WorldWideScience

Sample records for glucans synthesis gene

  1. Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

    Science.gov (United States)

    Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

  2. Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

    DEFF Research Database (Denmark)

    D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

    2008-01-01

    cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

  3. Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

    NARCIS (Netherlands)

    Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2004-01-01

    Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

  4. Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

    NARCIS (Netherlands)

    Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2004-01-01

    Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

  5. An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

    NARCIS (Netherlands)

    Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

    2004-01-01

    (1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

  6. β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

    2017-11-01

    The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  7. Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

    Science.gov (United States)

    Oliveira-Garcia, Ely; Deising, Holger B

    2016-08-01

    In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  8. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  9. Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

    1999-01-01

    β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

  10. Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

    Science.gov (United States)

    Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

    2017-03-07

    The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

  11. Synthesis of cell wall xylans and glucans by golgi membranes

    International Nuclear Information System (INIS)

    Gibeaut, D.M.; Carpita, N.C.

    1989-01-01

    We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

  12. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  13. Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

    Science.gov (United States)

    Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

    2014-10-22

    Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

  14. Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

    Science.gov (United States)

    Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2016-01-20

    α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

  15. Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

    International Nuclear Information System (INIS)

    Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

    2015-01-01

    β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

  16. Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

    2015-02-27

    β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

  17. Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

    Science.gov (United States)

    Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

    2014-11-01

    The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

  18. Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

    Science.gov (United States)

    Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

    2017-07-28

    The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

  19. Exopolysaccharide (EPS synthesis by Oenococcus oeni: from genes to phenotypes.

    Directory of Open Access Journals (Sweden)

    Maria Dimopoulou

    Full Text Available Oenococcus oeni is the bacterial species which drives malolactic fermentation in wine. The analysis of 50 genomic sequences of O. oeni (14 already available and 36 newly sequenced ones provided an inventory of the genes potentially involved in exopolysaccharide (EPS biosynthesis. The loci identified are: two gene clusters named eps1 and eps2, three isolated glycoside-hydrolase genes named dsrO, dsrV and levO, and three isolated glycosyltransferase genes named gtf, it3, it4. The isolated genes were present or absent depending on the strain and the eps gene clusters composition diverged from one strain to another. The soluble and capsular EPS production capacity of several strains was examined after growth in different culture media and the EPS structure was determined. Genotype to phenotype correlations showed that several EPS biosynthetic pathways were active and complementary in O. oeni. Can be distinguished: (i a Wzy-dependent synthetic pathway, allowing the production of heteropolysaccharides made of glucose, galactose and rhamnose, mainly in a capsular form, (ii a glucan synthase pathway (Gtf, involved in β-glucan synthesis in a free and a cell-associated form, giving a ropy phenotype to growth media and (iii homopolysaccharide synthesis from sucrose (α-glucan or β-fructan by glycoside-hydrolases of the GH70 and GH68 families. The eps gene distribution on the phylogenetic tree was examined. Fifty out of 50 studied genomes possessed several genes dedicated to EPS metabolism. This suggests that these polymers are important for the adaptation of O. oeni to its specific ecological niche, wine and possibly contribute to the technological performance of malolactic starters.

  20. Industrial scale gene synthesis.

    Science.gov (United States)

    Notka, Frank; Liss, Michael; Wagner, Ralf

    2011-01-01

    The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.

    Science.gov (United States)

    Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro

    2013-12-15

    A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

    Science.gov (United States)

    Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

    2012-06-01

    A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

  3. Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

    DEFF Research Database (Denmark)

    Munck, L.; Møller, B.; Jacobsen, Susanne

    2004-01-01

    -->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

  4. Potent inhibitory effects of D-tagatose on the acid production and water-insoluble glucan synthesis of Streptococcus mutans GS5 in the presence of sucrose.

    Science.gov (United States)

    Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki

    2015-01-01

    We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.

  5. Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

    2017-04-01

    Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

    Science.gov (United States)

    Thao, Cao Phuong; Tien, Le Thi Thuy

    2017-09-01

    β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

  7. The priming of storage glucan synthesis from bacteria to plants: current knowledge and new developments.

    Science.gov (United States)

    D'Hulst, Christophe; Mérida, Angel

    2010-10-01

    Starch is the main polymer in which carbon and energy are stored in land plants, algae and some cyanobacteria. It plays a crucial role in the physiology of these organisms and also represents an important polymer for humans, in terms of both diet and nonfood industry uses. Recent efforts have elucidated most of the steps involved in the synthesis of starch. However, the process that initiates the synthesis of the starch granule remains unclear. Here, we outline the similarities between the synthesis of starch and the synthesis of glycogen, the other widespread and abundant glucose-based polymer in living cells. We place special emphasis on the mechanisms of initiation of the glycogen granule and current knowledge concerning the initiation of the starch granule. We also discuss recent discoveries regarding the function of starch synthases in the priming of the starch granule and possible interactions with other elements of the starch synthesis machinery.

  8. Plants with elevated levels of glucan

    Energy Technology Data Exchange (ETDEWEB)

    Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

    2018-03-20

    The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

  9. Potent Inhibitory Effects of D-tagatose on the Acid Production and Water-insoluble Glucan Synthesis of Streptococcus mutans GS5 in the Presence of Sucrose

    OpenAIRE

    Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki

    2015-01-01

    We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10オ (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol...

  10. Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

    DEFF Research Database (Denmark)

    Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

    2008-01-01

    Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

  11. Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

    NARCIS (Netherlands)

    Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

    2016-01-01

    α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

  12. Homeobox genes and melatonin synthesis

    DEFF Research Database (Denmark)

    Rohde, Kristian; Møller, Morten; Rath, Martin Fredensborg

    2014-01-01

    Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a cAMP-based indu......Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a c......AMP-based induction of Aanat transcription. However, additional transcriptional control mechanisms exist. Homeobox genes, which are generally known to encode transcription factors controlling developmental processes, are also expressed in the mature rodent pineal gland. Among these, the cone-rod homeobox (CRX......) transcription factor is believed to control pineal-specific Aanat expression. Based on recent advances in our understanding of Crx in the rodent pineal gland, we here suggest that homeobox genes play a role in adult pineal physiology both by ensuring pineal-specific Aanat expression and by facilitating c...

  13. Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

    Science.gov (United States)

    Oliveira-Garcia, Ely; Deising, Holger B.

    2013-01-01

    β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

  14. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  15. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Science.gov (United States)

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

  16. β-1,3-glucan in developing cotton fibers

    International Nuclear Information System (INIS)

    Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

    1979-01-01

    Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

  17. Screening of lactic acid bacteria from Indonesia reveals glucansucrase and fructansucrase genes in two different Weissella confusa strains from soya

    NARCIS (Netherlands)

    Malik, Amarila; Radji, Maksum; Kralj, Slavko; Dijkhuizen, Lubbert

    2009-01-01

    Homopolysaccharide (glucan and fructan) synthesis from sucrose by sucrase enzymes in lactic acid bacteria (LAB) has been well studied in the genera Leuconostoc, Streptococcus and Lactobacillus. This study aimed to identify and characterize genes encoding glucansucrase/glucosyltransferase (GTF) and

  18. Development and characterization of an oat TILLING-population and identification of mutations in lignin and β-glucan biosynthesis genes

    Directory of Open Access Journals (Sweden)

    Vivekanand Vivekanand

    2010-05-01

    Full Text Available Abstract Background Oat, Avena sativa is the sixth most important cereal in the world. Presently oat is mostly used as feed for animals. However, oat also has special properties that make it beneficial for human consumption and has seen a growing importance as a food crop in recent decades. Increased demand for novel oat products has also put pressure on oat breeders to produce new oat varieties with specific properties such as increased or improved β-glucan-, antioxidant- and omega-3 fatty acid levels, as well as modified starch and protein content. To facilitate this development we have produced a TILLING (Targeting Induced Local Lesions IN Genomes population of the spring oat cultivar SW Belinda. Results Here a population of 2600 mutagenised M2 lines, producing 2550 M3 seed lots were obtained. The M2 population was initially evaluated by visual inspection and a number of different phenotypes were seen ranging from dwarfs to giants, early flowering to late flowering, leaf morphology and chlorosis. Phloroglucinol/HCl staining of M3 seeds, obtained from 1824 different M2 lines, revealed a number of potential lignin mutants. These were later confirmed by quantitative analysis. Genomic DNA was prepared from the M2 population and the mutation frequency was determined. The estimated mutation frequency was one mutation per 20 kb by RAPD-PCR fingerprinting, one mutation per 38 kb by MALDI-TOF analysis and one mutation per 22.4 kb by DNA sequencing. Thus, the overall mutation frequency in the population is estimated to be one mutation per 20-40 kb, depending on if the method used addressed the whole genome or specific genes. During the investigation, 6 different mutations in the phenylalanine ammonia-lyase (AsPAL1 gene and 10 different mutations in the cellulose synthase-like (AsCslF6 β-glucan biosynthesis gene were identified. Conclusion The oat TILLING population produced in this work carries, on average, hundreds of mutations in every individual

  19. Transcriptomic analysis of swarm motility phenotype of Salmonella enterica serovar Typhimurium mutant defective in periplasmic glucan synthesis

    Science.gov (United States)

    Movement of food-borne pathogens on moist surfaces enables them to migrate towards more favorable niches and facilitate their survival for extended periods of time. Salmonella enterica serovar Typhimurium mutants defective in OPG synthesis are unable to exhibit motility on moist surfaces (swarming) ...

  20. Preclinical Pharmacokinetics and Pharmacodynamic Target of SCY-078, a First-in-Class Orally Active Antifungal Glucan Synthesis Inhibitor, in Murine Models of Disseminated Candidiasis.

    Science.gov (United States)

    Wring, Stephen A; Randolph, Ryan; Park, SeongHee; Abruzzo, George; Chen, Qing; Flattery, Amy; Garrett, Graig; Peel, Michael; Outcalt, Russell; Powell, Kendall; Trucksis, Michelle; Angulo, David; Borroto-Esoda, Katyna

    2017-04-01

    SCY-078 (MK-3118) is a novel, semisynthetic derivative of enfumafungin and represents the first compound of the triterpene class of antifungals. SCY-078 exhibits potent inhibition of β-(1,3)-d-glucan synthesis, an essential cell wall component of many pathogenic fungi, including Candida spp. and Aspergillus spp. SCY-078 is currently in phase 2 clinical development for the treatment of invasive fungal diseases. In vitro disposition studies to assess solubility, intestinal permeability, and metabolic stability were predictive of good oral bioavailability. Preclinical pharmacokinetic studies were consistent with once-daily administration to humans. After intravenous delivery, plasma clearance in rodents and dogs was low, representing candidiasis, exceeded plasma by 20- to 25-fold for the area under the concentration-time curve from 0 h to infinity (AUC 0-∞ ) and C max SCY-078 achieved efficacy endpoints following oral delivery across multiple murine models of disseminated candidiasis. The pharmacokinetic/pharmacodynamic indices C max /MIC and AUC/MIC correlated with outcome. Target therapeutic exposure, expressed as the plasma AUC 0-24 , was comparable across models, with an upper value of 11.2 μg·h/ml (15.4 μM·h); the corresponding mean value for free drug AUC/MIC was ∼0.75. Overall, these results demonstrate that SCY-078 has the oral and intravenous (i.v.) pharmacokinetic properties and potency in murine infection models of disseminated candidiasis to support further investigation as a novel i.v. and oral treatment for invasive fungal diseases. Copyright © 2017 Wring et al.

  1. The Emerging Pathogen Candida auris: Growth Phenotype, Virulence Factors, Activity of Antifungals, and Effect of SCY-078, a Novel Glucan Synthesis Inhibitor, on Growth Morphology and Biofilm Formation.

    Science.gov (United States)

    Larkin, Emily; Hager, Christopher; Chandra, Jyotsna; Mukherjee, Pranab K; Retuerto, Mauricio; Salem, Iman; Long, Lisa; Isham, Nancy; Kovanda, Laura; Borroto-Esoda, Katyna; Wring, Steve; Angulo, David; Ghannoum, Mahmoud

    2017-05-01

    Candida auris , a new multidrug-resistant Candida spp. which is associated with invasive infection and high rates of mortality, has recently emerged. Here, we determined the virulence factors (germination, adherence, biofilm formation, phospholipase and proteinase production) of 16 C. auris isolates and their susceptibilities to 11 drugs belonging to different antifungal classes, including a novel orally bioavailable 1,3-β-d-glucan synthesis inhibitor (SCY-078). We also examined the effect of SCY-078 on the growth, ultrastructure, and biofilm-forming abilities of C. auris Our data showed that while the tested strains did not germinate, they did produce phospholipase and proteinase in a strain-dependent manner and had a significantly reduced ability to adhere and form biofilms compared to that of Candida albicans ( P = 0.01). C. auris isolates demonstrated reduced susceptibility to fluconazole and amphotericin B, while, in general, they were susceptible to the remaining drugs tested. SCY-078 had an MIC 90 of 1 mg/liter against C. auris and caused complete inhibition of the growth of C. auris and C. albicans Scanning electron microscopy analysis showed that SCY-078 interrupted C. auris cell division, with the organism forming abnormal fused fungal cells. Additionally, SCY-078 possessed potent antibiofilm activity, wherein treated biofilms demonstrated significantly reduced metabolic activity and a significantly reduced thickness compared to the untreated control ( P < 0.05 for both comparisons). Our study shows that C. auris expresses several virulence determinants (albeit to a lesser extent than C. albicans ) and is resistant to fluconazole and amphotericin B. SCY-078, the new orally bioavailable antifungal, had potent antifungal/antibiofilm activity against C. auris , indicating that further evaluation of this antifungal is warranted. Copyright © 2017 Larkin et al.

  2. Preclinical Pharmacokinetics and Pharmacodynamic Target of SCY-078, a First-in-Class Orally Active Antifungal Glucan Synthesis Inhibitor, in Murine Models of Disseminated Candidiasis

    Science.gov (United States)

    Randolph, Ryan; Park, SeongHee; Abruzzo, George; Chen, Qing; Flattery, Amy; Garrett, Graig; Peel, Michael; Outcalt, Russell; Powell, Kendall; Trucksis, Michelle; Angulo, David; Borroto-Esoda, Katyna

    2017-01-01

    ABSTRACT SCY-078 (MK-3118) is a novel, semisynthetic derivative of enfumafungin and represents the first compound of the triterpene class of antifungals. SCY-078 exhibits potent inhibition of β-(1,3)-d-glucan synthesis, an essential cell wall component of many pathogenic fungi, including Candida spp. and Aspergillus spp. SCY-078 is currently in phase 2 clinical development for the treatment of invasive fungal diseases. In vitro disposition studies to assess solubility, intestinal permeability, and metabolic stability were predictive of good oral bioavailability. Preclinical pharmacokinetic studies were consistent with once-daily administration to humans. After intravenous delivery, plasma clearance in rodents and dogs was low, representing candidiasis, exceeded plasma by 20- to 25-fold for the area under the concentration-time curve from 0 h to infinity (AUC0–∞) and Cmax. SCY-078 achieved efficacy endpoints following oral delivery across multiple murine models of disseminated candidiasis. The pharmacokinetic/pharmacodynamic indices Cmax/MIC and AUC/MIC correlated with outcome. Target therapeutic exposure, expressed as the plasma AUC0–24, was comparable across models, with an upper value of 11.2 μg·h/ml (15.4 μM·h); the corresponding mean value for free drug AUC/MIC was ∼0.75. Overall, these results demonstrate that SCY-078 has the oral and intravenous (i.v.) pharmacokinetic properties and potency in murine infection models of disseminated candidiasis to support further investigation as a novel i.v. and oral treatment for invasive fungal diseases. PMID:28137806

  3. Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

    Science.gov (United States)

    Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

    2008-01-01

    Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

  4. Biotechnological potential of novel glycoside hydrolase family 70 enzymes synthesizing α-glucans from starch and sucrose

    NARCIS (Netherlands)

    Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

    Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical

  5. Beta-glucans and cholesterol

    Czech Academy of Sciences Publication Activity Database

    Šíma, Petr; Vannucci, Luca; Větvička, V.

    2017-01-01

    Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

  6. Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

    Science.gov (United States)

    Theuwissen, Elke; Mensink, Ronald P

    2007-03-01

    Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

  7. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  8. A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

    Directory of Open Access Journals (Sweden)

    Heather T Taff

    Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

  9. Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

    Science.gov (United States)

    Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

    2017-07-01

    We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

    Science.gov (United States)

    Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

    2016-01-01

    Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

  11. Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

    Science.gov (United States)

    Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

    2017-08-15

    Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. (1,3;1,4)-β-Glucan Biosynthesis by the CSLF6 Enzyme: Position and Flexibility of Catalytic Residues Influence Product Fine Structure.

    Science.gov (United States)

    Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B

    2016-04-05

    Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.

  13. Gene Synthesis with H G Khorana

    Indian Academy of Sciences (India)

    IAS Admin

    student with Robert Letsinger at Northwestern University and had written to Gobind about a ... range aim must be the development of methods for the total synthesis of ... There is a good deal of evidence now to suggest that in addition to a.

  14. Visual effects of β-­glucans on wound healing in fish

    DEFF Research Database (Denmark)

    Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

    2011-01-01

    Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

  15. Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

    Science.gov (United States)

    Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

    2017-11-01

    Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

  16. Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

    Science.gov (United States)

    Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

  17. Defining Starch Binding by Glucan Phosphatases

    DEFF Research Database (Denmark)

    Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

    2015-01-01

    Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

  18. DNA repair synthesis dependent on the uvrA,B gene products

    International Nuclear Information System (INIS)

    Moses, R.E.; Moody, E.E.M.

    1975-01-01

    Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required

  19. Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

    NARCIS (Netherlands)

    van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

    Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

  20. Glucan: mechanisms involved in its radioprotective effect

    International Nuclear Information System (INIS)

    Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.

    1987-01-01

    It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested

  1. beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Satoh, S; Matsuda, K; Tamari, K

    1976-12-01

    A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

  2. Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

    Science.gov (United States)

    We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

  3. Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

    Science.gov (United States)

    Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

    2013-01-01

    Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

  4. Identification of sugarcane genes involved in the purine synthesis pathway

    Directory of Open Access Journals (Sweden)

    Mario A. Jancso

    2001-12-01

    Full Text Available Nucleotide synthesis is of central importance to all cells. In most organisms, the purine nucleotides are synthesized de novo from non-nucleotide precursors such as amino acids, ammonia and carbon dioxide. An understanding of the enzymes involved in sugarcane purine synthesis opens the possibility of using these enzymes as targets for chemicals which may be effective in combating phytopathogen. Such an approach has already been applied to several parasites and types of cancer. The strategy described in this paper was applied to identify sugarcane clusters for each step of the de novo purine synthesis pathway. Representative sequences of this pathway were chosen from the National Center for Biotechnology Information (NCBI database and used to search the translated sugarcane expressed sequence tag (SUCEST database using the available basic local alignment search tool (BLAST facility. Retrieved clusters were further tested for the statistical significance of the alignment by an implementation (PRSS3 of the Monte Carlo shuffling algorithm calibrated using known protein sequences of divergent taxa along the phylogenetic tree. The sequences were compared to each other and to the sugarcane clusters selected using BLAST analysis, with the resulting table of p-values indicating the degree of divergence of each enzyme within different taxa and in relation to the sugarcane clusters. The results obtained by this strategy allowed us to identify the sugarcane proteins participating in the purine synthesis pathway.A via de síntese de purino nucleotídeos é considerada uma via de central importância para todas as células. Na maioria dos organismos, os purino nucleotídeos são sintetizados ''de novo'' a partir de precursores não-nucleotídicos como amino ácidos, amônia e dióxido de carbono. O conhecimento das enzimas envolvidas na via de síntese de purinas da cana-de-açúcar vai abrir a possibilidade do uso dessas enzimas como alvos no desenho

  5. Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

    Science.gov (United States)

    Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

    2017-04-01

    Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

  6. Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

    OpenAIRE

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

    2014-01-01

    The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

  7. Inhibitory Role of Greatwall-Like Protein Kinase Rim15p in Alcoholic Fermentation via Upregulating the UDP-Glucose Synthesis Pathway in Saccharomyces cerevisiae.

    Science.gov (United States)

    Watanabe, Daisuke; Zhou, Yan; Hirata, Aiko; Sugimoto, Yukiko; Takagi, Kenichi; Akao, Takeshi; Ohya, Yoshikazu; Takagi, Hiroshi; Shimoi, Hitoshi

    2016-01-01

    The high fermentation rate of Saccharomyces cerevisiae sake yeast strains is attributable to a loss-of-function mutation in the RIM15 gene, which encodes a Greatwall-family protein kinase that is conserved among eukaryotes. In the present study, we performed intracellular metabolic profiling analysis and revealed that deletion of the RIM15 gene in a laboratory strain impaired glucose-anabolic pathways through the synthesis of UDP-glucose (UDPG). Although Rim15p is required for the synthesis of trehalose and glycogen from UDPG upon entry of cells into the quiescent state, we found that Rim15p is also essential for the accumulation of cell wall β-glucans, which are also anabolic products of UDPG. Furthermore, the impairment of UDPG or 1,3-β-glucan synthesis contributed to an increase in the fermentation rate. Transcriptional induction of PGM2 (phosphoglucomutase) and UGP1 (UDPG pyrophosphorylase) was impaired in Rim15p-deficient cells in the early stage of fermentation. These findings demonstrate that the decreased anabolism of glucose into UDPG and 1,3-β-glucan triggered by a defect in the Rim15p-mediated upregulation of PGM2 and UGP1 redirects the glucose flux into glycolysis. Consistent with this, sake yeast strains with defective Rim15p exhibited impaired expression of PGM2 and UGP1 and decreased levels of β-glucans, trehalose, and glycogen during sake fermentation. We also identified a sake yeast-specific mutation in the glycogen synthesis-associated glycogenin gene GLG2, supporting the conclusion that the glucose-anabolic pathway is impaired in sake yeast. These findings demonstrate that downregulation of the UDPG synthesis pathway is a key mechanism accelerating alcoholic fermentation in industrially utilized S. cerevisiae sake strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Identification of Cell Wall Synthesis Regulatory Genes Controlling Biomass Characteristics and Yield in Rice (Oryza Sativa)

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Zhaohua PEng [Mississippi State University; Ronald, Palmela [UC-Davis; Wang, Guo-Liang [The Ohio State University

    2013-04-26

    This project aims to identify the regulatory genes of rice cell wall synthesis pathways using a cell wall removal and regeneration system. We completed the gene expression profiling studies following the time course from cell wall removal to cell wall regeneration in rice suspension cells. We also completed, total proteome, nuclear subproteome and histone modification studies following the course from cell wall removal and cell wall regeneration process. A large number of differentially expressed regulatory genes and proteins were identified. Meanwhile, we generated RNAi and over-expression transgenic rice for 45 genes with at least 10 independent transgenic lines for each gene. In addition, we ordered T-DNA and transposon insertion mutants for 60 genes from Korea, Japan, and France and characterized the mutants. Overall, we have mutants and transgenic lines for over 90 genes, exceeded our proposed goal of generating mutants for 50 genes. Interesting Discoveries a) Cell wall re-synthesis in protoplasts may involve a novel cell wall synthesis mechanism. The synthesis of the primary cell wall is initiated in late cytokinesis with further modification during cell expansion. Phragmoplast plays an essential role in cell wall synthesis. It services as a scaffold for building the cell plate and formation of a new cell wall. Only one phragmoplast and one new cell wall is produced for each dividing cell. When the cell wall was removed enzymatically, we found that cell wall re-synthesis started from multiple locations simultaneously, suggesting that a novel mechanism is involved in cell wall re-synthesis. This observation raised many interesting questions, such as how the starting sites of cell wall synthesis are determined, whether phragmoplast and cell plate like structures are involved in cell wall re-synthesis, and more importantly whether the same set of enzymes and apparatus are used in cell wall re-synthesis as during cytokinesis. Given that many known cell wall

  9. Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

    Science.gov (United States)

    Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

    2011-03-01

    This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  10. Poly(3-Hydroxybutyrate) Synthesis Genes in Azotobacter sp. Strain FA8

    OpenAIRE

    Pettinari, M. Julia; Vázquez, Gustavo J.; Silberschmidt, Daniel; Rehm, Bernd; Steinbüchel, Alexander; Méndez, Beatriz S.

    2001-01-01

    Genes responsible for the synthesis of poly(3-hydroxybutyrate) (PHB) in Azotobacter sp. FA8 were cloned and analyzed. A PHB polymerase gene (phbC) was found downstream from genes coding for β-ketothiolase (phbA) and acetoacetyl-coenzyme A reductase (phbB). A PHB synthase mutant was obtained by gene inactivation and used for genetic studies. The phbC gene from this strain was introduced into Ralstonia eutropha PHB-4 (phbC-negative mutant), and the recombinant accumulated PHB when either glucos...

  11. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  12. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  13. Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

    For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

  14. The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

    Science.gov (United States)

    Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

    2015-01-01

    Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

  15. Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

    Science.gov (United States)

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

    2014-08-01

    The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Inactivation of pecS restores the virulence of mutants devoid of osmoregulated periplasmic glucans in the phytopathogenic bacterium Dickeya dadantii.

    Science.gov (United States)

    Bontemps-Gallo, Sébastien; Madec, Edwige; Lacroix, Jean-Marie

    2014-04-01

    Dickeya dadantii is a phytopathogenic enterobacterium that causes soft rot disease in a wide range of plant species. Maceration, an apparent symptom of the disease, is the result of the synthesis and secretion of a set of plant cell wall-degrading enzymes (PCWDEs), but many additional factors are required for full virulence. Among these, osmoregulated periplasmic glucans (OPGs) and the PecS transcriptional regulator are essential virulence factors. Several cellular functions are controlled by both OPGs and PecS. Strains devoid of OPGs display a pleiotropic phenotype including total loss of virulence, loss of motility and severe reduction in the synthesis of PCWDEs. PecS is one of the major regulators of virulence in D. dadantii, acting mainly as a repressor of various cellular functions including virulence, motility and synthesis of PCWDEs. The present study shows that inactivation of the pecS gene restored virulence in a D. dadantii strain devoid of OPGs, indicating that PecS cannot be de-repressed in strains devoid of OPGs.

  17. Investigating trehalose synthesis genes after cold acclimation in the Antarctic nematode Panagrolaimus sp. DAW1

    Directory of Open Access Journals (Sweden)

    Anna C. Seybold

    2017-12-01

    Full Text Available Panagrolaimus sp. DAW1 is a freeze-tolerant Antarctic nematode which survives extensive intracellular ice formation. The molecular mechanisms of this extreme adaptation are still poorly understood. We recently showed that desiccation-enhanced RNA interference (RNAi soaking can be used in conjunction with quantitative polymerase chain reaction (qPCR to screen for phenotypes associated with reduced expression of candidate genes in Panagrolaimus sp. DAW1. Here, we present the use of this approach to investigate the role of trehalose synthesis genes in this remarkable organism. Previous studies have shown that acclimating Panagrolaimus sp. DAW1 at 5°C before freezing or desiccation substantially enhances survival. In this study, the expression of tps-2 and other genes associated with trehalose metabolism, as well as lea-1, hsp-70 and gpx-1, in cold-acclimated and non-acclimated nematodes was analyzed using qPCR. Pd-tps-2 and Pd-lea-1 were significantly upregulated after cold acclimation, indicating an inducible expression in the cold adaptation of Panagrolaimus sp. DAW1. The role of trehalose synthesis genes in Panagrolaimus sp. DAW1 was further investigated by RNAi. Compared to the controls, Pd-tps-2a(RNAi-treated and cold-acclimated nematodes showed a significant decrease in mRNA, but no change in trehalose content or freezing survival. The involvement of two other trehalose synthesis genes (tps-2b and gob-1 was also investigated. These findings provide the first functional genomic investigation of trehalose synthesis genes in the non-model organism Panagrolaimus sp. DAW1. The presence of several trehalose synthesis genes with different RNAi sensitivities suggests the existence of multiple backup systems in Panagrolaimus sp. DAW1, underlining the importance of this sugar in preparation for freezing.

  18. Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I

    International Nuclear Information System (INIS)

    Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.

    1998-01-01

    The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains

  19. UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

    International Nuclear Information System (INIS)

    Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

    1989-01-01

    A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

  20. Stimulation of the synthesis of bacteriophage T4 gene 32 protein by ultraviolet light irradiation

    International Nuclear Information System (INIS)

    Krisch, H.M.; Van Houwe, G.

    1976-01-01

    The synthesis of bacteriophage T4 gene 32 product, P32, has been followed by gel electrophoresis of lysates of infected cells which have been irradiated with ultraviolet light. In wild-type infections irradiation after the commencement of late gene expression results in a rapid stimulation of the rate of P32 synthesis. Within four minutes after irradiation P32 is synthesized at 11 times the rate of the unirradiated control infection. P32 seems to be the only T4 protein which exhibits such u.v. inducibility. This inducibility is dependent on the function of genes 46 and 47 and to a lesser extent on several other T4 genes thought to be involved in repair (P43, w and y). An infection defective in both P43 and P46 shows essentially no stimulation of the rate of P32 synthesis after irradiation. In the absence of DNA replication the parental DNA is degraded after irradiation in a dose-dependent manner. The extent of P32 induction in such an infection is also proportional to the dose. It is suggested that the production of gaps during repair of u.v.-irradiated DNA is responsible for the stimulation of P32 synthesis. A model is proposed in which such regions of single-stranded DNA compete for P32 by binding it nonspecifically, thus reducing the amount of P32 free to block the expression of gene 32. Because the expression of gene 32 is self-regulatory this would result in increased P32 synthesis. The possible role of P32 in the repair of u.v.-damaged DNA is discussed. (author)

  1. Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis

    DEFF Research Database (Denmark)

    Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

    2016-01-01

    was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...

  2. Recent insight in α-glucan metabolism in probiotic bacteria

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

    2014-01-01

    α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

  3. Ethylene-induced senescence-related gene expression requires protein synthesis

    International Nuclear Information System (INIS)

    Lawton, K.A.; Raghothama, K.G.; Woodson, W.R.

    1990-01-01

    We have investigated the effects of inhibiting protein synthesis on the ethylene-induced expression of 3 carnation senescence-related genes, pSR5, pSR8, and pSR12. Treatment of preclimacteric carnation petal discs with 1μg/ml of cycloheximide, a cytoplasmic protein synthesis inhibitor, for 3h inhibited protein synthesis by >80% as quantitated by the incorporation of [35S]methionine into protein. Pre-treatment of petal discs with cycloheximide prevented ethylene-induced SR transcript accumulation. Cycloheximide treatment of petal discs held in air did not result in increased levels of SR mRNA. These results indicate that ethylene does not interact with pre-formed factors but rather that the activation of SR gene expression by ethylene is mediated by labile protein factor(s) synthesized on cytoplasmic ribosomes. Experiments are currently underway to determine if cycloheximide exerts its effect at the transcriptional or post-transcriptional level

  4. Homology of genes for exopolysaccharide synthesis in Rhizobium leguminosarum and effect of cloned exo genes on nodule formation

    International Nuclear Information System (INIS)

    Skorupska, A.; Derylo, M.

    1993-01-01

    A 5.4 kb BamHI fragment of Rhizobium leguminosarum (R.l.) bv. trifolii TA1 was found to carry genes involved in exopolysaccharide synthesis (exo genes). This fragment was strongly hybridized to the total DNA from DNA from R.l. bv. viciae and bv. phaseoli digested with EcoRI. No homology was found with total DNA of R. melilotic and Rhizobium sp. NGR 234. The exo genes R.l. bv. trifolii TA1 conjugally introduced into R.l. bv. viciae 1302 considerably affected the symbiosis: the nodules induced on vetch were abortive and did not fix nitrogen. On the other hand, Phaseolus beans infected with R.l. bv. trifolii exo genes formed the nitrogen-fixing nodules. It can be conduced that additional copies of exo genes introduced into wild type R.l. strains can disturb the synthesis of acidic exopolysaccharides and affect symbiosis of the plants forming indeterminate nodules, but do not affect symbiosis of the plants forming the determinate nodules. (author). 29 refs, 2 figs, 2 tabs

  5. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    Directory of Open Access Journals (Sweden)

    Lei Anping

    2012-03-01

    Full Text Available Abstract Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP, 3-ketoacyl-ACP-synthase (KAS, and acyl-ACP thioesterase (FATA gene expression had significant correlations with monounsaturated FA (MUFA synthesis and polyunsaturated FA (PUFA synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production.

  6. Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers

    International Nuclear Information System (INIS)

    Dugger, W.M.; Palmer, R.L.

    1986-01-01

    The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system

  7. Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

    International Nuclear Information System (INIS)

    Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.; Yankovskii, N.K.; Debabov, V.G.

    1989-01-01

    Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector λpSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB + clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA + transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmids consistently transduced the markers thrB + and lysA + . The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes

  8. Identification and phylogenetic analysis of heme synthesis genes in trypanosomatids and their bacterial endosymbionts.

    Directory of Open Access Journals (Sweden)

    João M P Alves

    Full Text Available It has been known for decades that some insect-infecting trypanosomatids can survive in culture without heme supplementation while others cannot, and that this capability is associated with the presence of a betaproteobacterial endosymbiont in the flagellate's cytoplasm. However, the specific mechanisms involved in this process remained obscure. In this work, we sequence and phylogenetically analyze the heme pathway genes from the symbionts and from their hosts, as well as from a number of heme synthesis-deficient Kinetoplastida. Our results show that the enzymes responsible for synthesis of heme are encoded on the symbiont genomes and produced in close cooperation with the flagellate host. Our evidence suggests that this synergistic relationship is the end result of a history of extensive gene loss and multiple lateral gene transfer events in different branches of the phylogeny of the Trypanosomatidae.

  9. Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

    Science.gov (United States)

    Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

    2008-06-01

    Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

  10. In vitro incorporation of 14C-hexose-6-phosphat in mannan, β-glucan and glycogen of Candida spec. H and their mutants

    International Nuclear Information System (INIS)

    Roeber, B.; Reuter, G.

    1982-01-01

    Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)

  11. Identification of key genes involved in polysaccharide bioflocculant synthesis in Bacillus licheniformis.

    Science.gov (United States)

    Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning

    2017-03-01

    The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  12. Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

    Science.gov (United States)

    Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

    2008-03-20

    Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

  13. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  14. Gene composer: database software for protein construct design, codon engineering, and gene synthesis.

    Science.gov (United States)

    Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance

    2009-04-21

    To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease

  15. Gene Composer: database software for protein construct design, codon engineering, and gene synthesis

    Directory of Open Access Journals (Sweden)

    Mixon Mark

    2009-04-01

    Full Text Available Abstract Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene

  16. Histone gene expression remains coupled to DNA synthesis during in vitro cellular senescence

    International Nuclear Information System (INIS)

    Zambetti, G.; Stein, G.; Stein, J.; Dell'Orco, R.

    1987-01-01

    Despite a decrease in the extent to which confluent monolayers of late compared to early passage CF3 human diploid fibroblasts can be stimulated to proliferate, the time course of DNA synthesis onset is similar regardless of the in vitro age of the cells. A parallel and stoichiometric relationship is maintained between the rate of DNA synthesis and the cellular levels of histone mRNA independent of the age of the cell cultures. Furthermore, DNA synthesis and cellular histone mRNA levels decline in a coordinate manner after inhibition of DNA replication by hydroxyurea treatment. These results indicate that while the proliferative activity of human diploid fibroblasts decreases with passage in culture, those cells that retain the ability to proliferate continue to exhibit a tight coupling of DNA replication and histone gene expression

  17. An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

    2017-01-01

    binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

  18. Naringenin Regulates Expression of Genes Involved in Cell Wall Synthesis in Herbaspirillum seropedicae▿

    Science.gov (United States)

    Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.

    2011-01-01

    Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805

  19. Naringenin regulates expression of genes involved in cell wall synthesis in Herbaspirillum seropedicae.

    Science.gov (United States)

    Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A

    2011-03-01

    Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.

  20. ALGEBRAIC STRUCTURES AND SYNTHESIS PROTEIN: A DESCRIPTION OF GENE CAPN10

    Directory of Open Access Journals (Sweden)

    Obidio Rubio

    2016-06-01

    Full Text Available This article mainly informative, some ways of algebraic modeling of human genome sequences is presented, with special emphasis on describing mutations in the genes, which by modifying protein synthesis involve genetic diseases such as Diabetes Mellitus. Mutations as endomorphisms on an R-module, which consists of a direct sum of groups of sequences 2q37.3 gene, on the rings Z64 and Z125, where el haplotype compound for the polymorphisms SNP43, SNP19 and SNP63 occur.

  1. Various roles of beta-glucan in invertebrates

    Czech Academy of Sciences Publication Activity Database

    Větvička, V.; Šíma, Petr

    2017-01-01

    Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

  2. Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

    Science.gov (United States)

    Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

    2018-04-03

    Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

  3. Synthesis of bacteriophage-coded gene products during infection of Escherichia coli with amber mutants of T3 and T7 defective in gene 1

    DEFF Research Database (Denmark)

    Issinger, O G; Hausmann, R

    1973-01-01

    During nonpermissive infection by a T7 amber mutant in gene 1 (phage RNA polymerase-deficient), synthesis of the products of the phage genes 3 (endonuclease), 3, 5 (lysozyme), 5 (DNA polymerase), and 17 (serum blocking power) was shown to occur at about half the rate as during wild-type infection...

  4. First principles insight into the α-glucan structures of starch

    DEFF Research Database (Denmark)

    Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas

    2010-01-01

    A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....

  5. Preparation, characterization, and biological properties of β-glucans

    Directory of Open Access Journals (Sweden)

    Sandeep Rahar

    2011-01-01

    Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

  6. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    Energy Technology Data Exchange (ETDEWEB)

    Burke-Agueero, D.H.

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight bch'' genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  7. Molecular genetic and molecular evolutionary studies on the bacteriochlorophyll synthesis genes of Rhodobacter capsulatus

    Energy Technology Data Exchange (ETDEWEB)

    Burke-Agueero, Donald H. [Univ. of California, Berkeley, CA (United States)

    1992-08-01

    Rhodobacter capsulatus, purple bacterium capable of either aerobic or photosynthetic growth, has proven to be very useful in genetic studies of photosynthesis. Forty-four genes clustered together within a 46 kilobase region are required to establish photosynthetic ability in R. capsulatus. Approximately twenty of these genes are involved in bacteriochlorophyll synthesis of which eight ``bch`` genes are the subject of this thesis. Six of these genes were found to code for the two ring reductases. The first converts protochlorophyllide (PChlide) into a chlorin, the immediate precursor to chlorophyll a, and then into a bacteriochlorin. Each reductase is shown to be made up of three subunits. PChlide reductase is coded by the genes bchN, bchB, and bchL. Proteins with amino acid sequences markedly similar to those of bchN and bchL have been shown in other organisms to be required for chlorophyll synthesis; hence, their designation as chlN and chlB. A third chloroplast-encoded gene of heretofore unknown function shares amino acid identities with bchB and is probably the third subunit of the plant PChlide reductase. The bchA locus, which encodes the chlorin reductase, is found to be made up of three separate, translationally coupled genes, referred to as bchX, bchY, and bchZ. Amino acid similarities between bchX, bchL, and the nitrogenase reductase protein nifH suggest that all three classes of proteins share certain three-dimensional structural features, including elements that are central to the enzymatic mechanism of nifH. PChlide reductase and chlorin reductase are clearly derived from a common ancestor. Several lines of analysis suggests the ancestor of both enzyme systems reduced PChlide twice to produce bacteriochlorophyll supporting the concept bacteriochlorophyll as the ancestral reaction center pigment.

  8. Circadian rhythm genes mediate fenvalerate-induced inhibition of testosterone synthesis in mouse Leydig cells.

    Science.gov (United States)

    Guo, Yichen; Shen, Ouxi; Han, Jingjing; Duan, Hongyu; Yang, Siyuan; Zhu, Zhenghong; Tong, Jian; Zhang, Jie

    2017-01-01

    Fenvalerate (Fen), a widely used pesticide, is known to impair male reproductive functions by mechanisms that remain to be elucidated. Recent studies indicated that circadian clock genes may play an important role in successful male reproduction. The aim of this study was to determine the effects of Fen on circadian clock genes involved in the biosynthesis of testosterone using TM3 cells derived from mouse Leydig cells. Data demonstrated that the circadian rhythm of testosterone synthesis in TM3 cells was disturbed following Fen treatment as evidenced by changes in the circadian rhythmicity of core clock genes (Bmal1, Rev-erbα, Rorα). Further, the observed altered rhythms were accompanied by increased intracellular Ca 2+ levels and modified steroidogenic acute regulatory (StAR) mRNA expression. Thus, data suggested that Fen inhibits testosterone synthesis via pathways involving intracellular Ca 2+ and clock genes (Bmal1, Rev-Erbα, Rorα) as well as StAR mRNA expression in TM3 cells.

  9. DnaB gene product-independence of DNA polymerase III-directed repair synthesis in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Billen, D.; Hellermann, G.R.

    1977-01-01

    An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)

  10. Evaluation on prebiotic properties of β-glucan and oligo-β-glucan from mushrooms by human fecal microbiota in fecal batch culture

    Directory of Open Access Journals (Sweden)

    Chiraphon Chaikliang

    2015-11-01

    Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of

  11. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  12. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  13. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  14. Induced tubulin synthesis is caused by induced gene transcription in Tetrahymena

    International Nuclear Information System (INIS)

    Seyfert, H.M.; Kohle, D.; Jenovai, S.

    1987-01-01

    Tubulin synthesis and tubulin mRNA concentrations increase to variable extents during ciliary regeneration in the ciliate Tetrahymena. Experiments described here were carried out to determine whether the increased tubulin mRNa concentrations are due to induced transcription of tubulin genes or to stabilization of tubulin mRNA. In vivo labeling experiments with [ 3 H]uridine and in vitro transcription assays suggest that under conditions of increased protein and tubulin synthesis the rate of transcription is enhanced. Hybridization assays of in vitro transcribed RNA also demonstrate qualitatively that the tubulin genes are transcribed at higher rates when tubulin synthesis is stimulated during ciliary regeneration. This observation is supported by measurements of the half-life of tubulin mRNA molecules in nondeciliated cells: This is approximately 2 h. Since the concentration of tubulin mRNA in cells engaged in cilia regeneration increases from 5 to 19-fold during the first hour of the regeneration period, even a complete stabilization of the tubulin mRNA molecules could not account for an increase in tubulin mRNA concentration of this magnitude

  15. A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

    Science.gov (United States)

    Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

    2017-07-15

    Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

  16. Genetic mapping of the regulator gene determining enterotoxin synthesis in Vibrio cholerae

    International Nuclear Information System (INIS)

    Smirnova, N.I.; Livanova, L.F.; Shaginyan, I.A.; Motin, V.L.

    1986-01-01

    Data on the genetic mapping of mutation tox-7 (the mutation affecting the synthesis of the cholera toxin) were obtained by conjugation crosses between the atoxigenic donor strain Vibrio cholerae Eltor and the toxigenic recipient strain V. cholera classica. The molecular and genetic analysis of the Tox - recombinants indicated that, when the synthesis of the cholera toxin is disrupted in these strains, the tox-7 mutation (which impairs the regulator gene tox) is gained. Close linkage between the tox-7 and pur-63 mutations was established (during the selection procedure there was 81.1% combined transfer with respect to marker pur-63 situated in the donor strain chromosome more proximal than mutation tox-7). The markers were localized in the following order in the region under investigation: asp-cys-nal-pur-61-trp-his-pur-63-tox-7-ile

  17. A simple and accurate two-step long DNA sequences synthesis strategy to improve heterologous gene expression in pichia.

    Directory of Open Access Journals (Sweden)

    Jiang-Ke Yang

    Full Text Available In vitro gene chemical synthesis is a powerful tool to improve the expression of gene in heterologous system. In this study, a two-step gene synthesis strategy that combines an assembly PCR and an overlap extension PCR (AOE was developed. In this strategy, the chemically synthesized oligonucleotides were assembled into several 200-500 bp fragments with 20-25 bp overlap at each end by assembly PCR, and then an overlap extension PCR was conducted to assemble all these fragments into a full length DNA sequence. Using this method, we de novo designed and optimized the codon of Rhizopus oryzae lipase gene ROL (810 bp and Aspergillus niger phytase gene phyA (1404 bp. Compared with the original ROL gene and phyA gene, the codon-optimized genes expressed at a significantly higher level in yeasts after methanol induction. We believe this AOE method to be of special interest as it is simple, accurate and has no limitation with respect to the size of the gene to be synthesized. Combined with de novo design, this method allows the rapid synthesis of a gene optimized for expression in the system of choice and production of sufficient biological material for molecular characterization and biotechnological application.

  18. Ancestral gene reconstruction and synthesis of ancient rhodopsins in the laboratory.

    Science.gov (United States)

    Chang, Belinda S W

    2003-08-01

    Laboratory synthesis of ancestral proteins offers an intriguing opportunity to study the past directly. The development of Bayesian methods to infer ancestral sequences, combined with advances in models of molecular evolution, and synthetic gene technology make this an increasingly promising approach in evolutionary studies of molecular function. Visual pigments form the first step in the biochemical cascade of events in the retina in all animals known to possess visual capabilities. In vertebrates, the necessity of spanning a dynamic range of light intensities of many orders of magnitude has given rise to two different types of photoreceptors, rods specialized for dim-light conditions, and cones for daylight and color vision. These photoreceptors contain different types of visual pigment genes. Reviewed here are methods of inferring ancestral sequences, chemical synthesis of artificial ancestral genes in the laboratory, and applications to the evolution of vertebrate visual systems and the experimental recreation of an archosaur rod visual pigment. The ancestral archosaurs gave rise to several notable lineages of diapsid reptiles, including the birds and the dinosaurs, and would have existed over 200 MYA. What little is known of their physiology comes from fossil remains, and inference based on the biology of their living descendants. Despite its age, an ancestral archosaur pigment was successfully recreated in the lab, and showed interesting properties of its wavelength sensitivity that may have implications for the visual capabilities of the ancestral archosaurs in dim light.

  19. Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

    Science.gov (United States)

    Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

    2018-05-01

    Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

  20. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  1. Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.

    Science.gov (United States)

    Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q

    2011-09-01

    EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    D. El Khoury

    2012-01-01

    Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.

  3. Concurrent synthesis and release of nod-gene-inducing flavonoids from alfalfa roots

    International Nuclear Information System (INIS)

    Maxwell, C.A.; Phillips, D.A.

    1990-01-01

    Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4',7-dihydroxyflavanone, 4',7-dihydroxyflavone, and 4,4'-dihydroxy-2'-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with [U- 14 C]-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained 14 C. In the presence of AOPP, 14 C labeling and release of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth

  4. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  5. Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

    NARCIS (Netherlands)

    Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

    2015-01-01

    β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

  6. Structure and function of α-glucan debranching enzymes

    DEFF Research Database (Denmark)

    Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

    2016-01-01

    α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

  7. DNA repair genes RAD52 and SRS2, a cell wall synthesis regulator gene SMI1, and the membrane sterol synthesis scaffold gene ERG28 are important in efficient Agrobacterium-mediated yeast transformation with chromosomal T-DNA.

    Science.gov (United States)

    Ohmine, Yuta; Satoh, Yukari; Kiyokawa, Kazuya; Yamamoto, Shinji; Moriguchi, Kazuki; Suzuki, Katsunori

    2016-04-02

    Plant pathogenic Agrobacterium strains can transfer T-DNA regions of their Ti plasmids to a broad range of eukaryotic hosts, including fungi, in vitro. In the recent decade, the yeast Saccharomyces cerevisiae is used as a model host to reveal important host proteins for the Agrobacterium-mediated transformation (AMT). Further investigation is required to understand the fundamental mechanism of AMT, including interaction at the cell surface, to expand the host range, and to develop new tools. In this study, we screened a yeast mutant library for low AMT mutant strains by advantage of a chromosome type T-DNA, which transfer is efficient and independent on integration into host chromosome. By the mutant screening, we identified four mutant strains (srs2Δ, rad52Δ, smi1Δ and erg28Δ), which showed considerably low AMT efficiency. Structural analysis of T-DNA product replicons in AMT colonies of mutants lacking each of the two DNA repair genes, SRS2 and RAD52, suggested that the genes act soon after T-DNA entry for modification of the chromosomal T-DNA to stably maintain them as linear replicons and to circularize certain T-DNA simultaneously. The cell wall synthesis regulator SMI1 might have a role in the cell surface interaction between the donor and recipient cells, but the smi1Δ mutant exhibited pleiotropic effect, i.e. low effector protein transport as well as low AMT for the chromosomal T-DNA, but relatively high AMT for integrative T-DNAs. The ergosterol synthesis regulator/enzyme-scaffold gene ERG28 probably contributes by sensing a congested environment, because growth of erg28Δ strain was unaffected by the presence of donor bacterial cells, while the growth of the wild-type and other mutant yeast strains was suppressed by their presence. RAD52 and the DNA helicase/anti-recombinase gene SRS2 are necessary to form and maintain artificial chromosomes through the AMT of chromosomal T-DNA. A sterol synthesis scaffold gene ERG28 is important in the high

  8. Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329

    Science.gov (United States)

    Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos

    2013-01-01

    Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729

  9. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp.

    Directory of Open Access Journals (Sweden)

    T. Catalina Adarme-Vega

    2014-06-01

    Full Text Available With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA to C20:4 eicosatetraenoic acid (ETA, correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4, but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt.

  10. Genome-wide identification, phylogenetic analysis, and expression profiling of polyamine synthesis gene family members in tomato.

    Science.gov (United States)

    Liu, Taibo; Huang, Binbin; Chen, Lin; Xian, Zhiqiang; Song, Shiwei; Chen, Riyuan; Hao, Yanwei

    2018-06-30

    Polyamines (PAs), including putrescine (Put), spermidine (Spd), spermine (Spm), and thermospermine (T-Spm), play key roles in plant development, including fruit setting and ripening, morphogenesis, and abiotic/biotic stress. Their functions appear to be intimately related to their synthesis, which occurs via arginine/ornithine decarboxylase (ADC/ODC), Spd synthase (SPDS), Spm synthase (SPMS), and Acaulis5 (ACL5), respectively. Unfortunately, the expression and function of these PA synthesis-relate genes during specific developmental process or under stress have not been fully elucidated. Here, we present the results of a genome-wide analysis of the PA synthesis genes (ADC, ODC, SPDS, SPMS, ACL5) in the tomato (Solanum lycopersicum). In total, 14 PA synthesis-related genes were identified. Further analysis of their structures, conserved domains, phylogenetic trees, predicted subcellular localization, and promoter cis-regulatory elements were analyzed. Furthermore, we also performed experiments to evaluate their tissue expression patterns and under hormone and various stress treatments. To our knowledge, this is the first study to elucidate the mechanisms underlying PA function in this variety of tomato. Taken together, these data provide valuable information for future functional characterization of specific genes in the PA synthesis pathway in this and other plant species. Although additional research is required, the insight gained by this and similar studies can be used to improve our understanding of PA metabolism ultimately leading to more effective and consistent plant cultivation. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

    Science.gov (United States)

    Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

    2013-03-01

    The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

  12. Suppressing effects of glucan on micronuclei induced by Co60 in mice

    International Nuclear Information System (INIS)

    Chorvatovicova, D.

    1991-01-01

    The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

  13. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  14. Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

    Directory of Open Access Journals (Sweden)

    JD Biller-Takahashi

    Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

  15. Aquatic contaminants alter genes involved in neurotransmitter synthesis and gonadotropin release in largemouth bass

    Energy Technology Data Exchange (ETDEWEB)

    Martyniuk, Christopher J. [Department of Physiological Sciences and Center for Environmental and Human Toxicology, University of Florida, Gainesville, FL 32611 (United States); Sanchez, Brian C. [Department of Forestry and Natural Resources and School of Civil Engineering, 195 Marsteller St., Purdue University, West Lafayette, IN 47907 (United States); Szabo, Nancy J.; Denslow, Nancy D. [Department of Physiological Sciences and Center for Environmental and Human Toxicology, University of Florida, Gainesville, FL 32611 (United States); Sepulveda, Maria S., E-mail: mssepulv@purdue.edu [Department of Forestry and Natural Resources and School of Civil Engineering, 195 Marsteller St., Purdue University, West Lafayette, IN 47907 (United States)

    2009-10-19

    Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens ({mu}g/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl{sub 2}) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 {mu}g/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 {mu}g/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 {mu}g/g) but increased cGnRH-II mRNA at the lowest dose (5 {mu}g/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants.

  16. Aquatic contaminants alter genes involved in neurotransmitter synthesis and gonadotropin release in largemouth bass

    International Nuclear Information System (INIS)

    Martyniuk, Christopher J.; Sanchez, Brian C.; Szabo, Nancy J.; Denslow, Nancy D.; Sepulveda, Maria S.

    2009-01-01

    Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens (μg/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl 2 ) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 μg/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 μg/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 μg/g) but increased cGnRH-II mRNA at the lowest dose (5 μg/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants.

  17. Aquatic contaminants alter genes involved in neurotransmitter synthesis and gonadotropin release in largemouth bass.

    Science.gov (United States)

    Martyniuk, Christopher J; Sanchez, Brian C; Szabo, Nancy J; Denslow, Nancy D; Sepúlveda, Maria S

    2009-10-19

    Many aquatic contaminants potentially affect the central nervous system, however the underlying mechanisms of how toxicants alter normal brain function are not well understood. The objectives of this study were to compare the effects of emerging and prevalent environmental contaminants on the expression of brain transcripts with a role in neurotransmitter synthesis and reproduction. Adult male largemouth bass (Micropterus salmoides) were injected once for a 96 h duration with control (water or oil) or with one of two doses of a single chemical to achieve the following body burdens (microg/g): atrazine (0.3 and 3.0), toxaphene (10 and 100), cadmium (CdCl(2)) (0.000067 and 0.00067), polychlorinated biphenyl (PCB) 126 (0.25 and 2.5), and phenanthrene (5 and 50). Partial largemouth bass gene segments were cloned for enzymes involved in neurotransmitter (glutamic acid decarboxylase 65, GAD65; tyrosine hydroxylase) and estrogen (brain aromatase; CYP19b) synthesis for real-time PCR assays. In addition, neuropeptides regulating feeding (neuropeptide Y) and reproduction (chicken GnRH-II, cGnRH-II; salmon GnRH, sGnRH) were also investigated. Of the chemicals tested, only cadmium, PCB 126, and phenanthrene showed any significant effects on the genes tested, while atrazine and toxaphene did not. Cadmium (0.000067 microg/g) significantly increased cGnRH-II mRNA while PCB 126 (0.25 microg/g) decreased GAD65 mRNA. Phenanthrene decreased GAD65 and tyrosine hydroxylase mRNA levels at the highest dose (50 microg/g) but increased cGnRH-II mRNA at the lowest dose (5 microg/g). CYP19b, NPY, and sGnRH mRNA levels were unaffected by any of the treatments. A hierarchical clustering dendrogram grouped PCB 126 and phenanthrene more closely than other chemicals with respect to the genes tested. This study demonstrates that brain transcripts important for neurotransmitter synthesis neuroendocrine function are potential targets for emerging and prevalent aquatic contaminants.

  18. Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

    Science.gov (United States)

    Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

    2017-07-18

    Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

  19. β-Glucans: Relationships between Modification, Conformation and Functional Activities

    Directory of Open Access Journals (Sweden)

    Qiang Wang

    2017-02-01

    Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

  20. Long-lived effects of administering β-glucans

    NARCIS (Netherlands)

    Petit, Jules; Wiegertjes, Geert F.

    2016-01-01

    Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

  1. Immunostimulatory properties and antitumor activities of glucans (Review)

    Czech Academy of Sciences Publication Activity Database

    Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

    2013-01-01

    Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

  2. Towards a more versatile alpha-glucan biosynthesis in plants

    NARCIS (Netherlands)

    Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.

    2003-01-01

    Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated

  3. Synthesis of substrates for gene therapy monitoring of HSV1-TK system

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Tae Hyun; Ahn, Soon Hyuk; Choi, Chang Woon; Lim, Sang Moo; Awh, Ok Doo [College of Medicine, Yonsei Univ., Wonju (Korea, Republic of)

    2002-04-01

    In gene therapy, tumor cells expressing the herpes simplex virus thymidine kinase are sensitive to prodrugs. Potential prodrugs IVDU and IVFRU were synthesized and radiolabeled with radioiodine for noninvasive imaging of herpes simplex virus type 1 gene expression. 5-(2-trimethysilyl) vinyl-2'-deoxyuridine and 5-t(2-trimethylsilyl)vinyl-2'-fluoro-2'-deoxyuridine, precursors of 5-(2-iodo)viny 1-2'-deoxy uridine(IVDU) and 5-(2-iodo)-2'-vinyl-2'-deoxy-2'-fluorotibofuranosyl uracil(IVFRU), were synthesized from reaction of trans-1-trimethylsillyl-2-tri-n-butylstannylethylene with 5-iodo-2'-deoxyuridine and 5-iodo-2'-fluoro-2'-deoxyuridine, respectively, on the condition of Pd catalyst. These precursors were separated from reaction mixture by silica gel column chromatography method. Each precursor was radioiodinated with radioiodine by mixing with ICI oxidizing agent. These radioiodinated compounds were purified with HPLC. Radiohalogen exchange has been shown to be effective for the synthesis of products with lower specific activity. Similarly, carrier-added and high specific activity products have been isolated in respectable radiochemical yields using ICI method. Synthetic yield of precursors, IVDU and IVFRU were 43% and 18%, respectively. Radiochemical purity of both compunds was over 98%. We synthesized precursors of IVDU and IVFRU for monitoring of HSV1-tk gene expression. Radiotracers were radioiodinated with high radiolabeling yield by ICI method.

  4. Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2010-07-01

    In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

  5. Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

    International Nuclear Information System (INIS)

    Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

    2010-01-01

    In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

  6. Local NSAID infusion does not affect protein synthesis and gene expression in human muscle after eccentric exercise

    DEFF Research Database (Denmark)

    Mikkelsen, U R; Schjerling, P; Helmark, Ida Carøe

    2010-01-01

    models, and inhibit the exercise-induced satellite cell proliferation and protein synthesis in humans. However, the cellular mechanisms eliciting these responses remain unknown. Eight healthy male volunteers performed 200 maximal eccentric contractions with each leg. To block prostaglandin synthesis...... locally in the skeletal muscle, indomethacin (NSAID) was infused for 7.5 h via microdialysis catheters into m. vastus lateralis of one leg. Protein synthesis was determined by the incorporation of 1,2-(13)C(2) leucine into muscle protein from 24 to 28 h post-exercise. Furthermore, mRNA expression...... of selected genes was measured in muscle biopsies (5 h and 8 days post-exercise) by real-time reverse transcriptase PCR. Myofibrillar and collagen protein synthesis were unaffected by the local NSAID infusion. Five hours post-exercise, the mRNA expression of cyclooxygenase-2 (COX2) was sixfold higher...

  7. Sugar-mediated semidian oscillation of gene expression in the cassava storage root regulates starch synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, Christer; Baguma, Yona; Sun, Chuanxin; Boren, Mats; Olsson, Helena; Rosenqvist, Sara; Mutisya, Joel; Rubaihayo, Patrick R.; Jansson, Christer

    2008-01-15

    Starch branching enzyme (SBE) activity in the cassava storage root exhibited a diurnal fluctuation, dictated by a transcriptional oscillation of the corresponding SBE genes. The peak of SBE activity coincided with the onset of sucrose accumulation in the storage, and we conclude that the oscillatory mechanism keeps the starch synthetic apparatus in the storage root sink in tune with the flux of sucrose from the photosynthetic source. When storage roots were uncoupled from the source, SBE expression could be effectively induced by exogenous sucrose. Turanose, a sucrose isomer that cannot be metabolized by plants, mimicked the effect of sucrose, demonstrating that downstream metabolism of sucrose was not necessary for signal transmission. Also glucose and glucose-1-P induced SBE expression. Interestingly, induction by sucrose, turanose and glucose but not glucose-1-P sustained an overt semidian (12-h) oscillation in SBE expression and was sensitive to the hexokinase (HXK) inhibitor glucosamine. These results suggest a pivotal regulatory role for HXK during starch synthesis. Abscisic acid (ABA) was another potent inducer of SBE expression. Induction by ABA was similar to that of glucose-1-P in that it bypassed the semidian oscillator. Both the sugar and ABA signaling cascades were disrupted by okadaic acid, a protein phosphatase inhibitor. Based on these findings, we propose a model for sugar signaling in regulation of starch synthesis in the cassava storage root.

  8. An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

    Science.gov (United States)

    Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

    2017-06-15

    Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

  9. Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

    Directory of Open Access Journals (Sweden)

    Fhernanda R Smiderle

    Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

  10. A single gene directs synthesis of a precursor protein with beta- and alpha-amylase activities in Bacillus polymyxa.

    OpenAIRE

    Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S

    1989-01-01

    The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other a...

  11. Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

    Directory of Open Access Journals (Sweden)

    Shewmaker Christine K

    2010-10-01

    Full Text Available Abstract Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD 2 and fatty acid elongase (FAE 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general

  12. Terminator Operon Reporter: combining a transcription termination switch with reporter technology for improved gene synthesis and synthetic biology applications.

    Science.gov (United States)

    Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison

    2016-05-25

    Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.

  13. Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

    Energy Technology Data Exchange (ETDEWEB)

    Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

    1991-10-01

    The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

  14. Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

    Directory of Open Access Journals (Sweden)

    Vesna Zechner-Krpan

    2010-01-01

    Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

  15. One-Pot Parallel Synthesis of Lipid Library via Thiolactone Ring Opening and Screening for Gene Delivery.

    Science.gov (United States)

    Molla, Mijanur R; Böser, Alexander; Rana, Akshita; Schwarz, Karina; Levkin, Pavel A

    2018-04-18

    Efficient delivery of nucleic acids into cells is of great interest in the field of cell biology and gene therapy. Despite a lot of research, transfection efficiency and structural diversity of gene-delivery vectors are still limited. A better understanding of the structure-function relationship of gene delivery vectors is also essential for the design of novel and intelligent delivery vectors, efficient in "difficult-to-transfect" cells and in vivo clinical applications. Most of the existing strategies for the synthesis of gene-delivery vectors require multiple steps and lengthy procedures. Here, we demonstrate a facile, three-component one-pot synthesis of a combinatorial library of 288 structurally diverse lipid-like molecules termed "lipidoids" via a thiolactone ring opening reaction. This strategy introduces the possibility to synthesize lipidoids with hydrophobic tails containing both unsaturated bonds and reducible disulfide groups. The whole synthesis and purification are convenient, extremely fast, and can be accomplished within a few hours. Screening of the produced lipidoids using HEK293T cells without addition of helper lipids resulted in identification of highly stable liposomes demonstrating ∼95% transfection efficiency with low toxicity.

  16. Contribution of glucan-binding protein A to firm and stable biofilm formation by Streptococcus mutans.

    Science.gov (United States)

    Matsumi, Y; Fujita, K; Takashima, Y; Yanagida, K; Morikawa, Y; Matsumoto-Nakano, M

    2015-06-01

    Glucan-binding proteins (Gbps) of Streptococcus mutans, a major pathogen of dental caries, mediate the binding of glucans synthesized from sucrose by the action of glucosyltransferases (GTFs) encoded by gtfB, gtfC, and gtfD. Several stress proteins, including DnaK and GroEL encoded by dnaK and groEL, are related to environmental stress tolerance. The contribution of Gbp expression to biofilm formation was analyzed by focusing on the expression levels of genes encoding GTFs and stress proteins. Biofilm-forming assays were performed using GbpA-, GbpB-, and GbpC-deficient mutant strains and the parental strain MT8148. The expression levels of gtfB, gtfC, gtfD, dnaK, and groEL were evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Furthermore, the structure of biofilms formed by these Gbp-deficient mutant strains was observed using confocal laser scanning microscopy (CLSM). Biofilm-forming assay findings demonstrated that the amount formed by the GbpA-deficient mutant strain (AD1) was nearly the same as that by the parental strain, while the GbpB- and GbpC-deficient mutant strains produced lower amounts than MT8148. Furthermore, RT-qPCR assay results showed that the expressions of gtfB, dnaK, and groEL in AD1 were elevated compared with MT8148. CLSM also revealed that the structure of biofilm formed by AD1 was prominently different compared with that formed by the parental strain. These results suggest that a defect in GbpA influences the expression of genes controlling biofilm formation, indicating its importance as a protein for firm and stable biofilm formation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Association Mapping of Cell Wall Synthesis Regulatory Genes and Cell Wall Quality in Switchgrass

    Energy Technology Data Exchange (ETDEWEB)

    Bartley, Laura [Univ. of Oklahoma, Norman, OK (United States). Dept. of Microbiology and Plant Biology; Wu, Y. [Oklahoma State Univ., Stillwater, OK (United States); Zhu, L. [Oklahoma State Univ., Stillwater, OK (United States); Brummer, E. C. [Noble Foundation, Ardmore, OK (United States); Saha, M. [Noble Foundation, Ardmore, OK (United States)

    2016-05-31

    markers might be used to select switchgrass genotypes with improved composition in breeding programs for biofuel and forage production. Because the SSAC continues to be characterized by collaborators in the bioenergy community, the data generated will be used to identify additional markers in higher resolution genotyping data to approach identifying the genes and alleles that cause natural variation in switchgrass cell wall quality. For example, these markers can be surveyed in the 2100-member Oklahoma Southern and Northern Lowland switchgrass collections that this project also characterized. An orthogonal approach to biodiversity studies, using comparative functional genomics permits systematic querying of how much regulatory information is likely to be transferable from dicots to grasses and use of accumulated functional genomics resources for better-characterized grass species, such as rice, itself a biomass source in global agriculture and in certain regions. The project generated and tested a number of specific hypotheses regarding cell wall transcription factors and enzymes of grasses. To aid identification of cell wall regulators, the project assembled a novel, highdepth and -quality gene association network using a general linearized model scoring system to combine rice gene network data. Using known or putative orthologs of Arabidopsis cell wall biosynthesis genes and regulators, the project pulled from this network a cell wall sub-network that includes 96 transcription factors. Reverse genetics of a co-ortholog of the Arabidopsis MYB61 transcription factor in rice revealed that this regulatory node has evolved the ability to regulate grass-specific cell wall synthesis enzymes. A transcription factor with such activity has not been previously characterized to our knowledge, representing a major conclusion of this work. Changes in gene expression in a protoplast-based assay demonstrated positive or negative roles in cell wall regulation for eleven other

  18. Ndrg2 is a PGC-1α/ERRα target gene that controls protein synthesis and expression of contractile-type genes in C2C12 myotubes.

    Science.gov (United States)

    Foletta, Victoria C; Brown, Erin L; Cho, Yoshitake; Snow, Rod J; Kralli, Anastasia; Russell, Aaron P

    2013-12-01

    The stress-responsive, tumor suppressor N-myc downstream-regulated gene 2 (Ndrg2) is highly expressed in striated muscle. In response to anabolic and catabolic signals, Ndrg2 is suppressed and induced, respectively, in mouse C2C12 myotubes. However, little is known about the mechanisms regulating Ndrg2 expression in muscle, as well as the biological role for Ndrg2 in differentiated myotubes. Here, we show that Ndrg2 is a target of a peroxisome proliferator-activated receptor-gamma coactivator-1α (PGC-1α) and estrogen-related receptor alpha (ERRα) transcriptional program and is induced in response to endurance exercise, a physiological stress known also to increase PGC-1α/ERRα activity. Analyses of global gene and protein expression profiles in C2C12 myotubes with reduced levels of NDRG2, suggest that NDRG2 affects muscle growth, contractile properties, MAPK signaling, ion and vesicle transport and oxidative phosphorylation. Indeed, suppression of NDRG2 in myotubes increased protein synthesis and the expression of fast glycolytic myosin heavy chain isoforms, while reducing the expression of embryonic myosin Myh3, other contractile-associated genes and the MAPK p90 RSK1. Conversely, enhanced expression of NDRG2 reduced protein synthesis, and furthermore, partially blocked the increased protein synthesis rates elicited by a constitutively active form of ERRα. In contrast, suppressing or increasing levels of NDRG2 did not affect mRNA expression of genes involved in mitochondrial biogenesis that are regulated by PGC-1α or ERRα. This study shows that in C2C12 myotubes Ndrg2 is a novel PGC-1α/ERRα transcriptional target, which influences protein turnover and the regulation of genes involved in muscle contraction and function. © 2013 Elsevier B.V. All rights reserved.

  19. Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

    Directory of Open Access Journals (Sweden)

    Ernesto R. Soto

    2012-01-01

    Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

  20. Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

    Science.gov (United States)

    Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

    2015-07-20

    Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

    Directory of Open Access Journals (Sweden)

    Akira Yoshimi

    2017-11-01

    Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

  2. β-glucan extract from oat bran and its industrial importance

    Science.gov (United States)

    Ibrahim, M. N. G.; Selezneva, I. S.

    2017-09-01

    The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

  3. A Dual-Promoter Gene Orchestrates the Sucrose-Coordinated Synthesis of Starch and Fructan in Barley

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Yunkai; Fei, Mingliang; Rosenquist, Sara; Jin, Lu; Gohil, Suresh; Sandström, Corine; Olsson, Helena; Persson, Cecilia; Höglund, Anna-Stina; Fransson, Gunnel; Ruan, Ying; Åman, Per; Jansson, Christer; Liu, Chunlin; Andersson, Roger; Sun, Chuanxin

    2017-12-01

    Starch and fructan are two important carbohydrates in many flowering plants and in human diets. Understanding how plants allocate photosynthates and how they prioritize synthesis of different carbohydrates during development is essential in efforts to improve cereals for increased stress tolerance and for desirable carbohydrate compositions in food and feed. We report the coordinated synthesis of starch and fructan in barley, orchestrated by two functionally opposing transcription factors encoded from two alternative promoters, one intronic/exonic, harbored on a single gene. . This dual-transcription factor system employs an autoregulatory, antagonsitic mechanism in sensing sucrose at one promoter, potentially via sucrose/glucose/fructose/trehalose 6-phosphate signaling, and conduct a coordinated synthesis of starch and fructan synthesis by competitive transcription factor binding to the second promoter The finding of an intron/exon-spanning promoter in a hosting gene, resulting in proteins with distinct functions, contributes to our appreciation of the complexity of the plant genome As a case in point for the physiological role of the antagonistic transcription factor system, we have demonstrated that it can be exploited in breeding barley with tailored amounts of fructan for production of specialty food ingredients.

  4. Rice leaf hydrophobicity and gas films are conferred by a wax synthesis gene (LGF1) and contribute to flood tolerance

    DEFF Research Database (Denmark)

    Kurokawa, Yusuke; Nagai, Keisuke; Hung, Phung Danh

    2018-01-01

    Floods impede gas (O2and CO2) exchange between plants and the environment. A mechanism to enhance plant gas exchange under water comprises gas films on hydrophobic leaves, but the genetic regulation of this mechanism is unknown. We used a rice mutant (dripping wet leaf 7, drp7) which does...... not retain gas films on leaves, and its wild-type (Kinmaze), in gene discovery for this trait. Gene complementation was tested in transgenic lines. Functional properties of leaves as related to gas film retention and underwater photosynthesis were evaluated. Leaf Gas Film 1 (LGF1) was identified as the gene...... determining leaf gas films. LGF1 regulates C30 primary alcohol synthesis, which is necessary for abundant epicuticular wax platelets, leaf hydrophobicity and gas films on submerged leaves. This trait enhanced underwater photosynthesis 8.2-fold and contributes to submergence tolerance. Gene function...

  5. Synthesis and Gene Silencing Properties of siRNAs Containing Terminal Amide Linkages

    Directory of Open Access Journals (Sweden)

    Maria Gaglione

    2014-01-01

    Full Text Available The active components of the RNAi are 21 nucleotides long dsRNAs containing a 2 nucleotide overhang at the 3′ end, carrying 5′-phosphate and 3′-hydroxyl groups (siRNAs. Structural analysis revealed that the siRNA is functionally bound at both ends to RISC. Terminal modifications are considered with interest as the introduction of chemical moieties interferes with the 3′ overhang recognition by the PAZ domain and the 5′-phosphate recognition by the MID and PIWI domains of RISC. Herein, we report the synthesis of modified siRNAs containing terminal amide linkages by introducing hydroxyethylglycine PNA (hegPNA moieties at 5′, and at 3′ positions and on both terminals. Results of gene silencing studies highlight that some of these modifications are compatible with the RNAi machinery and markedly increase the resistance to serum-derived nucleases even after 24 h of incubation. Molecular docking simulations were attained to give at atomistic level a clearer picture of the effect of the most performing modifications on the interactions with the human Argonaute 2 PAZ, MID, and PIWI domains. This study adds another piece to the puzzle of the heterogeneous chemical modifications that can be attained to enhance the silencing efficiency of siRNAs.

  6. Histone deacetylase inhibition decreases cholesterol levels in neuronal cells by modulating key genes in cholesterol synthesis, uptake and efflux.

    Directory of Open Access Journals (Sweden)

    Maria João Nunes

    Full Text Available Cholesterol is an essential component of the central nervous system and increasing evidence suggests an association between brain cholesterol metabolism dysfunction and the onset of neurodegenerative disorders. Interestingly, histone deacetylase inhibitors (HDACi such as trichostatin A (TSA are emerging as promising therapeutic approaches in neurodegenerative diseases, but their effect on brain cholesterol metabolism is poorly understood. We have previously demonstrated that HDACi up-regulate CYP46A1 gene transcription, a key enzyme in neuronal cholesterol homeostasis. In this study, TSA was shown to modulate the transcription of other genes involved in cholesterol metabolism in human neuroblastoma cells, namely by up-regulating genes that control cholesterol efflux and down-regulating genes involved in cholesterol synthesis and uptake, thus leading to an overall decrease in total cholesterol content. Furthermore, co-treatment with the amphipathic drug U18666A that can mimic the intracellular cholesterol accumulation observed in cells of Niemman-Pick type C patients, revealed that TSA can ameliorate the phenotype induced by pathological cholesterol accumulation, by restoring the expression of key genes involved in cholesterol synthesis, uptake and efflux and promoting lysosomal cholesterol redistribution. These results clarify the role of TSA in the modulation of neuronal cholesterol metabolism at the transcriptional level, and emphasize the idea of HDAC inhibition as a promising therapeutic tool in neurodegenerative disorders with impaired cholesterol metabolism.

  7. Co-ordinate transcriptional regulation of dopamine synthesis genes by alpha-synuclein in human neuroblastoma cell lines.

    Science.gov (United States)

    Baptista, Melisa J; O'Farrell, Casey; Daya, Sneha; Ahmad, Rili; Miller, David W; Hardy, John; Farrer, Matthew J; Cookson, Mark R

    2003-05-01

    Abnormal accumulation of alpha-synuclein in Lewy bodies is a neuropathological hallmark of both sporadic and familial Parkinson's disease (PD). Although mutations in alpha-synuclein have been identified in autosomal dominant PD, the mechanism by which dopaminergic cell death occurs remains unknown. We investigated transcriptional changes in neuroblastoma cell lines transfected with either normal or mutant (A30P or A53T) alpha-synuclein using microarrays, with confirmation of selected genes by quantitative RT-PCR. Gene products whose expression was found to be significantly altered included members of diverse functional groups such as stress response, transcription regulators, apoptosis-inducing molecules, transcription factors and membrane-bound proteins. We also found evidence of altered expression of dihydropteridine reductase, which indirectly regulates the synthesis of dopamine. Because of the importance of dopamine in PD, we investigated the expression of all the known genes in dopamine synthesis. We found co-ordinated downregulation of mRNA for GTP cyclohydrolase, sepiapterin reductase (SR), tyrosine hydroxylase (TH) and aromatic acid decarboxylase by wild-type but not mutant alpha-synuclein. These were confirmed at the protein level for SR and TH. Reduced expression of the orphan nuclear receptor Nurr1 was also noted, suggesting that the co-ordinate regulation of dopamine synthesis is regulated through this transcription factor.

  8. Dietary β-glucan (MacroGard®) enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism and microbiota.

    Science.gov (United States)

    Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H

    2016-01-01

    Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. 6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

    Science.gov (United States)

    Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

    2016-02-12

    With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

  10. Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

    Directory of Open Access Journals (Sweden)

    Claudia Zielke

    Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

  11. Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

    International Nuclear Information System (INIS)

    Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

    2013-01-01

    Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

  12. Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

    DEFF Research Database (Denmark)

    Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

    2013-01-01

    for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

  13. Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

    Science.gov (United States)

    Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

    2009-07-01

    β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

  14. Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

    International Nuclear Information System (INIS)

    Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

    2009-01-01

    β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

  15. The structure of cell wall alpha-glucan from fission yeast

    NARCIS (Netherlands)

    Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

    2005-01-01

    Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

  16. The structure of cell wall alpha-glucan from fission yeast.

    NARCIS (Netherlands)

    Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

    2005-01-01

    Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

  17. Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

    Science.gov (United States)

    Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

    1992-01-01

    The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

  18. Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau

    -functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

  19. Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

    β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

  20. Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

    β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

  1. Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

    NARCIS (Netherlands)

    Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

    2007-01-01

    The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

  2. Relative gene expression of fatty acid synthesis genes at 60 days postpartum in bovine mammary epithelial cells of Surti and Jafarabadi buffaloes

    Directory of Open Access Journals (Sweden)

    Mamta Janmeda

    2017-05-01

    Full Text Available Aim: Aim of the study was to study the relative gene expression of genes associated with fatty acid synthesis at 60 days postpartum (pp in bovine mammary epithelial cells (MECs of Surti and Jafarabadi buffaloes. Materials and Methods: A total of 10 healthy Surti and Jafarabadi buffaloes of each breed were selected at random from Livestock Research Station, Navsari and Cattle Breeding Farm, Junagadh, Gujarat, respectively, for this study. Milk sample was collected from each selected buffalo at day 60 pp from these two breeds to study relative gene expression of major milk fat genes using non-invasive approach of obtaining primary bovine MECs (pBMEC from milk samples. Results: In this study overall, the relative expression of the six major milk lipogenic genes butyrophilin subfamily 1 member A1 (BTN1A1, stearoyl-CoA desaturase (SCD, lipoprotein lipase (LPL, glycerol-3-phosphate acyltransferase mitochondrial (GPAM, acetyl-coenzyme A carboxylase alpha (ACACA, and lipin (LPIN did not show changes in expression patterns at 60th day of lactation in both Surti and Jafarabadi buffaloes. Conclusion: The pBMEC can be successfully recovered from 1500 ml of milk of Surti and Jafarabadi buffaloes using antibody-mediated magnetic bead separation and can be further used for recovering RNA for down step quantification of major milk lipogenic gene expression. The relative expression of the six major milk lipogenic genes BTN1A1, SCD, LPL, GPAM, ACACA, and LPIN did not show changes in expression patterns in both Surti and Jafarabadi buffaloes, suggesting expression levels of lipogenic genes are maintained almost uniform till peak lactation without any significant difference.

  3. Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

    Directory of Open Access Journals (Sweden)

    KUSMIATI

    2007-04-01

    Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

  4. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    International Nuclear Information System (INIS)

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

    1986-01-01

    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  5. Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: Evidence for differential gene expression

    International Nuclear Information System (INIS)

    Kim, Sunyoung; Baltimore, D.; Byrn, R.; Groopman, J.

    1989-01-01

    The kinetics of retroviral DNA and RNA synthesis are parameters vital to understanding viral growth, especially for human immunodeficiency virus (HIV), which encodes several of its own regulatory genes. The authors have established a single-cycle growth condition for HIV in H9 cells, a human CD4 + lymphocyte line. The full-length viral linear DNA is first detectable by 4 h postinfection. During a one-step growth of HIV, amounts of viral DNA gradually increase until 8 to 12 h postinfection and then decrease. The copy number of unintegrated viral DNA is not extraordinarily high even at its peak. Most strikingly, there is a temporal program of RNA accumulation: the earliest RNA is greatly enriched in the 2-kilobase subgenomic mRNA species, while the level of 9.2-kilobase RNA which is both genomic RNA and mRNA remains low until after 24 h of infection. Virus production begins at about 24 h postinfection. Thus, viral DNA synthesis is as rapid as for other retroviruses, but viral RNA synthesis involves temporal alteration in the species that accumulate, presumably as a consequence of viral regulatory genes

  6. Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

    International Nuclear Information System (INIS)

    Nguyen Thanh Long; Le Quang Luan

    2015-01-01

    The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

  7. A Robust and Versatile Method of Combinatorial Chemical Synthesis of Gene Libraries via Hierarchical Assembly of Partially Randomized Modules

    Science.gov (United States)

    Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried

    2015-01-01

    A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis. PMID:26355961

  8. Transcriptome Analysis of Dendrobium officinale and its Application to the Identification of Genes Associated with Polysaccharide Synthesis

    Science.gov (United States)

    Zhang, Jianxia; He, Chunmei; Wu, Kunlin; Teixeira da Silva, Jaime A.; Zeng, Songjun; Zhang, Xinhua; Yu, Zhenming; Xia, Haoqiang; Duan, Jun

    2016-01-01

    Dendrobium officinale is one of the most important Chinese medicinal herbs. Polysaccharides are one of the main active ingredients of D. officinale. To identify the genes that maybe related to polysaccharides synthesis, two cDNA libraries were prepared from juvenile and adult D. officinale, and were named Dendrobium-1 and Dendrobium-2, respectively. Illumina sequencing for Dendrobium-1 generated 102 million high quality reads that were assembled into 93,881 unigenes with an average sequence length of 790 base pairs. The sequencing for Dendrobium-2 generated 86 million reads that were assembled into 114,098 unigenes with an average sequence length of 695 base pairs. Two transcriptome databases were integrated and assembled into a total of 145,791 unigenes. Among them, 17,281 unigenes were assigned to 126 KEGG pathways while 135 unigenes were involved in fructose and mannose metabolism. Gene Ontology analysis revealed that the majority of genes were associated with metabolic and cellular processes. Furthermore, 430 glycosyltransferase and 89 cellulose synthase genes were identified. Comparative analysis of both transcriptome databases revealed a total of 32,794 differential expression genes (DEGs), including 22,051 up-regulated and 10,743 down-regulated genes in Dendrobium-2 compared to Dendrobium-1. Furthermore, a total of 1142 and 7918 unigenes showed unique expression in Dendrobium-1 and Dendrobium-2, respectively. These DEGs were mainly correlated with metabolic pathways and the biosynthesis of secondary metabolites. In addition, 170 DEGs belonged to glycosyltransferase genes, 37 DEGs were related to cellulose synthase genes and 627 DEGs encoded transcription factors. This study substantially expands the transcriptome information for D. officinale and provides valuable clues for identifying candidate genes involved in polysaccharide biosynthesis and elucidating the mechanism of polysaccharide biosynthesis. PMID:26904032

  9. The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

    2010-08-01

    In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

  10. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

    Science.gov (United States)

    Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

    2001-07-01

    Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

  11. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  12. Colorful seashells: Identification of haem pathway genes associated with the synthesis of porphyrin shell color in marine snails

    KAUST Repository

    Williams, Suzanne T.; Lockyer, Anne E.; Dyal, Patricia; Nakano, Tomoyuki; Churchill, Celia K. C.; Speiser, Daniel I.

    2017-01-01

    Very little is known about the evolution of molluskan shell pigments, although Mollusca is a highly diverse, species rich, and ecologically important group of animals comprised of many brightly colored taxa. The marine snail genus Clanculus was chosen as an exceptional model for studying the evolution of shell color, first, because in Clanculus margaritarius and Clanculus pharaonius both shell and foot share similar colors and patterns; and second, because recent studies have identified the pigments, trochopuniceus (pink-red), and trochoxouthos (yellow-brown), both comprised of uroporphyrin I and uroporphyrin III, in both shell and colored foot tissue of these species. These unusual characteristics provide a rare opportunity to identify the genes involved in color production because, as the same pigments occur in the shell and colored foot tissue, the same color-related genes may be simultaneously expressed in both mantle (which produces the shell) and foot tissue. In this study, the transcriptomes of these two Clanculus species along with a third species, Calliostoma zizyphinum, were sequenced to identify genes associated with the synthesis of porphyrins. Calliostoma zizyphinum was selected as a negative control as trochopuniceus and trochoxouthos were not found to occur in this species. As expected, genes necessary for the production of uroporphyrin I and III were found in all three species, but gene expression levels were consistent with synthesis of uroporphyrins in mantle and colored foot tissue only in Clanculus. These results are relevant not only to understanding the evolution of shell pigmentation in Clanculus but also to understanding the evolution of color in other species with uroporphyrin pigmentation, including (mainly marine) mollusks soft tissues and shells, annelid and platyhelminth worms, and some bird feathers.

  13. Colorful seashells: Identification of haem pathway genes associated with the synthesis of porphyrin shell color in marine snails

    KAUST Repository

    Williams, Suzanne T.

    2017-10-30

    Very little is known about the evolution of molluskan shell pigments, although Mollusca is a highly diverse, species rich, and ecologically important group of animals comprised of many brightly colored taxa. The marine snail genus Clanculus was chosen as an exceptional model for studying the evolution of shell color, first, because in Clanculus margaritarius and Clanculus pharaonius both shell and foot share similar colors and patterns; and second, because recent studies have identified the pigments, trochopuniceus (pink-red), and trochoxouthos (yellow-brown), both comprised of uroporphyrin I and uroporphyrin III, in both shell and colored foot tissue of these species. These unusual characteristics provide a rare opportunity to identify the genes involved in color production because, as the same pigments occur in the shell and colored foot tissue, the same color-related genes may be simultaneously expressed in both mantle (which produces the shell) and foot tissue. In this study, the transcriptomes of these two Clanculus species along with a third species, Calliostoma zizyphinum, were sequenced to identify genes associated with the synthesis of porphyrins. Calliostoma zizyphinum was selected as a negative control as trochopuniceus and trochoxouthos were not found to occur in this species. As expected, genes necessary for the production of uroporphyrin I and III were found in all three species, but gene expression levels were consistent with synthesis of uroporphyrins in mantle and colored foot tissue only in Clanculus. These results are relevant not only to understanding the evolution of shell pigmentation in Clanculus but also to understanding the evolution of color in other species with uroporphyrin pigmentation, including (mainly marine) mollusks soft tissues and shells, annelid and platyhelminth worms, and some bird feathers.

  14. The effect of heat stress on gene expression, synthesis of steroids, and apoptosis in bovine granulosa cells.

    Science.gov (United States)

    Li, Lian; Wu, Jie; Luo, Man; Sun, Yu; Wang, Genlin

    2016-05-01

    Summer heat stress (HS) is a major contributing factor in low fertility in lactating dairy cows in hot environments. Heat stress inhibits ovarian follicular development leading to diminished reproductive efficiency of dairy cows during summer. Ovarian follicle development is a complex process. During follicle development, granulosa cells (GCs) replicate, secrete hormones, and support the growth of the oocyte. To obtain an overview of the effects of heat stress on GCs, digital gene expression profiling was employed to screen and identify differentially expressed genes (DEGs; false discovery rate (FDR) ≤ 0.001, fold change ≥2) of cultured GCs during heat stress. A total of 1211 DEGs including 175 upregulated and 1036 downregulated ones were identified, of which DEGs can be classified into Gene Ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The results suggested that heat stress triggers a dramatic and complex program of altered gene expression in GCs. We hypothesized that heat stress could induce the apoptosis and dysfunction of GCs. Real-time reverse transcription-polymerase chain reaction (RT-PCR) was used to evaluate the expression of steroidogenic genes (steroidogenic acute regulatory protein (Star), cytochrome P-450 (CYP11A1), CYP19A1, and steroidogenic factor 1 (SF-1)) and apoptosis-related genes (caspase-3, BCL-2, and BAX). Radio immunoassay (RIA) was used to analyze the level of 17β-estradiol (E2) and progesterone (P4). We also assessed the apoptosis of GCs by flow cytometry. Our data suggested that heat stress induced GC apoptosis through the BAX/BCL-2 pathway and reduced the steroidogenic gene messenger RNA (mRNA) expression and E2 synthesis. These results suggest that the decreased function of GCs may cause ovarian dysfunction and offer an improved understanding of the molecular mechanism responsible for the low fertility in cattle in summer.

  15. Synthesis of 5-radioiodoarabinosyl uridine analog for probing HSV-1 thymidine kinase gene: an unexpected chelating effect

    Energy Technology Data Exchange (ETDEWEB)

    Yu, C.-S. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China)]. E-mail: csyu@mx.nthu.edu.tw; Chiang, L.-W. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Wu, C.-H. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Wang, R.-T. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Chen, S.-W. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Wang, H.-Y. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China); Yeh, C.-H. [Department of Nuclear Science, National Tsing-Hua University, Hsinchu 300, Taiwan (China)

    2006-04-15

    Tumor cells transduced with herpes simplex virus thymidine kinase gene has been intensively applied to the field of positron emission tomography via imaging of its substrate. As a pilot synthesis approach, a facial preparation of 5-[{sup 125}I]iodoarabinosyl uridine starting from commercial available uridine is reported herein. Interestingly, the tin group in 5-trimethylstannyl arabinosyluridine was easily removed during purification. The destannylation through the formation of a six-ligand coordination involving 2'-hydroxyl and tin was thereby proposed.

  16. High Throughput Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    National Research Council Canada - National Science Library

    Boger, Dale L

    2005-01-01

    .... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...

  17. High Throughout Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    National Research Council Canada - National Science Library

    Boger, Dale

    2003-01-01

    .... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...

  18. High Throughput Synthesis and Screening for Agents Inhibiting Androgen Receptor Mediated Gene Transcription

    National Research Council Canada - National Science Library

    Boger, Dale

    2004-01-01

    .... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...

  19. Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

    Science.gov (United States)

    Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

    2009-10-14

    To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

  20. Effects of gamma irradiation on the physical and structural properties of β-glucan

    International Nuclear Information System (INIS)

    Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

    2008-01-01

    This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

  1. Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

    Science.gov (United States)

    Singh, Mukti; Kim, Sanghoon; Liu, Sean X

    2012-08-01

    Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

  2. Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

    Directory of Open Access Journals (Sweden)

    E. Y. Choi

    2016-11-01

    Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

  3. Suppressing Sorbitol Synthesis Substantially Alters the Global Expression Profile of Stress Response Genes in Apple (Malus domestica) Leaves.

    Science.gov (United States)

    Wu, Ting; Wang, Yi; Zheng, Yi; Fei, Zhangjun; Dandekar, Abhaya M; Xu, Kenong; Han, Zhenhai; Cheng, Lailiang

    2015-09-01

    Sorbitol is a major product of photosynthesis in apple (Malus domestica) that is involved in carbohydrate metabolism and stress tolerance. However, little is known about how the global transcript levels in apple leaves respond to decreased sorbitol synthesis. In this study we used RNA sequencing (RNA-seq) profiling to characterize the transcriptome of leaves from transgenic lines of the apple cultivar 'Greensleeves' exhibiting suppressed expression of aldose-6-phosphate reductase (A6PR) to gain insights into sorbitol function and the consequences of decreased sorbitol synthesis on gene expression. We observed that, although the leaves of the low sorbitol transgenic lines accumulate higher levels of various primary metabolites, only very limited changes were found in the levels of transcripts associated with primary metabolism. We suggest that this is indicative of post-transcriptional and/or post-translational regulation of primary metabolite accumulation and central carbon metabolism. However, we identified significantly enriched gene ontology terms belonging to the 'stress related process' category in the antisense lines (P-value sorbitol plays a role in the responses of apple trees to abiotic and biotic stresses. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  4. Beating Bias in the Directed Evolution of Proteins: Combining High-Fidelity on-Chip Solid-Phase Gene Synthesis with Efficient Gene Assembly for Combinatorial Library Construction.

    Science.gov (United States)

    Li, Aitao; Acevedo-Rocha, Carlos G; Sun, Zhoutong; Cox, Tony; Xu, Jia Lucy; Reetz, Manfred T

    2018-02-02

    Saturation mutagenesis (SM) constitutes a widely used technique in the directed evolution of selective enzymes as catalysts in organic chemistry and in the manipulation of metabolic paths and genomes, but the quality of the libraries is far from optimal due to the inherent amino acid bias. Herein, it is shown how this fundamental problem can be solved by applying high-fidelity solid-phase chemical gene synthesis on silicon chips followed by efficient gene assembly. Limonene epoxide hydrolase was chosen as the catalyst in the model desymmetrization of cyclohexene oxide with the stereoselective formation of (R,R)- and (S,S)-cyclohexane-1,2-diol. A traditional combinatorial PCR-based SM library, produced by simultaneous randomization at several residues by using a reduced amino acid alphabet, and the respective synthetic library were constructed and compared. Statistical analysis at the DNA level with massive sequencing demonstrates that, in the synthetic approach, 97 % of the theoretically possible DNA mutants are formed, whereas the traditional SM library contained only about 50 %. Screening at the protein level also showed the superiority of the synthetic library; many highly (R,R)- and (S,S)-selective variants being discovered are not found in the traditional SM library. With the prices of synthetic genes decreasing, this approach may point the way to future directed evolution. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Skeletal muscle morphology, protein synthesis and gene expression in Ehlers Danlos Syndrome

    DEFF Research Database (Denmark)

    Nygaard, Rie H; Jensen, Jacob K; Voermans, Nicol C

    2017-01-01

    skeletal muscle biopsies in patients with classic EDS (cEDS, n=5 (Denmark)+ 8 (The Netherlands)) and vascular EDS (vEDS, n=3) and analyzed muscle fiber morphology and content (Western blotting and muscle fiber type/area distributions) and muscle mRNA expression and protein synthesis rate (RT-PCR and stable...... isotope technique). RESULTS: The cEDS patients did not differ from healthy controls (n = 7-11) with regard to muscle fiber type/area, myosin/α-actin ratio, muscle protein synthesis rate or mRNA expression. In contrast, the vEDS patients demonstrated higher expression of matrix proteins compared to c......EDS patients (fibronectin and MMP-2). DISCUSSION: The cEDS patients had surprisingly normal muscle morphology and protein synthesis, whereas vEDS patients demonstrated higher mRNA expression for extracellular matrix remodeling in skeletal musculature compared to cEDS patients....

  6. Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

    Science.gov (United States)

    Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

    2014-02-07

    The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

  7. Specific genes involved in synthesis and editing of heparan sulfate proteoglycans show altered expression patterns in breast cancer

    International Nuclear Information System (INIS)

    Fernández-Vega, Iván; García, Olivia; Crespo, Ainara; Castañón, Sonia; Menéndez, Primitiva; Astudillo, Aurora; Quirós, Luis M

    2013-01-01

    The expression of a specific set of genes controls the different structures of heparan sulfate proteoglycans (HSPGs), which are involved in the growth, invasion and metastatic properties of cancerous cells. The purpose of this study is to increase knowledge of HSPG alterations in breast cancer. Twenty-three infiltrating ductal adenocarcinomas (IDCs), both metastatic and non-metastatic were studied. A transcriptomic approach to the structure of heparan sulfate (HS) chains was used, employing qPCR to analyze both the expression of the enzymes involved in their biosynthesis and editing, as well as the proteoglycan core proteins. Since some of these proteoglycans can also carry chondroitin sulfate chains, we extended the study to include the genes involved in the biosynthesis of these glycosaminoglycans. Histochemical techniques were also used to analyze tissular expression of particular genes showing significant expression differences, of potential interest. No significant change in transcription was detected in approximately 70% of analyzed genes. However, 13 demonstrated changes in both tumor types (40% showing more intense deregulation in the metastatic), while 5 genes showed changes only in non-metastatic tumors. Changes were related to 3 core proteins: overexpression of syndecan-1 and underexpression of glypican-3 and perlecan. HS synthesis was affected by lower levels of some 3-O-sulfotransferase transcripts, the expression of NDST4 and, only in non metastatic tumors, higher levels of extracellular sulfatases. Furthermore, the expression of chondroitin sulfate also was considerably affected, involving both the synthesis of the saccharidic chains and sulfations at all locations. However, the pro-metastatic enzyme heparanase did not exhibit significant changes in mRNA expression, although in metastatic tumors it appeared related to increased levels of the most stable form of mRNA. Finally, the expression of heparanase 2, which displays anti-metastatic features

  8. Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

    Science.gov (United States)

    Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

  9. Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

    OpenAIRE

    Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

    2012-01-01

    Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

  10. Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

    Science.gov (United States)

    Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

    2014-06-01

    Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

  11. Increasing platelet concentrations in leukocyte-reduced platelet-rich plasma decrease collagen gene synthesis in tendons.

    Science.gov (United States)

    Boswell, Stacie G; Schnabel, Lauren V; Mohammed, Hussni O; Sundman, Emily A; Minas, Tom; Fortier, Lisa A

    2014-01-01

    Platelet-rich plasma (PRP) is used for the treatment of tendinopathy. There are numerous PRP preparations, and the optimal combination of platelets and leukocytes is not known. Within leukocyte-reduced PRP (lrPRP), there is a plateau effect of platelet concentration, with increasing platelet concentrations being detrimental to extracellular matrix synthesis. Controlled laboratory study. Different formulations of lrPRP with respect to the platelet:leukocyte ratio were generated from venous blood of 8 horses. Explants of the superficial digital flexor tendon were cultured in lrPRP products for 96 hours. Platelet-derived growth factor-BB (PDGF-BB), tumor necrosis factor-α (TNF-α), transforming growth factor-β1 (TGF-β1), and interleukin-1β (IL-1β) concentrations were determined in the media by enzyme-linked immunosorbent assay. Gene expression in tendon tissue for collagen type I and III (COL1A1 and COL3A1, respectively), matrix metalloproteinase-3 and -13 (MMP-3 and MMP-13, respectively), cartilage oligomeric matrix protein (COMP), and IL-1β was determined. Data were divided into 3 groups of lrPRP based on the ratio of platelets:leukocytes and evaluated to determine the effect of platelet concentration. Complete blood counts verified leukocyte reduction and platelet enrichment in all PRP preparations. In the lrPRP preparation, the anabolic growth factors PDGF-BB and TGF-β1 were increased with increasing platelet concentrations, and the catabolic cytokine IL-1β was decreased with increasing platelet concentrations. Increasing the platelet concentration resulted in a significant reduction in COL1A1 and COL3A1 synthesis in tendons. Increasing the platelet concentration within lrPRP preparations results in the delivery of more anabolic growth factors and less proinflammatory cytokines, but the biological effect on tendons is diminished metabolism as indicated by a decrease in the synthesis of both COL1A1 and COL3A1. Together, this information suggests that

  12. Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

    Science.gov (United States)

    Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

    2013-05-01

    The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

    Science.gov (United States)

    Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

    2016-01-01

    Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

    Science.gov (United States)

    Gomaa, K; Kraus, J; Franz, G; Röper, H

    1991-09-18

    Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

  15. Constitutive synthesis of a transport function encoded by the Thiobacillus ferrooxidans merC gene cloned in Escherichia coli

    International Nuclear Information System (INIS)

    Kusano, Tomonobu; Ji, Guangyong; Silver, S.; Inoue, Chihiro

    1990-01-01

    Mercuric reductase activity determined by the Thiobacillus ferrooxidans merA gene (cloned and expressed constitutively in Escherichia coli) was measured by volatilization of 203 Hg 2+ . (The absence of a merR regulatory gene in the cloned Thiobacillus mer determinant provides a basis for the constitutive synthesis of this system.) In the absence of the Thiobacillus merC transport gene, the mercury volatilization activity was cryptic and was not seen with whole cells but only with sonication-disrupted cells. The Thiobacillus merC transport function was compared with transport via the merT-merP system of plasmid pDU1358. Both systems, cloned and expressed in E. coli, governed enhanced uptake of 203 Hg 2+ in a temperature- and concentration-dependent fashion. Uptake via MerT-MerP was greater and conferred greater hypersensitivity to Hg 2+ than did uptake with MerC. Mercury uptake was inhibited by N-ethylmaleimide but not by EDTA. Ag + salts inhibited mercury uptake by the MerT-MerP system but did not inhibit uptake via MerC. Radioactive mercury accumulated by the MerT-MerP and by the MerC systems was exchangeable with nonradioactive Hg 2+

  16. Down-regulation of SMT3A gene expression in association with DNA synthesis induction after X-ray irradiation in nevoid basal cell carcinoma syndrome (NBCCS) cells

    International Nuclear Information System (INIS)

    Sugaya, Shigeru; Nakanishi, Hiroshi; Tanzawa, Hideki; Sugita, Katsuo; Kita, Kazuko; Suzuki, Nobuo

    2005-01-01

    Fibroblast cells derived from nevoid basal carcinoma syndrome (NBCCS) patients show increased levels of DNA synthesis after X-ray irradiation. Genes, whose expression is modulated in association with the DNA synthesis induction, were searched by using PCR-based mRNA differential display analysis in one of the NBCCS cell lines, NBCCS1 cells. Decreased levels of SMT3A gene expression were found in X-ray-irradiated NBCCS1 cells. This decrease was also shown by RT-PCR analysis in another cell line, NBCCS3 cells. In addition to NBCCS cells, normal fibroblast cells showed the DNA synthesis induction after X-ray irradiation when they were treated with antisense oligonucleotides (AO) for SMT3A. However, treatment of normal fibroblasts with the random oligonucleotides (RO) resulted in decreased levels of DNA synthesis after X-ray irradiation. Thus, down-regulation of SMT3A gene expression may be involved in the DNA synthesis induction after X-ray irradiation in the NBCCS cells at least tested

  17. Down-regulation of SMT3A gene expression in association with DNA synthesis induction after X-ray irradiation in nevoid basal cell carcinoma syndrome (NBCCS) cells

    Energy Technology Data Exchange (ETDEWEB)

    Sugaya, Shigeru [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Nakanishi, Hiroshi [Department of Clinical Molecular Biology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Tanzawa, Hideki [Department of Clinical Molecular Biology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Sugita, Katsuo [Department of Clinical Medicine, Faculty of Education, Chiba University, 1-33 Yayoi, Inage-ku, Chiba 263-8522 (Japan); Kita, Kazuko [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan); Suzuki, Nobuo [Department of Environmental Biochemistry, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670 (Japan)]. E-mail: nobuo@faculty.chiba-u.jp

    2005-10-15

    Fibroblast cells derived from nevoid basal carcinoma syndrome (NBCCS) patients show increased levels of DNA synthesis after X-ray irradiation. Genes, whose expression is modulated in association with the DNA synthesis induction, were searched by using PCR-based mRNA differential display analysis in one of the NBCCS cell lines, NBCCS1 cells. Decreased levels of SMT3A gene expression were found in X-ray-irradiated NBCCS1 cells. This decrease was also shown by RT-PCR analysis in another cell line, NBCCS3 cells. In addition to NBCCS cells, normal fibroblast cells showed the DNA synthesis induction after X-ray irradiation when they were treated with antisense oligonucleotides (AO) for SMT3A. However, treatment of normal fibroblasts with the random oligonucleotides (RO) resulted in decreased levels of DNA synthesis after X-ray irradiation. Thus, down-regulation of SMT3A gene expression may be involved in the DNA synthesis induction after X-ray irradiation in the NBCCS cells at least tested.

  18. Demonstration of diet-induced decoupling of fatty acid and cholesterol synthesis by combining gene expression array and 2H2O quantification.

    Science.gov (United States)

    Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K

    2012-01-15

    The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.

  19. Discovery of Antibiotics-derived Polymers for Gene Delivery using Combinatorial Synthesis and Cheminformatics Modeling

    Science.gov (United States)

    Potta, Thrimoorthy; Zhen, Zhuo; Grandhi, Taraka Sai Pavan; Christensen, Matthew D.; Ramos, James; Breneman, Curt M.; Rege, Kaushal

    2014-01-01

    We describe the combinatorial synthesis and cheminformatics modeling of aminoglycoside antibiotics-derived polymers for transgene delivery and expression. Fifty-six polymers were synthesized by polymerizing aminoglycosides with diglycidyl ether cross-linkers. Parallel screening resulted in identification of several lead polymers that resulted in high transgene expression levels in cells. The role of polymer physicochemical properties in determining efficacy of transgene expression was investigated using Quantitative Structure-Activity Relationship (QSAR) cheminformatics models based on Support Vector Regression (SVR) and ‘building block’ polymer structures. The QSAR model exhibited high predictive ability, and investigation of descriptors in the model, using molecular visualization and correlation plots, indicated that physicochemical attributes related to both, aminoglycosides and diglycidyl ethers facilitated transgene expression. This work synergistically combines combinatorial synthesis and parallel screening with cheminformatics-based QSAR models for discovery and physicochemical elucidation of effective antibiotics-derived polymers for transgene delivery in medicine and biotechnology. PMID:24331709

  20. Cellulose synthesis genes CESA6 and CSI1 are important for salt stress tolerance in Arabidopsis.

    Science.gov (United States)

    Zhang, Shuang-Shuang; Sun, Le; Dong, Xinran; Lu, Sun-Jie; Tian, Weidong; Liu, Jian-Xiang

    2016-07-01

    Two salt hypersensitive mutants she1 and she2 were identified through genetic screening. SHE1 encodes a cellulose synthase CESA6 while SHE2 encodes a cellulose synthase-interactive protein CSI1. Both of them are involved in cellulose deposition. Our results demonstrated that the sustained cellulose synthesis is important for salt stress tolerance in Arabidopsis. © 2015 Institute of Botany, Chinese Academy of Sciences.

  1. Genetic variation in genes of the fatty acid synthesis pathway and breast cancer risk

    DEFF Research Database (Denmark)

    Campa, Daniele; McKay, James; Sinilnikova, Olga

    2009-01-01

    and FASN) is related to breast cancer risk and body-mass index (BMI) by studying 1,294 breast cancer cases and 2,452 controls from the European Prospective Investigation on Cancer (EPIC). We resequenced the FAS gene and combined information of SNPs found by resequencing and SNPs from public databases....... Using a tagging approach and selecting 20 SNPs, we covered all the common genetic variation of these genes. In this study we were not able to find any statistically significant association between the SNPs in the FAS, ChREBP and SREPB-1 genes and an increased risk of breast cancer overall...

  2. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Science.gov (United States)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  3. The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

    Science.gov (United States)

    Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

    2015-01-01

    Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

  4. Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

    Science.gov (United States)

    Zheng, Xueling; Li, Limin; Wang, Qi

    2011-01-01

    Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

  5. β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

    Directory of Open Access Journals (Sweden)

    Matthew J. Elder

    2017-07-01

    Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

  6. Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

    Science.gov (United States)

    Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

    2013-03-01

    β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

  7. Neo-Darwinism, the modern synthesis and selfish genes: are they of use in physiology?

    Science.gov (United States)

    Noble, Denis

    2011-03-01

    This article argues that the gene-centric interpretations of evolution, and more particularly the selfish gene expression of those interpretations, form barriers to the integration of physiological science with evolutionary theory. A gene-centred approach analyses the relationships between genotypes and phenotypes in terms of differences (change the genotype and observe changes in phenotype). We now know that, most frequently, this does not correctly reveal the relationships because of extensive buffering by robust networks of interactions. By contrast, understanding biological function through physiological analysis requires an integrative approach in which the activity of the proteins and RNAs formed from each DNA template is analysed in networks of interactions. These networks also include components that are not specified by nuclear DNA. Inheritance is not through DNA sequences alone. The selfish gene idea is not useful in the physiological sciences, since selfishness cannot be defined as an intrinsic property of nucleotide sequences independently of gene frequency, i.e. the 'success' in the gene pool that is supposed to be attributable to the 'selfish' property. It is not a physiologically testable hypothesis.

  8. Microarray-based analysis of the differential expression of melanin synthesis genes in dark and light-muzzle Korean cattle.

    Science.gov (United States)

    Kim, Sang Hwan; Hwang, Sue Yun; Yoon, Jong Taek

    2014-01-01

    The coat color of mammals is determined by the melanogenesis pathway, which is responsible for maintaining the balance between black-brown eumelanin and yellow-reddish pheomelanin. It is also believed that the color of the bovine muzzle is regulated in a similar manner; however, the molecular mechanism underlying pigment deposition in the dark-muzzle has yet to be elucidated. The aim of the present study was to identify melanogenesis-associated genes that are differentially expressed in the dark vs. light muzzle of native Korean cows. Using microarray clustering and real-time polymerase chain reaction techniques, we observed that the expression of genes involved in the mitogen-activated protein kinase (MAPK) and Wnt signaling pathways is distinctively regulated in the dark and light muzzle tissues. Differential expression of tyrosinase was also noticed, although the difference was not as distinct as those of MAPK and Wnt. We hypothesize that emphasis on the MAPK pathway in the dark-muzzle induces eumelanin synthesis through the activation of cAMP response element-binding protein and tyrosinase, while activation of Wnt signaling counteracts this process and raises the amount of pheomelanin in the light-muzzle. We also found 2 novel genes (GenBank No. NM-001076026 and XM-588439) with increase expression in the black nose, which may provide additional information about the mechanism of nose pigmentation. Regarding the increasing interest in the genetic diversity of cattle stocks, genes we identified for differential expression in the dark vs. light muzzle may serve as novel markers for genetic diversity among cows based on the muzzle color phenotype.

  9. Microarray-based analysis of the differential expression of melanin synthesis genes in dark and light-muzzle Korean cattle.

    Directory of Open Access Journals (Sweden)

    Sang Hwan Kim

    Full Text Available The coat color of mammals is determined by the melanogenesis pathway, which is responsible for maintaining the balance between black-brown eumelanin and yellow-reddish pheomelanin. It is also believed that the color of the bovine muzzle is regulated in a similar manner; however, the molecular mechanism underlying pigment deposition in the dark-muzzle has yet to be elucidated. The aim of the present study was to identify melanogenesis-associated genes that are differentially expressed in the dark vs. light muzzle of native Korean cows. Using microarray clustering and real-time polymerase chain reaction techniques, we observed that the expression of genes involved in the mitogen-activated protein kinase (MAPK and Wnt signaling pathways is distinctively regulated in the dark and light muzzle tissues. Differential expression of tyrosinase was also noticed, although the difference was not as distinct as those of MAPK and Wnt. We hypothesize that emphasis on the MAPK pathway in the dark-muzzle induces eumelanin synthesis through the activation of cAMP response element-binding protein and tyrosinase, while activation of Wnt signaling counteracts this process and raises the amount of pheomelanin in the light-muzzle. We also found 2 novel genes (GenBank No. NM-001076026 and XM-588439 with increase expression in the black nose, which may provide additional information about the mechanism of nose pigmentation. Regarding the increasing interest in the genetic diversity of cattle stocks, genes we identified for differential expression in the dark vs. light muzzle may serve as novel markers for genetic diversity among cows based on the muzzle color phenotype.

  10. Alkaline stress and iron deficiency regulate iron uptake and riboflavin synthesis gene expression differently in root and leaf tissue: implications for iron deficiency chlorosis.

    Science.gov (United States)

    Hsieh, En-Jung; Waters, Brian M

    2016-10-01

    Iron (Fe) is an essential mineral that has low solubility in alkaline soils, where its deficiency results in chlorosis. Whether low Fe supply and alkaline pH stress are equivalent is unclear, as they have not been treated as separate variables in molecular physiological studies. Additionally, molecular responses to these stresses have not been studied in leaf and root tissues simultaneously. We tested how plants with the Strategy I Fe uptake system respond to Fe deficiency at mildly acidic and alkaline pH by measuring root ferric chelate reductase (FCR) activity and expression of selected Fe uptake genes and riboflavin synthesis genes. Alkaline pH increased cucumber (Cucumis sativus L.) root FCR activity at full Fe supply, but alkaline stress abolished FCR response to low Fe supply. Alkaline pH or low Fe supply resulted in increased expression of Fe uptake genes, but riboflavin synthesis genes responded to Fe deficiency but not alkalinity. Iron deficiency increased expression of some common genes in roots and leaves, but alkaline stress blocked up-regulation of these genes in Fe-deficient leaves. In roots of the melon (Cucumis melo L.) fefe mutant, in which Fe uptake responses are blocked upstream of Fe uptake genes, alkaline stress or Fe deficiency up-regulation of certain Fe uptake and riboflavin synthesis genes was inhibited, indicating a central role for the FeFe protein. These results suggest a model implicating shoot-to-root signaling of Fe status to induce Fe uptake gene expression in roots. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  11. Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

    Directory of Open Access Journals (Sweden)

    Ira Widjiastuti

    2017-03-01

    Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

  12. Dynamic, morphotype-specific Candida albicans beta-glucan exposure during infection and drug treatment.

    Directory of Open Access Journals (Sweden)

    Robert T Wheeler

    2008-12-01

    Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.

  13. High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

    NARCIS (Netherlands)

    Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

    2010-01-01

    An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

  14. Expression of genes associated with carbohydrate metabolism in cotton stems and roots

    Directory of Open Access Journals (Sweden)

    Scheffler Jodi

    2009-01-01

    Full Text Available Abstract Background Cotton (Gossypium hirsutum L is an important crop worldwide that provides fiber for the textile industry. Cotton is a perennial plant that stores starch in stems and roots to provide carbohydrates for growth in subsequent seasons. Domesticated cotton makes these reserves available to developing seeds which impacts seed yield. The goals of these analyses were to identify genes and physiological pathways that establish cotton stems and roots as physiological sinks and investigate the role these pathways play in cotton development during seed set. Results Analysis of field-grown cotton plants indicated that starch levels peaked about the time of first anthesis and then declined similar to reports in greenhouse-grown cotton plants. Starch accumulated along the length of the stem and the shape and size of the starch grains from stems were easily distinguished from transient starch. Microarray analyses compared gene expression in tissues containing low levels of starch with tissues rapidly accumulating starch. Statistical analysis of differentially expressed genes indicated increased expression among genes associated with starch synthesis, starch degradation, hexose metabolism, raffinose synthesis and trehalose synthesis. The anticipated changes in these sugars were largely confirmed by measuring soluble sugars in selected tissues. Conclusion In domesticated cotton starch stored prior to flowering was available to support seed production. Starch accumulation observed in young field-grown plants was not observed in greenhouse grown plants. A suite of genes associated with starch biosynthesis was identified. The pathway for starch utilization after flowering was associated with an increase in expression of a glucan water dikinase gene as has been implicated in utilization of transient starch. Changes in raffinose levels and levels of expression of genes controlling trehalose and raffinose biosynthesis were also observed in vegetative

  15. Expression of genes involved in energy mobilization and osmoprotectant synthesis during thermal and dehydration stress in the Antarctic midge, Belgica antarctica.

    Science.gov (United States)

    Teets, Nicholas M; Kawarasaki, Yuta; Lee, Richard E; Denlinger, David L

    2013-02-01

    The Antarctic midge, Belgica antarctica, experiences sub-zero temperatures and desiccating conditions for much of the year, and in response to these environmental insults, larvae undergo rapid shifts in metabolism, mobilizing carbohydrate energy reserves to promote synthesis of low-molecular-mass osmoprotectants. In this study, we measured the expression of 11 metabolic genes in response to thermal and dehydration stress. During both heat and cold stress, we observed upregulation of phosphoenolpyruvate carboxykinase (pepck) and glycogen phosphorylase (gp) to support rapid glucose mobilization. In contrast, there was a general downregulation of pathways related to polyol, trehalose, and proline synthesis during both high- and low-temperature stress. Pepck was likewise upregulated in response to different types of dehydration stress; however, for many of the other genes, expression patterns depended on the nature of dehydration stress. Following fast dehydration, expression patterns were similar to those observed during thermal stress, i.e., upregulation of gp accompanied by downregulation of trehalose and proline synthetic genes. In contrast, gradual, prolonged dehydration (both at a constant temperature and in conjunction with chilling) promoted marked upregulation of genes responsible for trehalose and proline synthesis. On the whole, our data agree with known metabolic adaptations to stress in B. antarctica, although a few discrepancies between gene expression patterns and downstream metabolite contents point to fluxes that are not controlled at the level of transcription.

  16. B-Glucan exacerbates allergic asthma independent of fungal ...

    Science.gov (United States)

    BackgroundAllergic sensitization to fungi has been associated with asthma severity. As a result, it has been largely assumed that the contribution of fungi to allergic disease is mediated through their potent antigenicity.ObjectiveWe sought to determine the mechanism by which fungi affect asthma development and severity.MethodsWe integrated epidemiologic and experimental asthma models to explore the effect of fungal exposure on asthma development and severity.ResultsWe report that fungal exposure enhances allergen-driven TH2 responses, promoting severe allergic asthma. This effect is independent of fungal sensitization and can be reconstituted with β-glucan and abrogated by neutralization of IL-17A. Furthermore, this severe asthma is resistant to steroids and characterized by mixed TH2 and TH17 responses, including IL-13+IL-17+CD4+ double-producing effector T cells. Steroid resistance is dependent on fungus-induced TH17 responses because steroid sensitivity was restored in IL-17rc−/− mice. Similarly, in children with asthma, fungal exposure was associated with increased serum IL-17A levels and asthma severity.ConclusionOur data demonstrate that fungi are potent immunomodulators and have powerful effects on asthma independent of their potential to act as antigens. Furthermore, our results provide a strong rationale for combination treatment strategies targeting IL-17A for this subgroup of fungus-exposed patients with difficult-to-treat asthma. To describe th

  17. Identification and Functional Characterization of the Glycogen Synthesis Related Gene Glycogenin in Pacific Oysters (Crassostrea gigas).

    Science.gov (United States)

    Li, Busu; Meng, Jie; Li, Li; Liu, Sheng; Wang, Ting; Zhang, Guofan

    2017-09-06

    High glycogen levels in the Pacific oyster (Crassostrea gigas) contribute to its flavor, quality, and hardiness. Glycogenin (CgGN) is the priming glucosyltransferase that initiates glycogen biosynthesis. We characterized the full sequence and function of C. gigas CgGN. Three CgGN isoforms (CgGN-α, β, and γ) containing alternative exon regions were isolated. CgGN expression varied seasonally in the adductor muscle and gonadal area and was the highest in the adductor muscle. Autoglycosylation of CgGN can interact with glycogen synthase (CgGS) to complete glycogen synthesis. Subcellular localization analysis showed that CgGN isoforms and CgGS were located in the cytoplasm. Additionally, a site-directed mutagenesis experiment revealed that the Tyr200Phe and Tyr202Phe mutations could affect CgGN autoglycosylation. This is the first study of glycogenin function in marine bivalves. These findings will improve our understanding of glycogen synthesis and accumulation mechanisms in mollusks. The data are potentially useful for breeding high-glycogen oysters.

  18. Expression of cytoskeletal and matrix genes following exposure to ionizing radiation: Dose-rate effects and protein synthesis requirements

    International Nuclear Information System (INIS)

    Woloschak, G.E.

    1994-01-01

    Experiments were designed to examine the effects Of radiation dose-rate and of the protein synthesis inhibitor cycloheximide on expression of cytoskeletal elements (γ- and β-actin and α-tubulin) and matrix elements (fibronectin) in Syrian hamster embryo cells. Past work from our laboratory had already demonstrated optimum time points and doses for examination of radiation effects on accumulation of specific transcripts. Our results here demonstrated little effect of dose-rate for JANUS fission spectrum neutrons when comparing expression of either α-tubulin or fibronectin genes. Past work had already documented similar results for expression of actin transcripts. Effects of cycloheximide revealed that cycloheximide repressed accumulation of α-tubulin following exposure to high dose-rate neutrons or γ rays; this did not occur following similar low dose-rate exposure. (2) Cycloheximide did not affect accumulation of MRNA for actin genes; and that cycloheximide abrogated the moderate induction of fibronectin-mRNA which occurred following exposure to γ rays and high dose-rate neutrons. These results suggest a role for labile proteins in the maintenance of α-tubulin and fibronectin MRNA accumulation following exposure to ionizing radiation. in addition, they suggest that the cellular/molecular response to low dose-rate neutrons may be different from the response to high dose-rate neutrons

  19. Expression of cytoskeletal and matrix genes following exposure to ionizing radiation: Dose-rate effects and protein synthesis requirements

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Felcher, P.; Chang-Liu, Chin-Mei

    1992-01-01

    Experiments were designed to examine the effects of radiation dose-rate and of the protein synthesis inhibitor cycloheximide on expression of cytoskeletal elements (γ- and β-actin and α-tubulin) and matrix elements (fibronectin) in Syrian hamster embryo cells. Past work from our laboratory had already demonstrated optimum time points and doses for examination of radiation effects on accumulation of specific transcripts. Our results here demonstrated little effect of dose-rate for JANUS fission spectrum neutrons when comparing expression of either α-tubulin or fibronectin genes. Past work had already documented similar results for expression of actin transcripts. Effects of cycloheximide, however, revealed several interesting and novel findings: (1) Cycloheximide repressed accumulation of α-tubulin following exposure to high dose-rate neutrons or γ rays; this did not occur following similar low dose-rate exposure (2) Cycloheximide did not affect accumulation of mRNA for actin genes. Cycloheximide abrogated the moderate induction of fibronectin-mRNA which occurred following exposure to γ rays and high dose-rate neutrons. These results suggest a role for labile proteins in the maintenance of α-tubulin and fibronectin mRNA accumulation following exposure to ionizing radiation. In addition, they suggest that the cellular/molecular response to low dose-rate neutrons may be different from the response to high dose-rate neutrons

  20. Activation of anthocyanin synthesis genes by white light in eggplant hypocotyl tissues, and identification of an inducible P-450 cDNA

    International Nuclear Information System (INIS)

    Toguri, T.; Umemoto, N.; Kobayashi, O.; Ohtani, T.

    1993-01-01

    Eggplant seedlings (Solanum melongena) grown under red light irradiation showed a normal morphology with green, fully expanded cotyledons. When the seedlings grown under red light were irradiated with ultraviolet-containing white light, anthocyanin synthesis was induced in the hypocotyl tissues, especially when a UV light supplement was added. The accumulation of pigments was closely associated with the expression of genes involved in flavonoid synthesis. These genes include chalcone synthase (CHS) and dihydroflavonol 4-reductase (DFR). Using subtracted probes, which had been enriched for the accumulated mRNA, one white light-responsive cDNA was identified as being a P450 gene by comparison with database sequences. The maximal amino acid homology this cDNA had with other P450s was 36%. This was with CYP71 from avocado (Persea americana). Thus it represents a new P-450 family, which has been named CYP75. The mRNA of this gene was localized in the hypocotyl tissues of eggplant seedlings, which had been white light-irradiated. The transcript was accumulated by changing the light source, as in the case of other flavonoid biosynthesis genes. In delphinidin producing petunia plants, the mRNAs corresponding to the eggplant P-450 and flavonoid biosynthesis genes such as CHS and DFR were most abundant during the mid stage of flower bud development, but could not be detected in leaf tissues. These results suggest that this P-450 gene encodes a hydroxylating enzyme involved in flavonoid biosynthesis. (author)

  1. Effect of pollination and fertilization on the expression of genes related to floral transition, hormone synthesis and berry development in grapevine.

    Science.gov (United States)

    Dauelsberg, Patricia; Matus, José Tomás; Poupin, María Josefina; Leiva-Ampuero, Andrés; Godoy, Francisca; Vega, Andrea; Arce-Johnson, Patricio

    2011-09-15

    In the present work, the effect of assisted fertilization on anatomical, morphological and gene expression changes occurring in carpels and during early stages of berry development in Vitis vinifera were studied. Inflorescences were emasculated before capfall, immediately manually pollinated (EP) and fruit development was compared to emasculated but non-pollinated (ENP) and self-pollinated inflorescences (NESP). The diameter of berries derived from pollinated flowers (EP and NESP) was significantly higher than from non-pollinated flowers (ENP) at 21 days after emasculation/pollination (DAE), and a rapid increase in the size of the inner mesocarp, together with the presence of an embryo-like structure, were observed. The expression of gibberellin oxidases (GA20ox and GA2ox), anthranilate synthase (related to auxin synthesis) and cytokinin synthase coding genes was studied to assess the relationship between hormone synthesis and early berry development, while flower patterning genes were analyzed to describe floral transition. Significant expression changes were found for hormone-related genes, suggesting that their expression at early stages of berry development (13 DAE) is related to cell division and differentiation of mesocarp tissue at a later stage (21 DAE). Expression of hormone-related genes also correlates with the expression of VvHB13, a gene related to mesocarp expansion, and with an increased repression of floral patterning genes (PISTILLATA and TM6), which may contribute to prevent floral transition inhibiting fruit growth before fertilization takes place. Copyright © 2011 Elsevier GmbH. All rights reserved.

  2. Development of Novel Polymeric Materials for Gene Therapy and pH-Sensitive Drug Delivery: Modeling, Synthesis, Characterization, and Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Brian Curtis [Iowa State Univ., Ames, IA (United States)

    2002-01-01

    The underlying theme of this thesis is the use of polymeric materials in bioapplications. Chapters 2-5 either develop a fundamental understanding of current materials used for bioapplications or establish protocols and procedures used in characterizing and synthesizing novel materials. In chapters 6 and 7 these principles and procedures are applied to the development of materials to be used for gene therapy and drug delivery. Chapter one is an introduction to the ideas that will be necessary to understand the subsequent chapters, as well as a literature review of these topics. Chapter two is a paper that has been published in the ''Journal of Controlled Release'' that examines the mechanism of drug release from a polymer gel, as well as experimental design suggestions for the evaluation of water soluble drug delivery systems. Chapter three is a paper that has been published in the ''Journal of Pharmaceutical Sciences'' that discusses the effect ionic salts have on properties of the polymer systems examined in chapter two. Chapter four is a paper published in the Materials Research Society Fall 2000 Symposium Series dealing with the design and synthesis of a pH-sensitive polymeric drug delivery device. Chapter five is a paper that has been published in the journal ''Biomaterials'' proposing a novel polymer/metal composite for use as a biomaterial in hip arthroplasty surgery. Chapter six is a paper that will appear in an upcoming volume of the Journal ''Biomaterials'' dealing with the synthesis of a novel water soluble cationic polymer with possible applications in non-viral gene therapy. Chapter seven is a paper that has been submitted to ''Macromolecules'' discussing several novel block copolymers based on poly(ethylene glycol) and poly(diethylamino ethyl methacrylate) that possess both pH-sensitive and temperature sensitive properties. Chapter eight contains a

  3. Synthesis, antimicrobial activity and gene structure of a novel member of the dermaseptin B family.

    Science.gov (United States)

    Fleury, Y; Vouille, V; Beven, L; Amiche, M; Wróblewski, H; Delfour, A; Nicolas, P

    1998-03-09

    Dermaseptins are a family of cationic (Lys-rich) antimicrobial peptides that are abundant in the skin secretions of the arboreal frogs Phyllomedusa bicolor and P. sauvagii. In vitro, these peptides are microbicidal against a wide variety of microorganisms including Gram-positive and Gram-negative bacteria, yeasts, protozoa and fungi. To date, 6 dermaseptin B mature peptides, 24-34 residues long, 2 dermaseptin B cDNAs and 2 gene sequences have been identified in P. bicolor. To assess dermaseptin related genes further, we screened a P. bicolor genomic library with 32P-labeled cDNAs coding either for prepro-dermaseptins B1 or B2 (adenoregulin). A gene sequence was identified that coded a novel dermaseptin B, termed Drg3, which exhibits 23-42% amino acids identities with other members of the family. Analysis of the cDNAs coding precursors for several opioid and antimicrobial peptides originating from the skin of various amphibian species revealed that the 25-residue preproregion of these preproforms are all encoded by conserved nucleotides encompassed by the first coding exon of the Drg3 gene. Synthetic dermaseptin Drg3 exhibited a bactericidal activity towards several species of mollicutes (wall-less eubacteria), firmicutes (Gram-positive eubacteria), and gracilicutes (Gram-negative eubacteria), with minimal inhibitory concentrations (MICs) ranging from 6.25 to 100 microM. Experiments performed on Acholeplasma laidlawii cells revealed that this peptide is membranotropic and that if efficiently depolarizes the plasma membrane.

  4. Transcription factor 7-like 2 gene links increased in vivo insulin synthesis to type 2 diabetes

    NARCIS (Netherlands)

    S. Jainandunsing (Sjaam); Koole, H.R. (H. Rita); van Miert, J.N.I. (Joram N.I.); T. Rietveld (Trinet); J.L.D. Wattimena (Josias); E.J.G. Sijbrands (Eric); F.W.M. de Rooij (Felix)

    2018-01-01

    textabstractTranscription factor 7-like 2 (TCF7L2) is the main susceptibility gene for type 2 diabetes, primarily through impairing the insulin secretion by pancreatic β cells. However, the exact in vivo mechanisms remain poorly understood. We performed a family study and determined if the T risk

  5. Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

    Science.gov (United States)

    Chang, I.; Cho, G.

    2012-12-01

    Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

  6. Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

    International Nuclear Information System (INIS)

    Schmidt, W.E.; Ebel, J.

    1987-01-01

    Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

  7. Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

    International Nuclear Information System (INIS)

    Salama, S.F.

    2011-01-01

    1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

  8. Modulation of the immune response of porcine neutrophils by different β-glucan preparations

    DEFF Research Database (Denmark)

    Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

    2010-01-01

    β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

  9. 8-Methoxypsoralen DNA interstrand cross-linking of the ribosomal RNA genes in Tetrahymena thermophila. Distribution, repair and effect on rRNA synthesis

    DEFF Research Database (Denmark)

    Fengquin, X; Nielsen, Henrik; Zhen, W

    1993-01-01

    between three domains (terminal spacer, transcribed region and central spacer) as defined by restriction enzyme analysis (BamHI and ClaI). It is furthermore shown that a dosage resulting in approximately one cross-link per rDNA molecule (21 kbp, two genes) is sufficient to block RNA synthesis. Finally......, it is shown that the cross-links in the rDNA molecules are repaired at equal rate in all three domains within 24 h and that RNA synthesis is partly restored during this repair period. The majority of the cells also go through one to two cell divisions in this period but do not survive....

  10. Cell Wall Composition and Candidate Biosynthesis Gene Expression During Rice Development

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Fan; Manisseri, Chithra; Fagerström, Alexandra; Peck, Matthew L.; Vega-Sánchez, Miguel E.; Williams, Brian; Chiniquy, Dawn M.; Saha, Prasenjit; Pattathil, Sivakumar; Conlin, Brian; Zhu, Lan; Hahn, Michael G.; Willats, William G. T.; Scheller, Henrik V.; Ronald, Pamela C.; Bartley, Laura E.

    2016-08-01

    Cell walls of grasses, including cereal crops and biofuel grasses, comprise the majority of plant biomass and intimately influence plant growth, development and physiology. However, the functions of many cell wall synthesis genes, and the relationships among and the functions of cell wall components remain obscure. To better understand the patterns of cell wall accumulation and identify genes that act in grass cell wall biosynthesis, we characterized 30 samples from aerial organs of rice (Oryza sativa cv. Kitaake) at 10 developmental time points, 3-100 d post-germination. Within these samples, we measured 15 cell wall chemical components, enzymatic digestibility and 18 cell wall polysaccharide epitopes/ligands. We also used quantitative reverse transcription-PCR to measure expression of 50 glycosyltransferases, 15 acyltransferases and eight phenylpropanoid genes, many of which had previously been identified as being highly expressed in rice. Most cell wall components vary significantly during development, and correlations among them support current understanding of cell walls. We identified 92 significant correlations between cell wall components and gene expression and establish nine strong hypotheses for genes that synthesize xylans, mixed linkage glucan and pectin components. This work provides an extensive analysis of cell wall composition throughout rice development, identifies genes likely to synthesize grass cell walls, and provides a framework for development of genetically improved grasses for use in lignocellulosic biofuel production and agriculture.

  11. Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

    DEFF Research Database (Denmark)

    Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

    2005-01-01

    Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

  12. Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

    DEFF Research Database (Denmark)

    Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

    2012-01-01

    Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

  13. Binding Interactions Between alpha-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

    NARCIS (Netherlands)

    Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.

    Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the

  14. Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

    NARCIS (Netherlands)

    Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

    2010-01-01

    Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

  15. Co-ordinate expression of glycine betaine synthesis genes linked by the FMDV 2A region in a single open reading frame in Pichia pastoris.

    Science.gov (United States)

    Wang, Sanhong; Yao, Quanhong; Tao, Jianmin; Qiao, Yushan; Zhang, Zhen

    2007-12-01

    The genes encoding the two enzymes choline monooxygenase (CMO) and betaine aldehyde dehydrogenase (BADH) of glycine betaine synthesis in Suaeda salsa were cloned and fused with the 2A region of foot-and-mouth disease virus in a single open reading frame. The fused genes were placed under the control of the alcohol oxidase (AOX1) promoter in pPIC3B and transformed into P. pastoris GS115. The expression of the fused genes in P. pastoris and the ability of recombinant yeasts to tolerate environmental stresses were studied. The results showed that induced with 0.5% methanol for 96 h, the maximal activities of CMO and BADH in the tested recombinant yeasts were 45- and 44-fold higher than those in the control yeast transformed empty vector only, respectively; the content of glycine betaine in the recombinant yeasts was 28- to 35-fold higher than that in the control. The fused genes linked by 2A region of foot-and-mouth disease virus were expressed in P. pastoris successfully and the polyprotein was 'cleaved' to each functional protein. The yeasts transformed the fused genes, which were more resistant to salt, methanol, and high temperature stresses than the control as result of glycine betaine synthesis genes introduced.

  16. Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

    International Nuclear Information System (INIS)

    Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

    2012-01-01

    Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

  17. Combined effects of added beta glucan and black tea in breads on starch functionality.

    Science.gov (United States)

    Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

    2015-03-01

    Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

  18. Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

    Directory of Open Access Journals (Sweden)

    Ernesto R. Soto

    2016-01-01

    Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

  19. Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

    Science.gov (United States)

    Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

    2016-12-01

    β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Natural Variation in Synthesis and Catabolism Genes Influences Dhurrin Content in Sorghum

    Directory of Open Access Journals (Sweden)

    Chad M. Hayes

    2015-07-01

    Full Text Available Cyanogenic glucosides are natural compounds found in more than 1000 species of angiosperms that produce HCN and are deemed undesirable for agricultural use. However, these compounds are important components of the primary defensive mechanisms of many plant species. One of the best-studied cyanogenic glucosides is dhurrin [(--hydroxymandelonitrile-β--glucopyranoside], which is produced primarily in sorghum [ (L. Moench]. The biochemical basis for dhurrin metabolism is well established; however, little information is available on its genetic control. Here, we dissect the genetic control of leaf dhurrin content through a genome-wide association study (GWAS using a panel of 700 diverse converted sorghum lines (conversion panel previously subjected to pre-breeding and selected for short stature (∼1 m in height and photoperiod insensitivity. The conversion panel was grown for 2 yr in three environments. Wide variation for leaf dhurrin content was found in the sorghum conversion panel, with the Caudatum group exhibiting the highest dhurrin content and the Guinea group showing the lowest dhurrin content. A GWAS using a mixed linear model revealed significant associations (a false discovery rate [FDR] < 0.05 close to both UGT 185B1 in the canonical biosynthetic gene cluster on chromosome 1 and close to the catabolic dhurrinase loci on chromosome 8. Dhurrin content was associated consistently with biosynthetic genes in the two N-fertilized environments, while dhurrin content was associated with catabolic loci in the environment without supplemental N. These results suggest that genes for both biosynthesis and catabolism are important in determining natural variation for leaf dhurrin in sorghum in different environments.

  1. Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

    DEFF Research Database (Denmark)

    Jiménez, Natalia Ivonne Vera

    by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

  2. Synthesis and Evaluation of Tetramethylguanidinium-Polyethylenimine Polymers as Efficient Gene Delivery Vectors

    Directory of Open Access Journals (Sweden)

    Manohar Mahato

    2014-01-01

    Full Text Available Previously, we demonstrated that 6-(N,N,N′,N′-tetramethylguanidinium chloride-hexanoyl-polyethylenimine (THP polymers exhibited significantly enhanced transfection efficiency and cell viability. Here, in the present study, we have synthesized a series of N,N,N′,N′-tetramethylguanidinium-polyethylenimine (TP1-TP5 polymers via a single-step reaction involving peripheral primary amines of bPEI and varying amounts of 2-(1H-benzotriazol-1-yl-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU. These polymers were found to interact efficiently with negatively charged pDNA and formed stable complexes in the size range of ~240–450 nm. Acid-base titration profiles revealed improved buffering capacity of TP polymers as compared to bPEI. Transfection and cytotoxicity assays performed with TP/pDNA complexes on HEK293, CHO, and HeLa cells showed significantly higher transfection efficiency and cell viability with one of the complexes, TP2/pDNA complex, exhibited the highest transfection efficiency (~1.4–2.3-fold outcompeting native bPEI and the commercially available transfection reagent, Lipofectamine 2000. Compared to previously reported THP polymers, the transfection efficiency of TP/pDNA complexes was found to be lower, as examined by flow cytometry. These results highlight the importance of the hydrophobic C-6 linker in THP polymers in forming compact nanostructures with pDNA, which might lead to efficient uptake and internalization of the complexes; however, the projected TP polymers offer an advantage of their rapid and economical one-step synthesis.

  3. Synthesis and evaluation of tetramethylguanidinium-polyethylenimine polymers as efficient gene delivery vectors.

    Science.gov (United States)

    Mahato, Manohar; Yadav, Santosh; Kumar, Pradeep; Sharma, Ashwani Kumar

    2014-01-01

    Previously, we demonstrated that 6-(N,N,N',N'-tetramethylguanidinium chloride)-hexanoyl-polyethylenimine (THP) polymers exhibited significantly enhanced transfection efficiency and cell viability. Here, in the present study, we have synthesized a series of N,N,N',N'-tetramethylguanidinium-polyethylenimine (TP1-TP5) polymers via a single-step reaction involving peripheral primary amines of bPEI and varying amounts of 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU). These polymers were found to interact efficiently with negatively charged pDNA and formed stable complexes in the size range of ~240-450 nm. Acid-base titration profiles revealed improved buffering capacity of TP polymers as compared to bPEI. Transfection and cytotoxicity assays performed with TP/pDNA complexes on HEK293, CHO, and HeLa cells showed significantly higher transfection efficiency and cell viability with one of the complexes, TP2/pDNA complex, exhibited the highest transfection efficiency (~1.4-2.3-fold) outcompeting native bPEI and the commercially available transfection reagent, Lipofectamine 2000. Compared to previously reported THP polymers, the transfection efficiency of TP/pDNA complexes was found to be lower, as examined by flow cytometry. These results highlight the importance of the hydrophobic C-6 linker in THP polymers in forming compact nanostructures with pDNA, which might lead to efficient uptake and internalization of the complexes; however, the projected TP polymers offer an advantage of their rapid and economical one-step synthesis.

  4. Effects of repeated potassium iodide administration on genes involved in synthesis and secretion of thyroid hormone in adult male rat.

    Science.gov (United States)

    Lebsir, Dalila; Manens, Line; Grison, Stephane; Lestaevel, Philippe; Ebrahimian, Teni; Suhard, David; Phan, Guillaume; Dublineau, Isabelle; Tack, Karine; Benderitter, Marc; Pech, Annick; Jourdain, Jean-Rene; Souidi, Maâmar

    2018-02-26

    A single dose of potassium iodide (KI) is recommended to reduce the risk of thyroid cancer during nuclear accidents. However in case of prolonged radioiodine exposure, more than one dose of KI may be necessary. This work aims to evaluate the potential toxic effect of repeated administration of KI. Adult Wistar rats received an optimal dose of KI 1 mg/kg over a period of 1, 4 or 8 days. hormonal status (TSH, FT4) of treated rats was unaffected. Contrariwise, a sequential Wolff-Chaikoff effect was observed, resulting in a prompt decrease of NIS and MCT8 mRNA expression (-58% and -26% respectively), followed by a delayed decrease of TPO mRNA expression (-33%) in conjunction with a stimulation of PDS mRNA expression (+62%). we show for the first time that repeated administration of KI at 1 mg/kg/24h doesn't cause modification of thyroid hormones level, but leads to a reversible modification of the expression of genes involved in the synthesis and secretion of thyroid hormones. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

    DEFF Research Database (Denmark)

    Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

    2017-01-01

    -glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

  6. Identification of a cis-regulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis.

    Science.gov (United States)

    Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K

    1995-05-20

    In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.

  7. Synthesis and characterization of PEG-conjugated quaternized chitosan and its application as a gene vector.

    Science.gov (United States)

    Zhang, Xi; Yao, Juan; Zhang, Lihong; Fang, Jianguo; Bian, Fengling

    2014-03-15

    Poly(ethylene glycol)-conjugated N-(2-hydroxy) propyl-3-trimethyl ammonium chitosan chloride (PHTAC) derivatives were prepared by incorporating PEG molecules onto quaternized chitosan backbone. The copolymers were characterized by FTIR, (1)H NMR and XRD. Agarose gel retardation assay indicated that PHTAC had good plasmid DNA (pDNA) binding capability and the particle sizes of PHTAC/pDNA complexes determined by DLS were about 200 nm. Cytotoxicity assays in HeLa and 293T cells showed that PHTAC had low cytotoxicity. In vitro luciferase assay showed that PHTAC with PEGylation degree of 9% (PHTAC-1) had good transfection efficiency about 5.3-fold higher than quaternized chitosan, which was comparable with PEI (25 kDa). These results suggest that PHTAC-1 is a promising candidate as an efficient nonviral gene vector. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis.

    Science.gov (United States)

    Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming

    2012-05-01

    Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  9. The novel oral glucan synthase inhibitor SCY-078 shows in vitro activity against sessile and planktonic Candida spp.

    Science.gov (United States)

    Marcos-Zambrano, Laura Judith; Gómez-Perosanz, Marta; Escribano, Pilar; Bouza, Emilio; Guinea, Jesús

    2017-07-01

    We studied the antifungal activity of SCY-078 (an orally bioavailable 1,3-β -d- glucan synthesis inhibitor), micafungin and fluconazole against the planktonic and sessile forms of 178 Candida and non- Candida isolates causing fungaemia in patients recently admitted to a large European hospital. The in vitro activity of SCY-078, micafungin and fluconazole against the planktonic form of the isolates was assessed using EUCAST EDef 7.3 and CLSI M27-A3. Antibiofilm activity was assessed using the XTT reduction assay. SCY-078 and micafungin showed potent in vitro activity against Candida and non- Candida isolates. The in vitro activity of both drugs was similar, but SYC-078 displayed significantly lower MIC values than micafungin against Candida parapsilosis and non- Candida isolates, whereas micafungin displayed significantly lower MIC values for the remaining species ( P  Candida glabrata , in which the micafungin sessile MIC values were significantly lower ( P  Candida isolates in both sessile and planktonic forms is comparable to that of micafungin. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

    Directory of Open Access Journals (Sweden)

    Jae Gil Lee

    2016-06-01

    Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

  11. Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

    Science.gov (United States)

    Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

    2018-03-01

    Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

  12. Understanding the role of oat ß-glucan in oat-based dough systems

    NARCIS (Netherlands)

    Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

    2015-01-01

    B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

  13. An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans

    DEFF Research Database (Denmark)

    Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher

    2008-01-01

    alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...

  14. Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs

    NARCIS (Netherlands)

    Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava

    2017-01-01

    Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and

  15. The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

    Science.gov (United States)

    Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

    2014-04-01

    Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

  16. Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

    Czech Academy of Sciences Publication Activity Database

    Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

    2016-01-01

    Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

  17. Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

    NARCIS (Netherlands)

    Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

    1979-01-01

    A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

  18. Beta-glucans in the treatment of diabetes and associated cardiovascular risks

    Directory of Open Access Journals (Sweden)

    Jiezhong Chen

    2008-12-01

    Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

  19. Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

    Science.gov (United States)

    Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

    2012-09-04

    Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

  20. Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

    Directory of Open Access Journals (Sweden)

    Mattia P. Arena

    2014-02-01

    Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

  1. Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

    Science.gov (United States)

    Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

  2. Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

    Directory of Open Access Journals (Sweden)

    Taiki Kobayashi

    Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

  3. A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.

    Science.gov (United States)

    Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji

    2011-06-07

    The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur

  4. Facile synthesis of semi-library of low charge density cationic polyesters from poly(alkylene maleate)s for efficient local gene delivery.

    Science.gov (United States)

    Yan, Huijie; Zhu, Dingcheng; Zhou, Zhuxian; Liu, Xin; Piao, Ying; Zhang, Zhen; Liu, Xiangrui; Tang, Jianbin; Shen, Youqing

    2018-03-30

    Cationic polymers are one of the main non-viral vectors for gene therapy, but their applications are hindered by the toxicity and inefficient transfection, particularly in the presence of serum or other biological fluids. While rational design based on the current understanding of gene delivery process has produced various cationic polymers with improved overall transfection, high-throughput parallel synthesis of libraries of cationic polymers seems a more effective strategy to screen out efficacious polymers. Herein, we demonstrate a novel platform for parallel synthesis of low cationic charge-density polyesters for efficient gene delivery. Unsaturated polyester poly(alkylene maleate) (PAM) readily underwent Michael-addition reactions with various mercaptamines to produce polyester backbones with pendant amine groups, poly(alkylene maleate mercaptamine)s (PAMAs). Variations of the alkylenes in the backbone and the mercaptamines on the side chain produced PAMAs with tunable hydrophobicity and DNA-condensation ability, the key parameters dominating transfection efficiency of the resulting polymer/DNA complexes (polyplexes). A semi-library of such PAMAs was exampled from 7 alkylenes and 18 mercaptamines, from which a lead PAMA, G-1, synthesized from poly(1,4-phenylene bis(methylene) maleate) and N,N-dimethylcysteamine, showed remarkable transfection efficiency even in the presence of serum, owing to its efficient lysosome-circumventing cellular uptake. Furthermore, G-1 polyplexes efficiently delivered the suicide gene pTRAIL to intraperitoneal tumors and elicited effective anticancer activity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Chad Steele

    2005-12-01

    Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.

  6. Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

    Science.gov (United States)

    Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

    1989-05-01

    A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

  7. Synthesis and evaluation of cationic nanomicelles for in vitro and in vivo gene delivery

    Science.gov (United States)

    Mandke, Rhishikesh Subhash

    The goal of proposed study was to contribute towards the development of a nano size, high efficiency and low toxicity non-viral polymeric vector for gene delivery in vitro and in vivo. A series of fatty acid grafted low-molecular-weight chitosan (N-acyl LMWCs) were synthesized, purified and characterized for their physicochemical properties using various analytical techniques such as infrared spectroscopy, elemental analysis and dynamic light scattering. The formulation parameters including pH, sonication duration, and filtration altered the physicochemical characteristics of N-acyl LMWC nanomicelles. The acyl chain length and degree of unsaturation in fatty acids also had an impact on the physicochemical properties and the transfection efficiency of nanomicelles. N-acyl LMWC nanomicelles showed efficient in vitro transfection as visualized and quantified using a reporter plasmid (encoding green fluorescent protein), and therapeutic plasmids (encoding for interleukin-4 and interleukin-10), respectively. The in vitro transfection efficiencies of N-acyl LMWCs with 18:1 and 18:2 grafts (oleic and linoleic acids) were comparable with FuGENERTM HD (marketed non-viral vector) but were ˜8-fold and 35-fold higher as compared to LMWC and naked DNA, respectively. The in vivo transfection efficiency of N-acyl LMWC to deliver plasmids individually encoding IL-4 and IL-10 as well as a bicistronic plasmid encoding both IL-4 and IL-10 was studied in a multiple, low-dose streptozotocin induced diabetic mouse model. The transfection efficiency of pDNA/N-acyl LMWC polyplexes injected via intramuscular route showed significant improvement (ptumor necrosis factor-alpha (TNF-alpha) levels. The pancreas of pDNA/N-acyl LMWC polyplex treated animals exhibited protection from streptozotocin-induced insulitis and the delivery systems were biocompatible. Histological studies revealed that there were no signs of chronic inflammation at the injection site. The bicistronic plasmid exhibited

  8. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Directory of Open Access Journals (Sweden)

    Kristen K. Merritt

    2014-10-01

    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  9. Synthesis of a wild-type and three mutant Cucurbita maxima trypsin inhibitor-encoding genes by a single-strand approach.

    Science.gov (United States)

    Botes, D P; Qobose, M D; Corfield, V A

    1991-09-15

    A single-strand approach to gene assembly, based on a modification of an in vitro complementary oligodeoxyribonucleotide template-directed ligation of the desired sequence to a linearized vector [Chen et al., Nucleic Acids Res. 18 (1990) 871-878], is described. The gene coding for the wild-type Cucurbita maxima trypsin inhibitor of 29 amino acid residues [Bode et al., FEBS Lett. 242 (1989) 285-292], as well as three mutant forms of the gene, in which two of the three disulfide bonds have been replaced singly or as a pair, have been synthesized in a single synthesis run with minimal manual intervention. Subsequent to ligation to pUC9 and in vivo gapped duplex repair by Escherichia coli, their sequences have been verified.

  10. Characterization and analysis of CCR and CAD gene families at the whole-genome level for lignin synthesis of stone cells in pear (Pyrus bretschneideri) fruit.

    Science.gov (United States)

    Cheng, Xi; Li, Manli; Li, Dahui; Zhang, Jinyun; Jin, Qing; Sheng, Lingling; Cai, Yongping; Lin, Yi

    2017-11-15

    The content of stone cells has significant effects on the flavour and quality of pear fruit. Previous research suggested that lignin deposition is closely related to stone cell formation. In the lignin biosynthetic pathway, cinnamoyl-CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD), dehydrogenase/reductase family members, catalyse the last two steps in monolignol synthesis. However, there is little knowledge of the characteristics of the CCR and CAD families in pear and their involvement in lignin synthesis of stone cells. In this study, 31 CCR s and 26 CAD s were identified in the pear genome. Phylogenetic trees for CCR s and CAD s were constructed; key amino acid residues were analysed, and three-dimensional structures were predicted. Using quantitative real-time polymerase chain reaction (qRT-PCR), PbCAD2 , PbCCR1 , -2 and - 3 were identified as participating in lignin synthesis of stone cells in pear fruit. Subcellular localization analysis showed that the expressed proteins (PbCAD2, PbCCR1, -2 and -3) are found in the cytoplasm or at the cell membrane. These results reveal the evolutionary features of the CCR and CAD families in pear as well as the genes responsible for regulation of lignin synthesis and stone cell development in pear fruit. © 2017. Published by The Company of Biologists Ltd.

  11. Characterization and analysis of CCR and CAD gene families at the whole-genome level for lignin synthesis of stone cells in pear (Pyrus bretschneideri fruit

    Directory of Open Access Journals (Sweden)

    Xi Cheng

    2017-11-01

    Full Text Available The content of stone cells has significant effects on the flavour and quality of pear fruit. Previous research suggested that lignin deposition is closely related to stone cell formation. In the lignin biosynthetic pathway, cinnamoyl-CoA reductase (CCR and cinnamyl alcohol dehydrogenase (CAD, dehydrogenase/reductase family members, catalyse the last two steps in monolignol synthesis. However, there is little knowledge of the characteristics of the CCR and CAD families in pear and their involvement in lignin synthesis of stone cells. In this study, 31 CCRs and 26 CADs were identified in the pear genome. Phylogenetic trees for CCRs and CADs were constructed; key amino acid residues were analysed, and three-dimensional structures were predicted. Using quantitative real-time polymerase chain reaction (qRT-PCR, PbCAD2, PbCCR1, -2 and -3 were identified as participating in lignin synthesis of stone cells in pear fruit. Subcellular localization analysis showed that the expressed proteins (PbCAD2, PbCCR1, -2 and -3 are found in the cytoplasm or at the cell membrane. These results reveal the evolutionary features of the CCR and CAD families in pear as well as the genes responsible for regulation of lignin synthesis and stone cell development in pear fruit.

  12. Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

    Science.gov (United States)

    Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

    2013-05-21

    Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

  13. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  14. β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

    Science.gov (United States)

    Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

    2012-01-01

    ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

  15. Characterization of cycP gene expression in Achromobacter xylosoxidans NCIMB 11015 and high-level heterologous synthesis of cytochrome c' in Escherichia coli.

    Science.gov (United States)

    Harris, Roger L; Barbieri, Sonia; Paraskevopoulos, Kostas; Murphy, Loretta M; Eady, Robert R; Hasnain, S Samar; Sawers, R Gary

    2010-01-01

    The cycP gene encoding a periplasmic cytochrome c' from the denitrifying beta-proteobacterium Achromobacter xylosoxidans was characterized. The genes flanking cycP encode components of a mobile genetic element characteristic of the beta-proteobacteria, suggesting that cycP has inserted within a transposon or insertion element. The gene therefore does not form part of a denitrification operon or gene cluster. The level of expression of the cycP gene and the level of synthesis of its corresponding gene product were found to increase by maximally 3-fold anaerobically. Expression of cycP appears to occur mainly by non-specific read-through transcription from portions of the insertion element. Conditions were developed for high-level overproduction of cytochrome c' in Escherichia coli, which resulted in signal peptide cleavage concomitant with secretion of the protein into the periplasm. Using a single-step purification, 20-30 mg of pure protein were isolated from a 1-litre culture. Based on UV-visible spectrophotometry the dimeric protein was shown to have a full complement of haem and to be indistinguishable from the native protein purified from A. xylosoxidans. This system provides an excellent platform to facilitate biochemical and structural dissection of the mechanism underlying the novel specificity of NO binding to the proximal face of the haem.

  16. Isolation, structure, synthesis, and activity of a new member of the calcitonin gene-related peptide family from frog skin and molecular cloning of its precursor.

    Science.gov (United States)

    Seon, A A; Pierre, T N; Redeker, V; Lacombe, C; Delfour, A; Nicolas, P; Amiche, M

    2000-02-25

    Calcitonin gene-related peptide has been extracted from the skin exudate of a single living specimen of the frog Phyllomedusa bicolor and purified to homogeneity by a two-step protocol. A total volume of 250 microl of exudate yielded 380 microg of purified peptide. Mass spectrometric analysis and gas phase sequencing of the purified peptide as well as chemical synthesis and cDNA analysis were consistent with the structure SCDTSTCATQRLADFLSRSGGIGSPDFVPTDVSANSF amide and the presence of a disulfide bridge linking Cys(2) and Cys(7). The skin peptide, named skin calcitonin gene-related peptide, differs significantly from all other members of the calcitonin gene-related peptide family of peptides at nine positions but binds with high affinity to calcitonin gene-related peptide receptors in the rat brain and acts as an agonist in the rat vas deferens bioassay with potencies equal to those of human CGRP. Reverse transcriptase-polymerase chain reaction coupled with cDNA cloning and sequencing demonstrated that skin calcitonin gene-related peptide isolated in the skin is identical to that present in the frog's central and enteric nervous systems. These data, which indicate for the first time the existence of calcitonin gene-related peptide in the frog skin, add further support to the brain-skin-gut triangle hypothesis as a useful tool in the identification and/or isolation of mammalian peptides that are present in the brain and other tissues in only minute quantities.

  17. Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

    Directory of Open Access Journals (Sweden)

    A. Korpi

    2003-01-01

    Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

  18. Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

    DEFF Research Database (Denmark)

    Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

    2010-01-01

    To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

  19. The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

    Directory of Open Access Journals (Sweden)

    Fengdan Jin

    2014-01-01

    Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

  20. Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Fulcher R Gary

    2007-03-01

    Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

  1. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis.

    Science.gov (United States)

    Bilandžija, Helena; Ma, Li; Parkhurst, Amy; Jeffery, William R

    2013-01-01

    Albinism, the loss of melanin pigmentation, has evolved in a diverse variety of cave animals but the responsible evolutionary mechanisms are unknown. In Astyanax mexicanus, which has a pigmented surface dwelling form (surface fish) and several albino cave-dwelling forms (cavefish), albinism is caused by loss of function mutations in the oca2 gene, which operates during the first step of the melanin synthesis pathway. In addition to albinism, cavefish have evolved differences in behavior, including feeding and sleep, which are under the control of the catecholamine system. The catecholamine and melanin synthesis pathways diverge after beginning with the same substrate, L-tyrosine. Here we describe a novel relationship between the catecholamine and melanin synthesis pathways in Astyanax. Our results show significant increases in L-tyrosine, dopamine, and norepinephrine in pre-feeding larvae and adult brains of Pachón cavefish relative to surface fish. In addition, norepinephrine is elevated in cavefish adult kidneys, which contain the teleost homologs of catecholamine synthesizing adrenal cells. We further show that the oca2 gene is expressed during surface fish development but is downregulated in cavefish embryos. A key finding is that knockdown of oca2 expression in surface fish embryos delays the development of pigmented melanophores and simultaneously increases L-tyrosine and dopamine. We conclude that a potential evolutionary benefit of albinism in Astyanax cavefish may be to provide surplus L-tyrosine as a precursor for the elevated catecholamine synthesis pathway, which could be important for adaptation to the challenging cave environment.

  2. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis.

    Directory of Open Access Journals (Sweden)

    Helena Bilandžija

    Full Text Available Albinism, the loss of melanin pigmentation, has evolved in a diverse variety of cave animals but the responsible evolutionary mechanisms are unknown. In Astyanax mexicanus, which has a pigmented surface dwelling form (surface fish and several albino cave-dwelling forms (cavefish, albinism is caused by loss of function mutations in the oca2 gene, which operates during the first step of the melanin synthesis pathway. In addition to albinism, cavefish have evolved differences in behavior, including feeding and sleep, which are under the control of the catecholamine system. The catecholamine and melanin synthesis pathways diverge after beginning with the same substrate, L-tyrosine. Here we describe a novel relationship between the catecholamine and melanin synthesis pathways in Astyanax. Our results show significant increases in L-tyrosine, dopamine, and norepinephrine in pre-feeding larvae and adult brains of Pachón cavefish relative to surface fish. In addition, norepinephrine is elevated in cavefish adult kidneys, which contain the teleost homologs of catecholamine synthesizing adrenal cells. We further show that the oca2 gene is expressed during surface fish development but is downregulated in cavefish embryos. A key finding is that knockdown of oca2 expression in surface fish embryos delays the development of pigmented melanophores and simultaneously increases L-tyrosine and dopamine. We conclude that a potential evolutionary benefit of albinism in Astyanax cavefish may be to provide surplus L-tyrosine as a precursor for the elevated catecholamine synthesis pathway, which could be important for adaptation to the challenging cave environment.

  3. Overexpression of ALDH10A8 and ALDH10A9 Genes Provides Insight into Their Role in Glycine Betaine Synthesis and Affects Primary Metabolism in Arabidopsis thaliana.

    Science.gov (United States)

    Missihoun, Tagnon D; Willée, Eva; Guegan, Jean-Paul; Berardocco, Solenne; Shafiq, Muhammad R; Bouchereau, Alain; Bartels, Dorothea

    2015-09-01

    Betaine aldehyde dehydrogenases oxidize betaine aldehyde to glycine betaine in species that accumulate glycine betaine as a compatible solute under stress conditions. In contrast, the physiological function of betaine aldehyde dehydrogenase genes is at present unclear in species that do not accumulate glycine betaine, such as Arabidopsis thaliana. To address this question, we overexpressed the Arabidopsis ALDH10A8 and ALDH10A9 genes, which were identified to code for betaine aldehyde dehydrogenases, in wild-type A. thaliana. We analysed changes in metabolite contents of transgenic plants in comparison with the wild type. Using exogenous or endogenous choline, our results indicated that ALDH10A8 and ALDH10A9 are involved in the synthesis of glycine betaine in Arabidopsis. Choline availability seems to be a factor limiting glycine betaine synthesis. Moreover, the contents of diverse metabolites including sugars (glucose and fructose) and amino acids were altered in fully developed transgenic plants compared with the wild type. The plant metabolic response to salt and the salt stress tolerance were impaired only in young transgenic plants, which exhibited a delayed growth of the seedlings early after germination. Our results suggest that a balanced expression of the betaine aldehyde dehydrogenase genes is important for early growth of A. thaliana seedlings and for salt stress mitigation in young seedlings. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  4. NATURAL MUTATION IN THE GENE OF RESPONSE REGULATOR BgrR RESULTING IN REPRESSION OF Bac PROTEIN SYNTHESIS, A PATHOGENICITY FACTOR OF STREPTOCOCCUS AGALACTIAE

    Directory of Open Access Journals (Sweden)

    A. S. Rozhdestvenskaya

    2013-01-01

    Full Text Available Abstract. Streptococcus agalactiae can cause variety of diseases of newborns and adults. For successful colonization of different human tissues and organs as well as for suppression of the host immune system S. agalactiae expresses numerous virulence factors. For coordinated expression of the virulence genes S. agalactiae employs regulatory molecules including regulatory proteins of two-component systems. Results of the present study demonstrated that in S. agalactiae strain A49V the natural mutation in the brgR gene encoding for BgrR regulatory protein, which is component of regulatory system BgrRS, resulted in the repression of Bac protein synthesis, a virulence factor of S. agalactiae. A single nucleotide deletion in the bgrR gene has caused a shift of the reading frame and the changes in the primary, secondary and tertiary structures of the BgrR protein. The loss of functional activity of BgrR protein in A49V strain and repression of Bac protein synthesis have increased virulence of the strain in experimental animal streptococcal infection.

  5. Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

    Science.gov (United States)

    Rosburg, Valerie; Boylston, Terri; White, Pamela

    2010-06-01

    Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

  6. Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

    International Nuclear Information System (INIS)

    Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

    2004-01-01

    Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

  7. Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

    Directory of Open Access Journals (Sweden)

    Tomoko Jippo

    2015-02-01

    Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

  8. β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

    Directory of Open Access Journals (Sweden)

    AHMAD THONTOWI

    2007-10-01

    Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

  9. High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

    Directory of Open Access Journals (Sweden)

    Harry J. Wichers

    2010-08-01

    Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

  10. Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

    Directory of Open Access Journals (Sweden)

    Đukić Nevena H.

    2014-01-01

    Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

  11. Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

    Directory of Open Access Journals (Sweden)

    Antonio Francioso

    2017-05-01

    Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

  12. Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

    Directory of Open Access Journals (Sweden)

    Reshma Davidson

    Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

  13. Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

    Science.gov (United States)

    Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

    2013-10-01

    Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

  14. Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

    Science.gov (United States)

    Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

    2017-07-01

    The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  16. Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

    International Nuclear Information System (INIS)

    Tran, Huu Vinh

    1983-01-01

    After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

  17. Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

    Directory of Open Access Journals (Sweden)

    Daniela Fiocco

    2012-05-01

    Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

  18. Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

    Directory of Open Access Journals (Sweden)

    Andreas F. Haag

    2010-01-01

    Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

  19. Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

    Science.gov (United States)

    Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

    2004-10-01

    Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

  20. Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

    Science.gov (United States)

    Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

    2014-01-01

    Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

  1. Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

    Science.gov (United States)

    Das, Deeplina; Goyal, Arun

    2014-03-15

    Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

  2. Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

    2018-05-14

    Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

    Science.gov (United States)

    Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

    2017-03-01

    Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

    Directory of Open Access Journals (Sweden)

    Hirokazu Tokuyasu

    2010-09-01

    Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

  5. β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

    Directory of Open Access Journals (Sweden)

    Sonja de Vries

    Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

  6. Betulin inhibits cariogenic properties of Streptococcus mutans by targeting vicRK and gtf genes.

    Science.gov (United States)

    Viszwapriya, Dharmaprakash; Subramenium, Ganapathy Ashwinkumar; Radhika, Solai; Pandian, Shunmugiah Karutha

    2017-01-01

    Streptococcus mutans, a multivirulent pathogen is considered the primary etiological agent in dental caries. Development of antibiotic resistance in the pathogen has created a need for novel antagonistic agents which can control the virulence of the organism and reduce resistance development. The present study demonstrates the in vitro anti-virulence potential of betulin (lup-20(29)-ene-3β,28-diol), an abundantly available plant triterpenoid against S. mutans UA159. Betulin exhibited significant dose dependent antibiofilm activity without affecting bacterial viability. At 240 µg/ml (biofilm inhibitory concentration), betulin inhibited biofilm formation and adherence to smooth glass surfaces by 93 and 71 % respectively. It reduced water insoluble glucan synthesis by 89 %, in conjunction with down regulation of gtfBC genes. Microscopic analysis confirmed the disruption in biofilm architecture and decreased exopolysaccharide production. Acidogenicity and aciduricity, key virulence factors responsible for carious lesions, were also notably affected. The induced auto-aggregation of cells upon treatment could be due to the down regulation of vicK. Results of gene expression analysis demonstrated significant down-regulation of virulence genes upon betulin treatment. Furthermore, the nontoxic effect of betulin on peripheral blood mononuclear cells even after 72 h treatment makes it a strong candidate for assessing its suitability to be used as a therapeutic agent.

  7. Hypoxia and bicarbonate could limit the expression of iron acquisition genes in Strategy I plants by affecting ethylene synthesis and signaling in different ways.

    Science.gov (United States)

    García, María J; García-Mateo, María J; Lucena, Carlos; Romera, Francisco J; Rojas, Carmen L; Alcántara, Esteban; Pérez-Vicente, Rafael

    2014-01-01

    In a previous work, it was shown that bicarbonate (one of the most important factors causing Fe chlorosis in Strategy I plants) can limit the expression of several genes involved in Fe acquisition. Hypoxia is considered another important factor causing Fe chlorosis, mainly on calcareous soils. However, to date it is not known whether hypoxia aggravates Fe chlorosis by affecting bicarbonate concentration or by specific negative effects on Fe acquisition. Results found in this work show that hypoxia, generated by eliminating the aeration of the nutrient solution, can limit the expression of several Fe acquisition genes in Fe-deficient Arabidopsis, cucumber and pea plants, like the genes for ferric reductases AtFRO2, PsFRO1 and CsFRO1; iron transporters AtIRT1, PsRIT1 and CsIRT1; H(+) -ATPase CsHA1; and transcription factors AtFIT, AtbHLH38, and AtbHLH39. Interestingly, the limitation of the expression of Fe-acquisition genes by hypoxia did not occur in the Arabidopsis ethylene constitutive mutant ctr1, which suggests that the negative effect of hypoxia is related to ethylene, an hormone involved in the upregulation of Fe acquisition genes. As for hypoxia, results obtained by applying bicarbonate to the nutrient solution suggests that ethylene is also involved in its negative effect, since ACC (1-aminocyclopropane-1-carboxylic acid; ethylene precursor) partially reversed the negative effect of bicarbonate on the expression of Fe acquisition genes. Taken together, the results obtained show that hypoxia and bicarbonate could induce Fe chlorosis by limiting the expression of Fe acquisition genes, probably because each factor negatively affects different steps of ethylene synthesis and/or signaling. © 2013 Scandinavian Plant Physiology Society.

  8. De novo synthesis and functional analysis of the phosphatase-encoding gene acI-B of uncultured Actinobacteria from Lake Stechlin (NE Germany).

    Science.gov (United States)

    Srivastava, Abhishek; McMahon, Katherine D; Stepanauskas, Ramunas; Grossart, Hans-Peter

    2015-12-01

    The National Center for Biotechnology Information [http://www.ncbi.nlm.nih.gov/guide/taxonomy/] database enlists more than 15,500 bacterial species. But this also includes a plethora of uncultured bacterial representations. Owing to their metabolism, they directly influence biogeochemical cycles, which underscores the the important status of bacteria on our planet. To study the function of a gene from an uncultured bacterium, we have undertaken a de novo gene synthesis approach. Actinobacteria of the acI-B subcluster are important but yet uncultured members of the bacterioplankton in temperate lakes of the northern hemisphere such as oligotrophic Lake Stechlin (NE Germany). This lake is relatively poor in phosphate (P) and harbors on average ~1.3 x 10 6 bacterial cells/ml, whereby Actinobacteria of the ac-I lineage can contribute to almost half of the entire bacterial community depending on seasonal variability. Single cell genome analysis of Actinobacterium SCGC AB141-P03, a member of the acI-B tribe in Lake Stechlin has revealed several phosphate-metabolizing genes. The genome of acI-B Actinobacteria indicates potential to degrade polyphosphate compound. To test for this genetic potential, we targeted the exoP-annotated gene potentially encoding polyphosphatase and synthesized it artificially to examine its biochemical role. Heterologous overexpression of the gene in Escherichia coli and protein purification revealed phosphatase activity. Comparative genome analysis suggested that homologs of this gene should be also present in other Actinobacteria of the acI lineages. This strategic retention of specialized genes in their genome provides a metabolic advantage over other members of the aquatic food web in a P-limited ecosystem. [Int Microbiol 2016; 19(1):39-47]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  9. Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

    Science.gov (United States)

    Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

    2004-03-26

    The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

  10. The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

    Directory of Open Access Journals (Sweden)

    Jenneke Leentjens

    Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

  11. Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

    OpenAIRE

    Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

    2001-01-01

    (1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

  12. Probing interactions between B-glucan and bile salts at atomic detail by 1H-13C NMR assays

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

    2014-01-01

    Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

  13. The absence of the luxS gene increases swimming motility and flagella synthesis in Escherichia coli K12

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Hua; Kang, Aram; Tan, Mui Hua; Qi, Xiaobao [School of Chemical and Biomedical Engineering, Nanyang Technological University, Singapore 637459 (Singapore); Chang, Matthew Wook, E-mail: Matthewchang@ntu.edu.sg [School of Chemical and Biomedical Engineering, Nanyang Technological University, Singapore 637459 (Singapore)

    2010-10-29

    Research highlights: {yields} This paper provides the first evidence that luxS deletion enhances swimming motility and flagella synthesis in Escherichia coli K12 based on motility, transcriptome, and scanning electron microscopy analyses. {yields} A conceptual genetic regulatory network underlying the increased flagella synthesis was constructed based on the transcriptome and network component analyses, and previously known regulatory relations. {yields} The genetic regulatory network suggests that the increased flagella synthesis and motility might be contributed to by increased flhDC transcription level and/or decreased c-di-GMP concentration in luxS-deficient E. coli. -- Abstract: Despite the significant role of S-ribosylhomocysteinase (LuxS) in the activated methyl cycle pathway and quorum sensing, the connectivity between luxS and other cellular functions remains incomplete. Herein, we show that luxS deletion significantly increases swimming motility and flagella synthesis in Escherichia coli K12 using motility, transcriptome, and scanning electron microscopy assays. Further, based on the transcriptome and network component analyses, and known regulatory relations, we propose a conceptual genetic regulatory network underlying the increased flagella synthesis in response to luxS deletion.

  14. The absence of the luxS gene increases swimming motility and flagella synthesis in Escherichia coli K12

    International Nuclear Information System (INIS)

    Ling, Hua; Kang, Aram; Tan, Mui Hua; Qi, Xiaobao; Chang, Matthew Wook

    2010-01-01

    Research highlights: → This paper provides the first evidence that luxS deletion enhances swimming motility and flagella synthesis in Escherichia coli K12 based on motility, transcriptome, and scanning electron microscopy analyses. → A conceptual genetic regulatory network underlying the increased flagella synthesis was constructed based on the transcriptome and network component analyses, and previously known regulatory relations. → The genetic regulatory network suggests that the increased flagella synthesis and motility might be contributed to by increased flhDC transcription level and/or decreased c-di-GMP concentration in luxS-deficient E. coli. -- Abstract: Despite the significant role of S-ribosylhomocysteinase (LuxS) in the activated methyl cycle pathway and quorum sensing, the connectivity between luxS and other cellular functions remains incomplete. Herein, we show that luxS deletion significantly increases swimming motility and flagella synthesis in Escherichia coli K12 using motility, transcriptome, and scanning electron microscopy assays. Further, based on the transcriptome and network component analyses, and known regulatory relations, we propose a conceptual genetic regulatory network underlying the increased flagella synthesis in response to luxS deletion.

  15. Fish Oil Ameliorates High-Fat Diet Induced Male Mouse Reproductive Dysfunction via Modifying the Rhythmic Expression of Testosterone Synthesis Related Genes

    Directory of Open Access Journals (Sweden)

    Hualin Wang

    2018-04-01

    Full Text Available The present study aims to investigate the protective effects of ω-3 polyunsaturated fatty acids (ω-3PUFAs against high-fat diet induced male mouse reproductive dysfunction and to explore circadian regulation mechanisms. Male C57BL/6 mice were randomly divided into three groups and fed a normal chow diet (control group, CON, a high-fat diet (HFD group or a HFD supplemented with fish oil (FO group for 12 weeks. After 12 weeks of feeding, the body weight and the ratio of perinephric and epididymal fat weight to body weight were significantly higher in the HFD group compared with the CON group. The supplement of fish oil rich in ω-3PUFAs only slightly reduced the HFD-induced obesity but remarkably ameliorated HFD-induced dyslipidemia, sexual hormones disorder, testicle lesions and germ cell apoptosis. Fish oil supplementation restored the expression of steroid synthesis associated genes in HFD fed mouse and flattened the HFD-induced oscillations in circadian genes’ expression. Fish oil supplementation prevented HFD-induced male mouse reproductive dysfunction and modified the rhythmic expression of testosterone synthesis related genes.

  16. Expression of ABA synthesis and metabolism genes under different irrigation strategies and atmospheric VPDs is associated with stomatal conductance in grapevine (Vitis vinifera L. cv Cabernet Sauvignon).

    Science.gov (United States)

    Speirs, Jim; Binney, Allan; Collins, Marisa; Edwards, Everard; Loveys, Brian

    2013-04-01

    The influence of different levels of irrigation and of variation in atmospheric vapour pressure deficit (VPD) on the synthesis, metabolism, and transport of abscisic acid (ABA) and the effects on stomatal conductance were examined in field-grown Cabernet Sauvignon grapevines. Xylem sap, leaf tissue, and root tissue were collected at regular intervals during two seasons in conjunction with measurements of leaf water potential (Ψleaf) and stomatal conductance (gs). The different irrigation levels significantly altered the Ψleaf and gs of the vines across both seasons. ABA abundance in the xylem sap was correlated with gs. The expression of genes associated with ABA synthesis, NCED1 and NCED2, was higher in the roots than in the leaves throughout and highest in the roots in mid January, a time when soil moisture declined and VPD was at its highest. Their expression in roots was also inversely related to the levels of irrigation and correlated with ABA abundance in the roots, xylem sap, and leaves. Three genes encoding ABA 8'-hydroxylases were isolated and their identities confirmed by expression in yeast cells. The expression of one of these, Hyd1, was elevated in leaves when VPD was below 2.0-2.5 kPa and minimal at higher VPD levels. The results provide evidence that ABA plays an important role in linking stomatal response to soil moisture status and that changes in ABA catabolism at or near its site of action allows optimization of gas exchange to current environmental conditions.

  17. Characterization of the dextran-binding domain in the glucan-binding protein C of Streptococcus mutans.

    Science.gov (United States)

    Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M

    2015-10-01

    Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.

  18. Solid-phase-assisted synthesis of targeting peptide-PEG-oligo(ethane amino)amides for receptor-mediated gene delivery.

    Science.gov (United States)

    Martin, Irene; Dohmen, Christian; Mas-Moruno, Carlos; Troiber, Christina; Kos, Petra; Schaffert, David; Lächelt, Ulrich; Teixidó, Meritxell; Günther, Michael; Kessler, Horst; Giralt, Ernest; Wagner, Ernst

    2012-04-28

    In the forthcoming era of cancer gene therapy, efforts will be devoted to the development of new efficient and non-toxic gene delivery vectors. In this regard, the use of Fmoc/Boc-protected oligo(ethane amino)acids as building blocks for solid-phase-supported assembly represents a novel promising approach towards fully controlled syntheses of effective gene vectors. Here we report on the synthesis of defined polymers containing the following: (i) a plasmid DNA (pDNA) binding domain of eight succinoyl-tetraethylenpentamine (Stp) units and two terminal cysteine residues; (ii) a central polyethylene glycol (PEG) chain (with twenty-four oxyethylene units) for shielding; and (iii) specific peptides for targeting towards cancer cells. Peptides B6 and c(RGDfK), which bind transferrin receptor and α(v)β(3) integrin, respectively, were chosen because of the high expression of these receptors in many tumoral cells. This study shows the feasibility of designing these kinds of fully controlled vectors and their success for targeted pDNA-based gene transfer. This journal is © The Royal Society of Chemistry 2012

  19. Low-intensity pulsed ultrasound stimulates cell proliferation, proteoglycan synthesis and expression of growth factor-related genes in human nucleus pulposus cell line

    Directory of Open Access Journals (Sweden)

    Y Kobayashi

    2009-06-01

    Full Text Available Low-intensity pulsed ultrasound (LIPUS stimulation has been shown to effect differentiation and activation of human chondrocytes. A study involving stimulation of rabbit disc cells with LIPUS revealed upregulation of cell proliferation and proteoglycan (PG synthesis. However, the effect of LIPUS on human nucleus pulposus cells has not been investigated. In the present study, therefore, we investigated whether LIPUS stimulation of a human nucleus pulposus cell line (HNPSV-1 exerted a positive effect on cellular activity. HNPSV-1 cells were encapsulated in 1.2% sodium alginate solution at 1x105 cells/ml and cultured at 10 beads/well in 6-well plates. The cells were stimulated for 20 min each day using a LIPUS generator, and the effects of LIPUS were evaluated by measuring DNA and PG synthesis. Furthermore, mRNA expression was analyzed by cDNA microarray using total RNA extracted from the cultured cells. Our study revealed no significant difference in cell proliferation between the control and the ultrasound treated groups. However, PG production was significantly upregulated in HNPSV cells stimulated at intensities of 15, 30, 60, and 120 mW/cm2 compared with the control. The results of cDNA array showed that LIPUS significantly stimulated the gene expression of growth factors and their receptors (BMP2, FGF7, TGFbetaR1 EGFRF1, VEGF. These findings suggest that LIPUS stimulation upregulates PG production in human nucleus pulposus cells by the enhancement of several matrix-related genes including growth factor-related genes. Safe and non-invasive stimulation using LIPUS may be a useful treatment for delaying the progression of disc degeneration.

  20. Antimicrobial and Antitumor Activities of Novel Peptides Derived from the Lipopolysaccharide- and β-1,3-Glucan Binding Protein of the Pacific Abalone Haliotis discus hannai

    Directory of Open Access Journals (Sweden)

    Bo-Hye Nam

    2016-12-01

    Full Text Available Antimicrobial peptides are a pivotal component of the invertebrate innate immune system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP gene from the pacific abalone Haliotis discus hannai (HDH, which is involved in the pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF encoding a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2. By substituting a positively charged amino acid and amidation at the C-terminus, the pI and net charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa, lung (A549, and colon (HCT 116 carcinoma cell lines but not much on human umbilical vein cell (HUVEC. Fluorescence-activated cell sorter (FACS analysis showed that HDH-LGBP analogs disturb the cancer cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs as multifunctional drugs.

  1. Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

    Directory of Open Access Journals (Sweden)

    Ľubomír Mikuš

    2013-02-01

    Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

  2. Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

    Science.gov (United States)

    Kupetz, M; Sacher, B; Becker, T

    2016-06-05

    Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

    Science.gov (United States)

    Kumari, J; Sahoo, P K

    2006-02-01

    This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

  4. Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

    Science.gov (United States)

    Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

    2015-08-01

    A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

    Science.gov (United States)

    Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

    2018-06-19

    The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

  6. Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

    Science.gov (United States)

    Kuzmanoff, K. M.

    1984-01-01

    In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

  7. A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

    Science.gov (United States)

    Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

    2014-08-01

    An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. (1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

    Science.gov (United States)

    Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

    2017-03-01

    A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

  9. Influence of the IL-1Ra gene polymorphism on in vivo synthesis of IL-1Ra and IL-1beta after live yellow fever vaccination.

    Science.gov (United States)

    Hacker, U T; Erhardt, S; Tschöp, K; Jelinek, T; Endres, S

    2001-09-01

    The inflammatory response in infectious and autoimmune diseases is regulated by the balance between pro- and anti-inflammatory cytokines. The IL-1 complex contains polymorphic genes coding for IL-1alpha, IL-1beta and IL-1Ra. The IL-1Ra (variable number of tanden repeat) VNTR polymorphism has been shown to influence the capacity to produce IL-1beta and IL-1Ra after in vitro stimulation. Allele 2 of this polymorphism is associated with a number of inflammatory diseases. To determine the impact of the IL-1Ra polymorphism on in vivo human cytokine synthesis, we used a yellow fever vaccination model for the induction of cytokine synthesis in healthy volunteers. Two different yellow fever vaccines were used. After administration of the RKI vaccine (34 volunteers), plasma TNF-alpha concentration increased from 13.4 +/- 0.9 pg/ml to 23.3 +/- 1.1 pg/ml (P < 0.001), and plasma IL-1Ra concentration increased from 308 +/- 25 pg/ml to 1019 +/- 111 pg/ml (P < 0.001), on day 2. Using Stamaril vaccine, no increase in the plasma concentrations of either TNF-alpha or IL-1Ra could be detected (n = 17). Only the RKI vaccine induced TNF-alpha synthesis after in vitro stimulation of MNC. Carriers of allele 2 of the IL-1Ra polymorphism had increased baseline concentrations of IL-1Ra (350 +/- 32 pg/ml) compared with non-carriers (222 +/- 18 pg/ml, P < 0.001), and decreased concentrations of IL-1beta (0.9 +/- 0.2 pg/ml for carriers versus 2.8 +/- 0.7 pg/ml for non-carriers, P = 0.017). After yellow fever vaccination (RKI vaccine), no significant differences in the increase of IL-1Ra plasma levels were detected between carriers and non-carriers of allele 2 of the IL-1Ra gene polymorphism. This is the first study to examine the influence of this genetic polymorphism on in vivo-induced human IL-1beta and IL-1Ra synthesis. Baseline concentrations of IL-1Ra and IL-1beta were significantly influenced by the IL-1Ra polymorphism. No influence of the IL-1Ra polymorphism on the in vivo

  10. Sorghum Brown midrib 2 (Bmr2) gene encodes the major 4-coumarate Coenzyme A ligase involved in lignin synthesis

    Science.gov (United States)

    Successful modification of plant cell wall composition without compromising plant integrity is dependent on being able to modify the expression of specific genes, but can be very challenging when the target genes are members of multigene families. 4-Coumarate:CoA ligase (4CL) catalyzes the formatio...

  11. Map-Based Cloning of Seed Dormancy1-2 Identified a Gibberellin Synthesis Gene Regulating the Development of Endosperm-Imposed Dormancy in Rice.

    Science.gov (United States)

    Ye, Heng; Feng, Jiuhuan; Zhang, Lihua; Zhang, Jinfeng; Mispan, Muhamad S; Cao, Zhuanqin; Beighley, Donn H; Yang, Jianchang; Gu, Xing-You

    2015-11-01

    Natural variation in seed dormancy is controlled by multiple genes mapped as quantitative trait loci in major crop or model plants. This research aimed to clone and characterize the Seed Dormancy1-2 (qSD1-2) locus associated with endosperm-imposed dormancy and plant height in rice (Oryza sativa). qSD1-2 was delimited to a 20-kb region, which contains OsGA20ox2 and had an additive effect on germination. Naturally occurring or induced loss-of-function mutations of the gibberellin (GA) synthesis gene enhanced seed dormancy and also reduced plant height. Expression of this gene in seeds (including endospermic cells) during early development increased GA accumulation to promote tissue morphogenesis and maturation programs. The mutant allele prevalent in semidwarf cultivars reduced the seed GA content by up to 2-fold at the early stage, which decelerated tissue morphogenesis including endosperm cell differentiation, delayed abscisic acid accumulation by a shift in the temporal distribution pattern, and postponed dehydration, physiological maturity, and germinability development. As the endosperm of developing seeds dominates the moisture equilibrium and desiccation status of the embryo in cereal crops, qSD1-2 is proposed to control primary dormancy by a GA-regulated dehydration mechanism. Allelic distribution of OsGA20ox2, the rice Green Revolution gene, was associated with the indica and japonica subspeciation. However, this research provided no evidence that the primitive indica- and common japonica-specific alleles at the presumably domestication-related locus functionally differentiate in plant height and seed dormancy. Thus, the evolutionary mechanism of this agriculturally important gene remains open for discussion. © 2015 American Society of Plant Biologists. All Rights Reserved.

  12. Map-Based Cloning of Seed Dormancy1-2 Identified a Gibberellin Synthesis Gene Regulating the Development of Endosperm-Imposed Dormancy in Rice1

    Science.gov (United States)

    Ye, Heng; Feng, Jiuhuan; Zhang, Lihua; Zhang, Jinfeng; Mispan, Muhamad S.; Cao, Zhuanqin; Beighley, Donn H.; Yang, Jianchang; Gu, Xing-You

    2015-01-01

    Natural variation in seed dormancy is controlled by multiple genes mapped as quantitative trait loci in major crop or model plants. This research aimed to clone and characterize the Seed Dormancy1-2 (qSD1-2) locus associated with endosperm-imposed dormancy and plant height in rice (Oryza sativa). qSD1-2 was delimited to a 20-kb region, which contains OsGA20ox2 and had an additive effect on germination. Naturally occurring or induced loss-of-function mutations of the gibberellin (GA) synthesis gene enhanced seed dormancy and also reduced plant height. Expression of this gene in seeds (including endospermic cells) during early development increased GA accumulation to promote tissue morphogenesis and maturation programs. The mutant allele prevalent in semidwarf cultivars reduced the seed GA content by up to 2-fold at the early stage, which decelerated tissue morphogenesis including endosperm cell differentiation, delayed abscisic acid accumulation by a shift in the temporal distribution pattern, and postponed dehydration, physiological maturity, and germinability development. As the endosperm of developing seeds dominates the moisture equilibrium and desiccation status of the embryo in cereal crops, qSD1-2 is proposed to control primary dormancy by a GA-regulated dehydration mechanism. Allelic distribution of OsGA20ox2, the rice Green Revolution gene, was associated with the indica and japonica subspeciation. However, this research provided no evidence that the primitive indica- and common japonica-specific alleles at the presumably domestication-related locus functionally differentiate in plant height and seed dormancy. Thus, the evolutionary mechanism of this agriculturally important gene remains open for discussion. PMID:26373662

  13. Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

    NARCIS (Netherlands)

    Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

    1999-01-01

    Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

  14. Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

    NARCIS (Netherlands)

    Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

    Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

  15. Mutations in nif genes that cause Klebsiella pneumoniae to be derepressed for nitrogenase synthesis in the presence of ammonium.

    OpenAIRE

    MacNeil, D; Brill, W J

    1980-01-01

    Four Nif+ revertants from strains with polar insertions in nifL, were insensitive to ammonium and amino acid repression of nitrogenase synthesis. These strains have mutations located in or near the nifL region. The derepressed phenotype was dominant in a merodiploid containing a nif+ plasmid. These nif regulatory mutations also suppressed the Nif- phenotype of Gln- strains. Thus, regulation by fixed nitrogen (possible via glutamine synthetase) occurs on the nifLA operon but not on the other s...

  16. β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

    Science.gov (United States)

    2015-01-01

    The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

  17. Discovering the role of the apolipoprotein gene and the genes in the putative pullulan biosynthesis pathway on the synthesis of pullulan, heavy oil and melanin in Aureobasidium pullulans.

    Science.gov (United States)

    Guo, Jian; Huang, Siyao; Chen, Yefu; Guo, Xuewu; Xiao, Dongguang

    2017-12-18

    Pullulan produced by Aureobasidium pullulans presents various applications in food manufacturing and pharmaceutical industry. However, the pullulan biosynthesis mechanism remains unclear. This work proposed a pathway suggesting that heavy oil and melanin may correlate with pullulan production. The effects of overexpression or deletion of genes encoding apolipoprotein, UDPG-pyrophosphorylase, glucosyltransferase, and α-phosphoglucose mutase on the production of pullulan, heavy oil, and melanin were examined. Pullulan production increased by 16.93 and 8.52% with the overexpression of UDPG-pyrophosphorylase and apolipoprotein genes, respectively. Nevertheless, the overexpression or deletion of other genes exerted little effect on pullulan biosynthesis. Heavy oil production increased by 146.30, 64.81, and 33.33% with the overexpression of UDPG-pyrophosphorylase, α-phosphoglucose mutase, and apolipoprotein genes, respectively. Furthermore, the syntheses of pullulan, heavy oil, and melanin can compete with one another. This work may provide new guidance to improve the production of pullulan, heavy oil, and melanin through genetic approach.

  18. Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

    Science.gov (United States)

    Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

    2016-10-01

    This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Lysosomes are involved in induction of steroidogenic acute regulatory protein (StAR) gene expression and progesterone synthesis through low-density lipoprotein in cultured bovine granulosa cells.

    Science.gov (United States)

    Zhang, Jin-You; Wu, Yi; Zhao, Shuan; Liu, Zhen-Xing; Zeng, Shen-Ming; Zhang, Gui-Xue

    2015-09-15

    Progesterone is an important steroid hormone in the regulation of the bovine estrous cycle. The steroidogenic acute regulatory protein (StAR) is an indispensable component for transporting cholesterol to the inner mitochondrial membrane, which is one of the rate-limiting steps for progesterone synthesis. Low-density lipoprotein (LDL) supplies cholesterol precursors for progesterone formation, and the lysosomal degradation pathway of LDL is essential for progesterone biosynthesis in granulosa cells after ovulation. However, it is currently unknown how LDL and lysosomes coordinate the expression of the StAR gene and progesterone production in bovine granulosa cells. Here, we investigated the role of lysosomes in LDL-treated bovine granulosa cells. Our results reported that LDL induced expression of StAR messenger RNA and protein as well as expression of cholesterol side-chain cleavage cytochrome P-450 (CYP11A1) messenger RNA and progesterone production in cultured bovine granulosa cells. The number of lysosomes in the granulosa cells was also significantly increased by LDL; whereas the lysosomal inhibitor, chloroquine, strikingly abolished these LDL-induced effects. Our results indicate that LDL promotes StAR expression, synthesis of progesterone, and formation of lysosomes in bovine granulosa cells, and lysosomes participate in the process by releasing free cholesterol from hydrolyzed LDL. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Inhibitors of Fatty Acid Synthesis Induce PPAR α -Regulated Fatty Acid β -Oxidative Genes: Synergistic Roles of L-FABP and Glucose.

    Science.gov (United States)

    Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm

    2013-01-01

    While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.

  1. Genes and proteins of the alternative steroid backdoor pathway for dihydrotestosterone synthesis are expressed in the human ovary and seem enhanced in the polycystic ovary syndrome.

    Science.gov (United States)

    Marti, Nesa; Galván, José A; Pandey, Amit V; Trippel, Mafalda; Tapia, Coya; Müller, Michel; Perren, Aurel; Flück, Christa E

    2017-02-05

    Recently, dihydrotestosterone biosynthesis through the backdoor pathway has been implicated for the human testis in addition to the classic pathway for testosterone (T) synthesis. In the human ovary, androgen precursors are crucial for estrogen synthesis and hyperandrogenism in pathologies such as the polycystic ovary syndrome is partially due to ovarian overproduction. However, a role for the backdoor pathway is only established for the testis and the adrenal, but not for the human ovary. To investigate whether the backdoor pathway exists in normal and PCOS ovaries, we performed specific gene and protein expression studies on ovarian tissues. We found aldo-keto reductases (AKR1C1-1C4), 5α-reductases (SRD5A1/2) and retinol dehydrogenase (RoDH) expressed in the human ovary, indicating that the ovary might produce dihydrotestosterone via the backdoor pathway. Immunohistochemical studies showed specific localization of these proteins to the theca cells. PCOS ovaries show enhanced expression, what may account for the hyperandrogenism. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

    Directory of Open Access Journals (Sweden)

    A.C.C.F.F. De Paula

    2005-06-01

    Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

  3. A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

    Science.gov (United States)

    Semedo, Magda C; Karmali, Amin; Fonseca, Luís

    2015-02-01

    Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Effects of dietary yeastβ-glucan on nutrient digestibility and serum proifles in pre-ruminant Holstein calves

    Institute of Scientific and Technical Information of China (English)

    MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu

    2015-01-01

    This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.

  5. EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES

    OpenAIRE

    Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima

    2017-01-01

    The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...

  6. Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

    Science.gov (United States)

    Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

    2018-07-15

    A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    Science.gov (United States)

    Wu, Alex Chi; Ral, Jean-Philippe; Morell, Matthew K; Gilbert, Robert G

    2014-01-01

    Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (bio)synthesis of the chain-length distribution (CLD) of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  8. Low Concentrations of o,p’-DDT Inhibit Gene Expression and Prostaglandin Synthesis by Estrogen Receptor-Independent Mechanism in Rat Ovarian Cells

    Science.gov (United States)

    Liu, Jing; Zhao, Meirong; Zhuang, Shulin; Yang, Yan; Yang, Ye; Liu, Weiping

    2012-01-01

    o,p’-DDT is an infamous xenoestrogen as well as a ubiquitous and persistent pollutant. Biomonitoring studies show that women have been internally exposed to o,p’-DDT at range of 0.3–500 ng/g (8.46×10−10 M−1.41×10−6 M) in blood and other tissues. However, very limited studies have investigated the biological effects and mechanism(s) of o,p’-DDT at levels equal to or lower than current exposure levels in human. In this study, using primary cultures of rat ovarian granulosa cells, we determined that very low doses of o,p’-DDT (10−12−10−8 M) suppressed the expression of ovarian genes and production of prostaglandin E2 (PGE2). In vivo experiments consistently demonstrated that o,p’-DDT at 0.5–1 mg/kg inhibited the gene expression and PGE2 levels in rat ovary. The surprising results from the receptor inhibitors studies showed that these inhibitory effects were exerted independently of either classical estrogen receptors (ERs) or G protein-coupled receptor 30 (GPR30). Instead, o,p’-DDT altered gene expression or hormone action via inhibiting the activation of protein kinase A (PKA), rather than protein kinase C (PKC). We further revealed that o,p’-DDT directly interfered with the PKA catalytic subunit. Our novel findings support the hypothesis that exposure to low concentrations of o,p’-DDT alters gene expression and hormone synthesis through signaling mediators beyond receptor binding, and imply that the current exposure levels of o,p’-DDT observed in the population likely poses a health risk to female reproduction. PMID:23209616

  9. Characterization of the beta-carotene hydroxylase gene DSM2 conferring drought and oxidative stress resistance by increasing xanthophylls and abscisic acid synthesis in rice.

    Science.gov (United States)

    Du, Hao; Wang, Nili; Cui, Fei; Li, Xianghua; Xiao, Jinghua; Xiong, Lizhong

    2010-11-01

    Drought is a major limiting factor for crop production. To identify critical genes for drought resistance in rice (Oryza sativa), we screened T-DNA mutants and identified a drought-hypersensitive mutant, dsm2. The mutant phenotype was caused by a T-DNA insertion in a gene encoding a putative β-carotene hydroxylase (BCH). BCH is predicted for the biosynthesis of zeaxanthin, a carotenoid precursor of abscisic acid (ABA). The amounts of zeaxanthin and ABA were significantly reduced in two allelic dsm2 mutants after drought stress compared with the wild type. Under drought stress conditions, the mutant leaves lost water faster than the wild type and the photosynthesis rate, biomass, and grain yield were significantly reduced, whereas malondialdehyde level and stomata aperture were increased in the mutant. The mutant is also hypersensitive to oxidative stresses. The mutant had significantly lower maximal efficiency of photosystem II photochemistry and nonphotochemical quenching capacity than the wild type, indicating photoinhibition in photosystem II and decreased capacity for eliminating excess energy by thermal dissipation. Overexpression of DSM2 in rice resulted in significantly increased resistance to drought and oxidative stresses and increases of the xanthophylls and nonphotochemical quenching. Some stress-related ABA-responsive genes were up-regulated in the overexpression line. DSM2 is a chloroplast protein, and the response of DSM2 to environmental stimuli is distinctive from the other two BCH members in rice. We conclude that the DSM2 gene significantly contributes to control of the xanthophyll cycle and ABA synthesis, both of which play critical roles in the establishment of drought resistance in rice.

  10. Streptococcus mutans Protein Synthesis during Mixed-Species Biofilm Development by High-Throughput Quantitative Proteomics

    Science.gov (United States)

    Klein, Marlise I.; Xiao, Jin; Lu, Bingwen; Delahunty, Claire M.; Yates, John R.; Koo, Hyun

    2012-01-01

    Biofilms formed on tooth surfaces are comprised of mixed microbiota enmeshed in an extracellular matrix. Oral biofilms are constantly exposed to environmental changes, which influence the microbial composition, matrix formation and expression of virulence. Streptococcus mutans and sucrose are key modulators associated with the evolution of virulent-cariogenic biofilms. In this study, we used a high-throughput quantitative proteomics approach to examine how S. mutans produces relevant proteins that facilitate its establishment and optimal survival during mixed-species biofilms development induced by sucrose. Biofilms of S. mutans, alone or mixed with Actinomyces naeslundii and Streptococcus oralis, were initially formed onto saliva-coated hydroxyapatite surface under carbohydrate-limiting condition. Sucrose (1%, w/v) was then introduced to cause environmental changes, and to induce biofilm accumulation. Multidimensional protein identification technology (MudPIT) approach detected up to 60% of proteins encoded by S. mutans within biofilms. Specific proteins associated with exopolysaccharide matrix assembly, metabolic and stress adaptation processes were highly abundant as the biofilm transit from earlier to later developmental stages following sucrose introduction. Our results indicate that S. mutans within a mixed-species biofilm community increases the expression of specific genes associated with glucan synthesis and remodeling (gtfBC, dexA) and glucan-binding (gbpB) during this transition (Pmutans up-regulates specific adaptation mechanisms to cope with acidic environments (F1F0-ATPase system, fatty acid biosynthesis, branched chain amino acids metabolism), and molecular chaperones (GroEL). Interestingly, the protein levels and gene expression are in general augmented when S. mutans form mixed-species biofilms (vs. single-species biofilms) demonstrating fundamental differences in the matrix assembly, survival and biofilm maintenance in the presence of other

  11. Reactions of saccharides catalyzed by molybdate ions. XXXIII. Use of. cap alpha. (U-/sup 14/C)glucan for preparation of /sup 14/C-labelled saccharides

    Energy Technology Data Exchange (ETDEWEB)

    Bilik, V; Biely, P [Institute of Chemistry, Centre for Chemical Research, Slovak Academy of Sciences, Bratislava (Czechoslovakia); Kolina, J [Ustav pro Vyzkum, Vyrobu a Vyuziti Radioisotopu, Prague (Czechoslovakia)

    1984-01-01

    D-(U-/sup 14/C)glucose obtained in acid hydrolysis of ..cap alpha..-(U-/sup 14/C)glucan (2 M-HCl) was epimerized under a catalytic action of molybdate ions to D-(U-/sup 14/C)mannose isolated with a 20% yield. Oxidative degradation of 4-nitrophenylhydrazones of D-(U-/sup 14/C)arabinose and D-(U-/sup 14/C)xylose resulted in D-(U-/sup 14/C)erythrose and D-(U-/sup 14/C)threose, respectively, with a 15% yield relative to the starting aldopentoses. Nitromethane synthesis with D-(U-/sup 14/C)lyxose followed by oxidative decomposition of the corresponding nitrohexitols yielded /sup 14/C-labelled D-galactose. Described is also the preparation of D-(U-/sup 14/C)arabinose from D-(U-/sup 14/C)glucose and the conversion of D-(U-/sup 14/C)arabinose to D-(U-/sup 14/C)xylose and D-(U-/sup 14/C)lyxose.

  12. Synthesis and evaluation of a glutamic acid-modified hPAMAM complex as a promising versatile gene carrier.

    Science.gov (United States)

    Hemmati, Mohammad; Kazemi, Bahram; Najafi, Farhood; Zarebkohan, Amir; Shirkoohi, Reza

    2016-01-01

    Hyperbranched poly(amidoamine) (HPAMAM), structurally analogous to polyamidoamine dendrimer (PAMAM) dendrimers, has been suggested to be an effective carrier for gene delivery. In the present study, glutamic acid-modified hPAMAM was developed as a novel non-viral gene carrier for the first time. The hPAMAM was synthesized by using a modified one-pot method. DNA was found to be bound to hPAMAM at different weight ratios (WhPAMAM/WDNA). The resulting HPAMAM-Glu20 was able to efficiently protect the encapsulated-DNA against degradation for over 2 h. In addition to low cytotoxicity, the transfection efficiency of hPAMAM-Glu20 represented much higher (p glutamic amino acid (Glu)-based gene delivery is an economical, effective and biocompatible method.

  13. The AtCAO gene, encoding chlorophyll a oxygenase, is required for chlorophyll b synthesis in Arabidopsis thaliana

    Science.gov (United States)

    Espineda, Cromwell E.; Linford, Alicia S.; Devine, Domenica; Brusslan, Judy A.

    1999-01-01

    Chlorophyll b is synthesized from chlorophyll a and is found in the light-harvesting complexes of prochlorophytes, green algae, and both nonvascular and vascular plants. We have used conserved motifs from the chlorophyll a oxygenase (CAO) gene from Chlamydomonas reinhardtii to isolate a homologue from Arabidopsis thaliana. This gene, AtCAO, is mutated in both leaky and null chlorina1 alleles, and DNA sequence changes cosegregate with the mutant phenotype. AtCAO mRNA levels are higher in three different mutants that have reduced levels of chlorophyll b, suggesting that plants that do not have sufficient chlorophyll b up-regulate AtCAO gene expression. Additionally, AtCAO mRNA levels decrease in plants that are grown under dim-light conditions. We have also found that the six major Lhcb proteins do not accumulate in the null ch1-3 allele. PMID:10468639

  14. Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

    Science.gov (United States)

    Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

    2014-03-01

    The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

  15. Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

    Science.gov (United States)

    Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

    2014-03-19

    A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

  16. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  17. Post radiation protection and enhancement of DNA repair of beta glucan isolated from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.

    2013-01-01

    Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)

  18. Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

    Directory of Open Access Journals (Sweden)

    Eduardo Madrigal-Bujaidar

    2015-06-01

    Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

  19. Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

    International Nuclear Information System (INIS)

    Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

    2013-01-01

    Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

  20. Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae.

    Science.gov (United States)

    Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon

    2017-08-01

    Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

  1. Synthesis and characterization of polyamidoamine dendrimer-coated multi-walled carbon nanotubes and their application in gene delivery systems

    Science.gov (United States)

    Pan, Bifeng; Cui, Daxiang; Xu, Ping; Ozkan, Cengiz; Feng, Gao; Ozkan, Mihri; Huang, Tuo; Chu, Bingfeng; Li, Qing; He, Rong; Hu, Guohan

    2009-03-01

    With the aim of improving the amount and delivery efficiency of genes taken by carbon nanotubes into human cancer cells, different generations of polyamidoamine dendrimer modified multi-walled carbon nanotubes (dMNTs) were fabricated, and characterized by high-resolution transmission electron microscopy, atomic force microscopy, x-ray photoelectron spectroscopy, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis, revealing the presence of dendrimer capped on the surface of carbon nanotubes. The dMNTs fully conjugated with FITC-labeled antisense c-myc oligonucleotides (asODN), those resultant asODN-dMNTs composites were incubated with human breast cancer cell line MCF-7 cells and MDA-MB-435 cells, and liver cancer cell line HepG2 cells, and confirmed to enter into tumor cells within 15 min by laser confocal microscopy. These composites inhibited the cell growth in time- and dose-dependent means, and down-regulated the expression of the c-myc gene and C-Myc protein. Compared with the composites of CNT-NH2-asODN and dendrimer-asODN, no. 5 generation of dendrimer-modified MNT-asODN composites exhibit maximal transfection efficiencies and inhibition effects on tumor cells. The intracellular gene transport and uptake via dMNTs should be generic for the mammalian cell lines. The dMNTs have potentials in applications such as gene or drug delivery for cancer therapy and molecular imaging.

  2. Synthesis and characterization of polyamidoamine dendrimer-coated multi-walled carbon nanotubes and their application in gene delivery systems

    Energy Technology Data Exchange (ETDEWEB)

    Pan Bifeng; Cui Daxiang; Xu Ping; Feng Gao; Huang Tuo; Li Qing; He Rong [Department of Bio-Nano-Science and Engineering, National Key Laboratory of Nano/Micro Fabrication Technology, Key Laboratory for Thin Film and Microfabrication of Ministry of Education, Institute of Micro-Nano Science and Technology, Shanghai JiaoTong University, 800 Dongchuan Road, Shanghai 200240 (China); Ozkan, Cengiz [Mechanical Engineering Department, University of California Riverside, 900 University Avenue-Riverside, CA 92521 (United States); Ozkan, Mihri [Electrical Engineering Department, University of California Riverside, 900 University Avenue, Riverside, CA 92521 (United States); Chu, Bingfeng [Department of Stomatology, General Hospital of PLA, 28 Fuxing Road, Beijing100853 (China); Hu Guohan [Department of Neurosurgery of Changzheng Hospital, 415 Fengyang Road, Second Military Medical University, Shanghai 20003 (China)], E-mail: dxcui@sjtu.edu.cn, E-mail: huguohan6504@sina.com

    2009-03-25

    With the aim of improving the amount and delivery efficiency of genes taken by carbon nanotubes into human cancer cells, different generations of polyamidoamine dendrimer modified multi-walled carbon nanotubes (dMNTs) were fabricated, and characterized by high-resolution transmission electron microscopy, atomic force microscopy, x-ray photoelectron spectroscopy, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis, revealing the presence of dendrimer capped on the surface of carbon nanotubes. The dMNTs fully conjugated with FITC-labeled antisense c-myc oligonucleotides (asODN), those resultant asODN-dMNTs composites were incubated with human breast cancer cell line MCF-7 cells and MDA-MB-435 cells, and liver cancer cell line HepG2 cells, and confirmed to enter into tumor cells within 15 min by laser confocal microscopy. These composites inhibited the cell growth in time- and dose-dependent means, and down-regulated the expression of the c-myc gene and C-Myc protein. Compared with the composites of CNT-NH{sub 2}-asODN and dendrimer-asODN, no. 5 generation of dendrimer-modified MNT-asODN composites exhibit maximal transfection efficiencies and inhibition effects on tumor cells. The intracellular gene transport and uptake via dMNTs should be generic for the mammalian cell lines. The dMNTs have potentials in applications such as gene or drug delivery for cancer therapy and molecular imaging.

  3. Synthesis and characterization of polyamidoamine dendrimer-coated multi-walled carbon nanotubes and their application in gene delivery systems

    International Nuclear Information System (INIS)

    Pan Bifeng; Cui Daxiang; Xu Ping; Feng Gao; Huang Tuo; Li Qing; He Rong; Ozkan, Cengiz; Ozkan, Mihri; Chu, Bingfeng; Hu Guohan

    2009-01-01

    With the aim of improving the amount and delivery efficiency of genes taken by carbon nanotubes into human cancer cells, different generations of polyamidoamine dendrimer modified multi-walled carbon nanotubes (dMNTs) were fabricated, and characterized by high-resolution transmission electron microscopy, atomic force microscopy, x-ray photoelectron spectroscopy, Raman spectroscopy, Fourier transform infrared spectroscopy and thermogravimetric analysis, revealing the presence of dendrimer capped on the surface of carbon nanotubes. The dMNTs fully conjugated with FITC-labeled antisense c-myc oligonucleotides (asODN), those resultant asODN-dMNTs composites were incubated with human breast cancer cell line MCF-7 cells and MDA-MB-435 cells, and liver cancer cell line HepG2 cells, and confirmed to enter into tumor cells within 15 min by laser confocal microscopy. These composites inhibited the cell growth in time- and dose-dependent means, and down-regulated the expression of the c-myc gene and C-Myc protein. Compared with the composites of CNT-NH 2 -asODN and dendrimer-asODN, no. 5 generation of dendrimer-modified MNT-asODN composites exhibit maximal transfection efficiencies and inhibition effects on tumor cells. The intracellular gene transport and uptake via dMNTs should be generic for the mammalian cell lines. The dMNTs have potentials in applications such as gene or drug delivery for cancer therapy and molecular imaging.

  4. New perspectives on the role of α- and β-amylases in transient starch synthesis.

    Directory of Open Access Journals (Sweden)

    Alex Chi Wu

    Full Text Available Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (biosynthesis of the chain-length distribution (CLD of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.

  5. Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

    Science.gov (United States)

    Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

    2017-01-01

    This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

  6. Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

    Science.gov (United States)

    Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

    1990-04-01

    Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

  7. Auxin synthesis gene tms1 driven by tuber-specific promoter alters hormonal status of transgenic potato plants and their responses to exogenous phytohormones.

    Science.gov (United States)

    Kolachevskaya, Oksana O; Sergeeva, Lidiya I; Floková, Kristyna; Getman, Irina A; Lomin, Sergey N; Alekseeva, Valeriya V; Rukavtsova, Elena B; Buryanov, Yaroslav I; Romanov, Georgy A

    2017-03-01

    Ectopic auxin overproduction in transgenic potato leads to enhanced productivity accompanied with concerted and occasional changes in hormonal status, and causing altered response of transformants to exogenous auxin or cytokinin. Previously, we generated potato transformants expressing Agrobacterium-derived auxin synthesis gene tms1 driven by tuber-specific patatin gene promoter (B33-promoter). Here, we studied the endogenous hormonal status and the response to exogenous phytohormones in tms1 transformants cultured in vitro. Adding indole-3-acetic acid (IAA) or kinetin to culture medium affected differently tuberization of tms1-transformed and control plants, depending also on sucrose content in the medium. Exogenous phytohormones ceased to stimulate the tuber initiation in transformants at high (5-8%) sucrose concentration, while in control plants the stimulation was observed in all experimental settings. Furthermore, exogenous auxin partly inhibited the tuber initiation, and exogenous cytokinin reduced the average tuber weight in most transformants at high sucrose content. The elevated auxin level in tubers of the transformants was accompanied with a decrease in content of cytokinin bases and their ribosides in tubers and most shoots. No concerted changes in contents of abscisic, jasmonic, salicylic acids and gibberellins in tubers were detected. The data on hormonal status indicated that the enhanced productivity of tms1 transformants was due to auxin and not mediated by other phytohormones. In addition, exogenous cytokinin was shown to upregulate the expression of genes encoding orthologs of auxin receptors. Overall, the results showed that tms1 expression and local increase in IAA level in transformants affect both the balance of endogenous cytokinins and the dynamics of tuberization in response to exogenous hormones (auxin, cytokinin), the latter reaction depending also on the carbohydrate supply. We introduce a basic model for the hormonal network

  8. Rice gene SDL/RNRS1, encoding the small subunit of ribonucleotide reductase, is required for chlorophyll synthesis and plant growth development.

    Science.gov (United States)

    Qin, Ran; Zeng, Dongdong; Liang, Rong; Yang, Chengcong; Akhter, Delara; Alamin, Md; Jin, Xiaoli; Shi, Chunhai

    2017-09-05

    A new mutant named sdl (stripe and drooping leaf) was characterized from indica cultivar Zhenong 34 by ethylmethane sulfonate (EMS) mutagenesis. The mutant sdl exhibited development defects including stripe and drooping leaf, dwarfism and deformed floral organs. The gene SDL was found allelic to RNRS1 by map-based cloning, which was homologous to Arabidopsis TSO2 encoding the small subunit of ribonucleotide reductase. The gDNA sequencing results of sdl in mutant showed that there was a repetitive sequence insertion of 138-bp at the 475 th bp in the exon. The redundant sequence was conserved in SDL homologous proteins, which contained the active site (tyrosine), as well as two amino acids glutamate and histidine involved in the binding of iron. There were fewer chloroplasts and grana lamellas in sdl leaf compared with those of wild-type. Additionally, the stripe leaves of sdl seedlings were highly sensitive to temperature, since the chlorophyll content was increased with the temperature rising. The drooping leaf of sdl might be resulted from the disappearance of vascular bundles and mesophyll cells in both leaf midrib and lateral veins. Fittingly to the phenotypes of mutant sdl, the expression levels of genes associated with photosynthesis and chlorophyll synthesis were found to be down- or up-regulated at different temperatures in mutant sdl. Also, the transcriptional levels of genes related to plant height and floral organ formation showed obvious differences between wild-type and sdl. The "SDL/RNRS1" was, hence, required for the chlorophyll biosynthesis and also played pleiotropic roles in the regulation of plant development. Copyright © 2017. Published by Elsevier B.V.

  9. Generic tools to assess genuine carbohydrate specific effects on in vitro immune modulation exemplified by β-glucans

    DEFF Research Database (Denmark)

    Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.

    2013-01-01

    Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...

  10. Protective Effects of Surfactant Protein D (SP-D) Treatment in 1,3-β-glucan-modulated Allergic Inflammation

    DEFF Research Database (Denmark)

    Fakih, Dalia; Pilecki, Bartosz; Schlosser, Anders

    2015-01-01

    SP-D is a pulmonary collectin important in lung immunity. SP-D-deficient mice (Sftpd(-/-)) are reported to be susceptible to ovalbumin (OVA)- and fungal allergen-induced pulmonary inflammation, while treatment with exogenous SP-D has therapeutic effects in such disease models. β-glucans are a div...

  11. Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus

    NARCIS (Netherlands)

    Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello

    2017-01-01

    A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle

  12. Respiratory health in children, and indoor exposure to (1,3)-beta-D-glucan, EPS mould components and endotoxin

    NARCIS (Netherlands)

    Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.

    For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular

  13. Crystal Structure of α-1,4-Glucan Lyase, a Unique Glycoside Hydrolase Family Member with a Novel Catalytic Mechanism

    NARCIS (Netherlands)

    Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.

    2013-01-01

    α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades

  14. β-glucan enriched bath directly stimulates the wound healing process in common carp (Cyprinus carpio L.)

    DEFF Research Database (Denmark)

    Przybylska, Dominika Alicja; Schmidt, Jacob; Jiménez, Natalia Ivonne Vera

    2013-01-01

    of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1b, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1b, IL-6 family member M17 and IL-8 were...

  15. Plant α-glucan phosphatases SEX4 and LSF2 display different affinity for amylopectin and amylose

    DEFF Research Database (Denmark)

    Wilkens, Casper; Auger, Kyle D.; Anderson, Nolan T.

    2016-01-01

    The plant glucan phosphatases Starch EXcess 4 (SEX4) and Like Sex Four2 (LSF2) apply different starch binding mechanisms. SEX4 contains a carbohydrate binding module, and LSF2 has two surface binding sites (SBSs). We determined KDapp for amylopectin and amylose, and KD for β-cyclodextrin and vali...

  16. Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

    Science.gov (United States)

    Shiota, E; Maekawa, M; Kono, T

    2001-12-01

    Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

  17. Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

    DEFF Research Database (Denmark)

    Madsen, A. M.; Tendal, K.; Thilsing, T.

    2013-01-01

    occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

  18. Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children

    DEFF Research Database (Denmark)

    Holst, Gitte Juel; Høst, Arne; Doekes, G

    2015-01-01

    Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...

  19. Characterization and partial purification of beta-1,3-D-glucan (callose) synthase from barley (Hordeum vulgare) leaves

    DEFF Research Database (Denmark)

    Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.

    1993-01-01

    The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...

  20. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

    Czech Academy of Sciences Publication Activity Database

    Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

    2009-01-01

    Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

  1. Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

    Science.gov (United States)

    Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

    2017-09-05

    Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Comparative Genomics of Pneumocystis Species Suggests the Absence of Genes for myo-Inositol Synthesis and Reliance on Inositol Transport and Metabolism

    Science.gov (United States)

    Sesterhenn, Thomas M.; Collins, Margaret S.; Welge, Jeffrey A.

    2014-01-01

    ABSTRACT In the context of deciphering the metabolic strategies of the obligate pathogenic fungi in the genus Pneumocystis, the genomes of three species (P. carinii, P. murina, and P. jirovecii) were compared among themselves and with the free-living, phylogenetically related fission yeast (Schizosaccharomyces pombe). The underrepresentation of amino acid metabolism pathways compared to those in S. pombe, as well as the incomplete steroid biosynthesis pathway, were confirmed for P. carinii and P. jirovecii and extended to P. murina. All three Pneumocystis species showed overrepresentation of the inositol phosphate metabolism pathway compared to that in the fission yeast. In addition to those known in S. pombe, four genes, encoding inositol-polyphosphate multikinase (EC 2.7.1.151), inositol-pentakisphosphate 2-kinase (EC 2.7.1.158), phosphoinositide 5-phosphatase (EC 3.1.3.36), and inositol-1,4-bisphosphate 1-phosphatase (EC 3.1.3.57), were identified in the two rodent Pneumocystis genomes, P. carinii and P. murina. The P. jirovecii genome appeared to contain three of these genes but lacked phosphoinositide 5-phosphatase. Notably, two genes encoding enzymes essential for myo-inositol synthesis, inositol-1-phosphate synthase (INO1) and inositol monophosphatase (INM1), were absent from all three genomes, suggesting that Pneumocystis species are inositol auxotrophs. In keeping with the need to acquire exogenous inositol, two genes with products homologous to fungal inositol transporters, ITR1 and ITR2, were identified in P. carinii and P. murina, while P. jirovecii contained only the ITR1 homolog. The ITR and inositol metabolism genes in P. murina and P. carinii were expressed during fulminant infection as determined by reverse transcriptase real-time PCR of cDNA from infected lung tissue. Supplementation of in vitro culture with inositol yielded significant improvement of the viability of P. carinii for days 7 through 14. PMID:25370490

  3. Transglycosylated Starch Modulates the Gut Microbiome and Expression of Genes Related to Lipid Synthesis in Liver and Adipose Tissue of Pigs

    Directory of Open Access Journals (Sweden)

    Monica A. Newman

    2018-02-01

    Full Text Available Dietary inclusion of resistant starches can promote host health through modulation of the gastrointestinal microbiota, short-chain fatty acid (SCFA profiles, and lipid metabolism. This study investigated the impact of a transglycosylated cornstarch (TGS on gastric, ileal, cecal, proximal-colonic, and mid-colonic bacterial community profiles and fermentation metabolites using a growing pig model. It additionally evaluated the effect of TGS on the expression of host genes related to glucose and SCFA absorption, incretins, and satiety in the gut as well as host genes related to lipid metabolism in hepatic and adipose tissue. Sixteen growing pigs (4 months of age were fed either a TGS or control (CON diet for 11 days. Bacterial profiles were determined via Illumina MiSeq sequencing of the V3–5 region of the 16S rRNA gene, whereas SCFA and gene expression were measured using gas chromatography and reverse transcription-quantitative PCR. Megasphaera, which was increased at all gut sites, began to benefit from TGS feeding in gastric digesta, likely through cross-feeding with other microbes, such as Lactobacillus. Shifts in the bacterial profiles from dietary TGS consumption in the cecum, proximal colon, and mid colon were similar. Relative abundances of Ruminococcus and unclassified Ruminococcaceae genus were lower, whereas that of unclassified Veillonellaceae genus was higher in TGS- compared to CON-fed pigs (p < 0.05. TGS consumption also increased (p < 0.05 concentrations of SCFA, especially propionate, and lactate in the distal hindgut compared to the CON diet which might have up-regulated GLP1 expression in the cecum (p < 0.05 and mid colon compared to the control diet (p < 0.10. TGS-fed pigs showed increased hepatic and decreased adipocyte expression of genes for lipid synthesis (FASN, SREBP1, and ACACA compared to CON-fed pigs, which may be related to postprandial portal nutrient flow and reduced systemic insulin signaling. Overall, our data

  4. Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

    Science.gov (United States)

    Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

    2012-04-01

    Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

  5. NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

    Directory of Open Access Journals (Sweden)

    Henky Manoppo

    2010-06-01

    Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

  6. Tobacco TTG2 and ARF8 function concomitantly to control flower colouring by regulating anthocyanin synthesis genes.

    Science.gov (United States)

    Li, P; Chen, X; Sun, F; Dong, H

    2017-07-01

    Recently we elucidated that tobacco TTG2 cooperates with ARF8 to regulate the vegetative growth and seed production. Here we show that TTG2 and ARF8 control flower colouring by regulating expression of ANS and DFR genes, which function in anthocyanin biosynthesis. Genetic modifications that substantially altered expression levels of the TTG2 gene and production quantities of TTG2 protein were correlated with flower development and colouring. Degrees of flower colour were increased by TTG2 overexpression but decreased through TTG2 silencing, in coincidence with high and low concentrations of anthocyanins in flowers. Of five genes involved in the anthocyanin biosynthesis pathway, only ANS and DFR were TTG2-regulated and displayed enhancement and diminution of expression with TTG2 overexpression and silencing, respectively. The floral expression of ANS and DFR also needed a functional ARF8 gene, as ANS and DFR expression were attenuated by ARF8 silencing, which concomitantly diminished the role of TTG2 in anthocyanin production. While ARF8 required TTG2 to be expressed by itself and to regulate ANS and DFR expression, the concurrent presence of normally functional TTG2 and ARF8 was critical for floral production of anthocyanins and also for flower colouration. Our data suggest that TTG2 functions concomitantly with ARF8 to control degrees of flower colour by regulating expression of ANS and DFR, which are involved in the anthocyanin biosynthesis pathway. ARF8 depends on TTG2 to regulate floral expression of ANS and DFR with positive effects on anthocyanin production and flower colour. © 2017 German Botanical Society and The Royal Botanical Society of the Netherlands.

  7. Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

    OpenAIRE

    Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara

    2015-01-01

    In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family...

  8. Microarray-Based Analysis of the Differential Expression of Melanin Synthesis Genes in Dark and Light-Muzzle Korean Cattle

    OpenAIRE

    Kim, Sang Hwan; Hwang, Sue Yun; Yoon, Jong Taek

    2014-01-01

    The coat color of mammals is determined by the melanogenesis pathway, which is responsible for maintaining the balance between black-brown eumelanin and yellow-reddish pheomelanin. It is also believed that the color of the bovine muzzle is regulated in a similar manner; however, the molecular mechanism underlying pigment deposition in the dark-muzzle has yet to be elucidated. The aim of the present study was to identify melanogenesis-associated genes that are differentially expressed in the d...

  9. Synthesis of 'cineole cassette' monoterpenes in Nicotiana section Alatae: gene isolation, expression, functional characterization and phylogenetic analysis.

    Science.gov (United States)

    Fähnrich, Anke; Brosemann, Anne; Teske, Laura; Neumann, Madeleine; Piechulla, Birgit

    2012-08-01

    The scent bouquets of flowers of Nicotiana species, particularly those of section Alatae, are rich in monoterpenes, including 1,8-cineole, limonene, β-myrcene, α- and β-pinene, sabinene, and α-terpineol. New terpene synthase genes were isolated from flowers of Nicotiana bonariensis, N. forgetiana, N. longiflora, and N. mutabilis. The recombinant enzymes synthesize simultaneously the characteristic 'cineole cassette' monoterpenes with 1,8-cineole as the dominant volatile product. Interestingly, amino acid sequence comparison and phylogenetic tree construction clustered the newly isolated cineole synthases (CIN) of section Alatae together with the catalytically similar CIN of N. suaveolens of section Suaveolentes, thus suggesting a common ancestor. These CIN genes of N. bonariensis, N. forgetiana, N. longiflora, and N. mutabilis are distinct from the terpineol synthases (TERs) of the taxonomically related N. alata and N. langsdorfii (both Alatae), thus indicating gene diversification of monoterpene synthases in section Alatae. Furthermore, the presence of CINs in species of the American section Alatae supports the hypothesis that one parent of the Australian section Suaveolentes was a member of the present section Alatae. Amino acid sequences of the Nicotiana CINs and TERs were compared to identify relevant amino acids of the cyclization reaction from α-terpineol to 1,8-cineole.

  10. Analysis of mRNA expression of genes related to fatty acids synthesis in goose fatty liver

    Directory of Open Access Journals (Sweden)

    Shuxia Xiang

    2010-11-01

    Full Text Available The aim of our study was to evaluate the effect of overfeeding on mRNA expression levels of genes involved in lipogenesis, in order to understand the mechanism of hepatic stea - tosis in the goose. Using Landes geese (Anser anser and Sichuan White geese (Anser cygnoides as experimental animals, we quantified the mRNA expression of lipogenic genes, acetyl-CoA carboxylase-α (ACCα and fatty acid synthase (FAS, and of two transcription factors, sterol regulatory element-binding proteins- 1 (SREBP-1 and carbohydrate responsive element-binding protein (ChREBP by real-time polymerase chain reaction (RTPCR, and measured the lipid and triglyceride (TG content in the liver and the plasma level of glucose, insulin and TG. Our results indicated that compared to the control group, the overfeeding induced an increase of the lipid and TG content in the liver and also of the plasma insulin and TG concentration in both breeds. However, the plasma glucose level decreased after overfeeding in the Sichuan White goose, and there was no evident change in the Landes goose. Lastly, the mRNA expression of ACCα, FAS, SREBP-1 and ChREBP in the overfed group was lower than in the control group in both breeds. We concluded that the lipogenesis pathway plays a role in overfeeding- induced hepatic steatosis and that the decreased mRNA level of related genes may be the indicator of hepatic steatosis.

  11. β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

    Science.gov (United States)

    Shao, Yujing; Guo, Yuming; Wang, Zhong

    2013-07-01

    This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

  12. Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

    Science.gov (United States)

    Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

    2017-02-01

    (1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

  13. Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

    Science.gov (United States)

    Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

    2015-04-01

    Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

    Directory of Open Access Journals (Sweden)

    Vishukumar Aimanianda

    2017-06-01

    Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

  15. Characterization of oat beta-glucan and coenzyme Q10-loaded beta-glucan powders generated by the pressurized gas-expanded liquid (PGX) technology.

    Science.gov (United States)

    Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral

    2018-04-01

    The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Design, synthesis and evaluation of VEGF-siRNA/CRS as a novel vector for gene delivery

    Directory of Open Access Journals (Sweden)

    Zhao W

    2016-11-01

    Full Text Available Wen Zhao, Yifan Zhang, Xueyun Jiang, Chunying Cui School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, China Abstract: Small interfering RNA (siRNA delivery is a prospective method in gene therapy, but it has application limitations such as negative charge, water solubility and high molecular weight. In this study, a safe and efficient nano-vector, CRS, was designed and synthesized to facilitate siRNA delivery. Physical and chemical properties of VEGF-siRNA/CRS were characterized by methods including scanning electron microscopy (SEM, transmission electron microscopy, zeta potential (ζ measurement, drug-releasing rate measurement, gel electrophoresis and confocal microscopy. The biological activities were evaluated using cell viability assay, gene-silencing efficacy assay in vitro, real-time polymerase chain reaction, enzyme-linked immunosorbent assay (ELISA and antitumor tests in vivo. The mean nanoparticle size of VEGF-siRNA/CRS was 121.4±0.3 nm with positive ζ potential of 7.69±4.47 mV. The release rate of VEGF-siRNA from VEGF-siRNA/CRS was 82.50% sustained for 48 h in Tris-ethylenediaminetetraacetic acid buffer (pH 8.0. Real-time polymerase chain reaction was used to analyze the efficiency of the transfection, and the result showed that VEGF mRNA expression had been knocked down by 82.36%. The expression of VEGF protein was also recorded to be downregulated to 14.83% using ELISA. The results of cytotoxicity measured by Cell Counting Kit-8 assay showed that VEGF-siRNA/CRS had significant inhibitory effect on HeLa cells. The results of antitumor assays indicated that VEGF-siRNA/CRS exhibited tumor cell growth inhibition in vivo. The results demonstrated that VEGF-siRNA could be delivered and transported by the designed carrier, while siRNA could be released constantly and led to an increasing gene-silencing effect against VEGF gene. In conclusion, VEGF-siRNA/CRS is a promising carrier for si

  17. Gene expression

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.

    1983-01-01

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  18. Effects of Low Molecular Weight Yeast β-Glucan on Antioxidant and Immunological Activities in Mice

    Directory of Open Access Journals (Sweden)

    Na Lei

    2015-09-01

    Full Text Available To evaluate the antioxidant and immune effects of low molecular yeast β-glucan on mice, three sulfated glucans from Saccharomyces cerevisiae (sGSCs with different molecular weight (MW and degrees of sulfation (DS were prepared. The structures of the sGSCs were analyzed through high performance liquid chromatography-gel permeation chromatography (HPLC-GPC and Fourier transform infrared spectroscopy (FTIR. sGSC1, sGSC2, and sGSC3 had MW of 12.9, 16.5 and 19.2 kDa, respectively, and DS of 0.16, 0.24 and 0.27, respectively. In vitro and in vivo experiments were conducted to evaluate the antioxidant and immunological activities of the sGSCs. In vitro experiment, the reactive oxygen species (ROS scavenging activities were determined. In vivo experiment, 50 male BALB/c mice were divided into five groups. The sGSC1, sGSC2 and sGSC3 treatment groups received the corresponding sGSCs at 50 mg/kg/day each. The GSC (glucans from Saccharomyces cerevisiae treatment group received 50 mg/kg/day GSC. The normal control group received equal volume of physiological saline solution. All treatments were administered intragastrically for 14 day. Results showed that sGSC1, sGSC2 and sGSC3 can scavenge 1,1-diphenyl-2-picryl-hydrazyl (DPPH, superoxide, and hydroxyl radicals in vitro. The strength of the radical scavenging effects of the sGSCs was in the order of sGSC1 > sGSC2 > sGSC3. Oral administration of sGSC1 significantly improved serum catalase (CAT and glutathione peroxidase (GSH-Px activities and decreased malondialdehyde (MDA level in mice. sGSC1 significantly improved the spleen and thymus indexes and the lymphocyte proliferation, effectively enhanced the percentage of CD4+ T cells, decreased the percentage of CD8+ T cells, and elevated the CD4+/CD8+ ratio. sGSC1 significantly promoted the secretion of IL-2 and IFN-γ. These results indicate that sGSC1 with low MW and DS has better antioxidant and immunological activities than the other sGSCs, and sGSC1 could

  19. Dopamine D1 receptor activation regulates the expression of the estrogen synthesis gene aromatase B in radial glial cell

    Directory of Open Access Journals (Sweden)

    Lei eXing

    2015-09-01

    Full Text Available Radial glial cells (RGCs are abundant stem-like non-neuronal progenitors that are important for adult neurogenesis and brain repair, yet little is known about their regulation by neurotransmitters. Here we provide evidence for neuronal-glial interactions via a novel role for dopamine to stimulate RGC function. Goldfish were chosen as the model organism due to the abundance of RGCs and regenerative abilities of the adult central nervous system. A close anatomical relationship was observed between tyrosine hydroxylase-positive catecholaminergic cell bodies and axons and dopamine-D1 receptor expressing RGCs along the ventricular surface of telencephalon, a site of active neurogenesis. A primary cell culture model was established and immunofluorescence analysis indicates that in vitro RGCs from female goldfish retain their major characteristics in vivo, including expression of glial fibrillary acidic protein and brain lipid binding protein. The estrogen synthesis enzyme aromatase B is exclusively found in RGCs, but this is lost as cells differentiate to neurons and other glial types in adult teleost brain. Pharmacological experiments using the cultured RGCs established that specific activation of dopamine D1 receptors up-regulates aromatase B mRNA through a cyclic adenosine monophosphate-dependent molecular mechanism. These data indicate that dopamine enhances the steroidogenic function of this neuronal progenitor cell.

  20. Structure elucidation and immunomodulatory activity of a beta glucan from the fruiting bodies of Ganoderma sinense.

    Directory of Open Access Journals (Sweden)

    Xiao-Qiang Han

    Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.

  1. Live imaging of β-1,3-glucan synthase FKS-1 in Neurospora crassa hyphae.

    Science.gov (United States)

    Sánchez-León, Eddy; Riquelme, Meritxell

    2015-09-01

    The subcellular localization and dynamics of FKS-1, the putative catalytic subunit of the β-1,3-glucan synthase complex, was analyzed in growing hyphae of Neurospora crassa by live confocal microscopy. GFP-tagged FKS-1 accumulated at the outer layer of the Spitzenkörper (Spk), and at the apical plasma membrane (PM). Fluorescence recovery after photobleaching analysis revealed arrival of FKS-1-containing carriers first at the immediate surroundings of the core region of the Spk, and thereafter to the Spk most outer region. The results obtained here and previous data suggest that FKS-1 is transported to the Spk in macrovesicles. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Structure Elucidation and Immunomodulatory Activity of A Beta Glucan from the Fruiting Bodies of Ganoderma sinense

    Science.gov (United States)

    Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin

    2014-01-01

    A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571

  3. Synthesis and optimization of cholesterol-based diquaternary ammonium Gemini Surfactant (Chol-GS) as a new gene delivery vector.

    Science.gov (United States)

    Kim, Bieong-Kil; Doh, Kyung-Oh; Bae, Yun-Ui; Seu, Young-Bae

    2011-01-01

    Amongst a number of potential nonviral vectors, cationic liposomes have been actively researched, with both gemini surfactants and bola amphiphiles reported as being in possession of good structures in terms of cell viability and in vitro transfection. In this study, a cholesterol-based diquaternary ammonium gemini surfactant (Chol-GS) was synthesized and assessed as a novel nonviral gene vector. Chol-GS was synthesized from cholesterol by way of four reaction steps. The optimal efficiency was found to be at a weight ratio of 1:4 of lipid:DOPE (1,2-dioleoyl-L-alpha- glycero-3-phosphatidylethanolamine), and at a ratio of between 10:1~15:1 of liposome:DNA. The transfection efficiency was compared with commercial liposomes and with Lipofectamine, 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE-C), and N-[1-(2,3-dioleoyloxy)propyl]- N,N,N-trimethylammonium chloride (DOTAP). The results indicate that the efficiency of Chol-GS is greater than that of all the tested commercial liposomes in COS7 and Huh7 cells, and higher than DOTAP and Lipofectamine in A549 cells. Confirmation of these findings was observed through the use of green fluorescent protein expression. Chol-GS exhibited a moderate level of cytotoxicity, at optimum concentrations for efficient transfection, indicating cell viability. Hence, the newly synthesized Chol-GS liposome has the potential of being an excellent nonviral vector for gene delivery.

  4. Antifungal Properties of Cationic Phenylene Ethynylenes and Their Impact on β-Glucan Exposure.

    Science.gov (United States)

    Pappas, Harry C; Sylejmani, Rina; Graus, Matthew S; Donabedian, Patrick L; Whitten, David G; Neumann, Aaron K

    2016-08-01

    Candida species are the cause of many bloodstream infections through contamination of indwelling medical devices. These infections account for a 40% mortality rate, posing a significant risk to immunocompromised patients. Traditional treatments against Candida infections include amphotericin B and various azole treatments. Unfortunately, these treatments are associated with high toxicity, and resistant strains have become more prevalent. As a new frontier, light-activated phenylene ethynylenes have shown promising biocidal activity against Gram-positive and -negative bacterial pathogens, as well as the environmental yeast Saccharomyces cerevisiae In this study, we monitored the viability of Candida species after treatment with a cationic conjugated polymer [poly(p-phenylene ethynylene); PPE] or oligomer ["end-only" oligo(p-phenylene ethynylene); EO-OPE] by flow cytometry in order to explore the antifungal properties of these compounds. The oligomer was found to disrupt Candida albicans yeast membrane integrity independent of light activation, while PPE is able to do so only in the presence of light, allowing for some control as to the manner in which cytotoxic effects are induced. The contrast in killing efficacy between the two compounds is likely related to their size difference and their intrinsic abilities to penetrate the fungal cell wall. Unlike EO-OPE-DABCO (where DABCO is quaternized diazabicyclo[2,2,2]octane), PPE-DABCO displayed a strong propensity to associate with soluble β-glucan, which is expected to inhibit its ability to access and perturb the inner cell membrane of Candida yeast. Furthermore, treatment with PPE-DABCO unmasked Candida albicans β-glucan and increased phagocytosis by Dectin-1-expressing HEK-293 cells. In summary, cationic phenylene ethynylenes show promising biocidal activity against pathogenic Candida yeast cells while also exhibiting immunostimulatory effects. Copyright © 2016, American Society for Microbiology. All Rights

  5. Prospective Evaluation of Serum β-Glucan Testing in Patients With Probable or Proven Fungal Diseases

    Science.gov (United States)

    Angebault, Cécile; Lanternier, Fanny; Dalle, Frédéric; Schrimpf, Cécile; Roupie, Anne-Laure; Dupuis, Aurélie; Agathine, Aurélie; Scemla, Anne; Paubelle, Etienne; Caillot, Denis; Neven, Bénédicte; Frange, Pierre; Suarez, Felipe; d'Enfert, Christophe; Lortholary, Olivier; Bougnoux, Marie-Elisabeth

    2016-01-01

    Background. Early diagnosis and treatment are crucial in invasive fungal diseases (IFD). Serum (1-3)-β-d-glucan (BG) is believed to be an early IFD marker, but its diagnostic performance has been ambiguous, with insufficient data regarding sensitivity at the time of IFD diagnosis (TOD) and according to outcome. Whether its clinical utility is equivalent for all types of IFD remains unknown. Methods. We included 143 patients with proven or probable IFD (49 invasive candidiasis, 45 invasive aspergillosis [IA], and 49 rare IFD) and analyzed serum BG (Fungitell) at TOD and during treatment. Results. (1-3)-β-d-glucan was undetectable at TOD in 36% and 48% of patients with candidemia and IA, respectively; there was no correlation between negative BG results at TOD and patients' characteristics, localization of infection, or prior antifungal use. Nevertheless, patients with candidemia due to Candida albicans were more likely to test positive for BG at TOD (odds ratio = 25.4, P = .01) than patients infected with other Candida species. In 70% of the patients with a follow-up, BG negativation occurred in >1 month for candidemia and >3 months for IA. A slower BG decrease in patients with candidemia was associated with deep-seated localizations (P = .04). Thirty-nine percent of patients with rare IFD had undetectable BG at TOD; nonetheless, all patients with chronic subcutaneous IFD tested positive at TOD. Conclusions. Undetectable serum BG does not rule out an early IFD, when the clinical suspicion is high. After IFD diagnostic, kinetics of serum BG are difficult to relate to clinical outcome. PMID:27419189

  6. Synthesis of mesoporous SiO2–ZnO nanocapsules: encapsulation of small biomolecules for drugs and “SiOZO-plex” for gene delivery

    International Nuclear Information System (INIS)

    Kumar, Vijay Bhooshan; Annamanedi, Madhavi; Prashad, Muvva Durga; Arunasree, Kalle M.; Mastai, Yitzhak; Gedanken, Aharon; Paik, Pradip

    2013-01-01

    This work presents a new synthesis of mesoporous SiO 2 –ZnO composite nanocapsules with sizes of 90–150 nm and represents their applications in encapsulation of small biomolecules (fluorescent molecules, drugs, and DNA) for uses in medical biotechnology (e.g., drug and gene delivery) for the first time. The nanocapsule size and morphology have been confirmed through the HRSEM and HRTEM. The mesoporous structure of the novel materials has been confirmed through both BET and HRTEM, and the pore diameter observed to be ca. 2–8 nm with an average diameter of 5.1 nm. The BET surface area of mesoporous SiO 2 –ZnO was found to be ∼230 m 2 g −1 . Three different types of pores were detected through HRTEM: type-I, normal pores in silica matrix, pore with ZnO nanoparticles at the boundary (type-II) and type-III, the pores with tiny ZnO nanoparticles (∼5–7 nm) inside them. To demonstrate the biocompatibility and cell viability of the nanocapsules, normal and cancerous lymphocyte cells have been chosen and investigated in a systematic way. Fluorescent dye (Rhodamine 6G), anticancer drug e.g., Doxorubicin (DOX) were loaded in all types of pores, and EtBr-labeled DNA molecules were loaded efficiently into the mesopores of second and third types of the composite nanocapsules to manifest the characteristic of mesoporous, and to find out its loading efficacy. The release kinetics of Rhodamine 6G and DOX were studied. The results highlight the potential of novel functional mesoporous SiO 2 –ZnO nanoparticles for using as the carrier of drugs and formation of “SiOZO-plex”, a complex of mesoporous SiO 2 –ZnO with DNA for gene delivery applications.Graphical Abstract

  7. Synthesis of mesoporous SiO{sub 2}-ZnO nanocapsules: encapsulation of small biomolecules for drugs and 'SiOZO-plex' for gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Vijay Bhooshan [School of Engineering Sciences and Technology, University of Hyderabad (India); Annamanedi, Madhavi [School of Life Sciences, University of Hyderabad, Department of Animal Sciences (India); Prashad, Muvva Durga [University of Hyderabad, Centre for Nanoscience and Nanotechnology (India); Arunasree, Kalle M. [School of Life Sciences, University of Hyderabad, Department of Animal Sciences (India); Mastai, Yitzhak; Gedanken, Aharon, E-mail: gedanken@mail.biu.ac.il [Bar-Ilan University, Department of Chemistry, Institute for Nanotechnology and Advanced Materials (Israel); Paik, Pradip, E-mail: ppse@uohyd.ernet.in [School of Engineering Sciences and Technology, University of Hyderabad (India)

    2013-09-15

    This work presents a new synthesis of mesoporous SiO{sub 2}-ZnO composite nanocapsules with sizes of 90-150 nm and represents their applications in encapsulation of small biomolecules (fluorescent molecules, drugs, and DNA) for uses in medical biotechnology (e.g., drug and gene delivery) for the first time. The nanocapsule size and morphology have been confirmed through the HRSEM and HRTEM. The mesoporous structure of the novel materials has been confirmed through both BET and HRTEM, and the pore diameter observed to be ca. 2-8 nm with an average diameter of 5.1 nm. The BET surface area of mesoporous SiO{sub 2}-ZnO was found to be {approx}230 m{sup 2} g{sup -1}. Three different types of pores were detected through HRTEM: type-I, normal pores in silica matrix, pore with ZnO nanoparticles at the boundary (type-II) and type-III, the pores with tiny ZnO nanoparticles ({approx}5-7 nm) inside them. To demonstrate the biocompatibility and cell viability of the nanocapsules, normal and cancerous lymphocyte cells have been chosen and investigated in a systematic way. Fluorescent dye (Rhodamine 6G), anticancer drug e.g., Doxorubicin (DOX) were loaded in all types of pores, and EtBr-labeled DNA molecules were loaded efficiently into the mesopores of second and third types of the composite nanocapsules to manifest the characteristic of mesoporous, and to find out its loading efficacy. The release kinetics of Rhodamine 6G and DOX were studied. The results highlight the potential of novel functional mesoporous SiO{sub 2}-ZnO nanoparticles for using as the carrier of drugs and formation of 'SiOZO-plex', a complex of mesoporous SiO{sub 2}-ZnO with DNA for gene delivery applications.Graphical Abstract.

  8. Cloning and expression of the sucrose phosphorylase gene in Bacillus subtilis and synthesis of kojibiose using the recombinant enzyme.

    Science.gov (United States)

    Wang, Miaomiao; Wu, Jing; Wu, Dan

    2018-02-15

    Kojibiose as a prebiotic and inhibitor of α-glucosidase exhibits potential for a wide range of applications in the food and medicine fields; however, large-scale separation and extraction of kojibiose from nature is difficult. Sucrose phosphorylase (SPase) can be used for the production of kojibiose, and currently, SPase is only heterologously expressed in E. coli, making it unsuitable for use in the food industry. However, Bacillus subtilis is generally considered to be a safe organism potentially useful for SPase expression. Here, for the first time, we heterologously expressed Bifidobacterium adolescentis SPase in a food-grade B. subtilis strain. The results showed that SPase was efficiently secreted into the extracellular medium in the absence of a signal peptide. After culturing the recombinant strain in a 3-L bioreactor, crude SPase yield and activity reached 7.5 g/L and 5.3 U/mL, respectively, the highest levels reported to date. The optimal reaction conditions for kojibiose synthesis catalyzed by recombinant SPase were as follows: 0.5 M sucrose, 0.5 M glucose, 0.02 U enzyme /mg all_substrates , pH 7.0, 50 °C, and 30 h. Furthermore, the substrate-conversion rate reached 40.01%, with kojibiose accounting for 104.45 g/L and selectivity for kojibiose production at 97%. Here, we successfully expressed SPase in B. subtilis in the absence of a signal peptide and demonstrated its secretion into the extracellular medium. Our results indicated high levels of recombinant enzyme expression, with a substrate-conversion rate of 40.01%. These results provide a basis for large-scale preparation of kojibiose by the recombinant SPase.

  9. Synthesis and NMR characterization of dendrimers based on 2, 2-bis-(hydroxymethyl-propanoic acid (bis-HMPA containing peripheral amino acid residues for gene transfection

    Directory of Open Access Journals (Sweden)

    Silvana Alfei

    2017-08-01

    Full Text Available Dendrimers, the emerging man made, highly branched, star-shaped macromolecules with nanometer-scale dimensions are well known for their well defined and high controlled architecture, their versatility and high functionality and are of eminent interest in nanomedical applications such as drug delivery, gene transfection, and imaging. In this paper, versatile protocols for the synthesis of polyester-based, hydrolysable, polycationic dendrimers have been setup. A fourth generation dendrimer equipped with 48 peripheral hydroxyl groups was prepared from 2,2-bis(hydroxymethylpropanoic acid and was used for grafting BOC-amino acids or as “hypercores” on which dendrons functionalized with BOC-amino acids were attached. A library of 15 polycationic homo- and hetero-dendrimers in the form of hydrochloride was obtained. Their structures and composition were confirmed by NMR analysis and by experimental molecular weight computed by volumetric titration. Their buffer capacity and results obtained from cytotoxicity assays and tests of binding with both pDNA and siRNA were very satisfactory.

  10. Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

    Science.gov (United States)

    Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

    2017-12-05

    Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  11. Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

    International Nuclear Information System (INIS)

    Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

    2015-01-01

    Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

  12. Synthesis of S-linked cello-oligosaccharides

    DEFF Research Database (Denmark)

    Nami, Faranak

    , structurally well-defined oligosaccharides made via chemical synthesis can be used as models for the more complex polysaccharides in the investigation of properties such as polysaccharide biosynthesis, degradation and protein-carbohydrate interactions. For this purpose, non-natural substrate analogues forming...... irreversible binding to the enzyme can be employed. Thio-oligosaccharides represent the largest class of specific non-natural inhibitors for glycanases. In this thesis the chemical synthesis of some thio-glucans is presented. The formation of thio-linkages using a classical and non-classical method...... is investigated. Two strategies, relying on either a linear or a convergent strategy, have been employed in the synthesis towards two target molecules. Furthermore, the activity of a glycosyltransferase responsible for the elongation of a pectic polysaccharide has been investigated and partially characterized....

  13. Mutational pattern of the nurse shark antigen receptor gene (NAR) is similar to that of mammalian Ig genes and to spontaneous mutations in evolution: the translesion synthesis model of somatic hypermutation.

    Science.gov (United States)

    Diaz, M; Velez, J; Singh, M; Cerny, J; Flajnik, M F

    1999-05-01

    The pattern of somatic mutations of shark and frog Ig is distinct from somatic hypermutation of Ig in mammals in that there is a bias to mutate GC base pairs and a low frequency of mutations. Previous analysis of the new antigen receptor gene in nurse sharks (NAR), however, revealed no bias to mutate GC base pairs and the frequency of mutation was comparable to that of mammalian IgG. Here, we analyzed 1023 mutations in NAR and found no targeting of the mechanism to any particular nucleotide but did obtain strong evidence for a transition bias and for strand polarity. As seen for all species studied to date, the serine codon AGC/T in NAR was a mutational hotspot. The NAR mutational pattern is most similar to that of mammalian IgG and furthermore both are strikingly akin to mutations acquired during the neutral evolution of nuclear pseudogenes, suggesting that a similar mechanism is at work for both processes. In yeast, most spontaneous mutations are introduced by the translesion synthesis DNA polymerase zeta (REV3) and in various DNA repair-deficient backgrounds transitions were more often REV3-dependent than were transversions. Therefore, we propose a model of somatic hypermutation where DNA polymerase zeta is recruited to the Ig locus. An excess of DNA glycosylases in germinal center reactions may further enhance the mutation frequency by a REV3-dependent mutagenic process known as imbalanced base excision repair.

  14. Quorum sensing controls the synthesis of virulence factors by modulating rsmA gene expression in Erwinia carotovora subsp. carotovora.

    Science.gov (United States)

    Kõiv, V; Mäe, A

    2001-04-01

    The plant-pathogenic bacterium Erwinia carotovora subsp. carotovora (Ecc) causes disease mainly by means of a number of extracellular plant cell wall-degrading enzymes (PCWDEs), also referred to as virulence factors. The production of PCWDEs is coordinately activated by the diffusible signal molecule N-acyl-homoserine lactone (HSL) in a population density-dependent manner ("quorum sensing"). ExpI is the enzyme responsible for the synthesis of HSL. The Rsm system negatively regulates the production of PCWDEs. It includes three components: RsmA is an RNA-binding protein which promotes mRNA decay; rsmB is a unique regulator RNA, and RsmC regulates expression of rsmA positively and of rsmB negatively. We report here that in an expI knockout mutant of Ecc strain SCC3193, the levels of rsmA and rsmB RNA are remarkably enhanced in comparison to the wild-type strain, while the level of the rsmC transcript is not affected. The increase in transcription of rsmA in the expI strain represses production of PCWDEs, which in turn leads to the avirulent phenotype of this mutant. In the expI- mutant, addition of exogenous HSL caused repression of rsmA and rsmB transcription to the wild-type level, whereas the expression of rsmC was not affected. Taken together, these data suggest that HSL affects the expression of rsmA, and that this effect is not mediated by RsmC. This specific effect and the previous demonstration that HSL is required for PCWDE production in Ecc support the hypothesis that regulation by quorum sensing in Ecc, in contrast to most other systems already described, requires HSL to repress rsmA transcription, which in turn leads to the activation of PCWDE production. A model is presented that explains how HSL controls the production of PCWDEs by modulating the expression of rsmA.

  15. Differential Activity of the Oral Glucan Synthase Inhibitor SCY-078 against Wild-Type and Echinocandin-Resistant Strains of Candida Species.

    Science.gov (United States)

    Pfaller, Michael A; Messer, Shawn A; Rhomberg, Paul R; Borroto-Esoda, Katyna; Castanheira, Mariana

    2017-08-01

    SCY-078 (formerly MK-3118) is a novel orally active inhibitor of fungal β-(1,3)-glucan synthase (GS). SCY-078 is a derivative of enfumafungin and is structurally distinct from the echinocandin class of antifungal agents. We evaluated the in vitro activity of this compound against wild-type (WT) and echinocandin-resistant isolates containing mutations in the FKS genes of Candida spp. Against 36 Candida spp. FKS mutants tested, 30 (83.3%) were non-WT to 1 or more echinocandins, and only 9 (25.0%) were non-WT (MIC, >WT-upper limit) to SCY-078. Among C. glabrata isolates carrying FKS alterations, 84.0% were non-WT to the echinocandins versus only 24.0% for SCY-078. In contrast to the echinocandin comparators, the activity of SCY-078 was minimally affected by the presence of FKS mutations, suggesting that this agent is useful in the treatment of Candida infections due to echinocandin-resistant strains. Copyright © 2017 American Society for Microbiology.

  16. Cloning and expression of the Aspergillus oryzae glucan 1,3-beta-glucosidase A (exgA) in Pichia pastoris.

    Science.gov (United States)

    Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut

    2012-10-01

    The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.

  17. In vivo gene expression profiling of the entomopathogenic fungus Beauveria bassiana elucidates its infection stratagems in Anopheles mosquito.

    Science.gov (United States)

    Lai, Yiling; Chen, Huan; Wei, Ge; Wang, Guandong; Li, Fang; Wang, Sibao

    2017-08-01

    The use of entomopathogenic fungi to control mosquitoes is a promising tool for reducing vector-borne disease transmission. To better understand infection stratagems of insect pathogenic fungi, we analyzed the global gene expression profiling of Beauveria bassiana at 36, 60, 84 and 108 h after topical infection of Anopheles stephensi adult mosquitoes using RNA sequencing (RNA-Seq). A total of 5,354 differentially expressed genes (DEGs) are identified over the course of fungal infection. When the fungus grows on the mosquito cuticle, up-regulated DEGs include adhesion-related genes involved in cuticle attachment, Pth11-like GPCRs hypothesized to be involved in host recognition, and extracellular enzymes involved in the degradation and penetration of the mosquito cuticle. Once in the mosquito hemocoel, the fungus evades mosquito immune system probably through up-regulating expression of β-1,3-glucan degrading enzymes and chitin synthesis enzymes for remodeling of cell walls. Moreover, six previous unknown SSCP (small secreted cysteine-rich proteins) are significantly up-regulated, which may serve as "effectors" to suppress host defense responses. B. bassiana also induces large amounts of antioxidant genes to mitigate host-generated exogenous oxidative stress. At late stage of infection, B. bassiana activates a broad spectrum of genes including nutrient degrading enzymes, some transporters and metabolism pathway components, to exploit mosquito tissues and hemolymph as a nutrient source for hyphal growth. These findings establish an important framework of knowledge for further comprehensive elucidation of fungal pathogenesis and molecular mechanism of Beauveria-mosquito interactions.

  18. In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

    Directory of Open Access Journals (Sweden)

    Rodrigo Juliano Oliveira

    2013-01-01

    Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

  19. Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

    Directory of Open Access Journals (Sweden)

    Gordon D Ross

    2007-06-01

    Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

  20. Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

    Science.gov (United States)

    Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

    2016-12-17

    Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

  1. Characterization of the Paenibacillus beijingensis DSM 24997 GtfD and its glucan polymer products representing a new glycoside hydrolase 70 subfamily of 4,6-α-glucanotransferase enzymes.

    Directory of Open Access Journals (Sweden)

    Joana Gangoiti

    Full Text Available Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4 glucan chains connected by alternating (α1→4/(α1→6 linkages and (α1→4,6 branching points. This enzyme constituted the single evidence for this reaction and product specificity in the GH70 family, mostly containing glucansucrases encoded by lactic acid bacteria (http://www.CAZy.org. In this work, 4 additional GtfD-like proteins were identified in taxonomically diverse plant-associated bacteria forming a new GH70 subfamily with intermediate characteristics between the evolutionary related GH13 and GH70 families. The GtfD enzyme encoded by Paenibacillus beijingensis DSM 24997 was characterized providing the first example of a reuteran-like polymer synthesizing 4,6-α-glucanotransferase in a Gram-positive bacterium. Whereas the A. chroococcum GtfD activity on amylose resulted in the synthesis of a high molecular polymer, in addition to maltose and other small oligosaccharides, two reuteran-like polymer distributions are produced by P. beijingensis GtfD: a high-molecular mass polymer and a low-molecular mass polymer with an average Mw of 27 MDa and 19 kDa, respectively. Compared to the A. chroooccum GtfD product, both P. beijingensis GtfD polymers contain longer linear (α1→4 sequences in their structure reflecting a preference for transfer of even longer glucan chains by this enzyme. Overall, this study provides new insights into the evolutionary history of GH70 enzymes, and enlarges the diversity of natural enzymes that can be applied for modification of the starch present in food into less and/or more slowly digestible carbohydrate structures.

  2. De Novo Transcriptome Assembly and Characterization of the Synthesis Genes of Bioactive Constituents in Abelmoschus esculentus (L.) Moench

    Science.gov (United States)

    Zhang, Chenghao; Dong, Wenqi; Gen, Wei; Xu, Baoyu; Shen, Chenjia

    2018-01-01

    Abelmoschus esculentus (okra or lady’s fingers) is a vegetable with high nutritional value, as well as having certain medicinal effects. It is widely used as food, in the food industry, and in herbal medicinal products, but also as an ornamental, in animal feed, and in other commercial sectors. Okra is rich in bioactive compounds, such as flavonoids, polysaccharides, polyphenols, caffeine, and pectin. In the present study, the concentrations of total flavonoids and polysaccharides in five organs of okra were determined and compared. Transcriptome sequencing was used to explore the biosynthesis pathways associated with the active constituents in okra. Transcriptome sequencing of five organs (roots, stem, leaves, flowers, and fruits) of okra enabled us to obtain 293,971 unigenes, of which 232,490 were annotated. Unigenes related to the enzymes involved in the flavonoid biosynthetic pathway or in fructose and mannose metabolism were identified, based on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. All of the transcriptional datasets were uploaded to Sequence Read Archive (SRA). In summary, our comprehensive analysis provides important information at the molecular level about the flavonoid and polysaccharide biosynthesis pathways in okra. PMID:29495525

  3. Biopolymers/poly(ε-caprolactone)/polyethylenimine functionalized nano-hydroxyapatite hybrid cryogel: Synthesis, characterization and application in gene delivery.

    Science.gov (United States)

    Simionescu, Bogdan C; Drobota, Mioara; Timpu, Daniel; Vasiliu, Tudor; Constantinescu, Cristina Ana; Rebleanu, Daniela; Calin, Manuela; David, Geta

    2017-12-01

    Nano-hydroxyapatite (nHAp), surface functionalized with linear polyethylenimine (LPEI), was used for the preparation of biocomposites in combination with biopolymers and poly(ε-caprolactone) (PCL), by cryogelation technique, to yield biomimetic scaffolds with controlled interconnected macroporosity, mechanical stability, and predictable degradation behavior. The structural characteristics, swelling and degradation behavior of hydroxyapatite and hydroxyapatite/β-tricalcium phosphate (β-TCP) filled matrices were investigated as compared to the corresponding naked polymer 3D system. It was found that the homogeneity and cohesivity of the composite are significantly dependent on the size and amount of the included inorganic particles, which are thus determining the structural parameters. Surface modification with LPEI and nanodimensions favored the nHAp integration in the organic matrix, with preferential location along protein fibers, while β-TCP microparticles induced an increased disorder in the hybrid system. The biocomposite including nHAp only was further investigated targeting biomedical uses, and proved to be non-cytotoxic and capable of acting as gene-activated matrix (GAM). It allowed sustained delivery over time (until 22days) of embedded PEI 25 -pDNA polyplexes at high levels of transgene expression, while insuring a decrease in cytotoxicity as compared to polyplexes alone. Experimental data recommend such biocomposite as an attractive material for regenerative medicine. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Synthesis and characterization of N-(2-hydroxy)propyl-3-trimethyl ammonium chitosan chloride for potential application in gene delivery.

    Science.gov (United States)

    Xiao, Bo; Wan, Ying; Wang, Xiaoyu; Zha, Qichen; Liu, Haoming; Qiu, Zhiye; Zhang, Shengmin

    2012-03-01

    A series of N-(2-hydroxy)propyl-3-trimethyl ammonium chitosan chloride (HTCC) samples with various degrees of quaternization ranging from 12.4 to 43.7% was synthesized. The structures and properties of HTCC were investigated by FT-IR, (1)H NMR, conductometric titration and XRD analysis. It was found that HTCC had a more amorphous structure than chitosan. HTCC samples showed significantly lower cytotoxicity than polyethyleneimine in HepG2 and HeLa cell lines. The samples spontaneously formed complexes with pGL3 luciferase plasmid. These complexes had desirable particle sizes (160-300 nm) and zeta potentials (10.8-18.7 mV) when the weight ratios of HTCC to plasmid altered in the range of 3:1-20:1. In vitro gene transfection results indicated that HTCC had significantly high transfection efficiency compared with chitosan for delivering pGL3 luciferase plasmid to HeLa cells. The results suggest that HTCC could be a promising non-viral vector for safe and efficient DNA delivery. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Design, synthesis, and evaluation of gadolinium cationic lipids as tools for biodistribution studies of gene delivery complexes.

    Science.gov (United States)

    Leclercq, Francoise; Cohen-Ohana, Mirit; Mignet, Nathalie; Sbarbati, Andrea; Herscovici, Jean; Scherman, Daniel; Byk, Gerardo

    2003-01-01

    Gadolinium-chelating cationic lipids have been synthesized to obtain lipoplexes with MRI contrast properties. These compounds were designed to follow the biodistribution of synthetic DNA for gene delivery by nuclear magnetic resonance imaging. The lipid MCO-I-68 was synthesized, and chelate complexes with gadolinium were formed and characterized in terms of physicochemical and DNA binding properties. The transfection activity of MCO-I-68-Gd/DNA complexes was assayed in vitro on NIH 3T3. Different formulations of the product were tested. When up to 5% of the gadolinium lipid complexes were co-formulated with the cationic lipid RPR120535 used as a reference, the transfection levels were maintained as compared to RPR120535 alone. To date, only a liposomal formulation of a gadolinium-cationic lipid chelate without DNA had been observed using magnetic resonance imaging. In vivo intratumoral administration of MCO-I-68-Gd/DNA lipoplexes to tumor model led to an important increase of the NMR signal. It was demonstrated that the new complexes also acted as transfection carriers when they were formulated from liposomes.

  6. Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

    Science.gov (United States)

    Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

    2016-11-01

    At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Repair of ultraviolet-light damaged ColE1 factor carrying Escherichia coli genes for guanine synthesis

    International Nuclear Information System (INIS)

    Kibe, A.; Shimada, K.; Tagaki, Y.

    1979-01-01

    Hybrid ColE1 plasmids called ColE1-cos lambda-guaA or ColE1-cos lambda-gal can be efficiently transduced into various E.coli K-12 cells through packaging into lambda phage particles. Using these plasmids, repair of ultraviolet-light (UV) damaged ColE1 DNAs was studied in various UV sensitive E.coli K-12 mutants. The host mutations uvrA and uvrB markedly reduced host-cell reactivation of UV-irradiated ColE1-cos lambda-guaA. Pre-existing hybrid ColE1 plasmids had no effect on the frequency of lambda phage-mediated transduction of another differentially marked hybrid ColE1 DNAs. ColE1-cos lambda-guaA and ColE1-cos lambda-gal DNAs could temporarily but not stably co-exist in E.coli K-12 recA cells. The presence of ColE1-cos lambda-gal in uvrB cells promoted the repair of super-infected UV-irradiated ColE1-cos lambda-guaA about 7-fold. The same ColE1-cos lambda-gal plasmid in a uvrB recA double mutant did not have this promoting effect. These results indicate that the effect of resident hybrid ColE1 plasmids is manifested by the host recA + gene function(s) and suggest that ColE1 plasmit itself provides no recA + -like functions. (orig.) [de

  8. Molecular identification of fungi trichothecens producing in seeds madder and detection of their nivalenol gene synthesis using PCR

    Directory of Open Access Journals (Sweden)

    Seyyed Alireza Esmailzadeh Hosseini

    2018-01-01

    Full Text Available Madder is one of the most important crops that used for medical and industrial applications and is widely cultivated in Yazd province. During 2012, sampling was done form seeds madder in important areas planted in Yazd province, including Bafq and Ardakan. After culturing and purification of fungal isolates in PDA and CLA media, additional identification was performed by PCR with specific primers for each species. Detection of fungi mycotoxins producing potential such as Nivalenol (NIV using Tri13 primers was done. High-performance liquid chromatography (HPLC was used to confirm the produce NIV mycotoxins potential in Fusarium species. 249 fungal strains were isolated from madder seed belonging to 6 genera of fungi including Fusarium spp., Aspergillus spp., Penicillium spp., Alternaria spp., Rhizoctonia solani and Rhizpous spp., that Fusarium isolates with 71 percent was the most frequency among fungi isolated. Among Fusarium fungi isolated, F. solani (55 isolates and F. oxysporum (41 isolates were the most frequency. F. poae, F. semitectum and F. equiseti ability to produce mycotoxins such as Nivalenol (NIV that are harmful to human health and animals as well as effect on the quantity and quality of madder color production. Tri13 gene involved in production NIV was detected in three Fusarium species that all isolates produce NIV. The results of HPLC showed that all studied Fusarium fungi, have the potential to produce NIV mycotoxins. The results of this study showed that fungi associated with seeds madder are able to produce trichothecene mycotoxins that they can be dangerous for consumers. Given that, this is the first report of fungi mycotoxins producing on seeds madder in Yazd province, thus should be measures to control and reduce fungal agents in these products.

  9. Synthesis and Characterization of Cationic Glycidyl-Based Poly(aminoester-Folic Acid Targeting Conjugates and Study on Gene Delivery

    Directory of Open Access Journals (Sweden)

    Yu Che Hsiao

    2012-07-01

    Full Text Available A new poly(aminoester (EPAE-FA containing folic acid and amino groups in the backbone and side chain was synthesized. EPAE-FA self-assembled readily with the plasmid DNA (pCMV-βgal in HEPES buffer and was characterized by dynamic light scattering, zeta potential, fluorescence images, and XTT cell viability assays. To evaluate the transfection effect of graft ratio of FA on the EPAE system, EPAE-FA polymers with two different graft ratios (EPAE-FA12k and EPAE-FA14k were also prepared. This study found that all EPAE-FA polymers were able to bind plasmid DNA and yielded positively charged complexes with nano-sized particles ( < 200 nm. To assess the transfection efficiency mediated by EPAE and EPAE-FA polymers, we performed in vitro transfection activity assays using FR-negative (COS-7 and FR-positive (HeLa cells. The EPAE-FA12k/DNA and EPAE-FA14k/DNA complexes were able to transfect HeLa cell in vitro with higher transfection efficiency than PEI25k/DNA at the similar weight ratio. These results demonstrated that the introduction of FA into EPAE system had a significant effect on transferring ability for FR-positive cells (HeLa. Examination of the cytotoxicity of PEI25k and EPAE-FA system revealed that EPAE-FA system had lower cytotoxicity. In this paper, EPAE-FA seemed to be a novel cationic poly(aminoester for gene delivery and an interesting candidate for further study.

  10. Repair of ultraviolet-light damaged ColE1 factor carrying Escherichia coli genes for guanine synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Kibe, A; Shimada, K; Tagaki, Y [Kyushu Univ., Fukuoka (Japan). Dept. of Biochemistry

    1979-01-01

    Hybrid ColE1 plasmids called ColE1-cos lambda-guaA or ColE1-cos lambda-gal can be efficiently transduced into various E.coli K-12 cells through packaging into lambda phage particles. Using these plasmids, repair of ultraviolet-light (UV) damaged ColE1 DNAs was studied in various UV sensitive E.coli K-12 mutants. The host mutations uvrA and uvrB markedly reduced host-cell reactivation of UV-irradiated ColE1-cos lambda-guaA. Pre-existing hybrid ColE1 plasmids had no effect on the frequency of lambda phage-mediated transduction of another differentially marked hybrid ColE1 DNAs. ColE1-cos lambda-guaA and ColE1-cos lambda-gal DNAs could temporarily but not stably co-exist in E.coli K-12 recA cells. The presence of ColE1-cos lambda-gal in uvrB cells promoted the repair of super-infected UV-irradiated ColE1-cos lambda-guaA about 7-fold. The same ColE1-cos lambda-gal plasmid in a uvrB recA double mutant did not have this promoting effect. These results indicate that the effect of resident hybrid ColE1 plasmids is manifested by the host recA/sup +/ gene function(s) and suggest that ColE1 plasmit itself provides no recA/sup +/-like functions.

  11. Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

    Directory of Open Access Journals (Sweden)

    Anna Bzducha-Wróbel

    2014-12-01

    Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

  12. Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

    Science.gov (United States)

    Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

    2017-02-01

    Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan

    OpenAIRE

    Mekoue Nguela, Julie; Poncet-Legrand, Celine; Sieczkowski, N.; Vernhet, Aude

    2016-01-01

    At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored b...

  14. Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

    Science.gov (United States)

    Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

    2015-05-04

    The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

  15. Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

    Science.gov (United States)

    Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

    2007-01-01

    Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

  16. Comparative Analysis of ?-Oryzanol, ?-Glucan, Total Phenolic Content and Antioxidant Activity in Fermented Rice Bran of Different Varieties

    OpenAIRE

    Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn

    2017-01-01

    Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans....

  17. Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

    Science.gov (United States)

    Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

    2012-04-13

    Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

  18. Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

    Science.gov (United States)

    Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara

    2015-01-01

    In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family of the crop plant Vitis vinifera. The identified four members of the VvSERAT protein family are assigned to three distinct groups upon their sequence similarities to Arabidopsis SERATs. Expression of fluorescently labeled VvSERAT proteins uncover that the sub-cellular localization of VvSERAT1;1 and VvSERAT3;1 is the cytosol and that VvSERAT2;1 and VvSERAT2;2 localize in addition in plastids and mitochondria, respectively. The purified VvSERATs of group 1 and 2 have higher enzymatic activity than VvSERAT3;1, which display a characteristic C-terminal extension also present in AtSERAT3;1. VvSERAT1;1 and VvSERAT2;2 are evidenced to form the CSC. CSC formation activates VvSERAT2;2, by releasing CSC-associated VvSERAT2;2 from cysteine inhibition. Thus, subcellular distribution of SERAT isoforms and CSC formation in cytosol and mitochondria is conserved between Arabidopsis and grapevine. Surprisingly, VvSERAT2;1 lack the canonical C-terminal tail of plant SERATs, does not form the CSC and is almost insensitive to cysteine inhibition (IC50 = 1.9 mM cysteine). Upon sulfate depletion VvSERAT2;1 is strongly induced at the transcriptional level, while transcription of other VvSERATs is almost unaffected in sulfate deprived grapevine cell suspension cultures. Application of abiotic stresses to soil grown grapevine plants revealed isoform-specific induction of VvSERAT2;1 in leaves upon drought, whereas high light- or temperature- stress hardly trigger VvSERAT2;1 transcription. PMID:25741355

  19. β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

    Directory of Open Access Journals (Sweden)

    Asli Akyol

    2014-09-01

    Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

  20. Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

    Science.gov (United States)

    de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

    2017-12-20

    A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

  1. Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

    Science.gov (United States)

    Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

    2017-02-01

    Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

    Directory of Open Access Journals (Sweden)

    Jie Zheng

    2013-12-01

    Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

  3. Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

    Directory of Open Access Journals (Sweden)

    R.C.Shendare

    2008-01-01

    Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

  4. β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

    Science.gov (United States)

    Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

    2014-09-23

    The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

  5. Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

    Science.gov (United States)

    Alwis, K U; Mandryk, J; Hocking, A D

    1999-09-01

    Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

  6. A snapshot of the hepatic transcriptome: ad libitum alcohol intake suppresses expression of cholesterol synthesis genes in alcohol-preferring (P rats.

    Directory of Open Access Journals (Sweden)

    Jonathon D Klein

    Full Text Available Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day in inbred alcohol-preferring (iP10a rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.

  7. Effect of an Organic Trace Mineral Premix on the Semen Quality, Testicular Morphology and Gene Expression Related to Testosterone Synthesis of Male Broiler Breeders

    Directory of Open Access Journals (Sweden)

    T Shan

    Full Text Available ABSTRACT In order to investigate the effect of organic trace minerals premix (OTM on the reproductive performance of breeder roosters, a total of 240 San Huang roosters (23 weeks of age were randomly divided into two treatments with six replicates of 20 roosters each. The first group (n = 120 was fed a basal diet containing an inorganic trace minerals premix (ITM and the other group (n = 120 was fed the basal diet in which ITM was replaced by OTM. The experiment period was 22 weeks. Semen from one randomly-selected rooster per replicate was collected two weeks after the beginning of the experiment and other 10 times every two weeks. Another rooster per replicate was randomly selected at 30, 35, and 45 weeks of age, and sacrificed. Results showed that OTM did not affect relative organ weights. There was a significant increase in semen parameters in OTM group (p<0.05, such as semen volume, semen density, and semen motility from 31 to 35 weeks. OTM-fed roosters presented higher serum testosterone levels at 45 weeks of age, as well as higher testicular mRNA expression of the genes 3-beta dehydrogenase 2 (HSD3B2 and cytochrome P450 17A1 (CYP17A1 in the OTM-fed group at 45 weeks of age compared with those fed ITM (p<0.05. Considering the results of the present study, it was concluded that feeding organic instead of inorganic trace minerals to male broilers breeders improves semen quality, which may be attributed to their better testicular development and higher expression of enzymes related to testosterone synthesis.

  8. Nitrophenols isolated from diesel exhaust particles regulate steroidogenic gene expression and steroid synthesis in the human H295R adrenocortical cell line

    International Nuclear Information System (INIS)

    Furuta, Chie; Noda, Shiho; Li Chunmei; Suzuki, Akira K; Taneda, Shinji; Watanabe, Gen; Taya, Kazuyoshi

    2008-01-01

    Studies of nitrophenols isolated from diesel exhaust particles (DEPs), 3-methyl-4-nitrophenol (PNMC) and 4-nitro-3-phenylphenol (PNMPP) have revealed that these chemicals possess estrogenic and anti-androgenic activity in vitro and in vivo and that PNMC accumulate in adrenal glands in vivo. However, the impacts of exposure to these compounds on adrenal endocrine disruption and steroidogenesis have not been investigated. To elucidate the non-receptor mediated effects of PNMC and PNMPP, we investigated the production of the steroid hormones progesterone, cortisol, testosterone, and estradiol-17β and modulation of nine major enzyme genes involved in the synthesis of steroid hormones (CYP11A, CYP11B1, CYP17, CYP19, 17βHSD1, 17βHSD4, CYP21, 3βHSD2, StAR) in human adrenal H295R cells supplied with cAMP. Exposure to 10 -7 to 10 -5 M PNMC and 1 mM 8-Br-cAMP for 48 h decreased testosterone, cortisol, and estradiol-17β levels and increased progesterone secretion. At 10 -5 M, PNMC with 1 mM 8-Br-cAMP significantly stimulated expression of the 17βHSD4 and significantly suppressed expression of 3βHSD2. In comparison, 10 -7 to 2 x 10 -5 M PNMPP with 1 mM 8-Br-cAMP for 48 h decreased concentrations of estradiol-17β, increased progesterone levels, but did not affect testosterone and cortisol secretion due to the significant suppression of CYP17 and the non-significant but obvious suppression of CYP19. Our results clarified steroidogenic enzymes as candidates responsible for the inhibition or stimulation for the production of steroid hormones in the steroidogenic pathway, thus providing the first experimental evidence for multiple mechanisms of disruption of endocrine pathways by these nitrophenols

  9. A snapshot of the hepatic transcriptome: ad libitum alcohol intake suppresses expression of cholesterol synthesis genes in alcohol-preferring (P) rats.

    Science.gov (United States)

    Klein, Jonathon D; Sherrill, Jeremy B; Morello, Gabriella M; San Miguel, Phillip J; Ding, Zhenming; Liangpunsakul, Suthat; Liang, Tiebing; Muir, William M; Lumeng, Lawrence; Lossie, Amy C

    2014-01-01

    Research is uncovering the genetic and biochemical effects of consuming large quantities of alcohol. One prime example is the J- or U-shaped relationship between the levels of alcohol consumption and the risk of atherosclerotic cardiovascular disease. Moderate alcohol consumption in humans (about 30 g ethanol/d) is associated with reduced risk of coronary heart disease, while abstinence and heavier alcohol intake is linked to increased risk. However, the hepatic consequences of moderate alcohol drinking are largely unknown. Previous data from alcohol-preferring (P) rats showed that chronic consumption does not produce significant hepatic steatosis in this well-established model. Therefore, free-choice alcohol drinking in P rats may mimic low risk or nonhazardous drinking in humans, and chronic exposure in P animals can illuminate the molecular underpinnings of free-choice drinking in the liver. To address this gap, we captured the global, steady-state liver transcriptome following a 23 week free-choice, moderate alcohol consumption regimen (∼ 7.43 g ethanol/kg/day) in inbred alcohol-preferring (iP10a) rats. Chronic consumption led to down-regulation of nine genes in the cholesterol biosynthesis pathway, including HMG-CoA reductase, the rate-limiting step for cholesterol synthesis. These findings corroborate our phenotypic analyses, which indicate that this paradigm produced animals whose hepatic triglyceride levels, cholesterol levels and liver histology were indistinguishable from controls. These findings explain, at least in part, the J- or U-shaped relationship between cardiovascular risk and alcohol intake, and provide outstanding candidates for future studies aimed at understanding the mechanisms that underlie the salutary cardiovascular benefits of chronic low risk and nonhazardous alcohol intake.

  10. High Production of 2,3-Butanediol (2,3-BD by Raoultella ornithinolytica B6 via Optimizing Fermentation Conditions and Overexpressing 2,3-BD Synthesis Genes.

    Directory of Open Access Journals (Sweden)

    Taeyeon Kim

    Full Text Available Biological production of 2,3-butandiol (2,3-BD has received great attention as an alternative to the petroleum-based 2,3-BD production. In this study, a high production of 2,3-BD in fed-batch fermentation was investigated with a newly isolated bacterium designated as Raoultella ornithinolytica B6. The isolate produced 2,3-BD as the main product using hexoses (glucose, galactose, and fructose, pentose (xylose and disaccharide (sucrose. The effects of temperature, pH-control schemes, and agitation speeds on 2,3-BD production were explored to optimize the fermentation conditions. Notably, cell growth and 2,3-BD production by R. ornithinolytica B6 were higher at 25°C than at 30°C. When three pH control schemes (no pH control, pH control at 7, and pH control at 5.5 after the pH was decreased to 5.5 during fermentation were tested, the best 2,3-BD titer and productivity along with reduced by-product formation were achieved with pH control at 5.5. Among different agitation speeds (300, 400, and 500 rpm, the optimum agitation speed was 400 rpm with 2,3-BD titer of 68.27 g/L, but acetic acid was accumulated up to 23.32 g/L. Further enhancement of the 2,3-BD titer (112.19 g/L, yield (0.38 g/g, and productivity (1.35 g/L/h as well as a significant reduction of acetic acid accumulation (9.71 g/L was achieved by the overexpression of homologous budABC genes, the 2,3-BD-synthesis genes involved in the conversion of pyruvate to 2,3-BD. This is the first report presenting a high 2,3-BD production by R.ornithinolytica which has attracted little attention with respect to 2,3-BD production, extending the microbial spectrum of 2,3-BD producers.

  11. Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

    Science.gov (United States)

    Boulos, Samy; Nyström, Laura

    2017-11-01

    The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO

  12. Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

    Science.gov (United States)

    Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

    2016-01-01

    An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

  13. Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

    International Nuclear Information System (INIS)

    Le Quang Luan; Nguyen Thanh Long

    2015-01-01

    The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

  14. Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

    Science.gov (United States)

    Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

    2014-01-01

    Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

    Science.gov (United States)

    Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

    2016-04-01

    The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

  16. A Proinflammatory Effect of the β-Glucan from Pleurotus cornucopiae Mushroom on Macrophage Action

    Directory of Open Access Journals (Sweden)

    Ken-ichiro Minato

    2017-01-01

    Full Text Available PCPS from P. citrinopileatus mushroom extract is a β-1,6-glucan possessing a proinflammatory effect on innate immune cells. The PCPS stimulated THP-1 macrophages to secrete significant levels of TNF. Moreover, the mRNA expressions of TNF and IL-1β were significantly enhanced by PCPS treatment. However, the PCPS did not induce to express both IL-12 and IL-10 mRNA in the macrophages. Next, the P. cornucopiae extract (containing mainly PCPS treatment against mice showed significant increases in TNF and IL-1β mRNA expressions in the peritoneal macrophages of them. In this study, the expression levels of IFNγ mRNA in the spleen were almost the same between the extract- (PCPS- treated group and control group. However, the expression of IL-4 mRNA showed a lower level in the extract-treated group than that in the control. Our results suggested that the PCPS could induce proinflammatory action in the immune response. In addition, the proinflammatory effect of the PCPS on THP-1 was enhanced by 5′-GMP-Na, while it was reduced by vitamin D2. These two compounds are majorly contained in the P. citrinopileatus mushroom. Therefore, these results suggested that the P. citrinopileatus mushroom might contain other immune regulative compounds, such as vitamin D2, as well as PCPS.

  17. Incorporation of β-glucans in meat emulsions through an optimal mixture modeling systems.

    Science.gov (United States)

    Vasquez Mejia, Sandra M; de Francisco, Alicia; Manique Barreto, Pedro L; Damian, César; Zibetti, Andre Wüst; Mahecha, Hector Suárez; Bohrer, Benjamin M

    2018-05-22

    The effects of β-glucans (βG) in beef emulsions with carrageenan and starch were evaluated using an optimal mixture modeling system. The best mathematical models to describe the cooking loss, color, and textural profile analysis (TPA) were selected and optimized. The cubic models were better to describe the cooking loss, color, and TPA parameters, with the exception of springiness. Emulsions with greater levels of βG and starch had less cooking loss (54 and <62), and greater hardness, cohesiveness and springiness values. Subsequently, during the optimization phase, the use of carrageenan was eliminated. The optimized emulsion contained 3.13 ± 0.11% βG, which could cover the intake daily of βG recommendations. However, the hardness of the optimized emulsion was greater (60,224 ± 1025 N) than expected. The optimized emulsion had a homogeneous structure and normal thermal behavior by DSC and allowed for the manufacture of products with high amounts of βG and desired functional attributes. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Development of cosmetic formulations containing glucan polymer of Cassava (Manihot esculenta: stability and sensory analysis

    Directory of Open Access Journals (Sweden)

    Luisa M. Manço

    2014-12-01

    Full Text Available The aim of this study was the development, rheological behaviour determination, and sensory analysis of cosmetic formulations containing glucan biopolymer (Manihot esculenta, a tensor agent that was proposed to produce an immediate lifting and smoothing effect. For this purpose, formulations were developed and supplemented or not with 4 % of hydrolysed Manihot esculenta tuber extract and submitted to preliminary stability tests. These formulations were evaluated in terms of rheological behaviour over 90 days. Sensory analysis was carried out through a research with 20 cosmetic consumers who answered a questionnaire regarding their perception to the cosmetic qualities. The formulations presented pseudoplastic behavior and were considered stable in the physical stability studies, with the exception of the gel formulation based on Ammonium Acryloyldimethyltaurate/VP Copolymer. The formulations were well evaluated in the sensory parameters. The gel formulations based on Polyacrylamide, C13- 14 Isoparaffin, and Laureth-7 were stable and presented the best sensory profile in some evaluated parameters, such as spreadability, smoothness and skin moisturizing, and can be considered an appropriate vehicle for formulations containing hydrolysed Manihot esculenta tuber extract.

  19. Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.

    Science.gov (United States)

    Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K

    2014-02-01

    Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.

  20. Adhesion of glucosyltransferase phase variants to Streptococcus gordonii bacterium-glucan substrata may involve lipoteichoic acid.

    Science.gov (United States)

    Vickerman, M M; Jones, G W

    1992-10-01

    Growing Streptococcus gordonii Spp+ phase variants, which have normal levels of glucosyltransferase (GTF) activity, use sucrose to promote their accumulation on surfaces by forming a cohesive bacterium-insoluble glucan polymer mass (BPM). Spp- phase variants, which have lower levels of GTF activity, do not form BPMs and do not remain in BPMs formed by Spp+ cells when grown in mixed cultures. To test the hypothesis that segregation of attached Spp+ and unattached Spp- cells was due to differences in adhesiveness, adhesion between washed, [3H]thymidine-labeled cells and preformed BPM substrata was measured. Unexpectedly, the results showed that cells of both phenotypes, as well as GTF-negative cells, attached equally well to preformed BPMs, indicating that attachment to BPMs was independent of cell surface GTF activity. Initial characterization of this binding interaction suggested that a protease-sensitive component on the washed cells may be binding to lipoteichoic acids sequestered in the BPM, since exogenous lipoteichoic acid inhibited adhesion. Surprisingly, the adhesion of both Spp+ and Spp- cells was markedly inhibited in the presence of sucrose, which also released lipoteichoic acid from the BPM. These in vitro findings suggest that, in vivo, sucrose and lipoteichoic acid may modify dental plaque development by enhancing or inhibiting the attachment of additional bacteria.

  1. Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

    Directory of Open Access Journals (Sweden)

    Vidyasagar Devaprasad Dedeepiya

    2012-01-01

    Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

  2. β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

    Directory of Open Access Journals (Sweden)

    Patricia de Souza Bonfim-Mendonça

    Full Text Available Vulvovaginal candidiasis (VVC is among