Evaluation on prebiotic properties of β-glucan and oligo-β-glucan from mushrooms by human fecal microbiota in fecal batch culture

Directory of Open Access Journals (Sweden)

Chiraphon Chaikliang

2015-11-01

Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of

Defining Starch Binding by Glucan Phosphatases

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2015-01-01

Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...

An analysis of employee exposure to organic dust at large-scale composting facilities

Science.gov (United States)

Sykes, P.; Allen, J. A.; Wildsmith, J. D.; Jones, K. P.

2009-02-01

The occupational health implications from exposure to dust, endotoxin and 1-3 β Glucan at commercial composting sites are uncertain. This study aims to establish employee exposure levels to inhalable and respirable dust, endotoxin and 1-3 β Glucan during various operational practices in the composting process. Personal samples were collected and the inhalable and respirable dust fractions were determined by gravimetric analysis. Endotoxin concentrations were determined using a Limulus Amebocyte Lysate assay (LAL). 1-3 β Glucan levels were estimated using a specific blocking agent to establish the contribution that these compounds gave to the original endotoxin assay. Employees' exposure to dust was found to be generally lower than the levels stipulated in the Control of Substances Hazardous to Health Regulations (COSHH) 2002 (as amended), (median inhalable fraction 1.08 mg/m3, min 0.25 mg/m3 max 10.80 mg/m3, median respirable fraction 0.05 mg/m3, min 0.02 mg/m3, max 1.49 mg/m3). Determination of the biological component of the dust showed that employees' exposures to endotoxin were elevated (median 31.5 EU/m3, min 2.00 EU/m3, max 1741.78 EU/m3), particularly when waste was agitated (median 175.0 EU/m3, min 2.03 EU/m3, max 1741.78 EU/m3). Eight out of 32 (25%) of the personal exposure data for endotoxin exceeded the 200 EU/m3 temporary legal limit adopted in the Netherlands and thirteen out of 32 (40.6%) exceeded the suggested 50 EU/m3 guidance level suggested to protect workers from respiratory health effects. A significant correlation was observed between employee inhalable dust exposure and personal endotoxin concentration (r = 0.728, phealth risks associated with endotoxin exposure at composting sites. Employee exposure levels and dose-response disease mechanisms are not well understood at this present time. Consequently, in light of this uncertainty, it is recommended that a precautionary approach be adopted in managing the potential health risks associated

β-1,3-glucan in developing cotton fibers

International Nuclear Information System (INIS)

Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.

1979-01-01

Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis

Exposures to thoracic particulate matter, endotoxin, and glucan during post-Hurricane Katrina restoration work, New Orleans 2005-2012.

Science.gov (United States)

Rando, Roy J; Kwon, Cheol-Woong; Lefante, John J

2014-01-01

In the aftermath of Hurricane Katrina, which devastated the city of New Orleans in August 2005, restoration workers were at risk for respiratory illness from exposure to airborne particles and microbial agents. In support of an epidemiologic investigation of this risk, an exposure assessment for restoration work activities (demolition, trash & debris management, landscape restoration, sewer/waterline repair, and mold remediation) was performed from 2005 to 2012. For 2005 and 2006, Occupational Safety and Health Administration (OSHA) data (n = 730) for personal and area monitoring of total and respirable dust exposures of restoration workers were accessed and analyzed. The most significant exposures were for demolition work, with average respirable dust exposures in 2005 above the action level of 2.5 mg/m(3) and 17.6% of exposures exceeding the permissible exposure limit (PEL) (5 mg/m(3)). Additional personal and area monitoring for thoracic particulate matter was performed from 2007 to 2012 (n = 774) and samples were assayed for endotoxin and (1→3, 1→6)-β-D-glucan (n = 202). In order to integrate the OSHA data with the later monitoring data, three independent predictive models were developed to convert total and respirable dust measures into the equivalent thoracic dust. The three models were not statistically different and the modeling results were in good agreement with an overall coefficient of variation of 16% for the thoracic dust means across work activities estimated by each of the three models. Overall, thoracic dust exposure levels decreased by about an order of magnitude within the first year after Katrina and then more gradually declined and stabilized through 2012. Estimated average exposures to endotoxin and microbial glucan in 2005 were as high as 256 EU/m(3) and 118 μg/m(3), respectively, and likewise were seen to decrease dramatically and stabilize after 2005. The results of this exposure assessment support previously published reports of

Plants with elevated levels of glucan

Energy Technology Data Exchange (ETDEWEB)

Pauly, Markus; Kraemer, Florian J.; Hake, Sarah

2018-03-20

The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.

Incidence of polybrominated diphenyl ethers in central air conditioner filter dust from a new office building.

Science.gov (United States)

Ni, Hong-Gang; Cao, Shan-Ping; Chang, Wen-Jing; Zeng, Hui

2011-07-01

This study examined polybrominated diphenyl ethers (PBDEs) in central air conditioner filter (CACF) dust from a new office building in Shenzhen, China. Human exposure to PBDE via dust inhalation and ingestion were also estimated. PBDEs level in CACF dust was lower than those in the other countries and regions. Approximately 0.671 pg/kg bw/day PM(2.5) (Particulate Matter up to 2.5 μm in size) bounded Σ(15)PBDEs can be inhaled deep into the lungs and 4.123 pg/kg bw/day PM(10) (Particulate Matter up to 10 μm in size) bounded Σ(15)PBDEs tend to be deposited in the upper parts of the respiratory system. The average total intake of Σ(15)PBDEs via dust inhalation and ingestion for adults reached ∼ 141 pg/kg bw/day in this building. This value was far below the reference dose (RfD) recommended by United States Environmental Protection Agency. Human exposure to PBDEs via dust inhalation and ingestion in the new building is less than the old ones. Copyright © 2010 Elsevier Ltd. All rights reserved.

Glucan: mechanisms involved in its radioprotective effect

International Nuclear Information System (INIS)

Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.

1987-01-01

It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

Science.gov (United States)

Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

2008-03-20

Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

Science.gov (United States)

Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

2016-02-12

With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

β-glucan extract from oat bran and its industrial importance

Science.gov (United States)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

Product screening for sources of halogenated flame retardants in Canadian house and office dust

Energy Technology Data Exchange (ETDEWEB)

Abbasi, Golnoush [Department of Geography, University of Toronto, 100 St. George St., Toronto M5S 3G3 (Canada); Saini, Amandeep [Department of Physical and Environmental Sciences, University of Toronto, 1265 Military Trail, Toronto M1C 1A4 (Canada); Goosey, Emma [Department of Earth Sciences, University of Toronto, 22 Russell Street, Toronto M5S 3B1 (Canada); Diamond, Miriam L., E-mail: miriam.diamond@utoronto.ca [Department of Earth Sciences, University of Toronto, 22 Russell Street, Toronto M5S 3B1 (Canada); Department of Physical and Environmental Sciences, University of Toronto, 1265 Military Trail, Toronto M1C 1A4 (Canada)

2016-03-01

Human exposure to halogenated flame retardants (HFRs) such as polybrominated diphenyl ethers (PBDEs) and their replacements, can be related to exposure to indoor dust and direct contact with HFR-containing products. This study aimed to identify electronic products that contributed to HFRs measured in indoor dust and to develop a screening method for identifying HFRs in hard polymer products. Concentrations of 10 PBDEs and 12 halogenated replacements in dust and surface wipe samples of hard polymer casings of electronic products plus Br in the surfaces of those casing measured using X-ray fluorescence (XRF) were analyzed from 35 homes and 10 offices in Toronto (ON, Canada). HFR concentrations in dust and product wipes were positively correlated. Thus, we hypothesize that electronic products with the highest HFR concentrations contribute the most to concentrations in dust, regardless of the volatility of the HFR. Abundant HFRs in dust and product wipes were PBDEs (BDE-47, 99, 100, 153, 154, 183, 209), TDCPP, DBDPE, EH-TBB and BEHTBP. Older CRT TVs had the highest concentration of BDE-209 of all products tested. This was followed by higher concentrations of HFRs in PCs, Audio/Video (A/V) devices, small household appliances (HHAs) and flat screen TVs. The removal of HFRs from polymer surfaces using wipes supports concerns that HFRs could be transferred from these surfaces to hands as a result of direct contact with HFR-containing products. Surface wipe testing shows promise for screening additive HFRs. In comparison, the Br-content obtained using a handheld XRF analyzer did not correspond to concentrations obtained from surface wipe testing. - Highlights: • Concentrations of flame retardants in dust correlated with product surface wipes • Most abundant FRs in electronics were PBDEs, TDCPP, DBDPE, EH-TBB and BEHTBP. • Descending order of FRs in CRTs, TVs, PCs, A-V devices, and small household appliances • Product wipe testing, but not XRF, useful for non

Product screening for sources of halogenated flame retardants in Canadian house and office dust

International Nuclear Information System (INIS)

Abbasi, Golnoush; Saini, Amandeep; Goosey, Emma; Diamond, Miriam L.

2016-01-01

Human exposure to halogenated flame retardants (HFRs) such as polybrominated diphenyl ethers (PBDEs) and their replacements, can be related to exposure to indoor dust and direct contact with HFR-containing products. This study aimed to identify electronic products that contributed to HFRs measured in indoor dust and to develop a screening method for identifying HFRs in hard polymer products. Concentrations of 10 PBDEs and 12 halogenated replacements in dust and surface wipe samples of hard polymer casings of electronic products plus Br in the surfaces of those casing measured using X-ray fluorescence (XRF) were analyzed from 35 homes and 10 offices in Toronto (ON, Canada). HFR concentrations in dust and product wipes were positively correlated. Thus, we hypothesize that electronic products with the highest HFR concentrations contribute the most to concentrations in dust, regardless of the volatility of the HFR. Abundant HFRs in dust and product wipes were PBDEs (BDE-47, 99, 100, 153, 154, 183, 209), TDCPP, DBDPE, EH-TBB and BEHTBP. Older CRT TVs had the highest concentration of BDE-209 of all products tested. This was followed by higher concentrations of HFRs in PCs, Audio/Video (A/V) devices, small household appliances (HHAs) and flat screen TVs. The removal of HFRs from polymer surfaces using wipes supports concerns that HFRs could be transferred from these surfaces to hands as a result of direct contact with HFR-containing products. Surface wipe testing shows promise for screening additive HFRs. In comparison, the Br-content obtained using a handheld XRF analyzer did not correspond to concentrations obtained from surface wipe testing. - Highlights: • Concentrations of flame retardants in dust correlated with product surface wipes • Most abundant FRs in electronics were PBDEs, TDCPP, DBDPE, EH-TBB and BEHTBP. • Descending order of FRs in CRTs, TVs, PCs, A-V devices, and small household appliances • Product wipe testing, but not XRF, useful for non

Laboratory study of PCB transport from primary sources to settled dust

Science.gov (United States)

Transport of house dust and Arizona Test Dust on polychlorinated biphenyl (PCB)-containing panels and PCB-free panels was investigated in a 30-m3 stainless steel chamber. The PCB-containing panels were aluminum sheets coated with a PCB-spiked, oil-based primer or two-part polysul...

The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

Energy Technology Data Exchange (ETDEWEB)

Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

2010-08-01

In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

Science.gov (United States)

Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

2008-01-01

Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

Directory of Open Access Journals (Sweden)

Akira Yoshimi

2017-11-01

Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Work Tasks as Determinants of Grain Dust and Microbial Exposure in the Norwegian Grain and Compound Feed Industry.

Science.gov (United States)

Straumfors, Anne; Heldal, Kari Kulvik; Wouters, Inge M; Eduard, Wijnand

2015-07-01

The grain and compound feed industry entails inevitable risks of exposure to grain dust and its microbial content. The objective of this study was therefore to investigate task-dependent exposure differences in order to create knowledge basis for awareness and exposure reducing measures in the Norwegian grain and compound feed industry. A total of 166 samples of airborne dust were collected by full-shift personal sampling during work in 20 grain elevators and compound feed mills during one autumn season and two winter seasons. The personal exposure to grain dust, endotoxins, β-1→3-glucans, bacteria, and fungal spores was quantified and used as individual outcomes in mixed models with worker nested in company as random effect and different departments and tasks as fixed effects. The exposure levels were highest in grain elevator departments. Exposure to endotoxins was particularly high. Tasks that represented the highest and lowest exposures varied depending on the bioaerosol component. The most important determinants for elevated dust exposure were cleaning and process controlling. Cleaning increased the dust exposure level by a factor of 2.44 of the reference, from 0.65 to 1.58mg m(-3), whereas process controlling increased the dust exposure level by a factor of 2.97, from 0.65 to 1.93mg m(-3). Process controlling was associated with significantly less grain dust exposure in compound feed mills and the combined grain elevators and compound feed mills, than in grain elevators. The exposure was reduced by a factor of 0.18 and 0.22, from 1.93 to 0.34mg m(-3) and to 0.42mg m(-3), respectively, compared with the grain elevators. Inspection/maintenance, cleaning, and grain rotation and emptying were determinants of higher exposure to both endotoxin and β-1→3-glucans. Seed winnowing was in addition a strong determinant for endotoxin, whereas mixing of animal feed implied higher β-1→3-glucan exposure. Cleaning was the only task that contributed significantly to

Nasal hyperresponders and atopic subjects report different symptom intensity to air quality: a climate chamber study.

Science.gov (United States)

Bodin, L; Andersson, K; Bønløkke, J H; Mølhave, L; Kjaergaard, S K; Stridh, G; Juto, J-E; Sigsgaard, T

2009-06-01

Short-term exposure to dust and dust added with beta-(1,3)-d-glucan or aldehydes may cause sensory reactions. In random order, we exposed 36 volunteers in a climate chamber to clean air, office dust, dust with glucan, and dust with aldehydes. Three groups of subjects were exposed, eleven were non-atopic with nasal histamine hyperreactivity, 13 were non-atopic, and 12 were atopic. Subjective ratings of symptoms and general health were registered four times during four 6-h exposure sessions. Six symptom intensity indices were constructed. The nasal hyperreactive group had a high and time-dependent increase of mucous membrane irritations, whereas the atopic group had a low and stable rate of irritations with exposure time, close to the reference group (P = 0.02 for differences between the groups with respect to time under exposure for Weak Inflammatory Responses and P = 0.05 for Irritative Body Perception, significance mainly because of the nasal hyperreactive group). Exposure to dust, with or without glucan or aldehydes, showed increased discomfort measured by the index for Constant Indoor Climate, and dust with glucan had a similar effect for the index for Lower Respiratory Effects. For Psychological and Neurological Effects these were dependent on group affiliation, thus preventing a uniform statement of exposure effects for all three investigated groups. Opportunities for identifying persons with high or low sensitivity to low-level exposures are important in preventive medicine and will reduce intra-group variability and thus increase the power of experimental and epidemiological studies searching for correlations between exposures and health effects. The contrast between nasal hyperreactive on one side and atopic and reference subjects on the other side is particularly important. The atopic group indicated a non-homogenous reaction depending on their hyperreactive status, a finding that could be important but needs further confirmation.

Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Preparation, characterization, and biological properties of β-glucans

Directory of Open Access Journals (Sweden)

Sandeep Rahar

2011-01-01

Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

Directory of Open Access Journals (Sweden)

D. El Khoury

2012-01-01

Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

Science.gov (United States)

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

Energy Technology Data Exchange (ETDEWEB)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2010-07-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

International Nuclear Information System (INIS)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

2010-01-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

Directory of Open Access Journals (Sweden)

JD Biller-Takahashi

Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

Suppressing effects of glucan on micronuclei induced by Co60 in mice

International Nuclear Information System (INIS)

Chorvatovicova, D.

1991-01-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

Effects of two Asian sand dusts transported from the dust source regions of Inner Mongolia and northeast China on murine lung eosinophilia

Energy Technology Data Exchange (ETDEWEB)

He, Miao, E-mail: hemiao.cmu@gmail.com [Environment and Chronic Non-communicable Disease Research Center, College of Public Health, China Medical University, 11001 Shenyang (China); Department of Health Sciences, Oita University of Nursing and Health Sciences, 870-1201 Oita (Japan); Ichinose, Takamichi, E-mail: ichinose@oita-nhs.ac.jp [Department of Health Sciences, Oita University of Nursing and Health Sciences, 870-1201 Oita (Japan); Song, Yuan, E-mail: freude@med.uoeh-u.ac.jp [Department of Immunology and Parasitology, School of Medicine, University of Occupational and Environmental Health, Iseigaoka, Yahata-nishi-ku, Kitakyushu, 807-8555 Fukuoka (Japan); Yoshida, Yasuhiro, E-mail: songyuan1107@163.com [Department of Immunology and Parasitology, School of Medicine, University of Occupational and Environmental Health, Iseigaoka, Yahata-nishi-ku, Kitakyushu, 807-8555 Fukuoka (Japan); Arashidani, Keiichi, E-mail: arashi@snow.ocn.ne.jp [Department of Immunology and Parasitology, School of Medicine, University of Occupational and Environmental Health, Iseigaoka, Yahata-nishi-ku, Kitakyushu, 807-8555 Fukuoka (Japan); Yoshida, Seiichi, E-mail: syoshida@oita-nhs.ac.jp [Department of Health Sciences, Oita University of Nursing and Health Sciences, 870-1201 Oita (Japan); Liu, Boying, E-mail: boyingliu321@gmail.com [Environment and Chronic Non-communicable Disease Research Center, College of Public Health, China Medical University, 11001 Shenyang (China); Department of Health Sciences, Oita University of Nursing and Health Sciences, 870-1201 Oita (Japan); Nishikawa, Masataka, E-mail: mnishi@nies.go.jp [Environmental Chemistry Division, National Institute for Environmental Studies, 305-8506 Tsukuba, Ibaraki (Japan); Takano, Hirohisa, E-mail: htakano@health.env.kyoto-u.ac.jp [Environmental Health Division, Department of Environmental Engineering, Graduate School of Engineering, Kyoto University, Kyoto daigaku-Katsura, Nishikyo-ku, Kyoto 615-8530 (Japan); and others

2013-11-01

The quality and quantity of toxic materials adsorbed onto Asian sand dust (ASD) are different based on dust source regions and passage routes. The aggravating effects of two ASDs (ASD1 and ASD2) transported from the source regions of Inner Mongolia and northeast China on lung eosinophilia were compared to clarify the role of toxic materials in ASD. The ASDs contained different amounts of lipopolysaccharides (LPS) and β-glucan (ASD1 < ASD2) and SiO{sub 2} (ASD1 > ASD2). CD-1 mice were instilled intratracheally with ASD1, ASD2 and/or ovalbumin (OVA) four times at 2-week intervals. ASD1 and ASD2 enhanced eosinophil recruitment induced by OVA in the submucosa of the airway, with goblet cell proliferation in the bronchial epithelium. ASD1 and ASD2 synergistically increased OVA-induced eosinophil-relevant cytokines interleukin-5 (IL-5), IL-13 (ASD1 < ASD2) and chemokine eotaxin (ASD1 > ASD2) in bronchoalveolar lavage fluid. ASD2 aggravating effects on lung eosinophilia were greater than ASD1. The role of LPS and β-glucan in ASD2 on the production of pro-inflammatory mediators was assessed using in vitro bone marrow-derived macrophages (BMDMs) from wild type, Toll-like receptor 2-deficient (TLR2 −/−), TLR4 −/−, and MyD88 −/− mice (on Balb/c background). ASD2-stimulated TLR2 −/− BMDMs enhanced IL-6, IL-12, TNF-α, MCP-1 and MIP-1α secretion compared with ASD2-stimulated TLR4 −/− BMDMs. Protein expression from ASD2-stimulated MyD88 −/− BMDM were very low or undetectable. The in vitro results indicate that lung eosinophilia caused by ASD is TLR4 dependent. Therefore, the aggravation of OVA-related lung eosinophilia by ASD may be dependent on toxic substances derived from microbes, such as LPS, rather than SiO{sub 2}. - Highlights: • Asian sand dust (ASD) from the deserts of China causes serious respiratory problems. • The aggravating effects of two ASDs on lung eosinophilia were compared. • The ASDs contained different LPS and β-glucan (ASD1

Effects of two Asian sand dusts transported from the dust source regions of Inner Mongolia and northeast China on murine lung eosinophilia

International Nuclear Information System (INIS)

He, Miao; Ichinose, Takamichi; Song, Yuan; Yoshida, Yasuhiro; Arashidani, Keiichi; Yoshida, Seiichi; Liu, Boying; Nishikawa, Masataka; Takano, Hirohisa

2013-01-01

The quality and quantity of toxic materials adsorbed onto Asian sand dust (ASD) are different based on dust source regions and passage routes. The aggravating effects of two ASDs (ASD1 and ASD2) transported from the source regions of Inner Mongolia and northeast China on lung eosinophilia were compared to clarify the role of toxic materials in ASD. The ASDs contained different amounts of lipopolysaccharides (LPS) and β-glucan (ASD1 2 (ASD1 > ASD2). CD-1 mice were instilled intratracheally with ASD1, ASD2 and/or ovalbumin (OVA) four times at 2-week intervals. ASD1 and ASD2 enhanced eosinophil recruitment induced by OVA in the submucosa of the airway, with goblet cell proliferation in the bronchial epithelium. ASD1 and ASD2 synergistically increased OVA-induced eosinophil-relevant cytokines interleukin-5 (IL-5), IL-13 (ASD1 ASD2) in bronchoalveolar lavage fluid. ASD2 aggravating effects on lung eosinophilia were greater than ASD1. The role of LPS and β-glucan in ASD2 on the production of pro-inflammatory mediators was assessed using in vitro bone marrow-derived macrophages (BMDMs) from wild type, Toll-like receptor 2-deficient (TLR2 −/−), TLR4 −/−, and MyD88 −/− mice (on Balb/c background). ASD2-stimulated TLR2 −/− BMDMs enhanced IL-6, IL-12, TNF-α, MCP-1 and MIP-1α secretion compared with ASD2-stimulated TLR4 −/− BMDMs. Protein expression from ASD2-stimulated MyD88 −/− BMDM were very low or undetectable. The in vitro results indicate that lung eosinophilia caused by ASD is TLR4 dependent. Therefore, the aggravation of OVA-related lung eosinophilia by ASD may be dependent on toxic substances derived from microbes, such as LPS, rather than SiO 2 . - Highlights: • Asian sand dust (ASD) from the deserts of China causes serious respiratory problems. • The aggravating effects of two ASDs on lung eosinophilia were compared. • The ASDs contained different LPS and β-glucan (ASD1 2 (ASD1 > ASD2). • The ASD2 aggravating effects on lung

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

Science.gov (United States)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

International Nuclear Information System (INIS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-01-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Beta-glucans and cholesterol

Czech Academy of Sciences Publication Activity Database

Šíma, Petr; Vannucci, Luca; Větvička, V.

2017-01-01

Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

NARCIS (Netherlands)

Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

1999-01-01

β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

Energy Technology Data Exchange (ETDEWEB)

Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

NARCIS (Netherlands)

Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

2015-01-01

β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

The effect of environmental parameters to dust concentration in air-conditioned space

Science.gov (United States)

Ismail, A. M. M.; Manssor, N. A. S.; Nalisa, A.; Yahaya, N.

2017-08-01

Malaysia has a wet and hot climate, therefore most of the spaces are air conditioned. The environment might affect dust concentration inside a space and affect the indoor air quality (IAQ). The main objective of this study is to study the dust concentration collected inside enclosed air-conditioned space. The measurement was done physically at four selected offices and two classrooms using a number of equipment to measure the dust concentration and environmental parameters which are temperature and relative air humidity. It was found that the highest dust concentration produced in office (temperature of 24.7°C, relative humidity of 66.5%) is 0.075 mg/m3, as compared to classroom, the highest dust concentration produced is 0.060 mg/m3 office (temperature of 25.9°C, relative humidity of 64.0%). However, both measurements show that value still within the safety level set by DOSH Malaysia (2005-2010) and ASHRAE 62.2 2016. The office contained higher dust concentration compared to classroom because of frequent movement transpires daily due to the functional of the offices.

Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

Science.gov (United States)

Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

2009-10-14

To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

Effects of gamma irradiation on the physical and structural properties of β-glucan

International Nuclear Information System (INIS)

Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

2008-01-01

This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

Recent insight in α-glucan metabolism in probiotic bacteria

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

2014-01-01

α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

β-Glucans: Relationships between Modification, Conformation and Functional Activities

Directory of Open Access Journals (Sweden)

Qiang Wang

2017-02-01

Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

International Nuclear Information System (INIS)

Nguyen Thanh Long; Le Quang Luan

2015-01-01

The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

2013-01-01

Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

Molecular size estimation of plasma membrane β-glucan synthase from red beet root

International Nuclear Information System (INIS)

Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

1986-01-01

Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

Aerosolization of fungi, (1→3)-β-D glucan, and endotoxin from flood-affected materials collected in New Orleans homes

Science.gov (United States)

Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.

2015-01-01

Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399

Structure and function of α-glucan debranching enzymes

DEFF Research Database (Denmark)

Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

2016-01-01

α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

Science.gov (United States)

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis

DEFF Research Database (Denmark)

Auger, Kyle; Raththagala, Madushi; Wilkens, Casper

2016-01-01

was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

Science.gov (United States)

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

Directory of Open Access Journals (Sweden)

KUSMIATI

2007-04-01

Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

Directory of Open Access Journals (Sweden)

Taiki Kobayashi

Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

Science.gov (United States)

Gomaa, K; Kraus, J; Franz, G; Röper, H

1991-09-18

Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

The structure of cell wall alpha-glucan from fission yeast

NARCIS (Netherlands)

Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

The structure of cell wall alpha-glucan from fission yeast.

NARCIS (Netherlands)

Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

Directory of Open Access Journals (Sweden)

Heather T Taff

Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

Directory of Open Access Journals (Sweden)

Claudia Zielke

Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

Microbial degradation of street dust polycyclic aromatic hydrocarbons in microcosms simulating diffuse pollution of urban soil

DEFF Research Database (Denmark)

Johnsen, Anders R; de Lipthay, Julia R; Sørensen, Søren J

2006-01-01

Diffuse pollution with polycyclic aromatic hydrocarbons (PAHs) of topsoil in urban regions has caused increasing concerns in recent years. We simulated diffuse pollution of soil in microcosms by spiking sandy topsoil (A-horizon) and coarse, mineral subsoil (C-horizon) with street dust (PM63...... for the persistence and low bioaccessibility of 5- and 6-ring PAHs in diffusely polluted soil.......) isolated from municipal street sweepings from central Copenhagen. The microbial communities adapted to PAH degradation in microcosms spiked with street dust in both A-horizon and C-horizon soils, in spite of low PAH-concentrations. The increased potential for PAH degradation was demonstrated on several...

Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

Directory of Open Access Journals (Sweden)

Vesna Zechner-Krpan

2010-01-01

Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

Science.gov (United States)

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

Directory of Open Access Journals (Sweden)

Ira Widjiastuti

2017-03-01

Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

Science.gov (United States)

Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

2014-06-01

Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

Science.gov (United States)

Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

1992-01-01

The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

Science.gov (United States)

Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

2016-01-01

Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

Science.gov (United States)

Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

2004-03-26

The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

Visual effects of β-­glucans on wound healing in fish

DEFF Research Database (Denmark)

Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

2011-01-01

Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

SuperSpike: Supervised Learning in Multilayer Spiking Neural Networks.

Science.gov (United States)

Zenke, Friedemann; Ganguli, Surya

2018-04-13

A vast majority of computation in the brain is performed by spiking neural networks. Despite the ubiquity of such spiking, we currently lack an understanding of how biological spiking neural circuits learn and compute in vivo, as well as how we can instantiate such capabilities in artificial spiking circuits in silico. Here we revisit the problem of supervised learning in temporally coding multilayer spiking neural networks. First, by using a surrogate gradient approach, we derive SuperSpike, a nonlinear voltage-based three-factor learning rule capable of training multilayer networks of deterministic integrate-and-fire neurons to perform nonlinear computations on spatiotemporal spike patterns. Second, inspired by recent results on feedback alignment, we compare the performance of our learning rule under different credit assignment strategies for propagating output errors to hidden units. Specifically, we test uniform, symmetric, and random feedback, finding that simpler tasks can be solved with any type of feedback, while more complex tasks require symmetric feedback. In summary, our results open the door to obtaining a better scientific understanding of learning and computation in spiking neural networks by advancing our ability to train them to solve nonlinear problems involving transformations between different spatiotemporal spike time patterns.

The Lunar Environment: Determining the Health Effects of Exposure to Moon Dusts

Science.gov (United States)

Khan-Mayberry, Noreen

2007-01-01

The moon's surface is covered with a thin layer of fine, charged, reactive dust capable of layer of fine, charged, reactive dust capable of capable of entering habitats and vehicle compartments, where it can result in crewmember health problems. NASA formed the Lunar Airborne Dust Toxicity Advisory Group (LADTAG) to study the effects of exposure to Lunar Dust on human health. To date, no scientifically defensible toxicological studies have been performed on lunar dusts, specifically the determination of exposure limits and their affect on human health. The multi-center LADTAG (Lunar Airborne Dust Toxicology center LADTAG (Lunar Airborne Dust Toxicology Advisory Group) was formed in response to the Office of the Chief Health and Medical Office s (OCHMO) request to develop recommendations for defining risk (OCHMO) request to develop recommendations for defining risk defining risk criteria for human lunar dust exposure.

An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

NARCIS (Netherlands)

Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

2004-01-01

(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

Dynamic, morphotype-specific Candida albicans beta-glucan exposure during infection and drug treatment.

Directory of Open Access Journals (Sweden)

Robert T Wheeler

2008-12-01

Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.

Bacterial and fungal components in house dust of farm children, Rudolf Steiner school children and reference children--the PARSIFAL Study.

Science.gov (United States)

Schram, D; Doekes, G; Boeve, M; Douwes, J; Riedler, J; Ublagger, E; von Mutius, E; Budde, J; Pershagen, G; Nyberg, F; Alm, J; Braun-Fahrländer, C; Waser, M; Brunekreef, B

2005-05-01

Growing up on a farm and an anthroposophic lifestyle are associated with a lower prevalence of allergic diseases in childhood. It has been suggested that the enhanced exposure to endotoxin is an important protective factor of farm environments. Little is known about exposure to other microbial components on farms and exposure in anthroposophic families. To assess the levels and determinants of bacterial endotoxin, mould beta(1,3)-glucans and fungal extracellular polysaccharides (EPS) in house dust of farm children, Steiner school children and reference children. Mattress and living room dust was collected in the homes of 229 farm children, 122 Steiner children and 60 and 67 of their respective reference children in five European countries. Stable dust was collected as well. All samples were analysed in one central laboratory. Determinants were assessed by questionnaire. Levels of endotoxin, EPS and glucans per gram of house dust in farm homes were 1.2- to 3.2-fold higher than levels in reference homes. For Steiner children, 1.1- to 1.6-fold higher levels were observed compared with their reference children. These differences were consistently found across countries, although mean levels varied considerably. Differences between groups and between countries were also significant after adjustment for home and family characteristics. Farm children are not only consistently exposed to higher levels of endotoxin, but also to higher levels of mould components. Steiner school children may also be exposed to higher levels of microbial agents, but differences with reference children are much less pronounced than for farm children. Further analyses are, however, required to assess the association between exposure to these various microbial agents and allergic and airway diseases in the PARSIFAL population.

Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

Science.gov (United States)

Theuwissen, Elke; Mensink, Ronald P

2007-03-01

Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

Science.gov (United States)

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

Spiking neural network for recognizing spatiotemporal sequences of spikes

International Nuclear Information System (INIS)

Jin, Dezhe Z.

2004-01-01

Sensory neurons in many brain areas spike with precise timing to stimuli with temporal structures, and encode temporally complex stimuli into spatiotemporal spikes. How the downstream neurons read out such neural code is an important unsolved problem. In this paper, we describe a decoding scheme using a spiking recurrent neural network. The network consists of excitatory neurons that form a synfire chain, and two globally inhibitory interneurons of different types that provide delayed feedforward and fast feedback inhibition, respectively. The network signals recognition of a specific spatiotemporal sequence when the last excitatory neuron down the synfire chain spikes, which happens if and only if that sequence was present in the input spike stream. The recognition scheme is invariant to variations in the intervals between input spikes within some range. The computation of the network can be mapped into that of a finite state machine. Our network provides a simple way to decode spatiotemporal spikes with diverse types of neurons

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

Science.gov (United States)

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

2017-04-01

Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2012-01-01

Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

Directory of Open Access Journals (Sweden)

E. Y. Choi

2016-11-01

Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

Science.gov (United States)

Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

2017-11-01

Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

Serial Spike Time Correlations Affect Probability Distribution of Joint Spike Events.

Science.gov (United States)

Shahi, Mina; van Vreeswijk, Carl; Pipa, Gordon

2016-01-01

Detecting the existence of temporally coordinated spiking activity, and its role in information processing in the cortex, has remained a major challenge for neuroscience research. Different methods and approaches have been suggested to test whether the observed synchronized events are significantly different from those expected by chance. To analyze the simultaneous spike trains for precise spike correlation, these methods typically model the spike trains as a Poisson process implying that the generation of each spike is independent of all the other spikes. However, studies have shown that neural spike trains exhibit dependence among spike sequences, such as the absolute and relative refractory periods which govern the spike probability of the oncoming action potential based on the time of the last spike, or the bursting behavior, which is characterized by short epochs of rapid action potentials, followed by longer episodes of silence. Here we investigate non-renewal processes with the inter-spike interval distribution model that incorporates spike-history dependence of individual neurons. For that, we use the Monte Carlo method to estimate the full shape of the coincidence count distribution and to generate false positives for coincidence detection. The results show that compared to the distributions based on homogeneous Poisson processes, and also non-Poisson processes, the width of the distribution of joint spike events changes. Non-renewal processes can lead to both heavy tailed or narrow coincidence distribution. We conclude that small differences in the exact autostructure of the point process can cause large differences in the width of a coincidence distribution. Therefore, manipulations of the autostructure for the estimation of significance of joint spike events seem to be inadequate.

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

Directory of Open Access Journals (Sweden)

Mattia P. Arena

2014-02-01

Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

iSpike: a spiking neural interface for the iCub robot

International Nuclear Information System (INIS)

Gamez, D; Fidjeland, A K; Lazdins, E

2012-01-01

This paper presents iSpike: a C++ library that interfaces between spiking neural network simulators and the iCub humanoid robot. It uses a biologically inspired approach to convert the robot’s sensory information into spikes that are passed to the neural network simulator, and it decodes output spikes from the network into motor signals that are sent to control the robot. Applications of iSpike range from embodied models of the brain to the development of intelligent robots using biologically inspired spiking neural networks. iSpike is an open source library that is available for free download under the terms of the GPL. (paper)

Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

Science.gov (United States)

Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

2013-03-01

β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

Modulation of the immune response of porcine neutrophils by different β-glucan preparations

DEFF Research Database (Denmark)

Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

2010-01-01

β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

International Nuclear Information System (INIS)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

2015-01-01

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

Energy Technology Data Exchange (ETDEWEB)

Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

2015-02-27

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

Directory of Open Access Journals (Sweden)

AHMAD THONTOWI

2007-10-01

Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

Beta-glucans in the treatment of diabetes and associated cardiovascular risks

Directory of Open Access Journals (Sweden)

Jiezhong Chen

2008-12-01

Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

Directory of Open Access Journals (Sweden)

Matthew J. Elder

2017-07-01

Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

Various roles of beta-glucan in invertebrates

Czech Academy of Sciences Publication Activity Database

Větvička, V.; Šíma, Petr

2017-01-01

Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

Training spiking neural networks to associate spatio-temporal input-output spike patterns

OpenAIRE

Mohemmed, A; Schliebs, S; Matsuda, S; Kasabov, N

2013-01-01

In a previous work (Mohemmed et al., Method for training a spiking neuron to associate input–output spike trains) [1] we have proposed a supervised learning algorithm based on temporal coding to train a spiking neuron to associate input spatiotemporal spike patterns to desired output spike patterns. The algorithm is based on the conversion of spike trains into analogue signals and the application of the Widrow–Hoff learning rule. In this paper we present a mathematical formulation of the prop...

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

Science.gov (United States)

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

Spike persistence and normalization in benign epilepsy with centrotemporal spikes - Implications for management.

Science.gov (United States)

Kim, Hunmin; Kim, Soo Yeon; Lim, Byung Chan; Hwang, Hee; Chae, Jong-Hee; Choi, Jieun; Kim, Ki Joong; Dlugos, Dennis J

2018-05-10

This study was performed 1) to determine the timing of spike normalization in patients with benign epilepsy with centrotemporal spikes (BECTS); 2) to identify relationships between age of seizure onset, age of spike normalization, years of spike persistence and treatment; and 3) to assess final outcomes between groups of patients with or without spikes at the time of medication tapering. Retrospective analysis of BECTS patients confirmed by clinical data, including age of onset, seizure semiology and serial electroencephalography (EEG) from diagnosis to remission. Age at spike normalization, years of spike persistence, and time of treatment onset to spike normalization were assessed. Final seizure and EEG outcome were compared between the groups with or without spikes at the time of AED tapering. One hundred and thirty-four patients were included. Mean age at seizure onset was 7.52 ± 2.11 years. Mean age at spike normalization was 11.89 ± 2.11 (range: 6.3-16.8) years. Mean time of treatment onset to spike normalization was 4.11 ± 2.13 (range: 0.24-10.08) years. Younger age of seizure onset was correlated with longer duration of spike persistence (r = -0.41, p < 0.001). In treated patients, spikes persisted for 4.1 ± 1.95 years, compared with 2.9 ± 1.97 years in untreated patients. No patients had recurrent seizures after AED was discontinued, regardless of the presence/absence of spikes at time of AED tapering. Years of spike persistence was longer in early onset BECTS patients. Treatment with AEDs did not shorten years of spike persistence. Persistence of spikes at time of treatment withdrawal was not associated with seizure recurrence. Copyright © 2018 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

Directory of Open Access Journals (Sweden)

Antonio Francioso

2017-05-01

Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

Science.gov (United States)

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

Science.gov (United States)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

75 FR 32142 - Combustible Dust

Science.gov (United States)

2010-06-07

.... Contact Mat Chibbaro, P.E., Fire Protection Engineer, Office of Safety Systems, OSHA Directorate of..., and metals (such as aluminum and magnesium). Industries that may have combustible dust hazards include..., chemical manufacturing, textile manufacturing, furniture manufacturing, metal processing, fabricated metal...

The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

Directory of Open Access Journals (Sweden)

Jenneke Leentjens

Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

Directory of Open Access Journals (Sweden)

Tomoko Jippo

2015-02-01

Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

DEFF Research Database (Denmark)

Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

2008-01-01

Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

Electrodynamic Dust Shield Demonstrator

Science.gov (United States)

Stankie, Charles G.

2013-01-01

The objective of the project was to design and manufacture a device to demonstrate a new technology developed by NASA's Electrostatics and Surface Physics Laboratory. The technology itself is a system which uses magnetic principles to remove regolith dust from its surface. This project was to create an enclosure that will be used to demonstrate the effectiveness of the invention to The Office of the Chief Technologist. ONE of the most important challenges of space exploration is actually caused by something very small and seemingly insignificant. Dust in space, most notably on the moon and Mars, has caused many unforeseen issues. Dirt and dust on Earth, while a nuisance, can be easily cleaned and kept at bay. However, there is considerably less weathering and erosion in space. As a result, the microscopic particles are extremely rough and abrasive. They are also electrostatically charged, so they cling to everything they make contact with. This was first noted to be a major problem during the Apollo missions. Dust would stick to the spacesuits, and could not be wiped off as predicted. Dust was brought back into the spacecraft, and was even inhaled by astronauts. This is a major health hazard. Atmospheric storms and other events can also cause dust to coat surfaces of spacecraft. This can cause abrasive damage to the craft. The coating can also reduce the effectiveness of thermal insulation and solar panels.' A group of engineers at Kennedy Space Center's Electrostatics and Surface Physics Laboratory have developed a new technology, called the Electrodynamic Dust Shield, to help alleviate these problems. It is based off of the electric curtain concept developed at NASA in 1967. "The EDS is an active dust mitigation technology that uses traveling electric fields to transport electrostatically charged dust particles along surfaces. To generate the traveling electric fields, the EDS consists of a multilayer dielectric coating with an embedded thin electrode grid

Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

Directory of Open Access Journals (Sweden)

Fulcher R Gary

2007-03-01

Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

International Nuclear Information System (INIS)

Schmidt, W.E.; Ebel, J.

1987-01-01

Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

International Nuclear Information System (INIS)

Salama, S.F.

2011-01-01

1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

Science.gov (United States)

Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

2004-10-01

Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

The Second Spiking Threshold: Dynamics of Laminar Network Spiking in the Visual Cortex

DEFF Research Database (Denmark)

Forsberg, Lars E.; Bonde, Lars H.; Harvey, Michael A.

2016-01-01

and moving visual stimuli from the spontaneous ongoing spiking state, in all layers and zones of areas 17 and 18 indicating that the second threshold is a property of the network. Spontaneous and evoked spiking, thus can easily be distinguished. In addition, the trajectories of spontaneous ongoing states......Most neurons have a threshold separating the silent non-spiking state and the state of producing temporal sequences of spikes. But neurons in vivo also have a second threshold, found recently in granular layer neurons of the primary visual cortex, separating spontaneous ongoing spiking from...... visually evoked spiking driven by sharp transients. Here we examine whether this second threshold exists outside the granular layer and examine details of transitions between spiking states in ferrets exposed to moving objects. We found the second threshold, separating spiking states evoked by stationary...

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

NARCIS (Netherlands)

Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

2007-01-01

The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

Span: spike pattern association neuron for learning spatio-temporal spike patterns.

Science.gov (United States)

Mohemmed, Ammar; Schliebs, Stefan; Matsuda, Satoshi; Kasabov, Nikola

2012-08-01

Spiking Neural Networks (SNN) were shown to be suitable tools for the processing of spatio-temporal information. However, due to their inherent complexity, the formulation of efficient supervised learning algorithms for SNN is difficult and remains an important problem in the research area. This article presents SPAN - a spiking neuron that is able to learn associations of arbitrary spike trains in a supervised fashion allowing the processing of spatio-temporal information encoded in the precise timing of spikes. The idea of the proposed algorithm is to transform spike trains during the learning phase into analog signals so that common mathematical operations can be performed on them. Using this conversion, it is possible to apply the well-known Widrow-Hoff rule directly to the transformed spike trains in order to adjust the synaptic weights and to achieve a desired input/output spike behavior of the neuron. In the presented experimental analysis, the proposed learning algorithm is evaluated regarding its learning capabilities, its memory capacity, its robustness to noisy stimuli and its classification performance. Differences and similarities of SPAN regarding two related algorithms, ReSuMe and Chronotron, are discussed.

Deep Spiking Networks

NARCIS (Netherlands)

O'Connor, P.; Welling, M.

2016-01-01

We introduce an algorithm to do backpropagation on a spiking network. Our network is "spiking" in the sense that our neurons accumulate their activation into a potential over time, and only send out a signal (a "spike") when this potential crosses a threshold and the neuron is reset. Neurons only

Long-lived effects of administering β-glucans

NARCIS (Netherlands)

Petit, Jules; Wiegertjes, Geert F.

2016-01-01

Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

Science.gov (United States)

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

Science.gov (United States)

Rosburg, Valerie; Boylston, Terri; White, Pamela

2010-06-01

Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

Science.gov (United States)

Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

2016-12-01

β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Decoding spikes in a spiking neuronal network

Energy Technology Data Exchange (ETDEWEB)

Feng Jianfeng [Department of Informatics, University of Sussex, Brighton BN1 9QH (United Kingdom); Ding, Mingzhou [Department of Mathematics, Florida Atlantic University, Boca Raton, FL 33431 (United States)

2004-06-04

We investigate how to reliably decode the input information from the output of a spiking neuronal network. A maximum likelihood estimator of the input signal, together with its Fisher information, is rigorously calculated. The advantage of the maximum likelihood estimation over the 'brute-force rate coding' estimate is clearly demonstrated. It is pointed out that the ergodic assumption in neuroscience, i.e. a temporal average is equivalent to an ensemble average, is in general not true. Averaging over an ensemble of neurons usually gives a biased estimate of the input information. A method on how to compensate for the bias is proposed. Reconstruction of dynamical input signals with a group of spiking neurons is extensively studied and our results show that less than a spike is sufficient to accurately decode dynamical inputs.

Decoding spikes in a spiking neuronal network

International Nuclear Information System (INIS)

Feng Jianfeng; Ding, Mingzhou

2004-01-01

We investigate how to reliably decode the input information from the output of a spiking neuronal network. A maximum likelihood estimator of the input signal, together with its Fisher information, is rigorously calculated. The advantage of the maximum likelihood estimation over the 'brute-force rate coding' estimate is clearly demonstrated. It is pointed out that the ergodic assumption in neuroscience, i.e. a temporal average is equivalent to an ensemble average, is in general not true. Averaging over an ensemble of neurons usually gives a biased estimate of the input information. A method on how to compensate for the bias is proposed. Reconstruction of dynamical input signals with a group of spiking neurons is extensively studied and our results show that less than a spike is sufficient to accurately decode dynamical inputs

Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

DEFF Research Database (Denmark)

Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

2017-01-01

-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

Science.gov (United States)

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau

-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

The dynamic relationship between cerebellar Purkinje cell simple spikes and the spikelet number of complex spikes.

Science.gov (United States)

Burroughs, Amelia; Wise, Andrew K; Xiao, Jianqiang; Houghton, Conor; Tang, Tianyu; Suh, Colleen Y; Lang, Eric J; Apps, Richard; Cerminara, Nadia L

2017-01-01

Purkinje cells are the sole output of the cerebellar cortex and fire two distinct types of action potential: simple spikes and complex spikes. Previous studies have mainly considered complex spikes as unitary events, even though the waveform is composed of varying numbers of spikelets. The extent to which differences in spikelet number affect simple spike activity (and vice versa) remains unclear. We found that complex spikes with greater numbers of spikelets are preceded by higher simple spike firing rates but, following the complex spike, simple spikes are reduced in a manner that is graded with spikelet number. This dynamic interaction has important implications for cerebellar information processing, and suggests that complex spike spikelet number may maintain Purkinje cells within their operational range. Purkinje cells are central to cerebellar function because they form the sole output of the cerebellar cortex. They exhibit two distinct types of action potential: simple spikes and complex spikes. It is widely accepted that interaction between these two types of impulse is central to cerebellar cortical information processing. Previous investigations of the interactions between simple spikes and complex spikes have mainly considered complex spikes as unitary events. However, complex spikes are composed of an initial large spike followed by a number of secondary components, termed spikelets. The number of spikelets within individual complex spikes is highly variable and the extent to which differences in complex spike spikelet number affects simple spike activity (and vice versa) remains poorly understood. In anaesthetized adult rats, we have found that Purkinje cells recorded from the posterior lobe vermis and hemisphere have high simple spike firing frequencies that precede complex spikes with greater numbers of spikelets. This finding was also evident in a small sample of Purkinje cells recorded from the posterior lobe hemisphere in awake cats. In addition

Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

Science.gov (United States)

Kumari, J; Sahoo, P K

2006-02-01

This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

Science.gov (United States)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

The Second Spiking Threshold: Dynamics of Laminar Network Spiking in the Visual Cortex

Science.gov (United States)

Forsberg, Lars E.; Bonde, Lars H.; Harvey, Michael A.; Roland, Per E.

2016-01-01

Most neurons have a threshold separating the silent non-spiking state and the state of producing temporal sequences of spikes. But neurons in vivo also have a second threshold, found recently in granular layer neurons of the primary visual cortex, separating spontaneous ongoing spiking from visually evoked spiking driven by sharp transients. Here we examine whether this second threshold exists outside the granular layer and examine details of transitions between spiking states in ferrets exposed to moving objects. We found the second threshold, separating spiking states evoked by stationary and moving visual stimuli from the spontaneous ongoing spiking state, in all layers and zones of areas 17 and 18 indicating that the second threshold is a property of the network. Spontaneous and evoked spiking, thus can easily be distinguished. In addition, the trajectories of spontaneous ongoing states were slow, frequently changing direction. In single trials, sharp as well as smooth and slow transients transform the trajectories to be outward directed, fast and crossing the threshold to become evoked. Although the speeds of the evolution of the evoked states differ, the same domain of the state space is explored indicating uniformity of the evoked states. All evoked states return to the spontaneous evoked spiking state as in a typical mono-stable dynamical system. In single trials, neither the original spiking rates, nor the temporal evolution in state space could distinguish simple visual scenes. PMID:27582693

An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

2017-01-01

binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

DEFF Research Database (Denmark)

Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

2010-01-01

To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

Directory of Open Access Journals (Sweden)

Jae Gil Lee

2016-06-01

Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

Science.gov (United States)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

Science.gov (United States)

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

Directory of Open Access Journals (Sweden)

Đukić Nevena H.

2014-01-01

Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

Science.gov (United States)

Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

2017-02-01

(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

Immunostimulatory properties and antitumor activities of glucans (Review)

Czech Academy of Sciences Publication Activity Database

Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

2013-01-01

Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.

Directory of Open Access Journals (Sweden)

Chad Steele

2005-12-01

Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.

Automatic EEG spike detection.

Science.gov (United States)

Harner, Richard

2009-10-01

Since the 1970s advances in science and technology during each succeeding decade have renewed the expectation of efficient, reliable automatic epileptiform spike detection (AESD). But even when reinforced with better, faster tools, clinically reliable unsupervised spike detection remains beyond our reach. Expert-selected spike parameters were the first and still most widely used for AESD. Thresholds for amplitude, duration, sharpness, rise-time, fall-time, after-coming slow waves, background frequency, and more have been used. It is still unclear which of these wave parameters are essential, beyond peak-peak amplitude and duration. Wavelet parameters are very appropriate to AESD but need to be combined with other parameters to achieve desired levels of spike detection efficiency. Artificial Neural Network (ANN) and expert-system methods may have reached peak efficiency. Support Vector Machine (SVM) technology focuses on outliers rather than centroids of spike and nonspike data clusters and should improve AESD efficiency. An exemplary spike/nonspike database is suggested as a tool for assessing parameters and methods for AESD and is available in CSV or Matlab formats from the author at brainvue@gmail.com. Exploratory Data Analysis (EDA) is presented as a graphic method for finding better spike parameters and for the step-wise evaluation of the spike detection process.

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

SpikeTemp: An Enhanced Rank-Order-Based Learning Approach for Spiking Neural Networks With Adaptive Structure.

Science.gov (United States)

Wang, Jinling; Belatreche, Ammar; Maguire, Liam P; McGinnity, Thomas Martin

2017-01-01

This paper presents an enhanced rank-order-based learning algorithm, called SpikeTemp, for spiking neural networks (SNNs) with a dynamically adaptive structure. The trained feed-forward SNN consists of two layers of spiking neurons: 1) an encoding layer which temporally encodes real-valued features into spatio-temporal spike patterns and 2) an output layer of dynamically grown neurons which perform spatio-temporal classification. Both Gaussian receptive fields and square cosine population encoding schemes are employed to encode real-valued features into spatio-temporal spike patterns. Unlike the rank-order-based learning approach, SpikeTemp uses the precise times of the incoming spikes for adjusting the synaptic weights such that early spikes result in a large weight change and late spikes lead to a smaller weight change. This removes the need to rank all the incoming spikes and, thus, reduces the computational cost of SpikeTemp. The proposed SpikeTemp algorithm is demonstrated on several benchmark data sets and on an image recognition task. The results show that SpikeTemp can achieve better classification performance and is much faster than the existing rank-order-based learning approach. In addition, the number of output neurons is much smaller when the square cosine encoding scheme is employed. Furthermore, SpikeTemp is benchmarked against a selection of existing machine learning algorithms, and the results demonstrate the ability of SpikeTemp to classify different data sets after just one presentation of the training samples with comparable classification performance.

Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

Directory of Open Access Journals (Sweden)

Ľubomír Mikuš

2013-02-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

DEFF Research Database (Denmark)

Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

2013-01-01

for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

Science.gov (United States)

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

Spiking Neural Networks Based on OxRAM Synapses for Real-Time Unsupervised Spike Sorting.

Science.gov (United States)

Werner, Thilo; Vianello, Elisa; Bichler, Olivier; Garbin, Daniele; Cattaert, Daniel; Yvert, Blaise; De Salvo, Barbara; Perniola, Luca

2016-01-01

In this paper, we present an alternative approach to perform spike sorting of complex brain signals based on spiking neural networks (SNN). The proposed architecture is suitable for hardware implementation by using resistive random access memory (RRAM) technology for the implementation of synapses whose low latency (spike sorting. This offers promising advantages to conventional spike sorting techniques for brain-computer interfaces (BCI) and neural prosthesis applications. Moreover, the ultra-low power consumption of the RRAM synapses of the spiking neural network (nW range) may enable the design of autonomous implantable devices for rehabilitation purposes. We demonstrate an original methodology to use Oxide based RRAM (OxRAM) as easy to program and low energy (Spike Timing Dependent Plasticity. Real spiking data have been recorded both intra- and extracellularly from an in-vitro preparation of the Crayfish sensory-motor system and used for validation of the proposed OxRAM based SNN. This artificial SNN is able to identify, learn, recognize and distinguish between different spike shapes in the input signal with a recognition rate about 90% without any supervision.

beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

Energy Technology Data Exchange (ETDEWEB)

Satoh, S; Matsuda, K; Tamari, K

1976-12-01

A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

Dust Interactions on Small Solar System Bodies and Technology Considerations for Exploration

Science.gov (United States)

Kobrick, Ryan,; Hoffman, Jeffrey; Pavone, Marco; Street, Kenneth; Rickman, Douglas

2014-01-01

Small-bodies such as asteroids and Mars' moons Phobos and Deimos have relatively unknown regolith environments. It is hypothesized that dust preserved in the regolith on the surfaces will have similar mechanical properties to lunar dust because of similar formation processes from micrometeorite bombardment, low relative gravity for slow settling times, and virtually no weathering because there is no atmosphere. This combination of processes infers that small-body dust particles will be highly angular and retain abrasive properties. The focus of this paper uses the mission architecture and engineering design for an asteroid hopper known as Hedgehog, a spherical spacecraft with several symmetric spikes used to aid with tumbling mobility in a low gravity environment. Dust abrasion considerations are highlighted throughout the paper relating to the lead authors' previous work, but act as an example of one of many important dust or regolith physical properties that need to be considered for future exploration. Measurable regolith properties are summarized in order to identify technologies that may be useful for exploration in terms of scientific return and spacecraft design. Previous instruments are summarized in this paper that could be used on the Hedgehog. Opportunities for hardware payloads are highlighted that include low mass solutions or dualpurpose instruments that can measure regolith or dust properties. Finally, dust mitigation suggestions are made for vehicles of this mobility profile.

Integration of RGB "Dust" Imagery to Operations at the Albuquerque Forecast Office

Science.gov (United States)

Fuell, Kevin; Guyer, Brian

2014-01-01

The NASA/Short-term Prediction, Research, and Transition (SPoRT) Program has been providing unique Red-Green-Blue (RGB) composite imagery to its operational partners since 2005. In the early years of activity these RGB products were related to a True Color RGB, showing what one's own eyes would see if looking down at earth from space, as well as a Snow-Cloud RGB (i.e. False Color), separating clouds from snow on the ground. More recently SPoRT has used the EUMETSAT Best Practices standards for RGB composites to transition a wide array of imagery for multiple uses. A "Dust" RGB product has had particular use at the Albuquerque, New Mexico WFO. Several cases have occurred where users were able to isolate dust plume locations for mesoscale and microscale events during day and night time conditions. In addition the "Dust" RGB can be used for more than just detection of dust as it is sensitive to the changes in density due to atmospheric moisture content. Hence low-level dry boundaries can often be discriminated. This type of imagery is a large change from the single channel imagery typically used by operational forecast staff and hence, can be a challenge to interpret. This presentation aims to discuss the integration of such new imagery into operational use as well as the benefits assessed by the Albuquerque WFO over several documented events.

Integration of RGB "Dust" Imagery to Operations at the Albuqueque Forecast Office

Science.gov (United States)

Fuell, Kevin; Guyer, Brian

2014-01-01

The NASA/Short-term Prediction, Research, and Transition (SPoRT) Program has been providing unique Red-Green-Blue (RGB) composite imagery to its operational partners since 2005. In the early years of activity these RGB products were related to a True Color RGB, showing what one's own eyes would see if looking down at earth from space, as well as a Snow-Cloud RGB (i.e. False Color), separating clouds from snow on the ground. More recently SPoRT has used the EUMETSAT Best Practices standards for RGB composites to transition a wide array of imagery for multiple uses. A "Dust" RGB product has had particular use at the Albuquerque, New Mexico WFO. Several cases have occurred where users were able to isolate dust plume locations for mesoscale and microscale events during day and night time conditions. In addition the "Dust" RGB can be used for more than just detection of dust as it is sensitive to the changes in density due to atmospheric moisture content. Hence low-level dry boundaries can often be discriminated. This type of imagery is a large change from the single channel imagery typically used by operational forecast staff and hence, can be a challenge to interpret. This presentation aims to discuss the integration of such new imagery into operational use as well as the benefits assessed by the Albuquerque WFO over several documented events.

Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

OpenAIRE

Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

2001-01-01

(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

Automatic spike sorting using tuning information.

Science.gov (United States)

Ventura, Valérie

2009-09-01

Current spike sorting methods focus on clustering neurons' characteristic spike waveforms. The resulting spike-sorted data are typically used to estimate how covariates of interest modulate the firing rates of neurons. However, when these covariates do modulate the firing rates, they provide information about spikes' identities, which thus far have been ignored for the purpose of spike sorting. This letter describes a novel approach to spike sorting, which incorporates both waveform information and tuning information obtained from the modulation of firing rates. Because it efficiently uses all the available information, this spike sorter yields lower spike misclassification rates than traditional automatic spike sorters. This theoretical result is verified empirically on several examples. The proposed method does not require additional assumptions; only its implementation is different. It essentially consists of performing spike sorting and tuning estimation simultaneously rather than sequentially, as is currently done. We used an expectation-maximization maximum likelihood algorithm to implement the new spike sorter. We present the general form of this algorithm and provide a detailed implementable version under the assumptions that neurons are independent and spike according to Poisson processes. Finally, we uncover a systematic flaw of spike sorting based on waveform information only.

Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2016-01-01

Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

Biotechnological potential of novel glycoside hydrolase family 70 enzymes synthesizing α-glucans from starch and sucrose

NARCIS (Netherlands)

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

OpenAIRE

Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

2012-01-01

Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

Reliability of MEG source imaging of anterior temporal spikes: analysis of an intracranially characterized spike focus.

Science.gov (United States)

Wennberg, Richard; Cheyne, Douglas

2014-05-01

To assess the reliability of MEG source imaging (MSI) of anterior temporal spikes through detailed analysis of the localization and orientation of source solutions obtained for a large number of spikes that were separately confirmed by intracranial EEG to be focally generated within a single, well-characterized spike focus. MSI was performed on 64 identical right anterior temporal spikes from an anterolateral temporal neocortical spike focus. The effects of different volume conductors (sphere and realistic head model), removal of noise with low frequency filters (LFFs) and averaging multiple spikes were assessed in terms of the reliability of the source solutions. MSI of single spikes resulted in scattered dipole source solutions that showed reasonable reliability for localization at the lobar level, but only for solutions with a goodness-of-fit exceeding 80% using a LFF of 3 Hz. Reliability at a finer level of intralobar localization was limited. Spike averaging significantly improved the reliability of source solutions and averaging 8 or more spikes reduced dependency on goodness-of-fit and data filtering. MSI performed on topographically identical individual spikes from an intracranially defined classical anterior temporal lobe spike focus was limited by low reliability (i.e., scattered source solutions) in terms of fine, sublobar localization within the ipsilateral temporal lobe. Spike averaging significantly improved reliability. MSI performed on individual anterior temporal spikes is limited by low reliability. Reduction of background noise through spike averaging significantly improves the reliability of MSI solutions. Copyright © 2013 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

Decoding spatiotemporal spike sequences via the finite state automata dynamics of spiking neural networks

International Nuclear Information System (INIS)

Jin, Dezhe Z

2008-01-01

Temporally complex stimuli are encoded into spatiotemporal spike sequences of neurons in many sensory areas. Here, we describe how downstream neurons with dendritic bistable plateau potentials can be connected to decode such spike sequences. Driven by feedforward inputs from the sensory neurons and controlled by feedforward inhibition and lateral excitation, the neurons transit between UP and DOWN states of the membrane potentials. The neurons spike only in the UP states. A decoding neuron spikes at the end of an input to signal the recognition of specific spike sequences. The transition dynamics is equivalent to that of a finite state automaton. A connection rule for the networks guarantees that any finite state automaton can be mapped into the transition dynamics, demonstrating the equivalence in computational power between the networks and finite state automata. The decoding mechanism is capable of recognizing an arbitrary number of spatiotemporal spike sequences, and is insensitive to the variations of the spike timings in the sequences

Application of cross-correlated delay shift rule in spiking neural networks for interictal spike detection.

Science.gov (United States)

Lilin Guo; Zhenzhong Wang; Cabrerizo, Mercedes; Adjouadi, Malek

2016-08-01

This study proposes a Cross-Correlated Delay Shift (CCDS) supervised learning rule to train neurons with associated spatiotemporal patterns to classify spike patterns. The objective of this study was to evaluate the feasibility of using the CCDS rule to automate the detection of interictal spikes in electroencephalogram (EEG) data on patients with epilepsy. Encoding is the initial yet essential step for spiking neurons to process EEG patterns. A new encoding method is utilized to convert the EEG signal into spike patterns. The simulation results show that the proposed algorithm identified 69 spikes out of 82 spikes, or 84% detection rate, which is quite high considering the subtleties of interictal spikes and the tediousness of monitoring long EEG records. This CCDS rule is also benchmarked by ReSuMe on the same task.

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

Science.gov (United States)

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

Science.gov (United States)

Thao, Cao Phuong; Tien, Le Thi Thuy

2017-09-01

β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

Science.gov (United States)

Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

1989-05-01

A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

Science.gov (United States)

Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

2015-01-01

Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

Science.gov (United States)

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

Directory of Open Access Journals (Sweden)

A. Korpi

2003-01-01

Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

Directory of Open Access Journals (Sweden)

Fengdan Jin

2014-01-01

Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

Combined effects of added beta glucan and black tea in breads on starch functionality.

Science.gov (United States)

Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

2015-03-01

Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

Spike rate and spike timing contributions to coding taste quality information in rat periphery

Directory of Open Access Journals (Sweden)

Vernon eLawhern

2011-05-01

Full Text Available There is emerging evidence that individual sensory neurons in the rodent brain rely on temporal features of the discharge pattern to code differences in taste quality information. In contrast, in-vestigations of individual sensory neurons in the periphery have focused on analysis of spike rate and mostly disregarded spike timing as a taste quality coding mechanism. The purpose of this work was to determine the contribution of spike timing to taste quality coding by rat geniculate ganglion neurons using computational methods that have been applied successfully in other sys-tems. We recorded the discharge patterns of narrowly-tuned and broadly-tuned neurons in the rat geniculate ganglion to representatives of the five basic taste qualities. We used mutual in-formation to determine significant responses and the van Rossum metric to characterize their temporal features. While our findings show that spike timing contributes a significant part of the message, spike rate contributes the largest portion of the message relayed by afferent neurons from rat fungiform taste buds to the brain. Thus, spike rate and spike timing together are more effective than spike rate alone in coding stimulus quality information to a single basic taste in the periphery for both narrowly-tuned specialist and broadly-tuned generalist neurons.

Impact of spike train autostructure on probability distribution of joint spike events.

Science.gov (United States)

Pipa, Gordon; Grün, Sonja; van Vreeswijk, Carl

2013-05-01

The discussion whether temporally coordinated spiking activity really exists and whether it is relevant has been heated over the past few years. To investigate this issue, several approaches have been taken to determine whether synchronized events occur significantly above chance, that is, whether they occur more often than expected if the neurons fire independently. Most investigations ignore or destroy the autostructure of the spiking activity of individual cells or assume Poissonian spiking as a model. Such methods that ignore the autostructure can significantly bias the coincidence statistics. Here, we study the influence of the autostructure on the probability distribution of coincident spiking events between tuples of mutually independent non-Poisson renewal processes. In particular, we consider two types of renewal processes that were suggested as appropriate models of experimental spike trains: a gamma and a log-normal process. For a gamma process, we characterize the shape of the distribution analytically with the Fano factor (FFc). In addition, we perform Monte Carlo estimations to derive the full shape of the distribution and the probability for false positives if a different process type is assumed as was actually present. We also determine how manipulations of such spike trains, here dithering, used for the generation of surrogate data change the distribution of coincident events and influence the significance estimation. We find, first, that the width of the coincidence count distribution and its FFc depend critically and in a nontrivial way on the detailed properties of the structure of the spike trains as characterized by the coefficient of variation CV. Second, the dependence of the FFc on the CV is complex and mostly nonmonotonic. Third, spike dithering, even if as small as a fraction of the interspike interval, can falsify the inference on coordinated firing.

Binding Interactions Between alpha-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

NARCIS (Netherlands)

Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.

Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the

Nicotine-Mediated ADP to Spike Transition: Double Spiking in Septal Neurons.

Science.gov (United States)

Kodirov, Sodikdjon A; Wehrmeister, Michael; Colom, Luis

2016-04-01

The majority of neurons in lateral septum (LS) are electrically silent at resting membrane potential. Nicotine transiently excites a subset of neurons and occasionally leads to long lasting bursting activity upon longer applications. We have observed simultaneous changes in frequencies and amplitudes of spontaneous action potentials (AP) in the presence of nicotine. During the prolonged exposure, nicotine increased numbers of spikes within a burst. One of the hallmarks of nicotine effects was the occurrences of double spikes (known also as bursting). Alignment of 51 spontaneous spikes, triggered upon continuous application of nicotine, revealed that the slope of after-depolarizing potential gradually increased (1.4 vs. 3 mV/ms) and neuron fired the second AP, termed as double spiking. A transition from a single AP to double spikes increased the amplitude of after-hyperpolarizing potential. The amplitude of the second (premature) AP was smaller compared to the first one, and this correlation persisted in regard to their duration (half-width). A similar bursting activity in the presence of nicotine, to our knowledge, has not been reported previously in the septal structure in general and in LS in particular.

Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

Directory of Open Access Journals (Sweden)

Daniela Fiocco

2012-05-01

Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

NARCIS (Netherlands)

Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

2010-01-01

Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

DEFF Research Database (Denmark)

Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

2012-01-01

Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

Directory of Open Access Journals (Sweden)

Reshma Davidson

Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

Science.gov (United States)

Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

2014-04-01

Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

Exposure assessment in Beijing, China: biological agents, ultrafine particles, and lead.

Science.gov (United States)

Dong, Shuofei; Yao, Maosheng

2010-11-01

In this study, air samples were taken using a BioSampler and gelatin filters from six sites in Beijing: office, hospital, student dormitory, train station, subway, and a commercial street. Dust samples were also collected using a surface sampler from the same environments. Limulus amoebocyte lysate (LAL) and Glucatell assays were used to quantify sample endotoxin and (1,3)-β-d-glucan concentration levels, respectively. Enzyme-linked immunosorbent assay (ELISA) was used to measure the dust mite allergens (Der p 1 and Der f 1). Ultrafine particle and lead concentrations in these sampling sites were also measured using P-Trak and atomic absorption spectrometer, respectively. Analysis of variance (ANOVA) and linear regression analysis were used to analyze the concentration data. Higher culturable bacteria (12,639 CFU/m3) and fungi (1,806 CFU/m3) concentrations were observed for the train station and the subway system, respectively. For the rest of sampling sites, their concentrations were comparable to those found in western countries, ranging from 990 to 2,276 CFU/m3 for bacteria, and from 119 to 269 CFU/m3 for fungi. ANOVA analysis indicated that there were statistically significant differences between the culturable bacterial and fungal concentration levels obtained for different sites (p value=0.0001 and 0.0047). As for dust allergens, endotoxin, and (1,3)-β-D-glucan, their concentrations also seemed to be comparable to those found in the developed countries. Airborne allergen concentrations ranged from 16 to 68 ng/m3. The dust-borne allergen concentration was observed to range from 0.063 to 0.327 ng/mg. As for endotoxin, the highest airborne concentration of 25.24 ng/m3 was observed for the commercial street, and others ranged from 0.0427 to 0.1259 ng/m3. And dust-borne endotoxin concentration ranged from 58.83 to 6,427.4 ng/mg. For (1,3)-β-D-glucan, the airborne concentration ranged from 0.02 to 1.2 ng/m3. Linear regression analyses showed that there existed

Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

Science.gov (United States)

Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

2016-01-01

An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

Science.gov (United States)

Shiota, E; Maekawa, M; Kono, T

2001-12-01

Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

DEFF Research Database (Denmark)

Madsen, A. M.; Tendal, K.; Thilsing, T.

2013-01-01

occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

Science.gov (United States)

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

Science.gov (United States)

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

Detection of bursts in neuronal spike trains by the mean inter-spike interval method

Institute of Scientific and Technical Information of China (English)

Lin Chen; Yong Deng; Weihua Luo; Zhen Wang; Shaoqun Zeng

2009-01-01

Bursts are electrical spikes firing with a high frequency, which are the most important property in synaptic plasticity and information processing in the central nervous system. However, bursts are difficult to identify because bursting activities or patterns vary with phys-iological conditions or external stimuli. In this paper, a simple method automatically to detect bursts in spike trains is described. This method auto-adaptively sets a parameter (mean inter-spike interval) according to intrinsic properties of the detected burst spike trains, without any arbitrary choices or any operator judgrnent. When the mean value of several successive inter-spike intervals is not larger than the parameter, a burst is identified. By this method, bursts can be automatically extracted from different bursting patterns of cultured neurons on multi-electrode arrays, as accurately as by visual inspection. Furthermore, significant changes of burst variables caused by electrical stimulus have been found in spontaneous activity of neuronal network. These suggest that the mean inter-spike interval method is robust for detecting changes in burst patterns and characteristics induced by environmental alterations.

Probing interactions between B-glucan and bile salts at atomic detail by ¹H-¹³C NMR assays

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

2014-01-01

Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

DEFF Research Database (Denmark)

Jiménez, Natalia Ivonne Vera

by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

Information transmission with spiking Bayesian neurons

International Nuclear Information System (INIS)

Lochmann, Timm; Deneve, Sophie

2008-01-01

Spike trains of cortical neurons resulting from repeatedpresentations of a stimulus are variable and exhibit Poisson-like statistics. Many models of neural coding therefore assumed that sensory information is contained in instantaneous firing rates, not spike times. Here, we ask how much information about time-varying stimuli can be transmitted by spiking neurons with such input and output variability. In particular, does this variability imply spike generation to be intrinsically stochastic? We consider a model neuron that estimates optimally the current state of a time-varying binary variable (e.g. presence of a stimulus) by integrating incoming spikes. The unit signals its current estimate to other units with spikes whenever the estimate increased by a fixed amount. As shown previously, this computation results in integrate and fire dynamics with Poisson-like output spike trains. This output variability is entirely due to the stochastic input rather than noisy spike generation. As a result such a deterministic neuron can transmit most of the information about the time varying stimulus. This contrasts with a standard model of sensory neurons, the linear-nonlinear Poisson (LNP) model which assumes that most variability in output spike trains is due to stochastic spike generation. Although it yields the same firing statistics, we found that such noisy firing results in the loss of most information. Finally, we use this framework to compare potential effects of top-down attention versus bottom-up saliency on information transfer with spiking neurons

Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

Science.gov (United States)

Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

2017-03-07

The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

Effects of dietary yeastβ-glucan on nutrient digestibility and serum proifles in pre-ruminant Holstein calves

Institute of Scientific and Technical Information of China (English)

MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu

2015-01-01

This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.

Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

Science.gov (United States)

Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

2012-09-04

Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

Towards a more versatile alpha-glucan biosynthesis in plants

NARCIS (Netherlands)

Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.

2003-01-01

Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated

Barbed micro-spikes for micro-scale biopsy

Science.gov (United States)

Byun, Sangwon; Lim, Jung-Min; Paik, Seung-Joon; Lee, Ahra; Koo, Kyo-in; Park, Sunkil; Park, Jaehong; Choi, Byoung-Doo; Seo, Jong Mo; Kim, Kyung-ah; Chung, Hum; Song, Si Young; Jeon, Doyoung; Cho, Dongil

2005-06-01

Single-crystal silicon planar micro-spikes with protruding barbs are developed for micro-scale biopsy and the feasibility of using the micro-spike as a micro-scale biopsy tool is evaluated for the first time. The fabrication process utilizes a deep silicon etch to define the micro-spike outline, resulting in protruding barbs of various shapes. Shanks of the fabricated micro-spikes are 3 mm long, 100 µm thick and 250 µm wide. Barbs protruding from micro-spike shanks facilitate the biopsy procedure by tearing off and retaining samples from target tissues. Micro-spikes with barbs successfully extracted tissue samples from the small intestines of the anesthetized pig, whereas micro-spikes without barbs failed to obtain a biopsy sample. Parylene coating can be applied to improve the biocompatibility of the micro-spike without deteriorating the biopsy function of the micro-spike. In addition, to show that the biopsy with the micro-spike can be applied to tissue analysis, samples obtained by micro-spikes were examined using immunofluorescent staining. Nuclei and F-actin of cells which are extracted by the micro-spike from a transwell were clearly visualized by immunofluorescent staining.

(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

Science.gov (United States)

Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

2017-03-01

A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

Reactions of healthy persons and persons suffering from allergic rhinitis when exposed to office dust

DEFF Research Database (Denmark)

Hauschildt, Pernille; Mølhave, Lars; Kjærgaard, Søren K.

1999-01-01

significance appeared. This problem was dealt with using the Bonferroni correction for multiple significance tests. Results The mean ratings of the potentiometer were higher (the subjects showed more irritation) during the dust exposure. The objective investigations showed only indications of effects of dust...

Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

Directory of Open Access Journals (Sweden)

A.C.C.F.F. De Paula

2005-06-01

Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

Science.gov (United States)

Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

2018-07-15

A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

NARCIS (Netherlands)

Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

2010-01-01

An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

Bayesian population decoding of spiking neurons.

Science.gov (United States)

Gerwinn, Sebastian; Macke, Jakob; Bethge, Matthias

2009-01-01

The timing of action potentials in spiking neurons depends on the temporal dynamics of their inputs and contains information about temporal fluctuations in the stimulus. Leaky integrate-and-fire neurons constitute a popular class of encoding models, in which spike times depend directly on the temporal structure of the inputs. However, optimal decoding rules for these models have only been studied explicitly in the noiseless case. Here, we study decoding rules for probabilistic inference of a continuous stimulus from the spike times of a population of leaky integrate-and-fire neurons with threshold noise. We derive three algorithms for approximating the posterior distribution over stimuli as a function of the observed spike trains. In addition to a reconstruction of the stimulus we thus obtain an estimate of the uncertainty as well. Furthermore, we derive a 'spike-by-spike' online decoding scheme that recursively updates the posterior with the arrival of each new spike. We use these decoding rules to reconstruct time-varying stimuli represented by a Gaussian process from spike trains of single neurons as well as neural populations.

Bayesian population decoding of spiking neurons

Directory of Open Access Journals (Sweden)

Sebastian Gerwinn

2009-10-01

Full Text Available The timing of action potentials in spiking neurons depends on the temporal dynamics of their inputs and contains information about temporal fluctuations in the stimulus. Leaky integrate-and-fire neurons constitute a popular class of encoding models, in which spike times depend directly on the temporal structure of the inputs. However, optimal decoding rules for these models have only been studied explicitly in the noiseless case. Here, we study decoding rules for probabilistic inference of a continuous stimulus from the spike times of a population of leaky integrate-and-fire neurons with threshold noise. We derive three algorithms for approximating the posterior distribution over stimuli as a function of the observed spike trains. In addition to a reconstruction of the stimulus we thus obtain an estimate of the uncertainty as well. Furthermore, we derive a `spike-by-spike' online decoding scheme that recursively updates the posterior with the arrival of each new spike. We use these decoding rules to reconstruct time-varying stimuli represented by a Gaussian process from spike trains of single neurons as well as neural populations.

Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

International Nuclear Information System (INIS)

Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

2012-01-01

Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

Heterogeneity of Purkinje cell simple spike-complex spike interactions: zebrin- and non-zebrin-related variations.

Science.gov (United States)

Tang, Tianyu; Xiao, Jianqiang; Suh, Colleen Y; Burroughs, Amelia; Cerminara, Nadia L; Jia, Linjia; Marshall, Sarah P; Wise, Andrew K; Apps, Richard; Sugihara, Izumi; Lang, Eric J

2017-08-01

Cerebellar Purkinje cells (PCs) generate two types of action potentials, simple and complex spikes. Although they are generated by distinct mechanisms, interactions between the two spike types exist. Zebrin staining produces alternating positive and negative stripes of PCs across most of the cerebellar cortex. Thus, here we compared simple spike-complex spike interactions both within and across zebrin populations. Simple spike activity undergoes a complex modulation preceding and following a complex spike. The amplitudes of the pre- and post-complex spike modulation phases were correlated across PCs. On average, the modulation was larger for PCs in zebrin positive regions. Correlations between aspects of the complex spike waveform and simple spike activity were found, some of which varied between zebrin positive and negative PCs. The implications of the results are discussed with regard to hypotheses that complex spikes are triggered by rises in simple spike activity for either motor learning or homeostatic functions. Purkinje cells (PCs) generate two types of action potentials, called simple and complex spikes (SSs and CSs). We first investigated the CS-associated modulation of SS activity and its relationship to the zebrin status of the PC. The modulation pattern consisted of a pre-CS rise in SS activity, and then, following the CS, a pause, a rebound, and finally a late inhibition of SS activity for both zebrin positive (Z+) and negative (Z-) cells, though the amplitudes of the phases were larger in Z+ cells. Moreover, the amplitudes of the pre-CS rise with the late inhibitory phase of the modulation were correlated across PCs. In contrast, correlations between modulation phases across CSs of individual PCs were generally weak. Next, the relationship between CS spikelets and SS activity was investigated. The number of spikelets/CS correlated with the average SS firing rate only for Z+ cells. In contrast, correlations across CSs between spikelet numbers and the

Improved SpikeProp for Using Particle Swarm Optimization

Directory of Open Access Journals (Sweden)

Falah Y. H. Ahmed

2013-01-01

Full Text Available A spiking neurons network encodes information in the timing of individual spike times. A novel supervised learning rule for SpikeProp is derived to overcome the discontinuities introduced by the spiking thresholding. This algorithm is based on an error-backpropagation learning rule suited for supervised learning of spiking neurons that use exact spike time coding. The SpikeProp is able to demonstrate the spiking neurons that can perform complex nonlinear classification in fast temporal coding. This study proposes enhancements of SpikeProp learning algorithm for supervised training of spiking networks which can deal with complex patterns. The proposed methods include the SpikeProp particle swarm optimization (PSO and angle driven dependency learning rate. These methods are presented to SpikeProp network for multilayer learning enhancement and weights optimization. Input and output patterns are encoded as spike trains of precisely timed spikes, and the network learns to transform the input trains into target output trains. With these enhancements, our proposed methods outperformed other conventional neural network architectures.

Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

Science.gov (United States)

Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

2018-05-01

Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

Directory of Open Access Journals (Sweden)

Gordon D Ross

2007-06-01

Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

NARCIS (Netherlands)

van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

Trace metal analysis of road dust by inductively coupled plasma mass spectrometry

International Nuclear Information System (INIS)

Powell, M.J.; Liu, L.; Gnanalingham, N.; Peters, L.

2000-01-01

Dust from roads in an air impingement zone close to anthropogenic sources of air pollutants can be a concern for people living in the immediate vicinity. The Ministry of the Environment (MOE) has conducted a case study to monitor the concentration of uranium, strontium, thorium and arsenic in road dust from one such area. A method for the analysis of road dust by inductively coupled plasma mass spectrometry (ICP-MS) has been developed with detection limits in the ng/1 range. A digestion technique has been developed by conducting experiments using single and combinations of acids in open-vessel wet digestions. Accuracy has been determined by the use of matrix representative certified reference materials (CRMs). Digestion precision was determined by elemental concentration measurements of the most representative CRM through replicates. Spike recovery data were from 95% to 110% for all elements, and inter-method comparison studies between hydride generation atomic absorption spectrometry (AAS) inductively coupled plasma atomic emission spectrometry (ICP-AES) and ICP-MS for arsenic and strontium show good agreement. (author)

Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

Science.gov (United States)

Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

2012-04-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

Precise-spike-driven synaptic plasticity: learning hetero-association of spatiotemporal spike patterns.

Directory of Open Access Journals (Sweden)

Qiang Yu

Full Text Available A new learning rule (Precise-Spike-Driven (PSD Synaptic Plasticity is proposed for processing and memorizing spatiotemporal patterns. PSD is a supervised learning rule that is analytically derived from the traditional Widrow-Hoff rule and can be used to train neurons to associate an input spatiotemporal spike pattern with a desired spike train. Synaptic adaptation is driven by the error between the desired and the actual output spikes, with positive errors causing long-term potentiation and negative errors causing long-term depression. The amount of modification is proportional to an eligibility trace that is triggered by afferent spikes. The PSD rule is both computationally efficient and biologically plausible. The properties of this learning rule are investigated extensively through experimental simulations, including its learning performance, its generality to different neuron models, its robustness against noisy conditions, its memory capacity, and the effects of its learning parameters. Experimental results show that the PSD rule is capable of spatiotemporal pattern classification, and can even outperform a well studied benchmark algorithm with the proposed relative confidence criterion. The PSD rule is further validated on a practical example of an optical character recognition problem. The results again show that it can achieve a good recognition performance with a proper encoding. Finally, a detailed discussion is provided about the PSD rule and several related algorithms including tempotron, SPAN, Chronotron and ReSuMe.

Precise-spike-driven synaptic plasticity: learning hetero-association of spatiotemporal spike patterns.

Science.gov (United States)

Yu, Qiang; Tang, Huajin; Tan, Kay Chen; Li, Haizhou

2013-01-01

A new learning rule (Precise-Spike-Driven (PSD) Synaptic Plasticity) is proposed for processing and memorizing spatiotemporal patterns. PSD is a supervised learning rule that is analytically derived from the traditional Widrow-Hoff rule and can be used to train neurons to associate an input spatiotemporal spike pattern with a desired spike train. Synaptic adaptation is driven by the error between the desired and the actual output spikes, with positive errors causing long-term potentiation and negative errors causing long-term depression. The amount of modification is proportional to an eligibility trace that is triggered by afferent spikes. The PSD rule is both computationally efficient and biologically plausible. The properties of this learning rule are investigated extensively through experimental simulations, including its learning performance, its generality to different neuron models, its robustness against noisy conditions, its memory capacity, and the effects of its learning parameters. Experimental results show that the PSD rule is capable of spatiotemporal pattern classification, and can even outperform a well studied benchmark algorithm with the proposed relative confidence criterion. The PSD rule is further validated on a practical example of an optical character recognition problem. The results again show that it can achieve a good recognition performance with a proper encoding. Finally, a detailed discussion is provided about the PSD rule and several related algorithms including tempotron, SPAN, Chronotron and ReSuMe.

Effects of Spike Anticipation on the Spiking Dynamics of Neural Networks

Directory of Open Access Journals (Sweden)

Daniel ede Santos-Sierra

2015-11-01

Full Text Available Synchronization is one of the central phenomena involved in information processing in living systems. It is known that the nervous system requires the coordinated activity of both local and distant neural populations. Such an interplay allows to merge different information modalities in a whole processing supporting high-level mental skills as understanding, memory, abstraction, etc. Though the biological processes underlying synchronization in the brain are not fully understood there have been reported a variety of mechanisms supporting different types of synchronization both at theoretical and experimental level. One of the more intriguing of these phenomena is the anticipating synchronization, which has been recently reported in a pair of unidirectionally coupled artificial neurons under simple conditions cite{Pyragas}, where the slave neuron is able to anticipate in time the behaviour of the master one. In this paper we explore the effect of spike anticipation over the information processing performed by a neural network at functional and structural level. We show that the introduction of intermediary neurons in the network enhances spike anticipation and analyse how these variations in spike anticipation can significantly change the firing regime of the neural network according to its functional and structural properties. In addition we show that the interspike interval (ISI, one of the main features of the neural response associated to the information coding, can be closely related to spike anticipation by each spike, and how synaptic plasticity can be modulated through that relationship. This study has been performed through numerical simulation of a coupled system of Hindmarsh-Rose neurons.

Effects of Spike Anticipation on the Spiking Dynamics of Neural Networks.

Science.gov (United States)

de Santos-Sierra, Daniel; Sanchez-Jimenez, Abel; Garcia-Vellisca, Mariano A; Navas, Adrian; Villacorta-Atienza, Jose A

2015-01-01

Synchronization is one of the central phenomena involved in information processing in living systems. It is known that the nervous system requires the coordinated activity of both local and distant neural populations. Such an interplay allows to merge different information modalities in a whole processing supporting high-level mental skills as understanding, memory, abstraction, etc. Though, the biological processes underlying synchronization in the brain are not fully understood there have been reported a variety of mechanisms supporting different types of synchronization both at theoretical and experimental level. One of the more intriguing of these phenomena is the anticipating synchronization, which has been recently reported in a pair of unidirectionally coupled artificial neurons under simple conditions (Pyragiene and Pyragas, 2013), where the slave neuron is able to anticipate in time the behavior of the master one. In this paper, we explore the effect of spike anticipation over the information processing performed by a neural network at functional and structural level. We show that the introduction of intermediary neurons in the network enhances spike anticipation and analyse how these variations in spike anticipation can significantly change the firing regime of the neural network according to its functional and structural properties. In addition we show that the interspike interval (ISI), one of the main features of the neural response associated with the information coding, can be closely related to spike anticipation by each spike, and how synaptic plasticity can be modulated through that relationship. This study has been performed through numerical simulation of a coupled system of Hindmarsh-Rose neurons.

(dust, PM10 , and BC) using CHIMERE chemistry tra

Indian Academy of Sciences (India)

The objective of this study is to evaluate the ability of a European chemistry transport model,. 'CHIMERE' driven by ..... tive days in May 2008 (12–16 May) to simulate the dust storm ...... Regional Office for Europe, Copenhagen. Zender C, Bian ...

Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

Science.gov (United States)

Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

2015-08-01

A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

Coronavirus spike-receptor interactions

NARCIS (Netherlands)

Mou, H.

2015-01-01

Coronaviruses cause important diseases in humans and animals. Coronavirus infection starts with the virus binding with its spike proteins to molecules present on the surface of host cells that act as receptors. This spike-receptor interaction is highly specific and determines the virus’ cell, tissue

Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

DEFF Research Database (Denmark)

Knudsen, Knud Erik Bach

The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

Science.gov (United States)

Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

2011-03-01

This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

Science.gov (United States)

Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

2015-04-01

Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Comparison of Air Impaction and Electrostatic Dust Collector Sampling Methods to Assess Airborne Fungal Contamination in Public Buildings.

Science.gov (United States)

Normand, Anne-Cécile; Ranque, Stéphane; Cassagne, Carole; Gaudart, Jean; Sallah, Kankoé; Charpin, Denis-André; Piarroux, Renaud

2016-03-01

Many ailments can be linked to exposure to indoor airborne fungus. However, obtaining a precise measurement of airborne fungal levels is complicated partly due to indoor air fluctuations and non-standardized techniques. Electrostatic dust collector (EDC) sampling devices have been used to measure a wide range of airborne analytes, including endotoxins, allergens, β-glucans, and microbial DNA in various indoor environments. In contrast, viable mold contamination has only been assessed in highly contaminated environments such as farms and archive buildings. This study aimed to assess the use of EDCs, compared with repeated air-impactor measurements, to assess airborne viable fungal flora in moderately contaminated indoor environments. Indoor airborne fungal flora was cultured from EDCs and daily air-impaction samples collected in an office building and a daycare center. The quantitative fungal measurements obtained using a single EDC significantly correlated with the cumulative measurement of nine daily air impactions. Both methods enabled the assessment of fungal exposure, although a few differences were observed between the detected fungal species and the relative quantity of each species. EDCs were also used over a 32-month period to monitor indoor airborne fungal flora in a hospital office building, which enabled us to assess the impact of outdoor events (e.g. ground excavations) on the fungal flora levels on the indoor environment. In conclusion, EDC-based measurements provided a relatively accurate profile of the viable airborne flora present during a sampling period. In particular, EDCs provided a more representative assessment of fungal levels compared with single air-impactor sampling. The EDC technique is also simpler than performing repetitive air-impaction measures over the course of several consecutive days. EDC is a versatile tool for collecting airborne samples and was efficient for measuring mold levels in indoor environments. © The Author 2015

Spike-based population coding and working memory.

Directory of Open Access Journals (Sweden)

Martin Boerlin

2011-02-01

Full Text Available Compelling behavioral evidence suggests that humans can make optimal decisions despite the uncertainty inherent in perceptual or motor tasks. A key question in neuroscience is how populations of spiking neurons can implement such probabilistic computations. In this article, we develop a comprehensive framework for optimal, spike-based sensory integration and working memory in a dynamic environment. We propose that probability distributions are inferred spike-per-spike in recurrently connected networks of integrate-and-fire neurons. As a result, these networks can combine sensory cues optimally, track the state of a time-varying stimulus and memorize accumulated evidence over periods much longer than the time constant of single neurons. Importantly, we propose that population responses and persistent working memory states represent entire probability distributions and not only single stimulus values. These memories are reflected by sustained, asynchronous patterns of activity which make relevant information available to downstream neurons within their short time window of integration. Model neurons act as predictive encoders, only firing spikes which account for new information that has not yet been signaled. Thus, spike times signal deterministically a prediction error, contrary to rate codes in which spike times are considered to be random samples of an underlying firing rate. As a consequence of this coding scheme, a multitude of spike patterns can reliably encode the same information. This results in weakly correlated, Poisson-like spike trains that are sensitive to initial conditions but robust to even high levels of external neural noise. This spike train variability reproduces the one observed in cortical sensory spike trains, but cannot be equated to noise. On the contrary, it is a consequence of optimal spike-based inference. In contrast, we show that rate-based models perform poorly when implemented with stochastically spiking neurons.

Consensus-Based Sorting of Neuronal Spike Waveforms.

Science.gov (United States)

Fournier, Julien; Mueller, Christian M; Shein-Idelson, Mark; Hemberger, Mike; Laurent, Gilles

2016-01-01

Optimizing spike-sorting algorithms is difficult because sorted clusters can rarely be checked against independently obtained "ground truth" data. In most spike-sorting algorithms in use today, the optimality of a clustering solution is assessed relative to some assumption on the distribution of the spike shapes associated with a particular single unit (e.g., Gaussianity) and by visual inspection of the clustering solution followed by manual validation. When the spatiotemporal waveforms of spikes from different cells overlap, the decision as to whether two spikes should be assigned to the same source can be quite subjective, if it is not based on reliable quantitative measures. We propose a new approach, whereby spike clusters are identified from the most consensual partition across an ensemble of clustering solutions. Using the variability of the clustering solutions across successive iterations of the same clustering algorithm (template matching based on K-means clusters), we estimate the probability of spikes being clustered together and identify groups of spikes that are not statistically distinguishable from one another. Thus, we identify spikes that are most likely to be clustered together and therefore correspond to consistent spike clusters. This method has the potential advantage that it does not rely on any model of the spike shapes. It also provides estimates of the proportion of misclassified spikes for each of the identified clusters. We tested our algorithm on several datasets for which there exists a ground truth (simultaneous intracellular data), and show that it performs close to the optimum reached by a support vector machine trained on the ground truth. We also show that the estimated rate of misclassification matches the proportion of misclassified spikes measured from the ground truth data.

Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

Science.gov (United States)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-20

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

Science.gov (United States)

Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

2017-03-01

Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

Directory of Open Access Journals (Sweden)

Hirokazu Tokuyasu

2010-09-01

Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

Science.gov (United States)

Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

2008-06-01

Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

Directory of Open Access Journals (Sweden)

Harry J. Wichers

2010-08-01

Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2013-01-01

Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

Visually Evoked Spiking Evolves While Spontaneous Ongoing Dynamics Persist

Science.gov (United States)

Huys, Raoul; Jirsa, Viktor K.; Darokhan, Ziauddin; Valentiniene, Sonata; Roland, Per E.

2016-01-01

Neurons in the primary visual cortex spontaneously spike even when there are no visual stimuli. It is unknown whether the spiking evoked by visual stimuli is just a modification of the spontaneous ongoing cortical spiking dynamics or whether the spontaneous spiking state disappears and is replaced by evoked spiking. This study of laminar recordings of spontaneous spiking and visually evoked spiking of neurons in the ferret primary visual cortex shows that the spiking dynamics does not change: the spontaneous spiking as well as evoked spiking is controlled by a stable and persisting fixed point attractor. Its existence guarantees that evoked spiking return to the spontaneous state. However, the spontaneous ongoing spiking state and the visual evoked spiking states are qualitatively different and are separated by a threshold (separatrix). The functional advantage of this organization is that it avoids the need for a system reorganization following visual stimulation, and impedes the transition of spontaneous spiking to evoked spiking and the propagation of spontaneous spiking from layer 4 to layers 2–3. PMID:26778982

β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

Science.gov (United States)

Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

2017-11-01

The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Spike voltage topography in temporal lobe epilepsy.

Science.gov (United States)

Asadi-Pooya, Ali A; Asadollahi, Marjan; Shimamoto, Shoichi; Lorenzo, Matthew; Sperling, Michael R

2016-07-15

We investigated the voltage topography of interictal spikes in patients with temporal lobe epilepsy (TLE) to see whether topography was related to etiology for TLE. Adults with TLE, who had epilepsy surgery for drug-resistant seizures from 2011 until 2014 at Jefferson Comprehensive Epilepsy Center were selected. Two groups of patients were studied: patients with mesial temporal sclerosis (MTS) on MRI and those with other MRI findings. The voltage topography maps of the interictal spikes at the peak were created using BESA software. We classified the interictal spikes as polar, basal, lateral, or others. Thirty-four patients were studied, from which the characteristics of 340 spikes were investigated. The most common type of spike orientation was others (186 spikes; 54.7%), followed by lateral (146; 42.9%), polar (5; 1.5%), and basal (3; 0.9%). Characteristics of the voltage topography maps of the spikes between the two groups of patients were somewhat different. Five spikes in patients with MTS had polar orientation, but none of the spikes in patients with other MRI findings had polar orientation (odds ratio=6.98, 95% confidence interval=0.38 to 127.38; p=0.07). Scalp topographic mapping of interictal spikes has the potential to offer different information than visual inspection alone. The present results do not allow an immediate clinical application of our findings; however, detecting a polar spike in a patient with TLE may increase the possibility of mesial temporal sclerosis as the underlying etiology. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of UDPG-binding polypeptides and purified (1,3)-β-glucan synthase by photoaffinity labelling with 5-azido-UDPG

International Nuclear Information System (INIS)

Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.

1989-01-01

The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex

[Hygienic assessment of a recirculatory combined air-conditioning extract-and-input system in office building].

Science.gov (United States)

Malysheva, A G; Abramov, E G

2006-01-01

The high concentrations of lead were reveled in the air and dust of some premises and on the filters of a combined air-conditioning extract-and-input system in the high-rise office buildings located in the ecologically lead favorable environment. The dust content of lead in some premises on the first floors dust was as high as 200 mg/kg, which was more than 6 times higher than that in the soil at the highway near the office buildings. The use of new technologies and devices for cleaning and optimizing the air in the premises requires analytical studies to assess the quality of the environment, by taking into account the optimal conditions of their operation.

Extraction and chemical characterization of rye arabinoxylan and the effect of β-glucan on the mechanical and barrier properties of cast arabinoxylan films

DEFF Research Database (Denmark)

Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena

2013-01-01

.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...

Multineuronal Spike Sequences Repeat with Millisecond Precision

Directory of Open Access Journals (Sweden)

Koki eMatsumoto

2013-06-01

Full Text Available Cortical microcircuits are nonrandomly wired by neurons. As a natural consequence, spikes emitted by microcircuits are also nonrandomly patterned in time and space. One of the prominent spike organizations is a repetition of fixed patterns of spike series across multiple neurons. However, several questions remain unsolved, including how precisely spike sequences repeat, how the sequences are spatially organized, how many neurons participate in sequences, and how different sequences are functionally linked. To address these questions, we monitored spontaneous spikes of hippocampal CA3 neurons ex vivo using a high-speed functional multineuron calcium imaging technique that allowed us to monitor spikes with millisecond resolution and to record the location of spiking and nonspiking neurons. Multineuronal spike sequences were overrepresented in spontaneous activity compared to the statistical chance level. Approximately 75% of neurons participated in at least one sequence during our observation period. The participants were sparsely dispersed and did not show specific spatial organization. The number of sequences relative to the chance level decreased when larger time frames were used to detect sequences. Thus, sequences were precise at the millisecond level. Sequences often shared common spikes with other sequences; parts of sequences were subsequently relayed by following sequences, generating complex chains of multiple sequences.

Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

DEFF Research Database (Denmark)

Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

2005-01-01

Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

2014-08-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

Science.gov (United States)

Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

2017-12-05

Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Optimization and scale-up of fermentation of glucansucrase and branched glucan by Pediococcus pentosaceus CRAG3 using Taguchi methodology in bioreactor

Directory of Open Access Journals (Sweden)

RISHIKESH SHUKLA

2012-01-01

Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.

Spiking Neural P Systems with Communication on Request.

Science.gov (United States)

Pan, Linqiang; Păun, Gheorghe; Zhang, Gexiang; Neri, Ferrante

2017-12-01

Spiking Neural [Formula: see text] Systems are Neural System models characterized by the fact that each neuron mimics a biological cell and the communication between neurons is based on spikes. In the Spiking Neural [Formula: see text] systems investigated so far, the application of evolution rules depends on the contents of a neuron (checked by means of a regular expression). In these [Formula: see text] systems, a specified number of spikes are consumed and a specified number of spikes are produced, and then sent to each of the neurons linked by a synapse to the evolving neuron. [Formula: see text]In the present work, a novel communication strategy among neurons of Spiking Neural [Formula: see text] Systems is proposed. In the resulting models, called Spiking Neural [Formula: see text] Systems with Communication on Request, the spikes are requested from neighboring neurons, depending on the contents of the neuron (still checked by means of a regular expression). Unlike the traditional Spiking Neural [Formula: see text] systems, no spikes are consumed or created: the spikes are only moved along synapses and replicated (when two or more neurons request the contents of the same neuron). [Formula: see text]The Spiking Neural [Formula: see text] Systems with Communication on Request are proved to be computationally universal, that is, equivalent with Turing machines as long as two types of spikes are used. Following this work, further research questions are listed to be open problems.

Self-control with spiking and non-spiking neural networks playing games.

Science.gov (United States)

Christodoulou, Chris; Banfield, Gaye; Cleanthous, Aristodemos

2010-01-01

Self-control can be defined as choosing a large delayed reward over a small immediate reward, while precommitment is the making of a choice with the specific aim of denying oneself future choices. Humans recognise that they have self-control problems and attempt to overcome them by applying precommitment. Problems in exercising self-control, suggest a conflict between cognition and motivation, which has been linked to competition between higher and lower brain functions (representing the frontal lobes and the limbic system respectively). This premise of an internal process conflict, lead to a behavioural model being proposed, based on which, we implemented a computational model for studying and explaining self-control through precommitment behaviour. Our model consists of two neural networks, initially non-spiking and then spiking ones, representing the higher and lower brain systems viewed as cooperating for the benefit of the organism. The non-spiking neural networks are of simple feed forward multilayer type with reinforcement learning, one with selective bootstrap weight update rule, which is seen as myopic, representing the lower brain and the other with the temporal difference weight update rule, which is seen as far-sighted, representing the higher brain. The spiking neural networks are implemented with leaky integrate-and-fire neurons with learning based on stochastic synaptic transmission. The differentiating element between the two brain centres in this implementation is based on the memory of past actions determined by an eligibility trace time constant. As the structure of the self-control problem can be likened to the Iterated Prisoner's Dilemma (IPD) game in that cooperation is to defection what self-control is to impulsiveness or what compromising is to insisting, we implemented the neural networks as two players, learning simultaneously but independently, competing in the IPD game. With a technique resembling the precommitment effect, whereby the

Memristors Empower Spiking Neurons With Stochasticity

KAUST Repository

Al-Shedivat, Maruan

2015-06-01

Recent theoretical studies have shown that probabilistic spiking can be interpreted as learning and inference in cortical microcircuits. This interpretation creates new opportunities for building neuromorphic systems driven by probabilistic learning algorithms. However, such systems must have two crucial features: 1) the neurons should follow a specific behavioral model, and 2) stochastic spiking should be implemented efficiently for it to be scalable. This paper proposes a memristor-based stochastically spiking neuron that fulfills these requirements. First, the analytical model of the memristor is enhanced so it can capture the behavioral stochasticity consistent with experimentally observed phenomena. The switching behavior of the memristor model is demonstrated to be akin to the firing of the stochastic spike response neuron model, the primary building block for probabilistic algorithms in spiking neural networks. Furthermore, the paper proposes a neural soma circuit that utilizes the intrinsic nondeterminism of memristive switching for efficient spike generation. The simulations and analysis of the behavior of a single stochastic neuron and a winner-take-all network built of such neurons and trained on handwritten digits confirm that the circuit can be used for building probabilistic sampling and pattern adaptation machinery in spiking networks. The findings constitute an important step towards scalable and efficient probabilistic neuromorphic platforms. © 2011 IEEE.

Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

International Nuclear Information System (INIS)

Tran, Huu Vinh

1983-01-01

After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

Non-orthogonally transitive G2 spike solution

International Nuclear Information System (INIS)

Lim, Woei Chet

2015-01-01

We generalize the orthogonally transitive (OT) G 2 spike solution to the non-OT G 2 case. This is achieved by applying Geroch’s transformation on a Kasner seed. The new solution contains two more parameters than the OT G 2 spike solution. Unlike the OT G 2 spike solution, the new solution always resolves its spike. (fast track communication)

Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

Science.gov (United States)

Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

2016-12-17

Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

Wavelet analysis of epileptic spikes

Science.gov (United States)

Latka, Miroslaw; Was, Ziemowit; Kozik, Andrzej; West, Bruce J.

2003-05-01

Interictal spikes and sharp waves in human EEG are characteristic signatures of epilepsy. These potentials originate as a result of synchronous pathological discharge of many neurons. The reliable detection of such potentials has been the long standing problem in EEG analysis, especially after long-term monitoring became common in investigation of epileptic patients. The traditional definition of a spike is based on its amplitude, duration, sharpness, and emergence from its background. However, spike detection systems built solely around this definition are not reliable due to the presence of numerous transients and artifacts. We use wavelet transform to analyze the properties of EEG manifestations of epilepsy. We demonstrate that the behavior of wavelet transform of epileptic spikes across scales can constitute the foundation of a relatively simple yet effective detection algorithm.

Wavelet analysis of epileptic spikes

CERN Document Server

Latka, M; Kozik, A; West, B J; Latka, Miroslaw; Was, Ziemowit; Kozik, Andrzej; West, Bruce J.

2003-01-01

Interictal spikes and sharp waves in human EEG are characteristic signatures of epilepsy. These potentials originate as a result of synchronous, pathological discharge of many neurons. The reliable detection of such potentials has been the long standing problem in EEG analysis, especially after long-term monitoring became common in investigation of epileptic patients. The traditional definition of a spike is based on its amplitude, duration, sharpness, and emergence from its background. However, spike detection systems built solely around this definition are not reliable due to the presence of numerous transients and artifacts. We use wavelet transform to analyze the properties of EEG manifestations of epilepsy. We demonstrate that the behavior of wavelet transform of epileptic spikes across scales can constitute the foundation of a relatively simple yet effective detection algorithm.

Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

Science.gov (United States)

Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

2017-09-05

Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

2015-01-01

Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

Directory of Open Access Journals (Sweden)

Jie Zheng

2013-12-01

Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

Motor control by precisely timed spike patterns

DEFF Research Database (Denmark)

Srivastava, Kyle H; Holmes, Caroline M; Vellema, Michiel

2017-01-01

whether the information in spike timing actually plays a role in brain function. By examining the activity of individual motor units (the muscle fibers innervated by a single motor neuron) and manipulating patterns of activation of these neurons, we provide both correlative and causal evidence......A fundamental problem in neuroscience is understanding how sequences of action potentials ("spikes") encode information about sensory signals and motor outputs. Although traditional theories assume that this information is conveyed by the total number of spikes fired within a specified time...... interval (spike rate), recent studies have shown that additional information is carried by the millisecond-scale timing patterns of action potentials (spike timing). However, it is unknown whether or how subtle differences in spike timing drive differences in perception or behavior, leaving it unclear...

Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

International Nuclear Information System (INIS)

Le Quang Luan; Nguyen Thanh Long

2015-01-01

The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

International Nuclear Information System (INIS)

Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

1989-01-01

A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

Science.gov (United States)

Shao, Yujing; Guo, Yuming; Wang, Zhong

2013-07-01

This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

Generalized activity equations for spiking neural network dynamics

Directory of Open Access Journals (Sweden)

Michael A Buice

2013-11-01

Full Text Available Much progress has been made in uncovering the computational capabilities of spiking neural networks. However, spiking neurons will always be more expensive to simulate compared to rate neurons because of the inherent disparity in time scales - the spike duration time is much shorter than the inter-spike time, which is much shorter than any learning time scale. In numerical analysis, this is a classic stiff problem. Spiking neurons are also much more difficult to study analytically. One possible approach to making spiking networks more tractable is to augment mean field activity models with some information about spiking correlations. For example, such a generalized activity model could carry information about spiking rates and correlations between spikes self-consistently. Here, we will show how this can be accomplished by constructing a complete formal probabilistic description of the network and then expanding around a small parameter such as the inverse of the number of neurons in the network. The mean field theory of the system gives a rate-like description. The first order terms in the perturbation expansion keep track of covariances.

β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

Science.gov (United States)

2015-01-01

The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Goyal, Arun

2014-03-15

Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

Science.gov (United States)

Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

Paleo-dust insights onto dust-climate interactions

Science.gov (United States)

Albani, S.; Mahowald, N. M.

2017-12-01

Mineral dust emissions are affected by changing climate conditions, and in turn dust impacts the atmospheric radiation budget, clouds and biogeochemical cycles. Climate and public health dust-related issues call for attention on the fate of the dust cycle in the future, and the representation of the dust cycle is now part of the strategy of the Paleoclimate Modelling Intercomparison Project phase 4 and the Coupled Model Intercomparison Project phase 6 (PMIP4-CMIP6). Since mineral aerosols are one of the most important natural aerosols, understanding past dust responses to climate in the paleoclimate will allow us to better understand mineral aerosol feedbacks with climate and biogeochemistry in the Anthropocene. Modern observations and paleoclimate records offer the possibility of multiple, complementary views on the global dust cycle, and allow to validate and/or constrain the numerical representation of dust in climate and Earth system models. We present our results from a set of simulations with the Community Earth System Model for different climate states, including present and past climates such as the pre-industrial, the mid-Holocene and the Last Glacial Maximum. A set of simulations including a prognostic dust cycle was thoroughly compared with a wide set of present day observations from different platforms and regions, in order to realistically constrain the magnitude of dust load, surface concentration, deposition, optical properties, and particle size distributions. The magnitude of emissions for past climate regimes was constrained based on compilations of paleodust mass accumulation rates and size distributions, as well as based on information on dust provenance. The comparison with a parallel set of simulations without dust allows estimating the impacts of dust on surface climate. We analyze impacts of dust on the mean and variability of surface temperature and precipitation in each climate state, as well as the impacts that changing dust emissions had

Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

International Nuclear Information System (INIS)

Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

2004-01-01

Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

Respirable dust measured downwind during rock dust application.

Science.gov (United States)

Harris, M L; Organiscak, J; Klima, S; Perera, I E

2017-05-01

The Pittsburgh Mining Research Division of the U.S. National Institute for Occupational Safety and Health (NIOSH) conducted underground evaluations in an attempt to quantify respirable rock dust generation when using untreated rock dust and rock dust treated with an anticaking additive. Using personal dust monitors, these evaluations measured respirable rock dust levels arising from a flinger-type application of rock dust on rib and roof surfaces. Rock dust with a majority of the respirable component removed was also applied in NIOSH's Bruceton Experimental Mine using a bantam duster. The respirable dust measurements obtained downwind from both of these tests are presented and discussed. This testing did not measure miners' exposure to respirable coal mine dust under acceptable mining practices, but indicates the need for effective continuous administrative controls to be exercised when rock dusting to minimize the measured amount of rock dust in the sampling device.

Epileptiform spike detection via convolutional neural networks

DEFF Research Database (Denmark)

Johansen, Alexander Rosenberg; Jin, Jing; Maszczyk, Tomasz

2016-01-01

The EEG of epileptic patients often contains sharp waveforms called "spikes", occurring between seizures. Detecting such spikes is crucial for diagnosing epilepsy. In this paper, we develop a convolutional neural network (CNN) for detecting spikes in EEG of epileptic patients in an automated...

Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B.

2013-01-01

β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

AMORE Mo-99 Spike Test Results

Energy Technology Data Exchange (ETDEWEB)

Youker, Amanda J. [Argonne National Lab. (ANL), Argonne, IL (United States); Krebs, John F. [Argonne National Lab. (ANL), Argonne, IL (United States); Quigley, Kevin J. [Argonne National Lab. (ANL), Argonne, IL (United States); Byrnes, James P. [Argonne National Lab. (ANL), Argonne, IL (United States); Rotsch, David A [Argonne National Lab. (ANL), Argonne, IL (United States); Brossard, Thomas [Argonne National Lab. (ANL), Argonne, IL (United States); Wesolowski, Kenneth [Argonne National Lab. (ANL), Argonne, IL (United States); Alford, Kurt [Argonne National Lab. (ANL), Argonne, IL (United States); Chemerisov, Sergey [Argonne National Lab. (ANL), Argonne, IL (United States); Vandegrift, George F. [Argonne National Lab. (ANL), Argonne, IL (United States)

2017-09-27

With funding from the National Nuclear Security Administrations Material Management and Minimization Office, Argonne National Laboratory (Argonne) is providing technical assistance to help accelerate the U.S. production of Mo-99 using a non-highly enriched uranium (non-HEU) source. A potential Mo-99 production pathway is by accelerator-initiated fissioning in a subcritical uranyl sulfate solution containing low enriched uranium (LEU). As part of the Argonne development effort, we are undertaking the AMORE (Argonne Molybdenum Research Experiment) project, which is essentially a pilot facility for all phases of Mo-99 production, recovery, and purification. Production of Mo-99 and other fission products in the subcritical target solution is initiated by putting an electron beam on a depleted uranium (DU) target; the fast neutrons produced in the DU target are thermalized and lead to fissioning of U-235. At the end of irradiation, Mo is recovered from the target solution and separated from uranium and most of the fission products by using a titania column. The Mo is stripped from the column with an alkaline solution. After acidification of the Mo product solution from the recovery column, the Mo is concentrated (and further purified) in a second titania column. The strip solution from the concentration column is then purified with the LEU Modified Cintichem process. A full description of the process can be found elsewhere [1–3]. The initial commissioning steps for the AMORE project include performing a Mo-99 spike test with pH 1 sulfuric acid in the target vessel without a beam on the target to demonstrate the initial Mo separation-and-recovery process, followed by the concentration column process. All glovebox operations were tested with cold solutions prior to performing the Mo-99 spike tests. Two Mo-99 spike tests with pH 1 sulfuric acid have been performed to date. Figure 1 shows the flow diagram for the remotely operated Mo-recovery system for the AMORE project

Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

Science.gov (United States)

Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

2017-01-01

This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

Statistical properties of superimposed stationary spike trains.

Science.gov (United States)

Deger, Moritz; Helias, Moritz; Boucsein, Clemens; Rotter, Stefan

2012-06-01

The Poisson process is an often employed model for the activity of neuronal populations. It is known, though, that superpositions of realistic, non- Poisson spike trains are not in general Poisson processes, not even for large numbers of superimposed processes. Here we construct superimposed spike trains from intracellular in vivo recordings from rat neocortex neurons and compare their statistics to specific point process models. The constructed superimposed spike trains reveal strong deviations from the Poisson model. We find that superpositions of model spike trains that take the effective refractoriness of the neurons into account yield a much better description. A minimal model of this kind is the Poisson process with dead-time (PPD). For this process, and for superpositions thereof, we obtain analytical expressions for some second-order statistical quantities-like the count variability, inter-spike interval (ISI) variability and ISI correlations-and demonstrate the match with the in vivo data. We conclude that effective refractoriness is the key property that shapes the statistical properties of the superposition spike trains. We present new, efficient algorithms to generate superpositions of PPDs and of gamma processes that can be used to provide more realistic background input in simulations of networks of spiking neurons. Using these generators, we show in simulations that neurons which receive superimposed spike trains as input are highly sensitive for the statistical effects induced by neuronal refractoriness.

Learning Universal Computations with Spikes

Science.gov (United States)

Thalmeier, Dominik; Uhlmann, Marvin; Kappen, Hilbert J.; Memmesheimer, Raoul-Martin

2016-01-01

Providing the neurobiological basis of information processing in higher animals, spiking neural networks must be able to learn a variety of complicated computations, including the generation of appropriate, possibly delayed reactions to inputs and the self-sustained generation of complex activity patterns, e.g. for locomotion. Many such computations require previous building of intrinsic world models. Here we show how spiking neural networks may solve these different tasks. Firstly, we derive constraints under which classes of spiking neural networks lend themselves to substrates of powerful general purpose computing. The networks contain dendritic or synaptic nonlinearities and have a constrained connectivity. We then combine such networks with learning rules for outputs or recurrent connections. We show that this allows to learn even difficult benchmark tasks such as the self-sustained generation of desired low-dimensional chaotic dynamics or memory-dependent computations. Furthermore, we show how spiking networks can build models of external world systems and use the acquired knowledge to control them. PMID:27309381

Spiking Neurons for Analysis of Patterns

Science.gov (United States)

Huntsberger, Terrance

2008-01-01

Artificial neural networks comprising spiking neurons of a novel type have been conceived as improved pattern-analysis and pattern-recognition computational systems. These neurons are represented by a mathematical model denoted the state-variable model (SVM), which among other things, exploits a computational parallelism inherent in spiking-neuron geometry. Networks of SVM neurons offer advantages of speed and computational efficiency, relative to traditional artificial neural networks. The SVM also overcomes some of the limitations of prior spiking-neuron models. There are numerous potential pattern-recognition, tracking, and data-reduction (data preprocessing) applications for these SVM neural networks on Earth and in exploration of remote planets. Spiking neurons imitate biological neurons more closely than do the neurons of traditional artificial neural networks. A spiking neuron includes a central cell body (soma) surrounded by a tree-like interconnection network (dendrites). Spiking neurons are so named because they generate trains of output pulses (spikes) in response to inputs received from sensors or from other neurons. They gain their speed advantage over traditional neural networks by using the timing of individual spikes for computation, whereas traditional artificial neurons use averages of activity levels over time. Moreover, spiking neurons use the delays inherent in dendritic processing in order to efficiently encode the information content of incoming signals. Because traditional artificial neurons fail to capture this encoding, they have less processing capability, and so it is necessary to use more gates when implementing traditional artificial neurons in electronic circuitry. Such higher-order functions as dynamic tasking are effected by use of pools (collections) of spiking neurons interconnected by spike-transmitting fibers. The SVM includes adaptive thresholds and submodels of transport of ions (in imitation of such transport in biological

The Omega-Infinity Limit of Single Spikes

CERN Document Server

Axenides, Minos; Linardopoulos, Georgios

A new infinite-size limit of strings in RxS2 is presented. The limit is obtained from single spike strings by letting their angular velocity omega become infinite. We derive the energy-momenta relation of omega-infinity single spikes as their linear velocity v-->1 and their angular momentum J-->1. Generally, the v-->1, J-->1 limit of single spikes is singular and has to be excluded from the spectrum and be studied separately. We discover that the dispersion relation of omega-infinity single spikes contains logarithms in the limit J-->1. This result is somewhat surprising, since the logarithmic behavior in the string spectra is typically associated with their motion in non-compact spaces such as AdS. Omega-infinity single spikes seem to completely cover the surface of the 2-sphere they occupy, so that they may essentially be viewed as some sort of "brany strings". A proof of the sphere-filling property of omega-infinity single spikes is given in the appendix.

Stress-Induced Impairment of a Working Memory Task: Role of Spiking Rate and Spiking History Predicted Discharge

Science.gov (United States)

Devilbiss, David M.; Jenison, Rick L.; Berridge, Craig W.

2012-01-01

Stress, pervasive in society, contributes to over half of all work place accidents a year and over time can contribute to a variety of psychiatric disorders including depression, schizophrenia, and post-traumatic stress disorder. Stress impairs higher cognitive processes, dependent on the prefrontal cortex (PFC) and that involve maintenance and integration of information over extended periods, including working memory and attention. Substantial evidence has demonstrated a relationship between patterns of PFC neuron spiking activity (action-potential discharge) and components of delayed-response tasks used to probe PFC-dependent cognitive function in rats and monkeys. During delay periods of these tasks, persistent spiking activity is posited to be essential for the maintenance of information for working memory and attention. However, the degree to which stress-induced impairment in PFC-dependent cognition involves changes in task-related spiking rates or the ability for PFC neurons to retain information over time remains unknown. In the current study, spiking activity was recorded from the medial PFC of rats performing a delayed-response task of working memory during acute noise stress (93 db). Spike history-predicted discharge (SHPD) for PFC neurons was quantified as a measure of the degree to which ongoing neuronal discharge can be predicted by past spiking activity and reflects the degree to which past information is retained by these neurons over time. We found that PFC neuron discharge is predicted by their past spiking patterns for nearly one second. Acute stress impaired SHPD, selectively during delay intervals of the task, and simultaneously impaired task performance. Despite the reduction in delay-related SHPD, stress increased delay-related spiking rates. These findings suggest that neural codes utilizing SHPD within PFC networks likely reflects an additional important neurophysiological mechanism for maintenance of past information over time. Stress

Spikes and matter inhomogeneities in massless scalar field models

International Nuclear Information System (INIS)

Coley, A A; Lim, W C

2016-01-01

We shall discuss the general relativistic generation of spikes in a massless scalar field or stiff perfect fluid model. We first investigate orthogonally transitive (OT) G 2 stiff fluid spike models both heuristically and numerically, and give a new exact OT G 2 stiff fluid spike solution. We then present a new two-parameter family of non-OT G 2 stiff fluid spike solutions, obtained by the generalization of non-OT G 2 vacuum spike solutions to the stiff fluid case by applying Geroch’s transformation on a Jacobs seed. The dynamics of these new stiff fluid spike solutions is qualitatively different from that of the vacuum spike solutions in that the matter (stiff fluid) feels the spike directly and the stiff fluid spike solution can end up with a permanent spike. We then derive the evolution equations of non-OT G 2 stiff fluid models, including a second perfect fluid, in full generality, and briefly discuss some of their qualitative properties and their potential numerical analysis. Finally, we discuss how a fluid, and especially a stiff fluid or massless scalar field, affects the physics of the generation of spikes. (paper)

Spiking neural P systems with multiple channels.

Science.gov (United States)

Peng, Hong; Yang, Jinyu; Wang, Jun; Wang, Tao; Sun, Zhang; Song, Xiaoxiao; Luo, Xiaohui; Huang, Xiangnian

2017-11-01

Spiking neural P systems (SNP systems, in short) are a class of distributed parallel computing systems inspired from the neurophysiological behavior of biological spiking neurons. In this paper, we investigate a new variant of SNP systems in which each neuron has one or more synaptic channels, called spiking neural P systems with multiple channels (SNP-MC systems, in short). The spiking rules with channel label are introduced to handle the firing mechanism of neurons, where the channel labels indicate synaptic channels of transmitting the generated spikes. The computation power of SNP-MC systems is investigated. Specifically, we prove that SNP-MC systems are Turing universal as both number generating and number accepting devices. Copyright © 2017 Elsevier Ltd. All rights reserved.

Geomagnetic spikes on the core-mantle boundary

Science.gov (United States)

Davies, C. J.; Constable, C.

2017-12-01

Extreme variations of Earth's magnetic field occurred in the Levantine region around 1000 BC, where the field intensity rose and fell by a factor of 2-3 over a short time and confined spatial region. There is presently no coherent link between this intensity spike and the generating processes in Earth's liquid core. Here we test the attribution of a surface spike to a flux patch visible on the core-mantle boundary (CMB), calculating geometric and energetic bounds on resulting surface geomagnetic features. We show that the Levantine intensity high must span at least 60 degrees in longitude. Models providing the best trade-off between matching surface spike intensity, minimizing L1 and L2 misfit to the available data and satisfying core energy constraints produce CMB spikes 8-22 degrees wide with peak values of O(100) mT. We propose that the Levantine spike grew in place before migrating northward and westward, contributing to the growth of the axial dipole field seen in Holocene field models. Estimates of Ohmic dissipation suggest that diffusive processes, which are often neglected, likely govern the ultimate decay of geomagnetic spikes. Using these results, we search for the presence of spike-like features in geodynamo simulations.

Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

Science.gov (United States)

Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

2007-01-01

Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

Bursts generate a non-reducible spike-pattern code

Directory of Open Access Journals (Sweden)

Hugo G Eyherabide

2009-05-01

Full Text Available On the single-neuron level, precisely timed spikes can either constitute firing-rate codes or spike-pattern codes that utilize the relative timing between consecutive spikes. There has been little experimental support for the hypothesis that such temporal patterns contribute substantially to information transmission. Using grasshopper auditory receptors as a model system, we show that correlations between spikes can be used to represent behaviorally relevant stimuli. The correlations reflect the inner structure of the spike train: a succession of burst-like patterns. We demonstrate that bursts with different spike counts encode different stimulus features, such that about 20% of the transmitted information corresponds to discriminating between different features, and the remaining 80% is used to allocate these features in time. In this spike-pattern code, the "what" and the "when" of the stimuli are encoded in the duration of each burst and the time of burst onset, respectively. Given the ubiquity of burst firing, we expect similar findings also for other neural systems.

Stochastic Variational Learning in Recurrent Spiking Networks

Directory of Open Access Journals (Sweden)

Danilo eJimenez Rezende

2014-04-01

Full Text Available The ability to learn and perform statistical inference with biologically plausible recurrent network of spiking neurons is an important step towards understanding perception and reasoning. Here we derive and investigate a new learning rule for recurrent spiking networks with hidden neurons, combining principles from variational learning and reinforcement learning. Our network defines a generative model over spike train histories and the derived learning rule has the form of a local Spike Timing Dependent Plasticity rule modulated by global factors (neuromodulators conveying information about ``novelty on a statistically rigorous ground.Simulations show that our model is able to learn bothstationary and non-stationary patterns of spike trains.We also propose one experiment that could potentially be performed with animals in order to test the dynamics of the predicted novelty signal.

Stochastic variational learning in recurrent spiking networks.

Science.gov (United States)

Jimenez Rezende, Danilo; Gerstner, Wulfram

2014-01-01

The ability to learn and perform statistical inference with biologically plausible recurrent networks of spiking neurons is an important step toward understanding perception and reasoning. Here we derive and investigate a new learning rule for recurrent spiking networks with hidden neurons, combining principles from variational learning and reinforcement learning. Our network defines a generative model over spike train histories and the derived learning rule has the form of a local Spike Timing Dependent Plasticity rule modulated by global factors (neuromodulators) conveying information about "novelty" on a statistically rigorous ground. Simulations show that our model is able to learn both stationary and non-stationary patterns of spike trains. We also propose one experiment that could potentially be performed with animals in order to test the dynamics of the predicted novelty signal.

Test plan for glove box testing with the real-time transuranic dust monitor

International Nuclear Information System (INIS)

Partin, J.K.; Fincke, J.R.

1994-10-01

This test plan describes the objectives, instrumentation, and testing procedures used to prove the feasibility of a real-time transuranic dust monitor (RTDM). The RTDM is under development at the Idaho National Engineering Laboratory (INEL) as a Waste Characterization Technology funded by the Buried Waste Integrated Demonstration Project. The instrument is an in situ monitor that uses optical techniques to establish particle size, particle number density, and mass and species of heavy metal contamination. US Department of Energy orders mandate the assessment of radiological exposure and contamination spread during the remediation of radioactive waste. Of particular concern is heavy metal contamination of dust, both radioactive and nonradioactive. Small particles of metal, particularly the radioactive species, tend to become electrically charged and consequently attach themselves to dust particles. This airborne activated dust is a primary means of contamination transport during remediation activities, and therefore, must be continuously monitored to protect personnel involved in the operations and to control the spread of contamination. If real-time monitoring is not available there is increased likelihood of generating unacceptably high levels of contamination and being forced to shut down costly retrieval operations to decontaminate. A series of experiments are described to determine the optimal experimental design, operational parameters, and levels of detection for the RTDM. Initial screening will be performed using monodisperse particle standards to set parameters and calibrate the instrument. Additional testing will be performed using INEL soil samples spiked with a surrogate, cerium oxide, to prove the design before transporting the apparatus to the Test Reactor Area for testing with plutonium-contaminated dusts

Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

Directory of Open Access Journals (Sweden)

Anna Bzducha-Wróbel

2014-12-01

Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

Inferring oscillatory modulation in neural spike trains.

Science.gov (United States)

Arai, Kensuke; Kass, Robert E

2017-10-01

Oscillations are observed at various frequency bands in continuous-valued neural recordings like the electroencephalogram (EEG) and local field potential (LFP) in bulk brain matter, and analysis of spike-field coherence reveals that spiking of single neurons often occurs at certain phases of the global oscillation. Oscillatory modulation has been examined in relation to continuous-valued oscillatory signals, and independently from the spike train alone, but behavior or stimulus triggered firing-rate modulation, spiking sparseness, presence of slow modulation not locked to stimuli and irregular oscillations with large variability in oscillatory periods, present challenges to searching for temporal structures present in the spike train. In order to study oscillatory modulation in real data collected under a variety of experimental conditions, we describe a flexible point-process framework we call the Latent Oscillatory Spike Train (LOST) model to decompose the instantaneous firing rate in biologically and behaviorally relevant factors: spiking refractoriness, event-locked firing rate non-stationarity, and trial-to-trial variability accounted for by baseline offset and a stochastic oscillatory modulation. We also extend the LOST model to accommodate changes in the modulatory structure over the duration of the experiment, and thereby discover trial-to-trial variability in the spike-field coherence of a rat primary motor cortical neuron to the LFP theta rhythm. Because LOST incorporates a latent stochastic auto-regressive term, LOST is able to detect oscillations when the firing rate is low, the modulation is weak, and when the modulating oscillation has a broad spectral peak.

The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

Directory of Open Access Journals (Sweden)

Vishukumar Aimanianda

2017-06-01

Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

Science.gov (United States)

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

2018-04-03

Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

1999-01-01

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

The local field potential reflects surplus spike synchrony

DEFF Research Database (Denmark)

Denker, Michael; Roux, Sébastien; Lindén, Henrik

2011-01-01

While oscillations of the local field potential (LFP) are commonly attributed to the synchronization of neuronal firing rate on the same time scale, their relationship to coincident spiking in the millisecond range is unknown. Here, we present experimental evidence to reconcile the notions...... of synchrony at the level of spiking and at the mesoscopic scale. We demonstrate that only in time intervals of significant spike synchrony that cannot be explained on the basis of firing rates, coincident spikes are better phase locked to the LFP than predicted by the locking of the individual spikes....... This effect is enhanced in periods of large LFP amplitudes. A quantitative model explains the LFP dynamics by the orchestrated spiking activity in neuronal groups that contribute the observed surplus synchrony. From the correlation analysis, we infer that neurons participate in different constellations...

Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti-inflammatory role of glucan fractions.

Directory of Open Access Journals (Sweden)

Samir Jawhara

Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the

Supervised Learning Based on Temporal Coding in Spiking Neural Networks.

Science.gov (United States)

Mostafa, Hesham

2017-08-01

Gradient descent training techniques are remarkably successful in training analog-valued artificial neural networks (ANNs). Such training techniques, however, do not transfer easily to spiking networks due to the spike generation hard nonlinearity and the discrete nature of spike communication. We show that in a feedforward spiking network that uses a temporal coding scheme where information is encoded in spike times instead of spike rates, the network input-output relation is differentiable almost everywhere. Moreover, this relation is piecewise linear after a transformation of variables. Methods for training ANNs thus carry directly to the training of such spiking networks as we show when training on the permutation invariant MNIST task. In contrast to rate-based spiking networks that are often used to approximate the behavior of ANNs, the networks we present spike much more sparsely and their behavior cannot be directly approximated by conventional ANNs. Our results highlight a new approach for controlling the behavior of spiking networks with realistic temporal dynamics, opening up the potential for using these networks to process spike patterns with complex temporal information.

Characterization of Polysaccharides from the Fruiting Bodies of Two Species of Genus Ganoderma (Agaricomycetes) and Determination of Water-Soluble β-D-Glucan Using High-Performance Liquid Chromatography.

Science.gov (United States)

Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song

2017-01-01

Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.

Mice housed on coal dust-contaminated sand: A model to evaluate the impacts of coal mining on health.

Science.gov (United States)

Caballero-Gallardo, Karina; Olivero-Verbel, Jesus

2016-03-01

Coal dust is the most important air pollutant in coal mining in regards to producing deleterious health effects. It permeates the surrounding environment threatening public health. The aim of this study was to evaluate the toxic effects associated with exposure to sand contaminated with coal dust particles below 38 μm in diameter, obtained from a mineral sample collected in the largest coal mine in South America, La Loma, Cesar, Colombia. Sterilized sand was spiked with coal dust to obtain concentrations ranging from zero to 4% coal dust. To model natural exposure, mice were housed for eight weeks in boxes containing this mixture as bedding after which, they were euthanized and blood and tissue samples were collected. Real time PCR analysis revealed an increase in Cyp1A1 mRNA for living on sand with coal dust concentrations greater than 2% compared to mice living on sand without coal dust. Unexpectedly, for mice on coal dust-polluted sand, Sod1, Scd1 and Nqo1 hepatic mRNA were downregulated. The Comet assay in peripheral blood cells and the micronucleus test in blood smears, showed a significant potential genotoxic effect only at the highest coal dust concentration. Histopathological analysis revealed vascular congestion and peribronchial inflammation in the lungs. A dose-response relationship for the presence of hepatic steatosis, vacuolization and nuclei enlargements was observed in the exposed animals. The data suggest living on a soil polluted with coal dust induces molecular, cellular and histopathological changes in mice. Accordingly, the proposed model can be used to identify deleterious effects of exposure to coal dust deposited in soils that may pose health risks for surrounding wildlife populations. Copyright © 2016 Elsevier Inc. All rights reserved.

Linking investment spikes and productivity growth

NARCIS (Netherlands)

Geylani, P.C.; Stefanou, S.E.

2013-01-01

We investigate the relationship between productivity growth and investment spikes using Census Bureau’s plant-level dataset for the U.S. food manufacturing industry. There are differences in productivity growth and investment spike patterns across different sub-industries and food manufacturing

An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans

DEFF Research Database (Denmark)

Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher

2008-01-01

alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...

Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

Science.gov (United States)

Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

2018-05-14

Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

Science.gov (United States)

Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

2017-01-01

Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

Directory of Open Access Journals (Sweden)

Weitberg Alan B

2008-09-01

Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

A new supervised learning algorithm for spiking neurons.

Science.gov (United States)

Xu, Yan; Zeng, Xiaoqin; Zhong, Shuiming

2013-06-01

The purpose of supervised learning with temporal encoding for spiking neurons is to make the neurons emit a specific spike train encoded by the precise firing times of spikes. If only running time is considered, the supervised learning for a spiking neuron is equivalent to distinguishing the times of desired output spikes and the other time during the running process of the neuron through adjusting synaptic weights, which can be regarded as a classification problem. Based on this idea, this letter proposes a new supervised learning method for spiking neurons with temporal encoding; it first transforms the supervised learning into a classification problem and then solves the problem by using the perceptron learning rule. The experiment results show that the proposed method has higher learning accuracy and efficiency over the existing learning methods, so it is more powerful for solving complex and real-time problems.

Mice housed on coal dust-contaminated sand: A model to evaluate the impacts of coal mining on health

Energy Technology Data Exchange (ETDEWEB)

Caballero-Gallardo, Karina, E-mail: kcaballerog@unicartagena.edu.co; Olivero-Verbel, Jesus, E-mail: joliverov@unicartagena.edu.co

2016-03-01

Coal dust is the most important air pollutant in coal mining in regards to producing deleterious health effects. It permeates the surrounding environment threatening public health. The aim of this study was to evaluate the toxic effects associated with exposure to sand contaminated with coal dust particles below 38 μm in diameter, obtained from a mineral sample collected in the largest coal mine in South America, La Loma, Cesar, Colombia. Sterilized sand was spiked with coal dust to obtain concentrations ranging from zero to 4% coal dust. To model natural exposure, mice were housed for eight weeks in boxes containing this mixture as bedding after which, they were euthanized and blood and tissue samples were collected. Real time PCR analysis revealed an increase in Cyp1A1 mRNA for living on sand with coal dust concentrations greater than 2% compared to mice living on sand without coal dust. Unexpectedly, for mice on coal dust-polluted sand, Sod1, Scd1 and Nqo1 hepatic mRNA were downregulated. The Comet assay in peripheral blood cells and the micronucleus test in blood smears, showed a significant potential genotoxic effect only at the highest coal dust concentration. Histopathological analysis revealed vascular congestion and peribronchial inflammation in the lungs. A dose–response relationship for the presence of hepatic steatosis, vacuolization and nuclei enlargements was observed in the exposed animals. The data suggest living on a soil polluted with coal dust induces molecular, cellular and histopathological changes in mice. Accordingly, the proposed model can be used to identify deleterious effects of exposure to coal dust deposited in soils that may pose health risks for surrounding wildlife populations. - Highlights: • Mice were exposed to coal dust-contaminated sand. • mRNA Markers for PAH exposure, lipid metabolism and oxidative stress increased. • ALT activity in plasma increased at the highest exposure to coal dust. • Liver tissues of exposed

Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

Directory of Open Access Journals (Sweden)

R.C.Shendare

2008-01-01

Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

Solving constraint satisfaction problems with networks of spiking neurons

Directory of Open Access Journals (Sweden)

Zeno eJonke

2016-03-01

Full Text Available Network of neurons in the brain apply – unlike processors in our current generation ofcomputer hardware – an event-based processing strategy, where short pulses (spikes areemitted sparsely by neurons to signal the occurrence of an event at a particular point intime. Such spike-based computations promise to be substantially more power-efficient thantraditional clocked processing schemes. However it turned out to be surprisingly difficult todesign networks of spiking neurons that can solve difficult computational problems on the levelof single spikes (rather than rates of spikes. We present here a new method for designingnetworks of spiking neurons via an energy function. Furthermore we show how the energyfunction of a network of stochastically firing neurons can be shaped in a quite transparentmanner by composing the networks of simple stereotypical network motifs. We show that thisdesign approach enables networks of spiking neurons to produce approximate solutions todifficult (NP-hard constraint satisfaction problems from the domains of planning/optimizationand verification/logical inference. The resulting networks employ noise as a computationalresource. Nevertheless the timing of spikes (rather than just spike rates plays an essential rolein their computations. Furthermore, networks of spiking neurons carry out for the Traveling Salesman Problem a more efficient stochastic search for good solutions compared with stochastic artificial neural networks (Boltzmann machines and Gibbs sampling.

Surfing a spike wave down the ventral stream.

Science.gov (United States)

VanRullen, Rufin; Thorpe, Simon J

2002-10-01

Numerous theories of neural processing, often motivated by experimental observations, have explored the computational properties of neural codes based on the absolute or relative timing of spikes in spike trains. Spiking neuron models and theories however, as well as their experimental counterparts, have generally been limited to the simulation or observation of isolated neurons, isolated spike trains, or reduced neural populations. Such theories would therefore seem inappropriate to capture the properties of a neural code relying on temporal spike patterns distributed across large neuronal populations. Here we report a range of computer simulations and theoretical considerations that were designed to explore the possibilities of one such code and its relevance for visual processing. In a unified framework where the relation between stimulus saliency and spike relative timing plays the central role, we describe how the ventral stream of the visual system could process natural input scenes and extract meaningful information, both rapidly and reliably. The first wave of spikes generated in the retina in response to a visual stimulation carries information explicitly in its spatio-temporal structure: the most salient information is represented by the first spikes over the population. This spike wave, propagating through a hierarchy of visual areas, is regenerated at each processing stage, where its temporal structure can be modified by (i). the selectivity of the cortical neurons, (ii). lateral interactions and (iii). top-down attentional influences from higher order cortical areas. The resulting model could account for the remarkable efficiency and rapidity of processing observed in the primate visual system.

Determination and human exposure assessment of polybrominated diphenyl ethers and tetrabromobisphenol A in indoor dust in South Africa.

Science.gov (United States)

Abafe, Ovokeroye A; Martincigh, Bice S

2016-04-01

The concentration of TBBPA in dust samples from automobiles (n = 14), computer laboratories (n = 8), homes (n = 7), and offices (n = 7), and, also, PBDE concentrations in the indoor dust of 19 personal and previously owned automobiles in Durban, South Africa, were determined. Gas chromatography coupled with mass spectrometry was applied for the separation, identification, and quantitation of TBBPA and PBDEs. The median concentrations of TBBPA were 1156, 269, 120, and 492 ng g(-1) in automobiles, computer laboratories, homes, and offices, respectively. The ∑ n = 8 PBDE in 19 automobile samples ranged from 573 to 11,833 ng g(-1). BDE-209 accounted for approximately 42% of ∑ n = 8 PBDE in the samples. Household characteristics influenced the distribution of TBBPA in the various microenvironments. By assuming an average dust ingestion rate, and a median TBBPA concentration, the ∑DED (in ng kg(-1) bw day(-1)) of TBBPA is 0.08, 0.08, and 0.60, for an adult, teenager, and toddler, respectively. These doses are similar to dust ingestion intakes reported for Asian countries where there is a high demand for TBBPA as a flame retardant. Similarly, automobiles provide ample opportunity for human exposure to PBDEs via dust ingestion, particularly for toddlers and occupationally exposed adults.

Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329

Science.gov (United States)

Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos

2013-01-01

Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729

Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

OpenAIRE

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

2014-01-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

Science.gov (United States)

Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

2017-07-01

We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Spike timing precision of neuronal circuits.

Science.gov (United States)

Kilinc, Deniz; Demir, Alper

2018-04-17

Spike timing is believed to be a key factor in sensory information encoding and computations performed by the neurons and neuronal circuits. However, the considerable noise and variability, arising from the inherently stochastic mechanisms that exist in the neurons and the synapses, degrade spike timing precision. Computational modeling can help decipher the mechanisms utilized by the neuronal circuits in order to regulate timing precision. In this paper, we utilize semi-analytical techniques, which were adapted from previously developed methods for electronic circuits, for the stochastic characterization of neuronal circuits. These techniques, which are orders of magnitude faster than traditional Monte Carlo type simulations, can be used to directly compute the spike timing jitter variance, power spectral densities, correlation functions, and other stochastic characterizations of neuronal circuit operation. We consider three distinct neuronal circuit motifs: Feedback inhibition, synaptic integration, and synaptic coupling. First, we show that both the spike timing precision and the energy efficiency of a spiking neuron are improved with feedback inhibition. We unveil the underlying mechanism through which this is achieved. Then, we demonstrate that a neuron can improve on the timing precision of its synaptic inputs, coming from multiple sources, via synaptic integration: The phase of the output spikes of the integrator neuron has the same variance as that of the sample average of the phases of its inputs. Finally, we reveal that weak synaptic coupling among neurons, in a fully connected network, enables them to behave like a single neuron with a larger membrane area, resulting in an improvement in the timing precision through cooperation.

Causal Inference and Explaining Away in a Spiking Network

Science.gov (United States)

Moreno-Bote, Rubén; Drugowitsch, Jan

2015-01-01

While the brain uses spiking neurons for communication, theoretical research on brain computations has mostly focused on non-spiking networks. The nature of spike-based algorithms that achieve complex computations, such as object probabilistic inference, is largely unknown. Here we demonstrate that a family of high-dimensional quadratic optimization problems with non-negativity constraints can be solved exactly and efficiently by a network of spiking neurons. The network naturally imposes the non-negativity of causal contributions that is fundamental to causal inference, and uses simple operations, such as linear synapses with realistic time constants, and neural spike generation and reset non-linearities. The network infers the set of most likely causes from an observation using explaining away, which is dynamically implemented by spike-based, tuned inhibition. The algorithm performs remarkably well even when the network intrinsically generates variable spike trains, the timing of spikes is scrambled by external sources of noise, or the network is mistuned. This type of network might underlie tasks such as odor identification and classification. PMID:26621426

Neuro-Inspired Spike-Based Motion: From Dynamic Vision Sensor to Robot Motor Open-Loop Control through Spike-VITE

Directory of Open Access Journals (Sweden)

Fernando Perez-Peña

2013-11-01

Full Text Available In this paper we present a complete spike-based architecture: from a Dynamic Vision Sensor (retina to a stereo head robotic platform. The aim of this research is to reproduce intended movements performed by humans taking into account as many features as possible from the biological point of view. This paper fills the gap between current spike silicon sensors and robotic actuators by applying a spike processing strategy to the data flows in real time. The architecture is divided into layers: the retina, visual information processing, the trajectory generator layer which uses a neuroinspired algorithm (SVITE that can be replicated into as many times as DoF the robot has; and finally the actuation layer to supply the spikes to the robot (using PFM. All the layers do their tasks in a spike-processing mode, and they communicate each other through the neuro-inspired AER protocol. The open-loop controller is implemented on FPGA using AER interfaces developed by RTC Lab. Experimental results reveal the viability of this spike-based controller. Two main advantages are: low hardware resources (2% of a Xilinx Spartan 6 and power requirements (3.4 W to control a robot with a high number of DoF (up to 100 for a Xilinx Spartan 6. It also evidences the suitable use of AER as a communication protocol between processing and actuation.

Neuro-Inspired Spike-Based Motion: From Dynamic Vision Sensor to Robot Motor Open-Loop Control through Spike-VITE

Science.gov (United States)

Perez-Peña, Fernando; Morgado-Estevez, Arturo; Linares-Barranco, Alejandro; Jimenez-Fernandez, Angel; Gomez-Rodriguez, Francisco; Jimenez-Moreno, Gabriel; Lopez-Coronado, Juan

2013-01-01

In this paper we present a complete spike-based architecture: from a Dynamic Vision Sensor (retina) to a stereo head robotic platform. The aim of this research is to reproduce intended movements performed by humans taking into account as many features as possible from the biological point of view. This paper fills the gap between current spike silicon sensors and robotic actuators by applying a spike processing strategy to the data flows in real time. The architecture is divided into layers: the retina, visual information processing, the trajectory generator layer which uses a neuroinspired algorithm (SVITE) that can be replicated into as many times as DoF the robot has; and finally the actuation layer to supply the spikes to the robot (using PFM). All the layers do their tasks in a spike-processing mode, and they communicate each other through the neuro-inspired AER protocol. The open-loop controller is implemented on FPGA using AER interfaces developed by RTC Lab. Experimental results reveal the viability of this spike-based controller. Two main advantages are: low hardware resources (2% of a Xilinx Spartan 6) and power requirements (3.4 W) to control a robot with a high number of DoF (up to 100 for a Xilinx Spartan 6). It also evidences the suitable use of AER as a communication protocol between processing and actuation. PMID:24264330

DustEM: Dust extinction and emission modelling

Science.gov (United States)

Compiègne, M.; Verstraete, L.; Jones, A.; Bernard, J.-P.; Boulanger, F.; Flagey, N.; Le Bourlot, J.; Paradis, D.; Ysard, N.

2013-07-01

DustEM computes the extinction and the emission of interstellar dust grains heated by photons. It is written in Fortran 95 and is jointly developed by IAS and CESR. The dust emission is calculated in the optically thin limit (no radiative transfer) and the default spectral range is 40 to 108 nm. The code is designed so dust properties can easily be changed and mixed and to allow for the inclusion of new grain physics.

Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

Science.gov (United States)

Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

2016-01-01

In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

Understanding the role of oat ß-glucan in oat-based dough systems

NARCIS (Netherlands)

Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

2015-01-01

B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

2013-03-01

The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

Spike Pattern Structure Influences Synaptic Efficacy Variability Under STDP and Synaptic Homeostasis. II: Spike Shuffling Methods on LIF Networks

Directory of Open Access Journals (Sweden)

Zedong Bi

2016-08-01

Full Text Available Synapses may undergo variable changes during plasticity because of the variability of spike patterns such as temporal stochasticity and spatial randomness. Here, we call the variability of synaptic weight changes during plasticity to be efficacy variability. In this paper, we investigate how four aspects of spike pattern statistics (i.e., synchronous firing, burstiness/regularity, heterogeneity of rates and heterogeneity of cross-correlations influence the efficacy variability under pair-wise additive spike-timing dependent plasticity (STDP and synaptic homeostasis (the mean strength of plastic synapses into a neuron is bounded, by implementing spike shuffling methods onto spike patterns self-organized by a network of excitatory and inhibitory leaky integrate-and-fire (LIF neurons. With the increase of the decay time scale of the inhibitory synaptic currents, the LIF network undergoes a transition from asynchronous state to weak synchronous state and then to synchronous bursting state. We first shuffle these spike patterns using a variety of methods, each designed to evidently change a specific pattern statistics; and then investigate the change of efficacy variability of the synapses under STDP and synaptic homeostasis, when the neurons in the network fire according to the spike patterns before and after being treated by a shuffling method. In this way, we can understand how the change of pattern statistics may cause the change of efficacy variability. Our results are consistent with those of our previous study which implements spike-generating models on converging motifs. We also find that burstiness/regularity is important to determine the efficacy variability under asynchronous states, while heterogeneity of cross-correlations is the main factor to cause efficacy variability when the network moves into synchronous bursting states (the states observed in epilepsy.

β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

Directory of Open Access Journals (Sweden)

Patricia de Souza Bonfim-Mendonça

Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.

Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

Directory of Open Access Journals (Sweden)

Vidyasagar Devaprasad Dedeepiya

2012-01-01

Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

Joint Probability-Based Neuronal Spike Train Classification

Directory of Open Access Journals (Sweden)

Yan Chen

2009-01-01

Full Text Available Neuronal spike trains are used by the nervous system to encode and transmit information. Euclidean distance-based methods (EDBMs have been applied to quantify the similarity between temporally-discretized spike trains and model responses. In this study, using the same discretization procedure, we developed and applied a joint probability-based method (JPBM to classify individual spike trains of slowly adapting pulmonary stretch receptors (SARs. The activity of individual SARs was recorded in anaesthetized, paralysed adult male rabbits, which were artificially-ventilated at constant rate and one of three different volumes. Two-thirds of the responses to the 600 stimuli presented at each volume were used to construct three response models (one for each stimulus volume consisting of a series of time bins, each with spike probabilities. The remaining one-third of the responses where used as test responses to be classified into one of the three model responses. This was done by computing the joint probability of observing the same series of events (spikes or no spikes, dictated by the test response in a given model and determining which probability of the three was highest. The JPBM generally produced better classification accuracy than the EDBM, and both performed well above chance. Both methods were similarly affected by variations in discretization parameters, response epoch duration, and two different response alignment strategies. Increasing bin widths increased classification accuracy, which also improved with increased observation time, but primarily during periods of increasing lung inflation. Thus, the JPBM is a simple and effective method performing spike train classification.

Fitting neuron models to spike trains

Directory of Open Access Journals (Sweden)

Cyrille eRossant

2011-02-01

Full Text Available Computational modeling is increasingly used to understand the function of neural circuitsin systems neuroscience.These studies require models of individual neurons with realisticinput-output properties.Recently, it was found that spiking models can accurately predict theprecisely timed spike trains produced by cortical neurons in response tosomatically injected currents,if properly fitted. This requires fitting techniques that are efficientand flexible enough to easily test different candidate models.We present a generic solution, based on the Brian simulator(a neural network simulator in Python, which allowsthe user to define and fit arbitrary neuron models to electrophysiological recordings.It relies on vectorization and parallel computing techniques toachieve efficiency.We demonstrate its use on neural recordings in the barrel cortex andin the auditory brainstem, and confirm that simple adaptive spiking modelscan accurately predict the response of cortical neurons. Finally, we show how a complexmulticompartmental model can be reduced to a simple effective spiking model.

Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

Science.gov (United States)

Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

2017-04-08

While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

Detection and Evaluation of Spatio-Temporal Spike Patterns in Massively Parallel Spike Train Data with SPADE

Directory of Open Access Journals (Sweden)

Pietro Quaglio

2017-05-01

Full Text Available Repeated, precise sequences of spikes are largely considered a signature of activation of cell assemblies. These repeated sequences are commonly known under the name of spatio-temporal patterns (STPs. STPs are hypothesized to play a role in the communication of information in the computational process operated by the cerebral cortex. A variety of statistical methods for the detection of STPs have been developed and applied to electrophysiological recordings, but such methods scale poorly with the current size of available parallel spike train recordings (more than 100 neurons. In this work, we introduce a novel method capable of overcoming the computational and statistical limits of existing analysis techniques in detecting repeating STPs within massively parallel spike trains (MPST. We employ advanced data mining techniques to efficiently extract repeating sequences of spikes from the data. Then, we introduce and compare two alternative approaches to distinguish statistically significant patterns from chance sequences. The first approach uses a measure known as conceptual stability, of which we investigate a computationally cheap approximation for applications to such large data sets. The second approach is based on the evaluation of pattern statistical significance. In particular, we provide an extension to STPs of a method we recently introduced for the evaluation of statistical significance of synchronous spike patterns. The performance of the two approaches is evaluated in terms of computational load and statistical power on a variety of artificial data sets that replicate specific features of experimental data. Both methods provide an effective and robust procedure for detection of STPs in MPST data. The method based on significance evaluation shows the best overall performance, although at a higher computational cost. We name the novel procedure the spatio-temporal Spike PAttern Detection and Evaluation (SPADE analysis.

Constructing Precisely Computing Networks with Biophysical Spiking Neurons.

Science.gov (United States)

Schwemmer, Michael A; Fairhall, Adrienne L; Denéve, Sophie; Shea-Brown, Eric T

2015-07-15

While spike timing has been shown to carry detailed stimulus information at the sensory periphery, its possible role in network computation is less clear. Most models of computation by neural networks are based on population firing rates. In equivalent spiking implementations, firing is assumed to be random such that averaging across populations of neurons recovers the rate-based approach. Recently, however, Denéve and colleagues have suggested that the spiking behavior of neurons may be fundamental to how neuronal networks compute, with precise spike timing determined by each neuron's contribution to producing the desired output (Boerlin and Denéve, 2011; Boerlin et al., 2013). By postulating that each neuron fires to reduce the error in the network's output, it was demonstrated that linear computations can be performed by networks of integrate-and-fire neurons that communicate through instantaneous synapses. This left open, however, the possibility that realistic networks, with conductance-based neurons with subthreshold nonlinearity and the slower timescales of biophysical synapses, may not fit into this framework. Here, we show how the spike-based approach can be extended to biophysically plausible networks. We then show that our network reproduces a number of key features of cortical networks including irregular and Poisson-like spike times and a tight balance between excitation and inhibition. Lastly, we discuss how the behavior of our model scales with network size or with the number of neurons "recorded" from a larger computing network. These results significantly increase the biological plausibility of the spike-based approach to network computation. We derive a network of neurons with standard spike-generating currents and synapses with realistic timescales that computes based upon the principle that the precise timing of each spike is important for the computation. We then show that our network reproduces a number of key features of cortical networks

Synthesis of cell wall xylans and glucans by golgi membranes

International Nuclear Information System (INIS)

Gibeaut, D.M.; Carpita, N.C.

1989-01-01

We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

A Simple Deep Learning Method for Neuronal Spike Sorting

Science.gov (United States)

Yang, Kai; Wu, Haifeng; Zeng, Yu

2017-10-01

Spike sorting is one of key technique to understand brain activity. With the development of modern electrophysiology technology, some recent multi-electrode technologies have been able to record the activity of thousands of neuronal spikes simultaneously. The spike sorting in this case will increase the computational complexity of conventional sorting algorithms. In this paper, we will focus spike sorting on how to reduce the complexity, and introduce a deep learning algorithm, principal component analysis network (PCANet) to spike sorting. The introduced method starts from a conventional model and establish a Toeplitz matrix. Through the column vectors in the matrix, we trains a PCANet, where some eigenvalue vectors of spikes could be extracted. Finally, support vector machine (SVM) is used to sort spikes. In experiments, we choose two groups of simulated data from public databases availably and compare this introduced method with conventional methods. The results indicate that the introduced method indeed has lower complexity with the same sorting errors as the conventional methods.

Solving Constraint Satisfaction Problems with Networks of Spiking Neurons.

Science.gov (United States)

Jonke, Zeno; Habenschuss, Stefan; Maass, Wolfgang

2016-01-01

Network of neurons in the brain apply-unlike processors in our current generation of computer hardware-an event-based processing strategy, where short pulses (spikes) are emitted sparsely by neurons to signal the occurrence of an event at a particular point in time. Such spike-based computations promise to be substantially more power-efficient than traditional clocked processing schemes. However, it turns out to be surprisingly difficult to design networks of spiking neurons that can solve difficult computational problems on the level of single spikes, rather than rates of spikes. We present here a new method for designing networks of spiking neurons via an energy function. Furthermore, we show how the energy function of a network of stochastically firing neurons can be shaped in a transparent manner by composing the networks of simple stereotypical network motifs. We show that this design approach enables networks of spiking neurons to produce approximate solutions to difficult (NP-hard) constraint satisfaction problems from the domains of planning/optimization and verification/logical inference. The resulting networks employ noise as a computational resource. Nevertheless, the timing of spikes plays an essential role in their computations. Furthermore, networks of spiking neurons carry out for the Traveling Salesman Problem a more efficient stochastic search for good solutions compared with stochastic artificial neural networks (Boltzmann machines) and Gibbs sampling.

Recent progress in multi-electrode spike sorting methods.

Science.gov (United States)

Lefebvre, Baptiste; Yger, Pierre; Marre, Olivier

2016-11-01

In recent years, arrays of extracellular electrodes have been developed and manufactured to record simultaneously from hundreds of electrodes packed with a high density. These recordings should allow neuroscientists to reconstruct the individual activity of the neurons spiking in the vicinity of these electrodes, with the help of signal processing algorithms. Algorithms need to solve a source separation problem, also known as spike sorting. However, these new devices challenge the classical way to do spike sorting. Here we review different methods that have been developed to sort spikes from these large-scale recordings. We describe the common properties of these algorithms, as well as their main differences. Finally, we outline the issues that remain to be solved by future spike sorting algorithms. Copyright © 2017 Elsevier Ltd. All rights reserved.

β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

Directory of Open Access Journals (Sweden)

Sonja de Vries

Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

Multineuron spike train analysis with R-convolution linear combination kernel.

Science.gov (United States)

Tezuka, Taro

2018-06-01

A spike train kernel provides an effective way of decoding information represented by a spike train. Some spike train kernels have been extended to multineuron spike trains, which are simultaneously recorded spike trains obtained from multiple neurons. However, most of these multineuron extensions were carried out in a kernel-specific manner. In this paper, a general framework is proposed for extending any single-neuron spike train kernel to multineuron spike trains, based on the R-convolution kernel. Special subclasses of the proposed R-convolution linear combination kernel are explored. These subclasses have a smaller number of parameters and make optimization tractable when the size of data is limited. The proposed kernel was evaluated using Gaussian process regression for multineuron spike trains recorded from an animal brain. It was compared with the sum kernel and the population Spikernel, which are existing ways of decoding multineuron spike trains using kernels. The results showed that the proposed approach performs better than these kernels and also other commonly used neural decoding methods. Copyright © 2018 Elsevier Ltd. All rights reserved.

Las β-(1®3-glucanas: moléculas inmunomoduladoras contaminantes de productos farmacéuticos β-(1®3-glucans as immunomodulating moléculas polluting pharmaceuticals

Directory of Open Access Journals (Sweden)

Zenia Pardo Ruiz

2012-03-01

Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

Science.gov (United States)

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I

International Nuclear Information System (INIS)

Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.

1998-01-01

The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains

Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

Directory of Open Access Journals (Sweden)

Andreas F. Haag

2010-01-01

Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

Dust acoustic shock wave at high dust density

International Nuclear Information System (INIS)

Ghosh, Samiran; Sarkar, Susmita; Khan, Manoranjan; Avinash, K.; Gupta, M. R.

2003-01-01

Dust acoustic (DA) shock wave at high dust density, i.e., the dust electroacoustic (DEA) or dust Coulomb (DC) shock wave has been investigated incorporating the nonadiabatic dust charge variation. The nonlinear DEA (DC) shock wave is seen to be governed by the Korteweg-de Vries Burger equation, in which the Burger term is proportional to the nonadiabaticity generated dissipation. It is seen that the shock strength decreases but after reaching minimum, it increases as the dust space charge density |q d n d | increases and the shock strength of DA wave is greater than that of DEA (DC) wave. Moreover the DEA (DC) shock width increases appreciably with increase mass m i of the ion component of the dusty plasma but for DA shock wave the effect is weak

Comparison of electrodialytic removal of Cu from spiked kaolinite, spiked soil and industrially polluted soil

DEFF Research Database (Denmark)

Ottosen, Lisbeth M.; Lepkova, Katarina; Kubal, Martin

2006-01-01

Electrokinetic remediation methods for removal of heavy metals from polluted soils have been subjected for quite intense research during the past years since these methods are well suitable for fine-grained soils where other remediation methods fail. Electrodialytic remediation is an electrokinetic...... remediation method which is based on applying an electric DC field and the use of ion exchange membranes that ensures the main transport of heavy metals to be out of the pollutes soil. An experimental investigation was made with electrodialytic removal of Cu from spiked kaolinite, spiked soil and industrially...... polluted soil under the same operational conditions (constant current density 0.2 mA/cm2 and duration 28 days). The results of the present paper show that caution must be taken when generalising results obtained in spiked kaolinite to remediation of industrially polluted soils, as it was shown...

Toxicity of nickel-spiked freshwater sediments to benthic invertebrates-Spiking methodology, species sensitivity, and nickel bioavailability

Science.gov (United States)

Besser, John M.; Brumbaugh, William G.; Kemble, Nile E.; Ivey, Chris D.; Kunz, James L.; Ingersoll, Christopher G.; Rudel, David

2011-01-01

This report summarizes data from studies of the toxicity and bioavailability of nickel in nickel-spiked freshwater sediments. The goal of these studies was to generate toxicity and chemistry data to support development of broadly applicable sediment quality guidelines for nickel. The studies were conducted as three tasks, which are presented here as three chapters: Task 1, Development of methods for preparation and toxicity testing of nickel-spiked freshwater sediments; Task 2, Sensitivity of benthic invertebrates to toxicity of nickel-spiked freshwater sediments; and Task 3, Effect of sediment characteristics on nickel bioavailability. Appendices with additional methodological details and raw chemistry and toxicity data for the three tasks are available online at http://pubs.usgs.gov/sir/2011/5225/downloads/.

Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

ViSAPy: a Python tool for biophysics-based generation of virtual spiking activity for evaluation of spike-sorting algorithms.

Science.gov (United States)

Hagen, Espen; Ness, Torbjørn V; Khosrowshahi, Amir; Sørensen, Christina; Fyhn, Marianne; Hafting, Torkel; Franke, Felix; Einevoll, Gaute T

2015-04-30

New, silicon-based multielectrodes comprising hundreds or more electrode contacts offer the possibility to record spike trains from thousands of neurons simultaneously. This potential cannot be realized unless accurate, reliable automated methods for spike sorting are developed, in turn requiring benchmarking data sets with known ground-truth spike times. We here present a general simulation tool for computing benchmarking data for evaluation of spike-sorting algorithms entitled ViSAPy (Virtual Spiking Activity in Python). The tool is based on a well-established biophysical forward-modeling scheme and is implemented as a Python package built on top of the neuronal simulator NEURON and the Python tool LFPy. ViSAPy allows for arbitrary combinations of multicompartmental neuron models and geometries of recording multielectrodes. Three example benchmarking data sets are generated, i.e., tetrode and polytrode data mimicking in vivo cortical recordings and microelectrode array (MEA) recordings of in vitro activity in salamander retinas. The synthesized example benchmarking data mimics salient features of typical experimental recordings, for example, spike waveforms depending on interspike interval. ViSAPy goes beyond existing methods as it includes biologically realistic model noise, synaptic activation by recurrent spiking networks, finite-sized electrode contacts, and allows for inhomogeneous electrical conductivities. ViSAPy is optimized to allow for generation of long time series of benchmarking data, spanning minutes of biological time, by parallel execution on multi-core computers. ViSAPy is an open-ended tool as it can be generalized to produce benchmarking data or arbitrary recording-electrode geometries and with various levels of complexity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

Science.gov (United States)

Boulos, Samy; Nyström, Laura

2017-11-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO�

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

Science.gov (United States)

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

(1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

Science.gov (United States)

Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

2011-08-15

Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

Visually Evoked Spiking Evolves While Spontaneous Ongoing Dynamics Persist

DEFF Research Database (Denmark)

Huys, Raoul; Jirsa, Viktor K; Darokhan, Ziauddin

2016-01-01

attractor. Its existence guarantees that evoked spiking return to the spontaneous state. However, the spontaneous ongoing spiking state and the visual evoked spiking states are qualitatively different and are separated by a threshold (separatrix). The functional advantage of this organization...

Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

Science.gov (United States)

Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

2014-10-22

Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

Multichannel interictal spike activity detection using time-frequency entropy measure.

Science.gov (United States)

Thanaraj, Palani; Parvathavarthini, B

2017-06-01

Localization of interictal spikes is an important clinical step in the pre-surgical assessment of pharmacoresistant epileptic patients. The manual selection of interictal spike periods is cumbersome and involves a considerable amount of analysis workload for the physician. The primary focus of this paper is to automate the detection of interictal spikes for clinical applications in epilepsy localization. The epilepsy localization procedure involves detection of spikes in a multichannel EEG epoch. Therefore, a multichannel Time-Frequency (T-F) entropy measure is proposed to extract features related to the interictal spike activity. Least squares support vector machine is used to train the proposed feature to classify the EEG epochs as either normal or interictal spike period. The proposed T-F entropy measure, when validated with epilepsy dataset of 15 patients, shows an interictal spike classification accuracy of 91.20%, sensitivity of 100% and specificity of 84.23%. Moreover, the area under the curve of Receiver Operating Characteristics plot of 0.9339 shows the superior classification performance of the proposed T-F entropy measure. The results of this paper show a good spike detection accuracy without any prior information about the spike morphology.

Cometary Dust

Science.gov (United States)

Levasseur-Regourd, Anny-Chantal; Agarwal, Jessica; Cottin, Hervé; Engrand, Cécile; Flynn, George; Fulle, Marco; Gombosi, Tamas; Langevin, Yves; Lasue, Jérémie; Mannel, Thurid; Merouane, Sihane; Poch, Olivier; Thomas, Nicolas; Westphal, Andrew

2018-04-01

This review presents our understanding of cometary dust at the end of 2017. For decades, insight about the dust ejected by nuclei of comets had stemmed from remote observations from Earth or Earth's orbit, and from flybys, including the samples of dust returned to Earth for laboratory studies by the Stardust return capsule. The long-duration Rosetta mission has recently provided a huge and unique amount of data, obtained using numerous instruments, including innovative dust instruments, over a wide range of distances from the Sun and from the nucleus. The diverse approaches available to study dust in comets, together with the related theoretical and experimental studies, provide evidence of the composition and physical properties of dust particles, e.g., the presence of a large fraction of carbon in macromolecules, and of aggregates on a wide range of scales. The results have opened vivid discussions on the variety of dust-release processes and on the diversity of dust properties in comets, as well as on the formation of cometary dust, and on its presence in the near-Earth interplanetary medium. These discussions stress the significance of future explorations as a way to decipher the formation and evolution of our Solar System.

Training Deep Spiking Neural Networks Using Backpropagation.

Science.gov (United States)

Lee, Jun Haeng; Delbruck, Tobi; Pfeiffer, Michael

2016-01-01

Deep spiking neural networks (SNNs) hold the potential for improving the latency and energy efficiency of deep neural networks through data-driven event-based computation. However, training such networks is difficult due to the non-differentiable nature of spike events. In this paper, we introduce a novel technique, which treats the membrane potentials of spiking neurons as differentiable signals, where discontinuities at spike times are considered as noise. This enables an error backpropagation mechanism for deep SNNs that follows the same principles as in conventional deep networks, but works directly on spike signals and membrane potentials. Compared with previous methods relying on indirect training and conversion, our technique has the potential to capture the statistics of spikes more precisely. We evaluate the proposed framework on artificially generated events from the original MNIST handwritten digit benchmark, and also on the N-MNIST benchmark recorded with an event-based dynamic vision sensor, in which the proposed method reduces the error rate by a factor of more than three compared to the best previous SNN, and also achieves a higher accuracy than a conventional convolutional neural network (CNN) trained and tested on the same data. We demonstrate in the context of the MNIST task that thanks to their event-driven operation, deep SNNs (both fully connected and convolutional) trained with our method achieve accuracy equivalent with conventional neural networks. In the N-MNIST example, equivalent accuracy is achieved with about five times fewer computational operations.

Spike Code Flow in Cultured Neuronal Networks.

Science.gov (United States)

Tamura, Shinichi; Nishitani, Yoshi; Hosokawa, Chie; Miyoshi, Tomomitsu; Sawai, Hajime; Kamimura, Takuya; Yagi, Yasushi; Mizuno-Matsumoto, Yuko; Chen, Yen-Wei

2016-01-01

We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of "1101" and "1011," which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the "maximum cross-correlations" among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

Grain price spikes and beggar-thy-neighbor policy responses

DEFF Research Database (Denmark)

Jensen, Hans Grinsted; Anderson, Kym

2017-01-01

When prices spike in international grain markets, national governments often reduce the extent to which that spike affects their domestic food markets. Those actions exacerbate the price spike and international welfare transfer associated with that terms of trade change. Several recent analyses...

Spike sorting for polytrodes: a divide and conquer approach

Directory of Open Access Journals (Sweden)

Nicholas V. Swindale

2014-02-01

Full Text Available In order to determine patterns of neural activity, spike signals recorded by extracellular electrodes have to be clustered (sorted with the aim of ensuring that each cluster represents all the spikes generated by an individual neuron. Many methods for spike sorting have been proposed but few are easily applicable to recordings from polytrodes which may have 16 or more recording sites. As with tetrodes, these are spaced sufficiently closely that signals from single neurons will usually be recorded on several adjacent sites. Although this offers a better chance of distinguishing neurons with similarly shaped spikes, sorting is difficult in such cases because of the high dimensionality of the space in which the signals must be classified. This report details a method for spike sorting based on a divide and conquer approach. Clusters are initially formed by assigning each event to the channel on which it is largest. Each channel-based cluster is then sub-divided into as many distinct clusters as possible. These are then recombined on the basis of pairwise tests into a final set of clusters. Pairwise tests are also performed to establish how distinct each cluster is from the others. A modified gradient ascent clustering (GAC algorithm is used to do the clustering. The method can sort spikes with minimal user input in times comparable to real time for recordings lasting up to 45 minutes. Our results illustrate some of the difficulties inherent in spike sorting, including changes in spike shape over time. We show that some physiologically distinct units may have very similar spike shapes. We show that RMS measures of spike shape similarity are not sensitive enough to discriminate clusters that can otherwise be separated by principal components analysis. Hence spike sorting based on least-squares matching to templates may be unreliable. Our methods should be applicable to tetrodes and scaleable to larger multi-electrode arrays (MEAs.

Introduction to spiking neural networks: Information processing, learning and applications.

Science.gov (United States)

Ponulak, Filip; Kasinski, Andrzej

2011-01-01

The concept that neural information is encoded in the firing rate of neurons has been the dominant paradigm in neurobiology for many years. This paradigm has also been adopted by the theory of artificial neural networks. Recent physiological experiments demonstrate, however, that in many parts of the nervous system, neural code is founded on the timing of individual action potentials. This finding has given rise to the emergence of a new class of neural models, called spiking neural networks. In this paper we summarize basic properties of spiking neurons and spiking networks. Our focus is, specifically, on models of spike-based information coding, synaptic plasticity and learning. We also survey real-life applications of spiking models. The paper is meant to be an introduction to spiking neural networks for scientists from various disciplines interested in spike-based neural processing.

Neuronal spike sorting based on radial basis function neural networks

Directory of Open Access Journals (Sweden)

Taghavi Kani M

2011-02-01

Full Text Available "nBackground: Studying the behavior of a society of neurons, extracting the communication mechanisms of brain with other tissues, finding treatment for some nervous system diseases and designing neuroprosthetic devices, require an algorithm to sort neuralspikes automatically. However, sorting neural spikes is a challenging task because of the low signal to noise ratio (SNR of the spikes. The main purpose of this study was to design an automatic algorithm for classifying neuronal spikes that are emitted from a specific region of the nervous system."n "nMethods: The spike sorting process usually consists of three stages: detection, feature extraction and sorting. We initially used signal statistics to detect neural spikes. Then, we chose a limited number of typical spikes as features and finally used them to train a radial basis function (RBF neural network to sort the spikes. In most spike sorting devices, these signals are not linearly discriminative. In order to solve this problem, the aforesaid RBF neural network was used."n "nResults: After the learning process, our proposed algorithm classified any arbitrary spike. The obtained results showed that even though the proposed Radial Basis Spike Sorter (RBSS reached to the same error as the previous methods, however, the computational costs were much lower compared to other algorithms. Moreover, the competitive points of the proposed algorithm were its good speed and low computational complexity."n "nConclusion: Regarding the results of this study, the proposed algorithm seems to serve the purpose of procedures that require real-time processing and spike sorting.

Spiking irregularity and frequency modulate the behavioral report of single-neuron stimulation.

Science.gov (United States)

Doron, Guy; von Heimendahl, Moritz; Schlattmann, Peter; Houweling, Arthur R; Brecht, Michael

2014-02-05

The action potential activity of single cortical neurons can evoke measurable sensory effects, but it is not known how spiking parameters and neuronal subtypes affect the evoked sensations. Here, we examined the effects of spike train irregularity, spike frequency, and spike number on the detectability of single-neuron stimulation in rat somatosensory cortex. For regular-spiking, putative excitatory neurons, detectability increased with spike train irregularity and decreasing spike frequencies but was not affected by spike number. Stimulation of single, fast-spiking, putative inhibitory neurons led to a larger sensory effect compared to regular-spiking neurons, and the effect size depended only on spike irregularity. An ideal-observer analysis suggests that, under our experimental conditions, rats were using integration windows of a few hundred milliseconds or more. Our data imply that the behaving animal is sensitive to single neurons' spikes and even to their temporal patterning. Copyright © 2014 Elsevier Inc. All rights reserved.

Error-backpropagation in temporally encoded networks of spiking neurons

NARCIS (Netherlands)

S.M. Bohte (Sander); J.A. La Poutré (Han); J.N. Kok (Joost)

2000-01-01

textabstractFor a network of spiking neurons that encodes information in the timing of individual spike-times, we derive a supervised learning rule, emph{SpikeProp, akin to traditional error-backpropagation and show how to overcome the discontinuities introduced by thresholding. With this algorithm,

Spike Pattern Structure Influences Synaptic Efficacy Variability Under STDP and Synaptic Homeostasis. I: Spike Generating Models on Converging Motifs

Directory of Open Access Journals (Sweden)

Zedong eBi

2016-02-01

Full Text Available In neural systems, synaptic plasticity is usually driven by spike trains. Due to the inherent noises of neurons and synapses as well as the randomness of connection details, spike trains typically exhibit variability such as spatial randomness and temporal stochasticity, resulting in variability of synaptic changes under plasticity, which we call efficacy variability. How the variability of spike trains influences the efficacy variability of synapses remains unclear. In this paper, we try to understand this influence under pair-wise additive spike-timing dependent plasticity (STDP when the mean strength of plastic synapses into a neuron is bounded (synaptic homeostasis. Specifically, we systematically study, analytically and numerically, how four aspects of statistical features, i.e. synchronous firing, burstiness/regularity, heterogeneity of rates and heterogeneity of cross-correlations, as well as their interactions influence the efficacy variability in converging motifs (simple networks in which one neuron receives from many other neurons. Neurons (including the post-synaptic neuron in a converging motif generate spikes according to statistical models with tunable parameters. In this way, we can explicitly control the statistics of the spike patterns, and investigate their influence onto the efficacy variability, without worrying about the feedback from synaptic changes onto the dynamics of the post-synaptic neuron. We separate efficacy variability into two parts: the drift part (DriftV induced by the heterogeneity of change rates of different synapses, and the diffusion part (DiffV induced by weight diffusion caused by stochasticity of spike trains. Our main findings are: (1 synchronous firing and burstiness tend to increase DiffV, (2 heterogeneity of rates induces DriftV when potentiation and depression in STDP are not balanced, and (3 heterogeneity of cross-correlations induces DriftV together with heterogeneity of rates. We anticipate our

Mimickers of generalized spike and wave discharges.

Science.gov (United States)

Azzam, Raed; Bhatt, Amar B

2014-06-01

Overinterpretation of benign EEG variants is a common problem that can lead to the misdiagnosis of epilepsy. We review four normal patterns that mimic generalized spike and wave discharges: phantom spike-and-wave, hyperventilation hypersynchrony, hypnagogic/ hypnopompic hypersynchrony, and mitten patterns.

A Cross-Correlated Delay Shift Supervised Learning Method for Spiking Neurons with Application to Interictal Spike Detection in Epilepsy.

Science.gov (United States)

Guo, Lilin; Wang, Zhenzhong; Cabrerizo, Mercedes; Adjouadi, Malek

2017-05-01

This study introduces a novel learning algorithm for spiking neurons, called CCDS, which is able to learn and reproduce arbitrary spike patterns in a supervised fashion allowing the processing of spatiotemporal information encoded in the precise timing of spikes. Unlike the Remote Supervised Method (ReSuMe), synapse delays and axonal delays in CCDS are variants which are modulated together with weights during learning. The CCDS rule is both biologically plausible and computationally efficient. The properties of this learning rule are investigated extensively through experimental evaluations in terms of reliability, adaptive learning performance, generality to different neuron models, learning in the presence of noise, effects of its learning parameters and classification performance. Results presented show that the CCDS learning method achieves learning accuracy and learning speed comparable with ReSuMe, but improves classification accuracy when compared to both the Spike Pattern Association Neuron (SPAN) learning rule and the Tempotron learning rule. The merit of CCDS rule is further validated on a practical example involving the automated detection of interictal spikes in EEG records of patients with epilepsy. Results again show that with proper encoding, the CCDS rule achieves good recognition performance.

Enzymatic hydrolysis on protein and β-glucan content of Sang-yodrice bran hydrolysatesand their anti-inflammatory activityonRAW 264.7 cells

Directory of Open Access Journals (Sweden)

Natcha Phantuwong

2017-12-01

Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9

Unsupervised spike sorting based on discriminative subspace learning.

Science.gov (United States)

Keshtkaran, Mohammad Reza; Yang, Zhi

2014-01-01

Spike sorting is a fundamental preprocessing step for many neuroscience studies which rely on the analysis of spike trains. In this paper, we present two unsupervised spike sorting algorithms based on discriminative subspace learning. The first algorithm simultaneously learns the discriminative feature subspace and performs clustering. It uses histogram of features in the most discriminative projection to detect the number of neurons. The second algorithm performs hierarchical divisive clustering that learns a discriminative 1-dimensional subspace for clustering in each level of the hierarchy until achieving almost unimodal distribution in the subspace. The algorithms are tested on synthetic and in-vivo data, and are compared against two widely used spike sorting methods. The comparative results demonstrate that our spike sorting methods can achieve substantially higher accuracy in lower dimensional feature space, and they are highly robust to noise. Moreover, they provide significantly better cluster separability in the learned subspace than in the subspace obtained by principal component analysis or wavelet transform.

Multiplexed Spike Coding and Adaptation in the Thalamus

Directory of Open Access Journals (Sweden)

Rebecca A. Mease

2017-05-01

Full Text Available High-frequency “burst” clusters of spikes are a generic output pattern of many neurons. While bursting is a ubiquitous computational feature of different nervous systems across animal species, the encoding of synaptic inputs by bursts is not well understood. We find that bursting neurons in the rodent thalamus employ “multiplexing” to differentially encode low- and high-frequency stimulus features associated with either T-type calcium “low-threshold” or fast sodium spiking events, respectively, and these events adapt differently. Thus, thalamic bursts encode disparate information in three channels: (1 burst size, (2 burst onset time, and (3 precise spike timing within bursts. Strikingly, this latter “intraburst” encoding channel shows millisecond-level feature selectivity and adapts across statistical contexts to maintain stable information encoded per spike. Consequently, calcium events both encode low-frequency stimuli and, in parallel, gate a transient window for high-frequency, adaptive stimulus encoding by sodium spike timing, allowing bursts to efficiently convey fine-scale temporal information.

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

Science.gov (United States)

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

Implementing Signature Neural Networks with Spiking Neurons.

Science.gov (United States)

Carrillo-Medina, José Luis; Latorre, Roberto

2016-01-01

Spiking Neural Networks constitute the most promising approach to develop realistic Artificial Neural Networks (ANNs). Unlike traditional firing rate-based paradigms, information coding in spiking models is based on the precise timing of individual spikes. It has been demonstrated that spiking ANNs can be successfully and efficiently applied to multiple realistic problems solvable with traditional strategies (e.g., data classification or pattern recognition). In recent years, major breakthroughs in neuroscience research have discovered new relevant computational principles in different living neural systems. Could ANNs benefit from some of these recent findings providing novel elements of inspiration? This is an intriguing question for the research community and the development of spiking ANNs including novel bio-inspired information coding and processing strategies is gaining attention. From this perspective, in this work, we adapt the core concepts of the recently proposed Signature Neural Network paradigm-i.e., neural signatures to identify each unit in the network, local information contextualization during the processing, and multicoding strategies for information propagation regarding the origin and the content of the data-to be employed in a spiking neural network. To the best of our knowledge, none of these mechanisms have been used yet in the context of ANNs of spiking neurons. This paper provides a proof-of-concept for their applicability in such networks. Computer simulations show that a simple network model like the discussed here exhibits complex self-organizing properties. The combination of multiple simultaneous encoding schemes allows the network to generate coexisting spatio-temporal patterns of activity encoding information in different spatio-temporal spaces. As a function of the network and/or intra-unit parameters shaping the corresponding encoding modality, different forms of competition among the evoked patterns can emerge even in the absence

Effect of heavy metals on pH buffering capacity and solubility of Ca, Mg, K, and P in non-spiked and heavy metal-spiked soils.

Science.gov (United States)

Najafi, Sarvenaz; Jalali, Mohsen

2016-06-01

In many parts of the world, soil acidification and heavy metal contamination has become a serious concern due to the adverse effects on chemical properties of soil and crop yield. The aim of this study was to investigate the effect of pH (in the range of 1 to 3 units above and below the native pH of soils) on calcium (Ca), magnesium (Mg), potassium (K), and phosphorus (P) solubility in non-spiked and heavy metal-spiked soil samples. Spiked samples were prepared by cadmium (Cd), copper (Cu), nickel (Ni), and zinc (Zn) as chloride salts and incubating soils for 40 days. The pH buffering capacity (pHBC) of each sample was determined by plotting the amount of H(+) or OH(-) added (mmol kg(-1)) versus the related pH value. The pHBC of soils ranged from 47.1 to 1302.5 mmol kg(-1) for non-spiked samples and from 45.0 to 1187.4 mmol kg(-1) for spiked soil samples. The pHBC values were higher in soil 2 (non-spiked and spiked) which had higher calcium carbonate content. The results indicated the presence of heavy metals in soils generally decreased the solution pH and pHBC values in spiked samples. In general, solubility of Ca, Mg, and K decreased with increasing equilibrium pH of non-spiked and spiked soil samples. In the case of P, increasing the pH to about 7, decreased the solubility in all soils but further increase of pH from 7, enhanced P solubility. The solubility trends and values for Ca, Mg, and K did not differed significantly in non-spiked and spiked samples. But in the case of P, a reduction in solubility was observed in heavy metal-spiked soils. The information obtained in this study can be useful to make better estimation of the effects of soil pollutants on anion and cation solubility from agricultural and environmental viewpoints.

Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

NARCIS (Netherlands)

Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

1979-01-01

A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

The Mutation Frequency in Different Spike Categories in Barley

DEFF Research Database (Denmark)

Frydenberg, O.; Doll, Hans; Sandfær, J.

1964-01-01

After gamma irradiation of barley seeds, a comparison has been made between the chlorophyll-mutant frequencies in X1 spikes that had multicellular bud meristems in the seeds at the time of treatment (denoted as pre-formed spikes) and X1 spikes having no recognizable meristems at the time...

Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2014-01-01

Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

Orthobunyavirus ultrastructure and the curious tripodal glycoprotein spike.

Directory of Open Access Journals (Sweden)

Thomas A Bowden

Full Text Available The genus Orthobunyavirus within the family Bunyaviridae constitutes an expanding group of emerging viruses, which threaten human and animal health. Despite the medical importance, little is known about orthobunyavirus structure, a prerequisite for understanding virus assembly and entry. Here, using electron cryo-tomography, we report the ultrastructure of Bunyamwera virus, the prototypic member of this genus. Whilst Bunyamwera virions are pleomorphic in shape, they display a locally ordered lattice of glycoprotein spikes. Each spike protrudes 18 nm from the viral membrane and becomes disordered upon introduction to an acidic environment. Using sub-tomogram averaging, we derived a three-dimensional model of the trimeric pre-fusion glycoprotein spike to 3-nm resolution. The glycoprotein spike consists mainly of the putative class-II fusion glycoprotein and exhibits a unique tripod-like arrangement. Protein-protein contacts between neighbouring spikes occur at membrane-proximal regions and intra-spike contacts at membrane-distal regions. This trimeric assembly deviates from previously observed fusion glycoprotein arrangements, suggesting a greater than anticipated repertoire of viral fusion glycoprotein oligomerization. Our study provides evidence of a pH-dependent conformational change that occurs during orthobunyaviral entry into host cells and a blueprint for the structure of this group of emerging pathogens.

Independent component analysis separates spikes of different origin in the EEG.

Science.gov (United States)

Urrestarazu, Elena; Iriarte, Jorge; Artieda, Julio; Alegre, Manuel; Valencia, Miguel; Viteri, César

2006-02-01

Independent component analysis (ICA) is a novel system that finds independent sources in recorded signals. Its usefulness in separating epileptiform activity of different origin has not been determined. The goal of this study was to demonstrate that ICA is useful for separating different spikes using samples of EEG of patients with focal epilepsy. Digital EEG samples from four patients with focal epilepsy were included. The patients had temporal (n = 2), centrotemporal (n = 1) or frontal spikes (n = 1). Twenty-six samples with two (or more) spikes from two different patients were created. The selection of the two spikes for each mixed EEG was performed randomly, trying to have all the different combinations and rejecting the mixture of two spikes from the same patient. Two different examiners studied the EEGs using ICA with JADE paradigm in Matlab platform, trying to separate and to identify the spikes. They agreed in the correct separation of the spikes in 24 of the 26 samples, classifying the spikes as frontal, temporal or centrotemporal, left or right sided. The demonstration of the possibility of detecting different artificially mixed spikes confirms that ICA may be useful in separating spikes or other elements in real EEGs.

Spiking and bursting patterns of fractional-order Izhikevich model

Science.gov (United States)

Teka, Wondimu W.; Upadhyay, Ranjit Kumar; Mondal, Argha

2018-03-01

Bursting and spiking oscillations play major roles in processing and transmitting information in the brain through cortical neurons that respond differently to the same signal. These oscillations display complex dynamics that might be produced by using neuronal models and varying many model parameters. Recent studies have shown that models with fractional order can produce several types of history-dependent neuronal activities without the adjustment of several parameters. We studied the fractional-order Izhikevich model and analyzed different kinds of oscillations that emerge from the fractional dynamics. The model produces a wide range of neuronal spike responses, including regular spiking, fast spiking, intrinsic bursting, mixed mode oscillations, regular bursting and chattering, by adjusting only the fractional order. Both the active and silent phase of the burst increase when the fractional-order model further deviates from the classical model. For smaller fractional order, the model produces memory dependent spiking activity after the pulse signal turned off. This special spiking activity and other properties of the fractional-order model are caused by the memory trace that emerges from the fractional-order dynamics and integrates all the past activities of the neuron. On the network level, the response of the neuronal network shifts from random to scale-free spiking. Our results suggest that the complex dynamics of spiking and bursting can be the result of the long-term dependence and interaction of intracellular and extracellular ionic currents.

Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

2017-04-01

Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Spike Bursts from an Excitable Optical System

Science.gov (United States)

Rios Leite, Jose R.; Rosero, Edison J.; Barbosa, Wendson A. S.; Tredicce, Jorge R.

Diode Lasers with double optical feedback are shown to present power drop spikes with statistical distribution controllable by the ratio of the two feedback times. The average time between spikes and the variance within long time series are studied. The system is shown to be excitable and present bursting of spikes created with specific feedback time ratios and strength. A rate equation model, extending the Lang-Kobayashi single feedback for semiconductor lasers proves to match the experimental observations. Potential applications to construct network to mimic neural systems having controlled bursting properties in each unit will be discussed. Brazilian Agency CNPQ.

Spike Code Flow in Cultured Neuronal Networks

Directory of Open Access Journals (Sweden)

Shinichi Tamura

2016-01-01

Full Text Available We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of “1101” and “1011,” which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the “maximum cross-correlations” among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

Science.gov (United States)

de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

2017-12-20

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

Directory of Open Access Journals (Sweden)

Asli Akyol

2014-09-01

Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

Science.gov (United States)

Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

2014-09-23

The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

Directory of Open Access Journals (Sweden)

Eduardo Madrigal-Bujaidar

2015-06-01

Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

Concentrations of legacy and novel brominated flame retardants in indoor dust in Melbourne, Australia: An assessment of human exposure.

Science.gov (United States)

McGrath, Thomas J; Morrison, Paul D; Ball, Andrew S; Clarke, Bradley O

2018-04-01

Polybrominated diphenyl ethers (PBDEs) and novel brominated flame retardants (NBFR) have been used in a range of polymers to inhibit the spread of fires but also have a propensity to migrate out of consumer materials and contaminate indoor dust. In this study, a total of 57 dust samples were collected from 12 homes, eight offices and eight vehicles in Melbourne, Australia and analysed for eight PBDEs (-28, -47, -99, -100, -153, -154, -183 and -209) and seven NBFRs (PBT, PBEB, HBB, EH-TBB, BEH-TEBP, BTBPE and DBDPE) to determine human exposure risks from dust ingestion. Samples were analysed using selective pressurized liquid extraction (S-PLE) and gas chromatography coupled to tandem mass spectrometry (GC-MS/MS). Legacy and replacement flame retardants were detected in all samples with overall ∑PBDE concentrations ranging from 120 to 1700,000 ng/g (median 2100 ng/g) and ∑NBFRs ranging from 1.1 to 10,000 ng/g (median 1800 ng/g). BDE-209 and DBDPE were the dominant compounds in dust samples, followed by congeners associated with commercial Penta-BDE formulations (-47, -99, -100, -153 and -154) and then EH-TBB of the FireMaster 550 and BZ-54 products. ∑Penta-BDE concentrations were elevated in office samples compared with homes and vehicles, while EH-TBB and BDE-209 measured higher concentrations in vehicles compared with their respective levels in homes and offices. Risk assessment estimates revealed the majority of exposure to occur in the home for both adults and toddlers in the City of Melbourne. Generally, body weight adjusted exposure to PBDEs and NBFRs was predicted to be 1 to 2 orders of magnitude higher for toddlers than adults. Estimated rates of BDE-47, -99, -153 and -209 ingestion were each 2 orders of magnitude or more below the USEPA's prescribed oral reference dose values (RfDs) for typical exposure scenarios. However, exposure rates for BDE-47 and -99 reached as high as 52 and 95% of RfDs, respectively, for adults and 4.4 and 7

Comparison of Classifier Architectures for Online Neural Spike Sorting.

Science.gov (United States)

Saeed, Maryam; Khan, Amir Ali; Kamboh, Awais Mehmood

2017-04-01

High-density, intracranial recordings from micro-electrode arrays need to undergo Spike Sorting in order to associate the recorded neuronal spikes to particular neurons. This involves spike detection, feature extraction, and classification. To reduce the data transmission and power requirements, on-chip real-time processing is becoming very popular. However, high computational resources are required for classifiers in on-chip spike-sorters, making scalability a great challenge. In this review paper, we analyze several popular classifiers to propose five new hardware architectures using the off-chip training with on-chip classification approach. These include support vector classification, fuzzy C-means classification, self-organizing maps classification, moving-centroid K-means classification, and Cosine distance classification. The performance of these architectures is analyzed in terms of accuracy and resource requirement. We establish that the neural networks based Self-Organizing Maps classifier offers the most viable solution. A spike sorter based on the Self-Organizing Maps classifier, requires only 7.83% of computational resources of the best-reported spike sorter, hierarchical adaptive means, while offering a 3% better accuracy at 7 dB SNR.

Automatic fitting of spiking neuron models to electrophysiological recordings

Directory of Open Access Journals (Sweden)

Cyrille Rossant

2010-03-01

Full Text Available Spiking models can accurately predict the spike trains produced by cortical neurons in response to somatically injected currents. Since the specific characteristics of the model depend on the neuron, a computational method is required to fit models to electrophysiological recordings. The fitting procedure can be very time consuming both in terms of computer simulations and in terms of code writing. We present algorithms to fit spiking models to electrophysiological data (time-varying input and spike trains that can run in parallel on graphics processing units (GPUs. The model fitting library is interfaced with Brian, a neural network simulator in Python. If a GPU is present it uses just-in-time compilation to translate model equations into optimized code. Arbitrary models can then be defined at script level and run on the graphics card. This tool can be used to obtain empirically validated spiking models of neurons in various systems. We demonstrate its use on public data from the INCF Quantitative Single-Neuron Modeling 2009 competition by comparing the performance of a number of neuron spiking models.

Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

Science.gov (United States)

Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

2017-08-15

Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

Science.gov (United States)

Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

2014-03-19

A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

Scaling of spiking and humping in keyhole welding

Energy Technology Data Exchange (ETDEWEB)

Wei, P S; Chuang, K C [Department of Mechanical and Electro-Mechanical Engineering, National Sun Yat-Sen University, Kaohsiung, Taiwan (China); DebRoy, T [Department of Materials Science and Engineering, The Pennsylvania State University, University Park, PA 16802 (United States); Ku, J S, E-mail: pswei@mail.nsysu.edu.tw, E-mail: cielo.zhuang@gmail.com, E-mail: rtd1@psu.edu, E-mail: jsku@mail.nsysu.edu.tw [Institute of Materials Science and Engineering, National Sun Yat-Sen University, Kaohsiung, Taiwan (China)

2011-06-22

Spiking, rippling and humping seriously reduce the strength of welds. The effects of beam focusing, volatile alloying element concentration and welding velocity on spiking, coarse rippling and humping in keyhole mode electron-beam welding are examined through scale analysis. Although these defects have been studied in the past, the mechanisms for their formation are not fully understood. This work relates the average amplitudes of spikes to fusion zone depth for the welding of Al 6061, SS 304 and carbon steel, and Al 5083. The scale analysis introduces welding and melting efficiencies and an appropriate power distribution to account for the focusing effects, and the energy which is reflected and escapes through the keyhole opening to the surroundings. The frequency of humping and spiking can also be predicted from the scale analysis. The analysis also reveals the interrelation between coarse rippling and humping. The data and the mechanistic findings reported in this study are useful for understanding and preventing spiking and humping during keyhole mode electron and laser beam welding.

A metric space approach to the information capacity of spike trains

OpenAIRE

HOUGHTON, CONOR JAMES; GILLESPIE, JAMES

2010-01-01

PUBLISHED Classical information theory can be either discrete or continuous, corresponding to discrete or continuous random variables. However, although spike times in a spike train are described by continuous variables, the information content is usually calculated using discrete information theory. This is because the number of spikes, and hence, the number of variables, varies from spike train to spike train, making the continuous theory difficult to apply.It is possible to avoid ...

Clustering predicts memory performance in networks of spiking and non-spiking neurons

Directory of Open Access Journals (Sweden)

Weiliang eChen

2011-03-01

Full Text Available The problem we address in this paper is that of finding effective and parsimonious patterns of connectivity in sparse associative memories. This problem must be addressed in real neuronal systems, so that results in artificial systems could throw light on real systems. We show that there are efficient patterns of connectivity and that these patterns are effective in models with either spiking or non-spiking neurons. This suggests that there may be some underlying general principles governing good connectivity in such networks. We also show that the clustering of the network, measured by Clustering Coefficient, has a strong linear correlation to the performance of associative memory. This result is important since a purely static measure of network connectivity appears to determine an important dynamic property of the network.

Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

Czech Academy of Sciences Publication Activity Database

Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

2016-01-01

Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

Voltage-spike analysis for a free-running parallel inverter

Science.gov (United States)

Lee, F. C. Y.; Wilson, T. G.

1974-01-01

Unwanted and sometimes damaging high-amplitude voltage spikes occur during each half cycle in many transistor saturable-core inverters at the moment when the core saturates and the transistors switch. The analysis shows that spikes are an intrinsic characteristic of certain types of inverters even with negligible leakage inductance and purely resistive load. The small but unavoidable after-saturation inductance of the saturable-core transformer plays an essential role in creating these undesired thigh-voltage spikes. State-plane analysis provides insight into the complex interaction between core and transistors, and shows the circuit parameters upon which the magnitude of these spikes depends.

In-reactor creep of zirconium alloys by thermal spikes

International Nuclear Information System (INIS)

Ibrahim, E.F.

1975-01-01

The size and duration of thermal spikes from fast neutrons have been calculated for zirconium alloys, showing that spikes up to 1.8 nm radius may exist for 2 x 10 -11 s at greater than melting point, at 570K ambient temperature. Creep rates have been calculated assuming that the elastic strain from the applied stress relaxes in the volume of the spikes (by preferential loop alignment or modification of an existing dislocation network). The calculated rates are consistent with strain rates observed in long term tests-in-reactor, if spike lifetimes are 2 to 2.5 x 10 -11 s. (Auth.)

Automated spike preparation system for Isotope Dilution Mass Spectrometry (IDMS)

International Nuclear Information System (INIS)

Maxwell, S.L. III; Clark, J.P.

1990-01-01

Isotope Dilution Mass Spectrometry (IDMS) is a method frequently employed to measure dissolved, irradiated nuclear materials. A known quantity of a unique isotope of the element to be measured (referred to as the ''spike'') is added to the solution containing the analyte. The resulting solution is chemically purified then analyzed by mass spectrometry. By measuring the magnitude of the response for each isotope and the response for the ''unique spike'' then relating this to the known quantity of the ''spike'', the quantity of the nuclear material can be determined. An automated spike preparation system was developed at the Savannah River Site (SRS) to dispense spikes for use in IDMS analytical methods. Prior to this development, technicians weighed each individual spike manually to achieve the accuracy required. This procedure was time-consuming and subjected the master stock solution to evaporation. The new system employs a high precision SMI Model 300 Unipump dispenser interfaced with an electronic balance and a portable Epson HX-20 notebook computer to automate spike preparation

Spike-threshold adaptation predicted by membrane potential dynamics in vivo.

Directory of Open Access Journals (Sweden)

Bertrand Fontaine

2014-04-01

Full Text Available Neurons encode information in sequences of spikes, which are triggered when their membrane potential crosses a threshold. In vivo, the spiking threshold displays large variability suggesting that threshold dynamics have a profound influence on how the combined input of a neuron is encoded in the spiking. Threshold variability could be explained by adaptation to the membrane potential. However, it could also be the case that most threshold variability reflects noise and processes other than threshold adaptation. Here, we investigated threshold variation in auditory neurons responses recorded in vivo in barn owls. We found that spike threshold is quantitatively predicted by a model in which the threshold adapts, tracking the membrane potential at a short timescale. As a result, in these neurons, slow voltage fluctuations do not contribute to spiking because they are filtered by threshold adaptation. More importantly, these neurons can only respond to input spikes arriving together on a millisecond timescale. These results demonstrate that fast adaptation to the membrane potential captures spike threshold variability in vivo.

Reface, remodel, or rebuild your dental office.

Science.gov (United States)

Werhan, J Haden

2010-07-01

Upgrades to a dental practice can range from a minor facelift to all new construction. Consulting a certified public accountant is important to properly account for all the various assets that go into a new office so the tax benefits from each can be optimized. After all the dust has settled, practitioners will be able to take pride in their new dental facility and enjoy their surroundings for many years to come.

An Overview of Bayesian Methods for Neural Spike Train Analysis

Directory of Open Access Journals (Sweden)

Zhe Chen

2013-01-01

Full Text Available Neural spike train analysis is an important task in computational neuroscience which aims to understand neural mechanisms and gain insights into neural circuits. With the advancement of multielectrode recording and imaging technologies, it has become increasingly demanding to develop statistical tools for analyzing large neuronal ensemble spike activity. Here we present a tutorial overview of Bayesian methods and their representative applications in neural spike train analysis, at both single neuron and population levels. On the theoretical side, we focus on various approximate Bayesian inference techniques as applied to latent state and parameter estimation. On the application side, the topics include spike sorting, tuning curve estimation, neural encoding and decoding, deconvolution of spike trains from calcium imaging signals, and inference of neuronal functional connectivity and synchrony. Some research challenges and opportunities for neural spike train analysis are discussed.

Dust Measurements in Tokamaks

International Nuclear Information System (INIS)

Rudakov, D; Yu, J; Boedo, J; Hollmann, E; Krasheninnikov, S; Moyer, R; Muller, S; Yu, A; Rosenberg, M; Smirnov, R; West, W; Boivin, R; Bray, B; Brooks, N; Hyatt, A; Wong, C; Fenstermacher, M; Groth, M; Lasnier, C; McLean, A; Stangeby, P; Ratynskaia, S; Roquemore, A; Skinner, C; Solomon, W M

2008-01-01

Dust production and accumulation impose safety and operational concerns for ITER. Diagnostics to monitor dust levels in the plasma as well as in-vessel dust inventory are currently being tested in a few tokamaks. Dust accumulation in ITER is likely to occur in hidden areas, e.g. between tiles and under divertor baffles. A novel electrostatic dust detector for monitoring dust in these regions has been developed and tested at PPPL. In DIII-D tokamak dust diagnostics include Mie scattering from Nd:YAG lasers, visible imaging, and spectroscopy. Laser scattering resolves size of particles between 0.16-1.6 (micro)m in diameter; the total dust content in the edge plasmas and trends in the dust production rates within this size range have been established. Individual dust particles are observed by visible imaging using fast-framing cameras, detecting dust particles of a few microns in diameter and larger. Dust velocities and trajectories can be determined in 2D with a single camera or 3D using multiple cameras, but determination of particle size is problematic. In order to calibrate diagnostics and benchmark dust dynamics modeling, pre-characterized carbon dust has been injected into the lower divertor of DIII-D. Injected dust is seen by cameras, and spectroscopic diagnostics observe an increase of carbon atomic, C2 dimer, and thermal continuum emissions from the injected dust. The latter observation can be used in the design of novel dust survey diagnostics

Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

Science.gov (United States)

We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

An Unsupervised Online Spike-Sorting Framework.

Science.gov (United States)

Knieling, Simeon; Sridharan, Kousik S; Belardinelli, Paolo; Naros, Georgios; Weiss, Daniel; Mormann, Florian; Gharabaghi, Alireza

2016-08-01

Extracellular neuronal microelectrode recordings can include action potentials from multiple neurons. To separate spikes from different neurons, they can be sorted according to their shape, a procedure referred to as spike-sorting. Several algorithms have been reported to solve this task. However, when clustering outcomes are unsatisfactory, most of them are difficult to adjust to achieve the desired results. We present an online spike-sorting framework that uses feature normalization and weighting to maximize the distinctiveness between different spike shapes. Furthermore, multiple criteria are applied to either facilitate or prevent cluster fusion, thereby enabling experimenters to fine-tune the sorting process. We compare our method to established unsupervised offline (Wave_Clus (WC)) and online (OSort (OS)) algorithms by examining their performance in sorting various test datasets using two different scoring systems (AMI and the Adamos metric). Furthermore, we evaluate sorting capabilities on intra-operative recordings using established quality metrics. Compared to WC and OS, our algorithm achieved comparable or higher scores on average and produced more convincing sorting results for intra-operative datasets. Thus, the presented framework is suitable for both online and offline analysis and could substantially improve the quality of microelectrode-based data evaluation for research and clinical application.

Emergent dynamics of spiking neurons with fluctuating threshold

Science.gov (United States)

Bhattacharjee, Anindita; Das, M. K.

2017-05-01

Role of fluctuating threshold on neuronal dynamics is investigated. The threshold function is assumed to follow a normal probability distribution. Standard deviation of inter-spike interval of the response is computed as an indicator of irregularity in spike emission. It has been observed that, the irregularity in spiking is more if the threshold variation is more. A significant change in modal characteristics of Inter Spike Intervals (ISI) is seen to occur as a function of fluctuation parameter. Investigation is further carried out for coupled system of neurons. Cooperative dynamics of coupled neurons are discussed in view of synchronization. Total and partial synchronization regimes are depicted with the help of contour plots of synchrony measure under various conditions. Results of this investigation may provide a basis for exploring the complexities of neural communication and brain functioning.

Practical tips for dealing with office construction and repair.

Science.gov (United States)

Hills, Laura Sachs

2008-01-01

Many medical practices embark on a large office construction project sooner or later. When they do, the medical practice staff often finds itself up to its eyeballs in dust, debris, and confusion. This article suggests practical strategies for the medical practice staff to help employees cope with the inevitable challenges before, during, and after an office construction project. It suggests a strategy for a staff kick-off meeting and for establishing staff to-do lists throughout the project. It offers 10 practical staff strategies before the project begins including doing preparatory work with patients and neighbors and establishing a chain of communication. The article also offers tips for ensuring safety during office construction and ways to use a construction project as a springboard for goodwill-building and practice-marketing activities. Finally, this article offers advice about maintaining the daily schedule of the practice during a large-scale office construction project.

Single-trial estimation of stimulus and spike-history effects on time-varying ensemble spiking activity of multiple neurons: a simulation study

International Nuclear Information System (INIS)

Shimazaki, Hideaki

2013-01-01

Neurons in cortical circuits exhibit coordinated spiking activity, and can produce correlated synchronous spikes during behavior and cognition. We recently developed a method for estimating the dynamics of correlated ensemble activity by combining a model of simultaneous neuronal interactions (e.g., a spin-glass model) with a state-space method (Shimazaki et al. 2012 PLoS Comput Biol 8 e1002385). This method allows us to estimate stimulus-evoked dynamics of neuronal interactions which is reproducible in repeated trials under identical experimental conditions. However, the method may not be suitable for detecting stimulus responses if the neuronal dynamics exhibits significant variability across trials. In addition, the previous model does not include effects of past spiking activity of the neurons on the current state of ensemble activity. In this study, we develop a parametric method for simultaneously estimating the stimulus and spike-history effects on the ensemble activity from single-trial data even if the neurons exhibit dynamics that is largely unrelated to these effects. For this goal, we model ensemble neuronal activity as a latent process and include the stimulus and spike-history effects as exogenous inputs to the latent process. We develop an expectation-maximization algorithm that simultaneously achieves estimation of the latent process, stimulus responses, and spike-history effects. The proposed method is useful to analyze an interaction of internal cortical states and sensory evoked activity

The electric potential of tripolar spikes

Energy Technology Data Exchange (ETDEWEB)

Nocera, L. [Theoretical Plasma Physics, IPCF-CNR, Via Moruzzi 1, I-56124 Pisa (Italy)

2010-02-22

We present an analytical formula for the waveform of the electric potential associated with a tripolar spike in a plasma. This formula is based on the construction and on the subsequent solution of a differential equation for the waveform. We work out this equation as a direct consequence of the morphological and functional properties of the observed waveform, without making any reference to the velocity distributions of the electrons and of the ions which sustain the spike. In the approximation of small potential amplitudes, we solve this equation by quadrature. In particular, in the second order approximation, the solution of this equation is given in terms of elementary functions. This analytical solution is able to reproduce the potential waveforms associated with electron holes, ion holes, monotonic and nonmonotonic double layers and tripolar spikes, in excellent agreement with observations.

The electric potential of tripolar spikes

International Nuclear Information System (INIS)

Nocera, L.

2010-01-01

We present an analytical formula for the waveform of the electric potential associated with a tripolar spike in a plasma. This formula is based on the construction and on the subsequent solution of a differential equation for the waveform. We work out this equation as a direct consequence of the morphological and functional properties of the observed waveform, without making any reference to the velocity distributions of the electrons and of the ions which sustain the spike. In the approximation of small potential amplitudes, we solve this equation by quadrature. In particular, in the second order approximation, the solution of this equation is given in terms of elementary functions. This analytical solution is able to reproduce the potential waveforms associated with electron holes, ion holes, monotonic and nonmonotonic double layers and tripolar spikes, in excellent agreement with observations.

Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

Science.gov (United States)

Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

2015-05-04

The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

Noisy Spiking in Visual Area V2 of Amblyopic Monkeys.

Science.gov (United States)

Wang, Ye; Zhang, Bin; Tao, Xiaofeng; Wensveen, Janice M; Smith, Earl L; Chino, Yuzo M

2017-01-25

Interocular decorrelation of input signals in developing visual cortex can cause impaired binocular vision and amblyopia. Although increased intrinsic noise is thought to be responsible for a range of perceptual deficits in amblyopic humans, the neural basis for the elevated perceptual noise in amblyopic primates is not known. Here, we tested the idea that perceptual noise is linked to the neuronal spiking noise (variability) resulting from developmental alterations in cortical circuitry. To assess spiking noise, we analyzed the contrast-dependent dynamics of spike counts and spiking irregularity by calculating the square of the coefficient of variation in interspike intervals (CV 2 ) and the trial-to-trial fluctuations in spiking, or mean matched Fano factor (m-FF) in visual area V2 of monkeys reared with chronic monocular defocus. In amblyopic neurons, the contrast versus response functions and the spike count dynamics exhibited significant deviations from comparable data for normal monkeys. The CV 2 was pronounced in amblyopic neurons for high-contrast stimuli and the m-FF was abnormally high in amblyopic neurons for low-contrast gratings. The spike count, CV 2 , and m-FF of spontaneous activity were also elevated in amblyopic neurons. These contrast-dependent spiking irregularities were correlated with the level of binocular suppression in these V2 neurons and with the severity of perceptual loss for individual monkeys. Our results suggest that the developmental alterations in normalization mechanisms resulting from early binocular suppression can explain much of these contrast-dependent spiking abnormalities in V2 neurons and the perceptual performance of our amblyopic monkeys. Amblyopia is a common developmental vision disorder in humans. Despite the extensive animal studies on how amblyopia emerges, we know surprisingly little about the neural basis of amblyopia in humans and nonhuman primates. Although the vision of amblyopic humans is often described as

Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B

2016-08-01

In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Synchronous spikes are necessary but not sufficient for a synchrony code in populations of spiking neurons.

Science.gov (United States)

Grewe, Jan; Kruscha, Alexandra; Lindner, Benjamin; Benda, Jan

2017-03-07

Synchronous activity in populations of neurons potentially encodes special stimulus features. Selective readout of either synchronous or asynchronous activity allows formation of two streams of information processing. Theoretical work predicts that such a synchrony code is a fundamental feature of populations of spiking neurons if they operate in specific noise and stimulus regimes. Here we experimentally test the theoretical predictions by quantifying and comparing neuronal response properties in tuberous and ampullary electroreceptor afferents of the weakly electric fish Apteronotus leptorhynchus These related systems show similar levels of synchronous activity, but only in the more irregularly firing tuberous afferents a synchrony code is established, whereas in the more regularly firing ampullary afferents it is not. The mere existence of synchronous activity is thus not sufficient for a synchrony code. Single-cell features such as the irregularity of spiking and the frequency dependence of the neuron's transfer function determine whether synchronous spikes possess a distinct meaning for the encoding of time-dependent signals.

Voltage spikes in Nb3Sn and NbTi strands

International Nuclear Information System (INIS)

Bordini, B.; Ambrosio, G.; Barzi, E.; Carcagno, R.; Feher, S.; Kashikhin, V.V.; Lamm, M.J.; Orris, D.; Tartaglia, M.; Tompkins, J.C.; Turrioni, D.; Yamada, R.; Zlobin, A.V.; Fermilab

2005-01-01

As part of the High Field Magnet program at Fermilab several NbTi and Nb 3 Sn strands were tested with particular emphasis on the study of voltage spikes and their relationship to superconductor instabilities. The voltage spikes were detected under various experimental conditions using voltage-current (V-I) and voltage-field (V-H) methods. Two types of spikes, designated ''magnetization'' and ''transport current'' spikes, have been identified. Their origin is most likely related to magnetization flux jump and transport current redistribution, respectively. Many of the signals observed appear to be a combination of these two types of spikes; the combination of these two instability mechanisms should play a dominant role in determining the minimum quench current

A supervised learning rule for classification of spatiotemporal spike patterns.

Science.gov (United States)

Lilin Guo; Zhenzhong Wang; Adjouadi, Malek

2016-08-01

This study introduces a novel supervised algorithm for spiking neurons that take into consideration synapse delays and axonal delays associated with weights. It can be utilized for both classification and association and uses several biologically influenced properties, such as axonal and synaptic delays. This algorithm also takes into consideration spike-timing-dependent plasticity as in Remote Supervised Method (ReSuMe). This paper focuses on the classification aspect alone. Spiked neurons trained according to this proposed learning rule are capable of classifying different categories by the associated sequences of precisely timed spikes. Simulation results have shown that the proposed learning method greatly improves classification accuracy when compared to the Spike Pattern Association Neuron (SPAN) and the Tempotron learning rule.

Dust confinement and dust acoustic waves in a magnetized plasma

Science.gov (United States)

Piel, A.

2005-10-01

Systematic laboratory experiments on dust acoustic waves require the confinement of dust particles. Here we report on new experiments in a magnetized plasma region in front of an additional positively biased disk electrode in a background plasma which is generated in argon at 27MHz between a disk and grid electrode. The plasma diffuses through the grid along the magnetic field. The three-dimensional dust distribution is measured with a horizontal sheet of laser light and a CCD camera, which are mounted on a vertical translation stage. Depending on magnetic field and discharge current, cigar or donut-shaped dust clouds are generated, which tend to rotate about the magnetic field direction. Measurements with emissive probes show that the axial confinement of dust particles with diameters between 0.7-2 μm is achieved by a balance of ion-drag force and electric field force. Dust levitation and radial confinement is due to a strong radial electric field. Dust acoustic waves are destabilized by the ion flow or can be stimulated by a periodic bias on the disk electrode. The observed wave dispersion is compared with fluid and kinetic models of the dust acoustic wave.

Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

Science.gov (United States)

Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

2011-01-01

The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

A Visual Guide to Sorting Electrophysiological Recordings Using 'SpikeSorter'.

Science.gov (United States)

Swindale, Nicholas V; Mitelut, Catalin; Murphy, Timothy H; Spacek, Martin A

2017-02-10

Few stand-alone software applications are available for sorting spikes from recordings made with multi-electrode arrays. Ideally, an application should be user friendly with a graphical user interface, able to read data files in a variety of formats, and provide users with a flexible set of tools giving them the ability to detect and sort extracellular voltage waveforms from different units with some degree of reliability. Previously published spike sorting methods are now available in a software program, SpikeSorter, intended to provide electrophysiologists with a complete set of tools for sorting, starting from raw recorded data file and ending with the export of sorted spikes times. Procedures are automated to the extent this is currently possible. The article explains and illustrates the use of the program. A representative data file is opened, extracellular traces are filtered, events are detected and then clustered. A number of problems that commonly occur during sorting are illustrated, including the artefactual over-splitting of units due to the tendency of some units to fire spikes in pairs where the second spike is significantly smaller than the first, and over-splitting caused by slow variation in spike height over time encountered in some units. The accuracy of SpikeSorter's performance has been tested with surrogate ground truth data and found to be comparable to that of other algorithms in current development.

A Markovian event-based framework for stochastic spiking neural networks.

Science.gov (United States)

Touboul, Jonathan D; Faugeras, Olivier D

2011-11-01

In spiking neural networks, the information is conveyed by the spike times, that depend on the intrinsic dynamics of each neuron, the input they receive and on the connections between neurons. In this article we study the Markovian nature of the sequence of spike times in stochastic neural networks, and in particular the ability to deduce from a spike train the next spike time, and therefore produce a description of the network activity only based on the spike times regardless of the membrane potential process. To study this question in a rigorous manner, we introduce and study an event-based description of networks of noisy integrate-and-fire neurons, i.e. that is based on the computation of the spike times. We show that the firing times of the neurons in the networks constitute a Markov chain, whose transition probability is related to the probability distribution of the interspike interval of the neurons in the network. In the cases where the Markovian model can be developed, the transition probability is explicitly derived in such classical cases of neural networks as the linear integrate-and-fire neuron models with excitatory and inhibitory interactions, for different types of synapses, possibly featuring noisy synaptic integration, transmission delays and absolute and relative refractory period. This covers most of the cases that have been investigated in the event-based description of spiking deterministic neural networks.

Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

Directory of Open Access Journals (Sweden)

Fhernanda R Smiderle

Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

Fast convergence of spike sequences to periodic patterns in recurrent networks

International Nuclear Information System (INIS)

Jin, Dezhe Z.

2002-01-01

The dynamical attractors are thought to underlie many biological functions of recurrent neural networks. Here we show that stable periodic spike sequences with precise timings are the attractors of the spiking dynamics of recurrent neural networks with global inhibition. Almost all spike sequences converge within a finite number of transient spikes to these attractors. The convergence is fast, especially when the global inhibition is strong. These results support the possibility that precise spatiotemporal sequences of spikes are useful for information encoding and processing in biological neural networks

Noise-enhanced coding in phasic neuron spike trains.

Science.gov (United States)

Ly, Cheng; Doiron, Brent

2017-01-01

The stochastic nature of neuronal response has lead to conjectures about the impact of input fluctuations on the neural coding. For the most part, low pass membrane integration and spike threshold dynamics have been the primary features assumed in the transfer from synaptic input to output spiking. Phasic neurons are a common, but understudied, neuron class that are characterized by a subthreshold negative feedback that suppresses spike train responses to low frequency signals. Past work has shown that when a low frequency signal is accompanied by moderate intensity broadband noise, phasic neurons spike trains are well locked to the signal. We extend these results with a simple, reduced model of phasic activity that demonstrates that a non-Markovian spike train structure caused by the negative feedback produces a noise-enhanced coding. Further, this enhancement is sensitive to the timescales, as opposed to the intensity, of a driving signal. Reduced hazard function models show that noise-enhanced phasic codes are both novel and separate from classical stochastic resonance reported in non-phasic neurons. The general features of our theory suggest that noise-enhanced codes in excitable systems with subthreshold negative feedback are a particularly rich framework to study.

Financial time series prediction using spiking neural networks.

Science.gov (United States)

Reid, David; Hussain, Abir Jaafar; Tawfik, Hissam

2014-01-01

In this paper a novel application of a particular type of spiking neural network, a Polychronous Spiking Network, was used for financial time series prediction. It is argued that the inherent temporal capabilities of this type of network are suited to non-stationary data such as this. The performance of the spiking neural network was benchmarked against three systems: two "traditional", rate-encoded, neural networks; a Multi-Layer Perceptron neural network and a Dynamic Ridge Polynomial neural network, and a standard Linear Predictor Coefficients model. For this comparison three non-stationary and noisy time series were used: IBM stock data; US/Euro exchange rate data, and the price of Brent crude oil. The experiments demonstrated favourable prediction results for the Spiking Neural Network in terms of Annualised Return and prediction error for 5-Step ahead predictions. These results were also supported by other relevant metrics such as Maximum Drawdown and Signal-To-Noise ratio. This work demonstrated the applicability of the Polychronous Spiking Network to financial data forecasting and this in turn indicates the potential of using such networks over traditional systems in difficult to manage non-stationary environments.

Allergies, asthma, and dust

Science.gov (United States)

Reactive airway disease - dust; Bronchial asthma - dust; Triggers - dust ... Things that make allergies or asthma worse are called triggers. Dust is a common trigger. When your asthma or allergies become worse due to dust, you are ...

Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

DEFF Research Database (Denmark)

Munck, L.; Møller, B.; Jacobsen, Susanne

2004-01-01

-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

Genes with a spike expression are clustered in chromosome (sub)bands and spike (sub)bands have a powerful prognostic value in patients with multiple myeloma

Science.gov (United States)

Kassambara, Alboukadel; Hose, Dirk; Moreaux, Jérôme; Walker, Brian A.; Protopopov, Alexei; Reme, Thierry; Pellestor, Franck; Pantesco, Véronique; Jauch, Anna; Morgan, Gareth; Goldschmidt, Hartmut; Klein, Bernard

2012-01-01

Background Genetic abnormalities are common in patients with multiple myeloma, and may deregulate gene products involved in tumor survival, proliferation, metabolism and drug resistance. In particular, translocations may result in a high expression of targeted genes (termed spike expression) in tumor cells. We identified spike genes in multiple myeloma cells of patients with newly-diagnosed myeloma and investigated their prognostic value. Design and Methods Genes with a spike expression in multiple myeloma cells were picked up using box plot probe set signal distribution and two selection filters. Results In a cohort of 206 newly diagnosed patients with multiple myeloma, 2587 genes/expressed sequence tags with a spike expression were identified. Some spike genes were associated with some transcription factors such as MAF or MMSET and with known recurrent translocations as expected. Spike genes were not associated with increased DNA copy number and for a majority of them, involved unknown mechanisms. Of spiked genes, 36.7% clustered significantly in 149 out of 862 documented chromosome (sub)bands, of which 53 had prognostic value (35 bad, 18 good). Their prognostic value was summarized with a spike band score that delineated 23.8% of patients with a poor median overall survival (27.4 months versus not reached, Pband score was independent of other gene expression profiling-based risk scores, t(4;14), or del17p in an independent validation cohort of 345 patients. Conclusions We present a new approach to identify spike genes and their relationship to patients’ survival. PMID:22102711

Predictive coding of dynamical variables in balanced spiking networks.

Science.gov (United States)

Boerlin, Martin; Machens, Christian K; Denève, Sophie

2013-01-01

Two observations about the cortex have puzzled neuroscientists for a long time. First, neural responses are highly variable. Second, the level of excitation and inhibition received by each neuron is tightly balanced at all times. Here, we demonstrate that both properties are necessary consequences of neural networks that represent information efficiently in their spikes. We illustrate this insight with spiking networks that represent dynamical variables. Our approach is based on two assumptions: We assume that information about dynamical variables can be read out linearly from neural spike trains, and we assume that neurons only fire a spike if that improves the representation of the dynamical variables. Based on these assumptions, we derive a network of leaky integrate-and-fire neurons that is able to implement arbitrary linear dynamical systems. We show that the membrane voltage of the neurons is equivalent to a prediction error about a common population-level signal. Among other things, our approach allows us to construct an integrator network of spiking neurons that is robust against many perturbations. Most importantly, neural variability in our networks cannot be equated to noise. Despite exhibiting the same single unit properties as widely used population code models (e.g. tuning curves, Poisson distributed spike trains), balanced networks are orders of magnitudes more reliable. Our approach suggests that spikes do matter when considering how the brain computes, and that the reliability of cortical representations could have been strongly underestimated.

A method for decoding the neurophysiological spike-response transform.

Science.gov (United States)

Stern, Estee; García-Crescioni, Keyla; Miller, Mark W; Peskin, Charles S; Brezina, Vladimir

2009-11-15

Many physiological responses elicited by neuronal spikes-intracellular calcium transients, synaptic potentials, muscle contractions-are built up of discrete, elementary responses to each spike. However, the spikes occur in trains of arbitrary temporal complexity, and each elementary response not only sums with previous ones, but can itself be modified by the previous history of the activity. A basic goal in system identification is to characterize the spike-response transform in terms of a small number of functions-the elementary response kernel and additional kernels or functions that describe the dependence on previous history-that will predict the response to any arbitrary spike train. Here we do this by developing further and generalizing the "synaptic decoding" approach of Sen et al. (1996). Given the spike times in a train and the observed overall response, we use least-squares minimization to construct the best estimated response and at the same time best estimates of the elementary response kernel and the other functions that characterize the spike-response transform. We avoid the need for any specific initial assumptions about these functions by using techniques of mathematical analysis and linear algebra that allow us to solve simultaneously for all of the numerical function values treated as independent parameters. The functions are such that they may be interpreted mechanistically. We examine the performance of the method as applied to synthetic data. We then use the method to decode real synaptic and muscle contraction transforms.

A study of the management strategies for river aeolian dust inhibition at the estuary of Zhuo-shui River

Science.gov (United States)

Tsai, S. F.; Lin, C. Y.

2014-12-01

With the characteristics of humidity in summer and drought in winter, there existing lots of bare lands due to the decline of water level cause large amounts of aeolian dust and environmental deterioration during the monsoon seasons in central Taiwan. How to adopt effective measures to inhibit the damage of dust is an essential issue. This study selected the serious dust-affected section of Zhuo-shui river (bridge Zi-qiang to Xi-bin) to delineate the areas of potential aeolian dust occurrence, explore the relationship between elevation and water level determined from return period analysis, submit the countermeasures for dust inhibition at the bare lands and/or cultivated areas, and address the responsibilities of related authority offices for dust prevention by means of literature review. The return period of inundation for the areas of potential aeolian dust occurrence is 1.1 years. Engineering of dust prevention with highly unit price are not recommended due to could be destroyed annually. The deposition sites of a river are usually located at the convex bank, which with silt texture and high salinity are not suitable for cultivation, are delineated as the areas of potential aeolian dust occurrence. Besides technology consideration in dust prevention, this study also examined the related articles of river management to integrate a comprehensive vision for better riverside environment and air quality.

A spiking neuron circuit based on a carbon nanotube transistor

International Nuclear Information System (INIS)

Chen, C-L; Kim, K; Truong, Q; Shen, A; Li, Z; Chen, Y

2012-01-01

A spiking neuron circuit based on a carbon nanotube (CNT) transistor is presented in this paper. The spiking neuron circuit has a crossbar architecture in which the transistor gates are connected to its row electrodes and the transistor sources are connected to its column electrodes. An electrochemical cell is incorporated in the gate of the transistor by sandwiching a hydrogen-doped poly(ethylene glycol)methyl ether (PEG) electrolyte between the CNT channel and the top gate electrode. An input spike applied to the gate triggers a dynamic drift of the hydrogen ions in the PEG electrolyte, resulting in a post-synaptic current (PSC) through the CNT channel. Spikes input into the rows trigger PSCs through multiple CNT transistors, and PSCs cumulate in the columns and integrate into a ‘soma’ circuit to trigger output spikes based on an integrate-and-fire mechanism. The spiking neuron circuit can potentially emulate biological neuron networks and their intelligent functions. (paper)

An online supervised learning method based on gradient descent for spiking neurons.

Science.gov (United States)

Xu, Yan; Yang, Jing; Zhong, Shuiming

2017-09-01

The purpose of supervised learning with temporal encoding for spiking neurons is to make the neurons emit a specific spike train encoded by precise firing times of spikes. The gradient-descent-based (GDB) learning methods are widely used and verified in the current research. Although the existing GDB multi-spike learning (or spike sequence learning) methods have good performance, they work in an offline manner and still have some limitations. This paper proposes an online GDB spike sequence learning method for spiking neurons that is based on the online adjustment mechanism of real biological neuron synapses. The method constructs error function and calculates the adjustment of synaptic weights as soon as the neurons emit a spike during their running process. We analyze and synthesize desired and actual output spikes to select appropriate input spikes in the calculation of weight adjustment in this paper. The experimental results show that our method obviously improves learning performance compared with the offline learning manner and has certain advantage on learning accuracy compared with other learning methods. Stronger learning ability determines that the method has large pattern storage capacity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Carbohydrate and protein contents of grain dusts in relation to dust morphology.

Science.gov (United States)

Dashek, W V; Olenchock, S A; Mayfield, J E; Wirtz, G H; Wolz, D E; Young, C A

1986-01-01

Grain dusts contain a variety of materials which are potentially hazardous to the health of workers in the grain industry. Because the characterization of grain dusts is incomplete, we are defining the botanical, chemical, and microbial contents of several grain dusts collected from grain elevators in the Duluth-Superior regions of the U.S. Here, we report certain of the carbohydrate and protein contents of dusts in relation to dust morphology. Examination of the gross morphologies of the dusts revealed that, except for corn, each dust contained either husk or pericarp (seed coat in the case of flax) fragments in addition to respirable particles. When viewed with the light microscope, the fragments appeared as elongated, pointed structures. The possibility that certain of the fragments within corn, settled, and spring wheat were derived from cell walls was suggested by the detection of pentoses following colorimetric assay of neutralized 2 N trifluoroacetic acid hydrolyzates of these dusts. The presence of pentoses together with the occurrence of proteins within water washings of grain dusts suggests that glycoproteins may be present within the dusts. With scanning electron microscopy, each dust was found to consist of a distinct assortment of particles in addition to respirable particles. Small husk fragments and "trichome-like" objects were common to all but corn dust. Images FIGURE 4. FIGURE 5. PMID:3709476

Bistability induces episodic spike communication by inhibitory neurons in neuronal networks.

Science.gov (United States)

Kazantsev, V B; Asatryan, S Yu

2011-09-01

Bistability is one of the important features of nonlinear dynamical systems. In neurodynamics, bistability has been found in basic Hodgkin-Huxley equations describing the cell membrane dynamics. When the neuron is clamped near its threshold, the stable rest potential may coexist with the stable limit cycle describing periodic spiking. However, this effect is often neglected in network computations where the neurons are typically reduced to threshold firing units (e.g., integrate-and-fire models). We found that the bistability may induce spike communication by inhibitory coupled neurons in the spiking network. The communication is realized in the form of episodic discharges with synchronous (correlated) spikes during the episodes. A spiking phase map is constructed to describe the synchronization and to estimate basic spike phase locking modes.

The accumulation of dust mite allergens on mattresses made of different kinds of materials.

Science.gov (United States)

Visitsunthorn, Nualanong; Chirdjirapong, Varakorn; Pootong, Visanu; Jirapongsananuruk, Orathai; Pacharn, Punchama; Weeravejsukit, Sirirat; Mahakittikun, Vanna; Vichyanond, Pakit

2010-01-01

Different mattress materials may affect the accumulation of allergens. To compare the amount of group 1 dust mite allergens (Der p1 + Der f1) on mattresses made of different kinds of materials before and after use. Sixty new mattresses made of kapok, synthetic fiber, coconut fiber and sponge-like polyurethane, were placed in the house officers' dormitory at Siriraj hospital, Thailand. The dust samples were collected before (0), 1, 2, 3, 6, 9 and 12 months after the mattresses were used. Group 1 dust mite allergens were analyzed using two-site monoclonal antibody ELISA. Der f1 made up 86.7 % of group 1 allergens found in the matress dust. After the 2nd month, only the mean level in sponge-like polyurethane mattress was under 2 microg/g dust (sensitized level). At the 6th month, the mean levels were 13.1 in coconut, 21.7 in kapok and 17.3 microg/g dust in synthetic fiber, all of which were more than 10 microg/g dust (symptomatic level). At the 9th month, the level in sponge-like polyurethane mattress was increased to 11.2 microg/g. At 12th month the level in coconut fiber, sponge-like polyurethane synthetic fiber and kapok mattresses were 20.2, 22.4, 28.9 and 32.2 microg/g dust respectively. The accumulation rate in kapok and synthetic mattresses was significantly higher than coconut and sponge-like polyurethane mattresses. The mean level of group 1 mite allergens exceeded 10 microg/g dust after the 6th month of use in coconut fiber, kapok and synthetic fiber and at the 9th month in sponge-like polyurethane mattress.

The role of endotoxin in grain dust-induced lung disease.

Science.gov (United States)

Schwartz, D A; Thorne, P S; Yagla, S J; Burmeister, L F; Olenchock, S A; Watt, J L; Quinn, T J

1995-08-01

To identify the role of endotoxin in grain dust-induced lung disease, we conducted a population-based, cross-sectional investigation among grain handlers and postal workers. The study subjects were selected by randomly sampling all grain facilities and post offices within 100 miles of Iowa City. Our study population consisted of 410 grain workers and 201 postal workers. Grain workers were found to be exposed to higher concentrations of airborne dust (p = 0.0001) and endotoxin (p = 0.0001) when compared with postal workers. Grain workers had a significantly higher prevalence of work-related (cough, phlegm, wheezing, chest tightness, and dyspnea) and chronic (usual cough or phlegm production) respiratory symptoms than postal workers. Moreover, after controlling for age, gender, and cigarette smoking status, work-related respiratory symptoms were strongly associated with the concentration of endotoxin in the bioaerosol in the work setting. The concentration of total dust in the bioaerosol was marginally related to these respiratory problems. After controlling for age, gender, and cigarette smoking status, grain workers were found to have reduced spirometric measures of airflow (FEV1, FEV1/FVC, and FEF25-75) and enhanced airway reactivity to inhaled histamine when compared with postal workers. Although the total dust concentration in the work environment appeared to have little effect on these measures of airflow obstruction, higher concentrations of endotoxin in the bioaerosol were associated with diminished measures of airflow and enhanced bronchial reactivity. Our results indicate that the concentration of endotoxin in the bioaerosol may be particularly important in the development of grain dust-induced lung disease.

Voltage spikes in Nb3Sn and NbTi strands

Energy Technology Data Exchange (ETDEWEB)

Bordini, B.; Ambrosio, G.; Barzi, E.; Carcagno, R.; Feher, S.; Kashikhin, V.V.; Lamm, M.J.; Orris, D.; Tartaglia, M.; Tompkins, J.C.; Turrioni, D.; Yamada, R.; Zlobin,; /Fermilab

2005-09-01

As part of the High Field Magnet program at Fermilab several NbTi and Nb{sub 3}Sn strands were tested with particular emphasis on the study of voltage spikes and their relationship to superconductor instabilities. The voltage spikes were detected under various experimental conditions using voltage-current (V-I) and voltage-field (V-H) methods. Two types of spikes, designated ''magnetization'' and ''transport current'' spikes, have been identified. Their origin is most likely related to magnetization flux jump and transport current redistribution, respectively. Many of the signals observed appear to be a combination of these two types of spikes; the combination of these two instability mechanisms should play a dominant role in determining the minimum quench current.

Pressurized water reactor iodine spiking behavior under power transient conditions

International Nuclear Information System (INIS)

Ho, J.C.

1992-01-01

The most accepted theory explaining the cause of pressurized water reactor iodine spiking is steam formation and condensation in damaged fuel rods. The phase transformation of the primary coolant from water to steam and back again is believed to cause the iodine spiking phenomenon. But due to the complex nature of the phenomenon, a comprehensive model of the behavior has not yet been successfully developed. This paper presents a new model based on an empirical approach, which gives a first-order estimation of the peak iodine spiking magnitude. Based on the proposed iodine spiking model, it is apparent that it is feasible to derive a correlation using the plant operating data base to monitor and control the peak iodine spiking magnitude