Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.

Science.gov (United States)

Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza

2008-03-20

Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).

6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.

Science.gov (United States)

Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu

2016-02-12

With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.

β-glucan extract from oat bran and its industrial importance

Science.gov (United States)

Ibrahim, M. N. G.; Selezneva, I. S.

2017-09-01

The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.

The biological activities of (1,3)-(1,6)-{beta}-d-glucan and porous electrospun PLGA membranes containing {beta}-glucan in human dermal fibroblasts and adipose tissue-derived stem cells

Energy Technology Data Exchange (ETDEWEB)

Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)

2010-08-01

In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.

Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).

Science.gov (United States)

Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio

2008-01-01

Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.

Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi

Directory of Open Access Journals (Sweden)

Akira Yoshimi

2017-11-01

Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.

Glucan synthesis in the genus Lactobacillus : isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Glucan synthesis in the genus Lactobacillus: Isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains

NARCIS (Netherlands)

Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

2004-01-01

Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan

Preparation, characterization, and biological properties of β-glucans

Directory of Open Access Journals (Sweden)

Sandeep Rahar

2011-01-01

Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome

Directory of Open Access Journals (Sweden)

D. El Khoury

2012-01-01

Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

Directory of Open Access Journals (Sweden)

Sharon Avni

2017-07-01

Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.

Science.gov (United States)

Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij

2015-07-20

Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

Energy Technology Data Exchange (ETDEWEB)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2010-07-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.

Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity

International Nuclear Information System (INIS)

Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon

2010-01-01

In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity

Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan

Directory of Open Access Journals (Sweden)

JD Biller-Takahashi

Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.

Suppressing effects of glucan on micronuclei induced by Co60 in mice

International Nuclear Information System (INIS)

Chorvatovicova, D.

1991-01-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

Science.gov (United States)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-07-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation

International Nuclear Information System (INIS)

Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon

2009-01-01

β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.

Beta-glucans and cholesterol

Czech Academy of Sciences Publication Activity Database

Šíma, Petr; Vannucci, Luca; Větvička, V.

2017-01-01

Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016

Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae

NARCIS (Netherlands)

Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.

1999-01-01

β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are

Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice

Energy Technology Data Exchange (ETDEWEB)

Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)

1991-10-01

The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).

Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation

NARCIS (Netherlands)

Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.

2015-01-01

β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the

Physicochemical properties of beta-glucan in differently processed oat foods influence glycemic response.

Science.gov (United States)

Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J

2009-10-14

To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.

Effects of gamma irradiation on the physical and structural properties of β-glucan

International Nuclear Information System (INIS)

Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon

2008-01-01

This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility

Recent insight in α-glucan metabolism in probiotic bacteria

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm

2014-01-01

α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...

β-Glucans: Relationships between Modification, Conformation and Functional Activities

Directory of Open Access Journals (Sweden)

Qiang Wang

2017-02-01

Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.

Study on the immuno stimulation of radiation degraded β-glucan in swiss mice

International Nuclear Information System (INIS)

Nguyen Thanh Long; Le Quang Luan

2015-01-01

The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)

Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu

2013-01-01

Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)

Molecular size estimation of plasma membrane β-glucan synthase from red beet root

International Nuclear Information System (INIS)

Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

1986-01-01

Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

Structure and function of α-glucan debranching enzymes

DEFF Research Database (Denmark)

Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte

2016-01-01

α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....

Effect of purified oat β-glucan on fermentation of set-style yogurt mix.

Science.gov (United States)

Singh, Mukti; Kim, Sanghoon; Liu, Sean X

2012-08-01

Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.

Incorporation of phosphate into glycogen by glycogen synthase.

Science.gov (United States)

Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

2016-05-01

The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.

Science.gov (United States)

Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan

2013-05-01

The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.

Beta Glucan Production from Two Strains of Agrobacterium sp in Medium Containing of Molases and Uracil Combine

Directory of Open Access Journals (Sweden)

KUSMIATI

2007-04-01

Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both

Comparison of Chain-Length Preferences and Glucan Specificities of Isoamylase-Type α-Glucan Debranching Enzymes from Rice, Cyanobacteria, and Bacteria.

Directory of Open Access Journals (Sweden)

Taiki Kobayashi

Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.

Malin decreases glycogen accumulation by promoting the degradation of protein targeting to glycogen (PTG)

OpenAIRE

Worby, Carolyn A.; Gentry, Matthew S.; Dixon, Jack E.

2007-01-01

Lafora disease (LD) is an autosomal recessive neurodegenerative disease that results in progressive myoclonus epilepsy and death. LD is caused by mutations in either the E3 ubiquitin ligase malin or the dual-specificity phosphatase laforin. A hallmark of LD is the accumulation of insoluble glycogen in the cytoplasm of cells from most tissues. Glycogen metabolism is regulated by phosphorylation of key metabolic enzymes. One regulator of this phosphorylation is protein targeting to glycogen (PT...

Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.

Science.gov (United States)

Gomaa, K; Kraus, J; Franz, G; Röper, H

1991-09-18

Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.

The structure of cell wall alpha-glucan from fission yeast

NARCIS (Netherlands)

Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

The structure of cell wall alpha-glucan from fission yeast.

NARCIS (Netherlands)

Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.

2005-01-01

Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the

A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.

Directory of Open Access Journals (Sweden)

Heather T Taff

Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.

Characterization of cereal β-glucan extracts from oat and barley and quantification of proteinaceous matter.

Directory of Open Access Journals (Sweden)

Claudia Zielke

Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.

Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods

Directory of Open Access Journals (Sweden)

Vesna Zechner-Krpan

2010-01-01

Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.

Distribution and molecular characterization of β-glucans from hull-less barley bran, shorts and flour.

Science.gov (United States)

Zheng, Xueling; Li, Limin; Wang, Qi

2011-01-01

Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.

Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus

Directory of Open Access Journals (Sweden)

Ira Widjiastuti

2017-03-01

Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of

Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.

Science.gov (United States)

Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa

2014-06-01

Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.

Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.

Science.gov (United States)

Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G

1992-01-01

The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.

β-Glucan as an encapsulating agent: Effect on probiotic survival in simulated gastrointestinal tract.

Science.gov (United States)

Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A

2016-01-01

Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.

Revisiting the structure of the anti-neoplastic glucans of Mycobacterium bovis Bacille Calmette-Guerin. Structural analysis of the extracellular and boiling water extract-derived glucans of the vaccine substrains.

Science.gov (United States)

Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou

2004-03-26

The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.

Visual effects of β-­glucans on wound healing in fish

DEFF Research Database (Denmark)

Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær

2011-01-01

Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...

An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.

NARCIS (Netherlands)

Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.

2004-01-01

(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method

Dynamic, morphotype-specific Candida albicans beta-glucan exposure during infection and drug treatment.

Directory of Open Access Journals (Sweden)

Robert T Wheeler

2008-12-01

Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.

Simultaneous intake of beta-glucan and plant stanol esters affects lipid metabolism in slightly hypercholesterolemic subjects.

Science.gov (United States)

Theuwissen, Elke; Mensink, Ronald P

2007-03-01

Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.

Chemical Synthesis of Sulfated Yeast (Saccharomyces cerevisiae) Glucans and Their In Vivo Antioxidant Activity.

Science.gov (United States)

Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang

2017-07-28

The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.

Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192.

Science.gov (United States)

Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan

2017-04-01

Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable

Glucan Particles for Macrophage Targeted Delivery of Nanoparticles

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2012-01-01

Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.

Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide

Directory of Open Access Journals (Sweden)

E. Y. Choi

2016-11-01

Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.

Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.

Science.gov (United States)

Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P

2017-11-01

Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs

Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria

Directory of Open Access Journals (Sweden)

Mattia P. Arena

2014-02-01

Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.

Integration of β-glucan fibre rich fractions from barley and mushrooms to form healthy extruded snacks.

Science.gov (United States)

Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S

2013-03-01

β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.

Modulation of the immune response of porcine neutrophils by different β-glucan preparations

DEFF Research Database (Denmark)

Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard

2010-01-01

β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...

Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht

β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

International Nuclear Information System (INIS)

Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo

2015-01-01

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber

Intestinal microbiota and immune related genes in sea cucumber (Apostichopus japonicus) response to dietary β-glucan supplementation

Energy Technology Data Exchange (ETDEWEB)

Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)

2015-02-27

β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.

β-Glucan production of Saccharomyces cerevisiae in medium with different nitrogen sources in air-lift fermentor

Directory of Open Access Journals (Sweden)

AHMAD THONTOWI

2007-10-01

Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.

Beta-glucans in the treatment of diabetes and associated cardiovascular risks

Directory of Open Access Journals (Sweden)

Jiezhong Chen

2008-12-01

Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis

β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

Directory of Open Access Journals (Sweden)

Matthew J. Elder

2017-07-01

Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

Engineering Potato Starch with a Higher Phosphate Content.

Directory of Open Access Journals (Sweden)

Xuan Xu

Full Text Available Phosphate esters are responsible for valuable and unique functionalities of starch for industrial applications. Also in the cell phosphate esters play a role in starch metabolism, which so far has not been well characterized in storage starch. Laforin, a human enzyme composed of a carbohydrate-binding module and a dual-specificity phosphatase domain, is involved in the dephosphorylation of glycogen. To modify phosphate content and better understand starch (dephosphorylation in storage starch, laforin was engineered and introduced into potato (cultivar Kardal. Interestingly, expression of an (engineered laforin in potato resulted in significantly higher phosphate content of starch, and this result was confirmed in amylose-free potato genetic background (amf. Modified starches exhibited altered granule morphology and size compared to the control. About 20-30% of the transgenic lines of each series showed red-staining granules upon incubation with iodine, and contained higher phosphate content than the blue-stained starch granules. Moreover, low amylose content and altered gelatinization properties were observed in these red-stained starches. Principle component and correlation analysis disclosed a complex correlation between starch composition and starch physico-chemical properties. Ultimately, the expression level of endogenous genes involved in starch metabolism was analysed, revealing a compensatory response to the decrease of phosphate content in potato starch. This study provides a new perspective for engineering starch phosphate content in planta by making use of the compensatory mechanism in the plant itself.

Abnormal metabolism of glycogen phosphate as a cause for Lafora disease.

Science.gov (United States)

Tagliabracci, Vincent S; Girard, Jean Marie; Segvich, Dyann; Meyer, Catalina; Turnbull, Julie; Zhao, Xiaochu; Minassian, Berge A; Depaoli-Roach, Anna A; Roach, Peter J

2008-12-05

Lafora disease is a progressive myoclonus epilepsy with onset in the teenage years followed by neurodegeneration and death within 10 years. A characteristic is the widespread formation of poorly branched, insoluble glycogen-like polymers (polyglucosan) known as Lafora bodies, which accumulate in neurons, muscle, liver, and other tissues. Approximately half of the cases of Lafora disease result from mutations in the EPM2A gene, which encodes laforin, a member of the dual specificity protein phosphatase family that is able to release the small amount of covalent phosphate normally present in glycogen. In studies of Epm2a(-/-) mice that lack laforin, we observed a progressive change in the properties and structure of glycogen that paralleled the formation of Lafora bodies. At three months, glycogen metabolism remained essentially normal, even though the phosphorylation of glycogen has increased 4-fold and causes altered physical properties of the polysaccharide. By 9 months, the glycogen has overaccumulated by 3-fold, has become somewhat more phosphorylated, but, more notably, is now poorly branched, is insoluble in water, and has acquired an abnormal morphology visible by electron microscopy. These glycogen molecules have a tendency to aggregate and can be recovered in the pellet after low speed centrifugation of tissue extracts. The aggregation requires the phosphorylation of glycogen. The aggregrated glycogen sequesters glycogen synthase but not other glycogen metabolizing enzymes. We propose that laforin functions to suppress excessive glycogen phosphorylation and is an essential component of the metabolism of normally structured glycogen.

Various roles of beta-glucan in invertebrates

Czech Academy of Sciences Publication Activity Database

Větvička, V.; Šíma, Petr

2017-01-01

Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016

The phosphoglucan phosphatase like sex Four2 dephosphorylates starch at the C3-position in Arabidopsis.

Science.gov (United States)

Santelia, Diana; Kötting, Oliver; Seung, David; Schubert, Mario; Thalmann, Matthias; Bischof, Sylvain; Meekins, David A; Lutz, Andy; Patron, Nicola; Gentry, Matthew S; Allain, Frédéric H-T; Zeeman, Samuel C

2011-11-01

Starch contains phosphate covalently bound to the C6-position (70 to 80% of total bound phosphate) and the C3-position (20 to 30%) of the glucosyl residues of the amylopectin fraction. In plants, the transient phosphorylation of starch renders the granule surface more accessible to glucan hydrolyzing enzymes and is required for proper starch degradation. Phosphate also confers desired properties to starch-derived pastes for industrial applications. In Arabidopsis thaliana, the removal of phosphate by the glucan phosphatase Starch Excess4 (SEX4) is essential for starch breakdown. We identified a homolog of SEX4, LSF2 (Like Sex Four2), as a novel enzyme involved in starch metabolism in Arabidopsis chloroplasts. Unlike SEX4, LSF2 does not have a carbohydrate binding module. Nevertheless, it binds to starch and specifically hydrolyzes phosphate from the C3-position. As a consequence, lsf2 mutant starch has elevated levels of C3-bound phosphate. SEX4 can release phosphate from both the C6- and the C3-positions, resulting in partial functional overlap with LSF2. However, compared with sex4 single mutants, the lsf2 sex4 double mutants have a more severe starch-excess phenotype, impaired growth, and a further change in the proportion of C3- and C6-bound phosphate. These findings significantly advance our understanding of the metabolism of phosphate in starch and provide innovative options for tailoring novel starches with improved functionality for industry.

Novel structural features in Candida albicans hyphal glucan provide a basis for differential innate immune recognition of hyphae versus yeast.

Science.gov (United States)

Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L

2014-02-07

The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.

Studies on Trans-Resveratrol/Carboxymethylated (1,3/1,6-β-d-Glucan Association for Aerosol Pharmaceutical Applications

Directory of Open Access Journals (Sweden)

Antonio Francioso

2017-05-01

Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.

Evaluation of correlation between glucan conversion and degree of delignification depending on pretreatment strategies using Jabon Merah.

Science.gov (United States)

Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu

2017-07-01

The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.

Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil

Science.gov (United States)

Chang, I.; Cho, G.

2012-12-01

Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.

The effects of orally administered Beta-glucan on innate immune responses in humans, a randomized open-label intervention pilot-study.

Directory of Open Access Journals (Sweden)

Jenneke Leentjens

Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.

Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis

Directory of Open Access Journals (Sweden)

Tomoko Jippo

2015-02-01

Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases

Capsular glucan and intracellular glycogen of Mycobacterium tuberculosis: biosynthesis and impact on the persistence in mice

DEFF Research Database (Denmark)

Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo

2008-01-01

Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...

Concentrated oat β-glucan, a fermentable fiber, lowers serum cholesterol in hypercholesterolemic adults in a randomized controlled trial

Directory of Open Access Journals (Sweden)

Fulcher R Gary

2007-03-01

Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other

Specific binding of a fungal glucan phytoalexin elicitor to membrane fractions from soybean Glycine max

International Nuclear Information System (INIS)

Schmidt, W.E.; Ebel, J.

1987-01-01

Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay

Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats

International Nuclear Information System (INIS)

Salama, S.F.

2011-01-01

1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications

Reduced and high molecular weight barley beta-glucans decrease plasma total and non-HDL-cholesterol in hypercholesterolemic Syrian golden hamsters.

Science.gov (United States)

Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen

2004-10-01

Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.

A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Baruah, Rwivoo; Goyal, Arun

2014-08-01

An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.

Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast

NARCIS (Netherlands)

Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans

2007-01-01

The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential

Long-lived effects of administering β-glucans

NARCIS (Netherlands)

Petit, Jules; Wiegertjes, Geert F.

2016-01-01

Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a

Effect of purified oat ß-glucan on fermentation of set-style yogurt mix

Science.gov (United States)

Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...

Viability of bifidobacteria strains in yogurt with added oat beta-glucan and corn starch during cold storage.

Science.gov (United States)

Rosburg, Valerie; Boylston, Terri; White, Pamela

2010-06-01

Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.

Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.

Science.gov (United States)

Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui

2016-12-01

β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Barley genotypic β-glucan variation combined with enzymatic modifications direct its potential as a natural ingredient in a high fiber extract

DEFF Research Database (Denmark)

Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.

2017-01-01

-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f  and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....

Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction

Science.gov (United States)

Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar

2013-01-01

Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938

Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau

-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...

Dietary beta-1,3 glucan potentiates innate immunity and disease resistance of Asian catfish, Clarias batrachus (L.).

Science.gov (United States)

Kumari, J; Sahoo, P K

2006-02-01

This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.

Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

Science.gov (United States)

Kuzmanoff, K. M.

1984-01-01

In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

An extracellular cell-attached pullulanase confers branched α-glucan utilization in human gut Lactobacillus acidophilus

DEFF Research Database (Denmark)

Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig

2017-01-01

binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...

Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy

DEFF Research Database (Denmark)

Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling

2010-01-01

To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...

Effect of Immune-Enhancing Enteral Nutrition Enriched with or without Beta-Glucan on Immunomodulation in Critically Ill Patients

Directory of Open Access Journals (Sweden)

Jae Gil Lee

2016-06-01

Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.

Structural characterization and evaluation of antioxidant, anticancer and hypoglycemic activity of radiation degraded oat (Avena sativa) β- glucan

Science.gov (United States)

Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.

2018-03-01

Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.

A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.

Science.gov (United States)

Semedo, Magda C; Karmali, Amin; Fonseca, Luís

2015-02-01

Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.

β-1,3-Glucan, Which Can Be Targeted by Drugs, Forms a Trabecular Scaffold in the Oocyst Walls of Toxoplasma and Eimeria

Science.gov (United States)

Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John

2012-01-01

ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739

Molecular characterization and genetic diversity analysis β-glucan content variability in grain of oat (Avena sativa L.

Directory of Open Access Journals (Sweden)

Đukić Nevena H.

2014-01-01

Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092

Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.

Science.gov (United States)

Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong

2017-02-01

(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis

Immunostimulatory properties and antitumor activities of glucans (Review)

Czech Academy of Sciences Publication Activity Database

Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.

2013-01-01

Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.

Directory of Open Access Journals (Sweden)

Chad Steele

2005-12-01

Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

Preparation and characteristics of beta-glucan concentrate from brewer's yeast as the additive substance in foods

Directory of Open Access Journals (Sweden)

Ľubomír Mikuš

2013-02-01

Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too.  At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258

Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults

DEFF Research Database (Denmark)

Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe

2013-01-01

for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...

Impact of flavouring substances on the aggregation behaviour of dissolved barley β-glucans in a model beer.

Science.gov (United States)

Kupetz, M; Sacher, B; Becker, T

2016-06-05

Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.

beta. -1,4-glucan occurring in homogenate of Phaseolus aureus seedlings. Possible nascent stage of cellulose biosynthesis in vivo

Energy Technology Data Exchange (ETDEWEB)

Satoh, S; Matsuda, K; Tamari, K

1976-12-01

A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.

Enzyme-Linked Immunosorbent Assay Specific for (1→6) Branched, (1→3)-β-d-Glucan Detection in Environmental Samples

OpenAIRE

Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael

2001-01-01

(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...

Targeted Delivery of Glucan Particle Encapsulated Gallium Nanoparticles Inhibits HIV Growth in Human Macrophages

Directory of Open Access Journals (Sweden)

Ernesto R. Soto

2016-01-01

Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.

Biotechnological potential of novel glycoside hydrolase family 70 enzymes synthesizing α-glucans from starch and sucrose

NARCIS (Netherlands)

Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert

Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

OpenAIRE

Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas

2012-01-01

Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...

Effects of β-glucan and Vitamin D Supplementation on Inflammatory Parameters in Patients with Diabetic Retinopathy.

Science.gov (United States)

Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie

2018-06-19

The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.

The influences of sugars and plant growth regulators on β-glucan synthesis of G. lucidum mycelium in submerged culture

Science.gov (United States)

Thao, Cao Phuong; Tien, Le Thi Thuy

2017-09-01

β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.

Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

Science.gov (United States)

Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

1989-05-01

A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

The well-coordinated linkage between acidogenicity and aciduricity via insoluble glucans on the surface of Streptococcus mutans

Science.gov (United States)

Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan

2015-01-01

Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939

Re-examination of cellular cyclic beta-1,2-glucans of Rhizobiaceae: distribution of ring sizes and degrees of glycerol-1-phosphate substitution.

Science.gov (United States)

Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H

1990-04-01

Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.

Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols

Directory of Open Access Journals (Sweden)

A. Korpi

2003-01-01

Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.

The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice

Directory of Open Access Journals (Sweden)

Fengdan Jin

2014-01-01

Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.

Combined effects of added beta glucan and black tea in breads on starch functionality.

Science.gov (United States)

Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L

2015-03-01

Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.

Binding Interactions Between alpha-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

NARCIS (Netherlands)

Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.

Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the

Phosphatases in Cancer : Shifting the balance

NARCIS (Netherlands)

E. Hoekstra (Elmer)

2015-01-01

markdownabstractAbstract The role of phosphatases in cancer is an ignored research field, mostly based on the dogma that phosphatases function as tumor suppressor genes. However, in our opinion dephosphorylation events by phosphatases can also enhance signaling in cancer. The current research

Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms

Directory of Open Access Journals (Sweden)

Daniela Fiocco

2012-05-01

Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.

Dietary (1-->3), (1-->4)-beta-D-glucans from oat activate nuclear factor-kappaB in intestinal leukocytes and enterocytes from mice

NARCIS (Netherlands)

Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum

2010-01-01

Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB

Binding Interactions Between α-glucans from Lactobacillus reuteri and Milk Proteins Characterised by Surface Plasmon Resonance

DEFF Research Database (Denmark)

Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.

2012-01-01

Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...

Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

Directory of Open Access Journals (Sweden)

Reshma Davidson

Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.

Science.gov (United States)

Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum

2014-04-01

Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.

Immune Enhancing Activity of β-(1,3)-Glucan Isolated from Genus Agrobacterium in Bone-Marrow Derived Macrophages and Mice Splenocytes.

Science.gov (United States)

Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun

2016-01-01

An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.

Monitoring total endotoxin and (1 --> 3)-beta-D-glucan at the air exhaust of concentrated animal feeding operations.

Science.gov (United States)

Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S

2013-10-01

Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.

Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.

Science.gov (United States)

Shiota, E; Maekawa, M; Kono, T

2001-12-01

Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.

Fungi, beta-Glucan, and Bacteria in Nasal Lavage of Greenhouse Workers and Their Relation to Occupational Exposure

DEFF Research Database (Denmark)

Madsen, A. M.; Tendal, K.; Thilsing, T.

2013-01-01

occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...

Beta 1,3/1,6-glucan and vitamin C immunostimulate the non-specific immune response of white shrimp (Litopenaeus vannamei).

Science.gov (United States)

Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua

2016-10-01

This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.

Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...

HD-PTP is a catalytically inactive tyrosine phosphatase due to a conserved divergence in its phosphatase domain.

Directory of Open Access Journals (Sweden)

Marie-Claude Gingras

Full Text Available The HD-PTP protein has been described as a tumor suppressor candidate and based on its amino acid sequence, categorized as a classical non-transmembrane protein tyrosine phosphatase (PTP. To date, no HD-PTP phosphorylated substrate has been identified and controversial results concerning its catalytic activity have been recently reported.Here we report a rigorous enzymatic analysis demonstrating that the HD-PTP protein does not harbor tyrosine phosphatase or lipid phosphatase activity using the highly sensitive DiFMUP substrate and a panel of different phosphatidylinositol phosphates. We found that HD-PTP tyrosine phosphatase inactivity is caused by an evolutionary conserved amino acid divergence of a key residue located in the HD-PTP phosphatase domain since its back mutation is sufficient to restore the HD-PTP tyrosine phosphatase activity. Moreover, in agreement with a tumor suppressor activity, HD-PTP expression leads to colony growth reduction in human cancer cell lines, independently of its catalytic PTP activity status.In summary, we demonstrate that HD-PTP is a catalytically inactive protein tyrosine phosphatase. As such, we identify one residue involved in its inactivation and show that its colony growth reduction activity is independent of its PTP activity status in human cancer cell lines.

An Extracellular Cell-Attached Pullulanase Confers Branched α-Glucan Utilization in Human Gut Lactobacillus acidophilus.

Science.gov (United States)

Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher

2017-06-15

Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a

Probing interactions between B-glucan and bile salts at atomic detail by ¹H-¹³C NMR assays

DEFF Research Database (Denmark)

Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G

2014-01-01

Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....

Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)

DEFF Research Database (Denmark)

Jiménez, Natalia Ivonne Vera

by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...

Oral microbe-host interactions: influence of β-glucans on gene expression of inflammatory cytokines and metabolome profile.

Science.gov (United States)

Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça

2017-03-07

The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.

Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.

Science.gov (United States)

Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish

2012-09-04

Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.

Towards a more versatile alpha-glucan biosynthesis in plants

NARCIS (Netherlands)

Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.

2003-01-01

Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated

Probing protein phosphatase substrate binding

DEFF Research Database (Denmark)

Højlys-Larsen, Kim B.; Sørensen, Kasper Kildegaard; Jensen, Knud Jørgen

2012-01-01

Proteomics and high throughput analysis for systems biology can benefit significantly from solid-phase chemical tools for affinity pull-down of proteins from complex mixtures. Here we report the application of solid-phase synthesis of phosphopeptides for pull-down and analysis of the affinity...... profile of the integrin-linked kinase associated phosphatase (ILKAP), a member of the protein phosphatase 2C (PP2C) family. Phosphatases can potentially dephosphorylate these phosphopeptide substrates but, interestingly, performing the binding studies at 4 °C allowed efficient binding to phosphopeptides......, without the need for phosphopeptide mimics or phosphatase inhibitors. As no proven ILKAP substrates were available, we selected phosphopeptide substrates among known PP2Cδ substrates including the protein kinases: p38, ATM, Chk1, Chk2 and RSK2 and synthesized directly on PEGA solid supports through a BAL...

(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.

Science.gov (United States)

Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin

2017-03-01

A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.

Hypoglycemic activity of polysaccharide fractions containing ß-glucans from extracts of Rhynchelytrum repens (Willd. C.E. Hubb., Poaceae

Directory of Open Access Journals (Sweden)

A.C.C.F.F. De Paula

2005-06-01

Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.

Lafora disease offers a unique window into neuronal glycogen metabolism.

Science.gov (United States)

Gentry, Matthew S; Guinovart, Joan J; Minassian, Berge A; Roach, Peter J; Serratosa, Jose M

2018-05-11

Lafora disease (LD) is a fatal, autosomal recessive, glycogen-storage disorder that manifests as severe epilepsy. LD results from mutations in the gene encoding either the glycogen phosphatase laforin or the E3 ubiquitin ligase malin. Individuals with LD develop cytoplasmic, aberrant glycogen inclusions in nearly all tissues that more closely resemble plant starch than human glycogen. This Minireview discusses the unique window into glycogen metabolism that LD research offers. It also highlights recent discoveries, including that glycogen contains covalently bound phosphate and that neurons synthesize glycogen and express both glycogen synthase and glycogen phosphorylase. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Amphiphilic polymeric micelles originating from 1,4-β-D-glucan-g-polyphenylene oxide as the carriers for delivery of docetaxel and the corresponding release behaviors.

Science.gov (United States)

Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang

2018-07-15

A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.

High molecular weight glucan of the culinary medicinal mushroom Agaricus bisporus is an a-glucan that forms complexes with low molecular weight galactan

NARCIS (Netherlands)

Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.

2010-01-01

An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.

Phosphatase activity of Poa pratensis seeds. II. Purification and characterization of acid phosphatase Ia2 and Ia3

Directory of Open Access Journals (Sweden)

I. Lorenc-Kubis

2015-01-01

Full Text Available Two acid phosphatases (Ia2, Ia3 have been isolated from Poa pratensis seeds and partially purified. Both enzymes showed maximal activity at pH 4,9. They exhibited high activity towards p-nitrophenyl phosphate, inorganic pyrophosphate and phenyl phosphate, much less activity towards glucose-6 phosphate, and mononucleotides. Phosphatases a2 and a3 differed in their activity towards ADP. Orthophosphate, fluoride and Zn2+ were effective inhibitors. EDTA, β-mercaptoethanol and Mg2+ activated phophatase a2 but had no effect on phosphatase a3. Zn2+ inhibited the activity of phosphatase a2 noncompetitively, whereas phosphatase a3 showed inhibition of mixed type. Trypsin, chymotrypsin and pronase had no effect on the enzyme activities of both molecular forms.

Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions

International Nuclear Information System (INIS)

Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian

2012-01-01

Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)

Voltage-sensing phosphatase: its molecular relationship with PTEN.

Science.gov (United States)

Okamura, Yasushi; Dixon, Jack E

2011-02-01

Voltage-sensing phosphoinositide phosphatase (VSP) contains voltage sensor and cytoplasmic phosphatase domains. A unique feature of this protein is that depolarization-induced motions of the voltage sensor activate PtdIns(3,4,5)P(3) and PtdIns(4,5)P(2) phosphatase activities. VSP exhibits remarkable structural similarities with PTEN, the phosphatase and tensin homolog deleted on chromosome 10. These similarities include the cytoplasmic phosphatase region, the phosphoinositide binding region, and the putative membrane interacting C2 domain.

Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children

DEFF Research Database (Denmark)

Holst, Gitte Juel; Høst, Arne; Doekes, G

2015-01-01

Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...

Glycogen phosphorylation and Lafora disease.

Science.gov (United States)

Roach, Peter J

2015-12-01

Covalent phosphorylation of glycogen, first described 35 years ago, was put on firm ground through the work of the Whelan laboratory in the 1990s. But glycogen phosphorylation lay fallow until interest was rekindled in the mid 2000s by the finding that it could be removed by a glycogen-binding phosphatase, laforin, and that mutations in laforin cause a fatal teenage-onset epilepsy, called Lafora disease. Glycogen phosphorylation is due to phosphomonoesters at C2, C3 and C6 of glucose residues. Phosphate is rare, ranging from 1:500 to 1:5000 phosphates/glucose depending on the glycogen source. The mechanisms of glycogen phosphorylation remain under investigation but one hypothesis to explain C2 and perhaps C3 phosphate is that it results from a rare side reaction of the normal synthetic enzyme glycogen synthase. Lafora disease is likely caused by over-accumulation of abnormal glycogen in insoluble deposits termed Lafora bodies in neurons. The abnormality in the glycogen correlates with elevated phosphorylation (at C2, C3 and C6), reduced branching, insolubility and an enhanced tendency to aggregate and become insoluble. Hyperphosphorylation of glycogen is emerging as an important feature of this deadly childhood disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels

Science.gov (United States)

Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.

2014-01-01

Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183

Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.

Science.gov (United States)

Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A

2018-05-01

Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.

Oral beta-glucan adjuvant therapy converts nonprotective Th2 response to protective Th1 cell-mediated immune response in mammary tumor-bearing mice.

Directory of Open Access Journals (Sweden)

Gordon D Ross

2007-06-01

Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.

Structural analysis of bioengineered alpha-D-glucan produced by a triple mutant of the glucansucrase GTF180 enzyme from Lactobacillus reuteri strain 180 : Generation of (alpha 1 -> 4) linkages in a native (1 -> 3)(1 -> 6)-alpha-D-glucan

NARCIS (Netherlands)

van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.

Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).

Phosphatase activity of Poa pratensis seeds. I. Preliminary studies on acid phosphatase II

Directory of Open Access Journals (Sweden)

I. Lorenc-Kubis

2015-01-01

Full Text Available Acid phosphatase (EC 3.1.3.2 was extracted with 0.1 M sodium acetate buffer pH 5.1 from Poa pratensis seeds, and separated into three fractions by chromatography on DEAE cellulose. The highest activity was found in fraction Il-b (acid phosphatase II. The activity of the enzyme was optimal at pH 4.9. It hydrolyzed p-nitrophenyl phosphate most readily among the various phosphomonoesters examined. Acid phosphatase II showed also a high activity toward β-naphtyl phosphate and phenyl phosphate, very low activity towards β-glycero phosphate, 5'-GMP and no activity with glucose-1 phosphate. The enzyme was inhibited by Ca2+ and fluoride, but activated by Mg2+. EDTA had no influence on the activity of the enzyme.

Phosphatase activity of Poa pratensis seeds. l. Preliminary studies on acid phosphatase II

Energy Technology Data Exchange (ETDEWEB)

Lorenc-Kubis, I.; Morawiecka, B.

1973-01-01

Acid phosphatase (EC 3.1.3.2) was extracted from 0.1 M sodium acetate buffer, pH 5.1 from Poa pratensis seeds, and separated into three fractions by chromatography on DEAE cellulose. The highest activity was found in fraction II-b (acid phosphatase II). The activity of the enzyme was optimal at pH 4.9. It hydrolyzed p-nitrophenyl phosphate most readily among the various phosphomonoesters examined. Acid phosphatase II showed also a high activity toward ..beta..-naphtyl phosphate and phenyl phosphate, very low activity towards ..beta..-glycero phosphate, 5'-GMP and no activity with glucose-1 phosphate. The enzyme was inhibited by Ca/sup 2 +/ and fluoride, but activated by Mg/sup 2 +/. EDTA had no influence on the activity of the enzyme. 12 references, 3 figures, 4 tables.

Presence of a large β(1-3)glucan linked to chitin at the Saccharomyces cerevisiae mother-bud neck suggests involvement in localized growth control.

Science.gov (United States)

Cabib, Enrico; Blanco, Noelia; Arroyo, Javier

2012-04-01

Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.

Chitosan-guar gum-silver nanoparticles hybrid matrix with immobilized enzymes for fabrication of beta-glucan and glucose sensing photometric flow injection system.

Science.gov (United States)

Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang

2014-01-01

Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.

Zinc-ion-dependent acid phosphatase exhibits magnesium-ion-dependent myo-inositol-1-phosphatase activity.

Science.gov (United States)

Fujimoto, S; Okano, I; Tanaka, Y; Sumida, Y; Tsuda, J; Kawakami, N; Shimohama, S

1996-06-01

We have purified bovine brain Zn(2+)-dependent acid phosphatase (Zn(2+)-APase), which requires Zn2+ ions to hydrolyze the substrate p-nitrophenyl phosphate (pNPP) in an acidic environment. The substrate specificity and metal requirement of Zn(2+)-APase at a physiological pH was also studied. The enzyme exhibited hydrolytic activity on myo-inositol-1- and -2-monophosphates, 2'-adenosine monophosphate, 2'-guanosine monophosphate, and the alpha- and beta-glycerophosphates, glucose-1-phosphate, and fructose-6-phosphate in 50 mM Tris-HCl buffer (pH 7.4) in the presence of Mg2+ ions, but not on pNPP and phosphotyrosine. Zn2+, Mn2+ and Co2+ ions were less effective for activation. Among the above substrates, myo-inositol-1-phosphate was the most susceptible to hydrolysis by the enzyme in the presence of 3 mM Mg2+ ions. The enzyme exhibited an optimum pH at around 8 for myo-inositol-1-phosphate in the presence of 3 mM Mg2+ ions. The Mg(2+)-dependent myo-inositol-1-phosphatase activity of the enzyme was significantly inhibited by Li+ ions. The Zn(2+)-dependent p-nitrophenyl phosphatase activity and Mg(2+)-dependent myo-inositol-1-phosphatase activity of the purified enzyme fraction exhibited similar behavior on Sephadex G-100 and Mono Q colomns. These findings suggest that Zn(2+)-APase also exhibits Mg(2+)-dependent myo-inositol-1-phosphatase activity under physiological conditions.

Quantitative assessment of the effects of beta-glucan consumption on serum lipid profile and glucose level in hypercholesterolemic subjects.

Science.gov (United States)

Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S

2015-08-01

A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.

Lactose in diet influences the degradation of mixed linked β(1-3;1-4)-D-glucan in the small intestine of pigs

DEFF Research Database (Denmark)

Knudsen, Knud Erik Bach

The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...

Dietary calcium phosphate content and oat β-glucan influence gastrointestinal microbiota, butyrate-producing bacteria and butyrate fermentation in weaned pigs.

Science.gov (United States)

Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G

2011-03-01

This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

3' Phosphatase activity toward phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] by voltage-sensing phosphatase (VSP).

Science.gov (United States)

Kurokawa, Tatsuki; Takasuga, Shunsuke; Sakata, Souhei; Yamaguchi, Shinji; Horie, Shigeo; Homma, Koichi J; Sasaki, Takehiko; Okamura, Yasushi

2012-06-19

Voltage-sensing phosphatases (VSPs) consist of a voltage-sensor domain and a cytoplasmic region with remarkable sequence similarity to phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a tumor suppressor phosphatase. VSPs dephosphorylate the 5' position of the inositol ring of both phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P(3)] and phosphatidylinositol 4,5-bisphosphate [PI(4,5)P(2)] upon voltage depolarization. However, it is unclear whether VSPs also have 3' phosphatase activity. To gain insights into this question, we performed in vitro assays of phosphatase activities of Ciona intestinalis VSP (Ci-VSP) and transmembrane phosphatase with tensin homology (TPTE) and PTEN homologous inositol lipid phosphatase (TPIP; one human ortholog of VSP) with radiolabeled PI(3,4,5)P(3). TLC assay showed that the 3' phosphate of PI(3,4,5)P(3) was not dephosphorylated, whereas that of phosphatidylinositol 3,4-bisphosphate [PI(3,4)P(2)] was removed by VSPs. Monitoring of PI(3,4)P(2) levels with the pleckstrin homology (PH) domain from tandem PH domain-containing protein (TAPP1) fused with GFP (PH(TAPP1)-GFP) by confocal microscopy in amphibian oocytes showed an increase of fluorescence intensity during depolarization to 0 mV, consistent with 5' phosphatase activity of VSP toward PI(3,4,5)P(3). However, depolarization to 60 mV showed a transient increase of GFP fluorescence followed by a decrease, indicating that, after PI(3,4,5)P(3) is dephosphorylated at the 5' position, PI(3,4)P(2) is then dephosphorylated at the 3' position. These results suggest that substrate specificity of the VSP changes with membrane potential.

Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.

Science.gov (United States)

Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena

2015-04-01

Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Synthesis of New Hyperbranched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants.

Science.gov (United States)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-20

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.

Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

Science.gov (United States)

Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

2017-03-01

Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer

Directory of Open Access Journals (Sweden)

Hirokazu Tokuyasu

2010-09-01

Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran

Direct ethanol production from barley beta-glucan by sake yeast displaying Aspergillus oryzae beta-glucosidase and endoglucanase.

Science.gov (United States)

Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi

2008-06-01

Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.

High Molecular Weight Glucan of the Culinary Medicinal Mushroom Agaricus bisporus is an α-Glucan that Forms Complexes with Low Molecular Weight Galactan

Directory of Open Access Journals (Sweden)

Harry J. Wichers

2010-08-01

Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.

In vivo evaluation of the antimutagenic and antigenotoxic effects of β-glucan extracted from Saccharomyces cerevisiae in acute treatment with multiple doses

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2013-01-01

Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.

Influence of triethyl phosphate on phosphatase activity in shooting range soil: Isolation of a zinc-resistant bacterium with an acid phosphatase.

Science.gov (United States)

Story, Sandra; Brigmon, Robin L

2017-03-01

Phosphatase-mediated hydrolysis of organic phosphate may be a viable means of stabilizing heavy metals via precipitation as a metal phosphate in bioremediation applications. We investigated the effect of triethyl phosphate (TEP) on soil microbial-phosphatase activity in a heavy-metal contaminated soil. Gaseous TEP has been used at subsurface sites for bioremediation of organic contaminants but not applied in heavy-metal contaminated areas. Little is known about how TEP affects microbial activity in soils and it is postulated that TEP can serve as a phosphate source in nutrient-poor groundwater and soil/sediments. Over a 3-week period, TEP amendment to microcosms containing heavy-metal contaminated soil resulted in increased activity of soil acid-phosphatase and repression of alkaline phosphatase, indicating a stimulatory effect on the microbial population. A soil-free enrichment of microorganisms adapted to heavy-metal and acidic conditions was derived from the TEP-amended soil microcosms using TEP as the sole phosphate source and the selected microbial consortium maintained a high acid-phosphatase activity with repression of alkaline phosphatase. Addition of 5mM zinc to soil-free microcosms had little effect on acid phosphatase but inhibited alkaline phosphatase. One bacterial member from the consortium, identified as Burkholderia cepacia sp., expressed an acid-phosphatase activity uninhibited by high concentrations of zinc and produced a soluble, indigo pigment under phosphate limitation. The pigment was produced in a phosphate-free medium and was not produced in the presence of TEP or phosphate ion, indicative of purple acid-phosphatase types that are pressed by bioavailable phosphate. These results demonstrate that TEP amendment was bioavailable and increased overall phosphatase activity in both soil and soil-free microcosms supporting the possibility of positive outcomes in bioremediation applications. Copyright © 2016. Published by Elsevier Inc.

β-1,6-glucan synthesis-associated genes are required for proper spore wall formation in Saccharomyces cerevisiae.

Science.gov (United States)

Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong

2017-11-01

The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Identification of UDPG-binding polypeptides and purified (1,3)-β-glucan synthase by photoaffinity labelling with 5-azido-UDPG

International Nuclear Information System (INIS)

Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.

1989-01-01

The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex

Extraction and chemical characterization of rye arabinoxylan and the effect of β-glucan on the mechanical and barrier properties of cast arabinoxylan films

DEFF Research Database (Denmark)

Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena

2013-01-01

.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...

Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

DEFF Research Database (Denmark)

Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

2005-01-01

Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

Posttranslational heterogeneity of bone alkaline phosphatase in metabolic bone disease.

Science.gov (United States)

Langlois, M R; Delanghe, J R; Kaufman, J M; De Buyzere, M L; Van Hoecke, M J; Leroux-Roels, G G

1994-09-01

Bone alkaline phosphatase is a marker of osteoblast activity. In order to study the posttranscriptional modification (glycosylation) of bone alkaline phosphatase in bone disease, we investigated the relationship between mass and catalytic activity of bone alkaline phosphatase in patients with osteoporosis and hyperthyroidism. Serum bone alkaline phosphatase activity was measured after lectin precipitation using the Iso-ALP test kit. Mass concentration of bone alkaline phosphatase was determined with an immunoradiometric assay (Tandem-R Ostase). In general, serum bone alkaline phosphatase mass and activity concentration correlated well. The activity : mass ratio of bone alkaline phosphatase was low in hyperthyroidism. Activation energy of the reaction catalysed by bone alkaline phosphatase was high in osteoporosis and in hyperthyroidism. Experiments with neuraminidase digestion further demonstrated that the thermodynamic heterogeneity of bone alkaline phosphatase can be explained by a different glycosylation of the enzyme.

Feeding common carp Cyprinus carpio with β-glucan supplemented diet stimulates C-reactive protein and complement immune acute phase responses following PAMPs injection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave

2014-08-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Aspergillus fumigatus Cell Wall α-(1,3)-Glucan Stimulates Regulatory T-Cell Polarization by Inducing PD-L1 Expression on Human Dendritic Cells.

Science.gov (United States)

Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh

2017-12-05

Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Optimization and scale-up of fermentation of glucansucrase and branched glucan by Pediococcus pentosaceus CRAG3 using Taguchi methodology in bioreactor

Directory of Open Access Journals (Sweden)

RISHIKESH SHUKLA

2012-01-01

Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.

Methodologies for conformational studies of oligo- and poly-glucans: crystallography and molecular mechanics

International Nuclear Information System (INIS)

Tran, Huu Vinh

1983-01-01

After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans

Exercise and Beta-Glucan Consumption (Saccharomyces cerevisiae) Improve the Metabolic Profile and Reduce the Atherogenic Index in Type 2 Diabetic Rats (HFD/STZ).

Science.gov (United States)

Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José

2016-12-17

Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.

Structural Analysis of a Family 81 Glycoside Hydrolase Implicates Its Recognition of β-1,3-Glucan Quaternary Structure.

Science.gov (United States)

Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B

2017-09-05

Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.

Study on preparation and effect of oligoβ-glucan and oligochitosan on immune stimulation white patches in the internal organs disease on Tra catfish (Pangasianodon hypophthalmus)

International Nuclear Information System (INIS)

Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai

2015-01-01

Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)

Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet

Directory of Open Access Journals (Sweden)

Jie Zheng

2013-12-01

Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.

Enhancement of the immunity and body weight gain in broiler by feeding with the brewer yeast β-glucan degraded by gamma Co-60 radiation

International Nuclear Information System (INIS)

Le Quang Luan; Nguyen Thanh Long

2015-01-01

The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)

UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity

International Nuclear Information System (INIS)

Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.

1989-01-01

A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains

β-1,3/1,6-Glucan alleviated intestinal mucosal barrier impairment of broiler chickens challenged with Salmonella enterica serovar Typhimurium.

Science.gov (United States)

Shao, Yujing; Guo, Yuming; Wang, Zhong

2013-07-01

This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.

β-Glucans (Saccharomyces cereviseae) Reduce Glucose Levels and Attenuate Alveolar Bone Loss in Diabetic Rats with Periodontal Disease

Science.gov (United States)

2015-01-01

The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983

Characterization and biocompatibility of glucan: a safe food additive from probiotic Lactobacillus plantarum DM5.

Science.gov (United States)

Das, Deeplina; Goyal, Arun

2014-03-15

Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.

Substantial decrease in cell wall α-1,3-glucan caused by disruption of the kexB gene encoding a subtilisin-like processing protease in Aspergillus oryzae.

Science.gov (United States)

Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.

Influence of chitosan and melanin-glucan complex onto gamma-exposure with low doses and acute stressful reaction

International Nuclear Information System (INIS)

Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.

2004-01-01

Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex

Increased liver alkaline phosphatase and aminotransferase ...

African Journals Online (AJOL)

The effect of daily, oral administration of ethanolic extract of Khaya senegalensis stem bark (2mg/kg body weight) for 18days on the alkaline phosphatase, aspartate and alanine aminotransferase activities of rat liver and serum were investigated. Compared with the control, the activities of liver alkaline phosphatase (ALP), ...

Infection Structure–Specific Expression of β-1,3-Glucan Synthase Is Essential for Pathogenicity of Colletotrichum graminicola and Evasion of β-Glucan–Triggered Immunity in Maize[W

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B.

2013-01-01

β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035

Effects of β-Glucans Ingestion on Alveolar Bone Loss, Intestinal Morphology, Systemic Inflammatory Profile, and Pancreatic β-Cell Function in Rats with Periodontitis and Diabetes

Science.gov (United States)

Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.

2017-01-01

This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456

Glucan, Water Dikinase Activity Stimulates Breakdown of Starch Granules by Plastidial β-Amylases1[W][OA

Science.gov (United States)

Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard

2007-01-01

Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522

Evaluation of the Efficiency of Different Disruption Methods on Yeast Cell Wall Preparation for β-Glucan Isolation

Directory of Open Access Journals (Sweden)

Anna Bzducha-Wróbel

2014-12-01

Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.

Preparative resolution of D,L-threonine catalyzed by immobilized phosphatase.

Science.gov (United States)

Scollar, M P; Sigal, G; Klibanov, A M

1985-03-01

Hydrolysis of L- and D-O-phosphothreonines catalyzed by four different phosphatases, alkaline phosphatases from calf intestine and E. coli and acid phosphatases from wheat germ and potato, has been kinetically studied. Alkaline phosphatases were found to have comparable reactivities towards the optical isomers. On the other hand, both acid phosphatases displayed a marked stereoselectivity, hydrolyzing the L-ester much faster than its D counterpart. Wheat germ acid phosphatase was the most stereoselective enzyme: V(L)/V(D) = 24 and K(m,L)/K(m,D) = 0.17. This enzyme was immobilized (in k-carrageenan gel, followed by crosslinking with glutaraldehyde) and used for the preparative resolution of D,L-threonine: the latter was first chemically O-phosphorylated and then asymmetrically hydrolyzed by the immobilized phosphatase. As a result, gram quantities of L-threonine of high optical purity and O-phospho-D-threonine were prepared. Immobilized wheat germ phosphatase has been tested for the resolution of other racemic alcohols: serine, 2-amino-1-butanol, 1-amino-2-propanol, 2-octanol, and menthol. In all those cases, the enzyme was either not sufficiently stereoselective or too slow for preparative resolutions.

The Dual Activity Responsible for the Elongation and Branching of β-(1,3-Glucan in the Fungal Cell Wall

Directory of Open Access Journals (Sweden)

Vishukumar Aimanianda

2017-06-01

Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.

Only small fractions of soluble ß-glucan modulate the mucosal immune system in carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht

For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...

Conservation and Divergence in the Candida Species Biofilm Matrix Mannan-Glucan Complex Structure, Function, and Genetic Control.

Science.gov (United States)

Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R

2018-04-03

Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

1999-01-01

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique

Biochemical and structural characterization of the glucan and fructan exopolysaccharides synthesized by the Lactobacillus reuteri wild-type strain and by mutant strains

NARCIS (Netherlands)

Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.

Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique

Modulation of intestinal inflammation by yeasts and cell wall extracts: strain dependence and unexpected anti-inflammatory role of glucan fractions.

Directory of Open Access Journals (Sweden)

Samir Jawhara

Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the

Phosphatase activity of Poa pratensis seeds. III. Effect of fluoride, citrate, urea and other substances on the activity of acid phosphatase Ia2 and Ia3

Directory of Open Access Journals (Sweden)

Irena Lorenc-Kubis

2015-01-01

Full Text Available Effects of fluoride, citrate, urea and other substances on the activity of acid phosphatase a2 and a3 toward p-nitrophenylphosphate and phenylphosphate were investigated. Both enzymes were inhibited by fluoride, p-chloromercuribenzoate and oxalate. Fluoride inhibited acid phosphatase a2 noncorapetitively with p-mitrophenylphosphate, whereas acid phosphatase a3 showed inhibition of mixed type. Hydrolysis of phenylphosphate by both acid phosphatases was activated by citrate. Cytosine and uridine inhibited the activity of phosphatase a2 toward p-nitrophenylphosphate and phenylphosphate, but no effect was observed in case of acid phosphatase a3. After 30 min. incubation with 4 M urea both enzymes lost about 30% of activity.

Characterization of Polysaccharides from the Fruiting Bodies of Two Species of Genus Ganoderma (Agaricomycetes) and Determination of Water-Soluble β-D-Glucan Using High-Performance Liquid Chromatography.

Science.gov (United States)

Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song

2017-01-01

Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.

An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans

DEFF Research Database (Denmark)

Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher

2008-01-01

alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...

Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

Science.gov (United States)

Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

2018-05-14

Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.

Science.gov (United States)

Alwis, K U; Mandryk, J; Hocking, A D

1999-09-01

Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.

Validation of a high-performance size-exclusion chromatography method to determine and characterize β-glucans in beer wort using a triple-detector array.

Science.gov (United States)

Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe

2017-01-01

Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

A phase I/II trial of beta-(1,3/(1,6 D-glucan in the treatment of patients with advanced malignancies receiving chemotherapy

Directory of Open Access Journals (Sweden)

Weitberg Alan B

2008-09-01

Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.

Effect of supplementation of Manno-Oligosaccharide and b-glucans on maize based meal on commercial broilers

Directory of Open Access Journals (Sweden)

R.C.Shendare

2008-01-01

Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15

Feeding common carp Cyprinus carpio with b-glucan supplemented \\ud diet stimulates C-reactive protein and complement immune acute\\ud phase responses following PAMPs injection

OpenAIRE

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave

2014-01-01

The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...

Cell wall α-1,3-glucan prevents α-amylase adsorption onto fungal cell in submerged culture of Aspergillus oryzae.

Science.gov (United States)

Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya

2017-07-01

We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Direct determination of phosphatase activity from physiological substrates in cells.

Directory of Open Access Journals (Sweden)

Zhongyuan Ren

Full Text Available A direct and continuous approach to determine simultaneously protein and phosphate concentrations in cells and kinetics of phosphate release from physiological substrates by cells without any labeling has been developed. Among the enzymes having a phosphatase activity, tissue non-specific alkaline phosphatase (TNAP performs indispensable, multiple functions in humans. It is expressed in numerous tissues with high levels detected in bones, liver and neurons. It is absolutely required for bone mineralization and also necessary for neurotransmitter synthesis. We provided the proof of concept that infrared spectroscopy is a reliable assay to determine a phosphatase activity in the osteoblasts. For the first time, an overall specific phosphatase activity in cells was determined in a single step by measuring simultaneously protein and substrate concentrations. We found specific activities in osteoblast like cells amounting to 116 ± 13 nmol min(-1 mg(-1 for PPi, to 56 ± 11 nmol min(-1 mg(-1 for AMP, to 79 ± 23 nmol min(-1 mg(-1 for beta-glycerophosphate and to 73 ± 15 nmol min(-1 mg(-1 for 1-alpha-D glucose phosphate. The assay was also effective to monitor phosphatase activity in primary osteoblasts and in matrix vesicles. The use of levamisole--a TNAP inhibitor--served to demonstrate that a part of the phosphatase activity originated from this enzyme. An IC50 value of 1.16 ± 0.03 mM was obtained for the inhibition of phosphatase activity of levamisole in osteoblast like cells. The infrared assay could be extended to determine any type of phosphatase activity in other cells. It may serve as a metabolomic tool to monitor an overall phosphatase activity including acid phosphatases or other related enzymes.

Soluble β-(1,3)-glucans enhance LPS-induced response in the monocyte activation test, but inhibit LPS-mediated febrile response in rabbits: Implications for pyrogenicity tests.

Science.gov (United States)

Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando

2016-01-01

In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.

Understanding the role of oat ß-glucan in oat-based dough systems

NARCIS (Netherlands)

Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.

2015-01-01

B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat

Dietary β-glucan stimulate complement and C-reactive protein acute phase responses in common carp (Cyprinus carpio) during an Aeromonas salmonicida infection.

Science.gov (United States)

Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave

2013-03-01

The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All

Domain-to-domain coupling in voltage-sensing phosphatase.

Science.gov (United States)

Sakata, Souhei; Matsuda, Makoto; Kawanabe, Akira; Okamura, Yasushi

2017-01-01

Voltage-sensing phosphatase (VSP) consists of a transmembrane voltage sensor and a cytoplasmic enzyme region. The enzyme region contains the phosphatase and C2 domains, is structurally similar to the tumor suppressor phosphatase PTEN, and catalyzes the dephosphorylation of phosphoinositides. The transmembrane voltage sensor is connected to the phosphatase through a short linker region, and phosphatase activity is induced upon membrane depolarization. Although the detailed molecular characteristics of the voltage sensor domain and the enzyme region have been revealed, little is known how these two regions are coupled. In addition, it is important to know whether mechanism for coupling between the voltage sensor domain and downstream effector function is shared among other voltage sensor domain-containing proteins. Recent studies in which specific amino acid sites were genetically labeled using a fluorescent unnatural amino acid have enabled detection of the local structural changes in the cytoplasmic region of Ciona intestinalis VSP that occur with a change in membrane potential. The results of those studies provide novel insight into how the enzyme activity of the cytoplasmic region of VSP is regulated by the voltage sensor domain.

β-Glucan induces reactive oxygen species production in human neutrophils to improve the killing of Candida albicans and Candida glabrata isolates from vulvovaginal candidiasis.

Directory of Open Access Journals (Sweden)

Patricia de Souza Bonfim-Mendonça

Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.

Potential Effects of Nichi Glucan as a Food Supplement for Diabetes Mellitus and Hyperlipidemia: Preliminary Findings from the Study on Three Patients from India

Directory of Open Access Journals (Sweden)

Vidyasagar Devaprasad Dedeepiya

2012-01-01

Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.

Measuring (1,3)-β-D-glucan in tracheal aspirate, bronchoalveolar lavage fluid, and serum for detection of suspected Candida pneumonia in immunocompromised and critically ill patients: a prospective observational study.

Science.gov (United States)

Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru

2017-04-08

While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.

Cdc14 phosphatase

DEFF Research Database (Denmark)

Machín, Félix; Quevedo Rodriguez, Oliver; Ramos-Pérez, Cristina

2016-01-01

and cancer cells uncontrollably divide, much attention has been put into knocking down CDK activity. However, much less is known on the consequences of interfering with the phosphatases that put an end to the cell cycle. We have addressed in recent years the consequences of transiently inactivating the only...

Synthesis of cell wall xylans and glucans by golgi membranes

International Nuclear Information System (INIS)

Gibeaut, D.M.; Carpita, N.C.

1989-01-01

We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus

β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.

Directory of Open Access Journals (Sweden)

Sonja de Vries

Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.

The TriTryp Phosphatome: analysis of the protein phosphatase catalytic domains

Directory of Open Access Journals (Sweden)

Huxley-Jones Julie

2007-11-01

Full Text Available Abstract Background The genomes of the three parasitic protozoa Trypanosoma cruzi, Trypanosoma brucei and Leishmania major are the main subject of this study. These parasites are responsible for devastating human diseases known as Chagas disease, African sleeping sickness and cutaneous Leishmaniasis, respectively, that affect millions of people in the developing world. The prevalence of these neglected diseases results from a combination of poverty, inadequate prevention and difficult treatment. Protein phosphorylation is an important mechanism of controlling the development of these kinetoplastids. With the aim to further our knowledge of the biology of these organisms we present a characterisation of the phosphatase complement (phosphatome of the three parasites. Results An ontology-based scan of the three genomes was used to identify 86 phosphatase catalytic domains in T. cruzi, 78 in T. brucei, and 88 in L. major. We found interesting differences with other eukaryotic genomes, such as the low proportion of tyrosine phosphatases and the expansion of the serine/threonine phosphatase family. Additionally, a large number of atypical protein phosphatases were identified in these species, representing more than one third of the total phosphatase complement. Most of the atypical phosphatases belong to the dual-specificity phosphatase (DSP family and show considerable divergence from classic DSPs in both the domain organisation and sequence features. Conclusion The analysis of the phosphatome of the three kinetoplastids indicates that they possess orthologues to many of the phosphatases reported in other eukaryotes, including humans. However, novel domain architectures and unusual combinations of accessory domains, suggest distinct functional roles for several of the kinetoplastid phosphatases, which await further experimental exploration. These distinct traits may be exploited in the selection of suitable new targets for drug development to prevent

Overexpression of Human Bone Alkaline Phosphatase in Pichia Pastoris

Science.gov (United States)

Karr, Laurel; Malone, Christine, C.; Rose, M. Franklin (Technical Monitor)

2000-01-01

The Pichiapastoris expression system was utilized to produce functionally active human bone alkaline phosphatase in gram quantities. Bone alkaline phosphatase is a key enzyme in bone formation and biomineralization, yet important questions about its structural chemistry and interactions with other cellular enzymes in mineralizing tissues remain unanswered. A soluble form of human bone alkaline phosphatase was constructed by deletion of the 25 amino acid hydrophobic C-terminal region of the encoding cDNA and inserted into the X-33 Pichiapastoris strain. An overexpression system was developed in shake flasks and converted to large-scale fermentation. Alkaline phosphatase was secreted into the medium to a level of 32mgAL when cultured in shake flasks. Enzyme activity was 12U/mg measured by a spectrophotometric assay. Fermentation yielded 880mgAL with enzymatic activity of 968U/mg. Gel electrophoresis analysis indicates that greater than 50% of the total protein in the fermentation is alkaline phosphatase. A purification scheme has been developed using ammonium sulfate precipitation followed by hydrophobic interaction chromatography. We are currently screening crystallization conditions of the purified recombinant protein for subsequent X-ray diffraction analyses. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

Las β-(1®3-glucanas: moléculas inmunomoduladoras contaminantes de productos farmacéuticos β-(1®3-glucans as immunomodulating moléculas polluting pharmaceuticals

Directory of Open Access Journals (Sweden)

Zenia Pardo Ruiz

2012-03-01

Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis

Voltage sensitive phosphatases: emerging kinship to protein tyrosine phosphatases from structure-function research

Directory of Open Access Journals (Sweden)

Kirstin eHobiger

2015-02-01

Full Text Available The transmembrane protein Ci-VSP from the ascidian Ciona intestinalis was described as first member of a fascinating family of enzymes, the voltage sensitive phosphatases (VSPs. Ci-VSP and its voltage-activated homologs from other species are stimulated by positive membrane potentials and dephosphorylate the head groups of negatively charged phosphoinositide phosphates (PIPs. In doing so, VSPs act as control centers at the cytosolic membrane surface, because they intervene in signaling cascades that are mediated by PIP lipids. The characteristic motif CX5RT/S in the active site classifies VSPs as members of the huge family of cysteine-based protein tyrosine phosphatases (PTPs. Although PTPs have already been well characterized regarding both, structure and function, their relationship to VSPs has drawn only limited attention so far. Therefore, the intention of this review is to give a short overview about the extensive knowledge about PTPs in relation to the facts known about VSPs. Here, we concentrate on the structural features of the catalytic domain which are similar between both classes of phosphatases and their consequences for the enzymatic function. By discussing results obtained from crystal structures, molecular dynamics simulations, and mutagenesis studies, a possible mechanism for the catalytic cycle of VSPs is presented based on that one proposed for PTPs. In this way, we want to link the knowledge about the catalytic activity of VSPs and PTPs.

Redox-dependent interaction between thaumatin-like protein and β-glucan influences malting quality of barley.

Science.gov (United States)

Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder

2017-07-18

Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.

Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I

International Nuclear Information System (INIS)

Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.

1998-01-01

The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains

Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections

Directory of Open Access Journals (Sweden)

Andreas F. Haag

2010-01-01

Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.

Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress

Science.gov (United States)

Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...

Complementary sample preparation strategies for analysis of cereal β-glucan oxidation products by UPLC-MS/MS

Science.gov (United States)

Boulos, Samy; Nyström, Laura

2017-11-01

The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO�

The tillage effect on the soil acid and alkaline phosphatase activity

Directory of Open Access Journals (Sweden)

Lacramioara Oprica

2011-12-01

Full Text Available Phosphatases (acid and alkaline are important in soils because these extracellular enzymes catalyze the hydrolysis of organic phosphate esters to orthophosphate; thus they form an important link between biologically unavailable and mineral phosphorous. Phosphatase activity is sensitive to environmental perturbations such as organic amendments, tillage, waterlogging, compaction, fertilizer additions and thus it is often used as an environmental indicator of soil quality in riparian ecosystems. The aim of the study was to assess the effect of tillage systems on phosphatases activity in a field experiment carried out in Ezăreni farm. The phosphatase activitiy were determined at two depths (7-10 cm and 15-25cm layers of a chernozem soil submitted to conventional tillage (CT in a fertilised and unfertilised experiment. Monitoring soil alkaline phosphatase activity showed, generally, the same in fertilized soil profiles collected from both depths; the values being extremely close. In unfertilized soils, alkaline phosphatase activity is different only in soils that were exposed to unconventional work using disc harrows and 30cm tillage. Both works type (no tillage and conventional tillage cause an intense alkaline phosphatase activity in 7-10 cm soil profile. Acid phosphatase activity is highly fluctuating in both fertilized as well unfertilized soil, this enzyme being influenced by the performed works.

Membrane-bound 2,3-diphosphoglycerate phosphatase of human erythrocytes.

Science.gov (United States)

Schröter, W; Neuvians, M

1970-12-01

Gradual osmotic hemolysis of human erythrocytes reduces the cell content of whole protein, hemoglobin, 2,3-diphosphoglycerate and triosephosphate isomerase extensively, but not that of membrane protein and 2,3-diphosphoglycerate phosphatase. After the refilling of the ghosts with 2,3-diphosphoglycerate and reconstitution of the membrane, the 2,3-diphosphoglycerate phosphatase activity equals that of intact red cells. The membrane-bound 2,3-diphosphoglycerate phosphatase can be activated by sodium hyposulfite. The enzyme system of ghosts seems to differ from that of intact red cells with regard to the optima of pH and temperature. It remains to be elucidated if the membrane binding of the 2,3-diphosphoglycerate phosphatase is related to the transfer of inorganic phosphate across the red cell membrane.

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

Science.gov (United States)

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

(1-3)(1-6)-β-glucan-enriched materials from Lentinus edodes mushroom as a high-fibre and low-calorie flour substitute for baked foods.

Science.gov (United States)

Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong

2011-08-15

Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.

Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.

Science.gov (United States)

Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David

2014-10-22

Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.

Characterization of Human Bone Alkaline Phosphatase in Pichia Pastoris

Science.gov (United States)

Malone, Christine C.; Ciszak, Eva; Karr, Laurel J.

1999-01-01

A soluble form of human bone alkaline phosphatase has been expressed in a recombinant strain of the methylotrophic yeast Pichia pastoris. We constructed a plasmid containing cDNA encoding for human bone alkaline phosphatase, with the hydrophobic carboxyl terminal portion deleted. Alkaline phosphatase was secreted into the medium to a level of 32mg/L when cultured in shake flasks, and enzyme activity was 12U/mg, as measured by a spectrophotometric assay. By conversion to a fermentation system, a yield of 880mg/L has been achieved with an enzyme activity of 968U/mg. By gel electrophoresis analysis, it appears that greater than 50% of the total protein in the fermentation media is alkaline phosphatase. Although purification procedures are not yet completely optimized, they are expected to include filtration, ion exchange and affinity chromatography. Our presentation will focus on the purification and crystallization results up to the time of the conference. Structural data should provide additional information on the role of alkaline phosphatase in normal bone mineralization and in certain bone mineralization anomalies.

Osteocalcin and bone-specific alkaline phosphatase in Sickle cell ...

African Journals Online (AJOL)

specific alkaline phosphatase (b-AP) total protein levels were evaluated as indicators of bone turnover in twenty patients with sickle cell haemoglobinopathies and in twenty normal healthy individuals. The serum bonespecific alkaline phosphatase ...

Purification and characterization of a phosphotyrosyl-protein phosphatase from wheat seedlings.

Science.gov (United States)

Cheng, H F; Tao, M

1989-10-19

A neutral phosphatase which catalyzes the hydrolysis of p-nitrophenylphosphate has been purified to homogeneity from wheat seedlings. The enzyme is a monomeric glycoprotein exhibiting a molecular weight of 35,000, frictional ratio of 1.22, Stokes' radius of 260 nm, and sedimentation coefficient of 3.2 S. That the enzyme is a glycoprotein is surmised from its chromatographic property on Concanavalin A-Sepharose column. An examination of the substrate specificity indicates that the enzyme exhibits a preference for phosphotyrosine over a number of phosphocompounds, including p-nitrophenylphosphate and several glycolytic intermediates. Both phosphoserine and phosphothreonine are not hydrolyzed by the enzyme. The phosphatase activity is not affected by high concentrations of chelating agents and does not require metal ions. Molybdate, orthovanadate, Zn2+, and Hg2+ are all potent inhibitors of the phosphatase activity. The ability of the phosphatase to dephosphorylate protein phosphotyrosine has been investigated. [32P-Tyr]poly(Glu,Tyr)n, [32P-Tyr]alkylated bovine serum albumin, [32P-Tyr]angiotensin-I, and [32P-Tyr]band 3 (from human erythrocyte) are all substrates of the phosphatase. On the other hand, the enzyme has no activity toward protein phosphoserine and phosphothreonine. Our result further indicates that the neutral phosphatase is distinct from the wheat germ acid phosphatase. The latter enzyme is found to dephosphorylate phosphotyrosyl as well as phosphoseryl and phosphothreonyl groups in proteins. In light of the many similarities in properties to phosphotyrosyl protein phosphatases isolated from several sources, it is suggested that the wheat seedling phosphatase may participate in cellular regulation involving protein tyrosine phosphorylation.

Research on Phosphatases of Belladona Leaves and Their Purification

Directory of Open Access Journals (Sweden)

M. Khorsand

1957-01-01

Full Text Available Through experimentation with several leaves it has been possible for us to point out the existance of two different acid phosphatases. We have studied in more detail the phosphatases of belldon a leaves (Atropa Belladona L. Solanacees. The great part of the phosphatase activity is water extractable. We have compared the activity of the soluble fraction with that not directly extractable by means of water. The insoluble fraction could not be solubilized in a satisfaetC'fY m.anner.The digestion by papaine produced a slight solubilizing effect; on the other hand salt solutions, neutral or alkaline, or water glycerol mixtures had no solubilizing effect on the enzyme, It has been possible to demonstrate the existence of two different phosphatases in the insoluble fraction: the first of the type II,

Enzymatic hydrolysis on protein and β-glucan content of Sang-yodrice bran hydrolysatesand their anti-inflammatory activityonRAW 264.7 cells

Directory of Open Access Journals (Sweden)

Natcha Phantuwong

2017-12-01

Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9

Diagnostic potential of nested PCR, galactomannan EIA, and beta-D-glucan for invasive aspergillosis in pediatric patients.

Science.gov (United States)

Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa

2012-04-13

Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen  (Platelia Aspergillus), nested  PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp.  The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders. 

Escherichia coli Phosphoenolpyruvate Dependent Phosphotransferase System. Copurification of HPr and α1-6 Glucan

NARCIS (Netherlands)

Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.

1979-01-01

A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of

Effects of β-glucan polysaccharide revealed by the dominant lethal assay and micronucleus assays, and reproductive performance of male mice exposed to cyclophosphamide

Directory of Open Access Journals (Sweden)

Rodrigo Juliano Oliveira

2014-01-01

Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.

Serum alkaline phosphatase screening for vitamin D deficiency states

International Nuclear Information System (INIS)

Shaheen, S.; Barrakzai, Q.

2012-01-01

Objective: To determine whether serum vitamin D levels are correlated with serum levels of alkaline phosphatase or not. Study Design: Cross-sectional, observational study. Place and Duration of Study: Multi-centre study, conducted at Liaquat National Hospital and Medical College, National Medical Centre and Medicare Hospital, Karachi, from January to October 2009. Methodology: Patients attending the Orthopaedic OPDs with complaints of pain in different body regions and serum vitamin D/sub 3/ levels of greater or equal to 30 ng/ml were included in the study. Patients with vitamin D deficiency were further categorized into mild deficiency or insufficiency (vit. D/sub 3/ = 20-29 ng/ml), moderate deficiency (vit. D/sub 3/ = 5 - 19 ng/ml) and severe deficiency forms (vit. D/sub 3/ < 5 ng/ml). Pearson correlation was applied to test the correlation of serum alkaline phosphatase levels with serum vitamin D/sub 3/ levels. P-value < 0.05 was considered to be significant. Results: Out of 110 samples, 26 had mild (23%), 61 had moderate (55%) and 21 had severe (19.1%) vitamin D deficiencies. All of the patients in the three groups had alkaline phosphatase with in normal limits and the total mean value of the enzyme was 135.97 +- 68.14I U/L. The inter group comparison showed highest values of alkaline phosphatase in the moderate vitamin D deficiency group. The correlation coefficient of alkaline phosphatase and serum vitamin D/sub 3/ levels was r =0.05 (p =0.593). Conclusion: Serum vitamin D/sub 3/ levels may not be correlated with increased serum alkaline phosphatase levels. Therefore, alkaline phosphatase may not be used as a screening test to rule out vitamin D deficiency. (author)

Elevated Serum Level of Human Alkaline Phosphatase in Obesity

International Nuclear Information System (INIS)

Khan, A. R.; Awan, F. R.; Najam, S. S.; Islam, M.; Siddique, T.; Zain, M.

2015-01-01

Objective: To investigate a correlation between serum alkaline phosphatase level and body mass index in human subjects. Methods: The comparative cross-sectional study was carried out at the National Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan, from April 2012 to June 2013. Blood serum alkaline phosphatase levels were estimated and the subjects were divided into three sub-groups on the basis of their body mass index: normal weight (<25kg/m2), overweight (25-27kg/m2) and obese (>27kg/m2) subjects. The serum samples were used for the estimation of clinically important biochemical parameters, using commercial kits on clinical chemistry analyser. Results: Of the 197 subjects, 97(49 percent) were obese and 100(51 percent) were non-obese. The serum alkaline phosphatase level increased in obese (214±6.4 IU/L) compared to the non-obese subjects (184.5±5 IU/L). Furthermore, a significant linear relationship (r=0.3;p-0.0001) was found between serum alkaline phosphatase and body mass index. Other biochemical variables were not correlated to the body mass index. Conclusion: Over activity and higher amounts of alkaline phosphatase were linked to the development of obesity. (author)

Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick

2017-04-01

Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus.

Science.gov (United States)

de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello

2017-12-20

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5  Da with a random coil conformation for molecular weights below 1 × 10 6  Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.

β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake

Directory of Open Access Journals (Sweden)

Asli Akyol

2014-09-01

Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.

Science.gov (United States)

Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju

2014-09-23

The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.

Detection of phosphatase activity in aquatic and terrestrial cyanobacterial strains

Directory of Open Access Journals (Sweden)

Babić Olivera B.

2013-01-01

Full Text Available Cyanobacteria, as highly adaptable microorganisms, are characterized by an ability to survive in different environmental conditions, in which a significant role belongs to their enzymes. Phosphatases are enzymes produced by algae in relatively large quantities in response to a low orthophosphate concentration and their activity is significantly correlated with their primary production. The activity of these enzymes was investigated in 11 cyanobacterial strains in order to determine enzyme synthesis depending on taxonomic and ecological group of cyanobacteria. The study was conducted with 4 terrestrial cyanobacterial strains, which belong to Nostoc and Anabaena genera, and 7 filamentous water cyanobacteria of Nostoc, Oscillatoria, Phormidium and Microcystis genera. The obtained results showed that the activity of acid and alkaline phosphatases strongly depended on cyanobacterial strain and the environment from which the strain originated. Higher activity of alkaline phosphatases, ranging from 3.64 to 85.14 μmolpNP/s/dm3, was recorded in terrestrial strains compared to the studied water strains (1.11-5.96 μmolpNP/s/dm3. The activity of acid phosphatases was higher in most tested water strains (1.67-6.28 μmolpNP/s/dm3 compared to the activity of alkaline phosphatases (1.11-5.96 μmolpNP/s/dm3. Comparing enzyme activity of nitrogen fixing and non-nitrogen fixing cyanobacteria, it was found that most nitrogen fixing strains had a higher activity of alkaline phosphatases. The data obtained in this work indicate that activity of phosphatases is a strain specific property. The results further suggest that synthesis and activity of phosphatases depended on eco-physiological characteristics of the examined cyanobacterial strains. This can be of great importance for the further study of enzymes and mechanisms of their activity as a part of cyanobacterial survival strategy in environments with extreme conditions. [Projekat Ministarstva nauke Republike

Coupling between the voltage-sensing and phosphatase domains of Ci-VSP.

Science.gov (United States)

Villalba-Galea, Carlos A; Miceli, Francesco; Taglialatela, Maurizio; Bezanilla, Francisco

2009-07-01

The Ciona intestinalis voltage sensor-containing phosphatase (Ci-VSP) shares high homology with the phosphatidylinositol phosphatase enzyme known as PTEN (phosphatase and tensin homologue deleted on chromosome 10). We have taken advantage of the similarity between these proteins to inquire about the coupling between the voltage sensing and the phosphatase domains in Ci-VSP. Recently, it was shown that four basic residues (R11, K13, R14, and R15) in PTEN are critical for its binding onto the membrane, required for its catalytic activity. Ci-VSP has three of the basic residues of PTEN. Here, we show that when R253 and R254 (which are the homologues of R14 and R15 in PTEN) are mutated to alanines in Ci-VSP, phosphatase activity is disrupted, as revealed by a lack of effect on the ionic currents of KCNQ2/3, where current decrease is a measure of phosphatase activity. The enzymatic activity was not rescued by the introduction of lysines, indicating that the binding is an arginine-specific interaction between the phosphatase binding domain and the membrane, presumably through the phosphate groups of the phospholipids. We also found that the kinetics and steady-state voltage dependence of the S4 segment movement are affected when the arginines are not present, indicating that the interaction of R253 and R254 with the membrane, required for the catalytic action of the phosphatase, restricts the movement of the voltage sensor.

Detection of endogenous alkaline phosphatase activity in intact cells by flow cytometry using the fluorogenic ELF-97 phosphatase substrate

Science.gov (United States)

Telford, W. G.; Cox, W. G.; Stiner, D.; Singer, V. L.; Doty, S. B.

1999-01-01

BACKGROUND: The alkaline phosphatase (AP) substrate 2-(5'-chloro-2'-phosphoryloxyphenyl)-6-chloro-4-(3H)-quinazolinone (ELF((R))-97 for enzyme-labeled fluorescence) has been found useful for the histochemical detection of endogenous AP activity and AP-tagged proteins and oligonucleotide probes. In this study, we evaluated its effectiveness at detecting endogenous AP activity by flow cytometry. METHODS: The ELF-97 phosphatase substrate was used to detect endogenous AP activity in UMR-106 rat osteosarcoma cells and primary cultures of chick chondrocytes. Cells were labeled with the ELF-97 reagent and analyzed by flow cytometry using an argon ultraviolet (UV) laser. For comparison purposes, cells were also assayed for AP using a Fast Red Violet LB azo dye assay previously described for use in detecting AP activity by flow cytometry. RESULTS: The ELF-97 phosphatase substrate effectively detected endogenous AP activity in UMR-106 cells, with over 95% of the resulting fluorescent signal resulting from AP-specific activity (as determined by levamisole inhibition of AP activity). In contrast, less than 70% of the fluorescent signal from the Fast Red Violet LB (FRV) assay was AP-dependent, reflecting the high intrinsic fluorescence of the unreacted components. The ELF-97 phosphatase assay was also able to detect very low AP activity in chick chondrocytes that was undetectable by the azo dye method. CONCLUSIONS: The ELF-97 phosphatase assay was able to detect endogenous AP activity in fixed mammalian and avian cells by flow cytometry with superior sensitivity to previously described assays. This work also shows the applicability of ELF-97 to flow cytometry, supplementing its previously demonstrated histochemical applications. Copyright 1999 Wiley-Liss, Inc.

A generally applicable sequential alkaline phosphatase immunohistochemical double staining

NARCIS (Netherlands)

van der Loos, Chris M.; Teeling, Peter

2008-01-01

A universal type of sequential double alkaline phosphatase immunohistochemical staining is described that can be used for formalin-fixed, paraffin-embedded and cryostat tissue sections from human and mouse origin. It consists of two alkaline phosphatase detection systems including enzymatic

COMPARISON OF METHODS FOR ALKALINE PHOSPHATASE AND PEROXIDASE DETECTION IN MILK

Directory of Open Access Journals (Sweden)

felipe Nael Seixas

2014-02-01

Full Text Available This study evaluated the performance of strips for colorimetric detection of alkaline phosphatase and peroxidase in milk, comparing them with a kit of reagents for alkaline phosphatase and the official methodology for peroxidase. The samples were analyzed at the Laboratory Inspection of Products of Animal Origin, State University of Londrina. For the comparison tests for the detection of alkaline phosphatase four treatments were made by adding different percentages of raw milk (1%, 2%, 5% and 10% in the pasteurized milk, plus two control treatments. Thirty-eight samples triplicate for each treatment were analyzed. To compare the performance of tests for peroxidase 80 pasteurized milk samples were evaluated simultaneously by official methodology and by colorimetric strips. The performance of the alkaline phosphatase were different for the treatments with 1% and 2% of raw milk which had all the strips change color as the reagent kit showed the presence of phosphatase in just 2.63% and 5.26% the cases, respectively for each treatment. The colorimetric strips for alkaline phosphatase are more sensitive for the identification of small quantities compared to the reagent kit. The performance of tests for peroxidase showed no difference. The strips for the detection of peroxidase or alkaline phosphatase were effective and can replace traditional methods.

Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan

Directory of Open Access Journals (Sweden)

Eduardo Madrigal-Bujaidar

2015-06-01

Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.

Vanadate monomers and dimers both inhibit the human prostatic acid phosphatase.

Science.gov (United States)

Crans, D C; Simone, C M; Saha, A K; Glew, R H

1989-11-30

A combination of enzyme kinetics and 51V NMR spectroscopy was used to identify the species of vanadate that inhibits acid phosphatases. Monomeric vanadate was shown to inhibit wheat germ and potato acid phosphatases. At pH 5.5, the vanadate dimer inhibits the human prostatic acid phosphatase whereas at pH 7.0 it is the vanadate monomer that inhibits this enzyme. The pH-dependent shift in the affinity of the prostatic phosphatase for vanadate is presumably due to deprotonation of an amino acid side chain in or near the binding site resulting in a conformational change in the protein. pH may be a subtle effector of the insulin-like vanadate activity in biological systems and may explain some of the differences in selectivity observed with the protein phosphatases.

Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.

Science.gov (United States)

Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G

2017-08-15

Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.

Science.gov (United States)

Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong

2014-03-19

A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.

The impact of phosphatases on proliferative and survival signaling in cancer.

Science.gov (United States)

Narla, Goutham; Sangodkar, Jaya; Ryder, Christopher B

2018-05-03

The dynamic and stringent coordination of kinase and phosphatase activity controls a myriad of physiologic processes. Aberrations that disrupt the balance of this interplay represent the basis of numerous diseases. For a variety of reasons, early work in this area portrayed kinases as the dominant actors in these signaling events with phosphatases playing a secondary role. In oncology, these efforts led to breakthroughs that have dramatically altered the course of certain diseases and directed vast resources toward the development of additional kinase-targeted therapies. Yet, more recent scientific efforts have demonstrated a prominent and sometimes driving role for phosphatases across numerous malignancies. This maturation of the phosphatase field has brought with it the promise of further therapeutic advances in the field of oncology. In this review, we discuss the role of phosphatases in the regulation of cellular proliferation and survival signaling using the examples of the MAPK and PI3K/AKT pathways, c-Myc and the apoptosis machinery. Emphasis is placed on instances where these signaling networks are perturbed by dysregulation of specific phosphatases to favor growth and persistence of human cancer.

Novel chitin/chitosan-glucan wound dressing: Isolation, characterization, antibacterial activity and wound healing properties

Czech Academy of Sciences Publication Activity Database

Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.

2016-01-01

Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016

Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

Science.gov (United States)

We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

Protein tyrosine phosphatases: regulatory mechanisms.

NARCIS (Netherlands)

den Hertog, J.; Ostman, A.; Bohmer, F.D.

2008-01-01

Protein-tyrosine phosphatases are tightly controlled by various mechanisms, ranging from differential expression in specific cell types to restricted subcellular localization, limited proteolysis, post-translational modifications affecting intrinsic catalytic activity, ligand binding and

Characterization and site-directed mutagenesis of Wzb, an O-phosphatase from Lactobacillus rhamnosus

Directory of Open Access Journals (Sweden)

Gilbert Christophe

2008-04-01

Full Text Available Abstract Background Reversible phosphorylation events within a polymerisation complex have been proposed to modulate capsular polysaccharide synthesis in Streptococcus pneumoniae. Similar phosphatase and kinase genes are present in the exopolysaccharide (EPS biosynthesis loci of numerous lactic acid bacteria genomes. Results The protein sequence deduced from the wzb gene in Lactobacillus rhamnosus ATCC 9595 reveals four motifs of the polymerase and histidinol phosphatase (PHP superfamily of prokaryotic O-phosphatases. Native and modified His-tag fusion Wzb proteins were purified from Escherichia coli cultures. Extracts showed phosphatase activity towards tyrosine-containing peptides. The purified fusion protein Wzb was active on p-nitrophenyl-phosphate (pNPP, with an optimal activity in presence of bovine serum albumin (BSA 1% at pH 7.3 and a temperature of 75°C. At 50°C, residual activity decreased to 10 %. Copper ions were essential for phosphatase activity, which was significantly increased by addition of cobalt. Mutated fusion Wzb proteins exhibited reduced phosphatase activity on p-nitrophenyl-phosphate. However, one variant (C6S showed close to 20% increase in phosphatase activity. Conclusion These characteristics reveal significant differences with the manganese-dependent CpsB protein tyrosine phosphatase described for Streptococcus pneumoniae as well as with the polysaccharide-related phosphatases of Gram negative bacteria.

Rational Design of Adjuvant for Skin Delivery: Conjugation of Synthetic β-Glucan Dectin-1 Agonist to Protein Antigen.

Science.gov (United States)

Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C

2015-05-04

The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.

A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis

Directory of Open Access Journals (Sweden)

Bennett Hayley J

2010-08-01

Full Text Available Abstract Background Phosphoinositide metabolism is essential to membrane dynamics and impinges on many cellular processes, including phagocytosis. Modulation of phosphoinositide metabolism is important for pathogenicity and virulence of many human pathogens, allowing them to survive and replicate in the host cells. Phosphoinositide phosphatases from bacterial pathogens are therefore key players in this modulation and constitute attractive targets for chemotherapy. MptpB, a virulence factor from Mycobacterium tuberculosis, has phosphoinositide phosphatase activity and a distinct active site P-loop signature HCXXGKDR that shares characteristics with eukaryotic lipid phosphatases and protein tyrosine phosphatases. We used this P-loop signature as a "diagnostic motif" to identify related putative phosphatases with phosphoinositide activity in other organisms. Results We found more than 200 uncharacterised putative phosphatase sequences with the conserved signature in bacteria, with some related examples in fungi and protozoa. Many of the sequences identified belong to recognised human pathogens. Interestingly, no homologues were found in any other organisms including Archaea, plants, or animals. Phylogenetic analysis revealed that these proteins are unrelated to classic eukaryotic lipid phosphatases. However, biochemical characterisation of those from Listeria monocytogenes and Leishmania major, demonstrated that, like MptpB, they have phosphatase activity towards phosphoinositides. Mutagenesis studies established that the conserved Asp and Lys in the P-loop signature (HCXXGKDR are important in catalysis and substrate binding respectively. Furthermore, we provide experimental evidence that the number of basic residues in the P-loop is critical in determining activity towards poly-phosphoinositides. Conclusion This new family of enzymes in microorganisms shows distinct sequence and biochemical characteristics to classic eukaryotic lipid phosphatases

A new family of phosphoinositide phosphatases in microorganisms: identification and biochemical analysis.

Science.gov (United States)

Beresford, Nicola J; Saville, Charis; Bennett, Hayley J; Roberts, Ian S; Tabernero, Lydia

2010-08-02

Phosphoinositide metabolism is essential to membrane dynamics and impinges on many cellular processes, including phagocytosis. Modulation of phosphoinositide metabolism is important for pathogenicity and virulence of many human pathogens, allowing them to survive and replicate in the host cells. Phosphoinositide phosphatases from bacterial pathogens are therefore key players in this modulation and constitute attractive targets for chemotherapy. MptpB, a virulence factor from Mycobacterium tuberculosis, has phosphoinositide phosphatase activity and a distinct active site P-loop signature HCXXGKDR that shares characteristics with eukaryotic lipid phosphatases and protein tyrosine phosphatases. We used this P-loop signature as a "diagnostic motif" to identify related putative phosphatases with phosphoinositide activity in other organisms. We found more than 200 uncharacterised putative phosphatase sequences with the conserved signature in bacteria, with some related examples in fungi and protozoa. Many of the sequences identified belong to recognised human pathogens. Interestingly, no homologues were found in any other organisms including Archaea, plants, or animals. Phylogenetic analysis revealed that these proteins are unrelated to classic eukaryotic lipid phosphatases. However, biochemical characterisation of those from Listeria monocytogenes and Leishmania major, demonstrated that, like MptpB, they have phosphatase activity towards phosphoinositides. Mutagenesis studies established that the conserved Asp and Lys in the P-loop signature (HCXXGKDR) are important in catalysis and substrate binding respectively. Furthermore, we provide experimental evidence that the number of basic residues in the P-loop is critical in determining activity towards poly-phosphoinositides. This new family of enzymes in microorganisms shows distinct sequence and biochemical characteristics to classic eukaryotic lipid phosphatases and they have no homologues in humans. This study provides

Attenuation of PAMP-triggered immunity in maize requires down-regulation of the key β-1,6-glucan synthesis genes KRE5 and KRE6 in biotrophic hyphae of Colletotrichum graminicola.

Science.gov (United States)

Oliveira-Garcia, Ely; Deising, Holger B

2016-08-01

In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Anti-infective properties of the melanin-glucan complex obtained from medicinal tinder bracket mushroom, Fomes fomentarius (L.: Fr.) Fr. (Aphyllophoromycetideae).

Science.gov (United States)

Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I

2011-01-01

The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.

Anti-inflammatory properties of the medicinal mushroom Cordyceps militaris might be related to its linear (1→3-β-D-glucan.

Directory of Open Access Journals (Sweden)

Fhernanda R Smiderle

Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.

Near infrared spectra indicate specific mutant endosperm genes and reveal a new mechanism for substituting starch with (1-->3,1-->4)-[beta]-glucan in barley

DEFF Research Database (Denmark)

Munck, L.; Møller, B.; Jacobsen, Susanne

2004-01-01

-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....

Dephosphorylation of chicken cardiac myofibril C-protein by protein phosphatases 1 and 2A

International Nuclear Information System (INIS)

Thysseril, T.J.; Hegazy, M.G.; Schlender, K.K.

1987-01-01

C-Protein, which is a regulatory component of cardiac muscle myofibrils, is phosphorylated in response to β-adrenergic agonists by a cAMP-dependent mechanism and dephosphorylated in response to cholinergic agonists. It is believed that the cAMP-dependent phosphorylation is due to cAMP-dependent protein kinase. The protein phosphatase(s) involved in the dephosphorylation of C-protein has not been determined. In this study, chicken cardiac C-protein was phosphorylated with the cAMP-dependent protein kinase to about 3 mol phosphate/mol C-protein. Incubation of [ 32 P]C-protein with the catalytic subunit of protein phosphatase 1 or 2A rapidly removed 30-40% of 32 [P]. Phosphopeptide maps and phosphoamino acid analysis revealed that the major site(s) dephosphorylated by either phosphatase was a phosphothreonine residue(s) located on the same tryptic peptide and on the same CNBr fragment. Increasing the incubation period or the phosphatase concentration did not result in any further dephosphorylation of C-protein by phosphatase 1, but phosphatase 2A completely dephosphorylated C-protein. Preliminary studies showed that the major protein phosphatase associated with the myofibril was phosphatase 2A. These results indicate the phosphatase 2A may be important in the regulation of the phosphorylation state of C-protein

Serum creatinine and alkaline phosphatase levels are associated with severe chronic periodontitis.

Science.gov (United States)

Caúla, A L; Lira-Junior, R; Tinoco, E M B; Fischer, R G

2015-12-01

Periodontitis may alter systemic homeostasis and influence creatinine and alkaline phosphatase levels. Therefore, the aim of this study was to evaluate the relationship between severe chronic periodontitis and serum creatinine and alkaline phosphatase levels. One hundred patients were evaluated, 66 with severe chronic periodontitis (test group) and 34 periodontally healthy controls (control group). Medical, demographic and periodontal parameters were registered. Blood sample was collected after an overnight fast and serum creatinine and alkaline phosphatase levels were determined. There were significant differences between test and control groups in ethnicity, gender and educational level (p creatinine level (p creatinine and alkaline phosphatase levels. Severe chronic periodontitis was associated to lower creatinine and higher alkaline phosphatase levels. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Acid phosphatase turnover during repressed and derepressed cultivation of Aspergillus niger

International Nuclear Information System (INIS)

Komano, Teruya

1975-01-01

Enhancement of the activity of acid phosphatase (EC 3.1.3.2) by phosphate starvation in growing Aspergillus niger mycelia was prevented by cycloheximide. This indicates that the enhancement was due to de novo protein synthesis caused by derepression. Radioactive acid phosphatase extracted from mycelia labeled with 14 C-amino acid was separated into at least four fractions. Experiments on pulse labeling and the chasing of the four acid phosphatases revealed the synthesis and degradation of each fraction occurred at different rates; showing a different rate of turnover of the enzyme molecules. The results of similar experiments performed during culture in the presence of phosphate (partially repressed condition) suggested that the marked change in the activity ratios of the four acid phosphatases during cultivation was the result of the active turnover of enzyme molecules. In contrast, the slight changes in the ratios observed during derepressed cultivation seemed to be the result of similar of synthesis and degradation of each phosphatase fraction. (auth.)

Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

Science.gov (United States)

Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

2014-03-01

The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

Cloning and expression of a widely expressed receptor tyrosine phosphatase

DEFF Research Database (Denmark)

Sap, J; D'Eustachio, P; Givol, D

1990-01-01

We describe the identification of a widely expressed receptor-type (transmembrane) protein tyrosine phosphatase (PTPase; EC 3.1.3.48). Screening of a mouse brain cDNA library under low-stringency conditions with a probe encompassing the intracellular (phosphatase) domain of the CD45 lymphocyte...... antigen yielded cDNA clones coding for a 794-amino acid transmembrane protein [hereafter referred to as receptor protein tyrosine phosphatase alpha (R-PTP-alpha)] with an intracellular domain displaying clear homology to the catalytic domains of CD45 and LAR (45% and 53%, respectively). The 142-amino acid...

Immunocytochemical detection of the microsomal glucose-6-phosphatase in human brain astrocytes.

Science.gov (United States)

Bell, J E; Hume, R; Busuttil, A; Burchell, A

1993-10-01

Using an antibody raised against the catalytic subunit of glucose-6-phosphatase, this enzyme was immunolocalized in many astrocytes in 20 normal human brains. Double immunofluorescence studies showed co-localization of glial fibrillary acidic protein (GFAP) with glucose-6-phosphatase in astrocytes. However, not all GFAP-positive cells were also glucose-6-phosphatase positive, indicating that some astrocytes do not contain demonstrable expression of this enzyme. Reactive astrocytes in a variety of abnormal brains were strongly glucose-6-phosphatase positive, but neoplastic astrocytes were often only weakly positive. Expression of the enzyme could not be demonstrated in radial glia, neurons or oligodendroglia. Astrocytes normally contain glycogen and the demonstration that some astrocytes also contain glucose-6-phosphatase indicates that they are competent for both glycogenolysis and gluconeogenesis, which may be critical for neuronal welfare.

Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers

International Nuclear Information System (INIS)

Dugger, W.M.; Palmer, R.L.

1986-01-01

The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system

Dynamic Changes in Yeast Phosphatase Families Allow for Specialization in Phosphate and Thiamine Starvation.

Science.gov (United States)

Nahas, John V; Iosue, Christine L; Shaik, Noor F; Selhorst, Kathleen; He, Bin Z; Wykoff, Dennis D

2018-05-10

Convergent evolution is often due to selective pressures generating a similar phenotype. We observe relatively recent duplications in a spectrum of Saccharomycetaceae yeast species resulting in multiple phosphatases that are regulated by different nutrient conditions - thiamine and phosphate starvation. This specialization is both transcriptional and at the level of phosphatase substrate specificity. In Candida glabrata , loss of the ancestral phosphatase family was compensated by the co-option of a different histidine phosphatase family with three paralogs. Using RNA-seq and functional assays, we identify one of these paralogs, CgPMU3 , as a thiamine phosphatase. We further determine that the 81% identical paralog CgPMU2 does not encode thiamine phosphatase activity; however, both are capable of cleaving the phosphatase substrate, 1-napthyl-phosphate. We functionally demonstrate that members of this family evolved novel enzymatic functions for phosphate and thiamine starvation, and are regulated transcriptionally by either nutrient condition, and observe similar trends in other yeast species. This independent, parallel evolution involving two different families of histidine phosphatases suggests that there were likely similar selective pressures on multiple yeast species to recycle thiamine and phosphate. In this work, we focused on duplication and specialization, but there is also repeated loss of phosphatases, indicating that the expansion and contraction of the phosphatase family is dynamic in many Ascomycetes. The dynamic evolution of the phosphatase gene families is perhaps just one example of how gene duplication, co-option, and transcriptional and functional specialization together allow species to adapt to their environment with existing genetic resources. Copyright © 2018, G3: Genes, Genomes, Genetics.

Effect of vanadium compounds on acid phosphatase activity

OpenAIRE

Vescina, Cecilia M.; Sálice, Viviana C.; Cortizo, Ana María; Etcheverry, Susana B.

1996-01-01

The direct effect of different vanadium compounds on acid phosphatase (ACP) activity was investigated. Vanadate and vanadyl but not pervanadate inhibited the wheat germ ACP activity. These vanadium derivatives did not alter the fibroblast Swiss 3T3 soluble fraction ACP activity. Using inhibitors of tyrosine phosphatases (PTPases), the wheat germ ACP was partially characterized as a PTPase. This study suggests that the inhibitory ability of different vanadium derivatives to modulate ACP activi...

Synthesis of New Hyper-Branched α-Glucans from Sucrose by Lactobacillus reuteri 180 Glucansucrase Mutants

NARCIS (Netherlands)

Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert

2016-01-01

α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were

Use of β-glucan from spent brewer's yeast as a thickener in skimmed yogurt: Physicochemical, textural, and structural properties related to sensory perception.

Science.gov (United States)

Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren

2018-04-25

Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Chemical characterization and wound healing property of a β-D-glucan from edible mushroom Piptoporus betulinus

NARCIS (Netherlands)

Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello

2017-01-01

A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle

Phosphoglycolate phosphatase and 2,3-diphosphoglycerate in red cells of normal and anemic subjects.

Science.gov (United States)

Somoza, R; Beutler, E

1983-10-01

Red cell phosphoglycolate phosphatase (PGP) and 2,3-diphosphoglycerate (2,3-DPG) were investigated in normal and anemic patients and rabbits. In hemolytic anemia and blood-loss anemia, characterized by a young red cell population, there was an increase in both phosphoglycolate phosphatase activity and 2,3-diphosphoglycerate levels. In aplastic anemia, the phosphoglycolate phosphatase activity was normal, but the 2,3-diphosphoglycerate values were nonetheless increased. Thus, no relationship was found between phosphoglycolate phosphatase activity and 2,3-diphosphoglycerate levels. The lack of correlation between the activity of phosphoglycolate phosphatase and 2,3-DPG levels suggests that modulation of phosphoglycolate phosphatase activity does not control the level of 2,3-DPG in erythrocytes.

Two-dimensional NMR data of a water-soluble β-(1→3, 1→6-glucan from Aureobasidium pullulans and schizophyllan from Schizophyllum commune

Directory of Open Access Journals (Sweden)

Hiroyuki Kono

2017-12-01

Full Text Available This article contains two-dimensional (2D NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG and a water-soluble β-(1→3, 1→6-glucan from Aureobasidium pullulans. Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers, entitled “NMR spectroscopic structural characterization of a water-soluble β-(1→3, 1→6-glucan from A. pullulans” (Kono et al., 2017 [1]. Data can help to assign the 1H and 13C chemical shifts of the structurally complex polysaccharides. Keywords: NMR, β-(1→3, 1→6-glucan, Aureobasidium pullulans, Schizophyllan, Spectral data

Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs

NARCIS (Netherlands)

Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava

2017-01-01

Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and

Lysophosphatidic acids are new substrates for the phosphatase domain of soluble epoxide hydrolase.

Science.gov (United States)

Oguro, Ami; Imaoka, Susumu

2012-03-01

Soluble epoxide hydrolase (sEH) is a bifunctional enzyme that has a C-terminus epoxide hydrolase domain and an N-terminus phosphatase domain. The endogenous substrates of epoxide hydrolase are known to be epoxyeicosatrienoic acids, but the endogenous substrates of the phosphatase activity are not well understood. In this study, to explore the substrates of sEH, we investigated the inhibition of the phosphatase activity of sEH toward 4-methylumbelliferyl phosphate by using lecithin and its hydrolyzed products. Although lecithin itself did not inhibit the phosphatase activity, the hydrolyzed lecithin significantly inhibited it, suggesting that lysophospholipid or fatty acid can inhibit it. Next, we investigated the inhibition of phosphatase activity by lysophosphatidyl choline, palmitoyl lysophosphatidic acid, monopalmitoyl glycerol, and palmitic acid. Palmitoyl lysophosphatidic acid and fatty acid efficiently inhibited phosphatase activity, suggesting that lysophosphatidic acids (LPAs) are substrates for the phosphatase activity of sEH. As expected, palmitoyl, stearoyl, oleoyl, and arachidonoyl LPAs were efficiently dephosphorylated by sEH (Km, 3-7 μM; Vmax, 150-193 nmol/min/mg). These results suggest that LPAs are substrates of sEH, which may regulate physiological functions of cells via their metabolism.

Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber ( Apostichopus japonicus Selenka) challenged with Vibrio splendidus

Science.gov (United States)

Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei

2010-12-01

Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.

A study of the alkaline and acid phosphatase activities in acute uranium intoxication

International Nuclear Information System (INIS)

Bokova, N.; Pavlova, V.; Stancheva, Yu.; Khadzhirusev, S.; Kiradzhiev, G.

1975-01-01

Comparative study of the ability of the sodium salt of diethylbarbituric acid and acetazolamide to protect the kidneys is conducted under conditions of acute uranium intoxication in rats. The parameters studied are alkaline and acid phosphatase activities in the serum and urine and phosphatase activity in the kidneys (histochemically as described by Gomori) followed up until the 30th day after the total uranyl acetate dose was reached (2 or 7 mg per kg bodyweight). Either compound exerted only minor effect on serum alkaline phosphatase activity. Sodium diethylbarbiturate induced distinct fluctuations in urinary alkaline phosphatase activity throughout the entire study period, but the differences never reached statistical significance. Acetazolamide caused essential decrease in urinary alkaline phosphatase activity. In either case renal tissue protection from the action of the uranyl ion may be suggested. This assumption is supported by the histochemical analysis. The compounds appeared to have no effect on serum acid phosphatase activity which showed high variability both in control and in treated rats. (Ch.K.)

Characterization of the Functional Domains of a Mammalian Voltage-Sensitive Phosphatase.

Science.gov (United States)

Rosasco, Mario G; Gordon, Sharona E; Bajjalieh, Sandra M

2015-12-15

Voltage-sensitive phosphatases (VSPs) are proteins that directly couple changes in membrane electrical potential to inositol lipid phosphatase activity. VSPs thus couple two signaling pathways that are critical for cellular functioning. Although a number of nonmammalian VSPs have been characterized biophysically, mammalian VSPs are less well understood at both the physiological and biophysical levels. In this study, we aimed to address this gap in knowledge by determining whether the VSP from mouse, Mm-VSP, is expressed in the brain and contains a functional voltage-sensing domain (VSD) and a phosphatase domain. We report that Mm-VSP is expressed in neurons and is developmentally regulated. To address whether the functions of the VSD and phosphatase domain are retained in Mm-VSP, we took advantage of the modular nature of these domains and expressed each independently as a chimeric protein in a heterologous expression system. We found that the Mm-VSP VSD, fused to a viral potassium channel, was able to drive voltage-dependent gating of the channel pore. The Mm-VSP phosphatase domain, fused to the VSD of a nonmammalian VSP, was also functional: activation resulted in PI(4,5)P2 depletion that was sufficient to inhibit the PI(4,5)P2-regulated KCNQ2/3 channels. While testing the functionality of the VSD and phosphatase domain, we observed slight differences between the activities of Mm-VSP-based chimeras and those of nonmammalian VSPs. Although the properties of VSP chimeras may not completely reflect the properties of native VSPs, the differences we observed in voltage-sensing and phosphatase activity provide a starting point for future experiments to investigate the function of Mm-VSP and other mammalian VSPs. In conclusion, our data reveal that both the VSD and the lipid phosphatase domain of Mm-VSP are functional, indicating that Mm-VSP likely plays an important role in mouse neurophysiology. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All

Children’s residential exposure to selected allergens and microbial indicators: endotoxins and (1→3-β-D-glucans

Directory of Open Access Journals (Sweden)

Anna Kozajda

2013-12-01

Full Text Available Objectives: The study was aimed at assessment of exposure to endotoxins, (1→3-β-D-glucans and mite, cockroach, cat, dog allergens present in settled dust in premises of children as agents which may be significantly correlated with the occurrence of allergic symptoms and diseases in children. Materials and Methods: The study covered 50 homes of one- or two-year-old children in Poland. Samples of settled dust were taken from the floor and the child's bed. The levels of (1→3-β-D-glucans (floor, endotoxins (floor and allergens of mite, cat, dog and cockroach (floor and bed were analyzed. Results: Average geometric concentrations (geometric standard deviation of endotoxins, (1→3-β-D-glucans, Der p1, Fel d1, Can f1 and Bla g1 in children homes were on the floor 42 166.0 EU/g (3.2, 20 478.4 ng/g (2.38, 93.9 ng/g (6.58, 119.8 ng/g (13.0, 288.9 ng/g (3.4, 0.72 U/g (4.4 and in their beds (only allergens 597.8 ng/g (14.2, 54.1 ng/g (4.4, 158.6 ng/g (3.1 0.6 U/g (2.9, respectively. When the floor was covered with the carpet, higher concentrations of endotoxins, (1→3-β-D-glucans and allergens (each type were found in the settled dust (p < 0.05. The trend was opposite in case of allergens (except dog analyzed from bed dust and significantly higher concentrations were found in the rooms with smooth floor (p < 0.05. Conclusions: Among the analyzed factors only the type of floor significantly modified both the level of biological indicators and allergens. The results of this study could be the base for verifying a hypothesis that carpeting may have a protective role against high levels of cockroach, dog and cat allergens.

Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

Science.gov (United States)

Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

2014-07-16

Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

The study on application of radiation for preparation of oligo-β-glucan extracted from brewer yeast cell and for gold and silver nano particles

International Nuclear Information System (INIS)

Le Quang Luan; Nguyen Huynh Phuong Uyen; Nguyen Thanh Vu; Nguyen Quoc Hien; Dang Van Phu; Vo Thi Thu Ha; To Van Loi; Le Dinh Don; Truong Phuoc Thien Hoang; Do Thi Phuong Linh

2015-01-01

The process for production of insoluble β-glucan product from brewer’s yeast cell wall collected from the discard waste of beer production was successfully established. Radiation was improved as a useful tool for preparation of low Mw β-glucan. The water soluble oligo-β-glucans with Mw ~ 18 - 25 kDa were found to have novel features for application as plant growth promoter, growth and immune stimulator additive for animals and functional food for prevention and therapy of diabetic, dyslipidemia, cancer, etc. The processes for large scale production of oligo-β-glucan as plant growth promoter. chicken additive and functional food by gamma Co-60 irradiation method have been set up for application. In addition, gold nanoparticles (AuNPs) with size of 10 - 50 nm stabilized in sericin and water soluble chitosan and silver nanoparticles (AgNPs) with size of 5-20 nm stabilized PVA, PVP, sericin and alginate were also successfully synthesized by gamma Co-60 irradiation method. While AuNPs product was found to be not toxic and can be used for bio-medicine and cosmetics, AgNPs exhibited highly antimicrobial activity for potentially use as new and safety antimicrobial agent. The processes for large scale production of AuNPs, AgNPs, cream/AgNPs and hand-wash solution/AgNPs products were also successfully developed within this project. (author)

Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan.

Science.gov (United States)

Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A

2016-11-01

At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.

Aerosolization of fungi, (1→3)-β-D glucan, and endotoxin from flood-affected materials collected in New Orleans homes

Science.gov (United States)

Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.

2015-01-01

Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399

Hematopoietic cell phosphatase is recruited to CD22 following B cell antigen receptor ligation

NARCIS (Netherlands)

Lankester, A. C.; van Schijndel, G. M.; van Lier, R. A.

1995-01-01

Hematopoietic cell phosphatase is a nonreceptor protein tyrosine phosphatase that is preferentially expressed in hematopoietic cell lineages. Motheaten mice, which are devoid of (functional) hematopoietic cell phosphatase, have severe disturbances in the regulation of B cell activation and

In vitro incorporation of 14C-hexose-6-phosphat in mannan, β-glucan and glycogen of Candida spec. H and their mutants

International Nuclear Information System (INIS)

Roeber, B.; Reuter, G.

1982-01-01

Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)

Phylogenetic characterization of phosphatase-expressing bacterial communities in Baltic Sea sediments

NARCIS (Netherlands)

Steenbergh, Anne; Bodelier, Paul; Hoogveld, H.L.; Slomp, C.P; Laanbroek, H.J.

2015-01-01

Phosphate release from sediments hampers the remediation of aquatic systems from a eutrophic state. Microbial phosphatases in sediments release phosphorus during organic matter degradation. Despite the important role of phosphatase-expressing bacteria, the identity of these bacteria in sediments is

Yeast Acid Phosphatases and Phytases: Production, Characterization and Commercial Prospects

Science.gov (United States)

Kaur, Parvinder; Satyanarayana, T.

The element phosphorus is critical to all life forms as it forms the basic component of nucleic acids and ATP and has a number of indispensable biochemical roles. Unlike C or N, the biogeochemical cycling of phosphorus is very slow, and thus making it the growth-limiting element in most soils and aquatic systems. Phosphohydrolases (e.g. acid phosphatases and phytases) are enzymes that break the C-O-P ester bonds and provide available inorganic phosphorus from various inassimilable organic forms of phosphorus like phytates. These enzymes are of significant value in effectively combating phosphorus pollution. Although phytases and acid phosphatases are produced by various plants, animals and micro organisms, microbial sources are more promising for the production on a commercial scale. Yeasts being the simplest eukaryotes are ideal candidates for phytase and phos-phatase research due to their mostly non-pathogenic and GRAS status. They have not, however, been utilized to their full potential. This chapter focuses attention on the present state of knowledge on the production, characterization and potential commercial prospects of yeast phytases and acid phosphatases.

Design of a potentially prebiotic and responsive encapsulation material for probiotic bacteria based on chitosan and sulfated β-glucan.

Science.gov (United States)

Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité

2017-02-01

Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.

Composição centesimal e teor de beta-glucanas em cereais e derivados Nutrient profile and beta-glucans content in cereal seeds and foodstuffs contain them

Directory of Open Access Journals (Sweden)

Alexandre H. Fujita

2003-08-01

Full Text Available Foi utilizado o método enzimático recomendado pela AOAC para determinação de beta-glucanas em cereais e alimentos que os contém. O método, utiliza liquenase (EC 3.2.1.73 e beta-glucosidase (EC 3.2.1.21 para hidrólise debeta-glucanas, é rápido, fácil de executar e específico para beta-glucanas com ligações beta(1->3 e beta(1->4. As sementes analisadas foram subministradas pelo Instituto Agronômico de Campinas (IAC e os alimentos adquiridos nos supermercados. Aveia e cevada são os grãos com maior conteúdo de beta-glucanas. Na aveia os teores determinados foram 6,48 e 5,94%. Nos 10 cultivares de cevada os teores de beta-glucanas oscilaram entre 2,04 e 9,68%. Trigo e triticale apresentaram teores de b-glucanas menores que 1%. Nos produtos comerciais o teor de beta-glucanas estava relacionado ao tipo de cereal da fórmula. O produto comercial de maior conteúdo de beta-glucanas é o farelo de aveia. As beta-glucanas são ingredientes funcionais em potencial e a conveniência ou não de estimular sua incorporação em alimentos deve ser mais estudada. Quanto à composição centesimal dos grãos de cereais, o teor de proteínas foi o que apresentou a maior variação e isso se reflete na composição dos produtos comerciais.The method employed was the enzymatic one recommended by de AOAC for the determination of beta-glucans in cereals and in foodstuffs containing cereals in their formulation. The method, using lichenase (EC 3.2.1.73 and beta-glucosidase (EC 3.2.1.21 for the hydrolysis of beta-glucans, is quick and easy to execute, but is specific for beta-glucans with beta(1->3 and beta(1->4 bonds. The Agronomic Institute of Campinas (IAC supplied the seeds analyzed, and the foodstuffs were acquired in supermarkets. Oat and barley are the grains with the highest content of beta-glucans. In the oats, the determined values were 6.48 and 5.94%. In the 10 cultivars of barley, the content of beta-glucans varied between 2.04 and 9

Generic tools to assess genuine carbohydrate specific effects on in vitro immune modulation exemplified by β-glucans

DEFF Research Database (Denmark)

Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.

2013-01-01

Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...

Crystallization of a newly discovered histidine acid phosphatase from Francisella tularensis

Energy Technology Data Exchange (ETDEWEB)

Felts, Richard L. [Department of Chemistry, University of Missouri-Columbia, Columbia, Missouri 65211 (United States); Reilly, Thomas J. [Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri-Columbia, Columbia, Missouri 65212 (United States); Veterinary Medical Diagnostic Laboratory, College of Veterinary Medicine, University of Missouri-Columbia, Columbia, Missouri 65212 (United States); Calcutt, Michael J. [Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri-Columbia, Columbia, Missouri 65212 (United States); Tanner, John J., E-mail: tannerjj@missouri.edu [Department of Chemistry, University of Missouri-Columbia, Columbia, Missouri 65211 (United States); Department of Biochemistry, University of Missouri-Columbia, Columbia, Missouri 65211 (United States)

2006-01-01

A histidine acid phosphatase from the CDC Category A pathogen F. tularensis has been crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 61.96, c = 210.78 Å. A 1.75 Å resolution data set was collected at Advanced Light Source beamline 4.2.2. Francisella tularensis is a highly infectious bacterial pathogen that is considered by the Centers for Disease Control and Prevention to be a potential bioterrorism weapon. Here, the crystallization of a 37.2 kDa phosphatase encoded by the genome of F. tularensis subsp. holarctica live vaccine strain is reported. This enzyme shares 41% amino-acid sequence identity with Legionella pneumophila major acid phosphatase and contains the RHGXRXP motif that is characteristic of the histidine acid phosphatase family. Large diffraction-quality crystals were grown in the presence of Tacsimate, HEPES and PEG 3350. The crystals belong to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 61.96, c = 210.78 Å. The asymmetric unit is predicted to contain one protein molecule, with a solvent content of 53%. A 1.75 Å resolution native data set was recorded at beamline 4.2.2 of the Lawrence Berkeley National Laboratory Advanced Light Source. Molecular-replacement trials using the human prostatic acid phosphatase structure as the search model (28% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of F. tularensis histidine acid phosphatase will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative.

Crystallization of a newly discovered histidine acid phosphatase from Francisella tularensis

International Nuclear Information System (INIS)

Felts, Richard L.; Reilly, Thomas J.; Calcutt, Michael J.; Tanner, John J.

2005-01-01

A histidine acid phosphatase from the CDC Category A pathogen F. tularensis has been crystallized in space group P4 1 2 1 2, with unit-cell parameters a = 61.96, c = 210.78 Å. A 1.75 Å resolution data set was collected at Advanced Light Source beamline 4.2.2. Francisella tularensis is a highly infectious bacterial pathogen that is considered by the Centers for Disease Control and Prevention to be a potential bioterrorism weapon. Here, the crystallization of a 37.2 kDa phosphatase encoded by the genome of F. tularensis subsp. holarctica live vaccine strain is reported. This enzyme shares 41% amino-acid sequence identity with Legionella pneumophila major acid phosphatase and contains the RHGXRXP motif that is characteristic of the histidine acid phosphatase family. Large diffraction-quality crystals were grown in the presence of Tacsimate, HEPES and PEG 3350. The crystals belong to space group P4 1 2 1 2, with unit-cell parameters a = 61.96, c = 210.78 Å. The asymmetric unit is predicted to contain one protein molecule, with a solvent content of 53%. A 1.75 Å resolution native data set was recorded at beamline 4.2.2 of the Lawrence Berkeley National Laboratory Advanced Light Source. Molecular-replacement trials using the human prostatic acid phosphatase structure as the search model (28% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of F. tularensis histidine acid phosphatase will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative

Lysophosphatidic acids are new substrates for the phosphatase domain of soluble epoxide hydrolase[S

Science.gov (United States)

Oguro, Ami; Imaoka, Susumu

2012-01-01

Soluble epoxide hydrolase (sEH) is a bifunctional enzyme that has a C-terminus epoxide hydrolase domain and an N-terminus phosphatase domain. The endogenous substrates of epoxide hydrolase are known to be epoxyeicosatrienoic acids, but the endogenous substrates of the phosphatase activity are not well understood. In this study, to explore the substrates of sEH, we investigated the inhibition of the phosphatase activity of sEH toward 4-methylumbelliferyl phosphate by using lecithin and its hydrolyzed products. Although lecithin itself did not inhibit the phosphatase activity, the hydrolyzed lecithin significantly inhibited it, suggesting that lysophospholipid or fatty acid can inhibit it. Next, we investigated the inhibition of phosphatase activity by lysophosphatidyl choline, palmitoyl lysophosphatidic acid, monopalmitoyl glycerol, and palmitic acid. Palmitoyl lysophosphatidic acid and fatty acid efficiently inhibited phosphatase activity, suggesting that lysophosphatidic acids (LPAs) are substrates for the phosphatase activity of sEH. As expected, palmitoyl, stearoyl, oleoyl, and arachidonoyl LPAs were efficiently dephosphorylated by sEH (Km, 3–7 μM; Vmax, 150–193 nmol/min/mg). These results suggest that LPAs are substrates of sEH, which may regulate physiological functions of cells via their metabolism. PMID:22217705

Acid phosphatase and lipid peroxidation in human cataractous lens epithelium

Directory of Open Access Journals (Sweden)

Vasavada Abhay

1993-01-01

Full Text Available The anterior lens epithelial cells undergo a variety of degenerative and proliferative changes during cataract formation. Acid phosphatase is primarily responsible for tissue regeneration and tissue repair. The lipid hydroperoxides that are obtained by lipid peroxidation of polysaturated or unsaturated fatty acids bring about deterioration of biological membranes at cellular and tissue levels. Acid phosphatase and lipid peroxidation activities were studied on the lens epithelial cells of nuclear cataract, posterior subcapsular cataract, mature cataract, and mixed cataract. Of these, mature cataractous lens epithelium showed maximum activity for acid phosphatase (516.83 moles of p-nitrophenol released/g lens epithelium and maximum levels of lipid peroxidation (86.29 O.D./min/g lens epithelium. In contrast, mixed cataractous lens epithelium showed minimum activity of acid phosphatase (222.61 moles of p-nitrophenol released/g lens epithelium and minimum levels of lipid peroxidation (54.23 O.D./min/g lens epithelium. From our study, we correlated the maximum activity of acid phosphatase in mature cataractous lens epithelium with the increased areas of superimposed cells associated with the formation of mature cataract. Likewise, the maximum levels of lipid peroxidation in mature cataractous lens epithelium was correlated with increased permeability of the plasma membrane. Conversely, the minimum levels of lipid peroxidation in mixed cataractous lens epithelium makes us presume that factors other than lipid peroxidation may also account for the formation of mixed type of cataract.

Research on Phosphatases of Belladona Leaves and Their Purification (Part 1

Directory of Open Access Journals (Sweden)

M. Khorsand

1956-12-01

Full Text Available Belladona leaves as well as all other studied leaves contains two distinct phosphatase fractions belonging respectively to types II and IIIi the major parts of these enzymes is extraetible by water. It was not possible to extract the non soluble fraction which is solidly retained by the cellular constituents. Phosphatase II does not differ from other phosphatnses of the same type. Whereas phosphatase III is distinetely different from enzymes of the same type of vegetal or animal origins. It is activated by bivalent metallic ions which are specific activators of the alkaline phcspbatnses: Mg-Zn-Ni and Co.

Dietary β-glucan (MacroGard®) enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism and microbiota.

Science.gov (United States)

Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H

2016-01-01

Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.

Simplified preparation of a phosphatase inhibitor and further studies of its action.

Science.gov (United States)

Coburn, S P; Schaltenbrand, W E

1978-05-01

1-Pyrrolidinecarbothioic acid (2-pyridylmethylene) hydrazide chelates Zn2+ but not Mg2+. This compound is about twice as effective as EDTA for inhibiting alkaline phosphatase from calf mucosa, and approx. 1000-fold more effective than EDTA for inhibiting acid phosphatase from wheat germ. The compound did not inhibit pyridoxine kinase activity in human leucocytes at the highest concentration tested (33 micron). Therefore it may be a useful tool for either examining or eliminating the effects of phosphatases in complex enzyme systems.

A new fluorescence-based method identifies protein phosphatases regulating lipid droplet metabolism.

Directory of Open Access Journals (Sweden)

Bruno L Bozaquel-Morais

Full Text Available In virtually every cell, neutral lipids are stored in cytoplasmic structures called lipid droplets (LDs and also referred to as lipid bodies or lipid particles. We developed a rapid high-throughput assay based on the recovery of quenched BODIPY-fluorescence that allows to quantify lipid droplets. The method was validated by monitoring lipid droplet turnover during growth of a yeast culture and by screening a group of strains deleted in genes known to be involved in lipid metabolism. In both tests, the fluorimetric assay showed high sensitivity and good agreement with previously reported data using microscopy. We used this method for high-throughput identification of protein phosphatases involved in lipid droplet metabolism. From 65 yeast knockout strains encoding protein phosphatases and its regulatory subunits, 13 strains revealed to have abnormal levels of lipid droplets, 10 of them having high lipid droplet content. Strains deleted for type I protein phosphatases and related regulators (ppz2, gac1, bni4, type 2A phosphatase and its related regulator (pph21 and sap185, type 2C protein phosphatases (ptc1, ptc4, ptc7 and dual phosphatases (pps1, msg5 were catalogued as high-lipid droplet content strains. Only reg1, a targeting subunit of the type 1 phosphatase Glc7p, and members of the nutrient-sensitive TOR pathway (sit4 and the regulatory subunit sap190 were catalogued as low-lipid droplet content strains, which were studied further. We show that Snf1, the homologue of the mammalian AMP-activated kinase, is constitutively phosphorylated (hyperactive in sit4 and sap190 strains leading to a reduction of acetyl-CoA carboxylase activity. In conclusion, our fast and highly sensitive method permitted us to catalogue protein phosphatases involved in the regulation of LD metabolism and present evidence indicating that the TOR pathway and the SNF1/AMPK pathway are connected through the Sit4p-Sap190p pair in the control of lipid droplet biogenesis.

Characterization and partial purification of beta-1,3-D-glucan (callose) synthase from barley (Hordeum vulgare) leaves

DEFF Research Database (Denmark)

Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.

1993-01-01

The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...

Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

Czech Academy of Sciences Publication Activity Database

Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

2009-01-01

Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

Protective Effects of Surfactant Protein D (SP-D) Treatment in 1,3-β-glucan-modulated Allergic Inflammation

DEFF Research Database (Denmark)

Fakih, Dalia; Pilecki, Bartosz; Schlosser, Anders

2015-01-01

SP-D is a pulmonary collectin important in lung immunity. SP-D-deficient mice (Sftpd(-/-)) are reported to be susceptible to ovalbumin (OVA)- and fungal allergen-induced pulmonary inflammation, while treatment with exogenous SP-D has therapeutic effects in such disease models. β-glucans are a div...

Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

Science.gov (United States)

Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

2014-11-01

The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

A Global Protein Kinase and Phosphatase Interaction Network in Yeast

Science.gov (United States)

Breitkreutz, Ashton; Choi, Hyungwon; Sharom, Jeffrey R.; Boucher, Lorrie; Neduva, Victor; Larsen, Brett; Lin, Zhen-Yuan; Breitkreutz, Bobby-Joe; Stark, Chris; Liu, Guomin; Ahn, Jessica; Dewar-Darch, Danielle; Reguly, Teresa; Tang, Xiaojing; Almeida, Ricardo; Qin, Zhaohui Steve; Pawson, Tony; Gingras, Anne-Claude; Nesvizhskii, Alexey I.; Tyers, Mike

2011-01-01

The interactions of protein kinases and phosphatases with their regulatory subunits and substrates underpin cellular regulation. We identified a kinase and phosphatase interaction (KPI) network of 1844 interactions in budding yeast by mass spectrometric analysis of protein complexes. The KPI network contained many dense local regions of interactions that suggested new functions. Notably, the cell cycle phosphatase Cdc14 associated with multiple kinases that revealed roles for Cdc14 in mitogen-activated protein kinase signaling, the DNA damage response, and metabolism, whereas interactions of the target of rapamycin complex 1 (TORC1) uncovered new effector kinases in nitrogen and carbon metabolism. An extensive backbone of kinase-kinase interactions cross-connects the proteome and may serve to coordinate diverse cellular responses. PMID:20489023

The protein histidine phosphatase LHPP is a tumour suppressor.

Science.gov (United States)

Hindupur, Sravanth K; Colombi, Marco; Fuhs, Stephen R; Matter, Matthias S; Guri, Yakir; Adam, Kevin; Cornu, Marion; Piscuoglio, Salvatore; Ng, Charlotte K Y; Betz, Charles; Liko, Dritan; Quagliata, Luca; Moes, Suzette; Jenoe, Paul; Terracciano, Luigi M; Heim, Markus H; Hunter, Tony; Hall, Michael N

2018-03-29

Histidine phosphorylation, the so-called hidden phosphoproteome, is a poorly characterized post-translational modification of proteins. Here we describe a role of histidine phosphorylation in tumorigenesis. Proteomic analysis of 12 tumours from an mTOR-driven hepatocellular carcinoma mouse model revealed that NME1 and NME2, the only known mammalian histidine kinases, were upregulated. Conversely, expression of the putative histidine phosphatase LHPP was downregulated specifically in the tumours. We demonstrate that LHPP is indeed a protein histidine phosphatase. Consistent with these observations, global histidine phosphorylation was significantly upregulated in the liver tumours. Sustained, hepatic expression of LHPP in the hepatocellular carcinoma mouse model reduced tumour burden and prevented the loss of liver function. Finally, in patients with hepatocellular carcinoma, low expression of LHPP correlated with increased tumour severity and reduced overall survival. Thus, LHPP is a protein histidine phosphatase and tumour suppressor, suggesting that deregulated histidine phosphorylation is oncogenic.

Protein phosphatases decrease their activity during capacitation: a new requirement for this event.

Directory of Open Access Journals (Sweden)

Janetti R Signorelli

Full Text Available There are few reports on the role of protein phosphatases during capacitation. Here, we report on the role of PP2B, PP1, and PP2A during human sperm capacitation. Motile sperm were resuspended in non-capacitating medium (NCM, Tyrode's medium, albumin- and bicarbonate-free or in reconstituted medium (RCM, NCM plus 2.6% albumin/25 mM bicarbonate. The presence of the phosphatases was evaluated by western blotting and the subcellular localization by indirect immunofluorescence. The function of these phosphatases was analyzed by incubating the sperm with specific inhibitors: okadaic acid, I2, endothall, and deltamethrin. Different aliquots were incubated in the following media: 1 NCM; 2 NCM plus inhibitors; 3 RCM; and 4 RCM plus inhibitors. The percent capacitated sperm and phosphatase activities were evaluated using the chlortetracycline assay and a phosphatase assay kit, respectively. The results confirm the presence of PP2B and PP1 in human sperm. We also report the presence of PP2A, specifically, the catalytic subunit and the regulatory subunits PR65 and B. PP2B and PP2A were present in the tail, neck, and postacrosomal region, and PP1 was present in the postacrosomal region, neck, middle, and principal piece of human sperm. Treatment with phosphatase inhibitors rapidly (≤1 min increased the percent of sperm depicting the pattern B, reaching a maximum of ∼40% that was maintained throughout incubation; after 3 h, the percent of capacitated sperm was similar to that of the control. The enzymatic activity of the phosphatases decreased during capacitation without changes in their expression. The pattern of phosphorylation on threonine residues showed a sharp increase upon treatment with the inhibitors. In conclusion, human sperm express PP1, PP2B, and PP2A, and the activity of these phosphatases decreases during capacitation. This decline in phosphatase activities and the subsequent increase in threonine phosphorylation may be an important

Identification and characterization of a pyridoxal 5'-phosphate phosphatase in the silkworm (Bombyx mori).

Science.gov (United States)

Huang, ShuoHao; Han, CaiYun; Ma, ZhenQiao; Zhou, Jie; Zhang, JianYun; Huang, LongQuan

2017-03-01

Vitamin B 6 comprises six interconvertible pyridine compounds, among which pyridoxal 5'-phosphate (PLP) is a coenzyme for over 140 enzymes. PLP is also a very reactive aldehyde. The most well established mechanism for maintaining low levels of free PLP is its dephosphorylation by phosphatases. A human PLP-specific phosphatase has been identified and characterized. However, very little is known about the phosphatase in other living organisms. In this study, a cDNA clone of putative PLP phosphatase was identified from B. mori and characterized. The cDNA encodes a polypeptide of 343 amino acid residues, and the recombinant enzyme purified from E. coli exhibited properties similar to that of human PLP phosphatase. B. mori has a single copy of the PLPP gene, which is located on 11th chromosome, spans a 5.7kb region and contains five exons and four introns. PLP phosphatase transcript was detected in every larva tissue except hemolymph, and was most highly represented in Malpighian tube. We further down-regulated the gene expression of the PLP phosphatase in 5th instar larvae with the RNA interference. However, no significant changes in the gene expression of PLP biosynthetic enzymes and composition of B 6 vitamers were detected as compared with the control. Copyright © 2017 Elsevier Inc. All rights reserved.

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial.

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-03-17

Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.

A Multifunctional Bread Rich in Beta Glucans and Low in Starch Improves Metabolic Control in Type 2 Diabetes: A Controlled Trial

Science.gov (United States)

Tessari, Paolo; Lante, Anna

2017-01-01

Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350

Commercial breakfast cereals available in Mexican markets and their contribution in dietary fiber, β-glucans and protein quality by rat bioassays.

Science.gov (United States)

Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J

2014-09-01

The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.

The effect of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for CVD risk reduction: a systematic review and meta-analysis of randomised-controlled trials.

Science.gov (United States)

Ho, Hoang V T; Sievenpiper, John L; Zurbau, Andreea; Blanco Mejia, Sonia; Jovanovski, Elena; Au-Yeung, Fei; Jenkins, Alexandra L; Vuksan, Vladimir

2016-10-01

Oats are a rich source of β-glucan, a viscous, soluble fibre recognised for its cholesterol-lowering properties, and are associated with reduced risk of CVD. Our objective was to conduct a systematic review and meta-analysis of randomised-controlled trials (RCT) investigating the cholesterol-lowering potential of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for the risk reduction of CVD. MEDLINE, Embase, CINAHL and Cochrane CENTRAL were searched. We included RCT of ≥3 weeks of follow-up, assessing the effect of diets enriched with oat β-glucan compared with controlled diets on LDL-cholesterol, non-HDL-cholesterol or apoB. Two independent reviewers extracted data and assessed study quality and risk of bias. Data were pooled using the generic inverse-variance method with random effects models and expressed as mean differences with 95 % CI. Heterogeneity was assessed by the Cochran's Q statistic and quantified by the I 2-statistic. In total, fifty-eight trials (n 3974) were included. A median dose of 3·5 g/d of oat β-glucan significantly lowered LDL-cholesterol (-0·19; 95 % CI -0·23, -0·14 mmol/l, Pcholesterol (-0·20; 95 % CI -0·26, -0·15 mmol/l, PLDL-cholesterol (I 2=79 %) and non-HDL-cholesterol (I 2=99 %). Pooled analyses showed that oat β-glucan has a lowering effect on LDL-cholesterol, non-HDL-cholesterol and apoB. Inclusion of oat-containing foods may be a strategy for achieving targets in CVD reduction.

Effects of SOV-induced phosphatase inhibition and expression of protein tyrosine phosphatases in rat corneal endothelial cells.

Science.gov (United States)

Chen, Wei-Li; Harris, Deshea L; Joyce, Nancy C

2005-11-01

Contact inhibition is an important mechanism for maintaining corneal endothelium in a non-replicative state. Protein tyrosine phosphatases (PTPs) play a role in regulating the integrity of cell-cell contacts, differentiation, and growth. In this study, we aimed to evaluate whether phosphatases are involved in the maintenance of contact-dependent inhibition of proliferation in corneal endothelial cells and to identify candidate PTPs that are expressed in these cells and might be involved in regulation of contact inhibition. Confluent cultures of rat corneal endothelial cells or endothelium in ex vivo corneas were treated with the general phosphatase inhibitor, sodium orthovanadate (SOV). Immunocytochemistry (ICC) evaluated the effect of SOV on cell-cell contacts by staining for ZO-1, and on cell cycle progression by staining for Ki67. Transverse sections of rat cornea and cultured rat corneal endothelial cells were used to test for expression of the candidate PTPs: PTP-mu, PTP-LAR, PTP1B, SHP-1, SHP-2, and PTEN using ICC and either Western blots or RT-PCR. ZO-1 staining demonstrated that SOV induced a time-dependent release of cell-cell contacts in confluent cultures of corneal endothelial cells and in the endothelium of ex vivo corneas. Staining for Ki67 indicated that SOV promoted limited cell cycle progression in the absence of serum. PTP-mu, PTP1B, SHP-1, SHP-2, and PTEN, but not PTP-LAR, were expressed in rat corneal endothelial cells in situ and in culture. The subcellular location of PTP-mu and PTP1B differed in subconfluent and confluent cells, while that of SHP-1, SHP-2, and PTEN was similar, regardless of confluent status. Western blots confirmed the expression of PTP1B, SHP-1, SHP-2, and PTEN. RT-PCR confirmed expression of PTP-mu mRNA. Phosphatases are involved in regulation of junctional integrity and of cell proliferation in corneal endothelial cells. PTP-mu, PTP1B, SHP-1, SHP-2, and PTEN are expressed in rat corneal endothelium and may be involved in

Respiratory health in children, and indoor exposure to (1,3)-beta-D-glucan, EPS mould components and endotoxin

NARCIS (Netherlands)

Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.

For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular

Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan

Directory of Open Access Journals (Sweden)

Adrian Wiater

2016-09-01

Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.

Combining affinity proteomics and network context to identify new phosphatase substrates and adapters in growth pathways.

Directory of Open Access Journals (Sweden)

Francesca eSacco

2014-05-01

Full Text Available Protein phosphorylation homoeostasis is tightly controlled and pathological conditions are caused by subtle alterations of the cell phosphorylation profile. Altered levels of kinase activities have already been associated to specific diseases. Less is known about the impact of phosphatases, the enzymes that down-regulate phosphorylation by removing the phosphate groups. This is partly due to our poor understanding of the phosphatase-substrate network. Much of phosphatase substrate specificity is not based on intrinsic enzyme specificity with the catalytic pocket recognizing the sequence/structure context of the phosphorylated residue. In addition many phosphatase catalytic subunits do not form a stable complex with their substrates. This makes the inference and validation of phosphatase substrates a non-trivial task. Here, we present a novel approach that builds on the observation that much of phosphatase substrate selection is based on the network of physical interactions linking the phosphatase to the substrate. We first used affinity proteomics coupled to quantitative mass spectrometry to saturate the interactome of eight phosphatases whose down regulations was shown to affect the activation of the RAS-PI#K pathway. By integrating information from functional siRNA with protein interaction information, we develop a strategy that aims at inferring phosphatase physiological substrates. Graph analysis is used to identify protein scaffolds that may link the catalytic subunits to their substrates. By this approach we rediscover several previously described phosphatase substrate interactions and characterize two new protein scaffolds that promote the dephosphorylation of PTPN11 and ERK by DUSP18 and DUSP26 respectively.

Effect of vanadium compounds on acid phosphatase activity.

Science.gov (United States)

Vescina, C M; Sálice, V C; Cortizo, A M; Etcheverry, S B

1996-01-01

The direct effect of different vanadium compounds on acid phosphatase (ACP) activity was investigated. Vanadate and vanadyl but not pervanadate inhibited the wheat germ ACP activity. These vanadium derivatives did not alter the fibroblast Swiss 3T3 soluble fraction ACP activity. Using inhibitors of tyrosine phosphatases (PTPases), the wheat germ ACP was partially characterized as a PTPase. This study suggests that the inhibitory ability of different vanadium derivatives to modulate ACP activity seems to depend on the geometry around the vanadium atom more than on the oxidation state. Our results indicate a correlation between the PTPase activity and the sensitivity to vanadate and vanadyl cation.

Requirement for tyrosine phosphatase during serotonergic neuromodulation by protein kinase C.

Science.gov (United States)

Catarsi, S; Drapeau, P

1997-08-01

Tyrosine kinases and phosphatases are abundant in the nervous system, where they signal cellular differentiation, mediate the responses to growth factors, and direct neurite outgrowth during development. Tyrosine phosphorylation can also alter ion channel activity, but its physiological significance remains unclear. In an identified leech mechanosensory neuron, the ubiquitous neuromodulator serotonin increases the activity of a cation channel by activating protein kinase C (PKC), resulting in membrane depolarization and modulation of the receptive field properties. We observed that the effects on isolated neurons and channels were blocked by inhibiting tyrosine phosphatases. Serotonergic stimulation of PKC thus activates a tyrosine phosphatase activity associated with the channels, which reverses their constitutive inhibition by tyrosine phosphorylation, representing a novel form of neuromodulation.

[Spectroscopic analysis of the interaction of ethanol and acid phosphatase from wheat germ].

Science.gov (United States)

Xu, Dong-mei; Liu, Guang-shen; Wang, Li-ming; Liu, Wei-ping

2004-11-01

Conformational and activity changes of acid phosphatase from wheat germ in ethanol solutions of different concentrations were measured by fluorescence spectra and differential UV-absorption spectra. The effect of ethanol on kinetics of acid phosphatase was determined by using the double reciprocal plot. The results indicate the ethanol has a significant effect on the activity and conformation of acid phosphatase. The activity of acid phosphatase decreased linearly with increasing the concentration of ethanol. Differential UV-absorption spectra of the enzyme denatured in ethanol solutions showed two positive peaks at 213 and 234 nm, respectively. The peaks on the differential UV-absorption spectra suggested that the conformation of enzyme molecule changed from orderly structure to out-of-order crispation. The fluorescence emission peak intensity of the enzyme gradually strengthened with increasing ethanol concentration, which is in concordance with the conformational change of the microenvironments of tyrosine and tryptophan residues. The results indicate that the expression of the enzyme activity correlates with the stability and integrity of the enzyme conformation to a great degree. Ethanol is uncompetitive inhibitor of acid phosphatase.

Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.

Science.gov (United States)

Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H

2006-02-01

The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.

Interaction of Myosin Phosphatase Target Subunit (MYPT1) with Myosin Phosphatase-RhoA Interacting Protein (MRIP): A Role of Glutamic Acids in the Interaction.

Science.gov (United States)

Lee, Eunhee; Stafford, Walter F

2015-01-01

Scaffold proteins bind to and functionally link protein members of signaling pathways. Interaction of the scaffold proteins, myosin phosphatase target subunit (MYPT1) and myosin phosphatase-RhoA interacting protein (MRIP), causes co-localization of myosin phosphatase and RhoA to actomyosin. To examine biophysical properties of interaction of MYPT1 with MRIP, we employed analytical ultracentrifugation and surface plasmon resonance. In regard to MRIP, its residues 724-837 are sufficient for the MYPT1/MRIP interaction. Moreover, MRIP binds to MYPT1 as either a monomer or a dimer. With respect to MYPT1, its leucine repeat region, LR (residues 991-1030) is sufficient to account for the MYPT1/MRIP interaction. Furthermore, point mutations that replace glutamic acids 998-1000 within LR reduced the binding affinity toward MRIP. This suggests that the glutamic acids of MYPT1 play an important role in the interaction.

Morphology and Structural Properties of Novel Short Linear Glucan/Protein Hybrid Nanoparticles and Their Influence on the Rheological Properties of Starch Gel.

Science.gov (United States)

Li, Xiaojing; Ji, Na; Li, Man; Zhang, Shuangling; Xiong, Liu; Sun, Qingjie

2017-09-13

Starch nanoparticles were potential texture modifiers. However, they have strong tendency to aggregate and poor water dispersibility, which limited their application. The interaction between glucan (prepared from starch by enzymatic modification) and protein could significantly improve the dispersity of starch nanoparticles and, thus, enhance the rheological properties of food gels. In this work, glucan/protein hybrid nanoparticles were successfully developed for the first time using short linear glucan (SLG) and edible proteins [soy protein isolate (SPI), rice protein (RP), and whey protein isolate (WPI)]. The results showed that the SLG/SPI hybrid nanoparticles exhibited hollow structures, of which the smallest size was approximately 10-20 nm when the SLG/SPI ratio was 10:5. In contrast, SLG/RP nanoparticles displayed flower-like superstructures, and SLG/WPI nanoparticles presented stacked lamellar nanostructures with a width of 5-10 nm and a length of 50-70 nm. In comparison to bare SLG nanoparticles, SLG/SPI and SLG/WPI hybrid nanoparticles had higher melting temperatures. The addition of all nanoparticles greatly increased the storage modulus of corn starch gels and decreased loss tangent values. Importantly, the G' value of starch gels increased by 567% with the addition of flower-like SLG/RP superstructures.

An acid phosphatase in the plasma membranes of human astrocytoma showing marked specificity toward phosphotyrosine protein.

OpenAIRE

Leis, J F; Kaplan, N O

1982-01-01

The plasma membrane from the human tumor astrocytoma contains an active acid phosphatase activity based on hydrolysis of p-nitrophenyl phosphate. Other acid phosphatase substrates--beta-glycerophosphate, O-phosphorylcholine, and 5'-AMP--are not hydrolyzed significantly. The phosphatase activity is tartrate insensitive and is stimulated by Triton X-100 and EDTA. Of the three known phosphoamino acids, only free O-phosphotyrosine is hydrolyzed by the membrane phosphatase activity. Other acid pho...

Phosphotyrosine as a substrate of acid and alkaline phosphatases.

Science.gov (United States)

Apostoł, I; Kuciel, R; Wasylewska, E; Ostrowski, W S

1985-01-01

A new spectrophotometric method for following dephosphorylation of phosphotyrosine has been described. The absorption spectra of phosphotyrosine and tyrosine were plotted over the pH range from 3 to 9. The change in absorbance accompanying the conversion of phosphotyrosine to tyrosine was the greatest at 286 nm. The difference absorption coefficients were calculated for several pH values. Dephosphorylation of phosphotyrosine by acid phosphatases from human prostate gland, from wheat germ and potatoes obeys the Michaelis-Menten equation, whereas alkaline phosphatases calf intestine and E. coli are inhibited by excess of substrate.

Role of tyrosine phosphatase inhibitors in cancer treatment with emphasis on SH2 domain-containing tyrosine phosphatases (SHPs)

NARCIS (Netherlands)

Irandoust, Mahban; van den Berg, Timo K.; Kaspers, Gertjan J. L.; Cloos, Jacqueline

2009-01-01

Protein tyrosine phosphorylation is one of the key mechanisms involved in signal transduction pathways. This modification is regulated by concerted action of protein tyrosine phosphatases and protein tyrosine kinases. Deregulation of either of these key regulators lead to abnormal cellular

β-glucan enriched bath directly stimulates the wound healing process in common carp (Cyprinus carpio L.)

DEFF Research Database (Denmark)

Przybylska, Dominika Alicja; Schmidt, Jacob; Jiménez, Natalia Ivonne Vera

2013-01-01

of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1b, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1b, IL-6 family member M17 and IL-8 were...

Growth and extracellular phosphatase activity of arbuscular mycorrhizal hyphae as influenced by soil organic matter

DEFF Research Database (Denmark)

Joner, E.J.; Jakobsen, I.

1995-01-01

Two experiments were set up to investigate the influence of soil organic matter on growth of arbuscular mycorrhizal (AM) hyphae and concurrent changes in soil inorganic P, organic P and phosphatase activity. A sandy loam soil was kept for 14 months under two regimes (outdoor where surplus...... additions. In soil with added clover alkaline phosphatase activity increased due to the presence of mycorrhizal hyphae. We suggest that mycorrhizas may influence the exudation of acid phosphatase by roots. Hyphae of G. invermaium did apparently not excrete extracellular phosphatases, but their presence may...

Hydroxypropyl cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimers as effective carbohydrate-solubilizers for polycyclic aromatic hydrocarbons.

Science.gov (United States)

Choi, Jae Min; Jeong, Daham; Piao, Jinglan; Kim, Kyoungtea; Nguyen, Andrew Bao Loc; Kwon, Nak-Jung; Lee, Mi-Kyung; Lee, Im Soon; Yu, Jae-Hyuk; Jung, Seunho

2015-01-12

The removal of polycyclic aromatic hydrocarbons by soil washing using water is extremely difficult due to their intrinsic hydrophobic nature. In this study, the effective aqueous solubility enhancements of seven polycyclic aromatic hydrocarbons by chemically modified hydroxypropyl rhizobial cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimer have been investigated for the first time. In the presence of hydroxypropyl cyclic β-(1 → 2)-D-glucans, the solubility of benzo[a]pyrene is increased up to 38 fold of its native solubility. The solubility of pyrene and phenanthrene dramatically increased up to 160 and 359. Coronene, chrysene, perylene, and fluoranthene also show an increase of 11, 23, 23, and 97 fold, respectively, of enhanced solubility by complexation with synthetic epichlorohydrin β-cyclodextrin dimer. The physicochemical properties of the complex are characterized by Fourier-transform infrared spectra and differential scanning calorimetry. Utilizing a scanning electron microscopy, the morphological structures of native benzo[a]pyrene, pyrene, phenanthrene, coronene, chrysene, perylene, fluoranthene and their complex with novel carbohydrate-solubilizers are studied. These results elucidate that polycyclic aromatic hydrocarbons are able to form an efficient complex with hydroxypropyl cyclic β-(1 → 2)-D-glucans and β-cyclodextrin dimer, suggesting the potential usage of chemically modified novel carbohydrate-solubilizers. Copyright © 2014 Elsevier Ltd. All rights reserved.

Redox Regulation of Receptor Protein-Tyrosine Phosphatases

NARCIS (Netherlands)

Groen, A.J.

2006-01-01

Phosphorylation is of major importance in cell signalling processes like cell migration, cell proliferation and cell differentiation within higher eukaryotic organisms. Therefore, the balance between phosphorylation, mediated by kinases, and dephosphorylation, mediated by phosphatases, must be

First principles insight into the α-glucan structures of starch

DEFF Research Database (Denmark)

Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas

2010-01-01

A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....

The effect of aerobic exercise and barley β-glucan on blood glucose, body composition and blood pressure of diabetic women

Directory of Open Access Journals (Sweden)

Fatemeh Mokhtari

2018-04-01

Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.

A histochemical study of rat salivary gland acid phosphatase.

Science.gov (United States)

Isacsson, G

1986-01-01

Male Sprague-Dawley rats received 4 mg pilocarpine/100 g body wt intraperitoneally or physiological saline as control and were killed at various intervals. Acid phosphatase was reacted on frozen sections from soft palate, parotid and submandibular glands using sodium-alpha-naphthyl acid phosphate as substrate. Various inhibitors were added to the incubation medium. The strongest acid phosphatase activity was in the parotid gland acinar and proximal secretory duct cells; the mucous minor glands of the palate were completely negative. Activity was found in the acinar cells, proximal secretory duct cells, granular and striated duct and excretory duct cells. Pilocarpine injection slightly reduced the activity up to 6 h after injection. Cupric chloride added to the incubation medium lowered the overall activity. Fluoride and molybdate inhibited the acid phosphatase reaction in all structures. Tartrate inhibited the reaction in all structures except the submandibular striated duct cells. The tartrate-resistant activity may be a Na+K+-dependent ATPase involved in re-absorbing water and electrolytes from the primary saliva.

Correlations between calcineurin phosphatase inhibition and cyclosporine metabolites concentrations in kidney transplant recipients: Implications for immunoassays

DEFF Research Database (Denmark)

Jørgensen, Kaj Anker; Karamperis, Nikolaos; Koefoed-Nielsen, Pernille Bundgaard

2006-01-01

by inhibiting the enzyme calcineurin phosphatase. Determination of the enzyme's activity is one of the most promising pharmacodynamic markers. It is unknown how calcineurin phosphatase inhibition correlates with various cyclosporine monitoring assays and what is the potential impact of metabolites...... by the enzyme multiplied immunoassay technique (EMIT) and by the polyclonal fluorescence polarization immunoassay (pFPIA). Calcineurin phosphatase activity was measured by its ability to dephosphorylate a previously phosphorylated 19-amino acid peptide. We found that calcineurin phosphatase inhibition...

Correlations between calcineurin phosphatase inhibition and cyclosporine metabolites concentrations in kidney transplant recipients: implications for immunoassays

DEFF Research Database (Denmark)

Karamperis, N; Koefoed-Nielsen, PB; Brahe, P

2006-01-01

by inhibiting the enzyme calcineurin phosphatase. Determination of the enzyme's activity is one of the most promising pharmacodynamic markers. It is unknown how calcineurin phosphatase inhibition correlates with various cyclosporine monitoring assays and what is the potential impact of metabolites...... by the enzyme multiplied immunoassay technique (EMIT) and by the polyclonal fluorescence polarization immunoassay (pFPIA). Calcineurin phosphatase activity was measured by its ability to dephosphorylate a previously phosphorylated 19-amino acid peptide. We found that calcineurin phosphatase inhibition...

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

Energy Technology Data Exchange (ETDEWEB)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)

2013-07-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Development of anti β glucan aptamers for use as radiopharmaceutical in the identification of fungal Infections

International Nuclear Information System (INIS)

Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.

2013-01-01

Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)

Response to DNA damage: why do we need to focus on protein phosphatases?

Directory of Open Access Journals (Sweden)

Midori eShimada

2013-01-01

Full Text Available Eukaryotic cells are continuously threatened by unavoidable errors during normal DNA replication or various sources of genotoxic stresses that cause DNA damage or stalled replication. To maintain genomic integrity, cells have developed a coordinated signaling network, known as the DNA damage response (DDR. Following DNA damage, sensor molecules detect the presence of DNA damage and transmit signals to downstream transducer molecules. This in turn conveys the signals to numerous effectors, which initiate a large number of specific biological responses, including transient cell cycle arrest mediated by checkpoints, DNA repair, and apoptosis. It is recently becoming clear that dephosphorylation events are involved in keeping DDR factors inactive during normal cell growth. Moreover, dephosphorylation is required to shut off checkpoint arrest following DNA damage and has been implicated in the activation of the DDR. Spatial and temporal regulation of phosphorylation events is essential for the DDR, and fine-tuning of phosphorylation is partly mediated by protein phosphatases. While the role of kinases in the DDR has been well documented, the complex roles of protein dephosphorylation have only recently begun to be investigated. Therefore, it is important to focus on the role of phosphatases and to determine how their activity is regulated upon DNA damage. In this work, we summarize current knowledge on the involvement of serine/threonine phosphatases, especially the protein phosphatase 1, protein phosphatase 2A, and protein phosphatase Mg2+/Mn2+-dependent families, in the DDR.

Elevated serum tartrate-resistant acid phosphatase isoform 5a levels in metabolic syndrome.

Science.gov (United States)

Huang, Yi-Jhih; Huang, Tsai-Wang; Chao, Tsu-Yi; Sun, Yu-Shan; Chen, Shyi-Jou; Chu, Der-Ming; Chen, Wei-Liang; Wu, Li-Wei

2017-09-29

Tartrate-resistant phosphatase isoform 5a is expressed in tumor-associated macrophages and is a biomarker of chronic inflammation. Herein, we correlated serum tartrate-resistant phosphatase isoform 5a levels with metabolic syndrome status and made comparisons with traditional markers of inflammation, including c-reactive protein and interleukin-6. One hundred healthy volunteers were randomly selected, and cut-off points for metabolic syndrome related inflammatory biomarkers were determined using receiver operating characteristic curves. Linear and logistic regression models were subsequently used to correlate inflammatory markers with the risk of metabolic syndrome. Twenty-two participants met the criteria for metabolic syndrome, and serum tartrate-resistant phosphatase isoform 5a levels of >5.8 μg/L were associated with metabolic syndrome (c-statistics, 0.730; p = 0.001; 95% confidence interval, 0.618-0.842). In addition, 1 μg/L increases in tartrate-resistant phosphatase isoform 5a levels were indicative of a 1.860 fold increase in the risk of metabolic syndrome (p = 0.012). Elevated serum tartrate-resistant phosphatase isoform 5a levels are associated with the risk of metabolic syndrome, with a cut-off level of 5.8 μg/L.

Enzyme domain affects the movement of the voltage sensor in ascidian and zebrafish voltage-sensing phosphatases.

Science.gov (United States)

Hossain, Md Israil; Iwasaki, Hirohide; Okochi, Yoshifumi; Chahine, Mohamed; Higashijima, Shinichi; Nagayama, Kuniaki; Okamura, Yasushi

2008-06-27

The ascidian voltage-sensing phosphatase (Ci-VSP) consists of the voltage sensor domain (VSD) and a cytoplasmic phosphatase region that has significant homology to the phosphatase and tensin homolog deleted on chromosome TEN (PTEN). The phosphatase activity of Ci-VSP is modified by the conformational change of the VSD. In many proteins, two protein modules are bidirectionally coupled, but it is unknown whether the phosphatase domain could affect the movement of the VSD in VSP. We addressed this issue by whole-cell patch recording of gating currents from a teleost VSP (Dr-VSP) cloned from Danio rerio expressed in tsA201 cells. Replacement of a critical cysteine residue, in the phosphatase active center of Dr-VSP, by serine sharpened both ON- and OFF-gating currents. Similar changes were produced by treatment with phosphatase inhibitors, pervanadate and orthovanadate, that constitutively bind to cysteine in the active catalytic center of phosphatases. The distinct kinetics of gating currents dependent on enzyme activity were not because of altered phosphatidylinositol 4,5-bisphosphate levels, because the kinetics of gating current did not change by depletion of phosphatidylinositol 4,5-bisphosphate, as reported by coexpressed KCNQ2/3 channels. These results indicate that the movement of the VSD is influenced by the enzymatic state of the cytoplasmic domain, providing an important clue for understanding mechanisms of coupling between the VSD and its effector.

Post radiation protection and enhancement of DNA repair of beta glucan isolated from Ganoderma lucidum

International Nuclear Information System (INIS)

Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.

2013-01-01

Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)

Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

Science.gov (United States)

Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

2012-01-01

Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D-glucan

Detergent insolubility of alkaline phosphatase during biosynthetic transport and endocytosis. Role of cholesterol

NARCIS (Netherlands)

Cerneus, D. P.; Ueffing, E.; Posthuma, G.; Strous, G. J.; van der Ende, A.

1993-01-01

Alkaline phosphatase is anchored to the outer leaflet of the plasma membrane by a covalently attached glycosyl-phosphatidylinositol anchor. We have studied the biosynthetic transport and endocytosis of alkaline phosphatase in the choriocarcinoma cell line BeWo, which endogenously expresses this

Emerging issues in receptor protein tyrosine phosphatase function: lifting fog or simply shifting?

DEFF Research Database (Denmark)

Petrone, A; Sap, J

2000-01-01

Transmembrane (receptor) tyrosine phosphatases are intimately involved in responses to cell-cell and cell-matrix contact. Several important issues regarding the targets and regulation of this protein family are now emerging. For example, these phosphatases exhibit complex interactions with signal...

Comparative studies on the induction of Trichoderma harzianum mutanase by α-(1→3)-glucan-rich fruiting bodies and mycelia of Laetiporus sulphureus.

Science.gov (United States)

Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz

2012-01-01

Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.

Crystal structure of the cytoplasmic phosphatase and tensin homolog (PTEN)-like region of Ciona intestinalis voltage-sensing phosphatase provides insight into substrate specificity and redox regulation of the phosphoinositide phosphatase activity.

Science.gov (United States)

Matsuda, Makoto; Takeshita, Kohei; Kurokawa, Tatsuki; Sakata, Souhei; Suzuki, Mamoru; Yamashita, Eiki; Okamura, Yasushi; Nakagawa, Atsushi

2011-07-01

Ciona intestinalis voltage-sensing phosphatase (Ci-VSP) has a transmembrane voltage sensor domain and a cytoplasmic region sharing similarity to the phosphatase and tensin homolog (PTEN). It dephosphorylates phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate upon membrane depolarization. The cytoplasmic region is composed of a phosphatase domain and a putative membrane interaction domain, C2. Here we determined the crystal structures of the Ci-VSP cytoplasmic region in three distinct constructs, wild-type (248-576), wild-type (236-576), and G365A mutant (248-576). The crystal structure of WT-236 and G365A-248 had the disulfide bond between the catalytic residue Cys-363 and the adjacent residue Cys-310. On the other hand, the disulfide bond was not present in the crystal structure of WT-248. These suggest the possibility that Ci-VSP is regulated by reactive oxygen species as found in PTEN. These structures also revealed that the conformation of the TI loop in the active site of the Ci-VSP cytoplasmic region was distinct from the corresponding region of PTEN; Ci-VSP has glutamic acid (Glu-411) in the TI loop, orienting toward the center of active site pocket. Mutation of Glu-411 led to acquirement of increased activity toward phosphatidylinositol 3,5-bisphosphate, suggesting that this site is required for determining substrate specificity. Our results provide the basic information of the enzymatic mechanism of Ci-VSP.

Enzyme kinetic characterization of protein tyrosine phosphatases

DEFF Research Database (Denmark)

Peters, Günther H.J.; Branner, S.; Møller, K. B.

2003-01-01

Protein tyrosine phosphatases (PTPs) play a central role in cellular signaling processes, resulting in an increased interest in modulating the activities of PTPs. We therefore decided to undertake a detailed enzyme kinetic evaluation of various transmembrane and cytosolic PTPs (PTPalpha, PTPbeta...

Lysophosphatidic acids are new substrates for the phosphatase domain of soluble epoxide hydrolase[S

OpenAIRE

Oguro, Ami; Imaoka, Susumu

2012-01-01

Soluble epoxide hydrolase (sEH) is a bifunctional enzyme that has a C-terminus epoxide hydrolase domain and an N-terminus phosphatase domain. The endogenous substrates of epoxide hydrolase are known to be epoxyeicosatrienoic acids, but the endogenous substrates of the phosphatase activity are not well understood. In this study, to explore the substrates of sEH, we investigated the inhibition of the phosphatase activity of sEH toward 4-methylumbelliferyl phosphate by using lecithin and its hyd...

Structural Characterization and Antioxidative Activity of Low-Molecular-Weights Beta-1,3-Glucan from the Residue of Extracted Ganoderma lucidum Fruiting Bodies

Directory of Open Access Journals (Sweden)

Pai-Feng Kao

2012-01-01

Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.

Central regulation of metabolism by protein tyrosine phosphatases

Directory of Open Access Journals (Sweden)

Ryan eTsou

2013-01-01

Full Text Available Protein tyrosine phosphatases (PTPs are important regulators of intracellular signaling pathways via the dephosphorylation of phosphotyrosyl residues on various receptor and non-receptor substrates. The phosphorylation state of central nervous system (CNS signaling components underlies the molecular mechanisms of a variety of physiological functions including the control of energy balance and glucose homeostasis. In this review, we summarize the current evidence implicating PTPs as central regulators of metabolism, specifically highlighting their interactions with the neuronal leptin and insulin signaling pathways. We discuss the role of a number of PTPs (PTP1B, SHP2, TCPTP, RPTPe, and PTEN, reviewing the findings from genetic mouse models and in vitro studies which highlight these phosphatases as key central regulators of energy homeostasis.

2,3-diphosphoglycerate phosphatase activity of phosphoglycerate mutase: stimulation by vanadate and phosphate

International Nuclear Information System (INIS)

Stankiewicz, P.J.; Gresser, M.J.; Tracey, A.S.; Hass, L.F.

1987-01-01

The binding of inorganic vanadate (V/sub i/) to rabbit muscle phosphoglycerate mutase (PGM), studied by using 51 V nuclear magnetic resonance spectroscopy, shows a sigmoidal dependence on vanadate concentration with a stoichiometry of four vanadium atoms per PGM molecule at saturating [V/sub i/]. The data are consistent with binding of one divanadate ion to each of the two subunits of PGM in a noncooperative manner with an intrinsic dissociation constant of 4 x 10 -6 M. The relevance of this result to other studies which have shown that the V/sub i/-stimulated 2,3-diphosphoglycerate (2,3-DPG) phosphatase activity of PGM has a sigmoidal dependence on [V/sub i/] with a Hill coefficient of 2.0 is discussed. At pH 7.0, inorganic phosphate has little effect on the 2,3-DPG phosphatase activity of PGM, even at concentrations as high as 50 mM. Similarly, 25 μM V/sub i/ has little effect on the phosphatase activity. However, in the presence of 25 μM V/sub i/, a phosphate concentration of 20 mM increases the phosphatase activity by more than 3-fold. This behavior is rationalized in terms of activation of the phosphatase activity by a phosphate/vanadate mixed anhydride. This interpretation is supported by the observation of strong activation of the phosphatase activity by inorganic pyrophosphate. A molecular mechanism for the observed effects of vanadate is proposed, and the relevance of this study to the possible use of vanadate as a therapeutic agent for the treatment of sickle cell anemia is discussed

Dephosphorylation of microtubule-binding sites at the neurofilament-H tail domain by alkaline, acid, and protein phosphatases.

Science.gov (United States)

Hisanaga, S; Yasugawa, S; Yamakawa, T; Miyamoto, E; Ikebe, M; Uchiyama, M; Kishimoto, T

1993-06-01

The dephosphorylation-induced interaction of neurofilaments (NFs) with microtubules (MTs) was investigated by using several phosphatases. Escherichia coli alkaline and wheat germ acid phosphatases increased the electrophoretic mobility of NF-H and NF-M by dephosphorylation, and induced the binding of NF-H to MTs. The binding of NFs to MTs was observed only after the electrophoretic mobility of NF-H approached the exhaustively dephosphorylated level when alkaline phosphatase was used. The number of phosphate remaining when NF-H began to bind to MTs was estimated by measuring phosphate bound to NF-H. NF-H did not bind to MTs even when about 40 phosphates from the total of 51 had been removed by alkaline phosphatase. The removal of 6 further phosphates finally resulted in the association of NF-H with MTs. A similar finding, that the restricted phosphorylation sites in the NF-H tail domain, but not the total amount of phosphates, were important for binding to MTs, was also obtained with acid phosphatases. In contrast to alkaline and acid phosphatases, four classes of protein phosphatases (protein phosphatases 1, 2A, 2B, and 2C) were ineffective for shifting the electrophoretic mobility of NF proteins and for inducing the association of NFs to MTs.

SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease

Energy Technology Data Exchange (ETDEWEB)

Wang, P.; Israelian, L.; Xue, Y.; Song, S.; Attisano, L.; Minassian, B.

2016-07-01

Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease

International Nuclear Information System (INIS)

Wang, P.; Israelian, L.; Xue, Y.; Song, S.; Attisano, L.; Minassian, B.

2016-01-01

Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

Novel Combinatorial Chemistry-Derived Inhibitors of Oncogenic Phosphatases

National Research Council Canada - National Science Library

Lazo, John

1999-01-01

Our overall goal of this US Army Breast Cancer Grant entitled "Novel Combinatorial Chemistry-Derived Inhibitors of Oncogenic Phosphatases" is to identity and develop novel therapeutic agents for human breast cancer...

Cloning and characterization of rat density-enhanced phosphatase-1, a protein tyrosine phosphatase expressed by vascular cells.

Science.gov (United States)

Borges, L G; Seifert, R A; Grant, F J; Hart, C E; Disteche, C M; Edelhoff, S; Solca, F F; Lieberman, M A; Lindner, V; Fischer, E H; Lok, S; Bowen-Pope, D F

1996-09-01

We have cloned from cultured vascular smooth muscle cells a protein tyrosine phosphatase, rat density-enhanced phosphatase-1 (rDEP-1), which is a probable rat homologue of DEP-1/HPTP eta. rDEP-1 is encoded by an 8.7-kb transcript and is expressed as a 180- to 220-kD protein. The rDEP-1 gene is located on human chromosome 11 (region p11.2) and on mouse chromosome 2 (region 2E). The cDNA sequence predicts a transmembrane protein consisting of a single phosphatase catalytic domain in the intracellular region, a single transmembrane domain, and eight fibronectin type III repeats in the extracellular region (GenBank accession number U40790). In situ hybridization analysis demonstrates that rDEP-1 is widely expressed in vivo but that expression is highest in cells that form epithelioid monolayers. In cultured cells with epitheliod morphology, including endothelial cells and newborn smooth muscle cells, but not in fibroblast-like cells, rDEP-1 transcript levels are dramatically upregulated as population density increases. In vivo, quiescent endothelial cells in normal arteries express relatively high levels of rDEP-1. During repair of vascular injury, expression of rDEP-1 is downregulated in migrating and proliferating endothelial cells. In vivo, rDEP-1 transcript levels are present in very high levels in megakaryocytes, and circulating plates have high levels of the rDEP-1 protein. In vitro, initiation of differentiation of the human megakaryoblastic cell line CHRF-288-11 with phorbol 12-myristate 13-acetate leads to a very strong upregulation of rDEP-1 transcripts. The deduced structure and the regulation of expression of rDEP-1 suggest that it may play a role in adhesion and/or signaling events involving cell-cell and cell-matrix contact.

 Alkaline phosphatase normalization is a biomarker of improved survival in primary sclerosing cholangitis.

Science.gov (United States)

Hilscher, Moira; Enders, Felicity B; Carey, Elizabeth J; Lindor, Keith D; Tabibian, James H

2016-01-01

 Introduction. Recent studies suggest that serum alkaline phosphatase may represent a prognostic biomarker in patients with primary sclerosing cholangitis. However, this association remains poorly understood. Therefore, the aim of this study was to investigate the prognostic significance and clinical correlates of alkaline phosphatase normalization in primary sclerosing cholangitis. This was a retrospective cohort study of patients with a new diagnosis of primary sclerosing cholangitis made at an academic medical center. The primary endpoint was time to hepatobiliaryneoplasia, liver transplantation, or liver-related death. Secondary endpoints included occurrence of and time to alkaline phosphatase normalization. Patients who did and did not achieve normalization were compared with respect to clinical characteristics and endpoint-free survival, and the association between normalization and the primary endpoint was assessed with univariate and multivariate Cox proportional-hazards analyses. Eighty six patients were included in the study, with a total of 755 patient-years of follow-up. Thirty-eight patients (44%) experienced alkaline phosphatase normalization within 12 months of diagnosis. Alkaline phosphatase normalization was associated with longer primary endpoint-free survival (p = 0.0032) and decreased risk of requiring liver transplantation (p = 0.033). Persistent normalization was associated with even fewer adverse endpoints as well as longer survival. In multivariate analyses, alkaline phosphatase normalization (adjusted hazard ratio 0.21, p = 0.012) and baseline bilirubin (adjusted hazard ratio 4.87, p = 0.029) were the only significant predictors of primary endpoint-free survival. Alkaline phosphatase normalization, particularly if persistent, represents a robust biomarker of improved long-term survival and decreased risk of requiring liver transplantation in patients with primary sclerosing cholangitis.

Crystal Structure of α-1,4-Glucan Lyase, a Unique Glycoside Hydrolase Family Member with a Novel Catalytic Mechanism

NARCIS (Netherlands)

Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.

2013-01-01

α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades

TORC1 regulates Pah1 phosphatidate phosphatase activity via the Nem1/Spo7 protein phosphatase complex.

Directory of Open Access Journals (Sweden)

Emmanuelle Dubots

Full Text Available The evolutionarily conserved target of rapamycin complex 1 (TORC1 controls growth-related processes such as protein, nucleotide, and lipid metabolism in response to growth hormones, energy/ATP levels, and amino acids. Its deregulation is associated with cancer, type 2 diabetes, and obesity. Among other substrates, mammalian TORC1 directly phosphorylates and inhibits the phosphatidate phosphatase lipin-1, a central enzyme in lipid metabolism that provides diacylglycerol for the synthesis of membrane phospholipids and/or triacylglycerol as neutral lipid reserve. Here, we show that yeast TORC1 inhibits the function of the respective lipin, Pah1, to prevent the accumulation of triacylglycerol. Surprisingly, TORC1 regulates Pah1 in part indirectly by controlling the phosphorylation status of Nem1 within the Pah1-activating, heterodimeric Nem1-Spo7 protein phosphatase module. Our results delineate a hitherto unknown TORC1 effector branch that controls lipin function in yeast, which, given the recent discovery of Nem1-Spo7 orthologous proteins in humans, may be conserved.

The dual effect of curcumin nanoparticles encapsulated by 1-3/1-6 β-glucan from medicinal mushrooms Hericium erinaceus and Ganoderma lucidum

Science.gov (United States)

Huong Le, Mai; Doan Do, Hai; Tran Thi, Hong Ha; Dung, Le Vu; Nguyen, Hoai Nam; Nhu Tran Thi, Hang; Dinh Nguyen, Luyen; Hoang, Chi Kim; Le, Huu Cuong; Huong Le Thi, Thu; Trinh, Hoang Trung; Thu Ha, Phuong

2016-12-01

Curcumin is a polyphenol from turmeric Curcuma longa L that has been proved to possess numerous biological and pharmaceutical activities, including anti-cancer properties. However, curcumin has only limited clinical applications due to the aqueous insolubility characteristic that reduces its biological availability. On the other hand, using nanoparticles as drug delivery system has potential as it increases solubility of hydrophobic substances such as curcumin. Furthermore, nanoparticles can protect and control release of drug. Therefore, the objective of this project is to prepare nanoparticles by polymeric encapsulating curcumin by 1-3/1-6 β-glucan extracted from Vietnamese mushrooms to increase drug delivery efficiency and biological effect. Method of the preparation is nano-precipitation. The produced curcumin-β-glucan-nanoparticles (NanoGluCur) takes spherical shape with 60-70 nm in diameter. As expected, water solubility of curcumin increases about 180 times, from 0.6 μg ml-1 to 0.11 mg ml-1. Loading capacity of NanoGluCur is 18.16%. In vitro cytotoxicity and anti-tumor promoting effects of NanoGluCur were also investigated. Results revealed that NanoGluCur is able to inhibit the growth of two human cancer cell lines Hep-G2 and LU-1 with IC50 values of 6.82 and 15.53 mg ml-1, respectively, while free curcumin expresses the activity with IC50 values of 7.41 and 18.82 mg ml-1. At the concentration of 40 mg ml-1, NanoGluCur showed anti-tumor promoting effects in reducing tumor size by 59.93% and tumor density by 40.52%, while the percentages caused by pristine curcumin were 41.36% and 29.14%, respectively. These results demonstrated dual effect of 1-3/1-6 β-glucan encapsulated curcumin nanoparticles: higher water solubility and better in vitro anti-cancer effects compared to free curcumin and 1-3/1-6 β-glucan, expectedly. This observation can potentially open a new approach in research and manufacture of functional foods from medicinal mushrooms.

The involvement of glucose-6-phosphatase in mucilage secretion by root cap cells of Zea mays

Science.gov (United States)

Moore, R.; McClelen, C. E.

1985-01-01

In order to determine the involvement of glucose-6-phosphatase in mucilage secretion by root cap cells, we have cytochemically localized the enzyme in columella and peripheral cells of root caps of Zea mays. Glucose-6-phosphatase is associated with the plasmalemma and cell wall of columella cells. As columella cells differentiate into peripheral cells and begin to produce and secrete mucilage, glucose-6-phosphatase staining intensifies and becomes associated with the mucilage and, to a lesser extent, the cell wall. Cells being sloughed from the cap are characterized by glucose-6-phosphatase staining being associated with the vacuole and plasmalemma. These changes in enzyme localization during cellular differentiation in root caps suggest that glucose-6-phosphatase is involved in the production and/or secretion of mucilage by peripheral cells of Z. mays.

Effects of Low Molecular Weight Yeast β-Glucan on Antioxidant and Immunological Activities in Mice

Directory of Open Access Journals (Sweden)

Na Lei

2015-09-01

Full Text Available To evaluate the antioxidant and immune effects of low molecular yeast β-glucan on mice, three sulfated glucans from Saccharomyces cerevisiae (sGSCs with different molecular weight (MW and degrees of sulfation (DS were prepared. The structures of the sGSCs were analyzed through high performance liquid chromatography-gel permeation chromatography (HPLC-GPC and Fourier transform infrared spectroscopy (FTIR. sGSC1, sGSC2, and sGSC3 had MW of 12.9, 16.5 and 19.2 kDa, respectively, and DS of 0.16, 0.24 and 0.27, respectively. In vitro and in vivo experiments were conducted to evaluate the antioxidant and immunological activities of the sGSCs. In vitro experiment, the reactive oxygen species (ROS scavenging activities were determined. In vivo experiment, 50 male BALB/c mice were divided into five groups. The sGSC1, sGSC2 and sGSC3 treatment groups received the corresponding sGSCs at 50 mg/kg/day each. The GSC (glucans from Saccharomyces cerevisiae treatment group received 50 mg/kg/day GSC. The normal control group received equal volume of physiological saline solution. All treatments were administered intragastrically for 14 day. Results showed that sGSC1, sGSC2 and sGSC3 can scavenge 1,1-diphenyl-2-picryl-hydrazyl (DPPH, superoxide, and hydroxyl radicals in vitro. The strength of the radical scavenging effects of the sGSCs was in the order of sGSC1 > sGSC2 > sGSC3. Oral administration of sGSC1 significantly improved serum catalase (CAT and glutathione peroxidase (GSH-Px activities and decreased malondialdehyde (MDA level in mice. sGSC1 significantly improved the spleen and thymus indexes and the lymphocyte proliferation, effectively enhanced the percentage of CD4+ T cells, decreased the percentage of CD8+ T cells, and elevated the CD4+/CD8+ ratio. sGSC1 significantly promoted the secretion of IL-2 and IFN-γ. These results indicate that sGSC1 with low MW and DS has better antioxidant and immunological activities than the other sGSCs, and sGSC1 could

Evidence for phosphoprotein phosphatase in Streptomyces granaticolor

Czech Academy of Sciences Publication Activity Database

Bobek, J.; Hercík, K.; Dobrová, Zuzana; Branny, Pavel; Nádvorník, Richard; Janeček, Jiří

2000-01-01

Roč. 45, č. 4 (2000), s. 310-312 ISSN 0015-5632 R&D Projects: GA ČR GA204/99/1534 Institutional research plan: CEZ:AV0Z5020903 Keywords : streptomycetes * phosphoprotein phosphatase Subject RIV: EE - Microbiology, Virology Impact factor: 0.752, year: 2000

Purification and properties of acid phosphatase from Avena elatior L. seeds

Directory of Open Access Journals (Sweden)

E. Wieczorek

2015-01-01

Full Text Available Acid phosphatase F1 from Avena elatior seeds was isolated and partially purified by means of alcohol precepitation, DEAE-, CM-column chromatography, Sephadex G-150, Sephadex G-200 and Sepharose 4B - gel filtration. The enzyme was stable at 50°C, pH 5.1. The pH optimum for phosphatase activity was 4.2. Fluoride, Zn2+, molybdate were effective inhibitors. EDTA and l, 10-phenanthroline activated the enzyme.

Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene

Energy Technology Data Exchange (ETDEWEB)

Polymeropoulos, M H; Xiao, Hong; Rath, D S; Merril, C R [National Inst. of Mental Health Neuroscience Center, Washington, DC (United States)

1991-09-11

The polymorphic (AAAT){sub n} repeat begins at base pair 2342 of the human prostatic acid phosphatase gene on chromosome 3q21-qter. The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously. The predicted length of the amplified sequence was 275 bp. Co-dominant segregation was observed in two informative families. The human prostatic acid phosphatase gene has been assigned to chromosome 3q21-qter.

Proteomic analysis of protein phosphatase Z1 from Candida albicans.

Directory of Open Access Journals (Sweden)

Bernadett Márkus

Full Text Available Protein phosphatase Z is a "novel type" fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0 that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly

Proteomic analysis of protein phosphatase Z1 from Candida albicans

Science.gov (United States)

Pfliegler, Walter P.; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Dombrádi, Viktor

2017-01-01

Protein phosphatase Z is a “novel type” fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for

[Kinetic study on inhibition effects of dansyl-L-phenylalanine and L-phenylalanine on calf intestinal alkaline phosphatase].

Science.gov (United States)

Li, Li-Na; Wu, Yu-Qing; Buchet, René

2009-10-01

To evaluate the inhibition effect of dansyl-L-phenylalanine on calf intestinal alkaline phosphatase (CIAP), UV-Vis spectrophotometric method was employed. It was found that dansyl-L-phenylalanine can selectively inhibit CIAP. The kinetic inhibition processes of dansyl-L-phenylalanine and L-phenylalanine were comparatively studied. The authors' finding elucidates that at the optimized alkaline pH of alkaline phosphatase (pH 10.4) and 37 degrees C, dansyl-L-phenylalanine can inhibit alkaline phosphatase activity of CIAP efficiently and specifically, similar as L-phenylalanine. Both inhibition types were uncompetitive inhibition resulting from the double reciprocal curve fitting of upsilon versus substrate concentrations, and the inhibition constants Ki of both inhibitors were determined to be 2.3 and 1.1 mmol L(-1) respectively, both of which were at millimolar level. The investigation of the inhibition effect of dansyl modified L-phenylalanine on calf intestinal alkaline phosphatase not only helped get insight into the detailed inhibition mechanism of L-phenylalanine on tissue specific alkaline phosphatase, such as in the case of intestinal alkaline phosphatase, but also provided the possibility to employ fluorescence spectroscopy by labeling the specific inhibitors of alkaline phosphatase with chromophoric groups.

Alkaline phosphatase levels in patients with coronary heart disease saliva and its relation with periodontal status

Science.gov (United States)

Yunita, Dina Suci; Masulili, Sri Lelyati C.; Tadjoedin, Fatimah M.; Radi, Basuni

2017-02-01

Coronary heart disease (CHD) is a disease that causes narrowing of the coronary arteries. Currently, there is a hypothesis regarding periodontal infection that increases risk for heart disease. Alkaline phosphatase (ALP) as a marker of inflammation will increase in atherosclerosis and periodontal disease. The objective of this research is analyzing the relationship between the levels of alkaline phosphatase in saliva with periodontal status in patients with CHD and non CHD. Here, saliva of 104 subjects were taken, each 1 ml, and levels of Alkaline Phosphatase was analyzed using Abbott ci4100 architect. We found that no significant difference of Alkaline Phosphatase levels in saliva between CHD patients and non CHD. Therefore, it can be concluded that Alkaline Phosphatase levels in patients with CHD saliva was higher than non CHD and no association between ALP levels with periodontal status.

Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.

Science.gov (United States)

Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro

2013-12-15

A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.

An acid phosphatase in the plasma membranes of human astrocytoma showing marked specificity toward phosphotyrosine protein.

Science.gov (United States)

Leis, J F; Kaplan, N O

1982-11-01

The plasma membrane from the human tumor astrocytoma contains an active acid phosphatase activity based on hydrolysis of p-nitrophenyl phosphate. Other acid phosphatase substrates--beta-glycerophosphate, O-phosphorylcholine, and 5'-AMP--are not hydrolyzed significantly. The phosphatase activity is tartrate insensitive and is stimulated by Triton X-100 and EDTA. Of the three known phosphoamino acids, only free O-phosphotyrosine is hydrolyzed by the membrane phosphatase activity. Other acid phosphatases tested from potato, wheat germ, milk, and bovine prostate did not show this degree of specificity. The plasma membrane activity also dephosphorylated phosphotyrosine histone at a much greater rate than did the other acid phosphatases. pH profiles for free O-phosphotyrosine and phosphotyrosine histone showed a shift toward physiological pH, indicating possible physiological significance. Phosphotyrosine histone dephosphorylation activity was nearly 10 times greater than that seen for phosphoserine histone dephosphorylation, and Km values were much lower for phosphotyrosine histone dephosphorylation (0.5 microM vs. 10 microM). Fluoride and zinc significantly inhibited phosphoserine histone dephosphorylation. Vanadate, on the other hand, was a potent inhibitor of phosphotyrosine histone dephosphorylation (50% inhibition at 0.5 microM) but not of phosphoserine histone. ATP stimulated phosphotyrosine histone dephosphorylation (160-250%) but inhibited phosphoserine histone dephosphorylation (95%). These results suggest the existence of a highly specific phosphotyrosine protein phosphatase activity associated with the plasma membrane of human astrocytoma.

Displacement affinity chromatography of protein phosphatase one (PP1 complexes

Directory of Open Access Journals (Sweden)

Gourlay Robert

2008-11-01

Full Text Available Abstract Background Protein phosphatase one (PP1 is a ubiquitously expressed, highly conserved protein phosphatase that dephosphorylates target protein serine and threonine residues. PP1 is localized to its site of action by interacting with targeting or regulatory proteins, a majority of which contains a primary docking site referred to as the RVXF/W motif. Results We demonstrate that a peptide based on the RVXF/W motif can effectively displace PP1 bound proteins from PP1 retained on the phosphatase affinity matrix microcystin-Sepharose. Subsequent co-immunoprecipitation experiments confirmed that each identified binding protein was either a direct PP1 interactor or was in a complex that contains PP1. Our results have linked PP1 to numerous new nuclear functions and proteins, including Ki-67, Rif-1, topoisomerase IIα, several nuclear helicases, NUP153 and the TRRAP complex. Conclusion This modification of the microcystin-Sepharose technique offers an effective means of purifying novel PP1 regulatory subunits and associated proteins and provides a simple method to uncover a link between PP1 and additional cellular processes.

A population of Langerin-positive dendritic cells in murine Peyer's patches involved in sampling β-glucan microparticles.

Directory of Open Access Journals (Sweden)

Magdia De Jesus

Full Text Available Glucan particles (GPs are 2-4 μm hollow, porous shells composed of 1,3-β-D-glucan that have been effectively used for oral targeted-delivery of a wide range of payloads, including small molecules, siRNA, DNA, and protein antigens. While it has been demonstrated that the transepithelial transport of GPs is mediated by Peyer's patch M cells, the fate of the GPs once within gut-associated lymphoid tissue (GALT is not known. Here we report that fluorescently labeled GPs administered to mice by gavage accumulate in CD11c+ DCs situated in Peyer's patch sub-epithelial dome (SED regions. GPs appeared in DCs within minutes after gavage and remained within the SED for days afterwards. The co-administration or sequential administration of GPs with differentially labeled GPs or poly(lactic-co-glycolic acid nanoparticles demonstrated that the SED DC subpopulation in question was capable of internalizing particles of different sizes and material compositions. Phenotypic analysis identified the GP-containing DCs as being CD8α- and CD11blo/-, suggesting they are the so-called myeloid and/or double negative (DN subset(s of PP DCs. A survey of C-type lectin receptors (CLRs known to be expressed by leukocytes within the intestinal mucosa revealed that GP-containing SED DCs were positive for Langerin (CD207, a CLR with specificity for β-D-glucan and that has been shown to mediate the internalization of a wide range of microbial pathogens, including bacteria, viruses and fungi. The presence of Langerin+ DCs in the SED as determined by immunofluorescence was confirmed using Langerin E-GFP transgenic mice. In summary, our results demonstrate that following M cell-mediated transepithelial transport, GPs (and other micro/nanoparticles are sampled by a population of SED DCs distinguished from other Peyer's patch DC subsets by their expression of Langerin. Future studies will be aimed at defining the role of Langerin in antigen sampling and antigen presentation within

Src inhibitor herbimycin A prevents 132.7 kDa tyrosine phosphatase activity in Ramos Burkitt's lymphoma B cell line

International Nuclear Information System (INIS)

Hristov, K.; Mitev, V.; Knox, K.

2006-01-01

Reversible tyrosine phosphorylation, regulation of expression and proteolytic cleavage control tyrosine phosphatase contribution for the signalling pathways of B-cell antigen receptor (BCR), and CD40 during B cell selection. We used Ramos-BL B cell line to determine whether BCR and CD40 stimulation, or inhibition of the Src - tyrosine kinase, tyrosine phosphatase and caspase activity have an effect on the tyrosine phosphatase activities determined on in-gel phosphatase assay. The tyrosine phosphatase activities present in whole cell lysates of Ramos-BL B cells following treatment with 20 μg/ml anti-IgM, 1 μg/ml anti-CD40, 10 μM herbimycin A, 178 μM vanadate,100 μM phenylarsine oxide and 10 μM zVAD-fmk were detected with an in-gel phosphatase assay. Seven major tyrosine phosphatase activities with approximate molecular weight of 132.7, 63.9, 60.3, 54.2, 49.7, 44.6, and 39 kDa are present in whole cell lysates of Ramos-BL B cells. Treatment with Src-PTK inhibitor herbimycin A prevents 132.7 kDa tyrosine phosphatase activity. We conclude that the catalytic activity of Src-PTK in Ramos-BL B cells is critical for the presence of this 132.7 kDa tyrosine phosphatase activity. (authors)

Modulation of catalytic activity in multi-domain protein tyrosine phosphatases.

Directory of Open Access Journals (Sweden)

Lalima L Madan

Full Text Available Signaling mechanisms involving protein tyrosine phosphatases govern several cellular and developmental processes. These enzymes are regulated by several mechanisms which include variation in the catalytic turnover rate based on redox stimuli, subcellular localization or protein-protein interactions. In the case of Receptor Protein Tyrosine Phosphatases (RPTPs containing two PTP domains, phosphatase activity is localized in their membrane-proximal (D1 domains, while the membrane-distal (D2 domain is believed to play a modulatory role. Here we report our analysis of the influence of the D2 domain on the catalytic activity and substrate specificity of the D1 domain using two Drosophila melanogaster RPTPs as a model system. Biochemical studies reveal contrasting roles for the D2 domain of Drosophila Leukocyte antigen Related (DLAR and Protein Tyrosine Phosphatase on Drosophila chromosome band 99A (PTP99A. While D2 lowers the catalytic activity of the D1 domain in DLAR, the D2 domain of PTP99A leads to an increase in the catalytic activity of its D1 domain. Substrate specificity, on the other hand, is cumulative, whereby the individual specificities of the D1 and D2 domains contribute to the substrate specificity of these two-domain enzymes. Molecular dynamics simulations on structural models of DLAR and PTP99A reveal a conformational rationale for the experimental observations. These studies reveal that concerted structural changes mediate inter-domain communication resulting in either inhibitory or activating effects of the membrane distal PTP domain on the catalytic activity of the membrane proximal PTP domain.

Thermoresponsive .beta.-glucan-based polymers for bimodal immunoradiotherapy - Are they able to promote the immune system?

Czech Academy of Sciences Publication Activity Database

Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin

2017-01-01

Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016

(1,3;1,4)-β-Glucan Biosynthesis by the CSLF6 Enzyme: Position and Flexibility of Catalytic Residues Influence Product Fine Structure.

Science.gov (United States)

Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B

2016-04-05

Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.

Phosphatase activity in Antarctica soil samples as a biosignature of extant life

Science.gov (United States)

Sato, Shuji; Itoh, Yuki; Takano, Yoshinori; Fukui, Manabu; Kaneko, Takeo; Kobayashi, Kensei

Microbial activities have been detected in such extreme terrestrial environments as deep lithosphere, a submarine hydrothermal systems, stratosphere, and Antarctica. Microorganisms have adapted to such harsh environments by evolving their biomolecules. Some of these biomolecules such as enzymes might have different characteristics from those of organisms in ordinary environments. Many biosignatures (or biomarkers) have been proposed to detect microbial activities in such extreme environments. A number of techniques are proposed to evaluate biological activities in extreme environments including cultivation methods, assay of metabolism, and analysis of bioorganic compounds like amino acids and DNA. Enzyme activities are useful signature of extant life in extreme environments. Among many enzymes, phosphatase could be a good indicator of biological activities, since phosphate esters are essential for all the living terrestrial organisms. In addition, alkaline phosphatase is known as a typical zinc-containing metalloenzyme and quite stable in environments. We analyzed phosphatase activities in Antarctica soil samples to see whether they can be used as biosignatures for extant life. In addition, we characterized phosphatases extracted from the Antarctica soil samples, and compared with those obtained from other types of environments. Antarctica surface environments are quite severe environments for life since it is extremely cold and dry and exposed to strong UV and cosmic rays. We tried to evaluate biological activities in Antarctica by measuring phosphatase activities. Surface soil samples are obtained at the Sites 1-8 near Showa Base in Antarctica during the 47th Japan Antarctic exploration mission in 2005-6. Activities of acid phosphatase (ACP) and alkaline phosphatase (ALP) are measured spectrophotometrically after mixing the powdered sample and p-nitrophenyl phosphate solution (pH 6.5 for ACP, pH 8.0 for ALP). ALP was characterized after extraction from soils with

Acid phosphatase from stored Poa pratensis caryopses and its ability for binding to lectins

Directory of Open Access Journals (Sweden)

Irena Lorenc-Kubis

2014-01-01

Full Text Available The effect of the storage period of Poa pratensis caryopses on acid phosphatase activity and on the ability of this enzyme to interact with lectins has been studied. It has been shown that after ten years of caryopses storage, the activity of acid phosphatase decreased about 50 per cent, while the content of proteins and carbohydrates did not change. The decrease of enzyme activity during the long period of storage was found only in seeds, but not in chaffs. Acid phosphatase was isolated from caryopses stored one, two, three, five and ten years. The enzyme showed the ability to bind to immoblized as well as to free conA during the whole period of storage, hut did not react with Wheat Germen Agglutinin (WGA. The activation of acid phosphatase by binding to conA decreased with the length of storage period.

Identification and characterization of an ATP.Mg-dependent protein phosphatase from pig brain

International Nuclear Information System (INIS)

Yang, S.D.; Fong, Y.L.

1985-01-01

Substantial amounts of ATP.Mg-dependent phosphorylase phosphatase (Fc. M) and its activator (kinase FA) were identified and extensively purified from pig brain, in spite of the fact that glycogen metabolism in the brain is of little importance. The brain Fc.M was completely inactive and could only be activated by ATP.Mg and FA, isolated either from rabbit muscle or pig brain. Kinetical analysis of the dephosphorylation of endogenous brain protein indicates that Fc.M could dephosphorylate 32 P-labeled myelin basic protein (MBP) and [ 32 P]phosphorylase alpha at a comparable rate and moreover, this associated MBP phosphatase activity was also strictly kinase FA/ATP.Mg-dependent, demonstrating that MBP is a potential substrate for Fc.M in the brain. By manipulating MBP and inhibitor-2 as specific potent phosphorylase phosphatase inhibitors, we further demonstrate that 1) Fc.M contains two distinct catalytic sites to dephosphorylate different substrates, and 2) brain MBP may be a physiological trigger involved in the regulation of protein phosphatase substrate specificity in mammalian nervous tissues

Structure determination of T-cell protein-tyrosine phosphatase

DEFF Research Database (Denmark)

Iversen, L.F.; Møller, K. B.; Pedersen, A.K.

2002-01-01

Protein-tyrosine phosphatase 1B (PTP1B) has recently received much attention as a potential drug target in type 2 diabetes. This has in particular been spurred by the finding that PTP1B knockout mice show increased insulin sensitivity and resistance to diet-induced obesity. Surprisingly, the highly...... homologous T cell protein-tyrosine phosphatase (TC-PTP) has received much less attention, and no x-ray structure has been provided. We have previously co-crystallized PTP1B with a number of low molecular weight inhibitors that inhibit TC-PTP with similar efficiency. Unexpectedly, we were not able to co...... the high degree of functional and structural similarity between TC-PTP and PTP1B, we have been able to identify areas close to the active site that might be addressed to develop selective inhibitors of each enzyme....

The effect of yeast β-glucan on the amount of albumin, globulin, urea and total protein of broiler chickens

Directory of Open Access Journals (Sweden)

ali kargarirezapour

2013-08-01

Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p

Bone mineralisation in premature infants cannot be predicted from serum alkaline phosphatase or serum phosphate

DEFF Research Database (Denmark)

Faerk, J; Peitersen, Birgit; Petersen, S

2002-01-01

BACKGROUND: The bone mineral content of premature infants at term is lower than in mature infants at the same postconceptional age. Serum alkaline phosphatase and serum phosphate are often used as indicators of bone mineralisation. OBJECTIVE: To analyse the association between bone mineral content...... content was measured at term (mean gestational age 41 weeks) by dual energy x ray absorptiometry and corrected for body size. RESULTS: Serum alkaline phosphatase was significantly negatively associated with serum phosphate (p mineral content was not associated with mean serum alkaline...... and serum alkaline phosphatase and serum phosphate. METHODS: Serum alkaline phosphatase and phosphate were measured at weekly intervals during admission in 108 premature infants of gestational age below 32 weeks (mean (SD) gestational age 29 (2) weeks; mean (SD) birth weight 1129 (279) g). Bone mineral...

Decryptification of Acid Phosphatase in Arthrospores of Geotrichum Species Treated with Dimethyl Sulfoxide and Acetone

Science.gov (United States)

Cotter, David A.; Martel, Anita J.; MacDonald, Paul

1975-01-01

Decryptification of acid phosphatase in Geotrichum sp. arthrospores was accomplished using acetone or dimethyl sulfoxide treatment. Both dimethyl sulfoxide and acetone irreversibly destroyed the integrity of the spore membranes without solubilizing acid phosphatase. PMID:1167386

Biocatalysis with Sol-Gel Encapsulated Acid Phosphatase

Science.gov (United States)

Kulkarni, Suhasini; Tran, Vu; Ho, Maggie K.-M.; Phan, Chieu; Chin, Elizabeth; Wemmer, Zeke; Sommerhalter, Monika

2010-01-01

This experiment was performed in an upper-level undergraduate biochemistry laboratory course. Students learned how to immobilize an enzyme in a sol-gel matrix and how to perform and evaluate enzyme-activity measurements. The enzyme acid phosphatase (APase) from wheat germ was encapsulated in sol-gel beads that were prepared from the precursor…

Beta-1,3-1,6-glucan modulate the non-specific immune response to enhance the survival in the Vibrio alginolyticus infection of Taiwan abalone (Haliotis diversicolor supertexta).

Science.gov (United States)

Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua

2016-07-01

This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES

OpenAIRE

Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima

2017-01-01

The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...

Dephosphorylation of endotoxin by alkaline phosphatase in vivo

NARCIS (Netherlands)

Poelstra, Klaas; Bakker, W.W; Klok, P.A; Kamps, J.AAM; Hardonk, M.J; Meijer, D.K F

1997-01-01

Natural substrates for alkaline phosphatase (AP) are at present not identified despite extensive investigations. Difficulties in imagining a possible physiological function involve its extremely high pH optimum for the usual exogenous substrates and its localization as an ecto-enzyme. As endotoxin

Phosphate-solubility and phosphatase activity in Gangetic alluvial soil as influenced by organophosphate insecticide residues.

Science.gov (United States)

Majumder, Shyam Prasad; Das, Amal Chandra

2016-04-01

An experiment was conducted under laboratory conditions to investigate the effect of four organophosphate insecticides, viz. monocrotophos, profenophos, quinalphos and triazophos at their field application rates (0.75, 1.0, 0.5 and 0.6 kg a.i.ha(-1), respectively), on the growth and activities of phosphate solubilizing microorganisms in relation to availability of insoluble phosphates in the Gangetic alluvial soil of West Bengal, India. The proliferation of phosphate solubilizing microorganisms was highly induced with profenophos (38.3%), while monocrotophos exerted maximum stimulation (20.8%) towards the solubility of insoluble phosphates in soil. The phosphatase activities of the soil (both acid phosphatase and alkaline phosphatase) were significantly increased due to the incorporation of the insecticides in general, and the augmentation was more pronounced with quinalphos (43.1%) followed by profenophos (27.6%) for acid phosphatase, and with monocrotophos (25.2%) followed by profenophos (16.1%) for alkaline phosphatase activity in soil. The total phosphorus was highly retained by triazophos (19.9%) followed by monocrotophos (16.5%), while incorporation of triazophos and quinalphos manifested greater availability of water soluble phosphorus in soil. Copyright © 2015 Elsevier Inc. All rights reserved.

Influence of acid phosphatase activity on the saccharification of potato maltodextrins by Aspergillus niger glucoamylase

Energy Technology Data Exchange (ETDEWEB)

Zyla, K. (Akademia Rolnicza, Cracow (Poland). Dept. of Biotechnology)

1990-01-01

A preparation of Aspergillus niger acid phosphatase, which had the temperature optimum 60deg C, pH optimum 1.8-3.0; good stability at pH 4-5, the ability to hydrolyze glucose-6-phosphate at a high rate, and substantial lack of glucogenic activities, was used simultaneously with a glucoamylase in order to learn its influence on the saccharification of potato maltodextrins. The addition of the acid phosphatase activity in amounts that gave the 50 fold increase, as compared to phosphatase activity which naturally occurs in the gluocoamylase (GA) preparation 'AMG-200', was found to influence on the DE level, mainly at the high substrate concentration (40% d.s.) and low glucoamylase dosage (60-100 GAU/kg d.s.). It may also be possible, when using the acid phosphatase addition, to shorten the saccharification time. (orig.).

Integration of the sensory experience and post-ingestive measures for understanding food satisfaction. A case study on sucrose replacement by Stevia rebaudiana and addition of beta glucan in fruit drinks

DEFF Research Database (Denmark)

Andersen, Barbara Vad; Mielby, Line H.; Viemose, Ida

2017-01-01

apple-cherry fruit drinks with different levels of beta-glucans and different sweeteners, sucrose or Stevia rebaudiana. The aims were: 1) to study the hedonic sensory experience, 2) to study time and product effects on post-ingestive sensations and satisfaction, and 3) to study main drivers....... Satisfaction with sensory attributes was found to be the main driver of food satisfaction, while post-ingestive sensations drove satisfaction as well. While replacing sucrose with Stevia rebaudiana did not affect the hedonic and post-ingestive sensations, addition of beta glucan resulted in both positive...

Effect of a carbonated HAP/β-glucan composite bone substitute on healing of drilled bone voids in the proximal tibial metaphysis of rabbits

Energy Technology Data Exchange (ETDEWEB)

Borkowski, Leszek, E-mail: leszek.borkowski@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek [Department of Animal Physiology, University of Life Sciences in Lublin, Akademicka 12, 20-033 Lublin (Poland); Polkowska, Izabela [Department and Clinic of Animal Surgery, University of Life Sciences in Lublin, Głęboka 30, 20-612 Lublin (Poland); Belcarz, Anna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Karpiński, Mirosław [Department of Companion and Wildlife Animals, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin (Poland); Słowik, Tymoteusz [Independent Radiology Unit at Lublin Small Animals Medical Centre, Stefczyka 11, 20-151 Lublin (Poland); Matuszewski, Łukasz [Children' s Orthopaedic Clinic and Rehabilitation Department, Medical University of Lublin, Chodzki 2, 20-093 Lublin (Poland); Ślósarczyk, Anna [Faculty of Materials Science and Ceramics, AGH-University of Science and Technology, Mickiewicza 30, 30-059 Krakow (Poland); Ginalska, Grażyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland)

2015-08-01

A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration.

Effect of a carbonated HAP/β-glucan composite bone substitute on healing of drilled bone voids in the proximal tibial metaphysis of rabbits

International Nuclear Information System (INIS)

Borkowski, Leszek; Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek; Polkowska, Izabela; Belcarz, Anna; Karpiński, Mirosław; Słowik, Tymoteusz; Matuszewski, Łukasz; Ślósarczyk, Anna; Ginalska, Grażyna

2015-01-01

A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration

Characterization of oat beta-glucan and coenzyme Q10-loaded beta-glucan powders generated by the pressurized gas-expanded liquid (PGX) technology.

Science.gov (United States)

Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral

2018-04-01

The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

Catalytic activity of a novel serine/threonine protein phosphatase PP5 from Leishmania major

Directory of Open Access Journals (Sweden)

Norris-Mullins Brianna

2014-01-01

Full Text Available Leishmaniasis is a vector-borne disease caused by protozoan parasites of the genus Leishmania. Our knowledge of protein phosphatases (PPs and their implication in signaling events is very limited. Here we report the expression, characterization and mutagenesis analysis of a novel protein phosphatase 5 (PP5 in Leishmania major. Recombinant PP5 is a bona fide phosphatase and is enzymatically active. Site-directed mutagenesis revealed auto-inhibitory roles of the N-terminal region. This is a rational first approach to understand the role of PP5 in the biology of the parasite better as well as its potential future applicability to anti-parasitic intervention.

Receptor protein tyrosine phosphatase alpha is essential for hippocampal neuronal migration and long-term potentiation

DEFF Research Database (Denmark)

Petrone, Angiola; Battaglia, Fortunato; Wang, Cheng

2003-01-01

Despite clear indications of their importance in lower organisms, the contributions of protein tyrosine phosphatases (PTPs) to development or function of the mammalian nervous system have been poorly explored. In vitro studies have indicated that receptor protein tyrosine phosphatase alpha...

Synthesis and phosphatase activity of a Cobalt(II) phenanthroline ...

Indian Academy of Sciences (India)

MAMONI GARAI

2017-09-19

Sep 19, 2017 ... Synthesis and phosphatase activity of a Cobalt(II) phenanthroline complex. MAMONI GARAIa ... tion, cobalt complexes have gained importance because of their application as ... 2.3 Physical measurements. Infrared spectrum ...

Phosphatase and tensin homologue deleted on chromosome 10 ...

African Journals Online (AJOL)

Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

Interactions of grape tannins and wine polyphenols with a yeast protein extract, mannoproteins and β-glucan

OpenAIRE

Mekoue Nguela, Julie; Poncet-Legrand, Celine; Sieczkowski, N.; Vernhet, Aude

2016-01-01

At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored b...

Structural basis for inhibition of the protein tyrosine phosphatase 1B by phosphotyrosine peptide mimetics

NARCIS (Netherlands)

Groves, M R; Yao, Z J; Roller, P P; Burke, T R; Barford, D

1998-01-01

Protein tyrosine phosphatases regulate diverse cellular processes and represent important targets for therapeutic intervention in a number of diseases. The crystal structures of protein tyrosine phosphatase 1B (PTP1B) in complex with small molecule inhibitors based upon two classes of

Carboxymethyl chitin-glucan (CM-CG) protects human HepG2 and HeLa cells against oxidative DNA lesions and stimulates DNA repair of lesions induced by alkylating agents.

Science.gov (United States)

Slamenová, Darina; Kováciková, Ines; Horváthová, Eva; Wsólová, Ladislava; Navarová, Jana

2010-10-01

A large number of functional foods, including those that contain β-d-glucans, have been shown to prevent human DNA against genotoxic effects and associated development of cancer and other chronic diseases. In this paper, carboxymethyl chitin-glucan (CM-CG) isolated from Aspergillus niger was investigated from two standpoints: (1) DNA-protective effects against oxidative DNA damage induced by H(2)O(2) and alkylating DNA damage induced by MMS and MNNG, and (2) a potential effect on rejoining of MMS- and MNNG-induced single strand DNA breaks. The results obtained by the comet assay in human cells cultured in vitro showed that CM-CG reduced significantly the level of oxidative DNA lesions induced by H(2)O(2) but did not change the level of alkylating DNA lesions induced by MMS or MNNG. On the other side, the efficiency of DNA-rejoining of single strand DNA breaks induced by MMS and MNNG was significantly higher in HepG2 cells pre-treated with CM-CG. The antioxidative activity of carboxymethyl chitin-glucan was confirmed by the DPPH assay. Copyright © 2010 Elsevier Ltd. All rights reserved.

Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

International Nuclear Information System (INIS)

Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

1990-01-01

The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

Effects of in vitro fermentation of barley β-glucan and sugar beet pectin using human fecal inocula on cytokine expression by dendritic cells

NARCIS (Netherlands)

Rosch, Christiane; Taverne, Nico; Venema, Koen; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.

2017-01-01

Scope: This study simulates the fermentation process of barley β-glucan and sugar beet pectin in the human colon and monitors the degradation products formed. Additionally, immune effects of the degradation products were investigated. Methods and results: Immunostimulatory activity of

Regulation of Akt/Protein Kinase B Signaling by a Novel Protein Phosphatase in Breast Cancer Cells

National Research Council Canada - National Science Library

Brognard, John; Newton, Alexandra

2008-01-01

...: cell proliferation, growth, and apoptosis. Finally, since this phosphatase resides in a location of frequent loss of heterozygosity in breast cancer, we sought to determine if this phosphatase played a role in breast tumorigenesis...

The effect of potassium iodide on the production of acid phosphatase by Sporothrix schenckii

Directory of Open Access Journals (Sweden)

P. S. Grover

2003-06-01

Full Text Available The present study was undertaken to find out the in vitro effect of potassium iodide (KI on the production of acid phosphatase by fully characterized strain of S.schenckii isolated from a patient of Cutaneous Sporotrichosis. The enzyme acid phosphatase was estimated during the 3 phases of growth of S.schenckii, without and with three concentrations of KI incorporated in the culture medium. In the control and in the test proper, with various concentrations of KI, no adverse effect of KI was observed on the production of acid phosphatase in early and mid log phase of fungal growth. Whereas in the exponential phase in test proper, there was a statistical significant decrease in the enzyme production with 0.8% and 3.2% of KI. The low activity at 0.8% and 3.2% KI indicates that KI has inhibitory effect on the growth of S.schenckii and has led to decrease in the activity of the enzyme. (Med J Indones 2003; 12: 65-8 Keywords: S.schenckii, acid phosphatase, potassium iodide

Antifungal Properties of Cationic Phenylene Ethynylenes and Their Impact on β-Glucan Exposure.

Science.gov (United States)

Pappas, Harry C; Sylejmani, Rina; Graus, Matthew S; Donabedian, Patrick L; Whitten, David G; Neumann, Aaron K

2016-08-01

Candida species are the cause of many bloodstream infections through contamination of indwelling medical devices. These infections account for a 40% mortality rate, posing a significant risk to immunocompromised patients. Traditional treatments against Candida infections include amphotericin B and various azole treatments. Unfortunately, these treatments are associated with high toxicity, and resistant strains have become more prevalent. As a new frontier, light-activated phenylene ethynylenes have shown promising biocidal activity against Gram-positive and -negative bacterial pathogens, as well as the environmental yeast Saccharomyces cerevisiae In this study, we monitored the viability of Candida species after treatment with a cationic conjugated polymer [poly(p-phenylene ethynylene); PPE] or oligomer ["end-only" oligo(p-phenylene ethynylene); EO-OPE] by flow cytometry in order to explore the antifungal properties of these compounds. The oligomer was found to disrupt Candida albicans yeast membrane integrity independent of light activation, while PPE is able to do so only in the presence of light, allowing for some control as to the manner in which cytotoxic effects are induced. The contrast in killing efficacy between the two compounds is likely related to their size difference and their intrinsic abilities to penetrate the fungal cell wall. Unlike EO-OPE-DABCO (where DABCO is quaternized diazabicyclo[2,2,2]octane), PPE-DABCO displayed a strong propensity to associate with soluble β-glucan, which is expected to inhibit its ability to access and perturb the inner cell membrane of Candida yeast. Furthermore, treatment with PPE-DABCO unmasked Candida albicans β-glucan and increased phagocytosis by Dectin-1-expressing HEK-293 cells. In summary, cationic phenylene ethynylenes show promising biocidal activity against pathogenic Candida yeast cells while also exhibiting immunostimulatory effects. Copyright © 2016, American Society for Microbiology. All Rights

Acid phosphatases in seeds and developing of squash (Cucurbita ficifolia

Directory of Open Access Journals (Sweden)

Irena Lorenc-Kubis

2014-01-01

Full Text Available Changes in protein content and acid phosphatase activity were followed during germination (imbition through seedlings development in extracts from cotyledons of squash (Cucurbita ficifolia. It has been shown that the activity of acid phosphatase was initially low and than increased to a maximum after 6 days of imbition. Acid phosphates were isolated from cotyledons of seeds and from 6-, 10- and 22-days old seedlings by extraction the proteins with 0.1 M acetate buffer pH 5.1, precipitation with ethanol and by affinity chromatography on con A-Sepharose. Two glycoprotein enzymes AcPase Ba and AcPase Bb which differ in their affinity to immobilized con A were obtained. Both acid phosphatates retained the enzyme activity after binding to free con A. Rocket affinity electrophoresis of AcPase Ba and AcPase Bb, isolated from cotyledons of seeds and seedlings, revealed differences in their ability to bind to con A during seeds germination and seedling develop-ment indicating changes in their sugar component. Con A was found to activate both enzymes. The enzymes cross-reacted with monospecific antibodies raised against grass seed acid phosphatate Ba indicating an antigenic relationship between squash and grass acid phosphatases.

Rheological Properties, Water-Holding and Oil-Binding Capacities of Particulate β-Glucans Isolated from Spent Brewer’s Yeast by Three Different Procedures

Directory of Open Access Journals (Sweden)

Vlatka Petravić-Tominac

2011-01-01

Full Text Available Particulate β-glucans were isolated from brewer’s yeast using three different procedures – alkaline (A, alkaline-acidic (AA and alkaline-acidic with mannoprotein removal (AAM and dried using three different methods – air drying (AD, lyophilization (L and spray drying (SD. In this work, the obtained β-glucan preparations were tested for their microstructure, rheological properties, swelling, water-holding and oil-binding capacities. According to their rheological properties, suspensions containing 1 and 2 % (by mass of spray-dried samples belong to the category of dilatant fluids. Among the spray-dried samples, rheological behaviour and water-holding capacity of the preparation AA-SD differed from those obtained by other two procedures (A-SD and AAM-SD. Concerning different drying methods applied, swelling was the lowest in the lyophilized samples and the most pronounced in the air-dried ones. Oil-binding capacity was the highest in the lyophilized preparations and increased proportionally to the number of processing steps applied in the isolation procedure.

21 CFR 864.7660 - Leukocyte alkaline phosphatase test.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Leukocyte alkaline phosphatase test. 864.7660 Section 864.7660 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Hematology Kits and Packages § 864.7660...

Potent inhibitory effects of D-tagatose on the acid production and water-insoluble glucan synthesis of Streptococcus mutans GS5 in the presence of sucrose.

Science.gov (United States)

Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki

2015-01-01

We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.

Phosphatase activity in sandy soil influenced by mycorrhizal and non-mycorrhizal cover crops

Directory of Open Access Journals (Sweden)

Alceu Kunze

2011-06-01

Full Text Available Cover crops may difffer in the way they affect rhizosphere microbiota nutrient dynamics. The purpose of this study was to evaluate the effect of mycorrhizal and non-mycorrhizal cover crops on soil phosphatase activity and its persistence in subsequent crops. A three-year experiment was carried out with a Typic Quartzipsamment. Treatments were winter species, either mycorrhizal black oat (Avena strigosa Schreb or the non-mycorrhizal species oilseed radish (Raphanus sativus L. var. oleiferus Metzg and corn spurry (Spergula arvensis L.. The control treatment consisted of resident vegetation (fallow in the winter season. In the summer, a mixture of pearl millet (Pennisetum americanum L. with sunnhemp (Crotalaria juncea L. or with soybean (Glycine max L. was sown in all plots. Soil cores (0-10 cm and root samples were collected in six growing seasons (winter and summer of each year. Microbial biomass P was determined by the fumigation-extraction method and phosphatase activity using p-nitrophenyl-phosphate as enzyme substrate. During the flowering stage of the winter cover crops, acid phosphatase activity was 30-35 % higher in soils with the non-mycorrhizal species oilseed radish, than in the control plots, regardless of the amount of P immobilized in microbial biomass. The values of enzyme activity were intermediate in the plots with corn spurry and black oat. Alkaline phosphatase activity was 10-fold lower and less sensitive to the treatments, despite the significant relationship between the two phosphatase activities. The effect of plant species on the soil enzyme profile continued in the subsequent periods, during the growth of mycorrhizal summer crops, after completion of the life cycle of the cover crops.

Phosphorylation of Mycobacterium tuberculosis Ser/Thr phosphatase by PknA and PknB.

Directory of Open Access Journals (Sweden)

Andaleeb Sajid

2011-03-01

Full Text Available The integrated functions of 11 Ser/Thr protein kinases (STPKs and one phosphatase manipulate the phosphorylation levels of critical proteins in Mycobacterium tuberculosis. In this study, we show that the lone Ser/Thr phosphatase (PstP is regulated through phosphorylation by STPKs.PstP is phosphorylated by PknA and PknB and phosphorylation is influenced by the presence of Zn(2+-ions and inorganic phosphate (Pi. PstP is differentially phosphorylated on the cytosolic domain with Thr(137, Thr(141, Thr(174 and Thr(290 being the target residues of PknB while Thr(137 and Thr(174 are phosphorylated by PknA. The Mn(2+-ion binding residues Asp(38 and Asp(229 are critical for the optimal activity of PstP and substitution of these residues affects its phosphorylation status. Native PstP and its phosphatase deficient mutant PstP(c (D38G are phosphorylated by PknA and PknB in E. coli and addition of Zn(2+/Pi in the culture conditions affect the phosphorylation level of PstP. Interestingly, the phosphorylated phosphatase is more active than its unphosphorylated equivalent.This study establishes the novel mechanisms for regulation of mycobacterial Ser/Thr phosphatase. The results indicate that STPKs and PstP may regulate the signaling through mutually dependent mechanisms. Consequently, PstP phosphorylation may play a critical role in regulating its own activity. Since, the equilibrium between phosphorylated and non-phosphorylated states of mycobacterial proteins is still unexplained, understanding the regulation of PstP may help in deciphering the signal transduction pathways mediated by STPKs and the reversibility of the phenomena.

Characterization of protein phosphatase 5 from three lepidopteran insects: Helicoverpa armigera, Mythimna separata and Plutella xylostella.

Directory of Open Access Journals (Sweden)

Xi'en Chen

Full Text Available Protein phosphatase 5 (PP5, a unique member of serine/threonine phosphatases, regulates a variety of biological processes. We obtained full-length PP5 cDNAs from three lepidopteran insects, Helicoverpa armigera, Mythimna separata and Plutella xylostella, encoding predicted proteins of 490 (55.98 kDa, 490 (55.82 kDa and 491 (56.07 kDa amino acids, respectively. These sequences shared a high identity with other insect PP5s and contained the TPR (tetratricopeptide repeat domains at N-terminal regions and highly conserved C-terminal catalytic domains. Tissue- and stage-specific expression pattern analyses revealed these three PP5 genes were constitutively expressed in all stages and in tested tissues with predominant transcription occurring at the egg and adult stages. Activities of Escherichia coli-produced recombinant PP5 proteins could be enhanced by almost 2-fold by a known PP5 activator: arachidonic acid. Kinetic parameters of three recombinant proteins against substrate pNPP were similar both in the absence or presence of arachidonic acid. Protein phosphatases inhibitors, okadaic acid, cantharidin, and endothall strongly impeded the activities of the three recombinant PP5 proteins, as well as exerted an inhibitory effect on crude protein phosphatases extractions from these three insects. In summary, lepidopteran PP5s share similar characteristics and are all sensitive to the protein phosphatases inhibitors. Our results also imply protein phosphatase inhibitors might be used in the management of lepidopteran pests.

Relationship of serum and saliva calcium, phosphorus and alkaline phosphatase with dry mouth feeling in menopause.

Science.gov (United States)

Agha-Hosseini, Farzaneh; Mirzaii-Dizgah, Iraj; Moosavi, Mahdieh-Sadat

2012-06-01

The aim of this study was to compare serum and saliva calcium, phosphorus and alkaline phosphatase of menopausal women with/without dry mouth (DM) feeling. The composition of saliva in menopause women with/without DM feeling is different. Some of these differences are in hormones that are related to bone turnover. A case-control study was carried out on 60 selected menopausal women aged 45-79 years with or without DM feeling (30 as case, 30 as control), conducted at the Clinic of Oral Medicine, Tehran University of Medical Sciences. The phosphorus concentration was measured by photometrical measurement of the blue colour formed after the addition of ammonium molybdate and stannous chloride; calcium was measured by Arsenazo reaction; and alkaline phosphatase by the pNPP-AMP method. Statistical analysis of Student's t-test was used. The mean serum phosphorus and alkaline phosphatase, stimulated and unstimulated saliva calcium and alkaline phosphatase levels were significantly higher in the menopausal women suffering from DM. There were no significant differences between groups regarding saliva phosphorus and serum calcium concentration. Calcium, phosphorus and alkaline phosphatase appear associated with DM feeling in menopause. © 2012 The Gerodontology Society and John Wiley & Sons A/S.

Trehalose 6-phosphate phosphatases of Pseudomonas aeruginosa.

Science.gov (United States)

Cross, Megan; Biberacher, Sonja; Park, Suk-Youl; Rajan, Siji; Korhonen, Pasi; Gasser, Robin B; Kim, Jeong-Sun; Coster, Mark J; Hofmann, Andreas

2018-04-24

The opportunistic bacterium Pseudomonas aeruginosa has been recognized as an important pathogen of clinical relevance and is a leading cause of hospital-acquired infections. The presence of a glycolytic enzyme in Pseudomonas, which is known to be inhibited by trehalose 6-phosphate (T6P) in other organisms, suggests that these bacteria may be vulnerable to the detrimental effects of intracellular T6P accumulation. In the present study, we explored the structural and functional properties of trehalose 6-phosphate phosphatase (TPP) in P. aeruginosa in support of future target-based drug discovery. A survey of genomes revealed the existence of 2 TPP genes with either chromosomal or extrachromosomal location. Both TPPs were produced as recombinant proteins, and characterization of their enzymatic properties confirmed specific, magnesium-dependent catalytic hydrolysis of T6P. The 3-dimensional crystal structure of the chromosomal TPP revealed a protein dimer arising through β-sheet expansion of the individual monomers, which possess the overall fold of halo-acid dehydrogenases.-Cross, M., Biberacher, S., Park, S.-Y., Rajan, S., Korhonen, P., Gasser, R. B., Kim, J.-S., Coster, M. J., Hofmann, A. Trehalose 6-phosphate phosphatases of Pseudomonas aeruginosa.

In vitro studies on the translocation of acid phosphatase into the endoplasmic reticulum of the yeast Saccharomyces cerevisiae.

Science.gov (United States)

Krebs, H O; Hoffschulte, H K; Müller, M

1989-05-01

We demonstrate here the in vitro translocation of yeast acid phosphatase into rough endoplasmic reticulum. The precursor of the repressible acid phosphatase from Saccharomyces cerevisiae encoded by the PHO5 gene, was synthesized in a yeast lysate programmed with in vitro transcribed PHO5 mRNA. In the presence of yeast rough microsomes up to 16% of the acid phosphatase synthesized was found to be translocated into the microsomes, as judged by proteinase resistance, and fully core-glycosylated. The translocation efficiency however, decreased to 3% if yeast rough microsomes were added after synthesis of acid phosphatase had been terminated. When a wheat-germ extract was used for in vitro synthesis, the precursor of acid phosphatase was translocated into canine pancreatic rough microsomes and thereby core-glycosylated in a signal-recognition-particle-dependent manner. Replacing canine with yeast rough microsomes in the wheat-germ translation system, however, resulted in a significant decrease in the ability to translocate and glycosylate the precursor. Translocation and glycosylation were partially restored by a high-salt extract prepared from yeast ribosomes. The results presented here suggest that yeast-specific factors are needed to translocate and glycosylate acid phosphatase efficiently in vitro.

Protein phosphatase 5 promotes hepatocarcinogenesis through interaction with AMP-activated protein kinase.

Science.gov (United States)

Chen, Yao-Li; Hung, Man-Hsin; Chu, Pei-Yi; Chao, Tzu-I; Tsai, Ming-Hsien; Chen, Li-Ju; Hsiao, Yung-Jen; Shih, Chih-Ting; Hsieh, Feng-Shu; Chen, Kuen-Feng

2017-08-15

The serine-threonine protein phosphatase family members are known as critical regulators of various cellular functions, such as survival and transformation. Growing evidence suggests that pharmacological manipulation of phosphatase activity exhibits therapeutic benefits. Ser/Thr protein phosphatase 5 (PP5) is known to participate in glucocorticoid receptor (GR) and stress-induced signaling cascades that regulate cell growth and apoptosis, and has been shown to be overexpressed in various human malignant diseases. However, the role of PP5 in hepatocellular carcinoma (HCC) and whether PP5 may be a viable therapeutic target for HCC treatment are unknown. Here, by analyzing HCC clinical samples obtained from 215 patients, we found that overexpression of PP5 is tumor specific and associated with worse clinical outcomes. We further characterized the oncogenic properties of PP5 in HCC cells. Importantly, both silencing of PP5 with lentiviral-mediated short hairpin RNA (shRNA) and chemical inhibition of PP5 phosphatase activity using the natural compound cantharidin/norcantharidin markedly suppressed the growth of HCC cells and tumors in vitro and in vivo. Moreover, we identified AMP-activated protein kinase (AMPK) as a novel downstream target of oncogenic PP5 and demonstrated that the antitumor mechanisms underlying PP5 inhibition involve activation of AMPK signaling. Overall, our results establish a pathological function of PP5 in hepatocarcinogenesis via affecting AMPK signaling and suggest that PP5 inhibition is an attractive therapeutic approach for HCC. Copyright © 2017 Elsevier Inc. All rights reserved.

Gamma-glutamyltransferase, aspartate aminotransferase and alkaline phosphatase as markers of alcohol consumption in out-patient alcoholics

DEFF Research Database (Denmark)

Gluud, C; Andersen, I; Dietrichson, O

1981-01-01

and alkaline phosphatase in 18% and 7%. Neither the activity of gamma-glutamyltransferase, aspartate aminotransferase nor alkaline phosphatase showed any significant (P greater than 0.05) correlation with the history of alcohol consumption. The activities of gamma-glutamyltransferase and aspartate...

Sensitive detection of alkaline phosphatase by switching on gold nanoclusters fluorescence quenched by pyridoxal phosphate.

Science.gov (United States)

Halawa, Mohamed Ibrahim; Gao, Wenyue; Saqib, Muhammad; Kitte, Shimeles Addisu; Wu, Fengxia; Xu, Guobao

2017-09-15

In this work, we designed highly sensitive and selective luminescent detection method for alkaline phosphatase using bovine serum albumin functionalized gold nanoclusters (BSA-AuNCs) as the nanosensor probe and pyridoxal phosphate as the substrate of alkaline phosphatase. We found that pyridoxal phosphate can quench the fluorescence of BSA-AuNCs and pyridoxal has little effect on the fluorescence of BSA-AuNCs. The proposed mechanism of fluorescence quenching by PLP was explored on the basis of data obtained from high-resolution transmission electron microscopy (HRTEM), dynamic light scattering (DLS), UV-vis spectrophotometry, fluorescence spectroscopy, fluorescence decay time measurements and circular dichroism (CD) spectroscopy. Alkaline phosphatase catalyzes the hydrolysis of pyridoxal phosphate to generate pyridoxal, restoring the fluorescence of BSA-AuNCs. Therefore, a recovery type approach has been developed for the sensitive detection of alkaline phosphatase in the range of 1.0-200.0U/L (R 2 =0.995) with a detection limit of 0.05U/L. The proposed sensor exhibit excellent selectivity among various enzymes, such as glucose oxidase, lysozyme, trypsin, papain, and pepsin. The present switch-on fluorescence sensing strategy for alkaline phosphatase was successfully applied in human serum plasma with good recoveries (100.60-104.46%), revealing that this nanosensor probe is a promising tool for ALP detection. Copyright © 2017 Elsevier B.V. All rights reserved.

YbiV from E. coli K12 is a HAD phosphatase

Energy Technology Data Exchange (ETDEWEB)

Roberts, Anne; Lee, Seok-Yong; McCullagh, Emma; Silversmith, Ruth E.; Wemmer, David E.

2004-03-16

The protein YbiV from Escherichia coli K12 MG1655 is a hypothetical protein with sequence homology to the haloacid dehalogenase (HAD) superfamily of proteins. Although numerous members of this family have been identified, the functions of few are known. Using the crystal structure, sequence analysis, and biochemical assays, we have characterized ybiV as a HAD phosphatase. The crystal structure of YbiV reveals a two domain protein, one with the characteristic HAD hydrolase fold, the other an inserted a/b fold. In an effort to understand the mechanism we also solved and report the structures of YbiV in complex with beryllofluoride (BeF3-) and aluminum trifluoride (AlF3) which have been shown to mimic the phosphorylated intermediate and transition state for hydrolysis, respectively, in analogy to other HAD phosphatases. Analysis of the structures reveals the substrate binding cavity, which is hydrophilic in nature. Both structure and sequence homology indicate ybiV may be a sugar phosphatase, which is supported by biochemical assays which measured the release of free phosphate on a number of sugar-like substrates. We also investigated available genomic and functional data in an effort to determine the physiological substrate.

The Association of Endothelin-1 Signaling with Bone Alkaline Phosphatase Expression and Protumorigenic Activities in Canine Osteosarcoma.

Science.gov (United States)

Neumann, Z L; Pondenis, H C; Masyr, A; Byrum, M L; Wycislo, K L; Fan, T M

2015-01-01

Canine osteosarcoma (OS) is an aggressive sarcoma characterized by pathologic skeletal resorption and pulmonary metastases. A number of negative prognostic factors, including bone alkaline phosphatase, have been identified in dogs with OS, but the underlying biologic factors responsible for such observations have not been thoroughly investigated. Endothelin-1-mediated signaling is active during bone repair, and is responsible for osteoblast migration, survival, proliferation, and bone alkaline phosphatase expression. The endothelin-1 signaling axis is active in canine OS cells, and this pathway is utilized by malignant osteoblasts for promoting cellular migration, survival, proliferation, and bone alkaline phosphatase activities. 45 dogs with appendicular OS. The expressions of endothelin-1 and endothelin A receptor were studied in OS cell lines and in samples from spontaneously occurring tumors. Activities mediated by endothelin-1 signaling were investigated by characterizing responses in 3 OS cell lines. In 45 dogs with OS, bone alkaline phosphatase concentrations were correlated with primary tumor osteoproductivity. Canine OS cells express endothelin-1 and endothelin A receptor, and this signaling axis mediates OS migration, survival, proliferation, and bone alkaline phosphatase activities. In OS-bearing dogs, circulating bone alkaline phosphatase activities were positively correlated with primary tumor relative bone mineral densities. Canine OS cells express endothelin-1 and functional endothelin A receptors, with the potential for a protumorigenic signaling loop. Increases in bone alkaline phosphatase activity are associated with osteoblastic OS lesions, and might be an epiphenomenon of active endothelin-1 signaling or excessive osteoproduction within the localized bone microenvironment. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

International Nuclear Information System (INIS)

Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

1988-01-01

Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

Promoting Uranium Immobilization by the Activities of Microbial Phosphatases

Energy Technology Data Exchange (ETDEWEB)

Martinez, Robert J.; Beazley, Melanie J.; Wilson, Jarad J.; Taillefert, Martial; Sobecky, Patricia A.

2005-04-05

The overall goal of this project is to examine the role of nonspecific phosphohydrolases present in naturally occurring subsurface microorganisms for the purpose of promoting the immobilization of radionuclides through the production of uranium [U(VI)] phosphate precipitates. Specifically, we hypothesize that the precipitation of U(VI) phosphate minerals may be promoted through the microbial release and/or accumulation of PO{sub 4}{sup 3-}. During this phase of the project we have been conducting assays to determine the effects of pH, inorganic anions and organic ligands on U(VI) mineral formation and precipitation when FRC bacterial isolates were grown in simulated groundwater medium. The molecular characterization of FRC isolates has also been undertaken during this phase of the project. Analysis of a subset of gram-positive FRC isolates cultured from FRC soils (Areas 1, 2 and 3) and background sediments have indicated a higher percentage of isolates exhibiting phosphatase phenotypes (i.e., in particular those surmised to be PO{sub 4}{sup 3-}-irrepressible) relative to isolates from the reference site. A high percentage of strains that exhibited such putatively PO{sub 4}{sup 3-}-irrepressible phosphatase phenotypes were also resistant to the heavy metals lead and cadmium. Previous work on FRC strains, including Arthrobacter, Bacillus and Rahnella spp., has demonstrated differences in tolerance to U(VI) toxicity (200 {micro}M) in the absence of organophosphate substrates. For example, Arthrobacter spp. exhibited the greatest tolerance to U(VI) while the Rahnella spp. have been shown to facilitate the precipitation of U(VI) from solution and the Bacillus spp. demonstrate the greatest sensitivity to acidic conditions and high concentrations of U(VI). PCR-based detection of FRC strains are being conducted to determine if non-specific acid phosphatases of the known molecular classes [i.e., classes A, B and C] are present in these FRC isolates. Additionally, these

Purification and characterization of an alkaline phosphatase induced by phosphorus starvation in common bean (Phaseolus vulgaris L.) roots

International Nuclear Information System (INIS)

Morales, L.; Gutierrez, N.; Maya, V.; Parra, C.; Martinez B, E.; Coello, P.

2012-01-01

Two phosphatase isoforms from roots of the common bean (Phaseolus vulgaris L.) showed an increase in activity in response to phosphate deficiency. One of them (APIII) was chosen for further purification through ionic exchange chromatography and preparative electrophoresis. The estimated molecular mass of APIII was 35 kDa by both SDS-Page and gel filtration analyses, suggesting a monomeric form of the active enzyme. The phosphatase was classified as an alkaline phosphatase based on the requirement of ph 8 for optimum catalysis. It not only exhibited broad substrate specificity, with the most activity against pyrophosphate, but also effectively catalyzed the hydrolysis of polyphosphate, glucose-1-phosphate and phospho enol-pyruvate. Activity was completely inhibited by molybdate, vanadate and phosphate but was only partially inhibited by fluoride. Although divalent cations were not essential for the pyro phosphatase activity of this enzyme, the hydrolysis of pyro phosphatase increased substantially in the presence of Mg 2+ .

Purification and characterization of an alkaline phosphatase induced by phosphorus starvation in common bean (Phaseolus vulgaris L.) roots

Energy Technology Data Exchange (ETDEWEB)

Morales, L.; Gutierrez, N.; Maya, V.; Parra, C.; Martinez B, E.; Coello, P., E-mail: pcoello@servidor.unam.mx [UNAM, Facultad de Quimica, Departamento de Bioquimica, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)

2012-07-01

Two phosphatase isoforms from roots of the common bean (Phaseolus vulgaris L.) showed an increase in activity in response to phosphate deficiency. One of them (APIII) was chosen for further purification through ionic exchange chromatography and preparative electrophoresis. The estimated molecular mass of APIII was 35 kDa by both SDS-Page and gel filtration analyses, suggesting a monomeric form of the active enzyme. The phosphatase was classified as an alkaline phosphatase based on the requirement of ph 8 for optimum catalysis. It not only exhibited broad substrate specificity, with the most activity against pyrophosphate, but also effectively catalyzed the hydrolysis of polyphosphate, glucose-1-phosphate and phospho enol-pyruvate. Activity was completely inhibited by molybdate, vanadate and phosphate but was only partially inhibited by fluoride. Although divalent cations were not essential for the pyro phosphatase activity of this enzyme, the hydrolysis of pyro phosphatase increased substantially in the presence of Mg{sup 2+}.

Ivermectin resistant and susceptible third-stage larvae of Haemonchus contortus: cholinesterase and phosphatase activities

Directory of Open Access Journals (Sweden)

Consuelo Giménez-Pardo

2004-03-01

Full Text Available Cholinesterase and acid phosphatase (AP, but not alkaline phosphatase activities, were detected in cytosolic and membrane-bound fractions of ivermectin resistant and susceptible Haemonchus contortus infective-stage larvae. Some differences in acetylcholinesterase activity of cytosolic fractions and in the AP activity of these fractions as well as in the response to AP inhibitors by membrane-bound fractions were detected. Data are discussed.

Evaluation of the ability of barley genotypes containing different amounts of ß-glucan to alter growth and disease resistance of rainbow trout Oncorhynchus mykiss.

Science.gov (United States)

A feeding trial was performed to screen three barley genotypes containing different levels of '-glucan for their ability to influence growth, immune function, and disease resistance of rainbow trout. Three experimental diets were prepared by substituting each of three barely genotypes containing dif...

Phosphatase activity tunes two-component system sensor detection threshold.

Science.gov (United States)

Landry, Brian P; Palanki, Rohan; Dyulgyarov, Nikola; Hartsough, Lucas A; Tabor, Jeffrey J

2018-04-12

Two-component systems (TCSs) are the largest family of multi-step signal transduction pathways in biology, and a major source of sensors for biotechnology. However, the input concentrations to which biosensors respond are often mismatched with application requirements. Here, we utilize a mathematical model to show that TCS detection thresholds increase with the phosphatase activity of the sensor histidine kinase. We experimentally validate this result in engineered Bacillus subtilis nitrate and E. coli aspartate TCS sensors by tuning their detection threshold up to two orders of magnitude. We go on to apply our TCS tuning method to recently described tetrathionate and thiosulfate sensors by mutating a widely conserved residue previously shown to impact phosphatase activity. Finally, we apply TCS tuning to engineer B. subtilis to sense and report a wide range of fertilizer concentrations in soil. This work will enable the engineering of tailor-made biosensors for diverse synthetic biology applications.

Crystal structure and putative substrate identification for the Entamoeba histolytica low molecular weight tyrosine phosphatase.

Science.gov (United States)

Linford, Alicia S; Jiang, Nona M; Edwards, Thomas E; Sherman, Nicholas E; Van Voorhis, Wesley C; Stewart, Lance J; Myler, Peter J; Staker, Bart L; Petri, William A

2014-01-01

Entamoeba histolytica is a eukaryotic intestinal parasite of humans, and is endemic in developing countries. We have characterized the E. histolytica putative low molecular weight protein tyrosine phosphatase (LMW-PTP). The structure for this amebic tyrosine phosphatase was solved, showing the ligand-induced conformational changes necessary for binding of substrate. In amebae, it was expressed at low but detectable levels as detected by immunoprecipitation followed by immunoblotting. A mutant LMW-PTP protein in which the catalytic cysteine in the active site was replaced with a serine lacked phosphatase activity, and was used to identify a number of trapped putative substrate proteins via mass spectrometry analysis. Seven of these putative substrate protein genes were cloned with an epitope tag and overexpressed in amebae. Five of these seven putative substrate proteins were demonstrated to interact specifically with the mutant LMW-PTP. This is the first biochemical study of a small tyrosine phosphatase in Entamoeba, and sets the stage for understanding its role in amebic biology and pathogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

Advances in lanthanide-based luminescent peptide probes for monitoring the activity of kinase and phosphatase.

Science.gov (United States)

Pazos, Elena; Vázquez, M Eugenio

2014-02-01

Signaling pathways based on protein phosphorylation and dephosphorylation play critical roles in the orchestration of complex biochemical events and form the core of most signaling pathways in cells (i.e. cell cycle regulation, cell motility, apoptosis, etc.). The understanding of these complex signaling networks is based largely on the biochemical study of their components, i.e. kinases and phosphatases. The development of luminescent sensors for monitoring kinase and phosphatase activity is therefore an active field of research. Examples in the literature usually rely on the modulation of the fluorescence emission of organic fluorophores. However, given the exceptional photophysical properties of lanthanide ions, there is an increased interest in their application as emissive species for monitoring kinase and phosphatase activity. This review summarizes the advances in the development of lanthanide-based luminescent peptide sensors as tools for the study of kinases and phosphatases and provides a critical description of current examples and synthetic approaches to understand these lanthanide-based luminescent peptide sensors. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Integrative proteomics and biochemical analyses define Ptc6p as the Saccharomyces cerevisiae pyruvate dehydrogenase phosphatase.

Science.gov (United States)

Guo, Xiao; Niemi, Natalie M; Coon, Joshua J; Pagliarini, David J

2017-07-14

The pyruvate dehydrogenase complex (PDC) is the primary metabolic checkpoint connecting glycolysis and mitochondrial oxidative phosphorylation and is important for maintaining cellular and organismal glucose homeostasis. Phosphorylation of the PDC E1 subunit was identified as a key inhibitory modification in bovine tissue ∼50 years ago, and this regulatory process is now known to be conserved throughout evolution. Although Saccharomyces cerevisiae is a pervasive model organism for investigating cellular metabolism and its regulation by signaling processes, the phosphatase(s) responsible for activating the PDC in S. cerevisiae has not been conclusively defined. Here, using comparative mitochondrial phosphoproteomics, analyses of protein-protein interactions by affinity enrichment-mass spectrometry, and in vitro biochemistry, we define Ptc6p as the primary PDC phosphatase in S. cerevisiae Our analyses further suggest additional substrates for related S. cerevisiae phosphatases and describe the overall phosphoproteomic changes that accompany mitochondrial respiratory dysfunction. In summary, our quantitative proteomics and biochemical analyses have identified Ptc6p as the primary-and likely sole- S. cerevisiae PDC phosphatase, closing a key knowledge gap about the regulation of yeast mitochondrial metabolism. Our findings highlight the power of integrative omics and biochemical analyses for annotating the functions of poorly characterized signaling proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Phosphatase Activity of Microbial Populations in Different Milk Samples in Relation to Protein and Carbohydrate Content

Directory of Open Access Journals (Sweden)

Sosanka Protim SANDILYA

2014-12-01

Full Text Available Cattle milk is a rich source of protein, carbohydrate, vitamins, minerals and all other major and micro nutrients. At a moderate pH, milk is an excellent media for the growth of microbes and thus, intake of raw milk is precarious. In this study, attempt was made for a qualitative study of eight raw milk samples of different varieties of cow and goat milk, collected from Jorhat district of Assam, India, on the basis of nutritional value and microbial population. The highest microbial population was found in the milk collected from cross hybrid variety of cow, whereas microbial contamination was the least in Jersey cow milk. Samples of C1 (Jersey cow variety showed presence of the highest amount of protein and carbohydrate content as compared to the others. Almost all the milk samples showed positive acid and alkaline phosphatase activity. Maximum acid phosphatase activity was observed in cross hybrid cow milk, whereas local cow milk exhibited the highest alkaline phosphatase activity. Phosphatase activity did not show any co-relationship with microbial population of the milk samples. Similarly, the protein and carbohydrate content of the samples did not have any significant impact on both acid and alkaline phosphatase activity.

Protein kinase and phosphatase activities of thylakoid membranes

International Nuclear Information System (INIS)

Michel, H.; Shaw, E.K.; Bennett, J.

1987-01-01

Dephosphorylation of the 25 and 27 kDa light-harvesting Chl a/b proteins (LHCII) of the thylakoid membranes is catalyzed by a phosphatase which differs from previously reported thylakoid-bound phosphatases in having an alkaline pH optimum (9.0) and a requirement for Mg 2+ ions. Dephosphorylation of the 8.3 kDa psb H gene product requires a Mg 2+ ion concentration more than 200 fold higher than that for dephosphorylation of LHC II. The 8.3 kDa and 27 kDa proteins appear to be phosphorylated by two distinct kinases, which differ in substrate specificity and sensitivity to inhibitors. The plastoquinone antagonist 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB) inhibits phosphorylation of the 27 kDa LHC II much more readily than phosphorylation of the 8.3 kDa protein. A similar pattern of inhibition is seen for two synthetic oligopeptides (MRKSATTKKAVC and ATQTLESSSRC) which are analogs of the phosphorylation sites of the two proteins. Possible modes of action of DBMIB are discussed. 45 refs., 7 figs., 3 tabs

Intercropping Acacia mangium stimulates AMF colonization and soil phosphatase activity in Eucalyptus grandis

Directory of Open Access Journals (Sweden)

Daniel Bini

Full Text Available ABSTRACT: Arbuscular mycorrhizal fungi (AMF are very important to plant nutrition, mostly in terms of acquisition of P and micronutrients. While Acacia mangium is closely associated with AMF throughout the whole cycle, Eucalyptus grandis presents this symbiosis primarily at the seedling stage. The aim of this study was to evaluate the dynamics of AMF in these two tree species in both pure and mixed plantations during the first 20 months after planting. We evaluated the abundance, richness and diversity of AMF spores, the rate of AMF mycorrhizal root colonization, enzymatic activity and soil and litter C, N and P. There was an increase in AMF root colonization of E. grandis when intercropped with A. mangium as well as an increase in the activity of acid and alkaline phosphatase in the presence of leguminous trees. AMF colonization and phosphatase activities were both involved in improvements in P cycling and P nutrition in soil. In addition, P cycling was favored in the intercropped plantation, which showed negative correlation with litter C/N and C/P ratios and positive correlation with soil acid phosphatase activity and soil N and P concentrations. Intercropping A. mangium and E. grandis maximized AMF root colonization of E. grandis and phosphatase activity in the soil, both of which accelerate P cycling and forest performance.

Phosphatase-regulated recruitment of the spindle- and kinetochore-associated (Ska complex to kinetochores

Directory of Open Access Journals (Sweden)

Sushama Sivakumar

2017-11-01

Full Text Available Kinetochores move chromosomes on dynamic spindle microtubules and regulate signaling of the spindle checkpoint. The spindle- and kinetochore-associated (Ska complex, a hexamer composed of two copies of Ska1, Ska2 and Ska3, has been implicated in both roles. Phosphorylation of kinetochore components by the well-studied mitotic kinases Cdk1, Aurora B, Plk1, Mps1, and Bub1 regulate chromosome movement and checkpoint signaling. Roles for the opposing phosphatases are more poorly defined. Recently, we showed that the C terminus of Ska1 recruits protein phosphatase 1 (PP1 to kinetochores. Here we show that PP1 and protein phosphatase 2A (PP2A both promote accumulation of Ska at kinetochores. Depletion of PP1 or PP2A by siRNA reduces Ska binding at kinetochores, impairs alignment of chromosomes to the spindle midplane, and causes metaphase delay or arrest, phenotypes that are also seen after depletion of Ska. Artificial tethering of PP1 to the outer kinetochore protein Nuf2 promotes Ska recruitment to kinetochores, and it reduces but does not fully rescue chromosome alignment and metaphase arrest defects seen after Ska depletion. We propose that Ska has multiple functions in promoting mitotic progression and that kinetochore-associated phosphatases function in a positive feedback cycle to reinforce Ska complex accumulation at kinetochores.

Purification of acidic phosphatase from mustard seedlings

OpenAIRE

sprotocols

2014-01-01

### INTRODUCTION Phosphate esters are widely distributed in any organism. Nucleic acids, metabolic intermediates like glucose-6-phosphate, energy-rich substrates (AMP, creatine phosphate) are some obvious examples. While many metabolic intermediates are activated through the transfer of phosphate groups (e.g., by kinases) it is equally important that phosphate esters can also be rapidly broken down. The hydrolytic removal of phosphate groups from phosphoesters is catalyzed by phosphatases...

Subcellular localization of alkaline phosphatase in Bacillus licheniformis 749/C by immunoelectron microscopy with colloidal gold

International Nuclear Information System (INIS)

Tinglu, G.; Ghosh, A.; Ghosh, B.K.

1984-01-01

Subcellular distribution of the alkaline phosphatase of Bacillus licheniformis 749/C was determined by an immunoelectron microscopy method. Anti-alkaline phosphatase antibody labeled with 15- to 18-nm colloidal gold particles (gold-immunoglobulin G [IgG] complex) were used for the study. Both the plasma membrane and cytoplasmic material were labeled with the gold-IgG particles. These particles formed clusters in association with the plasma membrane; in contrast, in the cytoplasm the particles were largely dispersed, and only a few clusters were found. The gold-IgG binding was quantitatively estimated by stereological analysis of labeled, frozen thin sections. This estimation of a variety of control samples showed that the labeling was specific for the alkaline phosphatase. Cluster formation of the gold -IgG particles in association with the plasma membrane suggests that existence of specific alkaline phosphatase binding sites (receptors) in the plasma membrane of B. licheniformis 749/C. 27 references, 6 figures, 1 table

Phosphorylation-mediated regulation of the Staphylococcus aureus secreted tyrosine phosphatase PtpA.

Science.gov (United States)

Brelle, Solène; Baronian, Grégory; Huc-Brandt, Sylvaine; Zaki, Laila Gannoun; Cohen-Gonsaud, Martin; Bischoff, Markus; Molle, Virginie

2016-01-15

Due to the emergence of methicillin-resistant strains, Staphylococcus aureus has become as major public-health threat. Studies aimed at deciphering the molecular mechanism of virulence are thus required to identify new targets and develop efficient therapeutic agents. Protein phosphorylations are known to play key regulatory functions and their roles in pathogenesis are under intense scrutiny. Here we analyzed the protein tyrosine phosphatase PtpA of S. aureus, a member of the family of low molecular weight protein tyrosine phosphatases that are often secreted by pathogenic bacteria. We report for the first time that PtpA is phosphorylated in vitro by the S. aureus tyrosine kinase CapA1B2. A mass spectrometry approach allowed determining that Tyr122 and Tyr123 were the only two residues phosphorylated by this kinase. This result was confirmed by analysis of a double PtpA_Y122A/Y123A mutant that showed no phosphorylation by CapA1B2. Interestingly, PtpA phosphatase activity was abrogated in this mutant, suggesting a key regulatory function for these two tyrosine residues. This was further reinforced by the observation that CapA1B2-mediated phosphorylation significantly increased PtpA phosphatase activity. Moreover, we provide evidence that PtpA is secreted during growth of S. aureus. Together our results suggest that PtpA is an exported S. aureus signaling molecule controlled by tyrosine phosphorylation which may interfere with host cell signaling. Copyright © 2015 Elsevier Inc. All rights reserved.

Comparative Analysis of ?-Oryzanol, ?-Glucan, Total Phenolic Content and Antioxidant Activity in Fermented Rice Bran of Different Varieties

OpenAIRE

Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn

2017-01-01

Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans....

Endocytosis of lysosomal acid phosphatase; involvement of mannose receptor and effect of lectins.

Science.gov (United States)

Imai, K; Yoshimura, T

1994-08-01

Acid phosphatase and beta-glucosidase are unique among lysosomal enzymes in that they have both high mannose and complex type sugasr chains, whereas oligosaccharide chains of lysosomal enzymes in matrix are of high mannose type. We have previously shown that beta-glucosidase was endocytosed into macrophages via an unidentified receptor different from a mannose/fucose receptor (K. Imai, Cell Struct. Funct. 13, 325-332, 1988). Here, we show that uptake of acid phosphatase purified from rat liver lysosomes into rat macrophages was inhibited by ligands for a mannose/fucose receptor and was mediated via an apparently single binding site with Kuptake of 24.7 nM. These results indicate that acid phosphatase and beta-glucosidase recognize different types of receptors even if they have similar sugar chains. Polyvalent concanavalin A which binds both to the enzyme and to macrophages specifically stimulated the uptake in a dose dependent manner, whereas wheat germ agglutinin and phytohaemagglutinin did not.

Osteomalacia with low alkaline phosphatase: a not so rare condition with important consequences.

Science.gov (United States)

Belkhouribchia, Jamal; Bravenboer, Bert; Meuwissen, Marije; Velkeniers, Brigitte

2016-01-28

Hypophosphatasia is a genetic disorder, characterised by a dysfunctional tissue-non-specific isoenzyme of alkaline phosphatase that impacts bone metabolism and predisposes to osteomalacia or rickets. The clinical presentation is very diverse, depending on the age of onset and the severity of the disease. Several forms of hypophosphatasia are recognised. We present a case of a 50-year-old woman with low impact fractures and loss of teeth at a young age. She also had a low alkaline phosphatase and was diagnosed with adult hypophosphatasia. Although the severe forms of hypophosphatasia are rather rare, the adult form is thought to occur quite frequently. As this condition is not well known by healthcare professionals, the time to diagnosis and initiation of adequate treatment is often postponed. When encountering a patient with low alkaline phosphatase, low bone density or a history of bone fractures, the possibility of hypophosphatasia should be considered. 2016 BMJ Publishing Group Ltd.

[Effect of elevated atmospheric CO2 on soil urease and phosphatase activities].

Science.gov (United States)

Chen, Lijun; Wu, Zhijie; Huang, Guohong; Zhou, Likai

2002-10-01

The response of soil urease and phosphatase activities at different rice growth stages to free air CO2 enrichment (FACE) was studied. The results showed that comparing with the ambient atmospheric CO2 concentration (370 mumol.mol-1), FACE (570 mumol.mol-1) significantly increased the urease activity of 0-5 cm soil layer at the vigorous growth stage of rice, whole that of 5-10 cm layer had no significant change during the whole growing season. Phosphatase activity of 0-5 cm and 5-10 cm soil layers significantly increased, and the peak increment was at the vigorous growth stage of rice.

Identification of protein phosphatase involvement in the AT-receptor induced activation of endothelial nitric oxide synthase

DEFF Research Database (Denmark)

Peluso, A Augusto; Bertelsen, Jesper Bork; Andersen, Kenneth

2018-01-01

-antagonist), L-NAME (10µM; eNOS inhibitor), MK-2206 (100nM; Akt-inhibitor) sodium fluoride (1nM; serine/threonine-phosphatase inhibitor) or sodium orthovanadate (10nM; tyrosine-phosphatase inhibitor). NO release was estimated by quantifying DAF-FM fluorescence. The phosphorylation status of activating (e...

Alkaline phosphatase immobilization onto Bio-Gide(R) and Bio-Oss(R) for periodontal and bone regeneration.

NARCIS (Netherlands)

Oortgiesen, D.A.W.; Plachokova, A.S.; Geenen, C.; Meijer, G.J.; Walboomers, X.F.; Beucken, J.J.J.P van den; Jansen, J.B.M.J.

2012-01-01

AIM: To evaluate the effect of alkaline phosphatase (ALP) immobilization onto Bio-Gide((R)) in vitro, and to study the in vivo performance of ALP-enriched Bio-Gide((R)) and/or Bio-Oss((R)) with the purpose to enhance periodontal regeneration. MATERIALS AND METHODS: Alkaline phosphatase ALP was

Study on alkaline and acid phosphatase activity in acute uranium intoxication

International Nuclear Information System (INIS)

Bokova, N.V.; Pavlova, V.B.; Stancheva, Yu.A.; Khadzhirusev, S.B.; Kiradzhiev, G.D.

1975-01-01

The protective potential of diethyl barbituric acid sodium salt is studied, in comparison with that of acetazolamide, on kidneys under acute uranium intoxication. Experiments involved rats given intraperitoneal injections with uranyl acetate on 12 successive days up to a total dose of 0.5, 2.0 or 7.0 mg/kg. The resulting effects are measured by chemical assays of serum and urine for alkaline and acid phosphatase and histochemical assays for phosphatase activities in kidneys, kinetics being followed over a 30-day period after total dose administration. Protection of kidneys from toxic uranium effects was found to be of about the same degree with sodium diethyl barbiturate as with acetazolamide. (A.B.)

A quantitative method for measurement of lysosomal acid phosphatase latency in cultured rat heart cells with 210Pb

International Nuclear Information System (INIS)

Hale, T.W.; Wenzel, D.G.

1978-01-01

A method is described for measuring the latency of lysomal acid phosphatase in cultured rat heart endotheloid cells. 210 Pb was added to a medium used to demonstrate acid phosphatase activity by the Gomori lead method, and the amount of lead deposited was measured with a liquid scintillation counter. Deposition rates were measured after enzyme activation pretreatments with acetate buffer (pH 5.0) at various osmolalities, and after formaldehyde fixation. Formaldehyde, alloxan, or fluoride in the Gomori medium were evaluated for their differential effects on lysosomal and non-lysosomal acid phosphatase The method was found to provide a sensitive, rapid and quantitative evaluation of acid phosphatase latency and should be useful for studying the integrity of lysosomes within cells. (author)