan groups were shifted toward that of the low-fat-diet group. Metabolites analysis showed that salecan significantly increased hepatic glutathione and betaine levels which are related to regulation of cellular reactive oxygen species. These data demonstrate that dietary salecan not only disturbed fat digestion and absorption but also influenced lipid accumulation and metabolism in diet-induced obesity. Copyright © 2017 Elsevier Inc. All rights reserved.
Bastien, C.; Machlin, S.; Zhang, Y.; Donaldson, K.; Hanson, R. S.
1989-01-01
Restriction maps of genes required for the synthesis of active methanol dehydrogenase in Methylobacterium organophilum XX and Methylobacterium sp. strain AM1 have been completed and compared. In these two species of pink-pigmented, type II methylotrophs, 15 genes were identified that were required for the expression of methanol dehydrogenase activity. None of these genes were required for the synthesis of the prosthetic group of methanol dehydrogenase, pyrroloquinoline quinone. The structural gene required for the synthesis of cytochrome cL, an electron acceptor uniquely required for methanol dehydrogenase, and the genes encoding small basic peptides that copurified with methanol dehydrogenases were closely linked to the methanol dehydrogenase structural genes. A cloned 22-kilobase DNA insert from Methylsporovibrio methanica 81Z, an obligate type II methanotroph, complemented mutants that contained lesions in four genes closely linked to the methanol dehydrogenase structural genes. The methanol dehydrogenase and cytochrome cL structural genes were found to be transcribed independently in M. organophilum XX. Only two of the genes required for methanol dehydrogenase synthesis in this bacterium were found to be cotranscribed. PMID:16348074
Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07.
Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting
2016-02-25
Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis.
Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance
2009-04-21
To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease
Gene Composer: database software for protein construct design, codon engineering, and gene synthesis
Directory of Open Access Journals (Sweden)
Mixon Mark
2009-04-01
Full Text Available Abstract Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene
Kitagaki, Hiroshi; Wu, Hong; Shimoi, Hitoshi; Ito, Kiyoshi
2002-11-01
The cell wall of Saccharomyces cerevisiae consists of glucan, chitin and various kinds of mannoproteins. Major parts of mannoproteins are synthesized as glycosylphosphatidylinositol (GPI)-anchored proteins and are then transferred to cell wall beta-1,6-glucan. A glycosyltransferase has been hypothesized to catalyse this transfer reaction. A database search revealed that the products of YKL046c and DFG5 are homologous to bacterial mannosidase. These genes are homologous to each other and have primary structures characteristic of GPI-anchored proteins. Although single disruptants of ykl046c and dfg5 were viable, ykl046cDelta was hypersensitive to a cell wall-digesting enzyme (zymolyase), suggesting that this gene is involved in cell wall biosynthesis. We therefore designated this gene as DCW1 (defective cell wall). A double disruptant of dcw1 and dfg5 was synthetically lethal, indicating that the functions of these gene products are redundant, and at least one of them is required for cell growth. Cells deficient in both Dcw1p and Dfg5p were round and large, had cell walls that contained an increased amount of chitin and secreted a major cell wall protein, Cwp1p, into the medium. Biochemical analyses showed that epitope-tagged Dcw1p is an N-glycosylated, GPI-anchored membrane protein and is localized in the membrane fraction including the cell surface. These results suggest that both Dcw1p and Dfg5p are GPI-anchored membrane proteins and are required for normal biosynthesis of the cell wall.
DEFF Research Database (Denmark)
Khakimov, Bekzod; Rasmussen, Morten Arendt; Kannangara, Rubini Maya
2017-01-01
for ideal vegetable protein production and for augmented β-glucan production. Seeds from three barley lines (Bomi, lys3.a and lys5.f) were sampled eight times during grain filling and analysed for metabolites using gas chromatography-mass spectrometry (GC-MS). The lys3.a mutation disrupts a regulator gene...... their successful application to link genetic and environmental factors with the seed phenotype of unique and agro-economically important barley models for optimal vegetable protein and dietary fibre production......., causing an increase in proteins rich in the essential amino acid lysine, while lys5.f carries a mutation in an ADP-glucose transporter gene leading to a significant increase in production of mixed-linkage β-glucan at the expense of α-glucan. Unique metabolic patterns associated with the tricarboxylic acid...
Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried
2015-01-01
A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis. PMID:26355961
Czech Academy of Sciences Publication Activity Database
Cseh, A.; Kruppa, K.; Molnár, I.; Rakszegi, M.; Doležel, Jaroslav; Molnár-Láng, M.
2011-01-01
Roč. 54, č. 10 (2011), s. 795-804 ISSN 0831-2796 Institutional research plan: CEZ:AV0Z50380511 Keywords : wheat–barley chromosome translocation * β-d-glucan * centromere Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.653, year: 2011
Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C
2017-01-01
Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.
Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C
2010-01-01
Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.
International Nuclear Information System (INIS)
Kusano, Tomonobu; Ji, Guangyong; Silver, S.; Inoue, Chihiro
1990-01-01
Mercuric reductase activity determined by the Thiobacillus ferrooxidans merA gene (cloned and expressed constitutively in Escherichia coli) was measured by volatilization of 203 Hg 2+ . (The absence of a merR regulatory gene in the cloned Thiobacillus mer determinant provides a basis for the constitutive synthesis of this system.) In the absence of the Thiobacillus merC transport gene, the mercury volatilization activity was cryptic and was not seen with whole cells but only with sonication-disrupted cells. The Thiobacillus merC transport function was compared with transport via the merT-merP system of plasmid pDU1358. Both systems, cloned and expressed in E. coli, governed enhanced uptake of 203 Hg 2+ in a temperature- and concentration-dependent fashion. Uptake via MerT-MerP was greater and conferred greater hypersensitivity to Hg 2+ than did uptake with MerC. Mercury uptake was inhibited by N-ethylmaleimide but not by EDTA. Ag + salts inhibited mercury uptake by the MerT-MerP system but did not inhibit uptake via MerC. Radioactive mercury accumulated by the MerT-MerP and by the MerC systems was exchangeable with nonradioactive Hg 2+
Directory of Open Access Journals (Sweden)
Faezeh Tabesh
2014-01-01
Full Text Available Introduction. Oats are high in soluble fibers and effective in reducing the risk of cardiovascular diseases (CVD. We assessed the effects of beta-glucan from oat bran on serum nitric oxide (NO endothelial function in patients with hypercholesterolemia. Method. Sixty hypercholesterolemic patients were randomly divided to receive an experimental bread rich in beta-glucan from oat bran (intervention or bread rich in wheat fiber (control for four weeks. All subjects had the same diet for two-week baseline period and hypocaloric diet for four weeks of intervention. Serum NO concentration and flow-mediated dilation (FMD were determined before and after the experiment. Results. Mean age of the participants was 51.1 ± 9.3 years and 65% (n=39 were female. After intervention, serum NO concentration increased by 50.2 ± 19.8 μmol/lit in the intervention group (P=0.017, but no change was observed in the control group (17.5 ± 27.5 μmol/lit; P=0.530. No change of FMD was observed in the intervention (0.48 ± 0.78%; P=0.546 or in the control group (0.59 ± 0.92%; P=0.533. Conclusion. Consumption of oat bread for four weeks increases serum NO concentration but has no effect on FMD. Further studies are warranted in this regard.
Sterol Synthesis in Diverse Bacteria.
Wei, Jeremy H; Yin, Xinchi; Welander, Paula V
2016-01-01
Sterols are essential components of eukaryotic cells whose biosynthesis and function has been studied extensively. Sterols are also recognized as the diagenetic precursors of steranes preserved in sedimentary rocks where they can function as geological proxies for eukaryotic organisms and/or aerobic metabolisms and environments. However, production of these lipids is not restricted to the eukaryotic domain as a few bacterial species also synthesize sterols. Phylogenomic studies have identified genes encoding homologs of sterol biosynthesis proteins in the genomes of several additional species, indicating that sterol production may be more widespread in the bacterial domain than previously thought. Although the occurrence of sterol synthesis genes in a genome indicates the potential for sterol production, it provides neither conclusive evidence of sterol synthesis nor information about the composition and abundance of basic and modified sterols that are actually being produced. Here, we coupled bioinformatics with lipid analyses to investigate the scope of bacterial sterol production. We identified oxidosqualene cyclase (Osc), which catalyzes the initial cyclization of oxidosqualene to the basic sterol structure, in 34 bacterial genomes from five phyla (Bacteroidetes, Cyanobacteria, Planctomycetes, Proteobacteria, and Verrucomicrobia) and in 176 metagenomes. Our data indicate that bacterial sterol synthesis likely occurs in diverse organisms and environments and also provides evidence that there are as yet uncultured groups of bacterial sterol producers. Phylogenetic analysis of bacterial and eukaryotic Osc sequences confirmed a complex evolutionary history of sterol synthesis in this domain. Finally, we characterized the lipids produced by Osc-containing bacteria and found that we could generally predict the ability to synthesize sterols. However, predicting the final modified sterol based on our current knowledge of sterol synthesis was difficult. Some bacteria
Survival of adult neurons lacking cholesterol synthesis in vivo.
Fünfschilling, Ursula; Saher, Gesine; Xiao, Le; Möbius, Wiebke; Nave, Klaus-Armin
2007-01-02
Cholesterol, an essential component of all mammalian plasma membranes, is highly enriched in the brain. Both during development and in the adult, brain cholesterol is derived from local cholesterol synthesis and not taken up from the circulation. However, the contribution of neurons and glial cells to total brain cholesterol metabolism is unknown. Using conditional gene inactivation in the mouse, we disrupted the squalene synthase gene (fdft1), which is critical for cholesterol synthesis, in cerebellar granule cells and some precerebellar nuclei. Mutant mice showed no histological signs of neuronal degeneration, displayed ultrastructurally normal synapses, and exhibited normal motor coordination. This revealed that these adult neurons do not require cell-autonomous cholesterol synthesis for survival or function. We conclude that at least some adult neurons no longer require endogenous cholesterol synthesis and can fully meet their cholesterol needs by uptake from their surrounding. Glia are a likely source of cholesterol in the central nervous system.
Survival of adult neurons lacking cholesterol synthesis in vivo
Directory of Open Access Journals (Sweden)
Möbius Wiebke
2007-01-01
Full Text Available Abstract Background Cholesterol, an essential component of all mammalian plasma membranes, is highly enriched in the brain. Both during development and in the adult, brain cholesterol is derived from local cholesterol synthesis and not taken up from the circulation. However, the contribution of neurons and glial cells to total brain cholesterol metabolism is unknown. Results Using conditional gene inactivation in the mouse, we disrupted the squalene synthase gene (fdft1, which is critical for cholesterol synthesis, in cerebellar granule cells and some precerebellar nuclei. Mutant mice showed no histological signs of neuronal degeneration, displayed ultrastructurally normal synapses, and exhibited normal motor coordination. This revealed that these adult neurons do not require cell-autonomous cholesterol synthesis for survival or function. Conclusion We conclude that at least some adult neurons no longer require endogenous cholesterol synthesis and can fully meet their cholesterol needs by uptake from their surrounding. Glia are a likely source of cholesterol in the central nervous system.
Sørensen, Brita Singers; Busk, Morten; Overgaard, Jens; Horsman, Michael R; Alsner, Jan
2015-01-01
The tumor microenvironment is characterized by regions of hypoxia and acidosis which are linked to poor prognosis. This occurs due to an aberrant vasculature as well as high rates of glycolysis and lactate production in tumor cells even in the presence of oxygen (the Warburg effect), which weakens the spatial linkage between hypoxia and acidosis. Five different human squamous cell carcinoma cell lines (SiHa, FaDuDD, UTSCC5, UTSCC14 and UTSCC15) were treated with hypoxia, acidosis (pH 6.3), or a combination, and gene expression analyzed using microarray. SiHa and FaDuDD were chosen for further characterization of cell energetics and protein synthesis. Total cellular ATP turnover and relative glycolytic dependency was determined by simultaneous measurements of oxygen consumption and lactate synthesis rates and total protein synthesis was determined by autoradiographic quantification of the incorporation of 35S-labelled methionine and cysteine into protein. Microarray analysis allowed differentiation between genes induced at low oxygen only at normal extracellular pH (pHe), genes induced at low oxygen at both normal and low pHe, and genes induced at low pHe independent of oxygen concentration. Several genes were found to be upregulated by acidosis independent of oxygenation. Acidosis resulted in a more wide-scale change in gene expression profiles than hypoxia including upregulation of genes involved in the translation process, for example Eukaryotic translation initiation factor 4A, isoform 2 (EIF4A2), and Ribosomal protein L37 (RPL37). Acidosis suppressed overall ATP turnover and protein synthesis by 50%. Protein synthesis, but not total ATP production, was also suppressed under hypoxic conditions. A dramatic decrease in ATP turnover (SiHa) and protein synthesis (both cell lines) was observed when hypoxia and low pHe were combined. We demonstrate here that the influence of hypoxia and acidosis causes different responses, both in gene expression and in de novo
Gene assembly via one-pot chemical ligation of DNA promoted by DNA nanostructures
DEFF Research Database (Denmark)
Manuguerra, Ilenia; Croce, Stefano; El-Sagheer, Afaf H.
2018-01-01
Current gene synthesis methods are driven by enzymatic reactions. Here we report the one-pot synthesis of a chemically-ligated gene from 14 oligonucleotides. The chemical ligation benefits from the highly efficient click chemistry approach templated by DNA nanostructures, and produces modified DNA...
Energy Technology Data Exchange (ETDEWEB)
Papaspyridi, Lefki-Maria; Christakopoulos, Paul [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Katapodis, Petros [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Biotechnology Laboratory, Department of Biological Applications and Technologies, University of Ioannina, Ioannina (Greece); Gonou-Zagou, Zacharoula; Kapsanaki-Gotsi, Evangelia [Department of Ecology and Systematics, Faculty of Biology, National and Kapodistrian University of Athens, Athens (Greece)
2011-02-15
In this study we maximized biomass production by the basidiomycete Ganoderma australe ATHUM 4345, a species of pharmaceutical interest as it is a valuable source of nutraceuticals, including dietary fibers and glucans. We used the Biolog FF MicroPlate to screen 95 different carbon sources for growth monitoring. The pattern of substrate catabolism forms a substrate assimilation fingerprint, which is useful in selecting components for media optimization of maximum biomass production. Response surface methodology, based on the central composite design was applied to explore the optimum concentrations of carbon and nitrogen sources of culture medium in shake flask cultures. When the improved culture medium was tested in a 20-L stirred tank bioreactor, using 13.7 g/L glucose and 30.0 g/L yeast extract, high biomass yields (10.1{+-}0.4 g/L) and productivity of 0.09 g L{sup -1} h{sup -1} were obtained. The yield coefficients for total glucan and dietary fibers on biomass formed were 94.82{+-}6 and 341.15{+-}12.3 mg/g mycelium dry weight, respectively. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Energy Technology Data Exchange (ETDEWEB)
Jansson, Christer; Baguma, Yona; Sun, Chuanxin; Boren, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R.; Jansson, Christer
2008-01-15
Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.
Silverman, Andrew M; Qiao, Kangjian; Xu, Peng; Stephanopoulos, Gregory
2016-04-01
Single cell oil (SCO) is an attractive energy source due to scalability, utilization of low-cost renewable feedstocks, and type of product(s) made. Engineering strains capable of producing high lipid titers and yields is crucial to the economic viability of these processes. However, lipid synthesis in cells is a complex phenomenon subject to multiple layers of regulation, making gene target identification a challenging task. In this study, we aimed to identify genes in the oleaginous yeast Yarrowia lipolytica whose overexpression enhances lipid production by this organism. To this end, we examined the effect of the overexpression of a set of 44 native genes on lipid production in Y. lipolytica, including those involved in glycerolipid synthesis, fatty acid synthesis, central carbon metabolism, NADPH generation, regulation, and metabolite transport and characterized each resulting strain's ability to produce lipids growing on both glucose and acetate as a sole carbon source. Our results suggest that a diverse subset of genes was effective at individually influencing lipid production in Y. lipolytica, sometimes in a substrate-dependent manner. The most productive strain on glucose overexpressed the diacylglycerol acyltransferase DGA2 gene, increasing lipid titer, cellular content, and yield by 236, 165, and 246 %, respectively, over our control strain. On acetate, our most productive strain overexpressed the acylglycerol-phosphate acyltransferase SLC1 gene, with a lipid titer, cellular content, and yield increase of 99, 91, and 151 %, respectively, over the control strain. Aside from genes encoding enzymes that directly catalyze the reactions of lipid synthesis, other ways by which lipogenesis was increased in these cells include overexpressing the glycerol-3-phosphate dehydrogenase (GPD1) gene to increase production of glycerol head groups and overexpressing the 6-phosphogluconolactonase (SOL3) gene from the oxidative pentose phosphate pathway to increase NADPH
DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli
International Nuclear Information System (INIS)
Dorson, J.W.; Moses, R.E.
1978-01-01
DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair
Li, Aitao; Acevedo-Rocha, Carlos G; Sun, Zhoutong; Cox, Tony; Xu, Jia Lucy; Reetz, Manfred T
2018-02-02
Saturation mutagenesis (SM) constitutes a widely used technique in the directed evolution of selective enzymes as catalysts in organic chemistry and in the manipulation of metabolic paths and genomes, but the quality of the libraries is far from optimal due to the inherent amino acid bias. Herein, it is shown how this fundamental problem can be solved by applying high-fidelity solid-phase chemical gene synthesis on silicon chips followed by efficient gene assembly. Limonene epoxide hydrolase was chosen as the catalyst in the model desymmetrization of cyclohexene oxide with the stereoselective formation of (R,R)- and (S,S)-cyclohexane-1,2-diol. A traditional combinatorial PCR-based SM library, produced by simultaneous randomization at several residues by using a reduced amino acid alphabet, and the respective synthetic library were constructed and compared. Statistical analysis at the DNA level with massive sequencing demonstrates that, in the synthetic approach, 97 % of the theoretically possible DNA mutants are formed, whereas the traditional SM library contained only about 50 %. Screening at the protein level also showed the superiority of the synthetic library; many highly (R,R)- and (S,S)-selective variants being discovered are not found in the traditional SM library. With the prices of synthetic genes decreasing, this approach may point the way to future directed evolution. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
van der Kaaij, R M; Yuan, X-L; Franken, A; Ram, A F J; Punt, P J; van der Maarel, M J E C; Dijkhuizen, L
2007-07-01
In the genome sequence of Aspergillus niger CBS 513.88, three genes were identified with high similarity to fungal alpha-amylases. The protein sequences derived from these genes were different in two ways from all described fungal alpha-amylases: they were predicted to be glycosylphosphatidylinositol anchored, and some highly conserved amino acids of enzymes in the alpha-amylase family were absent. We expressed two of these enzymes in a suitable A. niger strain and characterized the purified proteins. Both enzymes showed transglycosylation activity on donor substrates with alpha-(1,4)-glycosidic bonds and at least five anhydroglucose units. The enzymes, designated AgtA and AgtB, produced new alpha-(1,4)-glycosidic bonds and therefore belong to the group of the 4-alpha-glucanotransferases (EC 2.4.1.25). Their reaction products reached a degree of polymerization of at least 30. Maltose and larger maltooligosaccharides were the most efficient acceptor substrates, although AgtA also used small nigerooligosaccharides containing alpha-(1,3)-glycosidic bonds as acceptor substrate. An agtA knockout of A. niger showed an increased susceptibility towards the cell wall-disrupting compound calcofluor white, indicating a cell wall integrity defect in this strain. Homologues of AgtA and AgtB are present in other fungal species with alpha-glucans in their cell walls, but not in yeast species lacking cell wall alpha-glucan. Possible roles for these enzymes in the synthesis and/or maintenance of the fungal cell wall are discussed.