Glucan: mechanisms involved in its radioprotective effect
International Nuclear Information System (INIS)
Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.
1987-01-01
It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested
International Nuclear Information System (INIS)
Tran, Huu Vinh
1983-01-01
After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans
Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick
2012-06-01
A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.
Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan
2017-04-01
Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable
Cabib, Enrico; Blanco, Noelia; Arroyo, Javier
2012-04-01
Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.
Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi
Directory of Open Access Journals (Sweden)
Akira Yoshimi
2017-11-01
Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.
Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome
Directory of Open Access Journals (Sweden)
D. El Khoury
2012-01-01
Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.
Effects of gamma irradiation on the physical and structural properties of β-glucan
International Nuclear Information System (INIS)
Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon
2008-01-01
This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility
DEFF Research Database (Denmark)
Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo
2008-01-01
Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas
2012-01-01
Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...
Directory of Open Access Journals (Sweden)
Chiraphon Chaikliang
2015-11-01
Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of
Defining Starch Binding by Glucan Phosphatases
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2015-01-01
Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...
β-1,3-glucan in developing cotton fibers
International Nuclear Information System (INIS)
Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.
1979-01-01
Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis
Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.
Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P
2017-11-01
Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs
Plants with elevated levels of glucan
Energy Technology Data Exchange (ETDEWEB)
Pauly, Markus; Kraemer, Florian J.; Hake, Sarah
2018-03-20
The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Beta-glucans in the treatment of diabetes and associated cardiovascular risks
Directory of Open Access Journals (Sweden)
Jiezhong Chen
2008-12-01
Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis
Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.
Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza
2008-03-20
Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I
International Nuclear Information System (INIS)
Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.
1998-01-01
The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains
6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.
Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu
2016-02-12
With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.
Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P
1989-05-01
A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.
DEFF Research Database (Denmark)
Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun
2005-01-01
Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...
β-glucan extract from oat bran and its industrial importance
Ibrahim, M. N. G.; Selezneva, I. S.
2017-09-01
The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.
Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L
2014-02-07
The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.
Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.
Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong
2017-02-01
(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis
Energy Technology Data Exchange (ETDEWEB)
Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)
2010-08-01
In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.
DEFF Research Database (Denmark)
Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena
2013-01-01
.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...
Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).
Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio
2008-01-01
Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.
Directory of Open Access Journals (Sweden)
Fulcher R Gary
2007-03-01
Full Text Available Abstract Background Soluble fibers lower serum lipids, but are difficult to incorporate into products acceptable to consumers. We investigated the physiological effects of a concentrated oat β-glucan on cardiovascular disease (CVD endpoints in human subjects. We also compared the fermentability of concentrated oat β-glucan with inulin and guar gum in a model intestinal fermentation system. Methods Seventy-five hypercholesterolemic men and women were randomly assigned to one of two treatments: 6 grams/day concentrated oat β-glucan or 6 grams/day dextrose (control. Fasting blood samples were collected at baseline, week 3, and week 6 and analyzed for total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, glucose, insulin, homocysteine and C-reactive protein (CRP. To estimate colonic fermentability, 0.5 g concentrated oat β-glucan was incubated in a batch model intestinal fermentation system, using human fecal inoculum to provide representative microflora. Fecal donors were not involved with the β-glucan feeding trial. Inulin and guar gum were also incubated in separate serum bottles for comparison. Results Oat β-glucan produced significant reduction from baseline in total cholesterol (-0.3 ± 0.1 mmol/L and LDL cholesterol (-0.3 ± 0.1 mmol/L, and the reduction in LDL cholesterol were significantly greater than in the control group (p = 0.03. Concentrated oat β-glucan was a fermentable fiber and produced total SCFA and acetate concentrations similar to inulin and guar gum. Concentrated oat β-glucan produced the highest concentrations of butyrate at 4, 8, and 12 hours. Conclusion Six grams concentrated oat β-glucan per day for six weeks significantly reduced total and LDL cholesterol in subjects with elevated cholesterol, and the LDL cholesterol reduction was greater than the change in the control group. Based on a model intestinal fermentation, this oat β-glucan was fermentable, producing higher amounts of butyrate than other
Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan
2015-01-01
Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.
Semedo, Magda C; Karmali, Amin; Fonseca, Luís
2015-02-01
Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.
Preparation, characterization, and biological properties of β-glucans
Directory of Open Access Journals (Sweden)
Sandeep Rahar
2011-01-01
Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Directory of Open Access Journals (Sweden)
Sharon Avni
2017-07-01
Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
Energy Technology Data Exchange (ETDEWEB)
Satoh, S; Matsuda, K; Tamari, K
1976-12-01
A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.
Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.
Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij
2015-07-20
Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
Energy Technology Data Exchange (ETDEWEB)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2010-07-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
International Nuclear Information System (INIS)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon
2010-01-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity
Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan
Directory of Open Access Journals (Sweden)
JD Biller-Takahashi
Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.
Suppressing effects of glucan on micronuclei induced by Co60 in mice
International Nuclear Information System (INIS)
Chorvatovicova, D.
1991-01-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-07-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
International Nuclear Information System (INIS)
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-01-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
An enzyme family reunion - similarities, differences and eccentricities in actions on alpha-glucans
DEFF Research Database (Denmark)
Seo, Eun-Seong; Christiansen, Camilla; Abou Hachem, Maher
2008-01-01
alpha-Glucans in general, including starch, glycogen and their derived oligosaccharides are processed by a host of more or less closely related enzymes that represent wide diversity in structure, mechanism, specificity and biological role. Sophisticated three-dimensional structures continue to em...
The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.
Directory of Open Access Journals (Sweden)
Chad Steele
2005-12-01
Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.
Czech Academy of Sciences Publication Activity Database
Šíma, Petr; Vannucci, Luca; Větvička, V.
2017-01-01
Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016
Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae
Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.
1999-01-01
β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are
Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice
Energy Technology Data Exchange (ETDEWEB)
Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)
1991-10-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).
Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation
Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.
2015-01-01
β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Nielsen, Michael Engelbrecht
For decades the ability of β-glucans to modulate immunity through activation of innate cellular components has been observed. However, toxicological effects associated with the systemic administration and dose-related immune-suppression has also been described. The superior aim of this study...... is to understand the effect of β-glucan induced modulation in carp in relation to tissue regeneration, mucosal immunity and host-pathogen interactions. Expression profiles of immune related genes will be measured in fresh water specie – common carp (Cyprinus carpio L.). The methodology of the project involves...
Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J
2009-10-14
To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.
Recent insight in α-glucan metabolism in probiotic bacteria
DEFF Research Database (Denmark)
Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm
2014-01-01
α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...
Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun
2016-01-01
An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.
β-Glucans: Relationships between Modification, Conformation and Functional Activities
Directory of Open Access Journals (Sweden)
Qiang Wang
2017-02-01
Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.
Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi
2018-05-14
Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.
Study on the immuno stimulation of radiation degraded β-glucan in swiss mice
International Nuclear Information System (INIS)
Nguyen Thanh Long; Le Quang Luan
2015-01-01
The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)
Directory of Open Access Journals (Sweden)
Magdia De Jesus
Full Text Available Glucan particles (GPs are 2-4 μm hollow, porous shells composed of 1,3-β-D-glucan that have been effectively used for oral targeted-delivery of a wide range of payloads, including small molecules, siRNA, DNA, and protein antigens. While it has been demonstrated that the transepithelial transport of GPs is mediated by Peyer's patch M cells, the fate of the GPs once within gut-associated lymphoid tissue (GALT is not known. Here we report that fluorescently labeled GPs administered to mice by gavage accumulate in CD11c+ DCs situated in Peyer's patch sub-epithelial dome (SED regions. GPs appeared in DCs within minutes after gavage and remained within the SED for days afterwards. The co-administration or sequential administration of GPs with differentially labeled GPs or poly(lactic-co-glycolic acid nanoparticles demonstrated that the SED DC subpopulation in question was capable of internalizing particles of different sizes and material compositions. Phenotypic analysis identified the GP-containing DCs as being CD8α- and CD11blo/-, suggesting they are the so-called myeloid and/or double negative (DN subset(s of PP DCs. A survey of C-type lectin receptors (CLRs known to be expressed by leukocytes within the intestinal mucosa revealed that GP-containing SED DCs were positive for Langerin (CD207, a CLR with specificity for β-D-glucan and that has been shown to mediate the internalization of a wide range of microbial pathogens, including bacteria, viruses and fungi. The presence of Langerin+ DCs in the SED as determined by immunofluorescence was confirmed using Langerin E-GFP transgenic mice. In summary, our results demonstrate that following M cell-mediated transepithelial transport, GPs (and other micro/nanoparticles are sampled by a population of SED DCs distinguished from other Peyer's patch DC subsets by their expression of Langerin. Future studies will be aimed at defining the role of Langerin in antigen sampling and antigen presentation within
Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia
International Nuclear Information System (INIS)
Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu
2013-01-01
Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Structure and function of α-glucan debranching enzymes
DEFF Research Database (Denmark)
Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte
2016-01-01
α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....
Dimerization of the Glucan Phosphatase Laforin Requires the Participation of Cysteine 329
Sánchez-Martín, Pablo; Raththagala, Madushi; Bridges, Travis M.; Husodo, Satrio; Gentry, Matthew S.; Sanz, Pascual; Romá-Mateo, Carlos
2013-01-01
Laforin, encoded by a gene that is mutated in Lafora Disease (LD, OMIM 254780), is a modular protein composed of a carbohydrate-binding module and a dual-specificity phosphatase domain. Laforin is the founding member of the glucan-phosphatase family and regulates the levels of phosphate present in glycogen. Multiple reports have described the capability of laforin to form dimers, although the function of these dimers and their relationship with LD remains unclear. Recent evidence suggests that laforin dimerization depends on redox conditions, suggesting that disulfide bonds are involved in laforin dimerization. Using site-directed mutagenesis we constructed laforin mutants in which individual cysteine residues were replaced by serine and then tested the ability of each protein to dimerize using recombinant protein as well as a mammalian cell culture assay. Laforin-Cys329Ser was the only Cys/Ser mutant unable to form dimers in both assays. We also generated a laforin truncation lacking the last three amino acids, laforin-Cys329X, and this truncation also failed to dimerize. Interestingly, laforin-Cys329Ser and laforin-Cys329X were able to bind glucans, and maintained wild type phosphatase activity against both exogenous and biologically relevant substrates. Furthermore, laforin-Cys329Ser was fully capable of participating in the ubiquitination process driven by a laforin-malin complex. These results suggest that dimerization is not required for laforin phosphatase activity, glucan binding, or for the formation of a functional laforin-malin complex. Cumulatively, these results suggest that cysteine 329 is specifically involved in the dimerization process of laforin. Therefore, the C329S mutant constitutes a valuable tool to analyze the physiological implications of laforin’s oligomerization. PMID:23922729
Effect of purified oat β-glucan on fermentation of set-style yogurt mix.
Singh, Mukti; Kim, Sanghoon; Liu, Sean X
2012-08-01
Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.
Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2016-01-01
was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...
Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.
Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan
2013-05-01
The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
KUSMIATI
2007-04-01
Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both
Directory of Open Access Journals (Sweden)
Taiki Kobayashi
Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.
Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.
Gomaa, K; Kraus, J; Franz, G; Röper, H
1991-09-18
Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.
The structure of cell wall alpha-glucan from fission yeast
Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
The structure of cell wall alpha-glucan from fission yeast.
Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.
Directory of Open Access Journals (Sweden)
Heather T Taff
Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.
Directory of Open Access Journals (Sweden)
Claudia Zielke
Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.
Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods
Directory of Open Access Journals (Sweden)
Vesna Zechner-Krpan
2010-01-01
Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.
Zheng, Xueling; Li, Limin; Wang, Qi
2011-01-01
Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.
Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus
Directory of Open Access Journals (Sweden)
Ira Widjiastuti
2017-03-01
Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of
Pan, Hua-Ping; Wang, Ning; Tachikawa, Hiroyuki; Nakanishi, Hideki; Gao, Xiao-Dong
2017-11-01
The yeast spore wall is an excellent model to study the assembly of an extracellular macromolecule structure. In the present study, mutants defective in β-1,6-glucan synthesis, including kre1∆, kre6∆, kre9∆ and big1∆, were sporulated to analyse the effect of β-1,6-glucan defects on the spore wall. Except for kre6∆, these mutant spores were sensitive to treatment with ether, suggesting that the mutations perturb the integrity of the spore wall. Morphologically, the mutant spores were indistinguishable from wild-type spores. They lacked significant sporulation defects partly because the chitosan layer, which covers the glucan layer, compensated for the damage. The proof for this model was obtained from the effect of the additional deletion of CHS3 that resulted in the absence of the chitosan layer. Among the double mutants, the most severe spore wall deficiency was observed in big1∆ spores. The majority of the big1∆chs3∆ mutants failed to form visible spores at a higher temperature. Given that the big1∆ mutation caused a failure to attach a GPI-anchored reporter, Cwp2-GFP, to the spore wall, β-1,6-glucan is involved in tethering of GPI-anchored proteins in the spore wall as well as in the vegetative cell wall. Thus, β-1,6-glucan is required for proper organization of the spore wall. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B
2017-09-05
Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.
Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.
Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa
2014-06-01
Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.
Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.
Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G
1992-01-01
The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.
Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A
2016-01-01
Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.
Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou
2004-03-26
The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.
Visual effects of β-glucans on wound healing in fish
DEFF Research Database (Denmark)
Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær
2011-01-01
Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...
An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.
Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.
2004-01-01
(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method
Directory of Open Access Journals (Sweden)
Robert T Wheeler
2008-12-01
Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.
DEFF Research Database (Denmark)
Munck, L.; Møller, B.; Jacobsen, Susanne
2004-01-01
-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....
Shi, Limin; Lin, Qinlu; Yang, Tao; Nie, Ying; Li, Xinhua; Liu, Bo; Shen, Junjun; Liang, Ying; Tang, Yiping; Luo, Feijun
2016-11-09
To evaluate the anti-inflammatory effect of β-glucans from Lentinus edodes, and its molecular mechanism, the dextran sulfate sodium salt (DSS) induced colitis model of mice and the LPS-stimulated RAW264.7 cell inflammation model were used in this study. 40 ICR male mice were randomly divided into 4 groups: Control, DSS (DSS treated only), DSS + low-βGs (500 mg kg -1 d -1 ) and DSS + high-βGs (1000 mg kg -1 d -1 ). The body weight of the mice with Lentinus edodes β-glucan supplementation increased significantly compared to the DSS group and the disease activity index (DAI) was improved in both βG-treated groups. Compared with the DSS group, histopathological analysis showed that the infiltration of inflammatory cells of both βG-treated groups decreased significantly in colonic tissues. Furthermore, oral administration of β-glucans decreases the concentration of malondialdehyde (MDA) and myeloperoxidase (MPO) and inhibits the expression of iNOS and several inflammatory factors: TNF-α, IL-1β and IL-6 as well as nitric oxide (NO) of the colonic tissues. The mitogen-activated protein kinase (MAPK) pathway is closely related to the expression of pro-inflammatory factors. In the DSS-induced colitis model and the LPS-stimulated RAW264.7 cell model, βGs inhibited the expression of pro-inflammatory factors and blocked the phosphorylation of JNK/ERK1/2 and p38; βGs also suppress the phosphorylation of Elk-1 at Ser84 and the phosphorylation of PPARγ at Ser112. Altogether, these results suggest that Lentinus edodes βGs could inhibit the DSS-induced ulcerative colitis and decrease inflammatory factor expressions. The molecular mechanism may be involved in suppressing MAPK signaling and inactivation of Elk-1 and activation of PPARγ.
Theuwissen, Elke; Mensink, Ronald P
2007-03-01
Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.
DEFF Research Database (Denmark)
Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.
1993-01-01
The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...
Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang
2017-07-28
The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.
Glucan Particles for Macrophage Targeted Delivery of Nanoparticles
Directory of Open Access Journals (Sweden)
Ernesto R. Soto
2012-01-01
Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.
Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide
Directory of Open Access Journals (Sweden)
E. Y. Choi
2016-11-01
Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.
Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria
Directory of Open Access Journals (Sweden)
Mattia P. Arena
2014-02-01
Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.
Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S
2013-03-01
β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.
Modulation of the immune response of porcine neutrophils by different β-glucan preparations
DEFF Research Database (Denmark)
Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard
2010-01-01
β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...
Plant α-glucan phosphatases SEX4 and LSF2 display different affinity for amylopectin and amylose
DEFF Research Database (Denmark)
Wilkens, Casper; Auger, Kyle D.; Anderson, Nolan T.
2016-01-01
The plant glucan phosphatases Starch EXcess 4 (SEX4) and Like Sex Four2 (LSF2) apply different starch binding mechanisms. SEX4 contains a carbohydrate binding module, and LSF2 has two surface binding sites (SBSs). We determined KDapp for amylopectin and amylose, and KD for β-cyclodextrin and vali...
Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard
2007-01-01
Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522
International Nuclear Information System (INIS)
Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo
2015-01-01
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber
Energy Technology Data Exchange (ETDEWEB)
Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)
2015-02-27
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.
Directory of Open Access Journals (Sweden)
AHMAD THONTOWI
2007-10-01
Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.
Directory of Open Access Journals (Sweden)
Matthew J. Elder
2017-07-01
Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.
Various roles of beta-glucan in invertebrates
Czech Academy of Sciences Publication Activity Database
Větvička, V.; Šíma, Petr
2017-01-01
Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016
Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.
Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G
2017-08-15
Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.
2013-01-01
α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades
Directory of Open Access Journals (Sweden)
Vishukumar Aimanianda
2017-06-01
Full Text Available β-(1,3-Glucan, the major fungal cell wall component, ramifies through β-(1,6-glycosidic linkages, which facilitates its binding with other cell wall components contributing to proper cell wall assembly. Using Saccharomyces cerevisiae as a model, we developed a protocol to quantify β-(1,6-branching on β-(1,3-glucan. Permeabilized S. cerevisiae and radiolabeled substrate UDP-(14Cglucose allowed us to determine branching kinetics. A screening aimed at identifying deletion mutants with reduced branching among them revealed only two, the bgl2Δ and gas1Δ mutants, showing 15% and 70% reductions in the branching, respectively, compared to the wild-type strain. Interestingly, a recombinant Gas1p introduced β-(1,6-branching on the β-(1,3-oligomers following its β-(1,3-elongase activity. Sequential elongation and branching activity of Gas1p occurred on linear β-(1,3-oligomers as well as Bgl2p-catalyzed products [short β-(1,3-oligomers linked by a linear β-(1,6-linkage]. The double S. cerevisiae gas1Δ bgl2Δ mutant showed a drastically sick phenotype. An ScGas1p ortholog, Gel4p from Aspergillus fumigatus, also showed dual β-(1,3-glucan elongating and branching activity. Both ScGas1p and A. fumigatus Gel4p sequences are endowed with a carbohydrate binding module (CBM, CBM43, which was required for the dual β-(1,3-glucan elongating and branching activity. Our report unravels the β-(1,3-glucan branching mechanism, a phenomenon occurring during construction of the cell wall which is essential for fungal life.
Directory of Open Access Journals (Sweden)
Antonio Francioso
2017-05-01
Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.
Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu
2017-07-01
The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.
Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil
Chang, I.; Cho, G.
2012-12-01
Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.
Directory of Open Access Journals (Sweden)
Jenneke Leentjens
Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.
Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis
Directory of Open Access Journals (Sweden)
Tomoko Jippo
2015-02-01
Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases
International Nuclear Information System (INIS)
Schmidt, W.E.; Ebel, J.
1987-01-01
Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay
Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats
International Nuclear Information System (INIS)
Salama, S.F.
2011-01-01
1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications
Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen
2004-10-01
Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.
Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R
2018-04-03
Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which
A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.
Das, Deeplina; Baruah, Rwivoo; Goyal, Arun
2014-08-01
An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.
Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast
Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans
2007-01-01
The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential
Long-lived effects of administering β-glucans
Petit, Jules; Wiegertjes, Geert F.
2016-01-01
Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a
Effect of purified oat ß-glucan on fermentation of set-style yogurt mix
Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...
Rosburg, Valerie; Boylston, Terri; White, Pamela
2010-06-01
Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.
Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.
Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui
2016-12-01
β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick
2017-04-01
Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.
2017-01-01
-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....
Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction
Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar
2013-01-01
Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938
Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans
DEFF Research Database (Denmark)
Mikkelsen, Mette Skau
-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...
Kumari, J; Sahoo, P K
2006-02-01
This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.
DEFF Research Database (Denmark)
Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig
2017-01-01
binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...
Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy
DEFF Research Database (Denmark)
Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling
2010-01-01
To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...
Directory of Open Access Journals (Sweden)
Jae Gil Lee
2016-06-01
Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.
Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.
2018-03-01
Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.
Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A
2016-11-01
At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John
2012-01-01
ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739
Directory of Open Access Journals (Sweden)
Đukić Nevena H.
2014-01-01
Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092
Immunostimulatory properties and antitumor activities of glucans (Review)
Czech Academy of Sciences Publication Activity Database
Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.
2013-01-01
Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Directory of Open Access Journals (Sweden)
Henky Manoppo
2010-06-01
Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.
Directory of Open Access Journals (Sweden)
Ľubomír Mikuš
2013-02-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too. At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258
Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults
DEFF Research Database (Denmark)
Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe
2013-01-01
for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...
Kupetz, M; Sacher, B; Becker, T
2016-06-05
Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.
Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael
2001-01-01
(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...
Directory of Open Access Journals (Sweden)
Ernesto R. Soto
2016-01-01
Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.
Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert
Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical
Energy Technology Data Exchange (ETDEWEB)
Przekora, Agata, E-mail: agata.przekora@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodzki 1, 20-093 Lublin (Poland); Palka, Krzysztof [Department of Materials Engineering, Lublin University of Technology, Nadbystrzycka 36, 20-618 Lublin (Poland); Ginalska, Grazyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodzki 1, 20-093 Lublin (Poland)
2016-01-01
The aim of this work was to compare biomedical potential of chitosan/hydroxyapatite (chit/HA) and novel chitosan/β-1,3-glucan/hydroxyapatite (chit/glu/HA) materials as scaffolds for bone regeneration via characterization of their biocompatibility, porosity, mechanical properties, and water uptake behaviour. Biocompatibility of the scaffolds was assessed in direct-contact with the materials using normal human foetal osteoblast cell line. Cytotoxicity and osteoblast proliferation rate were evaluated. Porosity was assessed using computed microtomography analysis and mechanical properties were determined by compression testing. Obtained results demonstrated that chit/HA scaffold possessed significantly better mechanical properties (compressive strength: 1.23 MPa, Young's modulus: 0.46 MPa) than chit/glu/HA material (compressive strength: 0.26 MPa, Young's modulus: 0.25 MPa). However, addition of bacterial β-1,3-glucan to the chit/HA scaffold improved its flexibility and porosity. Moreover, chit/glu/HA scaffold revealed significantly higher water uptake capability (52.6% after 24 h of soaking) compared to the chit/HA (30.7%) and thus can serve as a very good drug delivery carrier. Chit/glu/HA scaffold was also more favourable to osteoblast survival (near 100% viability after 24-h culture), proliferation, and spreading compared to the chit/HA (63% viability). The chit/glu/HA possesses better biomedical potential than chit/HA scaffold. Nevertheless, poor mechanical properties of the chit/glu/HA limit its application to non-load bearing implantation area. - Highlights: • Chitosan/HA and chit/β-1,3-glucan/HA scaffolds for bone regeneration were compared. • Chit/HA significantly reduced osteoblast viability to 63% compared to chit/glu/HA. • Unlike chit/HA, chit/glu/HA favoured cell adhesion, spreading, and proliferation. • Chit/HA had better compressive strength and Young's modulus than chit/glu/HA. • Chit/glu/HA revealed significantly higher
Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie
2018-06-19
The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.
Thao, Cao Phuong; Tien, Le Thi Thuy
2017-09-01
β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.
Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H
1990-04-01
Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.
Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols
Directory of Open Access Journals (Sweden)
A. Korpi
2003-01-01
Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.
The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice
Directory of Open Access Journals (Sweden)
Fengdan Jin
2014-01-01
Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.
Combined effects of added beta glucan and black tea in breads on starch functionality.
Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L
2015-03-01
Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.
Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.
Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the
Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms
Directory of Open Access Journals (Sweden)
Daniela Fiocco
2012-05-01
Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.
Oliveira-Garcia, Ely; Deising, Holger B
2016-08-01
In plants, pathogen defense is initiated by recognition of pathogen-associated molecular patterns (PAMPs) via plasma membrane-localized pattern-recognition receptors (PRRs). Fungal structural cell wall polymers such as branched β-glucans are essential for infection structure rigidity and pathogenicity, but at the same time represent PAMPs. Kre5 and Kre6 are key enzymes in β-1,6-glucan synthesis and formation of branch points of the β-glucan network. In spite of the importance of branched β-glucan for hyphal rigidity and plant-fungus interactions, neither the role of KRE5 and KRE6 in pathogenesis nor mechanisms allowing circumventing branched β-glucan-triggered immune responses are known. We functionally characterized KRE5 and KRE6 of the ascomycete Colletotrichum graminicola, a hemibiotroph that infects maize (Zea mays). After appressorial plant invasion, this fungus sequentially differentiates biotrophic and highly destructive necrotrophic hyphae. RNAi-mediated reduction of KRE5 and KRE6 transcript abundance caused appressoria to burst and swelling of necrotrophic hyphae, indicating that β-1,6-glucosidic bonds are essential in these cells. Live cell imaging employing KRE5:mCherry and KRE6:mCherry knock-in strains and probing of infection structures with a YFP-conjugated β-1,6-glucan-binding protein showed expression of these genes and exposure of β-1,6-glucan in conidia, appressoria and necrotrophic, but not in biotrophic hyphae. Overexpression of KRE5 and KRE6 in biotrophic hyphae led to activation of broad-spectrum plant defense responses, including papilla and H2 O2 formation, as well as transcriptional activation of several defense-related genes. Collectively, our results strongly suggest that down-regulation of synthesis and avoidance of exposure of branched β-1,3-β-1,6-glucan in biotrophic hyphae is required for attenuation of plant immune responses. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum
2010-01-01
Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB
DEFF Research Database (Denmark)
Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.
2012-01-01
Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...
Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.
Directory of Open Access Journals (Sweden)
Reshma Davidson
Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.
The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.
Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum
2014-04-01
Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.
Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S
2013-10-01
Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.
Mekoue Nguela, Julie; Poncet-Legrand, Celine; Sieczkowski, N.; Vernhet, Aude
2016-01-01
At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored b...
Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.
Shiota, E; Maekawa, M; Kono, T
2001-12-01
Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.
DEFF Research Database (Denmark)
Madsen, A. M.; Tendal, K.; Thilsing, T.
2013-01-01
occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...
Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua
2016-10-01
This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.
Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri
Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...
Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher
2017-06-15
Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a
Probing interactions between B-glucan and bile salts at atomic detail by 1H-13C NMR assays
DEFF Research Database (Denmark)
Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G
2014-01-01
Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
DEFF Research Database (Denmark)
Jiménez, Natalia Ivonne Vera
by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...
Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça
2017-03-07
The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.
Institute of Scientific and Technical Information of China (English)
MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu
2015-01-01
This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.
Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.
Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish
2012-09-04
Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.
Towards a more versatile alpha-glucan biosynthesis in plants
Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.
2003-01-01
Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated
(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.
Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin
2017-03-01
A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.
Directory of Open Access Journals (Sweden)
A.C.C.F.F. De Paula
2005-06-01
Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang
2018-07-15
A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.
Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.
2010-01-01
An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.
Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions
International Nuclear Information System (INIS)
Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian
2012-01-01
Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)
Vickerman, M M; Jones, G W
1992-10-01
Growing Streptococcus gordonii Spp+ phase variants, which have normal levels of glucosyltransferase (GTF) activity, use sucrose to promote their accumulation on surfaces by forming a cohesive bacterium-insoluble glucan polymer mass (BPM). Spp- phase variants, which have lower levels of GTF activity, do not form BPMs and do not remain in BPMs formed by Spp+ cells when grown in mixed cultures. To test the hypothesis that segregation of attached Spp+ and unattached Spp- cells was due to differences in adhesiveness, adhesion between washed, [3H]thymidine-labeled cells and preformed BPM substrata was measured. Unexpectedly, the results showed that cells of both phenotypes, as well as GTF-negative cells, attached equally well to preformed BPMs, indicating that attachment to BPMs was independent of cell surface GTF activity. Initial characterization of this binding interaction suggested that a protease-sensitive component on the washed cells may be binding to lipoteichoic acids sequestered in the BPM, since exogenous lipoteichoic acid inhibited adhesion. Surprisingly, the adhesion of both Spp+ and Spp- cells was markedly inhibited in the presence of sucrose, which also released lipoteichoic acid from the BPM. These in vitro findings suggest that, in vivo, sucrose and lipoteichoic acid may modify dental plaque development by enhancing or inhibiting the attachment of additional bacteria.
Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children
DEFF Research Database (Denmark)
Holst, Gitte Juel; Høst, Arne; Doekes, G
2015-01-01
Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...
Directory of Open Access Journals (Sweden)
Bo-Hye Nam
2016-12-01
Full Text Available Antimicrobial peptides are a pivotal component of the invertebrate innate immune system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP gene from the pacific abalone Haliotis discus hannai (HDH, which is involved in the pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF encoding a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2. By substituting a positively charged amino acid and amidation at the C-terminus, the pI and net charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa, lung (A549, and colon (HCT 116 carcinoma cell lines but not much on human umbilical vein cell (HUVEC. Fluorescence-activated cell sorter (FACS analysis showed that HDH-LGBP analogs disturb the cancer cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs as multifunctional drugs.
Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels
Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.
2014-01-01
Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183
Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.
Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A
2018-05-01
Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Gordon D Ross
2007-06-01
Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.
van Leeuwen, Sander S.; Kralj, Slavko; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.
Site-directed mutagenesis of the glucansucrase gtf180 gene from Lactobacillus reuteri strain 180 was used to transform the active site region. The alpha-D-glucan (mEPS-PNNS) produced by the triple mutant V1027P:S1137N: A1139S differed in structure from that of the wild-type alpha-D-glucan (EPS180).
Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang
2014-01-01
Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.
Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S
2015-08-01
A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Knudsen, Knud Erik Bach
The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...
Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G
2011-03-01
This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Yeast β-1,6-glucan is a primary target for the Saccharomyces cerevisiae K2 toxin.
Lukša, Juliana; Podoliankaitė, Monika; Vepštaitė, Iglė; Strazdaitė-Žielienė, Živilė; Urbonavičius, Jaunius; Servienė, Elena
2015-04-01
Certain Saccharomyces cerevisiae strains secrete different killer proteins of double-stranded-RNA origin. These proteins confer a growth advantage to their host by increasing its survival. K2 toxin affects the target cell by binding to the cell surface, disrupting the plasma membrane integrity, and inducing ion leakage. In this study, we determined that K2 toxin saturates the yeast cell surface receptors in 10 min. The apparent amount of K2 toxin, bound to a single cell of wild type yeast under saturating conditions, was estimated to be 435 to 460 molecules. It was found that an increased level of β-1,6-glucan directly correlates with the number of toxin molecules bound, thereby impacting the morphology and determining the fate of the yeast cell. We observed that the binding of K2 toxin to the yeast surface receptors proceeds in a similar manner as in case of the related K1 killer protein. It was demonstrated that the externally supplied pustulan, a poly-β-1,6-glucan, but not the glucans bearing other linkage types (such as laminarin, chitin, and pullulan) efficiently inhibits the K2 toxin killing activity. In addition, the analysis of toxin binding to the intact cells and spheroplasts confirmed that majority of K2 protein molecules attach to the β-1,6-glucan, rather than the plasma membrane-localized receptors. Taken together, our results reveal that β-1,6-glucan is a primary target of K2 toxin and is important for the execution of its killing property. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert
2016-01-20
α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.
Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar
2017-03-01
Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.
High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer
Directory of Open Access Journals (Sweden)
Hirokazu Tokuyasu
2010-09-01
Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran
Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi
2008-06-01
Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.
Directory of Open Access Journals (Sweden)
Harry J. Wichers
2010-08-01
Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.
Directory of Open Access Journals (Sweden)
Rodrigo Juliano Oliveira
2013-01-01
Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.
International Nuclear Information System (INIS)
Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.
1989-01-01
The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J; Shrive, Annette K; Hoole, Dave
2014-08-01
The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight or with control food for 25 days and then injected with PBS containing either LPS (4 mg/kg) or poly(I:C) (5 mg/kg) or PBS alone. Fish were sampled during the 25 days of the feeding period and up to 7 days post-PAMPs injections for serum and liver, head kidney and mid-gut tissues. Oral administration of β-glucan for 25 days significantly increased serum CRP levels and alternative complement activity (ACP). In addition, the subsequent LPS and poly(I:C) challenges significantly affected CRP and complement related gene expression profiles (crp1, crp2, c1r/s, bf/c2, c3 and masp2), with the greatest effects observed in the β-glucan fed fish. However, in fish fed β-glucan the PAMPs injections had less effects on CRP levels and complement activity in the serum than in control fed fish, suggesting that the 25 days of β-glucan immunostimulation was sufficient enough to reduce the effects of LPS and poly(I:C) injections. Results suggest that MacroGard® stimulated CRP and complement responses to PAMPs immunological challenges in common carp thus highlighting the beneficial β-glucan immunostimulant properties. Copyright © 2014 Elsevier Ltd. All rights reserved.
Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh
2017-12-05
Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
RISHIKESH SHUKLA
2012-01-01
Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.
Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José
2016-12-17
Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.
International Nuclear Information System (INIS)
Nguyen Ngoc Duy; Dang Van Phu; Nguyen Thi Kim Lan; Nguyen Quoc Hien; Pham Duy Hai
2015-01-01
Oligoβ-glucan and oligochitosan were prepared by gamma Co-60 irradiation of β-glucan/H_2O_2 and chitosan/H_2O_2 solution. The efficiency of the degradation process was determined by gel permeation chromatography (GPC) method. Results showed that the Mw decreased with increasing concentration of H_2O_2 and doses. For oligoβ-glucan, Mw reduced from 56.7 kDa to 7.1 kDa when β-glucan 10%/H_2O_2 1% solution was irradiated at 14 kGy. For oligochitosan, Mw reduced from 45.5 kDa to 5.0 kDa when chitosan 5%/H_2O_2 0.5% solution was irradiated at 21 kGy. Tra catfish (Pangasianodon hypophthalmus) was fed with oligoβ-glucan and oligochitosan in various concentrations of 0, 50, 100, and 200 mg/kg feed for 45 days and then was challenged with Edwardsiella ictaluri bacteria to investigate immune stimulation effect against white patches in the internal organs disease. The results indicated that oligoβ-glucan and oligochitosan exhibited good immune stimulation effect with optimum concentration of 100 mg/kg feed. Survival rate of Tra catfishes fed with oligochitosan and oligoβ-glucan is 47.62 ± 1.96% and 46.67 ± 2.58%, respectively. In addition, the mixture of oligochitosan 50 mg/kg + oligo?-glucan 50 mg/kg showed the highest survival rate (62.22 ± 1.96%). (author)
Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet
Directory of Open Access Journals (Sweden)
Jie Zheng
2013-12-01
Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.
International Nuclear Information System (INIS)
Le Quang Luan; Nguyen Thanh Long
2015-01-01
The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)
UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity
International Nuclear Information System (INIS)
Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.
1989-01-01
A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains
Shao, Yujing; Guo, Yuming; Wang, Zhong
2013-07-01
This study investigated the protective effect of β-1,3/1,6-glucan on gut morphology, intestinal epithelial tight junctions, and bacterial translocation of broiler chickens challenged with Salmonella enterica serovar Typhimurium. Ninety Salmonella-free Arbor Acre male broiler chickens were randomly divided into 3 groups: negative control group (NC), Salmonella Typhimurium-infected positive group (PC), and the Salmonella Typhimurium-infected group with dietary 100 mg/kg of β-1,3/1,6-glucan supplementation (T) to determine the effect of β-1,3/1,6-glucan on intestinal barrier function. Salmonella Typhimurium challenge alone significantly decreased villus height (P chickens challenged with Salmonella Typhimurium.
2015-01-01
The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p periodontal disease (p periodontal disease (p periodontal effects in diabetic rats with periodontal disease. PMID:26291983
Das, Deeplina; Goyal, Arun
2014-03-15
Exopolysaccharide produced by lactic acid bacteria are the subject of an increasing number of studies for their potential applications in the food industry as stabilizing, bio-thickening and immunostimulating agents. In this regard, the authors isolated an exopolysaccharide producing probiotic lactic acid bacterium from fermented beverage Marcha of north eastern Himalayas. The isolate Lactobacillus plantarum DM5 showed extracellular glucansucrase activity of 0.48 U mg⁻¹ by synthesizing natural exopolysaccharide glucan (1.87 mg mL⁻¹) from sucrose. Zymogram analysis of purified enzyme confirms the presence of glucosyltransferase of approximately 148 kDa with optimal activity of 18.7 U mg⁻¹ at 30 °C and pH 5.4. The exopolysaccharide was purified by gel permeation chromatography and had an average molecular weight of 1.11 × 10⁶ Da. Acid hydrolysis and structural characterization of exopolysaccharide revealed that it was composed of d-glucose residues, containing 86.5% of α-(1→6) and 13.5% of α-(1→3) linkages. Rheological study exhibited a shear thinning effect of glucan appropriate for food additives. A cytotoxicity test of glucan on human embryonic kidney 293 (HEK 293) and human cervical cancer (HeLa) cell lines revealed its nontoxic biocompatible nature. This is the first report on the structure and biocompatibility of homopolysaccharide α-D-glucan (dextran) from probiotic Lactobacillus plantarum strain and its unique physical and rheological properties that facilitate its application in the food industry as viscosifying and gelling agent. © 2013 Society of Chemical Industry.
Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.
International Nuclear Information System (INIS)
Senyuk, O.F.; Tarasenko, P.D.; Pazukhin, Eh.M.; Gorovoj, L.F.; Varlamov, V.P.
2004-01-01
Possibilities of prevention and reduction of consequences of acute exposure on the background of immobilization stress with the help of chitosan preparations and of melanin - glucan complex of highest bazidiomicetes (fungi) were studied. Tested preparations were capable to protect hematological and immunological homeostasis of line BALB/c mice from stressful reaction provoked by acute exposure and two-hour immobilization. The most expressed normalizing and adapting effect had the mixture composed of chitosan and melanin-glucan complex
Antibiotic resistance and ndvB gene expression among biofilm ...
African Journals Online (AJOL)
A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...
Oliveira-Garcia, Ely; Deising, Holger B.
2013-01-01
β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035
Silva, Viviam de O.; Lobato, Raquel V.; Orlando, Débora R.; Borges, Bruno D.B.; de Sousa, Raimundo V.
2017-01-01
This study aimed to evaluate the effects of β-glucan ingestion (Saccharomyces cerevisiae) on the plasmatic levels of tumor necrosis factor-α (TNF-α) and interleukin-10 (IL-10), alveolar bone loss, and pancreatic β-cell function (HOMA-BF) in diabetic rats with periodontal disease (PD). Besides, intestinal morphology was determined by the villus/crypt ratio. A total of 48 Wistar rats weighing 203 ± 18 g were used. Diabetes was induced by the intraperitoneal injection of streptozotocin (80 mg/kg) and periodontal inflammation, by ligature. The design was completely randomized in a factorial scheme 2 × 2 × 2 (diabetic or not, with or without periodontitis, and ingesting β-glucan or not). The animals received β-glucan by gavage for 28 days. Alveolar bone loss was determined by scanning electron microscopy (distance between the cementoenamel junction and alveolar bone crest) and histometric analysis (bone area between tooth roots). β-glucan reduced plasmatic levels of TNF-α in diabetic animals with PD and of IL-10 in animals with PD (p < 0.05). β-glucan reduced bone loss in animals with PD (p < 0.05). In diabetic animals, β-glucan improved β-cell function (p < 0.05). Diabetic animals had a higher villus/crypt ratio (p < 0.05). In conclusion, β-glucan ingestion reduced the systemic inflammatory profile, prevented alveolar bone loss, and improved β-cell function in diabetic animals with PD. PMID:28906456
Mechanisms of Candida biofilm drug resistance
Taff, Heather T; Mitchell, Kaitlin F; Edward, Jessica A; Andes, David R
2013-01-01
Candida commonly adheres to implanted medical devices, growing as a resilient biofilm capable of withstanding extraordinarily high antifungal concentrations. As currently available antifungals have minimal activity against biofilms, new drugs to treat these recalcitrant infections are urgently needed. Recent investigations have begun to shed light on the mechanisms behind the profound resistance associated with the biofilm mode of growth. This resistance appears to be multifactorial, involving both mechanisms similar to conventional, planktonic antifungal resistance, such as increased efflux pump activity, as well as mechanisms specific to the biofilm lifestyle. A unique biofilm property is the production of an extracellular matrix. Two components of this material, β-glucan and extracellular DNA, promote biofilm resistance to multiple antifungals. Biofilm formation also engages several stress response pathways that impair the activity of azole drugs. Resistance within a biofilm is often heterogeneous, with the development of a subpopulation of resistant persister cells. In this article we review the molecular mechanisms underlying Candida biofilm antifungal resistance and their relative contributions during various growth phases. PMID:24059922
Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.
Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K
2014-02-01
Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.
Directory of Open Access Journals (Sweden)
Anna Bzducha-Wróbel
2014-12-01
Full Text Available Selected methods for yeast cell disruption were evaluated to establish their suitability for cell wall preparation in the process of β-glucan isolation. The effect of different disruption methods on contents of total saccharides, β-glucans and proteins in the produced cell walls preparations was analyzed. The degree of cell wall purification from intracellular components was established on the basis of the ratio of solubilised material. The investigated methods included: cell exposure to hot water (autoclaving, thermally-induced autolysis, homogenization in a bead mill, sonication and their combinations. Experimental systems were prepared in water (pH 5.0 and pH 7.0 and Tris-HCl buffer (pH 8.0. The Saccharomyces cerevisiae yeast cell wall preparations with the highest degree of cytosol component release and purification of β-glucans were produced by 30 min of cell homogenization with zirconium-glass beads (0.5 mm in diameter. This was confirmed by the highest ratio of solubilised material (approx. 64%–67%. The thus-produced preparations contained ca. 60% of total saccharides, 13%–14% of β(1,3/(1,6-glucans, and approx. 35% of crude proteins. Similar results were obtained after autolysis coupled with bead milling as well as with sonication, but the time required for these processes was more than 24 h. Homogenization in a bead mill could be valuable for general isolation procedures because allows one to eliminate the different autolytic activity of various yeast strains.
Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.
1999-01-01
Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and 13C or 1H nuclear magnetic resonance analysis showed that the glucan has a unique
Geel-Schutten, G.H. van; Faber, E.J.; Smit, E.; Bonting, K.; Smith, M.R.; Brink, B. ten; Kamerling, J.P.; Vliegenthart, J.F.G.; Dijkhuizen, L.
Lactobacillus reuteri LB 121 cells growing on sucrose synthesize large amounts of a glucan (D-glucose) and a fructan (D-fructose) with molecular masses of 3,500 and 150 kDa, respectively. Methylation studies and (13)C or (1)H nuclear magnetic resonance analysis showed that the glucan has a unique
Directory of Open Access Journals (Sweden)
Samir Jawhara
Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the
Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song
2017-01-01
Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.
Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.
Alwis, K U; Mandryk, J; Hocking, A D
1999-09-01
Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.
Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe
2017-01-01
Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Weitberg Alan B
2008-09-01
Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.
Directory of Open Access Journals (Sweden)
R.C.Shendare
2008-01-01
Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave
2014-01-01
The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...
Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya
2017-07-01
We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Pardo-Ruiz, Zenia; Menéndez-Sardiñas, Dalia E; Pacios-Michelena, Anabel; Gabilondo-Ramírez, Tatiana; Montero-Alejo, Vivian; Perdomo-Morales, Rolando
2016-01-01
In the present study, we aimed to determine the influence of β-(1,3)-d-glucans on the LPS-induced pro-inflammatory cytokine response in the Monocyte Activation Test (MAT) for pyrogens, and on the LPS-induced febrile response in the Rabbit Pyrogen Test (RPT), thus evaluating the resulting effect in the outcome of each test. It was found that β-(1,3)-d-glucans elicited the production of pro-inflammatory cytokines IL-1β, IL-6 and TNF-α, also known as endogenous pyrogens, but not enough to classify them as pyrogenic according to MAT. The same β-(1,3)-d-glucans samples were non-pyrogenic by RPT. However, β-(1,3)-d-glucans significantly enhanced the LPS-induced pro-inflammatory cytokines response in MAT, insomuch that samples containing non-pyrogenic concentrations of LPS become pyrogenic. On the other hand, β-(1,3)-d-glucans had no effect on sub-pyrogenic LPS doses in the RPT, but surprisingly, inhibited the LPS-induced febrile response of pyrogenic LPS concentrations. Thus, while β-(1,3)-d-glucans could mask the LPS pyrogenic activity in the RPT, they exerted an overstimulation of pro-inflammatory cytokines in the MAT. Hence, MAT provides higher safety since it evidences an unwanted biological response, which is not completely controlled and is overlooked by the RPT. Copyright © 2015 Elsevier B.V. All rights reserved.
Understanding the role of oat ß-glucan in oat-based dough systems
Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.
2015-01-01
B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna; Frost, Patrick; Irnazarow, Ilgiz; Shrive, Annette; Hoole, Dave
2013-03-01
The effect of β-glucans as feed additive on the profile of C-reactive protein (CRP) and complement acute phase responses was studied in common carp Cyprinus carpio after exposition to a bacterial infection with Aeromonas salmonicida. Carp were orally administered with β-glucan (MacroGard®) for 14 days with a daily β-glucan intake of 6 mg per kg body weight. Fish were then intraperitoneally injected with either PBS or 1 × 10⁸ bacteria per fish and sampled at time 0, 6, 12, 24, 48, 72, 96 and 120 h post-injection (p.i.) for serum and head kidney, liver and mid-gut tissues. CRP levels and complement activity were determined in the serum samples whilst the gene expression profiles of CRP and complement related genes (crp1, crp2, c1r/s, bf/c2, c3 and masp2) were analysed in the tissues by quantitative PCR. Results obtained showed that oral administration of β-glucan for 14 days significantly increased serum CRP levels up to 2 fold and serum alternative complement activity (ACP) up to 35 fold. The bacterial infection on its own (i.e. not combined with a β-glucan feeding) did have significant effects on complement response whilst CRP was not detectably induced during the carp acute phase reaction. However, the combination of the infection and the β-glucan feeding did show significant effects on both CRP and complement profiles with higher serum CRP levels and serum ACP activity in the β-glucan fed fish than in the control fed fish. In addition, a distinct organ and time dependent expression profile pattern was detected for all the selected genes: a peak of gene expression first occurred in the head kidney tissue (6 h p.i. or 12 h p.i.), then an up-regulation in the liver several hours later (24 h p.i.) and finally up- or down-regulations in the mid-gut at 24 h p.i. and 72 h p.i. In conclusion, the results of this study suggest that MacroGard® stimulated CRP and complement responses to A. salmonicida infection in common carp. Copyright © 2013 Elsevier Ltd. All
Directory of Open Access Journals (Sweden)
Patricia de Souza Bonfim-Mendonça
Full Text Available Vulvovaginal candidiasis (VVC is among the most prevalent vaginal diseases. Candida albicans is still the most prevalent species associated with this pathology, however, the prevalence of other Candida species, such as C. glabrata, is increasing. The pathogenesis of these infections has been intensely studied, nevertheless, no consensus has been reached on the pathogenicity of VVC. In addition, inappropriate treatment or the presence of resistant strains can lead to RVVC (vulvovaginal candidiasis recurrent. Immunomodulation therapy studies have become increasingly promising, including with the β-glucans. Thus, in the present study, we evaluated microbicidal activity, phagocytosis, intracellular oxidant species production, oxygen consumption, myeloperoxidase (MPO activity, and the release of tumor necrosis factor α (TNF-α, interleukin-8 (IL-8, IL-1β, and IL-1Ra in neutrophils previously treated or not with β-glucan. In all of the assays, human neutrophils were challenged with C. albicans and C. glabrata isolated from vulvovaginal candidiasis. β-glucan significantly increased oxidant species production, suggesting that β-glucan may be an efficient immunomodulator that triggers an increase in the microbicidal response of neutrophils for both of the species isolated from vulvovaginal candidiasis. The effects of β-glucan appeared to be mainly related to the activation of reactive oxygen species and modulation of cytokine release.
Directory of Open Access Journals (Sweden)
Vidyasagar Devaprasad Dedeepiya
2012-01-01
Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.
Su, Kang-Cheng; Chou, Kun-Ta; Hsiao, Yi-Han; Tseng, Ching-Min; Su, Vincent Yi-Fong; Lee, Yu-Chin; Perng, Diahn-Warng; Kou, Yu Ru
2017-04-08
While Candida pneumonia is life-threatening, biomarker measurements to early detect suspected Candida pneumonia are lacking. This study compared the diagnostic values of measuring levels of (1, 3)-β-D-glucan in endotracheal aspirate, bronchoalveolar lavage fluid, and serum to detect suspected Candida pneumonia in immunocompromised and critically ill patients. This prospective, observational study enrolled immunocompromised, critically ill, and ventilated patients with suspected fungal pneumonia in mixed intensive care units from November 2010 to October 2011. Patients with D-glucan confounding factors or other fungal infection were excluded. Endotracheal aspirate, bronchoalveolar lavage fluid and serum were collected from each patient to perform a fungal smear, culture, and D-glucan assay. After screening 166 patients, 31 patients completed the study and were categorized into non-Candida pneumonia/non-candidemia (n = 18), suspected Candida pneumonia (n = 9), and non-Candida pneumonia/candidemia groups (n = 4). D-glucan levels in endotracheal aspirate or bronchoalveolar lavage were highest in suspected Candida pneumonia, while the serum D-glucan level was highest in non-Candida pneumonia/candidemia. In all patients, the D-glucan value in endotracheal aspirate was positively correlated with that in bronchoalveolar lavage fluid. For the detection of suspected Candida pneumonia, the predictive performance (sensitivity/specificity/D-glucan cutoff [pg/ml]) of D-glucan in endotracheal aspirate and bronchoalveolar lavage fluid was 67%/82%/120 and 89%/86%/130, respectively, accounting for areas under the receiver operating characteristic curve of 0.833 and 0.939 (both P pneumonia in the absence of concurrent candidemia. D-glucan levels in both endotracheal aspirate and bronchoalveolar lavage, but not in serum, provide good diagnostic values to detect suspected Candida pneumonia and to serve as potential biomarkers for early detection in this patient population.
Synthesis of cell wall xylans and glucans by golgi membranes
International Nuclear Information System (INIS)
Gibeaut, D.M.; Carpita, N.C.
1989-01-01
We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus
β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.
Directory of Open Access Journals (Sweden)
Sonja de Vries
Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.
Directory of Open Access Journals (Sweden)
Zenia Pardo Ruiz
2012-03-01
Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis
Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder
2017-07-18
Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.
Importance of Lipopolysaccharide and Cyclic β-1,2-Glucans in Brucella-Mammalian Infections
Directory of Open Access Journals (Sweden)
Andreas F. Haag
2010-01-01
Full Text Available Brucella species are the causative agents of one of the most prevalent zoonotic diseases: brucellosis. Infections by Brucella species cause major economic losses in agriculture, leading to abortions in infected animals and resulting in a severe, although rarely lethal, debilitating disease in humans. Brucella species persist as intracellular pathogens that manage to effectively evade recognition by the host's immune system. Sugar-modified components in the Brucella cell envelope play an important role in their host interaction. Brucella lipopolysaccharide (LPS, unlike Escherichia coli LPS, does not trigger the host's innate immune system. Brucella produces cyclic β-1,2-glucans, which are important for targeting them to their replicative niche in the endoplasmic reticulum within the host cell. This paper will focus on the role of LPS and cyclic β-1,2-glucans in Brucella-mammalian infections and discuss the use of mutants, within the biosynthesis pathway of these cell envelope structures, in vaccine development.
Altered DNA methylation: a secondary mechanism involved in carcinogenesis.
Goodman, Jay I; Watson, Rebecca E
2002-01-01
This review focuses on the role that DNA methylation plays in the regulation of normal and aberrant gene expression and on how, in a hypothesis-driven fashion, altered DNA methylation may be viewed as a secondary mechanism involved in carcinogenesis. Research aimed at discerning the mechanisms by which chemicals can transform normal cells into frank carcinomas has both theoretical and practical implications. Through an increased understanding of the mechanisms by which chemicals affect the carcinogenic process, we learn more about basic biology while, at the same time, providing the type of information required to make more rational safety assessment decisions concerning their actual potential to cause cancer under particular conditions of exposure. One key question is: does the mechanism of action of the chemical in question involve a secondary mechanism and, if so, what dose may be below its threshold?
Role of anionic charges of periplasmic glucans of Shigella flexneri in overcoming detergent stress
Osmoregulated periplasmic glucans (OPGs) are synthesized by the members of the family Enterobacteriaceae when grown under low osmotic growth conditions. Enteropathogens such as Shigella flexneri spend considerable time outside the host environment such as irrigation waters where low nutrient low os...
Boulos, Samy; Nyström, Laura
2017-11-01
The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO
Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do
2017-02-01
Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.
Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong
2011-08-15
Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.
Synthesis and evaluation of di- and trimeric hydroxylamine-based β-(1→3)-glucan mimetics.
Ferry, Angélique; Malik, Gaëlle; Guinchard, Xavier; Vĕtvička, Václav; Crich, David
2014-10-22
Di- and trimeric hydroxylamine-based mimetics of β-(1→3)-glucans have been accessed by an asymmetric synthesis route featuring an iterative double ring-closing reductive amination reaction. These oligomeric hydroxylamines are demonstrated to inhibit the staining of human neutrophils and of mouse macrophages by fluorescent anti-CR3 and anti-dectin-1 antibodies, respectively, and to stimulate phagocytosis, all in a linkage-dependent manner suggestive of binding to the lectin domains of complement receptor 3 (CR3) and dectin-1. The ability of these relatively short mimetics to bind to CR3 and dectin-1, as compared to the greater degree of polymerization required in β-(1→3)-glucans, is discussed in terms of the increased hydrophobicity of the α-face on replacement of the glycosidic bond by the hydroxylamine linkage.
B-Glucan exacerbates allergic asthma independent of fungal ...
BackgroundAllergic sensitization to fungi has been associated with asthma severity. As a result, it has been largely assumed that the contribution of fungi to allergic disease is mediated through their potent antigenicity.ObjectiveWe sought to determine the mechanism by which fungi affect asthma development and severity.MethodsWe integrated epidemiologic and experimental asthma models to explore the effect of fungal exposure on asthma development and severity.ResultsWe report that fungal exposure enhances allergen-driven TH2 responses, promoting severe allergic asthma. This effect is independent of fungal sensitization and can be reconstituted with β-glucan and abrogated by neutralization of IL-17A. Furthermore, this severe asthma is resistant to steroids and characterized by mixed TH2 and TH17 responses, including IL-13+IL-17+CD4+ double-producing effector T cells. Steroid resistance is dependent on fungus-induced TH17 responses because steroid sensitivity was restored in IL-17rc−/− mice. Similarly, in children with asthma, fungal exposure was associated with increased serum IL-17A levels and asthma severity.ConclusionOur data demonstrate that fungi are potent immunomodulators and have powerful effects on asthma independent of their potential to act as antigens. Furthermore, our results provide a strong rationale for combination treatment strategies targeting IL-17A for this subgroup of fungus-exposed patients with difficult-to-treat asthma. To describe th
DEFF Research Database (Denmark)
D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene
2008-01-01
cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...
Directory of Open Access Journals (Sweden)
Natcha Phantuwong
2017-12-01
Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9
Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa
2012-04-13
Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen (Platelia Aspergillus), nested PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp. The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders.
Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.
1979-01-01
A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of
Directory of Open Access Journals (Sweden)
Rodrigo Juliano Oliveira
2014-01-01
Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.
de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello
2017-12-20
A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5 Da with a random coil conformation for molecular weights below 1 × 10 6 Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.
β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake
Directory of Open Access Journals (Sweden)
Asli Akyol
2014-09-01
Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.
β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.
Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju
2014-09-23
The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.
Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan
Directory of Open Access Journals (Sweden)
Eduardo Madrigal-Bujaidar
2015-06-01
Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.
Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.
Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong
2014-03-19
A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.
Czech Academy of Sciences Publication Activity Database
Abdel-Mohsen, A. M.; Jancar, J.; Massoud, D.; Fohlerová, Z.; Elhadidy, Hassan; Spotz, Z.; Hebeish, A.
2016-01-01
Roč. 510, č. 1 (2016), s. 86-99 ISSN 0378-5173 R&D Projects: GA MŠk(CZ) LQ1601 Institutional support: RVO:68081723 Keywords : Chitin/chitosan-glucan complex * Nonwoven mat * Surgical wound healing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.649, year: 2016
We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...
Donadei, Agnese; Gallorini, Simona; Berti, Francesco; O'Hagan, Derek T; Adamo, Roberto; Baudner, Barbara C
2015-05-04
The potential benefits of skin delivery of vaccines derive from the presence of a densely connected network of antigen presenting cells in the skin layer, most significantly represented by Langerhans cells and dermal dendritic cells. Targeting these cells by adjuvant conjugated to an antigen should result in enhanced immunogenicity of a vaccine. Since one of the most widely used adjuvants is an insoluble salt of aluminum (aluminum hydroxide) that cannot be used for skin delivery due to reactogenicity, we focused our attention on agonists of receptors present on skin dendritic cells, including the Dectin-1 receptor. β-(1-3)-glucans, which are the most abundant components of the fungal surface, are known to activate the innate immune response by interaction with the C-type lectin-like Dectin-1 receptor. In this work we identified by rational design a well-defined synthetic β-(1-3)-glucan hexasaccharide as a Dectin-1 agonist and chemically conjugated it to the genetically detoxified diphtheria toxin (CRM197) protein antigen, as a means to increase the binding to Dectin-1 receptor and to target to skin dendritic cells. We demonstrated that the in vitro activation of the receptor was significantly impacted by the presentation of the glucan on the protein carrier. In vivo results in mice showed that the conjugation of the synthetic β-(1-3)-glucan when delivered intradermally resulted in higher antibody titers in comparison to intramuscular (i.m.) immunization and was not different from subcutaneous (s.c.) delivery. These findings suggest that weak receptor binders can be turned into more potent agonists by the multivalent presentation of many ligands covalently conjugated to the protein core. Moreover, this approach is particularly valuable to increase the immunogenicity of antigens administered via skin delivery.
Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I
2011-01-01
The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.
Directory of Open Access Journals (Sweden)
Fhernanda R Smiderle
Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.
Directory of Open Access Journals (Sweden)
Yoshihiko Ojiri
2015-04-01
Full Text Available Background: Fatigue is attributable to physical and psychological stress. Fatigue is also a common symptom which occurs in both sick and healthy individuals. Although its mechanism of cause is complex, fatigue from stress is known to affect the existing equilibrium of the immune system. However, nutrition, such as beta-1,3/1,6 glucan, has been reported to play an important role in regulating stress and fatigue states, via modulating a weakened immune system. In this study, a popular and healthy beverage in Okinawa, Japan, containing a soluble baker’s yeast in black koji vinegar (Moromisu, was provided to healthy subjects with a non-strenuous daily lifestyle. Results: By performing statistical analysis on the results of the Profile of Mood States (POMS survey, we observed that overall study results (n=14 demonstrated significant differences in fatigue and confusion in the POMS factors. Conclusions: In this study we confirmed that beta-1,3/1,6 glucan improved some of the factors related to stress and fatigue, as indicated by evaluation of POMS survey results.
Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul
2014-03-01
The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.
Incorporation of UDPglucose into cell wall glucans and lipids by intact cotton fibers
International Nuclear Information System (INIS)
Dugger, W.M.; Palmer, R.L.
1986-01-01
The [ 14 C] moiety from [ 3 H]UDP[ 14 C]glucose was incorporated by intact cotton fibers into hot water soluble, acetic-nitric reagent soluble and insoluble components, and chloroform-methanol soluble lipids; the [ 3 H]UDP moiety was not incorporated. The 3 H-label can be exchanged rapidly with unlabeled substrate in a chase experiment. The cell wall apparent free space of cotton fibers was in the order of 30 picomoles per milligram of dry fibers; 25 picomoles per milligram easily exchanged and about 5 picomoles per milligram more tightly adsorbed. At 50 micromolar UDPglucose, 70% of the [ 14 C]glucose was found in the lipid fraction after both a short labeling period and chase. The percent of [ 14 C]glucose incorporated into total glucan increased within a 30-minute chase period. The data supports the concept that glucan synthesis, including cellulose, as well as the synthesis of steryl glucosides, acetylated steryl glucosides, and glucosyl-phosphoryl-polyprenol from externally supplied UDPglucose occurs at the plasma membrane-cell wall interface. The synthase enzymes for such synthesis must be part of this interfacial membrane system
The mechanisms involved at the cell level
International Nuclear Information System (INIS)
Leblanc, G.; Pourcher, Th.; Perron, B.; Guillain, F.; Quemeneur, E.; Fritsch, P.
2003-01-01
The mechanisms responsible at the cell level for inducing toxic reactions after contamination are as yet only imperfectly known. Work still needs to be done for both contaminants that have a biological role, such as iodine, and those that do not, such as cadmium, uranium and plutonium. In particular, these mechanisms bring into play, in biological membranes, carriers which are the physiological partners responsible for material exchange with the environment or inside the body. As they lack absolute selectivity, these carriers, which are involved in the assimilation and accumulation of vital mineral elements, also have the ability to transport toxic elements and isotopes. (authors)
Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert
2016-01-01
α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088 and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were
Raikos, Vassilios; Grant, Shannon B; Hayes, Helen; Ranawana, Viren
2018-04-25
Powdered β-glucan extracted from brewer's yeast (Yestimun, Leiber GmbH, Bramsche, Germany) was incorporated into skimmed-milk yogurt at varying concentrations (0.2-0.8% wt/wt) to investigate its potential application as a thickener. The effect of β-glucan fortification on the nutritional profile, microstructure, physicochemical properties, and texture of freshly prepared yogurts was investigated. Sensory evaluation was also conducted and was correlated with instrumental analysis. The addition of Yestimun significantly reduced the fermentation time of the yogurt mix from 4 h to 3 h. Scanning electron microscopy revealed that β-glucan particles formed small spherical clusters within the yogurt matrix. The majority of the physicochemical properties (syneresis, viscosity, color, and titratable acidity) remained unaffected by the incorporation of Yestimun in the recipe. Textural properties showed a gradual increment with increasing β-glucan concentration. Hardness, total work done, adhesive force, and adhesiveness increased by 19.27, 23.3, 21.53, and 20.76%, respectively, when using the highest amount of Yestimun powder. Sensory analysis (n = 40) indicated that fortifying yogurt with Yestimun at 0.8% (wt/wt) concentration may affect overall acceptance ratings, which was attributed to adverse flavor and aftertaste effects. However, the overall liking score of the yogurt (5.0/9.0) shows potential for commercialization of the product. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello
2017-01-01
A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle
Directory of Open Access Journals (Sweden)
Hiroyuki Kono
2017-12-01
Full Text Available This article contains two-dimensional (2D NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG and a water-soluble β-(1â3, 1â6-glucan from Aureobasidium pullulans. Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers, entitled âNMR spectroscopic structural characterization of a water-soluble β-(1â3, 1â6-glucan from A. pullulansâ (Kono et al., 2017 [1]. Data can help to assign the 1H and 13C chemical shifts of the structurally complex polysaccharides. Keywords: NMR, β-(1â3, 1â6-glucan, Aureobasidium pullulans, Schizophyllan, Spectral data
Effects of β-Glucans and resistant starch on fermentation of recalcitrant fibers in growing pigs
Vries, de S.; Gerrits, W.J.J.; Kabel, M.A.; Zijlstra, Ruurd; Vasanthan, Thava
2017-01-01
Effects of the presence of β-glucans and resistant starch in diets on nutrient and fiber degradability of rapeseed meal [RSM] (Brassica napus) and Distillers Dried Grain with Solubles (DDGS) were tested in a 2 × 3 factorial arrangement. Two basal diets, containing either 500 g/kg RSM or DDGS and
Mechanisms involved in the transport of mercuric ions in target tissues
Bridges, Christy C.; Zalups, Rudolfs K.
2016-01-01
Mercury exists in the environment in various forms, all of which pose a risk to human health. Despite guidelines regulating the industrial release of mercury into the environment, humans continue to be exposed regularly to various forms of this metal via inhalation or ingestion. Following exposure, mercuric ions are taken up by and accumulate in numerous organs, including brain, intestine, kidney, liver, and placenta. In order to understand the toxicological effects of exposure to mercury, a thorough understanding of the mechanisms that facilitate entry of mercuric ions into target cells must first be obtained. A number of mechanisms for the transport of mercuric ions into target cells and organs have been proposed in recent years. However, the ability of these mechanisms to transport mercuric ions and the regulatory features of these carriers have not been characterized completely. The purpose of this review is to summarize the current findings related to the mechanisms that may be involved in the transport of inorganic and organic forms of mercury in target tissues and organs. This review will describe mechanisms known to be involved in the transport of mercury and will also propose additional mechanisms that may potentially be involved in the transport of mercuric ions into target cells. PMID:27422290
Chang, Jie; Zhang, Wenbing; Mai, Kangsen; Ma, Hongming; Xu, Wei
2010-12-01
Sea cucumbers, Apostichopus japonicus Selenka, were fed diets containing non-immunostimulant (basal diet), 0.2% β-glucan and 0.02% glycyrrhizin in a recirculatory water system for 45 days, and subsequently challenged with Vibrio splendidus by injection at 1.0×108 cfu / sea cucumber for 15 days. Phagocytic capacity (PC), intracellular superoxide anion production (ISAP), lysozyme (LSZ) activity and superoxide dismutase (SOD) activity in the coelomic fluid were analyzed on the 0th, 5th, 10th and 15th days after injection. Results showed that after the 45-day feeding period, PC, ISAP, LSZ activity and SOD activity in sea cucumbers fed with dietary β-glucan or glycyrrhizin were significantly higher than in those fed with the basal diet. On the 5th day after infection, all the immune parameters examined in the sea cucumbers injected with V. splendidus decreased in value significantly. On the 15th day, PC, ISAP and LSZ activity returned to levels similar to those on the 0th day. For the sea cucumbers injected with saline, there were no significant differences in all the immune parameters examined and in the cumulative morbidity during the 15-day challenging trial. After injecting with V. splendidus, the cumulative morbidity of sea cucumbers fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin when challenged with V. splendidus challenged sea cucumber fed with the basal diet was significantly higher than those fed with dietary β-glucan or glycyrrhizin. There was no significant difference in cumulative morbidity between the dietary β-glucan and glycyrrhizin treatments over time.
Directory of Open Access Journals (Sweden)
Anna Kozajda
2013-12-01
Full Text Available Objectives: The study was aimed at assessment of exposure to endotoxins, (1→3-β-D-glucans and mite, cockroach, cat, dog allergens present in settled dust in premises of children as agents which may be significantly correlated with the occurrence of allergic symptoms and diseases in children. Materials and Methods: The study covered 50 homes of one- or two-year-old children in Poland. Samples of settled dust were taken from the floor and the child's bed. The levels of (1→3-β-D-glucans (floor, endotoxins (floor and allergens of mite, cat, dog and cockroach (floor and bed were analyzed. Results: Average geometric concentrations (geometric standard deviation of endotoxins, (1→3-β-D-glucans, Der p1, Fel d1, Can f1 and Bla g1 in children homes were on the floor 42 166.0 EU/g (3.2, 20 478.4 ng/g (2.38, 93.9 ng/g (6.58, 119.8 ng/g (13.0, 288.9 ng/g (3.4, 0.72 U/g (4.4 and in their beds (only allergens 597.8 ng/g (14.2, 54.1 ng/g (4.4, 158.6 ng/g (3.1 0.6 U/g (2.9, respectively. When the floor was covered with the carpet, higher concentrations of endotoxins, (1→3-β-D-glucans and allergens (each type were found in the settled dust (p < 0.05. The trend was opposite in case of allergens (except dog analyzed from bed dust and significantly higher concentrations were found in the rooms with smooth floor (p < 0.05. Conclusions: Among the analyzed factors only the type of floor significantly modified both the level of biological indicators and allergens. The results of this study could be the base for verifying a hypothesis that carpeting may have a protective role against high levels of cockroach, dog and cat allergens.
International Nuclear Information System (INIS)
Le Quang Luan; Nguyen Huynh Phuong Uyen; Nguyen Thanh Vu; Nguyen Quoc Hien; Dang Van Phu; Vo Thi Thu Ha; To Van Loi; Le Dinh Don; Truong Phuoc Thien Hoang; Do Thi Phuong Linh
2015-01-01
The process for production of insoluble β-glucan product from brewer’s yeast cell wall collected from the discard waste of beer production was successfully established. Radiation was improved as a useful tool for preparation of low Mw β-glucan. The water soluble oligo-β-glucans with Mw ~ 18 - 25 kDa were found to have novel features for application as plant growth promoter, growth and immune stimulator additive for animals and functional food for prevention and therapy of diabetic, dyslipidemia, cancer, etc. The processes for large scale production of oligo-β-glucan as plant growth promoter. chicken additive and functional food by gamma Co-60 irradiation method have been set up for application. In addition, gold nanoparticles (AuNPs) with size of 10 - 50 nm stabilized in sericin and water soluble chitosan and silver nanoparticles (AgNPs) with size of 5-20 nm stabilized PVA, PVP, sericin and alginate were also successfully synthesized by gamma Co-60 irradiation method. While AuNPs product was found to be not toxic and can be used for bio-medicine and cosmetics, AgNPs exhibited highly antimicrobial activity for potentially use as new and safety antimicrobial agent. The processes for large scale production of AuNPs, AgNPs, cream/AgNPs and hand-wash solution/AgNPs products were also successfully developed within this project. (author)
Adhikari, Atin; Jung, Jaehee; Reponen, Tiina; Lewis, Jocelyn Suzanne; DeGrasse, Enjoli C.; Grimsley, L. Faye; Chew, Ginger L.; Grinshpun, Sergey A.
2015-01-01
Standing water and sediments remaining on flood-affected materials were the breeding ground for many microorganisms in flooded homes following Hurricane Katrina. The purpose of this laboratory study was to examine the aerosolization of culturable and total fungi, (1→3)-β-D glucan, and endotoxin from eight flood-affected floor and bedding materials collected in New Orleans homes, following Hurricane Katrina. Aerosolization was examined using the Fungal Spore Source Strength Tester (FSSST) connected to a BioSampler. Dust samples were collected by vacuuming. A two-stage cyclone sampler was used for size-selective analysis of aerosolized glucan and endotoxin. On average, levels of culturable fungi ranged from undetectable (lower limit = 8.3×104) to 2.6×105 CFU/m2; total fungi ranged from 2.07×105 to 1.6×106 spores/m2; (1→3)-β-D glucan and endotoxin were 2.0×103 – 2.9×104 ng/m2 and 7.0×102 – 9.3×104 EU/m2, respectively. The results showed that 5–15 min sampling is sufficient for detecting aerosolizable biocontaminants with the FSSST. Smaller particle size fractions (1.8 μm) fractions, which raises additional exposure concerns. Vacuuming was found to overestimate inhalation exposure risks by a factor of approximately 102 for (1→3)-β-D glucan and by 103 to 104 for endotoxin as detected by the FSSST. The information generated from this study is important with respect to restoration and rejuvenation of the flood-affected areas in New Orleans. We believe the findings will be significant during similar disasters in other regions of the world including major coastal floods from tsunamis. PMID:19201399
International Nuclear Information System (INIS)
Roeber, B.; Reuter, G.
1982-01-01
Mannose-6-P is an activator of 14 C-mannose incorporation from GDP- 14 C-mannose in mono- and oligosaccharides and in mannopolymers of the cell wall proteophosphomannan produced by the food protein yeast Candida spec. H. Moreover, mannose-6-P is a precursor of proteophosphomannan: 14 C-mannose-6-P has been incorporated in absence of GTP. Corresponding behavior shows glucose-6-P by synthesis of β-glucan and glycogen. Mutants of Candida spec. H with different efficiency in the biosynthesis of mannan, β-glucan and glycogen incorporate hexose-6-P in a different extent. (author)
Yucel Falco, Cigdem; Sotres, Javier; Rascón, Ana; Risbo, Jens; Cárdenas, Marité
2017-02-01
Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured by changes in the bacterial suspension zeta potential. Viability of coated cells was shown using plate counting method. The coatings on solid surfaces were examined after exposure to mimics of gastrointestinal fluids and a commercially available β-glucanase. Successful build-up of multilayers was confirmed with QCM-D and SE. Zeta potential values proved the coating of cells. There was 2 log CFU/mL decrease after coating cells with four alternating layers of chitosan and sulfated β-glucan when compared to viability of uncoated cells. The coatings were partially degraded after exposure to simulated intestinal fluid and restructured as a result of β-glucanase treatment, mimicking enzymes present in the microflora of the human gut, but seemed to resist acidic gastric conditions. Therefore, coatings of chitosan and sulfated β-glucan can potentially be exploited as carriers for probiotics and delicate nutraceuticals. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alexandre H. Fujita
2003-08-01
Full Text Available Foi utilizado o método enzimático recomendado pela AOAC para determinação de beta-glucanas em cereais e alimentos que os contém. O método, utiliza liquenase (EC 3.2.1.73 e beta-glucosidase (EC 3.2.1.21 para hidrólise debeta-glucanas, é rápido, fácil de executar e específico para beta-glucanas com ligações beta(1->3 e beta(1->4. As sementes analisadas foram subministradas pelo Instituto Agronômico de Campinas (IAC e os alimentos adquiridos nos supermercados. Aveia e cevada são os grãos com maior conteúdo de beta-glucanas. Na aveia os teores determinados foram 6,48 e 5,94%. Nos 10 cultivares de cevada os teores de beta-glucanas oscilaram entre 2,04 e 9,68%. Trigo e triticale apresentaram teores de b-glucanas menores que 1%. Nos produtos comerciais o teor de beta-glucanas estava relacionado ao tipo de cereal da fórmula. O produto comercial de maior conteúdo de beta-glucanas é o farelo de aveia. As beta-glucanas são ingredientes funcionais em potencial e a conveniência ou não de estimular sua incorporação em alimentos deve ser mais estudada. Quanto à composição centesimal dos grãos de cereais, o teor de proteínas foi o que apresentou a maior variação e isso se reflete na composição dos produtos comerciais.The method employed was the enzymatic one recommended by de AOAC for the determination of beta-glucans in cereals and in foodstuffs containing cereals in their formulation. The method, using lichenase (EC 3.2.1.73 and beta-glucosidase (EC 3.2.1.21 for the hydrolysis of beta-glucans, is quick and easy to execute, but is specific for beta-glucans with beta(1->3 and beta(1->4 bonds. The Agronomic Institute of Campinas (IAC supplied the seeds analyzed, and the foodstuffs were acquired in supermarkets. Oat and barley are the grains with the highest content of beta-glucans. In the oats, the determined values were 6.48 and 5.94%. In the 10 cultivars of barley, the content of beta-glucans varied between 2.04 and 9
DEFF Research Database (Denmark)
Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.
2013-01-01
Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...
Miest, Joanna J; Arndt, Carmen; Adamek, Mikolaj; Steinhagen, Dieter; Reusch, Thorsten B H
2016-01-01
Reflecting the natural biology of mass spawning fish aquaculture production of fish larvae is often hampered by high and unpredictable mortality rates. The present study aimed to enhance larval performance and immunity via the oral administration of an immunomodulator, β-glucan (MacroGard(®)) in turbot (Scophthalmus maximus). Rotifers (Brachionus plicatilis) were incubated with or without yeast β-1,3/1,6-glucan in form of MacroGard(®) at a concentration of 0.5 g/L. Rotifers were fed to first feeding turbot larvae once a day. From day 13 dph onwards all tanks were additionally fed untreated Artemia sp. nauplii (1 nauplius ml/L). Daily mortality was monitored and larvae were sampled at 11 and 24 dph for expression of 30 genes, microbiota analysis, trypsin activity and size measurements. Along with the feeding of β-glucan daily mortality was significantly reduced by ca. 15% and an alteration of the larval microbiota was observed. At 11 dph gene expression of trypsin and chymotrypsin was elevated in the MacroGard(®) fed fish, which resulted in heightened tryptic enzyme activity. No effect on genes encoding antioxidative proteins was observed, whilst the immune response was clearly modulated by β-glucan. At 11 dph complement component c3 was elevated whilst cytokines, antimicrobial peptides, toll like receptor 3 and heat shock protein 70 were not affected. At the later time point (24 dph) an anti-inflammatory effect in form of a down-regulation of hsp 70, tnf-α and il-1β was observed. We conclude that the administration of MacroGard(®) induced an immunomodulatory response and could be used as an effective measure to increase survival in rearing of turbot. Copyright © 2015 Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.
2009-01-01
Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009
DEFF Research Database (Denmark)
Fakih, Dalia; Pilecki, Bartosz; Schlosser, Anders
2015-01-01
SP-D is a pulmonary collectin important in lung immunity. SP-D-deficient mice (Sftpd(-/-)) are reported to be susceptible to ovalbumin (OVA)- and fungal allergen-induced pulmonary inflammation, while treatment with exogenous SP-D has therapeutic effects in such disease models. β-glucans are a div...
Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon
2014-11-01
The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.
Tessari, Paolo; Lante, Anna
2017-03-17
Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.
Tessari, Paolo; Lante, Anna
2017-01-01
Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350
Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J
2014-09-01
The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.
Ho, Hoang V T; Sievenpiper, John L; Zurbau, Andreea; Blanco Mejia, Sonia; Jovanovski, Elena; Au-Yeung, Fei; Jenkins, Alexandra L; Vuksan, Vladimir
2016-10-01
Oats are a rich source of β-glucan, a viscous, soluble fibre recognised for its cholesterol-lowering properties, and are associated with reduced risk of CVD. Our objective was to conduct a systematic review and meta-analysis of randomised-controlled trials (RCT) investigating the cholesterol-lowering potential of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for the risk reduction of CVD. MEDLINE, Embase, CINAHL and Cochrane CENTRAL were searched. We included RCT of ≥3 weeks of follow-up, assessing the effect of diets enriched with oat β-glucan compared with controlled diets on LDL-cholesterol, non-HDL-cholesterol or apoB. Two independent reviewers extracted data and assessed study quality and risk of bias. Data were pooled using the generic inverse-variance method with random effects models and expressed as mean differences with 95 % CI. Heterogeneity was assessed by the Cochran's Q statistic and quantified by the I 2-statistic. In total, fifty-eight trials (n 3974) were included. A median dose of 3·5 g/d of oat β-glucan significantly lowered LDL-cholesterol (-0·19; 95 % CI -0·23, -0·14 mmol/l, Pcholesterol (-0·20; 95 % CI -0·26, -0·15 mmol/l, PLDL-cholesterol (I 2=79 %) and non-HDL-cholesterol (I 2=99 %). Pooled analyses showed that oat β-glucan has a lowering effect on LDL-cholesterol, non-HDL-cholesterol and apoB. Inclusion of oat-containing foods may be a strategy for achieving targets in CVD reduction.
Directory of Open Access Journals (Sweden)
Bárbara E. García Triana
2008-12-01
Full Text Available La caries dental es una de las enfermedades más frecuentes en el ser humano. En su etiología multifactorial, desempeñan un papel importante determinadas bacterias cariogénicas, que en interacción con la superficie del diente promueven su desmineralización. Dentro de los mecanismos mediadores de la adhesión bacteriana, se encuentra la producción de polisacáridos extracelulares bacterianos. En particular los glucanos sintetizados por las glucosiltransferasas, no solo permiten la adherencia, sino que también constituyen una fuente nutricional para las bacterias, por lo tanto, la actividad de dichas enzimas se considera un factor de virulencia bacteriana en la caries dental. Esta revisión bibliográfica tiene el objetivo de esclarecer los aspectos relacionados con la estructura, biosíntesis y función de los glucanos, y enfatizar en la aplicación de estos conocimientos en la prevención de la caries dental.Dental caries is one of the most common diseases in the human being. Certain cariogenic bacteria play an important role in its multifactorial etiology, since in their interaction with the dental surface they promote its demineralization. The production of extracellular bacterial polyssacharides is among the mechanisms mediating bacterial adhesion. The glucans synthesized by glycosyltransferases not only allow the adherence, but they also are a nutritional source for bacteria and that's why the activity of such enzymes is considered a factor of bacterial virulence in dental caries. This bibliographic review is aimed at making clear the aspects related to the structure, biosynthesis and function of glucans and at giving emphasis to the application of this knowledge in the prevention of dental caries.
Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.
For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular
Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan
Directory of Open Access Journals (Sweden)
Adrian Wiater
2016-09-01
Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.
Li, Xiaojing; Ji, Na; Li, Man; Zhang, Shuangling; Xiong, Liu; Sun, Qingjie
2017-09-13
Starch nanoparticles were potential texture modifiers. However, they have strong tendency to aggregate and poor water dispersibility, which limited their application. The interaction between glucan (prepared from starch by enzymatic modification) and protein could significantly improve the dispersity of starch nanoparticles and, thus, enhance the rheological properties of food gels. In this work, glucan/protein hybrid nanoparticles were successfully developed for the first time using short linear glucan (SLG) and edible proteins [soy protein isolate (SPI), rice protein (RP), and whey protein isolate (WPI)]. The results showed that the SLG/SPI hybrid nanoparticles exhibited hollow structures, of which the smallest size was approximately 10-20 nm when the SLG/SPI ratio was 10:5. In contrast, SLG/RP nanoparticles displayed flower-like superstructures, and SLG/WPI nanoparticles presented stacked lamellar nanostructures with a width of 5-10 nm and a length of 50-70 nm. In comparison to bare SLG nanoparticles, SLG/SPI and SLG/WPI hybrid nanoparticles had higher melting temperatures. The addition of all nanoparticles greatly increased the storage modulus of corn starch gels and decreased loss tangent values. Importantly, the G' value of starch gels increased by 567% with the addition of flower-like SLG/RP superstructures.
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Jiménez, Natalia Ivonne Vera
2013-01-01
of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1b, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1b, IL-6 family member M17 and IL-8 were...
Choi, Jae Min; Jeong, Daham; Piao, Jinglan; Kim, Kyoungtea; Nguyen, Andrew Bao Loc; Kwon, Nak-Jung; Lee, Mi-Kyung; Lee, Im Soon; Yu, Jae-Hyuk; Jung, Seunho
2015-01-12
The removal of polycyclic aromatic hydrocarbons by soil washing using water is extremely difficult due to their intrinsic hydrophobic nature. In this study, the effective aqueous solubility enhancements of seven polycyclic aromatic hydrocarbons by chemically modified hydroxypropyl rhizobial cyclic β-(1 → 2)-D-glucans and epichlorohydrin β-cyclodextrin dimer have been investigated for the first time. In the presence of hydroxypropyl cyclic β-(1 → 2)-D-glucans, the solubility of benzo[a]pyrene is increased up to 38 fold of its native solubility. The solubility of pyrene and phenanthrene dramatically increased up to 160 and 359. Coronene, chrysene, perylene, and fluoranthene also show an increase of 11, 23, 23, and 97 fold, respectively, of enhanced solubility by complexation with synthetic epichlorohydrin β-cyclodextrin dimer. The physicochemical properties of the complex are characterized by Fourier-transform infrared spectra and differential scanning calorimetry. Utilizing a scanning electron microscopy, the morphological structures of native benzo[a]pyrene, pyrene, phenanthrene, coronene, chrysene, perylene, fluoranthene and their complex with novel carbohydrate-solubilizers are studied. These results elucidate that polycyclic aromatic hydrocarbons are able to form an efficient complex with hydroxypropyl cyclic β-(1 → 2)-D-glucans and β-cyclodextrin dimer, suggesting the potential usage of chemically modified novel carbohydrate-solubilizers. Copyright © 2014 Elsevier Ltd. All rights reserved.
First principles insight into the α-glucan structures of starch
DEFF Research Database (Denmark)
Damager, Iben; Engelsen, Søren Balling; Blennow, Andreas
2010-01-01
A study was conducted to demonstrate the synthesis, conformation, and hydration of the α-glucan structures of starch. Starch and glycogen were synthesized by sets of specific enzyme activities that directly determined their molecular structures and physical properties. It was demonstrated...... that the extent of crystallinity, aggregation and hydration was of fundamental importance for starch and its human analogue glycogen. Starch was deposited in the plant as a stable form in highly organized and semicrystalline granules having specific crystalline polymorphs as determined by powder X......-ray crystallography. The investigations mainly focused on the bottom-up approach of synthesis, conformation, and hydration of starch. Starch and glycogen were found to be polymers that were built up from a single monomer, D-glucopyranose, or for short D-glucose....
Directory of Open Access Journals (Sweden)
Fatemeh Mokhtari
2018-04-01
Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.
Directory of Open Access Journals (Sweden)
Hyo-Ju Son
Full Text Available Diagnosis of pneumocystis pneumonia (PCP relies on microscopic visualization of P. jirovecii, or detection of Pneumocystis DNA in respiratory specimens, which involves invasive procedures such as bronchoalveolar lavage. The (1-3-β-D-glucan (BG assay has been proposed as a less invasive and less expensive diagnostic test to rule out PCP. We therefore compared blood levels of BG in patients with PCP with those of patients with candidemia, chronic disseminated candidiasis (CDC, invasive aspergillosis, mucormycosis, and tuberculosis and those of healthy volunteers.Adult patients who were diagnosed with PCP, candidemia, CDC, invasive aspergillosis, mucormycosis, and tuberculosis whose blood samples were available, and healthy volunteers were enrolled in a tertiary hospital in Seoul, South Korea, during a 21-month period. The blood samples were assayed with the Goldstream Fungus (1-3-β-D-glucan test (Gold Mountain River Tech Development, Beijing, China.A total of 136 individuals including 50 patients P. jirovecii,15 candidemia, 6 CDC, 15 invasive aspergillosis, 10 mucormycosis, and 40 controls (20 TB and 20 healthy volunteers were included. The mean±SD of the concentration of 1-3-β-D-glucan in the patients with PCP (290.08 pg/mL±199.98 were similar to those of patients with candidemia (314.14 pg/mL±205.60, p = 0.90 at an α = 0.005 and CDC (129.74 pg/mL±182.79, p = 0.03 at an α = 0.005, but higher than those of patients with invasive aspergillosis (131.62 pg/mL±161.67, p = 0.002 at an α = 0.005, mucormycosis (95.08 pg/mL±146.80, p 31.25 pg/mL, which is highly sensitive for PCP versus tuberculosis plus healthy volunteers at the expense of specificity, the BG assay had a sensitivity of 92% (95% CI 81%-98% and a specificity of 55% (95% CI 39%-71%.The BG assay appears to be a useful adjunct test for PCP.
Energy Technology Data Exchange (ETDEWEB)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)
2013-07-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
International Nuclear Information System (INIS)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.
2013-01-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
International Nuclear Information System (INIS)
Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.
2013-01-01
Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)
Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka
2012-01-01
Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D-glucan
Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz
2012-01-01
Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.
Directory of Open Access Journals (Sweden)
Pai-Feng Kao
2012-01-01
Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.
Involvement of midbrain tectum neurokinin-mediated mechanisms in fear and anxiety
International Nuclear Information System (INIS)
Brenes, J.C.; Broiz, A.C.; Bassi, G.S.; Schwarting, R.K.W.; Brandão, M.L.
2012-01-01
Electrical stimulation of midbrain tectum structures, particularly the dorsal periaqueductal gray (dPAG) and inferior colliculus (IC), produces defensive responses, such as freezing and escape behavior. Freezing also ensues after termination of dPAG stimulation (post-stimulation freezing). These defensive reaction responses are critically mediated by Y -aminobutyric acid and 5-hydroxytryptamine mechanisms in the midbrain tectum. Neurokinins (NKs) also play a role in the mediation of dPAG stimulation-evoked fear, but how NK receptors are involved in the global processing and expression of fear at the level of the midbrain tectum is yet unclear. The present study investigated the role of NK-1 receptors in unconditioned defensive behavior induced by electrical stimulation of the dPAG and IC of male Wistar rats. Spantide (100 pmol/0.2 µL), a selective NK-1 antagonist, injected into these midbrain structures had anti-aversive effects on defensive responses and distress ultrasonic vocalizations induced by stimulation of the dPAG but not of the IC. Moreover, intra-dPAG injections of spantide did not influence post-stimulation freezing or alter exploratory behavior in rats subjected to the elevated plus maze. These results suggest that NK-1 receptors are mainly involved in the mediation of defensive behavior organized in the dPAG. Dorsal periaqueductal gray-evoked post-stimulation freezing was not affected by intra-dPAG injections of spantide, suggesting that NK-1-mediated mechanisms are only involved in the output mechanisms of defensive behavior and not involved in the processing of ascending aversive information from the dPAG
Involvement of midbrain tectum neurokinin-mediated mechanisms in fear and anxiety
Energy Technology Data Exchange (ETDEWEB)
Brenes, J.C. [Experimental and Physiological Psychology, Philipps-University of Marburg, Marburg (Germany); Broiz, A.C.; Bassi, G.S. [Instituto de Neurociências e Comportamento, Campus USP, Ribeirão Preto, SP (Brazil); Laboratório de Psicobiologia, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil); Schwarting, R.K.W. [Experimental and Physiological Psychology, Philipps-University of Marburg, Marburg (Germany); Brandão, M.L. [Instituto de Neurociências e Comportamento, Campus USP, Ribeirão Preto, SP (Brazil); Laboratório de Psicobiologia, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto, SP (Brazil)
2012-03-09
Electrical stimulation of midbrain tectum structures, particularly the dorsal periaqueductal gray (dPAG) and inferior colliculus (IC), produces defensive responses, such as freezing and escape behavior. Freezing also ensues after termination of dPAG stimulation (post-stimulation freezing). These defensive reaction responses are critically mediated by {sub Y}-aminobutyric acid and 5-hydroxytryptamine mechanisms in the midbrain tectum. Neurokinins (NKs) also play a role in the mediation of dPAG stimulation-evoked fear, but how NK receptors are involved in the global processing and expression of fear at the level of the midbrain tectum is yet unclear. The present study investigated the role of NK-1 receptors in unconditioned defensive behavior induced by electrical stimulation of the dPAG and IC of male Wistar rats. Spantide (100 pmol/0.2 µL), a selective NK-1 antagonist, injected into these midbrain structures had anti-aversive effects on defensive responses and distress ultrasonic vocalizations induced by stimulation of the dPAG but not of the IC. Moreover, intra-dPAG injections of spantide did not influence post-stimulation freezing or alter exploratory behavior in rats subjected to the elevated plus maze. These results suggest that NK-1 receptors are mainly involved in the mediation of defensive behavior organized in the dPAG. Dorsal periaqueductal gray-evoked post-stimulation freezing was not affected by intra-dPAG injections of spantide, suggesting that NK-1-mediated mechanisms are only involved in the output mechanisms of defensive behavior and not involved in the processing of ascending aversive information from the dPAG.
Mechanisms Involved in Exercise-Induced Cardioprotection: A Systematic Review
Borges, Juliana Pereira; Lessa, Marcos Adriano
2015-01-01
Background Acute myocardial infarction is the leading cause of morbidity and mortality worldwide. Furthermore, research has shown that exercise, in addition to reducing cardiovascular risk factors, can also protect the heart against injury due to ischemia and reperfusion through a direct effect on the myocardium. However, the specific mechanism involved in exerciseinduced cardiac preconditioning is still under debate. Objective To perform a systematic review of the studies that have addressed the mechanisms by which aerobic exercise promotes direct cardioprotection against ischemia and reperfusion injury. Methods A search was conducted using MEDLINE, Literatura Latino-Americana e do Caribe de Informação em Ciências da Saúde, and Scientific Electronic Library Online databases. Data were extracted in a standardized manner by two independent researchers, who were responsible for assessing the methodological quality of the studies. Results The search retrieved 78 studies; after evaluating the abstracts, 30 studies were excluded. The manuscripts of the remaining 48 studies were completely read and, of these, 20 were excluded. Finally, 28 studies were included in this systematic review. Conclusion On the basis of the selected studies, the following are potentially involved in the cardioprotective response to exercise: increased heat shock protein production, nitric oxide pathway involvement, increased cardiac antioxidant capacity, improvement in ATP-dependent potassium channel function, and opioid system activation. Despite all the previous investigations, further research is still necessary to obtain more consistent conclusions. PMID:25830711
Education on invasive mechanical ventilation involving intensive care nurses: a systematic review.
Guilhermino, Michelle C; Inder, Kerry J; Sundin, Deborah
2018-03-26
Intensive care unit nurses are critical for managing mechanical ventilation. Continuing education is essential in building and maintaining nurses' knowledge and skills, potentially improving patient outcomes. The aim of this study was to determine whether continuing education programmes on invasive mechanical ventilation involving intensive care unit nurses are effective in improving patient outcomes. Five electronic databases were searched from 2001 to 2016 using keywords such as mechanical ventilation, nursing and education. Inclusion criteria were invasive mechanical ventilation continuing education programmes that involved nurses and measured patient outcomes. Primary outcomes were intensive care unit mortality and in-hospital mortality. Secondary outcomes included hospital and intensive care unit length of stay, length of intubation, failed weaning trials, re-intubation incidence, ventilation-associated pneumonia rate and lung-protective ventilator strategies. Studies were excluded if they excluded nurses, patients were ventilated for less than 24 h, the education content focused on protocol implementation or oral care exclusively or the outcomes were participant satisfaction. Quality was assessed by two reviewers using an education intervention critical appraisal worksheet and a risk of bias assessment tool. Data were extracted independently by two reviewers and analysed narratively due to heterogeneity. Twelve studies met the inclusion criteria for full review: 11 pre- and post-intervention observational and 1 quasi-experimental design. Studies reported statistically significant reductions in hospital length of stay, length of intubation, ventilator-associated pneumonia rates, failed weaning trials and improvements in lung-protective ventilation compliance. Non-statistically significant results were reported for in-hospital and intensive care unit mortality, re-intubation and intensive care unit length of stay. Limited evidence of the effectiveness of
Huong Le, Mai; Doan Do, Hai; Tran Thi, Hong Ha; Dung, Le Vu; Nguyen, Hoai Nam; Nhu Tran Thi, Hang; Dinh Nguyen, Luyen; Hoang, Chi Kim; Le, Huu Cuong; Huong Le Thi, Thu; Trinh, Hoang Trung; Thu Ha, Phuong
2016-12-01
Curcumin is a polyphenol from turmeric Curcuma longa L that has been proved to possess numerous biological and pharmaceutical activities, including anti-cancer properties. However, curcumin has only limited clinical applications due to the aqueous insolubility characteristic that reduces its biological availability. On the other hand, using nanoparticles as drug delivery system has potential as it increases solubility of hydrophobic substances such as curcumin. Furthermore, nanoparticles can protect and control release of drug. Therefore, the objective of this project is to prepare nanoparticles by polymeric encapsulating curcumin by 1-3/1-6 β-glucan extracted from Vietnamese mushrooms to increase drug delivery efficiency and biological effect. Method of the preparation is nano-precipitation. The produced curcumin-β-glucan-nanoparticles (NanoGluCur) takes spherical shape with 60-70 nm in diameter. As expected, water solubility of curcumin increases about 180 times, from 0.6 μg ml-1 to 0.11 mg ml-1. Loading capacity of NanoGluCur is 18.16%. In vitro cytotoxicity and anti-tumor promoting effects of NanoGluCur were also investigated. Results revealed that NanoGluCur is able to inhibit the growth of two human cancer cell lines Hep-G2 and LU-1 with IC50 values of 6.82 and 15.53 mg ml-1, respectively, while free curcumin expresses the activity with IC50 values of 7.41 and 18.82 mg ml-1. At the concentration of 40 mg ml-1, NanoGluCur showed anti-tumor promoting effects in reducing tumor size by 59.93% and tumor density by 40.52%, while the percentages caused by pristine curcumin were 41.36% and 29.14%, respectively. These results demonstrated dual effect of 1-3/1-6 β-glucan encapsulated curcumin nanoparticles: higher water solubility and better in vitro anti-cancer effects compared to free curcumin and 1-3/1-6 β-glucan, expectedly. This observation can potentially open a new approach in research and manufacture of functional foods from medicinal mushrooms.
Effects of Low Molecular Weight Yeast β-Glucan on Antioxidant and Immunological Activities in Mice
Directory of Open Access Journals (Sweden)
Na Lei
2015-09-01
Full Text Available To evaluate the antioxidant and immune effects of low molecular yeast β-glucan on mice, three sulfated glucans from Saccharomyces cerevisiae (sGSCs with different molecular weight (MW and degrees of sulfation (DS were prepared. The structures of the sGSCs were analyzed through high performance liquid chromatography-gel permeation chromatography (HPLC-GPC and Fourier transform infrared spectroscopy (FTIR. sGSC1, sGSC2, and sGSC3 had MW of 12.9, 16.5 and 19.2 kDa, respectively, and DS of 0.16, 0.24 and 0.27, respectively. In vitro and in vivo experiments were conducted to evaluate the antioxidant and immunological activities of the sGSCs. In vitro experiment, the reactive oxygen species (ROS scavenging activities were determined. In vivo experiment, 50 male BALB/c mice were divided into five groups. The sGSC1, sGSC2 and sGSC3 treatment groups received the corresponding sGSCs at 50 mg/kg/day each. The GSC (glucans from Saccharomyces cerevisiae treatment group received 50 mg/kg/day GSC. The normal control group received equal volume of physiological saline solution. All treatments were administered intragastrically for 14 day. Results showed that sGSC1, sGSC2 and sGSC3 can scavenge 1,1-diphenyl-2-picryl-hydrazyl (DPPH, superoxide, and hydroxyl radicals in vitro. The strength of the radical scavenging effects of the sGSCs was in the order of sGSC1 > sGSC2 > sGSC3. Oral administration of sGSC1 significantly improved serum catalase (CAT and glutathione peroxidase (GSH-Px activities and decreased malondialdehyde (MDA level in mice. sGSC1 significantly improved the spleen and thymus indexes and the lymphocyte proliferation, effectively enhanced the percentage of CD4+ T cells, decreased the percentage of CD8+ T cells, and elevated the CD4+/CD8+ ratio. sGSC1 significantly promoted the secretion of IL-2 and IFN-γ. These results indicate that sGSC1 with low MW and DS has better antioxidant and immunological activities than the other sGSCs, and sGSC1 could
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Synthesis of O- and C-glycosides derived from β-(1,3)-D-glucans.
Marca, Eduardo; Valero-Gonzalez, Jessika; Delso, Ignacio; Tejero, Tomás; Hurtado-Guerrero, Ramon; Merino, Pedro
2013-12-15
A series of β-(1,3)-d-glucans have been synthesized incorporating structural variations specifically on the reducing end of the oligomers. Both O- and C-glucosides derived from di- and trisaccharides have been obtained in good overall yields and with complete selectivity. Whereas the O-glycosides were obtained via a classical Koenigs-Knorr glycosylation, the corresponding C-glycosides were obtained through allylation of the anomeric carbon and further cross-metathesis reaction. Finally, the compounds were evaluated against two glycosidases and two endo-glucanases and no inhibitory activity was observed. Copyright © 2013 Elsevier Ltd. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin
2017-01-01
Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016
Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B
2016-04-05
Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.
Directory of Open Access Journals (Sweden)
ali kargarirezapour
2013-08-01
Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p
Grün, Christian H.; Dekker, Nick; Nieuwland, Alexander A.; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.; Hochstenbach, Frans
2006-01-01
(1-->3)-alpha-glucanases catalyze the hydrolysis of fungal cell wall (1-->3)-alpha-glucan, and function during cell division of yeasts containing this cell wall component or act in mycoparasitic processes. Here, we characterize the mechanism of action of the (1-->3)-alpha-glucanase MutAp from the
Dai, Huaien; Hiromasa, Yasuaki; Takahashi, Daisuke; VanderVelde, David; Fabrick, Jeffrey A; Kanost, Michael R; Krishnamoorthi, Ramaswamy
2013-01-08
In response to invading microorganisms, insect β-1,3-glucan recognition protein (βGRP), a soluble receptor in the hemolymph, binds to the surfaces of bacteria and fungi and activates serine protease cascades that promote destruction of pathogens by means of melanization or expression of antimicrobial peptides. Here we report on the nuclear magnetic resonance (NMR) solution structure of the N-terminal domain of βGRP (N-βGRP) from Indian meal moth (Plodia interpunctella), which is sufficient to activate the prophenoloxidase (proPO) pathway resulting in melanin formation. NMR and isothermal calorimetric titrations of N-βGRP with laminarihexaose, a glucose hexamer containing β-1,3 links, suggest a weak binding of the ligand. However, addition of laminarin, a glucose polysaccharide (~6 kDa) containing β-1,3 and β-1,6 links that activates the proPO pathway, to N-βGRP results in the loss of NMR cross-peaks from the backbone (15)N-(1)H groups of the protein, suggesting the formation of a large complex. Analytical ultracentrifugation (AUC) studies of formation of the N-βGRP-laminarin complex show that ligand binding induces self-association of the protein-carbohydrate complex into a macro structure, likely containing six protein and three laminarin molecules (~102 kDa). The macro complex is quite stable, as it does not undergo dissociation upon dilution to submicromolar concentrations. The structural model thus derived from this study for the N-βGRP-laminarin complex in solution differs from the one in which a single N-βGRP molecule has been proposed to bind to a triple-helical form of laminarin on the basis of an X-ray crystallographic structure of the N-βGRP-laminarihexaose complex [Kanagawa, M., Satoh, T., Ikeda, A., Adachi, Y., Ohno, N., and Yamaguchi, Y. (2011) J. Biol. Chem. 286, 29158-29165]. AUC studies and phenoloxidase activation measurements conducted with the designed mutants of N-βGRP indicate that electrostatic interactions involving Asp45, Arg54
Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua
2016-07-01
This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.
EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES
Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima
2017-01-01
The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...
Bitoun, Jacob P; Liao, Sumei; McKey, Briggs A; Yao, Xin; Fan, Yuwei; Abranches, Jacqueline; Beatty, Wandy L; Wen, Zezhang T
2013-03-01
Streptococcus mutans, the primary causative agent of dental caries, contains two paralogues of the LytR-CpsA-Psr family proteins encoded by brpA and psr, respectively. Previous studies have shown that BrpA plays an important role in cell envelope biogenesis/homeostasis and affects stress responses and biofilm formation by Strep. mutans, traits critical to cariogenicity of this bacterium. In this study, a Psr-deficient mutant, TW251, was constructed. Characterization of TW251 showed that deficiency of Psr did not have any major impact on growth rate. However, when subjected to acid killing at pH 2.8, the survival rate of TW251 was decreased dramatically compared with the parent strain UA159. In addition, TW251 also displayed major defects in biofilm formation, especially during growth with sucrose. When compared to UA159, the biofilms of TW251 were mainly planar and devoid of extracellular glucans. Real-time-PCR and Western blot analyses revealed that deficiency of Psr significantly decreased the expression of glucosyltransferase C, a protein known to play a major role in biofilm formation by Strep. mutans. Transmission electron microscopy analysis showed that deficiency of BrpA caused alterations in cell envelope and cell division, and the most significant defects were observed in TW314, a Psr-deficient and BrpA-down mutant. No such effects were observed with Psr mutant TW251 under similar conditions. These results suggest that while there are similarities in functions between BrpA and Psr, distinctive differences also exist between these two paralogues. Like Bacillus subtilis but different from Staphylococcus aureus, a functional BrpA or Psr is required for viability in Strep. mutans.
DEFF Research Database (Denmark)
Andersen, Barbara Vad; Mielby, Line H.; Viemose, Ida
2017-01-01
apple-cherry fruit drinks with different levels of beta-glucans and different sweeteners, sucrose or Stevia rebaudiana. The aims were: 1) to study the hedonic sensory experience, 2) to study time and product effects on post-ingestive sensations and satisfaction, and 3) to study main drivers....... Satisfaction with sensory attributes was found to be the main driver of food satisfaction, while post-ingestive sensations drove satisfaction as well. While replacing sucrose with Stevia rebaudiana did not affect the hedonic and post-ingestive sensations, addition of beta glucan resulted in both positive...
Energy Technology Data Exchange (ETDEWEB)
Borkowski, Leszek, E-mail: leszek.borkowski@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek [Department of Animal Physiology, University of Life Sciences in Lublin, Akademicka 12, 20-033 Lublin (Poland); Polkowska, Izabela [Department and Clinic of Animal Surgery, University of Life Sciences in Lublin, Głęboka 30, 20-612 Lublin (Poland); Belcarz, Anna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Karpiński, Mirosław [Department of Companion and Wildlife Animals, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin (Poland); Słowik, Tymoteusz [Independent Radiology Unit at Lublin Small Animals Medical Centre, Stefczyka 11, 20-151 Lublin (Poland); Matuszewski, Łukasz [Children' s Orthopaedic Clinic and Rehabilitation Department, Medical University of Lublin, Chodzki 2, 20-093 Lublin (Poland); Ślósarczyk, Anna [Faculty of Materials Science and Ceramics, AGH-University of Science and Technology, Mickiewicza 30, 30-059 Krakow (Poland); Ginalska, Grażyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland)
2015-08-01
A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration.
International Nuclear Information System (INIS)
Borkowski, Leszek; Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek; Polkowska, Izabela; Belcarz, Anna; Karpiński, Mirosław; Słowik, Tymoteusz; Matuszewski, Łukasz; Ślósarczyk, Anna; Ginalska, Grażyna
2015-01-01
A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration
Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral
2018-04-01
The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhao, T.; Shi, L.; Zhang, Y. T.; Zou, L.; Zhang, L.
2017-10-01
Atmospheric pressure non-equilibrium plasmas have attracted significant attention and have been widely used to inactivate pathogens, yet the mechanisms underlying the interactions between plasma-generated species and bio-organisms have not been elucidated clearly. In this paper, reactive molecular dynamics simulations are employed to investigate the mechanisms of interactions between reactive oxygen plasma species (O, OH, and O2) and β-1,6-glucan (a model for the C. albicans cell wall) from a microscopic point of view. Our simulations show that O and OH species can break structurally important C-C and C-O bonds, while O2 molecules exhibit only weak, non-bonded interactions with β-1,6-glucan. Hydrogen abstraction from hydroxyl or CH groups occurs first in all bond cleavage mechanisms. This is followed by a cascade of bond cleavage and double bond formation events. These lead to the destruction of the fungal cell wall. O and OH have similar effects related to their bond cleavage mechanisms. Our simulation results provide fundamental insights into the mechanisms underlying the interactions between reactive oxygen plasma species and the fungal cell wall of C. albicans at the atomic level.
Slamenová, Darina; Kováciková, Ines; Horváthová, Eva; Wsólová, Ladislava; Navarová, Jana
2010-10-01
A large number of functional foods, including those that contain β-d-glucans, have been shown to prevent human DNA against genotoxic effects and associated development of cancer and other chronic diseases. In this paper, carboxymethyl chitin-glucan (CM-CG) isolated from Aspergillus niger was investigated from two standpoints: (1) DNA-protective effects against oxidative DNA damage induced by H(2)O(2) and alkylating DNA damage induced by MMS and MNNG, and (2) a potential effect on rejoining of MMS- and MNNG-induced single strand DNA breaks. The results obtained by the comet assay in human cells cultured in vitro showed that CM-CG reduced significantly the level of oxidative DNA lesions induced by H(2)O(2) but did not change the level of alkylating DNA lesions induced by MMS or MNNG. On the other side, the efficiency of DNA-rejoining of single strand DNA breaks induced by MMS and MNNG was significantly higher in HepG2 cells pre-treated with CM-CG. The antioxidative activity of carboxymethyl chitin-glucan was confirmed by the DPPH assay. Copyright © 2010 Elsevier Ltd. All rights reserved.
Rosch, Christiane; Taverne, Nico; Venema, Koen; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.
2017-01-01
Scope: This study simulates the fermentation process of barley β-glucan and sugar beet pectin in the human colon and monitors the degradation products formed. Additionally, immune effects of the degradation products were investigated. Methods and results: Immunostimulatory activity of
Antifungal Properties of Cationic Phenylene Ethynylenes and Their Impact on β-Glucan Exposure.
Pappas, Harry C; Sylejmani, Rina; Graus, Matthew S; Donabedian, Patrick L; Whitten, David G; Neumann, Aaron K
2016-08-01
Candida species are the cause of many bloodstream infections through contamination of indwelling medical devices. These infections account for a 40% mortality rate, posing a significant risk to immunocompromised patients. Traditional treatments against Candida infections include amphotericin B and various azole treatments. Unfortunately, these treatments are associated with high toxicity, and resistant strains have become more prevalent. As a new frontier, light-activated phenylene ethynylenes have shown promising biocidal activity against Gram-positive and -negative bacterial pathogens, as well as the environmental yeast Saccharomyces cerevisiae In this study, we monitored the viability of Candida species after treatment with a cationic conjugated polymer [poly(p-phenylene ethynylene); PPE] or oligomer ["end-only" oligo(p-phenylene ethynylene); EO-OPE] by flow cytometry in order to explore the antifungal properties of these compounds. The oligomer was found to disrupt Candida albicans yeast membrane integrity independent of light activation, while PPE is able to do so only in the presence of light, allowing for some control as to the manner in which cytotoxic effects are induced. The contrast in killing efficacy between the two compounds is likely related to their size difference and their intrinsic abilities to penetrate the fungal cell wall. Unlike EO-OPE-DABCO (where DABCO is quaternized diazabicyclo[2,2,2]octane), PPE-DABCO displayed a strong propensity to associate with soluble β-glucan, which is expected to inhibit its ability to access and perturb the inner cell membrane of Candida yeast. Furthermore, treatment with PPE-DABCO unmasked Candida albicans β-glucan and increased phagocytosis by Dectin-1-expressing HEK-293 cells. In summary, cationic phenylene ethynylenes show promising biocidal activity against pathogenic Candida yeast cells while also exhibiting immunostimulatory effects. Copyright © 2016, American Society for Microbiology. All Rights
Directory of Open Access Journals (Sweden)
Vlatka Petravić-Tominac
2011-01-01
Full Text Available Particulate β-glucans were isolated from brewer’s yeast using three different procedures – alkaline (A, alkaline-acidic (AA and alkaline-acidic with mannoprotein removal (AAM and dried using three different methods – air drying (AD, lyophilization (L and spray drying (SD. In this work, the obtained β-glucan preparations were tested for their microstructure, rheological properties, swelling, water-holding and oil-binding capacities. According to their rheological properties, suspensions containing 1 and 2 % (by mass of spray-dried samples belong to the category of dilatant fluids. Among the spray-dried samples, rheological behaviour and water-holding capacity of the preparation AA-SD differed from those obtained by other two procedures (A-SD and AAM-SD. Concerning different drying methods applied, swelling was the lowest in the lyophilized samples and the most pronounced in the air-dried ones. Oil-binding capacity was the highest in the lyophilized preparations and increased proportionally to the number of processing steps applied in the isolation procedure.
Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki
2015-01-01
We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.
Li, Yadi; Li, Caiming; Gu, Zhengbiao; Hong, Yan; Cheng, Li; Li, Zhaofeng
2017-10-01
Steady and dynamic shear measurements were used to investigate the rheological properties of cassava starches modified using the 1,4-α-glucan branching enzyme (GBE) from Geobacillus thermoglucosidans STB02. GBE treatment lowered the hysteresis loop areas, the activation energy (E a ) values and the parameters in rheological models of cassava starch pastes. Moreover, GBE treatment increased its storage (G') and loss (G″) moduli, and decreased their tan δ (ratio of G″/G') values and frequency-dependencies. Scanning electron microscopic studies showed the selective and particular attack of GBE on starch granules, and X-ray diffraction analyses showed that GBE treatment produces significant structural changes in amylose and amylopectin. These changes demonstrate that GBE modification produces cassava starch with a more structured network and improved stability towards mechanical processing. Differential scanning calorimetric analysis and temperature sweeps indicated greater resistance to granule rupture, higher gel rigidity, and a large decrease in the rate of initial conformational ordering with increasing GBE treatment time. Pronounced changes in rheological parameters revealed that GBE modification enhances the stability of cassava starch and its applicability in the food processing industry. Copyright © 2017 Elsevier B.V. All rights reserved.
Neurobiological mechanisms involved in sleep bruxism.
Lavigne, G J; Kato, T; Kolta, A; Sessle, B J
2003-01-01
Sleep bruxism (SB) is reported by 8% of the adult population and is mainly associated with rhythmic masticatory muscle activity (RMMA) characterized by repetitive jaw muscle contractions (3 bursts or more at a frequency of 1 Hz). The consequences of SB may include tooth destruction, jaw pain, headaches, or the limitation of mandibular movement, as well as tooth-grinding sounds that disrupt the sleep of bed partners. SB is probably an extreme manifestation of a masticatory muscle activity occurring during the sleep of most normal subjects, since RMMA is observed in 60% of normal sleepers in the absence of grinding sounds. The pathophysiology of SB is becoming clearer, and there is an abundance of evidence outlining the neurophysiology and neurochemistry of rhythmic jaw movements (RJM) in relation to chewing, swallowing, and breathing. The sleep literature provides much evidence describing the mechanisms involved in the reduction of muscle tone, from sleep onset to the atonia that characterizes rapid eye movement (REM) sleep. Several brainstem structures (e.g., reticular pontis oralis, pontis caudalis, parvocellularis) and neurochemicals (e.g., serotonin, dopamine, gamma aminobutyric acid [GABA], noradrenaline) are involved in both the genesis of RJM and the modulation of muscle tone during sleep. It remains unknown why a high percentage of normal subjects present RMMA during sleep and why this activity is three times more frequent and higher in amplitude in SB patients. It is also unclear why RMMA during sleep is characterized by co-activation of both jaw-opening and jaw-closing muscles instead of the alternating jaw-opening and jaw-closing muscle activity pattern typical of chewing. The final section of this review proposes that RMMA during sleep has a role in lubricating the upper alimentary tract and increasing airway patency. The review concludes with an outline of questions for future research.
A feeding trial was performed to screen three barley genotypes containing different levels of '-glucan for their ability to influence growth, immune function, and disease resistance of rainbow trout. Three experimental diets were prepared by substituting each of three barely genotypes containing dif...
Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn
2017-01-01
Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans....
Directory of Open Access Journals (Sweden)
Janaína A. Túrmina
2012-12-01
Full Text Available Studies evaluating the toxicity caused by fungal exopolysaccharides of the β-(1®6-D-glucan type are rare. In this study, the toxicological effects of sub-chronic treatments with lasiodiplodan (β-(1®6-D-glucan from Lasiodiplodia theobromae MMPI were evaluated in mice through the assessment of biochemical, hematological, and histopathological alterations. Thirty-two mice (16 male, 16 female were used in this study divided in two groups; one group received lasiodiplodan (50 mg/kg body weight daily for 28 days via gavage, and another (control group received saline during the same period. Blood samples were collected via cardiac puncture for hematological and biochemical analyses. Liver, heart, kidney, and spleen were collected for histopathological analysis. Statistical analysis was performed through one-way analysis of variance and only p < 0.05 F-values were presented. Significant reduction in blood glucose in the male group (35%; p < 0.01, transaminases activity in both sexes (AST and ALT; ~35%; p < 0.05, and urea (20%; p < 0.01 in the female group was observed with the lasiodiplodan treatment. The results showed that sub-chronic treatments with lasiodiplodan did not generate hematological and histopathological alterations leading to signs of toxicity in healthy mice, independent of gender.
Live imaging of β-1,3-glucan synthase FKS-1 in Neurospora crassa hyphae.
Sánchez-León, Eddy; Riquelme, Meritxell
2015-09-01
The subcellular localization and dynamics of FKS-1, the putative catalytic subunit of the β-1,3-glucan synthase complex, was analyzed in growing hyphae of Neurospora crassa by live confocal microscopy. GFP-tagged FKS-1 accumulated at the outer layer of the Spitzenkörper (Spk), and at the apical plasma membrane (PM). Fluorescence recovery after photobleaching analysis revealed arrival of FKS-1-containing carriers first at the immediate surroundings of the core region of the Spk, and thereafter to the Spk most outer region. The results obtained here and previous data suggest that FKS-1 is transported to the Spk in macrovesicles. Copyright © 2015 Elsevier Inc. All rights reserved.
Prospective Evaluation of Serum β-Glucan Testing in Patients With Probable or Proven Fungal Diseases
Angebault, Cécile; Lanternier, Fanny; Dalle, Frédéric; Schrimpf, Cécile; Roupie, Anne-Laure; Dupuis, Aurélie; Agathine, Aurélie; Scemla, Anne; Paubelle, Etienne; Caillot, Denis; Neven, Bénédicte; Frange, Pierre; Suarez, Felipe; d'Enfert, Christophe; Lortholary, Olivier; Bougnoux, Marie-Elisabeth
2016-01-01
Background. Early diagnosis and treatment are crucial in invasive fungal diseases (IFD). Serum (1-3)-β-d-glucan (BG) is believed to be an early IFD marker, but its diagnostic performance has been ambiguous, with insufficient data regarding sensitivity at the time of IFD diagnosis (TOD) and according to outcome. Whether its clinical utility is equivalent for all types of IFD remains unknown. Methods. We included 143 patients with proven or probable IFD (49 invasive candidiasis, 45 invasive aspergillosis [IA], and 49 rare IFD) and analyzed serum BG (Fungitell) at TOD and during treatment. Results. (1-3)-β-d-glucan was undetectable at TOD in 36% and 48% of patients with candidemia and IA, respectively; there was no correlation between negative BG results at TOD and patients' characteristics, localization of infection, or prior antifungal use. Nevertheless, patients with candidemia due to Candida albicans were more likely to test positive for BG at TOD (odds ratio = 25.4, P = .01) than patients infected with other Candida species. In 70% of the patients with a follow-up, BG negativation occurred in >1 month for candidemia and >3 months for IA. A slower BG decrease in patients with candidemia was associated with deep-seated localizations (P = .04). Thirty-nine percent of patients with rare IFD had undetectable BG at TOD; nonetheless, all patients with chronic subcutaneous IFD tested positive at TOD. Conclusions. Undetectable serum BG does not rule out an early IFD, when the clinical suspicion is high. After IFD diagnostic, kinetics of serum BG are difficult to relate to clinical outcome. PMID:27419189
Directory of Open Access Journals (Sweden)
Dickinson Bryony A
2009-06-01
Full Text Available Abstract Background Long-term depression (LTD in the hippocampus can be induced by activation of different types of G-protein coupled receptors, in particular metabotropic glutamate receptors (mGluRs and muscarinic acethycholine receptors (mAChRs. Since mGluRs and mAChRs activate the same G-proteins and isoforms of phospholipase C (PLC, it would be expected that these two forms of LTD utilise the same molecular mechanisms. However, we find a distinct mechanism of LTD involving GRIP and liprin-α. Results Whilst both forms of LTD require activation of tyrosine phosphatases and involve internalisation of AMPARs, they use different molecular interactions. Specifically, mAChR-LTD, but not mGluR-LTD, is blocked by peptides that inhibit the binding of GRIP to the AMPA receptor subunit GluA2 and the binding of GRIP to liprin-α. Thus, different receptors that utilise the same G-proteins can regulate AMPAR trafficking and synaptic efficacy via distinct molecular mechanisms. Conclusion Our results suggest that mAChR-LTD selectively involves interactions between GRIP and liprin-α. These data indicate a novel mechanism of synaptic plasticity in which activation of M1 receptors results in AMPAR endocytosis, via a mechanism involving interactions between GluA2, GRIP and liprin-α.
Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish
2017-10-01
We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.
Rabideau, Brooks D; Agarwal, Animesh; Ismail, Ahmed E
2013-04-04
Explicit, all-atom molecular dynamics simulations are used to study the breakup of small bundles of cellulose Iα and Iβ in the ionic liquids [BMIM]Cl, [EMIM]Ac, and [DMIM]DMP. In all cases, significant breakup of the bundles is observed with the initial breakup following a common underlying mechanism. Anions bind strongly to the hydroxyl groups of the exterior strands of the bundle, forming negatively charged complexes. Binding also weakens the intrastrand hydrogen bonds present in the cellulose strands, providing greater strand flexibility. Cations then intercalate between the individual strands, likely due to charge imbalances, providing the bulk to push the individual moieties apart and initiating the separation. The peeling of an individual strand from the main bundle is observed in [EMIM]Ac with an analysis of its hydrogen bonds with other strands showing that the chain detaches glucan by glucan from the main bundle in discrete, rapid events. Further analysis shows that the intrastrand hydrogen bonds of each glucan tend to break for a sustained period of time before the interstrand hydrogen bonds break and strand detachment occurs. Examination of similar nonpeeling strands shows that, without this intrastrand hydrogen bond breakage, the structural rigidity of the individual unit can hinder its peeling despite interstrand hydrogen bond breakage.
Drug-drug interactions involving lysosomes: mechanisms and potential clinical implications.
Logan, Randall; Funk, Ryan S; Axcell, Erick; Krise, Jeffrey P
2012-08-01
Many commercially available, weakly basic drugs have been shown to be lysosomotropic, meaning they are subject to extensive sequestration in lysosomes through an ion trapping-type mechanism. The extent of lysosomal trapping of a drug is an important therapeutic consideration because it can influence both activity and pharmacokinetic disposition. The administration of certain drugs can alter lysosomes such that their accumulation capacity for co-administered and/or secondarily administered drugs is altered. In this review the authors explore what is known regarding the mechanistic basis for drug-drug interactions involving lysosomes. Specifically, the authors address the influence of drugs on lysosomal pH, volume and lipid processing. Many drugs are known to extensively accumulate in lysosomes and significantly alter their structure and function; however, the therapeutic and toxicological implications of this remain controversial. The authors propose that drug-drug interactions involving lysosomes represent an important potential source of variability in drug activity and pharmacokinetics. Most evaluations of drug-drug interactions involving lysosomes have been performed in cultured cells and isolated tissues. More comprehensive in vivo evaluations are needed to fully explore the impact of this drug-drug interaction pathway on therapeutic outcomes.
Quantum-Mechanical Calculations on Molecular Substructures Involved in Nanosystems
Directory of Open Access Journals (Sweden)
Beata Szefler
2014-09-01
Full Text Available In this review article, four ideas are discussed: (a aromaticity of fullerenes patched with flowers of 6-and 8-membered rings, optimized at the HF and DFT levels of theory, in terms of HOMA and NICS criteria; (b polybenzene networks, from construction to energetic and vibrational spectra computations; (c quantum-mechanical calculations on the repeat units of various P-type crystal networks and (d construction and stability evaluation, at DFTB level of theory, of some exotic allotropes of diamond D5, involved in hyper-graphenes. The overall conclusion was that several of the yet hypothetical molecular nanostructures herein described are serious candidates to the status of real molecules.
Dobšíková, Radka; Blahová, Jana; Mikulíková, Ivana; Modrá, Helena; Prášková, Eva; Svobodová, Zdeňka; Skorič, Mišo; Jarkovský, Jiří; Siwicki, Andrzej-Krzysztof
2013-12-01
The aim of the study was to evaluate the effect of micronized β-1.3/1.6-D-glucan (BG) derived from the oyster mushroom Pleurotus ostreatus Hiratake and tetracycline antibiotic oxytetracycline (OTC) on biometrical, haematological, biochemical, and immunological indices, and histopathological changes in tissues of one- to two-year-old common carp (Cyprinus carpio L.). The fish tested were divided into five experimental groups and one control. Carp in the control group were fed commercial carp feed pellets. Fish in the five experimental groups were fed the same pellets supplemented with either OTC, a combination of OTC and BG, or BG as follows: 75 mg oxytetracycline kg(-1) bw (OTC group), 75 mg oxytetracycline kg(-1) bw and 0.5% β-glucan (OTC + 0.5% BG group), 75 mg oxytetracycline kg(-1) bw and 2.0% β-glucan (OTC + 2.0% BG group), 0.5% β-glucan (0.5% BG group), and 2.0% β-glucan (2.0% BG group). OTC- and BG-supplemented diets and the control diet were administered to experimental and control carp for 50 days (i.e. samplings 1-3, the exposure period); for the following 14 days, fish were fed only control feed pellets with no OTC or BG supplementation (i.e. sampling 4, the recovery period). Blood and tissue samples were collected both during, and at the end of the study. No significant changes in biometrical indices (i.e. total length, standard length, total weight, hepatosomatic and spleen somatic index, and Fulton's condition factor) were found in experimental carp compared to control in any sampling. In haematological indices, significant changes were found only in sampling 2, in which shifts in PCV (P < 0.01), Hb (P < 0.01), and WBC (P < 0.01), and in the counts of lymphocytes (P < 0.01), monocytes (P < 0.01), and neutrophil granulocytes-segments (P < 0.05) were revealed. As for biochemical profiling, plasma concentrations of glucose, albumins, cholesterol, natrium, and chlorides (all P < 0.01), and total proteins, lactate, phosphorus, and potassium (all P < 0
Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga
2012-01-01
The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard
International Nuclear Information System (INIS)
Lacerda, Camila Maria de Sousa
2016-01-01
Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with "3"2P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with "9"9"mTc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A "9"9"mTc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with "9"9"mTc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the "9"9"mTc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the target
Directory of Open Access Journals (Sweden)
Roberta M. de SÁ
2000-04-01
Full Text Available Com o crescente interesse em alimentos funcionais e nutracêuticos, a aveia (Avena sativa L. tem se destacado, devido ao seu teor de fibras alimentares e principalmente às beta-glucanas. As (1,3(1,4-beta-D-glucanas, fibras alimentares na maioria solúveis, atuam na redução do colesterol em indivíduos com hipercolesterolemia. Existem estudos para determinar as causas de variação do teor desta fibra em aveia, porém, pouco se sabe sobre a aveia cultivada no Brasil. O objetivo deste trabalho foi verificar se existem diferenças no conteúdo de beta-glucanas entre cultivares brasileiros e se há variação na porcentagem desta fibra devido ao ano de cultivo. Os cultivares IAC7, UFRGS14, UPF16 e UPF17 (3 amostras de cada, e ainda três amostras do cultivar IAC7 para cada ano de cultivo (97 e 98, foram analisados segundo os métodos da AACC (American Association of Cereal Chemists. Os teores médios (peso seco de beta-glucanas foram 6,50% (IAC7, 4,30% (UFRGS14, 3,51% (UPF16 e 3,78% (UPF17, com erro padrão de ±0,084 e coeficiente de variação de 7,89 %. Observou-se efeito significativo dos cultivares (p=0,03 e grande variabilidade entre as amostras (p=0,0001. O cultivar IAC7 apresentou média de beta-glucanas de 5,11% em 97 e 6,50 % em 98 (erro padrão ±0,14; CV=10,53% e observou-se efeito significativo do ano de cultivo.With the increasing interest in functional foods and nutraceuticals, oats (Avena sativa L. have received special attention because of their dietary fiber contents, and specially of their beta-glucans. The mostly soluble dietary fibers (1,3(1,4-beta-D-glucans, reduce serum cholesterol in individuals with hypercholesterolemia. There are studies about the causes of variation in the contents of this fiber in oats, however, very little is known about Brazilian cultivars. The objective of this work was to verify if there were differences in the beta-glucan contents among brazilian cultivars and if there was variation in the
Matsumi, Y; Fujita, K; Takashima, Y; Yanagida, K; Morikawa, Y; Matsumoto-Nakano, M
2015-06-01
Glucan-binding proteins (Gbps) of Streptococcus mutans, a major pathogen of dental caries, mediate the binding of glucans synthesized from sucrose by the action of glucosyltransferases (GTFs) encoded by gtfB, gtfC, and gtfD. Several stress proteins, including DnaK and GroEL encoded by dnaK and groEL, are related to environmental stress tolerance. The contribution of Gbp expression to biofilm formation was analyzed by focusing on the expression levels of genes encoding GTFs and stress proteins. Biofilm-forming assays were performed using GbpA-, GbpB-, and GbpC-deficient mutant strains and the parental strain MT8148. The expression levels of gtfB, gtfC, gtfD, dnaK, and groEL were evaluated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Furthermore, the structure of biofilms formed by these Gbp-deficient mutant strains was observed using confocal laser scanning microscopy (CLSM). Biofilm-forming assay findings demonstrated that the amount formed by the GbpA-deficient mutant strain (AD1) was nearly the same as that by the parental strain, while the GbpB- and GbpC-deficient mutant strains produced lower amounts than MT8148. Furthermore, RT-qPCR assay results showed that the expressions of gtfB, dnaK, and groEL in AD1 were elevated compared with MT8148. CLSM also revealed that the structure of biofilm formed by AD1 was prominently different compared with that formed by the parental strain. These results suggest that a defect in GbpA influences the expression of genes controlling biofilm formation, indicating its importance as a protein for firm and stable biofilm formation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Evaluation of autophagy as a mechanism involved in air pollutant-induced pulmonary injury
Evaluation of autophagy as a mechanism involved in air pollutant-induced pulmonary injuryHenriquez, A.1, Snow, S.2, Miller, D1.,Schladweiler, M.2 and Kodavanti, U2.1 Curriculum in Toxicology, UNC, Chapel Hill, NC. 2 EPHD/NHEERL, US EPA, RTP, Durham, NC. ...
Directory of Open Access Journals (Sweden)
Olav Christophersen
2012-02-01
damaged tissues, especially in the intestines, and 4 by functioning as an antifibrogenic agent. A detailed discussion is given of possible mechanisms involved both in the antioxidant effects of taurine, in its anti-inflammatory effects and in its role as a growth factor for leukocytes and nerve cells, which might be closely related to its role as an osmolyte important for cellular volume regulation because of the close connection between cell volume regulation and the regulation of protein synthesis as well as cellular protein degradation. While taurine supplementation alone would be expected to exert a therapeutic effect far better than negligible in patients that have been exposed to high doses of ionizing radiation, it may on theoretical grounds be expected that much better results may be obtained by using taurine as part of a multifactorial treatment strategy, where it may interact synergistically with several other nutrients, hormones or other drugs for optimizing antioxidant protection and minimizing harmful posttraumatic inflammatory reactions, while using other nutrients to optimize DNA and tissue repair processes, and using a combination of good diet, immunostimulatory hormones and perhaps other nontoxic immunostimulants (such as beta-glucans for optimizing the recovery of antiviral and antibacterial immune functions. Similar multifactorial treatment strategies may presumably be helpful in several other disease situations (including severe infectious diseases and severe asthma as well as for treatment of acute intoxications or acute injuries (both mechanical ones and severe burns where severely enhanced oxidative and/or nitrative stress and/or too much secretion of vasodilatory neuropeptides from C-fibres are important parts of the pathogenetic mechanisms that may lead to the death of the patient. Some case histories (with discussion of some of those mechanisms that may have been responsible for the observed therapeutic outcome are given for illustration of the
DEFF Research Database (Denmark)
Yücel, Cigdem; Sotres, Javier; Rascón, Ana
2017-01-01
HYPOTHESIS: Chitosan and sulfated oat β-glucan are materials suitable to create a prebiotic coating for targeted delivery to gastrointestinal system, using the layer by layer technology. EXPERIMENT: Quartz crystal microbalance with dissipation (QCM-D), spectroscopic ellipsometry (SE) and atomic...... force microscopy (AFM) were used to assess the multilayer formation capacity and characterize the resulting coatings in terms of morphology and material properties such as structure and rigidity. The coating of colloidal materials was proven, specifically on L. acidophilus bacteria as measured...
Brucella cyclic β-1,2-glucan plays a critical role in the induction of splenomegaly in mice.
Directory of Open Access Journals (Sweden)
Mara S Roset
Full Text Available Brucella, the etiological agent of animal and human brucellosis, is a bacterium with the capacity to modulate the inflammatory response. Cyclic β-1,2-glucan (CβG is a virulence factor key for the pathogenesis of Brucella as it is involved in the intracellular life cycle of the bacteria. Using comparative studies with different CβG mutants of Brucella, cgs (CβG synthase, cgt (CβG transporter and cgm (CβG modifier, we have identified different roles for this polysaccharide in Brucella. While anionic CβG is required for bacterial growth in low osmolarity conditions, the sole requirement for a successful Brucella interaction with mammalian host is its transport to periplasmic space. Our results uncover a new role for CβG in promoting splenomegaly in mice. We showed that CβG-dependent spleen inflammation is the consequence of massive cell recruitment (monocytes, dendritics cells and neutrophils due to the induction of pro-inflammatory cytokines such as IL-12 and TNF-α and also that the reduced splenomegaly response observed with the cgs mutant is not the consequence of changes in expression levels of the characterized Brucella PAMPs LPS, flagellin or OMP16/19. Complementation of cgs mutant with purified CβG increased significantly spleen inflammation response suggesting a direct role for this polysaccharide.
Yu, Yang; Park, Ji-Won; Kwon, Hyun-Mi; Hwang, Hyun-Ok; Jang, In-Hwan; Masuda, Akiko; Kurokawa, Kenji; Nakayama, Hiroshi; Lee, Won-Jae; Dohmae, Naoshi; Zhang, Jinghai; Lee, Bok Luel
2010-01-01
In Drosophila, the synthesis of antimicrobial peptides in response to microbial infections is under the control of the Toll and immune deficiency (Imd) signaling pathway. The Toll signaling pathway responds mainly to the lysine-type peptidoglycan of Gram-positive bacteria and fungal β-1,3-glucan, whereas the Imd pathway responds to the meso-diaminopimelic acid (DAP)-type peptidoglycan of Gram-negative bacteria and certain Gram-positive bacilli. Recently we determined the activation mechanism ...
Krisman, C R; Tolmasky, D S; Raffo, S
1985-06-01
Methods previously described for glycogen or amylopectin branching enzymatic activity are insufficiently sensitive and not quantitative. A new, more sensitive, specific, and quantitative one was developed. It is based upon the quantitation of the glucose residues joined by alpha 1,6 bonds introduced by varying amounts of branching enzyme. The procedure involved the synthesis of a polysaccharide from Glc-1-P and phosphorylase in the presence of the sample to be tested. The branched polysaccharide was then purified and the glucoses involved in the branching points were quantitated after degradation with phosphorylase and debranching enzymes. This method appeared to be useful, not only in enzymatic activity determinations but also in the study of the structure of alpha-D-glucans when combined with those of total polysaccharide quantitation, such as iodine and phenol-sulfuric acid.
Verduijn, J; Milaneschi, Y; Schoevers, R A; van Hemert, A M; Beekman, A T F; Penninx, B W J H
2015-09-29
Meta-analyses support the involvement of different pathophysiological mechanisms (inflammation, hypothalamic-pituitary (HPA)-axis, neurotrophic growth and vitamin D) in major depressive disorder (MDD). However, it remains unknown whether dysregulations in these mechanisms are more pronounced when MDD progresses toward multiple episodes and/or chronicity. We hypothesized that four central pathophysiological mechanisms of MDD are not only involved in etiology, but also associated with clinical disease progression. Therefore, we expected to find increasingly more dysregulation across consecutive stages of MDD progression. The sample from the Netherlands Study of Depression and Anxiety (18-65 years) consisted of 230 controls and 2333 participants assigned to a clinical staging model categorizing MDD in eight stages (0, 1A, 1B, 2, 3A, 3B, 3C and 4), from familial risk at MDD (stage 0) to chronic MDD (stage 4). Analyses of covariance examined whether pathophysiological mechanism markers (interleukin (IL)-6, C-reactive protein (CRP), cortisol, brain-derived neurotrophic factor and vitamin D) showed a linear trend across controls, those at risk for MDD (stages 0, 1A and 1B), and those with full-threshold MDD (stages 2, 3A, 3B, 3C and 4). Subsequently, pathophysiological differences across separate stages within those at risk and with full-threshold MDD were examined. A linear increase of inflammatory markers (CRP P=0.026; IL-6 P=0.090), cortisol (P=0.025) and decrease of vitamin D (P<0.001) was found across the entire sample (for example, from controls to those at risk and those with full-threshold MDD). Significant trends of dysregulations across stages were present in analyses focusing on at-risk individuals (IL-6 P=0.050; cortisol P=0.008; vitamin D P<0.001); however, no linear trends were found in dysregulations for any of the mechanisms across more progressive stages of full-threshold MDD. Our results support that the examined pathophysiological mechanisms are
Nakajima, H; Kita, Y; Hashimoto, S; Tsukada, W; Abe, S; Mizuno, D
1983-12-01
DMG, a degraded D-manno-D-glucan from the culture fluid of Microellobosporia grisea, inhibited the growth of murine syngeneic MM46 mammary carcinoma. Mice in which the tumor had completely regressed by DMG treatment showed tumor-specific antitumor resistance. The antitumor action of DMG was studied by examining the influences of DMG on tumor-specific and non-specific immune responses in tumor-bearing hosts. The tumor-specific delayed hypersensitivity reaction appeared transiently on day 7 after tumor inoculation but had decreased by day 15 in untreated tumor-bearing mice. In contrast, the reaction was retained and augmented in DMG-treated tumor-bearing mice. The tumor-neutralizing activity of spleen cells from DMG-treated tumor-bearing mice, tested by a Winn assay, was tumor-specific and significantly higher than that of untreated tumor-bearing mice. The tumor-neutralizing activity of peritoneal cells and the in vitro cytostatic activity of peritoneal macrophages in response to lymphokine supernatants containing macrophage activation factor were also augmented by DMG treatment. In contrast, the level of antitumor antibody in the serum increased with time, irrespective of DMG administration. Thus, DMG potentiated cellular antitumor effector mechanisms.
Czech Academy of Sciences Publication Activity Database
Cseh, A.; Kruppa, K.; Molnár, I.; Rakszegi, M.; Doležel, Jaroslav; Molnár-Láng, M.
2011-01-01
Roč. 54, č. 10 (2011), s. 795-804 ISSN 0831-2796 Institutional research plan: CEZ:AV0Z50380511 Keywords : wheat–barley chromosome translocation * β-d-glucan * centromere Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.653, year: 2011
Directory of Open Access Journals (Sweden)
Faezeh Tabesh
2014-01-01
Full Text Available Introduction. Oats are high in soluble fibers and effective in reducing the risk of cardiovascular diseases (CVD. We assessed the effects of beta-glucan from oat bran on serum nitric oxide (NO endothelial function in patients with hypercholesterolemia. Method. Sixty hypercholesterolemic patients were randomly divided to receive an experimental bread rich in beta-glucan from oat bran (intervention or bread rich in wheat fiber (control for four weeks. All subjects had the same diet for two-week baseline period and hypocaloric diet for four weeks of intervention. Serum NO concentration and flow-mediated dilation (FMD were determined before and after the experiment. Results. Mean age of the participants was 51.1 ± 9.3 years and 65% (n=39 were female. After intervention, serum NO concentration increased by 50.2 ± 19.8 μmol/lit in the intervention group (P=0.017, but no change was observed in the control group (17.5 ± 27.5 μmol/lit; P=0.530. No change of FMD was observed in the intervention (0.48 ± 0.78%; P=0.546 or in the control group (0.59 ± 0.92%; P=0.533. Conclusion. Consumption of oat bread for four weeks increases serum NO concentration but has no effect on FMD. Further studies are warranted in this regard.
Energy Technology Data Exchange (ETDEWEB)
Papaspyridi, Lefki-Maria; Christakopoulos, Paul [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Katapodis, Petros [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Biotechnology Laboratory, Department of Biological Applications and Technologies, University of Ioannina, Ioannina (Greece); Gonou-Zagou, Zacharoula; Kapsanaki-Gotsi, Evangelia [Department of Ecology and Systematics, Faculty of Biology, National and Kapodistrian University of Athens, Athens (Greece)
2011-02-15
In this study we maximized biomass production by the basidiomycete Ganoderma australe ATHUM 4345, a species of pharmaceutical interest as it is a valuable source of nutraceuticals, including dietary fibers and glucans. We used the Biolog FF MicroPlate to screen 95 different carbon sources for growth monitoring. The pattern of substrate catabolism forms a substrate assimilation fingerprint, which is useful in selecting components for media optimization of maximum biomass production. Response surface methodology, based on the central composite design was applied to explore the optimum concentrations of carbon and nitrogen sources of culture medium in shake flask cultures. When the improved culture medium was tested in a 20-L stirred tank bioreactor, using 13.7 g/L glucose and 30.0 g/L yeast extract, high biomass yields (10.1{+-}0.4 g/L) and productivity of 0.09 g L{sup -1} h{sup -1} were obtained. The yield coefficients for total glucan and dietary fibers on biomass formed were 94.82{+-}6 and 341.15{+-}12.3 mg/g mycelium dry weight, respectively. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Absorption of Carotenoids and Mechanisms Involved in Their Health-Related Properties.
Cervantes-Paz, Braulio; Victoria-Campos, Claudia I; Ornelas-Paz, José de Jesús
Carotenoids participate in the normal metabolism and function of the human body. They are involved in the prevention of several diseases, especially those related to the inflammation syndrome. Their main mechanisms of action are associated to their potent antioxidant activity and capacity to regulate the expression of specific genes and proteins. Recent findings suggest that carotenoid metabolites may explain several processes where the participation of their parent carotenoids was unclear. The health benefits of carotenoids strongly depend on their absorption and transformation during gastrointestinal digestion. The estimation of the 'bioaccessibility' of carotenoids through in vitro models have made possible the evaluation of the effect of a large number of factors on key stages of carotenoid digestion and intestinal absorption. The bioaccessibility of these compounds allows us to have a clear idea of their potential bioavailability, a term that implicitly involves the biological activity of these compounds.
Mechanisms involved in metformin action in the treatment of polycystic ovary syndrome.
Motta, A B
2009-01-01
The N, N' dimethyl-biguanide : Metformin is an antidiabetic drug that increases glucose utilization in insulin-sensitive tissues. As Polycystic Ovary Syndrome (PCOS) and diabetes share some altered parameters-such as abnormal glucose: insulin ratio, altered lipidic metabolism and insulin-resistance syndrome- the use of metformin has become increasingly accepted and widespread in the treatment of PCOS. Currently, metformin is used to induce ovulation and during early pregnancy in PCOS patients, however, a complete knowledge of the metformin action has not been achieved yet. This review describes beyond the classical reproductive action of metformin and explores other benefits of the drug. In addition, the present work discusses the molecular mechanisms involved further than the classical pathway that involves the AMP-activated protein kinase.
Liu, Ling; Kupiainen-Määttä, Oona; Zhang, Haijie; Li, Hao; Zhong, Jie; Kurtén, Theo; Vehkamäki, Hanna; Zhang, Shaowen; Zhang, Yunhong; Ge, Maofa; Zhang, Xiuhui; Li, Zesheng
2018-06-01
The formation of atmospheric aerosol particles from condensable gases is a dominant source of particulate matter in the boundary layer, but the mechanism is still ambiguous. During the clustering process, precursors with different reactivities can induce various chemical reactions in addition to the formation of hydrogen bonds. However, the clustering mechanism involving chemical reactions is rarely considered in most of the nucleation process models. Oxocarboxylic acids are common compositions of secondary organic aerosol, but the role of oxocarboxylic acids in secondary organic aerosol formation is still not fully understood. In this paper, glyoxylic acid, the simplest and the most abundant atmospheric oxocarboxylic acid, has been selected as a representative example of oxocarboxylic acids in order to study the clustering mechanism involving hydration reactions using density functional theory combined with the Atmospheric Clusters Dynamic Code. The hydration reaction of glyoxylic acid can occur either in the gas phase or during the clustering process. Under atmospheric conditions, the total conversion ratio of glyoxylic acid to its hydration reaction product (2,2-dihydroxyacetic acid) in both gas phase and clusters can be up to 85%, and the product can further participate in the clustering process. The differences in cluster structures and properties induced by the hydration reaction lead to significant differences in cluster formation rates and pathways at relatively low temperatures.
Lozano-Cuenca, J.; González-Hernández, A.; López-Canales, O.A.; Villagrana-Zesati, J.R.; Rodríguez-Choreão, J.D.; Morín-Zaragoza, R.; Castillo-Henkel, E.F.; López-Canales, J.S.
2017-01-01
Clobenzorex is a metabolic precursor of amphetamine indicated for the treatment of obesity. Amphetamines have been involved with cardiovascular side effects such as hypertension and pulmonary arterial hypertension. The aim of the present study was to investigate whether the direct application of 10?9?10?5 M clobenzorex on isolated phenylephrine-precontracted rat aortic rings produces vascular effects, and if so, what mechanisms may be involved. Clobenzorex produced an immediate concentration-...
Granger, Bruce L
2018-01-01
Yeast wall protein 1 (Ywp1) is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp) was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA) epitopes inserted into wall
Directory of Open Access Journals (Sweden)
Bruce L Granger
Full Text Available Yeast wall protein 1 (Ywp1 is an abundant glycoprotein of the cell wall of the yeast form of Candida albicans, the most prevalent fungal pathogen of humans. Antibodies that bind to the polypeptide backbone of isolated Ywp1 show little binding to intact yeast cells, presumably because the Ywp1 epitopes are masked by the polysaccharides of the mannoproteins that form the outer layer of the cell wall. Rare cells do exhibit much greater anti-Ywp1 binding, however, and one of these was isolated and characterized. No differences were seen in its Ywp1, but it exhibited greater adhesiveness, sensitivity to wall perturbing agents, and exposure of its underlying β-1,3-glucan layer to external antibodies. The molecular basis for this greater epitope accessibility has not been determined, but has facilitated exploration of how these properties change as a function of cell growth and morphology. In addition, previously engineered strains with reduced quantities of Ywp1 in their cell walls were also found to have greater β-1,3-glucan exposure, indicating that Ywp1 itself contributes to the masking of wall epitopes, which may be important for understanding the anti-adhesive effect of Ywp1. Ectopic production of Ywp1 by hyphae, which reduces the adhesivity of these filamentous forms of C. albicans, was similarly found to reduce exposure of the β-1,3-glucan in their walls. To monitor Ywp1 in the cell wall irrespective of its accessibility, green fluorescent protein (Gfp was genetically inserted into wall-anchored Ywp1 using a bifunctional cassette that also allowed production from a single transfection of a soluble, anchor-free version. The wall-anchored Ywp1-Gfp-Ywp1 accumulated in the wall of the yeast forms but not hyphae, and appeared to have properties similar to native Ywp1, including its adhesion-inhibiting effect. Some pseudohyphal walls also detectably accumulated this probe. Strains of C. albicans with tandem hemagglutinin (HA epitopes inserted into
An overview of potential molecular mechanisms involved in VSMC phenotypic modulation.
Zhang, Ming-Jie; Zhou, Yi; Chen, Lei; Wang, Yan-Qin; Wang, Xu; Pi, Yan; Gao, Chang-Yue; Li, Jing-Cheng; Zhang, Li-Li
2016-02-01
The fully differentiated medial vascular smooth muscle cells (VSMCs) of mature vessels keep quiescent and contractile. However, VSMC can exhibit the plasticity in phenotype switching from a differentiated and contractile phenotype to a dedifferentiated state in response to alterations in local environmental cues, which is called phenotypic modulation or switching. Distinguishing from its differentiated state expressing more smooth muscle (SM)-specific/selective proteins, the phenotypic modulation in VSMC is characterized by an increased rate of proliferation, migration, synthesis of extracellular matrix proteins and decreased expression of SM contractile proteins. Although it has been well demonstrated that phenotypic modulation of VSMC contributes to the occurrence and progression of many proliferative vascular diseases, little is known about the details of the molecular mechanisms of VSMC phenotypic modulation. Growing evidence suggests that variety of molecules including microRNAs, cytokines and biochemical factors, membrane receptors, ion channels, cytoskeleton and extracellular matrix play important roles in controlling VSMC phenotype. The focus of the present review is to provide an overview of potential molecular mechanisms involved in VSMC phenotypic modulation in recent years. To clarify VSMC differentiation and phenotypic modulation mechanisms will contribute to producing cell-based therapeutic interventions for aberrant VSMC differentiation-related diseases.
International Nuclear Information System (INIS)
Merini, Luciano J.; Bobillo, Cecilia; Cuadrado, Virginia; Corach, Daniel; Giulietti, Ana M.
2009-01-01
Atrazine impact on human health and the environment have been extensively studied. Phytoremediation emerged as a low cost, environmental friendly biotechnological solution for atrazine pollution in soil and water. In vitro atrazine tolerance assays were performed and Lolium multiflorum was found as a novel tolerant species, able to germinate and grow in the presence of 1 mg kg -1 of the herbicide. L. multiflorum presented 20% higher atrazine removal capacity than the natural attenuation, with high initial degradation rate in microcosms. The mechanisms involved in atrazine tolerance such as mutation in psbA gene, enzymatic detoxification via P 450 or chemical hydrolysis through benzoxazinones were evaluated. It was demonstrated that atrazine tolerance is conferred by enhanced enzymatic detoxification via P 450 . Due to its atrazine degradation capacity in soil and its agronomical properties, L. multiflorum is a candidate for designing phytoremediation strategies for atrazine contaminated agricultural soils, especially those involving run-off avoiding. - Finding of a novel atrazine-tolerant species, as a potential candidate for phytoremediating herbicide-contaminated agriculture soils and elucidation of the mechanisms involved in tolerance.
Energy Technology Data Exchange (ETDEWEB)
Merini, Luciano J. [Catedra de Microbiologia Industrial y Biotecnologia, Universidad de Buenos Aires (Argentina); Bobillo, Cecilia [Servicio de Huellas Digitales Geneticas, Facultad de Farmacia y Bioquimica, Microbiologia Industrial y Biotecnologia, Universidad de Buenos Aires, Junin 956, BS As (Argentina); Cuadrado, Virginia [Catedra de Microbiologia Industrial y Biotecnologia, Universidad de Buenos Aires (Argentina); Corach, Daniel [Servicio de Huellas Digitales Geneticas, Facultad de Farmacia y Bioquimica, Microbiologia Industrial y Biotecnologia, Universidad de Buenos Aires, Junin 956, BS As (Argentina); Giulietti, Ana M., E-mail: agiule@ffyb.uba.a [Catedra de Microbiologia Industrial y Biotecnologia, Universidad de Buenos Aires (Argentina)
2009-11-15
Atrazine impact on human health and the environment have been extensively studied. Phytoremediation emerged as a low cost, environmental friendly biotechnological solution for atrazine pollution in soil and water. In vitro atrazine tolerance assays were performed and Lolium multiflorum was found as a novel tolerant species, able to germinate and grow in the presence of 1 mg kg{sup -1} of the herbicide. L. multiflorum presented 20% higher atrazine removal capacity than the natural attenuation, with high initial degradation rate in microcosms. The mechanisms involved in atrazine tolerance such as mutation in psbA gene, enzymatic detoxification via P{sub 450} or chemical hydrolysis through benzoxazinones were evaluated. It was demonstrated that atrazine tolerance is conferred by enhanced enzymatic detoxification via P{sub 450}. Due to its atrazine degradation capacity in soil and its agronomical properties, L. multiflorum is a candidate for designing phytoremediation strategies for atrazine contaminated agricultural soils, especially those involving run-off avoiding. - Finding of a novel atrazine-tolerant species, as a potential candidate for phytoremediating herbicide-contaminated agriculture soils and elucidation of the mechanisms involved in tolerance.
Kozyrev, S A; Nikitin, V P
2013-03-01
We studied the involvement of translation and transcription processes into behavioral and neuronal mechanisms of reconsolidation of the long-term memory of the conditioned taste aversion in edible snails. Injection of cycloheximide (an inhibitor of protein synthesis) to the snails in 48 h after training combined with subsequent reminder and presentation of the conditional stimulus resulted in the development of persistent amnesia and depression of the responses of the defensive behavior command neurons LPl1 and RPl1 to the conditional stimulus. Injection of mRNA synthesis inhibitors actinomycin D or DRB (5,6-dichloro-1-β-D-ribofuranosylbenzimidasole) in 48 h after conditioning with subsequent reminding procedure produced no effects on memory retention and on the responses of the command neurons to the conditional stimulus. The study suggests that the proteins translated from previously synthesized and stored mRNA were involved in the mechanisms of reconsolidation of the memory responsible for conditioned taste aversion.
Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.
Hierarchy of mechanisms involved in generating Na/K-ATPase polarity in MDCK epithelial cells
Mays, R.W.; Siemers, K.A.; Fritz, B.A.; Lowe, A.W.; van Meer, G.; Nelson, W.J.
1995-01-01
We have studied mechanisms involved in generating a polarized distribution of Na/K-ATPase in the basal-lateral membrane of two clones of MDCK II cells. Both clones exhibit polarized distributions of marker proteins of the apical and basal-lateral membranes, including Na/K-ATPase, at steady state.
Azoulay, Elie; Guigue, Nicolas; Darmon, Michael; Mokart, Djamel; Lemiale, Virginie; Kouatchet, Achille; Mayaux, Julien; Vincent, François; Nyunga, Martine; Bruneel, Fabrice; Rabbat, Antoine; Bretagne, Stéphane; Lebert, Christine; Meert, Anne-Pascale; Benoit, Dominique; Pene, Frédéric
2016-04-19
Invasive fungal infections (IFIs) are life-threatening complications of hematological malignancies that must be diagnosed early to allow effective treatment. Few data are available on the performance of serum (1-3)-β-D-glucan (BG) assays for diagnosing IFI in patients with hematological malignancies admitted to the intensive care unit (ICU). In this study, 737 consecutive patients with hematological malignancies admitted to 17 ICUs routinely underwent a BG assay at ICU admission. IFIs were diagnosed using standard criteria applied by three independent specialists. Among the 737 patients, 439 (60%) required mechanical ventilation and 273 (37%) died before hospital discharge. Factors known to alter BG concentrations were identified in most patients. IFIs were documented in 78 (10.6%) patients (invasive pulmonary aspergillosis, n = 54; Pneumocystis jirovecii pneumonia, n = 13; candidemia, n = 13; and fusarium infections, n = 3). BG concentrations (pg/mL) were higher in patients with than without IFI (144 (77-510) vs. 50 (30-125), 80 pg/mL were IFI, admission SOFA score, autologous bone-marrow or hematopoietic stem-cell transplantation, and microbiologically documented bacterial infection. In conclusion, in unselected critically ill hematology patients with factors known to affect serum BG, this biomarker showed only moderate diagnostic performance and rarely detected IFI. However, the negative predictive value was high. Studies are needed to assess whether a negative BG test indicates that antifungal de-escalation is safe.
Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M
2015-10-01
Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.
Sendid, B; Dotan, N; Nseir, S; Savaux, C; Vandewalle, P; Standaert, A; Zerimech, F; Guery, B P; Dukler, A; Colombel, J F; Poulain, D
2008-12-01
Antibodies against Saccharomyces cerevisiae mannan (ASCA) and antibodies against synthetic disaccharide fragments of glucans (ALCA) and chitin (ACCA) are biomarkers of Crohn's disease (CD). We previously showed that Candida albicans infection generates ASCA. Here, we explored ALCA and ACCA as possible biomarkers of invasive C. albicans infection (ICI). ASCA, ALCA, ACCA, and Candida mannan antigen and antibody detection tests were performed on 69 sera obtained sequentially from 18 patients with ICIs proven by blood culture, 59 sera from CD patients, 47 sera from hospitalized subjects colonized by Candida species (CZ), and 131 sera from healthy controls (HC). ASCA, ALCA, and ACCA levels in CD and ICI patients were significantly different from those in CZ and HC subjects (PACCA, and Platelia Candida tests, 100% of ICIs were detected, with the kinetics of the antibody response depending on the patient during the time course of infection. A large number of sera presented with more than three positive tests. This is the first evidence that the detection of antibodies against chitin and glucans has diagnostic value in fungal infections and that these tests can complement more specific tests. Future trials are necessary to assess the value of these tests in multiparametric analysis, as well as their pathophysiological relevance.
Numerical and Experimental Study of Mechanisms Involved in Boiling Histotripsy.
Pahk, Ki Joo; Gélat, Pierre; Sinden, David; Dhar, Dipok Kumar; Saffari, Nader
2017-12-01
The aim of boiling histotripsy is to mechanically fractionate tissue as an alternative to thermal ablation for therapeutic applications. In general, the shape of a lesion produced by boiling histotripsy is tadpole like, consisting of a head and a tail. Although many studies have demonstrated the efficacy of boiling histotripsy for fractionating solid tumors, the exact mechanisms underpinning this phenomenon are not yet well understood, particularly the interaction of a boiling vapor bubble with incoming incident shockwaves. To investigate the mechanisms involved in boiling histotripsy, a high-speed camera with a passive cavitation detection system was used to observe the dynamics of bubbles produced in optically transparent tissue-mimicking gel phantoms exposed to the field of a 2.0-MHz high-intensity focused ultrasound (HIFU) transducer. We observed that boiling bubbles were generated in a localized heated region and cavitation clouds were subsequently induced ahead of the expanding bubble. This process was repeated with HIFU pulses and eventually resulted in a tadpole-shaped lesion. A simplified numerical model describing the scattering of the incident ultrasound wave by a vapor bubble was developed to help interpret the experimental observations. Together with the numerical results, these observations suggest that the overall size of a lesion induced by boiling histotripsy is dependent on the sizes of (i) the heated region at the HIFU focus and (ii) the backscattered acoustic field by the original vapor bubble. Copyright © 2017 World Federation for Ultrasound in Medicine and Biology. Published by Elsevier Inc. All rights reserved.
Gangoiti, Joana; Lamothe, Lisa; van Leeuwen, Sander Sebastiaan; Vafiadi, Christina; Dijkhuizen, Lubbert
2017-01-01
Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4) glucan chains connected by alternating (α1→4)/(α1→6) linkages and (α1→4,6)
Conde de la Rosa, L; Schoemaker, MH; Vrenken, TE; Buist-Homan, M; Havinga, R; Jansen, PLM; Moshage, H
Background/Aims: In liver diseases, reactive oxygen species (ROS) are involved in cell death and liver injury, but the mechanisms are not completely elucidated. To elucidate the mechanisms of hepatocyte cell death induced by the ROS superoxide anions and hydrogen peroxide, primary cultures of
Conde de la Rosa, Laura; Schoemaker, Marieke H.; Vrenken, Titia E.; Buist-Homan, Manon; Havinga, Rick; Jansen, Peter L. M.; Moshage, Han
2006-01-01
BACKGROUND/AIMS: In liver diseases, reactive oxygen species (ROS) are involved in cell death and liver injury, but the mechanisms are not completely elucidated. To elucidate the mechanisms of hepatocyte cell death induced by the ROS superoxide anions and hydrogen peroxide, primary cultures of
Coral bleaching under thermal stress: putative involvement of host/symbiont recognition mechanisms.
Vidal-Dupiol, Jeremie; Adjeroud, Mehdi; Roger, Emmanuel; Foure, Laurent; Duval, David; Mone, Yves; Ferrier-Pages, Christine; Tambutte, Eric; Tambutte, Sylvie; Zoccola, Didier; Allemand, Denis; Mitta, Guillaume
2009-08-04
Coral bleaching can be defined as the loss of symbiotic zooxanthellae and/or their photosynthetic pigments from their cnidarian host. This major disturbance of reef ecosystems is principally induced by increases in water temperature. Since the beginning of the 1980s and the onset of global climate change, this phenomenon has been occurring at increasing rates and scales, and with increasing severity. Several studies have been undertaken in the last few years to better understand the cellular and molecular mechanisms of coral bleaching but the jigsaw puzzle is far from being complete, especially concerning the early events leading to symbiosis breakdown. The aim of the present study was to find molecular actors involved early in the mechanism leading to symbiosis collapse. In our experimental procedure, one set of Pocillopora damicornis nubbins was subjected to a gradual increase of water temperature from 28 degrees C to 32 degrees C over 15 days. A second control set kept at constant temperature (28 degrees C). The differentially expressed mRNA between the stressed states (sampled just before the onset of bleaching) and the non stressed states (control) were isolated by Suppression Subtractive Hybridization. Transcription rates of the most interesting genes (considering their putative function) were quantified by Q-RT-PCR, which revealed a significant decrease in transcription of two candidates six days before bleaching. RACE-PCR experiments showed that one of them (PdC-Lectin) contained a C-Type-Lectin domain specific for mannose. Immunolocalisation demonstrated that this host gene mediates molecular interactions between the host and the symbionts suggesting a putative role in zooxanthellae acquisition and/or sequestration. The second gene corresponds to a gene putatively involved in calcification processes (Pdcyst-rich). Its down-regulation could reflect a trade-off mechanism leading to the arrest of the mineralization process under stress. Under thermal stress
Directory of Open Access Journals (Sweden)
Yano Takahisa
2011-01-01
Full Text Available Abstract Background Oxaliplatin is a platinum-based chemotherapy drug characterized by the development of acute and chronic peripheral neuropathies. The chronic neuropathy is a dose-limiting toxicity. We previously reported that repeated administration of oxaliplatin induced cold hyperalgesia in the early phase and mechanical allodynia in the late phase in rats. In the present study, we investigated the involvement of NR2B-containing N-methyl-D-aspartate (NMDA receptors in oxaliplatin-induced mechanical allodynia in rats. Results Repeated administration of oxaliplatin (4 mg/kg, i.p., twice a week caused mechanical allodynia in the fourth week, which was reversed by intrathecal injection of MK-801 (10 nmol and memantine (1 μmol, NMDA receptor antagonists. Similarly, selective NR2B antagonists Ro25-6981 (300 nmol, i.t. and ifenprodil (50 mg/kg, p.o. significantly attenuated the oxaliplatin-induced pain behavior. In addition, the expression of NR2B protein and mRNA in the rat spinal cord was increased by oxaliplatin on Day 25 (late phase but not on Day 5 (early phase. Moreover, we examined the involvement of nitric oxide synthase (NOS as a downstream target of NMDA receptor. L-NAME, a non-selective NOS inhibitor, and 7-nitroindazole, a neuronal NOS (nNOS inhibitor, significantly suppressed the oxaliplatin-induced pain behavior. The intensity of NADPH diaphorase staining, a histochemical marker for NOS, in the superficial layer of spinal dorsal horn was obviously increased by oxaliplatin, and this increased intensity was reversed by intrathecal injection of Ro25-6981. Conclusion These results indicated that spinal NR2B-containing NMDA receptors are involved in the oxaliplatin-induced mechanical allodynia.
Complement Involvement in Periodontitis: Molecular Mechanisms and Rational Therapeutic Approaches.
Hajishengallis, George; Maekawa, Tomoki; Abe, Toshiharu; Hajishengallis, Evlambia; Lambris, John D
2015-01-01
The complement system is a network of interacting fluid-phase and cell surface-associated molecules that trigger, amplify, and regulate immune and inflammatory signaling pathways. Dysregulation of this finely balanced network can destabilize host-microbe homeostasis and cause inflammatory tissue damage. Evidence from clinical and animal model-based studies suggests that complement is implicated in the pathogenesis of periodontitis, a polymicrobial community-induced chronic inflammatory disease that destroys the tooth-supporting tissues. This review discusses molecular mechanisms of complement involvement in the dysbiotic transformation of the periodontal microbiome and the resulting destructive inflammation, culminating in loss of periodontal bone support. These mechanistic studies have additionally identified potential therapeutic targets. In this regard, interventional studies in preclinical models have provided proof-of-concept for using complement inhibitors for the treatment of human periodontitis.
Directory of Open Access Journals (Sweden)
Xiao-Qiang Han
Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.
Evidence for the involvement of MC4 receptors in the central mechanisms of opioid antinociception
Starowicz, Katarzyna
2005-01-01
The data described in this thesis extend general knowledge of the involvement of the MC4 receptor in mechanisms of analgesia. The following aspects outlined below constitute novel information. Firstly, the MC4R localization in the DRG is demonstrated. The MC4 receptor was assumed to exist
International Nuclear Information System (INIS)
Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R.; Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N.
2015-01-01
The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with 99m Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with 32 P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with 99m Tc by the direct labeling method. The stability of the 99m Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with 99m Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The 32 P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with 99m Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals infected with C. albicans presented a
Incorporation of β-glucans in meat emulsions through an optimal mixture modeling systems.
Vasquez Mejia, Sandra M; de Francisco, Alicia; Manique Barreto, Pedro L; Damian, César; Zibetti, Andre Wüst; Mahecha, Hector Suárez; Bohrer, Benjamin M
2018-05-22
The effects of β-glucans (βG) in beef emulsions with carrageenan and starch were evaluated using an optimal mixture modeling system. The best mathematical models to describe the cooking loss, color, and textural profile analysis (TPA) were selected and optimized. The cubic models were better to describe the cooking loss, color, and TPA parameters, with the exception of springiness. Emulsions with greater levels of βG and starch had less cooking loss (54 and <62), and greater hardness, cohesiveness and springiness values. Subsequently, during the optimization phase, the use of carrageenan was eliminated. The optimized emulsion contained 3.13 ± 0.11% βG, which could cover the intake daily of βG recommendations. However, the hardness of the optimized emulsion was greater (60,224 ± 1025 N) than expected. The optimized emulsion had a homogeneous structure and normal thermal behavior by DSC and allowed for the manufacture of products with high amounts of βG and desired functional attributes. Copyright © 2018 Elsevier Ltd. All rights reserved.
A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.
Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji
2011-06-07
The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur
Hrckova, G; Velebný, S; Obwaller, A; Auer, H; Kogan, G
2007-01-01
Anthelmintic activity of benzimidazole carbamate anthelmintics is low against dormant Toxocara canis larvae during late infections in paratenic hosts. The present study was conducted to examine the efficacy of pure fenbendazole, or drug incorporated into sterically stabilized liposomes (SL-FBZ) administered to T. canis-infected mice alone and after its co-administration with the immunomodulator (1-->3)-beta-D-glucan against larvae localized in muscles and brains. Therapy with either drug forms (in total 250 mg/kg in 10 doses) commenced on day 28 post-infection (p.i.) and the efficacy of treatment, examined on day 30 after the last dose of drug, was the highest in groups of mice treated with SL-FBZ in combination with glucan (89.5+/-5.8% in the muscles, 66.1+/-8.1% in brains). During 56 days of follow-up after termination of therapy, serum levels of anti-TES IgG antibodies, circulating IgG-TES immune complexes (CIC) as well as IgG antibodies to the most immunogenic part of recombinant myosin antigen of T. canis larvae were investigated. In contrast to anti-TES IgG antibodies, levels of CIC and anti-myosin antibodies were in the linear correlation with the efficacy of treatments beginning from day 38 post-therapy. We also showed that the serum levels of CIC as well as anti-myosin IgG antibodies seem to be the suitable serological markers for the monitoring of progress in larval destruction and TES resorption from the tissues.
Directory of Open Access Journals (Sweden)
Roberto G. Pozner
2013-01-01
Full Text Available Viral hemorrhagic fevers (VHFs caused by arenaviruses are acute diseases characterized by fever, headache, general malaise, impaired cellular immunity, eventual neurologic involvement, and hemostatic alterations that may ultimately lead to shock and death. The causes of the bleeding are still poorly understood. However, it is generally accepted that these causes are associated to some degree with impaired hemostasis, endothelial cell dysfunction and low platelet counts or function. In this article, we present the current knowledge about the hematological alterations present in VHF induced by arenaviruses, including new aspects on the underlying pathogenic mechanisms.
Coral bleaching under thermal stress: putative involvement of host/symbiont recognition mechanisms
Directory of Open Access Journals (Sweden)
Tambutte Sylvie
2009-08-01
Full Text Available Abstract Background Coral bleaching can be defined as the loss of symbiotic zooxanthellae and/or their photosynthetic pigments from their cnidarian host. This major disturbance of reef ecosystems is principally induced by increases in water temperature. Since the beginning of the 1980s and the onset of global climate change, this phenomenon has been occurring at increasing rates and scales, and with increasing severity. Several studies have been undertaken in the last few years to better understand the cellular and molecular mechanisms of coral bleaching but the jigsaw puzzle is far from being complete, especially concerning the early events leading to symbiosis breakdown. The aim of the present study was to find molecular actors involved early in the mechanism leading to symbiosis collapse. Results In our experimental procedure, one set of Pocillopora damicornis nubbins was subjected to a gradual increase of water temperature from 28°C to 32°C over 15 days. A second control set kept at constant temperature (28°C. The differentially expressed mRNA between the stressed states (sampled just before the onset of bleaching and the non stressed states (control were isolated by Suppression Subtractive Hybridization. Transcription rates of the most interesting genes (considering their putative function were quantified by Q-RT-PCR, which revealed a significant decrease in transcription of two candidates six days before bleaching. RACE-PCR experiments showed that one of them (PdC-Lectin contained a C-Type-Lectin domain specific for mannose. Immunolocalisation demonstrated that this host gene mediates molecular interactions between the host and the symbionts suggesting a putative role in zooxanthellae acquisition and/or sequestration. The second gene corresponds to a gene putatively involved in calcification processes (Pdcyst-rich. Its down-regulation could reflect a trade-off mechanism leading to the arrest of the mineralization process under stress
Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin
2014-01-01
A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571
Directory of Open Access Journals (Sweden)
Qianqian Wang
2014-09-01
Full Text Available Wheat straw was pretreated by combined mechanical destruction and alkaline pretreatments to enhance enzymatic saccharification. Four strategies were employed to evaluate the potential of wheat straw as a feedstock for fermentable sugar production. The effects of the pretreatments on the substrate morphology, size distribution, chemical composition, and cellulose crystallinity, along with the subsequent enzymatic digestibility, were investigated. Optical microscope images showed that mechanical pretreatment alone resulted in poor fiber defibrillation, wherein samples mostly consisted of rigid fiber bundles, while integrated mechanical destruction and alkaline pretreatment led to relatively good fiber defibrillation. Low temperature NaOH/urea pretreatment can fibrillate the rigid fiber bundles into a relatively loose network and alter the structure of the treated substrate to make cellulose more accessible. The glucan conversion rates were 77% and 95% for integrated mechanical destruction and alkaline pretreatments and mechanical destruction followed by low temperature NaOH/urea and ammonium/urea pretreatments, respectively, after 72 h of enzymatic hydrolysis with enzyme loadings of 10 FPU cellulase per g of oven-dry substrate.
Investigations into the involvement of NMDA mechanisms in recognition memory.
Warburton, E Clea; Barker, Gareth R I; Brown, Malcom W
2013-11-01
This review will focus on evidence showing that NMDA receptor neurotransmission is critical for synaptic plasticity processes within brain regions known to be necessary for the formation of object recognition memories. The aim will be to provide evidence concerning NMDA mechanisms related to recognition memory processes and show that recognition memory for objects, places or associations between objects and places depends on NMDA neurotransmission within the perirhinal cortex, temporal association cortex medial prefrontal cortex and hippocampus. Administration of the NMDA antagonist AP5, selectively into each of these brain regions has revealed that the extent of the involvement NMDA receptors appears dependent on the type of information required to solve the recognition memory task; thus NMDA receptors in the perirhinal cortex are crucial for the encoding of long-term recognition memory for objects, and object-in-place associations, but not for short-term recognition memory or for retrieval. In contrast the hippocampus and medial prefrontal cortex are required for both long-term and short-term recognition memory for places or associations between objects and places, or for recognition memory tasks that have a temporal component. Such studies have therefore confirmed that the multiple brain regions make distinct contributions to recognition memory but in addition that more than one synaptic plasticity process must be involved. This article is part of the Special Issue entitled 'Glutamate Receptor-Dependent Synaptic Plasticity'. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Mechanisms and factors involved in hip injuries during frontal crashes.
Yoganandan, N; Pintar, F A; Gennarelli, T A; Maltese, M R; Eppinger, R H
2001-11-01
This study was conducted to collect data and gain insights relative to the mechanisms and factors involved in hip injuries during frontal crashes and to study the tolerance of hip injuries from this type of loading. Unembalmed human cadavers were seated on a standard automotive seat (reinforced) and subjected to knee impact test to each lower extremity. Varying combinations of flexion and adduction/abduction were used for initial alignment conditions and pre-positioning. Accelerometers were fixed to the iliac wings and twelfth thoracic vertebral spinous process. A 23.4-kg padded pendulum impacted the knee at velocities ranging from 4.3 to 7.6 m/s. The impacting direction was along the anteroposterior axis, i.e., the global X-axis, in the body-fixed coordinate system. A load cell on the front of the pendulum recorded the impact force. Peak impact forces ranged from 2,450 to 10,950 N. The rate of loading ranged from 123 to 7,664 N/msec. The impulse values ranged from 12.4 to 31.9 Nsec. Injuries were not apparent in three tests. Eight tests resulted in trauma. Fractures involving the pelvis including the acetabulum and proximal femur occurred in five out of the eight tests, and distal femoral bone fracture occurred in one test. These results underscore the importance of leg pre-positioning and the orientation of the impacting axis to produce specific types of trauma to the pelvic region of the lower extremity.
New perspectives on the role of α- and β-amylases in transient starch synthesis.
Wu, Alex Chi; Ral, Jean-Philippe; Morell, Matthew K; Gilbert, Robert G
2014-01-01
Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (bio)synthesis of the chain-length distribution (CLD) of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.
New perspectives on the role of α- and β-amylases in transient starch synthesis.
Directory of Open Access Journals (Sweden)
Alex Chi Wu
Full Text Available Transient starch in leaves is synthesized by various biosynthetic enzymes in the chloroplasts during the light period. This paper presents the first mathematical model for the (biosynthesis of the chain-length distribution (CLD of transient starch to aid the understanding of this synthesis. The model expresses the rate of change of the CLD in terms of the actions of the enzymes involved. Using this to simulate the experimental CLD with different enzyme combinations is a new means to test for enzymes that are significant to the rate of change of the CLD during synthesis. Comparison between the simulated CLD from different enzyme combinations and the experimental CLD in the leaves of the model plant Arabidopsis thaliana indicate α-amylase, in addition to the core starch biosynthetic enzymes, is also involved in the modification of glucans for the synthesis of insoluble starch granules. The simulations suggest involvement of β-amylase, in the absence of α-amylase in mutants, slows the rate of attaining a crystalline-competent CLD for crystallization of glucans to form insoluble starch. This suggests a minor role of β-amylase in shaping normal starch synthesis. The model simulation predicts that debranching of glucans is an efficient mechanism for the attainment of crystalline-competent CLD; however, attaining this is still possible, albeit slower, through combinations of α- and β-amylase in the absence of isoamylase-type debranching enzyme. In Arabidopsis defective in one of the isoamylase-type debranching enzymes, the impact of α-amylase in starch synthesis is reduced, while β-amylase becomes significantly involved, slowing the rate of synthesis in this mutant. Modeling of transient starch CLD brings to light previously unrecognized but significant effects of α- and β-amylase on the rate of transient starch synthesis.
Energy Technology Data Exchange (ETDEWEB)
Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R., E-mail: cmslacerda@gmail.com.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N., E-mail: valbertcardoso@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas
2015-07-01
The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with {sup 99m}Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with {sup 32}P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with {sup 99m}Tc by the direct labeling method. The stability of the {sup 99m}Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with {sup 99m}Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The {sup 32}P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with {sup 99m}Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals
Nakajima, H; Hashimoto, S; Kita, Y; Takashi, T; Tsukada, W; Kohno, M; Ogawa, H; Abe, S; Mizuno, D
1983-12-01
DMG, a degraded D-manno-D-glucan with a host-mediated antitumor activity did not significantly enhance nor inhibit the development of suppressor cells for either the antibody-forming response or the delayed hypersensitivity reaction to sheep red blood cells. Cyclophosphamide (CY), which inhibited the generation of suppressor cells, was combined with DMG in treatment of murine syngeneic tumors to obtain a higher antitumor activity. The antitumor activity of the combination against MH134 hepatoma was synergistically higher than that of either component alone. A marked antitumor effect of the combination treatment against MM46 mammary carcinoma was also shown. High levels of antitumor delayed hypersensitivity reactions were observed with this combination therapy. The possible roles of DMG and CY in this combination therapy are discussed.
Mechanisms involved in the chemical inhibition of the Eosin-sensitized photooxidation of trypsin
Energy Technology Data Exchange (ETDEWEB)
Rizzuto, F.; Spikes, J.D.
1975-01-01
A large series of compounds was screened for ability to protect trypsin from eosin-sensitized photodynamic inactivation. Eosin-sensitized photooxidation reactions of this type typically proceed via the triplet state of the dye and often involve singlet state oxygen as the oxidizing entity. In order to determine the mechanisms by which trypsin is protected from photoinactivation, a number of good protective agents (inhibitors) and some non-protective agents were selected for more detailed flash photolysis studies. Good inhibitors such as p-phenylenediamine, n-propyl gallate, serotonin creatinine sulfate and p-toluenediamine competed efficiently with oxygen and with trypsin for reaction with the triplet state of eosin. The inhibitors were shown to quench triplet eosin to the ground state and/or reduce triplet eosin to form the semireduced eosin radical and an oxidized form of the inhibitor. In the latter case, oxidized inhibitor could react by a reverse electron transfer reaction with the semireduced eosin radical to regenerate ground state eosin and the inhibitor. The good inhibitors also competed effectively with trypsin for oxidation by semioxidized eosin, thus giving another possible protective mechanism. Non-inhibitors such as halogen ions and the paramagnetic ions Co/sup + +/, Cu/sup + +/ and Mn/sup + +/ reacted only slowly with triplet and with semioxidized eosin. The primary pathway for the eosin-sensitized photooxidation of trypsin at pH 8.0 involved singlet oxygen, although semioxidized eosin may also participate.
The mechanisms involved at the cell level; Les mecanismes mis en jeu au niveau cellulaire
Energy Technology Data Exchange (ETDEWEB)
Leblanc, G.; Pourcher, Th.; Perron, B. [Nice Univ., Dir. des Sciences du Vivant, Dept. de Biologie Joliot-Curie, 06 (France); Guillain, F. [CEA Grenoble, Dir. des Sciences du Vivant, 38 (France); Quemeneur, E. [CEA Marcoule, Dir. des Sciences du Vivant, 30 (France); Fritsch, P. [CEA Bruyeres le Chatel, Dir. des Sciences du Vivant, 91 (France)
2003-07-01
The mechanisms responsible at the cell level for inducing toxic reactions after contamination are as yet only imperfectly known. Work still needs to be done for both contaminants that have a biological role, such as iodine, and those that do not, such as cadmium, uranium and plutonium. In particular, these mechanisms bring into play, in biological membranes, carriers which are the physiological partners responsible for material exchange with the environment or inside the body. As they lack absolute selectivity, these carriers, which are involved in the assimilation and accumulation of vital mineral elements, also have the ability to transport toxic elements and isotopes. (authors)
Directory of Open Access Journals (Sweden)
Aïsha Sahaï
2017-10-01
Full Text Available Nowadays, interactions with others do not only involve human peers but also automated systems. Many studies suggest that the motor predictive systems that are engaged during action execution are also involved during joint actions with peers and during other human generated action observation. Indeed, the comparator model hypothesis suggests that the comparison between a predicted state and an estimated real state enables motor control, and by a similar functioning, understanding and anticipating observed actions. Such a mechanism allows making predictions about an ongoing action, and is essential to action regulation, especially during joint actions with peers. Interestingly, the same comparison process has been shown to be involved in the construction of an individual's sense of agency, both for self-generated and observed other human generated actions. However, the implication of such predictive mechanisms during interactions with machines is not consensual, probably due to the high heterogeneousness of the automata used in the experimentations, from very simplistic devices to full humanoid robots. The discrepancies that are observed during human/machine interactions could arise from the absence of action/observation matching abilities when interacting with traditional low-level automata. Consistently, the difficulties to build a joint agency with this kind of machines could stem from the same problem. In this context, we aim to review the studies investigating predictive mechanisms during social interactions with humans and with automated artificial systems. We will start by presenting human data that show the involvement of predictions in action control and in the sense of agency during social interactions. Thereafter, we will confront this literature with data from the robotic field. Finally, we will address the upcoming issues in the field of robotics related to automated systems aimed at acting as collaborative agents.
Rando, Roy J; Kwon, Cheol-Woong; Lefante, John J
2014-01-01
In the aftermath of Hurricane Katrina, which devastated the city of New Orleans in August 2005, restoration workers were at risk for respiratory illness from exposure to airborne particles and microbial agents. In support of an epidemiologic investigation of this risk, an exposure assessment for restoration work activities (demolition, trash & debris management, landscape restoration, sewer/waterline repair, and mold remediation) was performed from 2005 to 2012. For 2005 and 2006, Occupational Safety and Health Administration (OSHA) data (n = 730) for personal and area monitoring of total and respirable dust exposures of restoration workers were accessed and analyzed. The most significant exposures were for demolition work, with average respirable dust exposures in 2005 above the action level of 2.5 mg/m(3) and 17.6% of exposures exceeding the permissible exposure limit (PEL) (5 mg/m(3)). Additional personal and area monitoring for thoracic particulate matter was performed from 2007 to 2012 (n = 774) and samples were assayed for endotoxin and (1→3, 1→6)-β-D-glucan (n = 202). In order to integrate the OSHA data with the later monitoring data, three independent predictive models were developed to convert total and respirable dust measures into the equivalent thoracic dust. The three models were not statistically different and the modeling results were in good agreement with an overall coefficient of variation of 16% for the thoracic dust means across work activities estimated by each of the three models. Overall, thoracic dust exposure levels decreased by about an order of magnitude within the first year after Katrina and then more gradually declined and stabilized through 2012. Estimated average exposures to endotoxin and microbial glucan in 2005 were as high as 256 EU/m(3) and 118 μg/m(3), respectively, and likewise were seen to decrease dramatically and stabilize after 2005. The results of this exposure assessment support previously published reports of
Wan, Ruiqian; Weigand, Letitia A.; Bateman, Ryan; Griffioen, Kathleen; Mendelowitz, David; Mattson, Mark P.
2014-01-01
Autonomic control of heart rate is mediated by cardioinhibitory parasympathetic cholinergic neurons located in the brainstem and stimulatory sympathetic noradrenergic neurons. During embryonic development the survival and cholinergic phenotype of brainstem autonomic neurons is promoted by brain-derived neurotrophic factor (BDNF). We now provide evidence that BDNF regulates heart rate by a mechanism involving increased brainstem cardioinhibitory parasympathetic activity. Mice with a BDNF haplo...
Mosquitoes of various species mate in swarms comprised of tens to thousands flying males. Yet little information is known about mosquito swarming mechanism. Discovering chemical cues involved in mosquito biology leads to better adaptation of disease control interventions. In this study, we aimed ...
Rosales-Reynoso, M A; Ochoa-Hernández, A B; Juárez-Vázquez, C I; Barros-Núñez, P
Today, scientists accept that the central nervous system of an adult possesses considerable morphological and functional flexibility, allowing it to perform structural remodelling processes even after the individual is fully developed and mature. In addition to the vast number of genes participating in the development of memory, different known epigenetic mechanisms are involved in normal and pathological modifications to neurons and therefore also affect the mechanisms of memory development. This study entailed a systematic review of biomedical article databases in search of genetic and epigenetic factors that participate in synaptic function and memory. The activation of gene expression in response to external stimuli also occurs in differentiated nerve cells. Neural activity induces specific forms of synaptic plasticity that permit the creation and storage of long-term memory. Epigenetic mechanisms play a key role in synaptic modification processes and in the creation and development of memory. Changes in these mechanisms result in the cognitive and memory impairment seen in neurodegenerative diseases (Alzheimer disease, Huntington disease) and in neurodevelopmental disorders (Rett syndrome, fragile X, and schizophrenia). Nevertheless, results obtained from different models are promising and point to potential treatments for some of these diseases. Copyright © 2013 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.
Irlbacher, Kerstin; Kraft, Antje; Kehrer, Stefanie; Brandt, Stephan A
2014-10-01
Cognitive control can be reactive or proactive in nature. Reactive control mechanisms, which support the resolution of interference, start after its onset. Conversely, proactive control involves the anticipation and prevention of interference prior to its occurrence. The interrelation of both types of cognitive control is currently under debate: Are they mediated by different neuronal networks? Or are there neuronal structures that have the potential to act in a proactive as well as in a reactive manner? This review illustrates the way in which integrating knowledge gathered from behavioral studies, functional imaging, and human electroencephalography proves useful in answering these questions. We focus on studies that investigate interference resolution at the level of working memory representations. In summary, different mechanisms are instrumental in supporting reactive and proactive control. Distinct neuronal networks are involved, though some brain regions, especially pre-SMA, possess functions that are relevant to both control modes. Therefore, activation of these brain areas could be observed in reactive, as well as proactive control, but at different times during information processing. Copyright © 2014 Elsevier Ltd. All rights reserved.
Mechanism(s) involved in opioid drug abuse modulation of HAND.
Dutta, Raini; Roy, Sabita
2012-07-01
Drug abuse and HIV infection are interlinked. From the onset of the HIV/AIDS epidemic, the impact of illicit drug use on HIV disease progression has been a focus of many investigations. Both laboratory-based and epidemiological studies strongly indicate that drug abuse may exacerbate HIV disease progression and increase mortality and morbidity in these patients. Increase susceptibility to opportunistic infection has been implicated as one of the major causes for this detriment. Furthermore, opioids are known to elicit prevalence of neurodegenerative disorders in HIV-infected patients. Numerous authors have delineated various molecular as well as cellular mechanisms associated with neurological complications in these patients. This review gives an overview of these findings. Understanding the mechanisms will allow for the development of targeted therapies aimed at reducing the progression of neurocognitive decline in the drug abusing HIV infected individuals.
Directory of Open Access Journals (Sweden)
de Morais Marcos A
2011-08-01
Full Text Available Abstract Background Polyhexamethylene biguanide (PHMB is an antiseptic polymer that is mainly used for cleaning hospitals and pools and combating Acantamoeba infection. Its fungicide activity was recently shown by its lethal effect on yeasts that contaminate the industrial ethanol process, and on the PE-2 strain of Saccharomyces cerevisiae, one of the main fermenting yeasts in Brazil. This pointed to the need to know the molecular mechanism that lay behind the cell resistance to this compound. In this study, we examined the factors involved in PHMB-cell interaction and the mechanisms that respond to the damage caused by this interaction. To achieve this, two research strategies were employed: the expression of some genes by RT-qPCR and the analysis of mutant strains. Results Cell Wall integrity (CWI genes were induced in the PHMB-resistant Saccharomyces cerevisiae strain JP-1, although they are poorly expressed in the PHMB-sensitive Saccharomyces cerevisiae PE2 strain. This suggested that PHMB damages the glucan structure on the yeast cell wall. It was also confirmed by the observed sensitivity of the yeast deletion strains, Δslg1, Δrom2, Δmkk2, Δslt2, Δknr4, Δswi4 and Δswi4, which showed that the protein kinase C (PKC regulatory mechanism is involved in the response and resistance to PHMB. The sensitivity of the Δhog1 mutant was also observed. Furthermore, the cytotoxicity assay and gene expression analysis showed that the part played by YAP1 and CTT1 genes in cell resistance to PHMB is unrelated to oxidative stress response. Thus, we suggested that Yap1p can play a role in cell wall maintenance by controlling the expression of the CWI genes. Conclusion The PHMB treatment of the yeast cells activates the PKC1/Slt2 (CWI pathway. In addition, it is suggested that HOG1 and YAP1 can play a role in the regulation of CWI genes.
Directory of Open Access Journals (Sweden)
Luisa M. Manço
2014-12-01
Full Text Available The aim of this study was the development, rheological behaviour determination, and sensory analysis of cosmetic formulations containing glucan biopolymer (Manihot esculenta, a tensor agent that was proposed to produce an immediate lifting and smoothing effect. For this purpose, formulations were developed and supplemented or not with 4 % of hydrolysed Manihot esculenta tuber extract and submitted to preliminary stability tests. These formulations were evaluated in terms of rheological behaviour over 90 days. Sensory analysis was carried out through a research with 20 cosmetic consumers who answered a questionnaire regarding their perception to the cosmetic qualities. The formulations presented pseudoplastic behavior and were considered stable in the physical stability studies, with the exception of the gel formulation based on Ammonium Acryloyldimethyltaurate/VP Copolymer. The formulations were well evaluated in the sensory parameters. The gel formulations based on Polyacrylamide, C13- 14 Isoparaffin, and Laureth-7 were stable and presented the best sensory profile in some evaluated parameters, such as spreadability, smoothness and skin moisturizing, and can be considered an appropriate vehicle for formulations containing hydrolysed Manihot esculenta tuber extract.
Wang, Lei; Ye, Fayin; Feng, Liyuan; Wei, Fubin; Zhao, Guohua
2017-12-01
The objective of this study was to evaluate the effects of the incorporation of oat β-glucan (OβG) on the sensory and nutritional quality of steamed bread. Wheat flour was substituted with OβG at levels varying from 0 g/100 g to 5 g/100 g. The results showed that the products containing 1 g/100 g and 3 g/100 g OβG produced a comparable overall consumer acceptance while a significantly lower score was given to the product with 5 g/100 g. Nutritionally, the presence of OβG impeded in vitro starch hydrolysis by amylolytic enzymes. More importantly, the addition of OβG up to 5 g/100 g did bring about a lower in vitro predicted glycaemic index to steamed bread, but it generated insignificant effects on the in vivo glycaemic response. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. Modern methods of food elaboration and processing frequently reduce the content of dietary fiber (DF). Despite the well-known health benefits of DF consumption, average intake levels still fall far below recommended ones. Oat β-glucan (OβG) is a kind of indigestible polysaccharide with diverse bioactivity. This article evaluated the effects of OβG incorporation on quality, structure, consumer acceptance, and glycaemic response of steamed bread. The addition of less than 3 g/100 g of OβG had negligible effects on the consumer acceptance of steamed bread. The enrichment at 5 g/100 g indeed deteriorated the consumer acceptance. Moreover, OβG highly lowered the glycaemic response of steamed bread. The current work first demonstrated the feasibility of fabricating OβG-enriched steamed bread and its nutritional superiority compared to the corresponding normal product. OβG enriched steamed bread may offer an alternative to improve DF intake of residents. © 2017 Wiley Periodicals, Inc.
A non-cardiomyocyte autonomous mechanism of cardioprotection involving the SLO1 BK channel
Directory of Open Access Journals (Sweden)
Andrew P. Wojtovich
2013-03-01
Full Text Available Opening of BK-type Ca2+ activated K+ channels protects the heart against ischemia-reperfusion (IR injury. However, the location of BK channels responsible for cardioprotection is debated. Herein we confirmed that openers of the SLO1 BK channel, NS1619 and NS11021, were protective in a mouse perfused heart model of IR injury. As anticipated, deletion of the Slo1 gene blocked this protection. However, in an isolated cardiomyocyte model of IR injury, protection by NS1619 and NS11021 was insensitive to Slo1 deletion. These data suggest that protection in intact hearts occurs by a non-cardiomyocyte autonomous, SLO1-dependent, mechanism. In this regard, an in-situ assay of intrinsic cardiac neuronal function (tachycardic response to nicotine revealed that NS1619 preserved cardiac neurons following IR injury. Furthermore, blockade of synaptic transmission by hexamethonium suppressed cardioprotection by NS1619 in intact hearts. These results suggest that opening SLO1 protects the heart during IR injury, via a mechanism that involves intrinsic cardiac neurons. Cardiac neuronal ion channels may be useful therapeutic targets for eliciting cardioprotection.
Lozano-Cuenca, J; González-Hernández, A; López-Canales, O A; Villagrana-Zesati, J R; Rodríguez-Choreão, J D; Morín-Zaragoza, R; Castillo-Henkel, E F; López-Canales, J S
2017-08-07
Clobenzorex is a metabolic precursor of amphetamine indicated for the treatment of obesity. Amphetamines have been involved with cardiovascular side effects such as hypertension and pulmonary arterial hypertension. The aim of the present study was to investigate whether the direct application of 10-9-10-5 M clobenzorex on isolated phenylephrine-precontracted rat aortic rings produces vascular effects, and if so, what mechanisms may be involved. Clobenzorex produced an immediate concentration-dependent vasorelaxant effect at the higher concentrations (10-7.5-10-5 M). The present outcome was not modified by 10-6 M atropine (an antagonist of muscarinic acetylcholine receptors), 3.1×10-7 M glibenclamide (an ATP-sensitive K+ channel blocker), 10-3 M 4-aminopyridine (4-AP; a voltage-activated K+ channel blocker), 10-5 M indomethacin (a prostaglandin synthesis inhibitor), 10-5 M clotrimazole (a cytochrome P450 inhibitor) or 10-5 M cycloheximide (a general protein synthesis inhibitor). Contrarily, the clobenzorex-induced vasorelaxation was significantly attenuated (Pclobenzorex on phenylephrine-precontracted rat aortic rings involved stimulation of the NO/cGMP/PKG/Ca2+-activated K+ channel pathway.
DEFF Research Database (Denmark)
Hartvigsen, M L; Gregersen, S; Lærke, H N
2014-01-01
BACKGROUND/OBJECTIVES: Several studies emphasise that arabinoxylan and β-glucan have more beneficial effects on glucose metabolism than low-dietary fibre (DF) meals. Less attention has been paid to the effects of concentrated DF compared with whole grain. We compared the effects of DF and whole...... grain on glucose, hormone responses and appetite in subjects with the metabolic syndrome (MetS). SUBJECTS/METHODS: Fifteen subjects with MetS participated in this acute, randomised, cross-over intervention study. The test breads provided 50 g of digestible carbohydrate: wheat bread with concentrated...
Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki
2015-01-01
We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10オ (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol...
Ledur, Pauline C; Tondolo, Juliana S M; Jesus, Francielli P K; Verdi, Camila M; Loreto, Érico S; Alves, Sydney H; Santurio, Janio M
2018-03-01
Pythiosis is a life-threatening disease caused by the fungus-like microorganism Pythium insidiosum that can lead to death if not treated. Since P. insidiosum has particular cell wall characteristics, pythiosis is difficult to treat, as it does not respond well to traditional antifungal drugs. In our study, we investigated a new immunotherapeutic approach with potential use in treatment and in the acquisition of immunity against pythiosis. Dendritic cells from both human and mouse, pulsed with P. insidiosum heat-inactivated zoospore, (1,3)(1,6)-β-glucan and the immunotherapeutic PitiumVac ® efficiently induced naïve T cell differentiation in a Th1 phenotype by the activation of specific Th1 cytokine production in vitro. Heat-inactivated zoospores showed the greatest Th1 response among the tested groups, with a significant increase in IL-6 and IFN-γ production in human cells. In mice cells, we also observed a Th17 pathway induction, with an increase on the IL-17A levels in lymphocytes cultured with β-glucan pulsed DCs. These results suggest a potential use of DCs pulsed with P. insidiosum antigens as a new therapeutic strategy in the treatment and acquisition of immunity against pythiosis. Copyright © 2017 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
O. F. Seniuk
2014-06-01
Full Text Available Protective effect of melanin-glucan complex from F. fomentarius (MGC and Russian armed forces radiopro-tector indralin in the model of acute exposure by dose of 5.95 Gy/8.5min care is compared. Obtained results indi-cate availabi¬lity at MGC and indralin both direct and indirect "bystander effect” of DNA-protective properties, as well as severe anxiolytic activity. Thus for indralin protection factor was 0.33 when in MGC it was 2.3 times higher (0.75.
Directory of Open Access Journals (Sweden)
M. H. Mohd. Sani
2012-01-01
Full Text Available Muntingia calabura L. (family Elaeocarpaceae has been traditionally used to relieve various pain-related ailments. The present study aimed to determine the antinociceptive activity of methanol extract of M. calabura leaves (MEMC and to elucidate the possible mechanism of antinociception involved. The in vivo chemicals (acetic acid-induced abdominal constriction and formalin-, capsaicin-, glutamate-, serotonin-induced paw licking test and thermal (hot plate test models of nociception were used to evaluate the extract antinociceptive activity. The extract (100, 250, and 500 mg/kg was administered orally 60 min prior to subjection to the respective test. The results obtained demonstrated that MEMC produced significant (P<0.05 antinociceptive response in all the chemical- and thermal-induced nociception models, which was reversed after pretreatment with 5 mg/kg naloxone, a non-selective opioid antagonist. Furthermore, pretreatment with L-arginine (a nitric oxide (NO donor, NG-nitro-L-arginine methyl esters (L-NAME; an inhibitor of NO synthase (NOS, methylene blue (MB; an inhibitor of cyclic-guanosine monophosphate (cGMP pathway, or their combination also caused significant (P<0.05 change in the intensity of the MEMC antinociception. In conclusion, the MEMC antinociceptive activity involves activation of the peripheral and central mechanisms, and modulation via, partly, the opioid receptors and NO/cGMP pathway.
Moderate expression of SEC16 increases protein secretion by Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Bao, Jichen; Huang, Mingtao; Petranovic, Dina
2017-01-01
in yeast, by moderately overexpressing SEC16, which is involved in protein translocation from the endoplasmic reticulum to the Golgi apparatus. The moderate overexpression of SEC16 increased α-amylase secretion by generating more endoplasmic reticulum exit sites. The production of reactive oxygen species...... were observed. Finally, the moderate overexpression of SEC16 was shown to improve the secretion of two other recombinant proteins, Trichoderma reesei endoglucanase I and Rhizopus oryzae glucan-1,4-α-glucosidase, indicating that this mechanism is of general relevance....
McFarlin, Brian K; Carpenter, Katie C; Davidson, Tiffany; McFarlin, Meredith A
2013-09-01
Strenuous exercise, such as running a marathon, is known to suppress mucosal immunity for up to 24 hr, which can increase the risk of developing an upper respiratory tract infection (URTI) and reduced performance capacity (Allgrove JE, Geneen L, Latif S, Gleeson M. Influence of a fed or fasted state on the s-IgA response to prolonged cycling in active men and women. Int J Sport Nutr Exerc Metab. 2009;19(3):209-221; Barrett B, Locken K, Maberry R, Schwamman J, Brown R, Bobula J, Stauffacher EA. The Wisconsin Upper Respiratory Symptom Survey (WURSS): a new research instrument for assessing the common cold. J Fam Pract. 2002;51(3):265; Carpenter KC, Breslin WL, Davidson T, Adams A, McFarlin BK. Baker's yeast beta glucan supplementation increases monocytes and cytokines post-exercise: implications for infection risk? Br J Nutr. 2012;1-9). While many dietary interventions have been used to combat postexercise immune suppression, most have been ineffective. The key purpose of this study was to determine if baker's yeast β-glucan (BG) could positively affect the immune system of individuals undergoing intense exercise stress using two experiments. In the first (E1; N = 182 men and women), BG was compared to placebo supplementation for the incidence of URTI symptoms for 28 days postmarathon. In the second (E2; N = 60 men and women) changes in salivary immunoglobulin A (IgA) were evaluated after 50-min of strenuous cycling when participants had been supplemented for 10 days with either BG (250 mg/day) or placebo (rice flour). For E1, subjects reported URTI symptoms using a daily health log. For E2, saliva was collected prior to, immediately, and 2-hr postexercise using a salivette. Data for E1 and E2 were analyzed using separate analyses of variance (ANOVAs) with repeated measures (p flu symptom days postmarathon compared to placebo (p = .026). In E2, BG was associated with a 32% increase in salivary IgA (p = .048) at 2 hr after exercise compared to placebo. In summary
Kimura, Takashi
2013-01-01
Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.
Directory of Open Access Journals (Sweden)
Takashi Kimura
2013-01-01
Full Text Available Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.
Bonfiglio, Juan José; Inda, Carolina; Refojo, Damián; Holsboer, Florian; Arzt, Eduardo; Silberstein, Susana
2011-01-01
Corticotropin-releasing hormone (CRH) plays a key role in adjusting the basal and stress-activated hypothalamic-pituitary-adrenal axis (HPA). CRH is also widely distributed in extrahypothalamic circuits, where it acts as a neuroregulator to integrate the complex neuroendocrine, autonomic, and behavioral adaptive response to stress. Hyperactive and/or dysregulated CRH circuits are involved in neuroendocrinological disturbances and stress-related mood disorders such as anxiety and depression. This review describes the main physiological features of the CRH network and summarizes recent relevant information concerning the molecular mechanism of CRH action obtained from signal transduction studies using cells and wild-type and transgenic mice lines. Special focus is placed on the MAPK signaling pathways triggered by CRH through the CRH receptor 1 that plays an essential role in CRH action in pituitary corticotrophs and in specific brain structures. Recent findings underpin the concept of specific CRH-signaling pathways restricted to specific anatomical areas. Understanding CRH action at molecular levels will not only provide insight into the precise CRH mechanism of action, but will also be instrumental in identifying novel targets for pharmacological intervention in neuroendocrine tissues and specific brain areas involved in CRH-related disorders. Copyright © 2011 S. Karger AG, Basel.
A host defense mechanism involving CFTR-mediated bicarbonate secretion in bacterial prostatitis.
Directory of Open Access Journals (Sweden)
Chen Xie
Full Text Available BACKGROUND: Prostatitis is associated with a characteristic increase in prostatic fluid pH; however, the underlying mechanism and its physiological significance have not been elucidated. METHODOLOGY/PRINCIPAL FINDINGS: In this study a primary culture of rat prostatic epithelial cells and a rat prostatitis model were used. Here we reported the involvement of CFTR, a cAMP-activated anion channel conducting both Cl(- and HCO(3(-, in mediating prostate HCO(3(- secretion and its possible role in bacterial killing. Upon Escherichia coli (E. coli-LPS challenge, the expression of CFTR and carbonic anhydrase II (CA II, along with several pro-inflammatory cytokines was up-regulated in the primary culture of rat prostate epithelial cells. Inhibiting CFTR function in vitro or in vivo resulted in reduced bacterial killing by prostate epithelial cells or the prostate. High HCO(3(- content (>50 mM, rather than alkaline pH, was found to be responsible for bacterial killing. The direct action of HCO(3(- on bacterial killing was confirmed by its ability to increase cAMP production and suppress bacterial initiation factors in E. coli. The relevance of the CFTR-mediated HCO(3(- secretion in humans was demonstrated by the upregulated expression of CFTR and CAII in human prostatitis tissues. CONCLUSIONS/SIGNIFICANCE: The CFTR and its mediated HCO(3(- secretion may be up-regulated in prostatitis as a host defense mechanism.
Zhuang, Haining; Chen, Zhongqiu; Feng, Tao; Yang, Yan; Zhang, Jingsong; Liu, Guodong; Li, Zhaofeng; Ye, Ran
2017-06-01
Lentinus edodes β-glucan (abbreviated LEBG) was prepared from fruiting bodies of Lentinus edodes. The average molecular weight (Mw) and polydispersity index (Mw/Mn) of LEBG were measured to be 1.868×10 6 g/mol and 1.007, respectively. In addition, the monosaccharide composition of LEBG was composed of arabinose, galactose, glucose, xylose, mannose with a molar ratio of 5:11:18:644:16. After adding LEBG, both G' and G″ of starch gel increased. This is mainly because the connecting points between the molecular chains of LEBG and starch formed so that gel network structures were enhanced. The peak temperature in the heat flow diagram shifted to a higher temperature and the peak area of the endothermic enthalpy increased. Furthermore, LEBG can significantly inhibit starch hydrolysis. The predicted glycemic index (pGI) values were reduced when starch was replaced with LEBG at 20% (w/w). It might indicate that LEBG was suitable to develop low GI noodle or bread. Copyright © 2016 Elsevier Ltd. All rights reserved.
A drug-sensitive genetic network masks fungi from the immune system.
Directory of Open Access Journals (Sweden)
Robert T Wheeler
2006-04-01
Full Text Available Fungal pathogens can be recognized by the immune system via their beta-glucan, a potent proinflammatory molecule that is present at high levels but is predominantly buried beneath a mannoprotein coat and invisible to the host. To investigate the nature and significance of "masking" this molecule, we characterized the mechanism of masking and consequences of unmasking for immune recognition. We found that the underlying beta-glucan in the cell wall of Candida albicans is unmasked by subinhibitory doses of the antifungal drug caspofungin, causing the exposed fungi to elicit a stronger immune response. Using a library of bakers' yeast (Saccharomyces cerevisiae mutants, we uncovered a conserved genetic network that is required for concealing beta-glucan from the immune system and limiting the host response. Perturbation of parts of this network in the pathogen C. albicans caused unmasking of its beta-glucan, leading to increased beta-glucan receptor-dependent elicitation of key proinflammatory cytokines from primary mouse macrophages. By creating an anti-inflammatory barrier to mask beta-glucan, opportunistic fungi may promote commensal colonization and have an increased propensity for causing disease. Targeting the widely conserved gene network required for creating and maintaining this barrier may lead to novel broad-spectrum antimycotics.
Directory of Open Access Journals (Sweden)
Yong K. Park
2003-12-01
Full Text Available Cogumelos comestíveis contêm importantes propriedades funcionais. Em particular, beta-glucanos, homo- e hetero-glucanos com ligações glicosídicas beta(1->3, beta(1->4 e beta(1->6, supostamente responsáveis por algumas propriedades benéficas à saúde humana, como atividade imunomodulatória, antioxidante, antiinflamatória e anticancerígena. Neste trabalho, a quantidade de beta-glucano presente em cogumelo Agaricus blazei Murill, coletados de três diferentes locais, foi analisada utilizando-se método enzimático. As amostras (em base seca foram tratadas com alfa-amilase, protease bacteriana e com glicoamilase fúngica. beta-glucano foi quantificado após hidrólise ácida e determinação da glicose liberada. Foi verificado que amostras de A. blazei Murill cultivadas em estufas apresentaram menor concentração de b-glucano (8,4±0,9 e 7,6±2,8g/100g quando comparado com amostras cultivadas em campo aberto (10,1±2,1g/100g. Observou-se ainda que, mesmo sendo cultivado em condições semelhantes, porém em locais diferentes, as amostras apresentaram diferenças significativas (7,6±2,8 e 8,4±0,9g/100g.Edible mushrooms contains a very interesting functional properties. Among them, the beta-glucans, polysaccharides with beta-1,3; b-1,4 and beta-1,6glucosidic linkages, they are responsible to a series of properties to human health, such as immunomodulatory, antioxidant, antiinflammatory and, antitumoral activities. In the present work, the Agaricus blazei Murill beta-glucan concentrations from three locations, were determined through the enzymatic method. Samples were treated with alpha-amylase, bacterial protease and fungal glucoamylase. beta-glucans were quantified after acid hydrolysis and, the glucose determined for spectrophotometric method. It was verified that samples cultivated inside stoves presented smaller beta-glucan concentration (8.4±0.9 and 7.6±2.8g/100g, when compared with samples cultivated in open field (10.1±2.1g/100
Fujita, Masahide; Andoh, Tsugunobu; Saiki, Ikuo; Kuraishi, Yasushi
2008-02-01
We investigated whether endothelin (ET) would be involved in skin cancer pain in mice. Orthotopic inoculation of B16-BL6 melanoma cells into the plantar region of the hind paw produced marked mechanical allodynia in C57BL/6 mice. Intraplantar injections of the ET(A)-receptor antagonist BQ-123 (0.3 - 3 nmol/site), but not the ET(B)-receptor antagonist BQ-788 (1 and 3 nmol/site), inhibited mechanical allodynia in mice with grown melanoma. In naive mice, an intraplantar injection of tumor extract (1 and 3 mg/site), which was prepared from the grown melanoma in the paw, produced mechanical allodynia, which was inhibited by BQ-123 and BQ-788 at doses of 3 and 10 nmol/site. An intraplantar injection of ET-1 (1 and 10 pmol/site) elicited licking behavior, which was increased in the melanoma-bearing hind paw. BQ-123 (3 and 10 nmol/site) inhibited licking induced by ET-1 (10 pmol/site). The level of mRNA of ET(A), but not ET(B), receptor, was significantly increased in the dorsal root ganglia on the inoculated side. Cultured B16-BL6 cells contained ET, and the melanoma mass increased the concentration of ET as it grew bigger. These results suggest that ET-1 and ET(A) receptor are at least partly involved in the induction of pain induced by melanoma cell inoculation.
Suzuki, Yusuke; Nagasawa, Ryo; Senpuku, Hidenobu
2017-09-01
Streptococcus mutans produces glucosyltransferases encoded by the gtfB and gtfC genes, which synthesize insoluble glucan, and both insoluble and soluble glucans by conversion of sucrose, and are known as principal agents to provide strong biofilm formation and demineralization on tooth surfaces. S. mutans possess a Com-dependent quorum sensing (QS) system, which is important for survival in severe conditions. The QS system is stimulated by the interaction between ComD {Receptor to competence-stimulating peptide (CSP)} encoded by the comD and CSP encoded by the comC, and importantly associated with bacteriocin production and genetic competence. Previously, we found enzyme fructanase (FruA) as a new inhibitor for the glucan-dependent biofilm formation. In the present study, inhibiting effects by FruA on glucan-independent biofilm formation of S. mutans UA159, UA159.gtfB - , UA159.gtfC - , and UA159.gtfBC - were observed in sucrose and no sucrose sugars-supplemented conditions using the plate assay. The reduction of UA159.comC - and UA159.comD - biofilm formation were also observed as compared with UA159 in same conditions. These results suggested that inhibitions of glucan-independent and Com-dependent biofilm formation were involved in the inhibiting mechanism by FruA. To more thoroughly investigate effects by FruA on the QS system, we examined on CSP-stimulated and Com-dependent bacteriocin production and genetic transformation. FruA inhibited bacteriocin production in collaboration with CSP and genetic transformation in bacterial cell conditions treated with FruA. Our findings show that FruA has multiple effects that inhibit survival functions of S. mutans, including biofilm formation and CSP-dependent QS responses, indicating its potential use as an agent for prevention of dental caries. Copyright © 2017 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kaneuji, Takeshi; Ariyoshi, Wataru; Okinaga, Toshinori; Toshinaga, Akihiro; Takahashi, Tetsu; Nishihara, Tatsuji
2011-01-01
Highlights: → Effect of compressive force on osteoblasts were examined. → Compressive force induced OPG expression and suppressed osteoclastogenesis. → This enhancement of OPG is dependent on Wnt/Ca2+ signal pathway. -- Abstract: Mechanical stress is known to be important for regulation of bone turnover, though the detailed mechanisms are not fully understood. In the present study, we examined the effect of mechanical stress on osteoblasts using a novel compression model. Mouse osteoblastic MC3T3-E1 cells were embedded in three-dimensional (3D) gels and cultured with continuous compressive force (0-10.0 g/cm 2 ) for 48 h, and the conditioned medium were collected. RAW264.7 cells were then incubated with the conditioned medium for various times in the presence of receptor activator of nuclear factor-κB ligand (RANKL). Conditioned medium was found to inhibit the differentiation of RAW264.7 cells into osteoclasts induced by RANKL via down-regulation of the expression of tumor necrosis factor receptor-associated factor 6 (TRAF6), phosphorylation of IκBα, and nuclear translocation of p50 and p65. Interestingly, the conditioned medium also had a high level of binding activity to RANKL and blocked the binding of RANK to RANKL. Furthermore, the binding activity of conditioned medium to RANKL was reduced when the 3D gel was supplemented with KN-93, an inhibitor of non-canonical Wnt/Ca 2+ pathway. In addition, expression level of osteoprotegerin (OPG) mRNA was increased in time- and force-dependent manners, and remarkably suppressed by KN-93. These results indicate that osteoblastic cells subjected to mechanical stress produce OPG, which binds to RANKL. Furthermore, this binding activity strongly inhibited osteoclastogenesis through suppression of TRAF6 and the nuclear factor-kappa B (NF-κB) signaling pathway, suggesting that enhancement of OPG expression induced by mechanical stress is dependent on non-canonical Wnt/Ca 2+ pathway.
Energy Technology Data Exchange (ETDEWEB)
Kaneuji, Takeshi [Division of Oral and Maxillofacial Reconstructive Surgery, Department of Oral and Maxillofacial Surgery, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580 (Japan); Division of Infections and Molecular Biology, Department of Health Promotion, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580 (Japan); Ariyoshi, Wataru; Okinaga, Toshinori; Toshinaga, Akihiro [Division of Infections and Molecular Biology, Department of Health Promotion, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580 (Japan); Takahashi, Tetsu [Division of Oral and Maxillofacial Reconstructive Surgery, Department of Oral and Maxillofacial Surgery, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580 (Japan); Oral Bioresearch Center, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580 (Japan); Nishihara, Tatsuji, E-mail: tatsujin@kyu-dent.ac.jp [Division of Infections and Molecular Biology, Department of Health Promotion, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580 (Japan); Oral Bioresearch Center, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, Kitakyushu 803-8580 (Japan)
2011-04-29
Highlights: {yields} Effect of compressive force on osteoblasts were examined. {yields} Compressive force induced OPG expression and suppressed osteoclastogenesis. {yields} This enhancement of OPG is dependent on Wnt/Ca2+ signal pathway. -- Abstract: Mechanical stress is known to be important for regulation of bone turnover, though the detailed mechanisms are not fully understood. In the present study, we examined the effect of mechanical stress on osteoblasts using a novel compression model. Mouse osteoblastic MC3T3-E1 cells were embedded in three-dimensional (3D) gels and cultured with continuous compressive force (0-10.0 g/cm{sup 2}) for 48 h, and the conditioned medium were collected. RAW264.7 cells were then incubated with the conditioned medium for various times in the presence of receptor activator of nuclear factor-{kappa}B ligand (RANKL). Conditioned medium was found to inhibit the differentiation of RAW264.7 cells into osteoclasts induced by RANKL via down-regulation of the expression of tumor necrosis factor receptor-associated factor 6 (TRAF6), phosphorylation of I{kappa}B{alpha}, and nuclear translocation of p50 and p65. Interestingly, the conditioned medium also had a high level of binding activity to RANKL and blocked the binding of RANK to RANKL. Furthermore, the binding activity of conditioned medium to RANKL was reduced when the 3D gel was supplemented with KN-93, an inhibitor of non-canonical Wnt/Ca{sup 2+} pathway. In addition, expression level of osteoprotegerin (OPG) mRNA was increased in time- and force-dependent manners, and remarkably suppressed by KN-93. These results indicate that osteoblastic cells subjected to mechanical stress produce OPG, which binds to RANKL. Furthermore, this binding activity strongly inhibited osteoclastogenesis through suppression of TRAF6 and the nuclear factor-kappa B (NF-{kappa}B) signaling pathway, suggesting that enhancement of OPG expression induced by mechanical stress is dependent on non-canonical Wnt
Directory of Open Access Journals (Sweden)
Tamas Kiss
Full Text Available Pulmonary arterial hypertension (PH is associated with high mortality due to right ventricular failure and hypoxia, therefore to understand the mechanism by which pulmonary vascular remodeling initiates these processes is very important. We used a well-characterized monocrotaline (MCT-induced rat PH model, and analyzed lung morphology, expression of cytokines, mitogen-activated protein kinase (MAPK phosphorylation, and phosphatidylinositol 3-kinase-Akt (PI-3k-Akt pathway and nuclear factor (NF-κB activation in order to elucidate the mechanisms by which sildenafil's protective effect in PH is exerted. Besides its protective effect on lung morphology, sildenafil suppressed multiple cytokines involved in neutrophil and mononuclear cells recruitment including cytokine-induced neutrophil chemoattractant (CINC-1, CINC-2α/β, tissue inhibitor of metalloproteinase (TIMP-1, interleukin (IL-1α, lipopolysaccharide induced CXC chemokine (LIX, monokine induced by gamma interferon (MIG, macrophage inflammatory protein (MIP-1α, and MIP-3α. NF-κB activation and phosphorylation were also attenuated by sildenafil. Furthermore, sildenafil reduced extracellular signal-regulated kinase (ERK1/2 and p38 MAPK activation while enhanced activation of the cytoprotective Akt pathway in PH. These data suggest a beneficial effect of sildenafil on inflammatory and kinase signaling mechanisms that substantially contribute to its protective effects, and may have potential implications in designing future therapeutic strategies in the treatment of pulmonary hypertension.
Mechanisms Involved in Nematode Control by Endophytic Fungi.
Schouten, Alexander
2016-08-04
Colonization of plants by particular endophytic fungi can provide plants with improved defenses toward nematodes. Evidently, such endophytes can be important in developing more sustainable agricultural practices. The mechanisms playing a role in this quantitative antagonism are poorly understood but most likely multifactorial. This knowledge gap obstructs the progress regarding the development of endophytes or endophyte-derived constituents into biocontrol agents. In part, this may be caused by the fact that endophytic fungi form a rather heterogeneous group. By combining the knowledge of the currently characterized antagonistic endophytic fungi and their effects on nematode behavior and biology with the knowledge of microbial competition and induced plant defenses, the various mechanisms by which this nematode antagonism operates or may operate are discussed. Now that new technologies are becoming available and more accessible, the currently unresolved mechanisms can be studied in greater detail than ever before.
Andersson, I M; Lorentzen, J C; Ericsson-Dahlstrand, A
2000-11-01
Endogenous corticosterone secreted during immune challenge restricts the inflammatory process and genetic variations in this neuroendocrine-immune dialogue have been suggested to influence an individuals sensitivity to develop chronic inflammatory disorders. We have tested inflammation-susceptible Dark Agouti (DA) rats and resistant, MHC-identical, PVG.1AV1 rats for their abilities to secrete corticosterone in response to acute challenge with bacterial lipopolysaccharide (LPS) or a prolonged activation of the nonspecific immune system with arthritogenic yeast beta-glucan. Intravenous injection of LPS triggered equipotent secretion of corticosterone in both rat strains. Interestingly, peak concentrations of corticosterone did not differ significantly between the strains. Intradermal injection of beta-glucan caused severe, monophasic, polyarthritis in DA rats while PVG.1AV1 responded with significantly milder joint inflammation. Importantly, serial sampling of plasma from glucan-injected DA and PVG.1AV1 rats did not reveal elevated concentrations of plasma corticosterone at any time from days 1-30 postinjection compared to preinjection values, in spite of the ongoing inflammatory process. Interestingly, adrenalectomized, beta-glucan-challenged DA rats responded with an aggravated arthritic process, indicating an anti-inflammatory role for the basal levels of corticosterone that were detected in intact DA rats challenged with beta-glucan. Moreover, substitution with subcutaneous corticosterone-secreting pellets, yielding moderate stress-levels, significantly attenuated the arthritic response. In contrast, adrenalectomized and glucan-challenged PVG.1AV1 rats did not respond with an elevated arthritic response, suggesting that these rats contain the arthritic process via corticosterone-independent mechanisms. In conclusion, the hypothalamic-pituitary-adrenal axis in both rat strains exhibited strong activation after challenge with LPS. This contrasted to the basal
Huang, Xian-Rong; Peng, Ru-Wen
2010-04-01
Interactions between light and conducting microstructures or nanostructures can result in a variety of novel phenomena, but their underlying mechanisms have not been completely understood. From calculations of surface charge density waves on conducting gratings and by comparing them with classical surface plasmons, we revealed a general yet concrete picture regarding the coupling of light to free electron oscillation on structured conducting surfaces that can lead to oscillating subwavelength charge patterns (i.e., structured surface plasmons). New wavelets emitted from these light sources then destructively interfere to form evanescent waves. This principle, usually combined with other mechanisms, is mainly a geometrical effect that can be universally involved in light scattering from all periodic and non-periodic structures containing free electrons. This picture may provide clear guidelines for developing conductor-based nano-optical devices.
DEFF Research Database (Denmark)
Seefeldt, Helene Fast; van den Berg, Frans W.J.; Köckenberger, Walter
2007-01-01
1H NMR imaging (MRI) was used as a noninvasive technique to study water distribution and mobility in hydrated barley (Hordeum vulgare L.) seeds of accessions with varying content of beta glucan (BG), a highly hygroscopic cell wall component. High contents of BG in barley are unfavorable in malting...... where it leads to clotting of filters and hazing of beer as well as in animal feed where it hinders the rapid uptake of energy. However, a high content of BG has a positive nutritional effect, as it lowers the cholesterol and the glycaemic index. It was studied whether water distribution and mobility...... were related to content and location of BG. Water mobility was investigated by following the rate and mode of desiccation in hydrated single seeds. In order to determine the different water components, a multispin echo experiment was set up to reveal the T2 transverse relaxation rates of water within...
Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut
2012-10-01
The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.
Atomic cranks and levers control sugar ring conformations
International Nuclear Information System (INIS)
Zhang Qingmin; Lee, Gwangrog; Marszalek, Piotr E
2005-01-01
In this paper we review the conformational analysis of sugar rings placed under tension during mechanical manipulations of single polysaccharide molecules with the atomic force microscope and during steered molecular dynamics simulations. We examine the role of various chemical bonds and linkages between sugar rings in inhibiting or promoting their conformational transitions by means of external forces. Small differences in the orientation of one chemical bond on the sugar ring can produce significantly different mechanical properties at the polymer level as exemplified by two polysaccharides: cellulose, composed of β-1→4-linked D-glucose, and amylose, composed of α-1→4-linked D-glucose. In contrast to β-glucose rings, which are mechanically stable and produce simple entropic elasticity of the chain, α-glucose rings flip under tension from their chair to a boat-like structure and these transitions produce deviations of amylose elasticity from the freely jointed chain model. We also examine the deformation of two mechanically complementary 1→6-linked polysaccharides: pustulan, a β-1→6-linked glucan, and dextran, a α-1→6-linked glucan. Forced rotations about the C 5 -C 6 bonds govern the elasticity of pustulan, and complex conformational transitions that involve simultaneous C 5 -C 6 rotations and chair-boat transitions govern the elasticity of dextran. Finally, we discuss the likelihood of various conformational transitions in sugar rings in biological settings and speculate on their significance
Mechanisms involved in the development of diabetic retinopathy induced by oxidative stress.
Guzman, David Calderón; Olguín, Hugo Juárez; García, Ernestina Hernández; Peraza, Armando Valenzuela; de la Cruz, Diego Zamora; Soto, Monica Punzo
2017-01-01
Diabetic retinopathy (DR) is one of the main complications in patients with diabetes and has been the leading cause of visual loss since 1990. Oxidative stress is a biological process resulting from excessive production of reactive oxygen species (ROS). This process contributes to the development of many diseases and disease complications. ROS interact with various cellular components to induce cell injury. Fortunately, there is an antioxidan t system that protects organisms against ROS. Indeed, when ROS exceed antioxidant capacity, the resulting cell injury can cause diverse physiological and pathological changes that could lead to a disease like DR. This paper reviews the possible mechanisms of common and novel biomarkers involved in the development of DR and explores how these biomarkers could be used to monitor the damage induced by oxidative stress in DR, which is a significant complication in people with diabetes. The poor control of glucemy in pacients with DB has been shown contribute to the development of complications in eyes as DR.
DEFF Research Database (Denmark)
Leucci, E; Cocco, M; Onnis, A
2008-01-01
at the standardization of FISH procedures in lymphoma diagnosis, we found that five cases out of 35 classic endemic BLs were negative for MYC translocations by using a split-signal as well as a dual-fusion probe. Here we investigated the expression pattern of miRNAs predicted to target c-Myc, in BL cases, to clarify...... whether alternative pathogenetic mechanisms may be responsible for lymphomagenesis in cases lacking the MYC translocation. miRNAs are a class of small RNAs that are able to regulate gene expression at the post-transcriptional level. Several studies have reported their involvement in cancer...
Mechanisms involved in the p62-73 idiopeptide-modulated delay of lupus nephritis in SNF(1) mice.
Nyland, J F; Stoll, M L; Jiang, F; Feng, F; Gavalchin, J
2012-12-01
The F(1) progeny of the (SWR × NZB) cross develop a lupus-like disease with high serum titers of autoantibodies, and increased frequency and severity of immune complex-mediated glomerulonephritis in females. In previous work, we found that an idiotypic peptide corresponding to aa62-73 (p62-73) of the heavy chain variable region of autoantibody 540 (Id(LN)F(1)) induced the proliferation of p62-73 idiotype-reactive T cell clones. Further, monthly immunization of pre-nephritic SNF(1) female mice with p62-73 resulted in decreased nephritis and prolonged life spans. Here we show that this treatment modulated proliferative responses to Id(LN)F(1) antigen, including a reduction in the population of idiopeptide-presenting antigen-presenting cells (APCs), as early as two weeks after immunization (10 weeks of age). Th1-type cytokine production was increased at 12 weeks of age. The incidence and severity of nephritis was reduced by 14 weeks compared to controls. Clinical indicators of nephritis, specifically histological evidence of glomerulonephritis and urine protein levels, were reduced by 20 weeks. Together these data suggest that events involved in the mechanism(s) whereby p62-73 immunization delayed nephritis occurred early after immunization, and involved modulation of APCs, B and T cell populations.
The cell wall: a carbohydrate armour for the fungal cell.
Latgé, Jean-Paul
2007-10-01
The cell wall is composed of a polysaccharide-based three-dimensional network. Considered for a long time as an inert exoskeleton, the cell wall is now seen as a dynamic structure that is continuously changing as a result of the modification of culture conditions and environmental stresses. Although the cell wall composition varies among fungal species, chemogenomic comparative analysis have led to a better understanding of the genes and mechanisms involved in the construction of the common central core composed of branched beta1,3 glucan-chitin. Because of its essential biological role, unique biochemistry and structural organization and the absence in mammalian cells of most of its constitutive components, the cell wall is an attractive target for the development of new antifungal agents. Genomic as well as drug studies have shown that the death of the fungus can result from inhibition of cell wall polysaccharide synthases. To date, only beta1,3 glucan synthase inhibitors have been launched clinically and many more targets remain to be explored.
Zhang, Anqiang; Deng, Jiaying; Liu, Xiaoqing; He, Pengfei; He, Liang; Zhang, Fuming; Linhardt, Robert J; Sun, Peilong
2018-07-01
Agaricus blazei Murill is an edible and medicinal mushroom favored in many countries, by virtue of both its delicious taste and its potential health benefits such as its purported anticancer activity. A neutral α-glucan (ABM40-1) with a carbohydrate content of 96% was purified from the high-speed shearing homogenization extracts of A. Blazei Murill by ethanol precipitation and column chromatography. Methylation analysis along with nuclear magnetic resonance spectroscopy revealed that ABM40-1 was an α-(1→4)-d-glucopyranan with O-6 position occasionally occupied with α-Glcp-(1→or α-Glcp-(1→6)-β-Glcp-(1→side chains. A weight-average molecular weight of 7.34×10 6 Da was determined for ABM40-1 and its chain in solution was revealed as a compact sphere by size exclusion chromatography (SEC) coupled with a laser light scattering. This spherical conformation was also further confirmed by Congo red test and using atom force microscopy. These results suggest it would be worthwhile to further study the potential bioactivities of ABM40-1. Copyright © 2018 Elsevier B.V. All rights reserved.
Investigating the Mechanisms of Amylolysis of Starch Granules by Solution-State NMR
2015-01-01
Starch is a prominent component of the human diet and is hydrolyzed by α-amylase post-ingestion. Probing the mechanism of this process has proven challenging, due to the intrinsic heterogeneity of individual starch granules. By means of solution-state NMR, we demonstrate that flexible polysaccharide chains protruding from the solvent-exposed surfaces of waxy rice starch granules are highly mobile and that during hydrothermal treatment, when the granules swell, the number of flexible residues on the exposed surfaces increases by a factor of 15. Moreover, we show that these flexible chains are the primary substrates for α-amylase, being cleaved in the initial stages of hydrolysis. These findings allow us to conclude that the quantity of flexible α-glucan chains protruding from the granule surface will greatly influence the rate of energy acquisition from digestion of starch. PMID:25815624
Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.
Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung
2016-04-01
The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®
A Proinflammatory Effect of the β-Glucan from Pleurotus cornucopiae Mushroom on Macrophage Action
Directory of Open Access Journals (Sweden)
Ken-ichiro Minato
2017-01-01
Full Text Available PCPS from P. citrinopileatus mushroom extract is a β-1,6-glucan possessing a proinflammatory effect on innate immune cells. The PCPS stimulated THP-1 macrophages to secrete significant levels of TNF. Moreover, the mRNA expressions of TNF and IL-1β were significantly enhanced by PCPS treatment. However, the PCPS did not induce to express both IL-12 and IL-10 mRNA in the macrophages. Next, the P. cornucopiae extract (containing mainly PCPS treatment against mice showed significant increases in TNF and IL-1β mRNA expressions in the peritoneal macrophages of them. In this study, the expression levels of IFNγ mRNA in the spleen were almost the same between the extract- (PCPS- treated group and control group. However, the expression of IL-4 mRNA showed a lower level in the extract-treated group than that in the control. Our results suggested that the PCPS could induce proinflammatory action in the immune response. In addition, the proinflammatory effect of the PCPS on THP-1 was enhanced by 5′-GMP-Na, while it was reduced by vitamin D2. These two compounds are majorly contained in the P. citrinopileatus mushroom. Therefore, these results suggested that the P. citrinopileatus mushroom might contain other immune regulative compounds, such as vitamin D2, as well as PCPS.
Schouteden, Nele; De Waele, Dirk; Panis, Bart; Vos, Christine M
2015-01-01
Arbuscular mycorrhizal fungi (AMF) are obligate root symbionts that can protect their host plant against biotic stress factors such as plant-parasitic nematode (PPN) infection. PPN consist of a wide range of species with different life styles that can cause major damage in many important crops worldwide. Various mechanisms have been proposed to play a role in the biocontrol effect of AMF against PPN. This review presents an overview of the different mechanisms that have been proposed, and discusses into more detail the plausibility of their involvement in the biocontrol against PPN specifically. The proposed mechanisms include enhanced plant tolerance, direct competition for nutrients and space, induced systemic resistance (ISR) and altered rhizosphere interactions. Recent studies have emphasized the importance of ISR in biocontrol and are increasingly placing rhizosphere effects on the foreground as well, both of which will be the focal point of this review. Though AMF are not yet widely used in conventional agriculture, recent data help to develop a better insight into the modes of action, which will eventually lead toward future field applications of AMF against PPN. The scientific community has entered an exciting era that provides the tools to actually unravel the underlying molecular mechanisms, making this a timely opportunity for a review of our current knowledge and the challenges ahead.
Directory of Open Access Journals (Sweden)
Nele eSchouteden
2015-11-01
Full Text Available Arbuscular mycorrhizal fungi (AMF are obligate root symbionts that can protect their host plant against biotic stress factors such as plant parasitic nematode (PPN infection. PPN consist of a wide range of species with different life styles that can cause major damage in many important crops worldwide. Various mechanisms have been proposed to play a role in the biocontrol effect of AMF against PPN. This review presents an overview of the different mechanisms that have been proposed, and discusses into more detail the plausibility of their involvement in the biocontrol against PPN specifically. The proposed mechanisms include enhanced plant tolerance, direct competition for nutrients and space, induced systemic resistance (ISR and altered rhizosphere interactions. Recent studies have emphasized the importance of ISR in biocontrol and are increasingly placing rhizosphere effects on the foreground as well, both of which will be the focal point of this review. Though AMF are not yet widely used in conventional agriculture, recent data help to develop a better insight into the modes of action, which will eventually lead towards future field applications of AMF against PPN. The scientific community has entered an exciting era that provide the tools to actually unravel the underlying molecular mechanisms, making this a timely opportunity for a review of our current knowledge and the challenges ahead.
Schouteden, Nele; De Waele, Dirk; Panis, Bart; Vos, Christine M.
2015-01-01
Arbuscular mycorrhizal fungi (AMF) are obligate root symbionts that can protect their host plant against biotic stress factors such as plant-parasitic nematode (PPN) infection. PPN consist of a wide range of species with different life styles that can cause major damage in many important crops worldwide. Various mechanisms have been proposed to play a role in the biocontrol effect of AMF against PPN. This review presents an overview of the different mechanisms that have been proposed, and discusses into more detail the plausibility of their involvement in the biocontrol against PPN specifically. The proposed mechanisms include enhanced plant tolerance, direct competition for nutrients and space, induced systemic resistance (ISR) and altered rhizosphere interactions. Recent studies have emphasized the importance of ISR in biocontrol and are increasingly placing rhizosphere effects on the foreground as well, both of which will be the focal point of this review. Though AMF are not yet widely used in conventional agriculture, recent data help to develop a better insight into the modes of action, which will eventually lead toward future field applications of AMF against PPN. The scientific community has entered an exciting era that provides the tools to actually unravel the underlying molecular mechanisms, making this a timely opportunity for a review of our current knowledge and the challenges ahead. PMID:26635750
Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn
2017-06-03
Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans. Among the fermented rice brans, the Haedam rice bran contained the highest level of total phenol content (156.08 mg gallic acid equivalents/g), DPPH (2,2-diphenyl-1-picrylhydrazyl) radical scavenging activity (71.30%) and ORAC (Oxygen radical absorbance capacity) value (1101.31 μM trolox equivalents/g). Furthermore, the fermented Migwang rice bran showed the highest level of γ-oryzanol content (294.77 ± 6.74 mg/100 g).
Vera-Jimenez, N I; Pietretti, D; Wiegertjes, G F; Nielsen, M E
2013-05-01
The respiratory burst is an important feature of the immune system. The increase in cellular oxygen uptake that marks the initiation of the respiratory burst is followed by the production of reactive oxygen species (ROS) such as superoxide anion and hydrogen peroxide which plays a role in the clearance of pathogens and tissue regeneration processes. Therefore, the respiratory burst and associated ROS constitute important indicators of fish health status. This paper compares two methods for quantitation of ROS produced during the respiratory burst in common carp: the widely used, single-point measurement based on the intracellular reduction of nitroblue tetrazolium (NBT) and a real-time luminol-enhanced assay based on the detection of native chemiluminescence. Both assays allowed for detection of dose-dependent changes in magnitude of the respiratory burst response induced by β-glucans in head kidney cells of carp. However, whereas the NBT assay was shown to detect the production of only superoxide anions, the real-time luminol-enhanced assay could detect the production of both superoxide anions and hydrogen peroxide. Only the chemiluminescence assay could reliably record the production of ROS on a real-time scale at frequent and continual time intervals for time course experiments, providing more detailed information on the respiratory burst response. The real-time chemiluminescence assay was used to measure respiratory burst activity in macrophage and neutrophilic granulocyte-enriched head kidney cell fractions and total head kidney cell suspensions and proved to be a fast, reliable, automated multiwell microplate assay to quantitate fish health status modulated by β-glucans. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yong Peng Yu
2016-01-01
Full Text Available Accurate definition and better understanding of the mechanisms of stroke are crucial as this will guide the effective care and therapy. In this paper, we review the previous basic and clinical researches on the causes or mechanisms of ischemic cerebrovascular diseases (ICVD and interpret the correlation between embolism and hypoperfusion based on vascular stenosis and arterial intimal lesions. It was suggested that if there is no embolus (dynamic or in situ emboli, there might be no cerebral infarction. Three kinds of different clinical outcomes of TIA were theoretically interpreted based on its mechanisms. We suppose that there is a correlation between embolism and hypoperfusion, and which mechanisms (hypoperfusion or hypoperfusion induced microemboli playing the dominant role in each type of ICVD depends on the unique background of arterial intimal lesions (the vulnerability of vessels. That is to say, the vulnerability of vessels is involved in the role of embolism and hypoperfusion in the mechanisms of ischemic cerebrovascular diseases. This inference might enrich and provide better understandings for the underlying etiologies of ischemic cerebrovascular events.
Commandeur, Arno E; Styer, Aaron K; Teixeira, Jose M
2015-01-01
Uterine leiomyomas (fibroids) are highly prevalent benign smooth muscle tumors of the uterus. In the USA, the lifetime risk for women developing uterine leiomyomas is estimated as up to 75%. Except for hysterectomy, most therapies or treatments often provide only partial or temporary relief and are not successful in every patient. There is a clear racial disparity in the disease; African-American women are estimated to be three times more likely to develop uterine leiomyomas and generally develop more severe symptoms. There is also familial clustering between first-degree relatives and twins, and multiple inherited syndromes in which fibroid development occurs. Leiomyomas have been described as clonal and hormonally regulated, but despite the healthcare burden imposed by the disease, the etiology of uterine leiomyomas remains largely unknown. The mechanisms involved in their growth are also essentially unknown, which has contributed to the slow progress in development of effective treatment options. A comprehensive PubMed search for and critical assessment of articles related to the epidemiological, biological and genetic clues for uterine leiomyoma development was performed. The individual functions of some of the best candidate genes are explained to provide more insight into their biological function and to interconnect and organize genes and pathways in one overarching figure that represents the current state of knowledge about uterine leiomyoma development and growth. In this review, the widely recognized roles of estrogen and progesterone in uterine leiomyoma pathobiology on the basis of clinical and experimental data are presented. This is followed by fundamental aspects and concepts including the possible cellular origin of uterine fibroids. The central themes in the subsequent parts are cytogenetic aberrations in leiomyomas and the racial/ethnic disparities in uterine fibroid biology. Then, the attributes of various in vitro and in vivo, human syndrome
Farkas, Vladimír; Takeo, Kanji; Maceková, Danka; Ohkusu, Misako; Yoshida, Soichi; Sipiczki, Matthias
2009-03-01
Growth of the opportunistic yeast pathogen Cryptococcus neoformans in a synthetic medium containing yeast nitrogen base and 1.0-3.0% glucose is accompanied by spontaneous acidification of the medium, with its pH decreasing from the initial 5.5 to around 2.5 in the stationary phase. During the transition from the late exponential to the stationary phase of growth, many cells died as a consequence of autolytic erosion of their cell walls. Simultaneously, there was an increase in an ecto-glucanase active towards beta-1,3-glucan and having a pH optimum between pH 3.0 and 3.5. As a response to cell wall degradation, some cells developed an unusual survival strategy by forming 'secondary' cell walls underneath the original ones. Electron microscopy revealed that the secondary cell walls were thicker than the primary ones, exposing bundles of polysaccharide microfibrils only partially masked by an amorphous cell wall matrix on their surfaces. The cells bearing secondary cell walls had a three to five times higher content of the alkali-insoluble cell wall polysaccharides glucan and chitin, and their chitin/glucan ratio was about twofold higher than in cells from the logarithmic phase of growth. The cell lysis and the formation of the secondary cell walls could be suppressed by buffering the growth medium between pH 4.5 and 6.5.
Singh, Pankaj Kumar; Silakari, Om
2017-10-01
Clinical reports suggest that EGFR-mutated lung cancer usually respond significantly towards small molecule tyrosine kinase inhibitors. Same studies also report the eventual development of acquired resistance within a median time interval of 9 to 14months. One of the major mechanisms involved in this acquired resistance was found to be a secondary point mutation at gate-keeper residue, EGFR T790M. However, there are other recent studies which disclose the role of few other novel key players such as, ZEB1, TOPK etc., in the development of tolerance towards the EGFR TKI's, along with other commonly known mechanisms, such as amplification of signalling pathways such as, c-MET, Erbb2, AXL, additional acquired secondary mutations (PIK3CA, BRAF), or phenotypic transformation (small cell or epithelial to mesenchymal transitions). Interestingly, a recent study showed development of resistance via another point mutation, C797S, in case of tumors which were previously resistant and were administered agents capable of overcoming T790M gatekeeper mutation based resistance. Thus, raising serious concern over the direction of drug development involving tyrosine kinases such as EGFR. Current approaches focussing on development of third generation inhibitors, dual inhibitors or inhibitors of HSP90 have shown significant activity but do not answer the long term question of resistance. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Gupta, Dyuti Datta; Saha, Subhrajit; Chakrabarti, Manoj K.
2005-01-01
The present study was undertaken to determine the involvement of calcium-protein kinase C pathway in the mechanism of action of Escherichia coli heat stable enterotoxin (STa) apart from STa-induced activation of guanylate cyclase in human colonic carcinoma cell line COLO-205, which was used as a model cultured cell line to study the mechanism of action of E. coli STa. In response to E. coli STa, protein kinase C (PKC) activity was increased in a time-dependent manner with its physical translocation from cytosol to membrane. Inhibition of the PKC activity in membrane fraction and inhibition of its physical translocation in response to IP 3 -mediated calcium release inhibitor dantrolene suggested the involvement of intracellular store depletion in the regulation of PKC activity. Among different PKC isoforms, predominant involvement of calcium-dependent protein kinase C (PKCα) was specified using isotype-specific pseudosubstrate, which showed pronounce enzyme activity. Inhibition of enzyme activity by PKCα-specific inhibitor Goe6976 and immunoblott study employing isotype-specific antibody further demonstrated the involvement of calcium-dependent isoform of PKC in the mechanism of action of E. coli STa. Moreover, inhibition of guanylate cyclase activity by PKCα-specific inhibitor Goe6976 suggested the involvement of PKCα in the regulation of guanylate cyclase activity
Xu, Linxiang; Cheng, Rui; Li, Jing; Wang, Yang; Zhu, Bin; Ma, Shihong; Zhang, Weiming; Dong, Wei; Wang, Shiming; Zhang, Jianfa
2017-01-01
Salecan, a soluble β-1,3-D-glucan produced by a salt-tolerant strain Agrobacterium sp. ZX09, has been the subject of considerable interest in recent years because of its multiple bioactivities and unusual rheological properties in solution. In this study, both succinyl and pyruvyl substituent groups on salecan were identified by an enzymatic hydrolysis following nuclear magnetic resonance (NMR), HPLC, and MS analysis. The putative succinyltransferase gene (sleA) and pyruvyltransferase gene (sleV) were determined and cloned. Disruption of the sleA gene resulted in the absence of succinyl substituent groups on salecan. This defect could be complemented by expressing the sleA cloned in a plasmid. Thus, the sleA and sleV genes located in a 19.6-kb gene cluster may be involved in salecan biosynthesis. Despite the lack of succinyl substituents, the molecular mass of salecan generated by the sleA mutant did not substantially differ from that generated by the wild-type strain. Loss of succinyl substituents on salecan changed its rheological characteristics, especially a decrease in intrinsic viscosity.
Directory of Open Access Journals (Sweden)
Vivekanand Vivekanand
2010-05-01
Full Text Available Abstract Background Oat, Avena sativa is the sixth most important cereal in the world. Presently oat is mostly used as feed for animals. However, oat also has special properties that make it beneficial for human consumption and has seen a growing importance as a food crop in recent decades. Increased demand for novel oat products has also put pressure on oat breeders to produce new oat varieties with specific properties such as increased or improved β-glucan-, antioxidant- and omega-3 fatty acid levels, as well as modified starch and protein content. To facilitate this development we have produced a TILLING (Targeting Induced Local Lesions IN Genomes population of the spring oat cultivar SW Belinda. Results Here a population of 2600 mutagenised M2 lines, producing 2550 M3 seed lots were obtained. The M2 population was initially evaluated by visual inspection and a number of different phenotypes were seen ranging from dwarfs to giants, early flowering to late flowering, leaf morphology and chlorosis. Phloroglucinol/HCl staining of M3 seeds, obtained from 1824 different M2 lines, revealed a number of potential lignin mutants. These were later confirmed by quantitative analysis. Genomic DNA was prepared from the M2 population and the mutation frequency was determined. The estimated mutation frequency was one mutation per 20 kb by RAPD-PCR fingerprinting, one mutation per 38 kb by MALDI-TOF analysis and one mutation per 22.4 kb by DNA sequencing. Thus, the overall mutation frequency in the population is estimated to be one mutation per 20-40 kb, depending on if the method used addressed the whole genome or specific genes. During the investigation, 6 different mutations in the phenylalanine ammonia-lyase (AsPAL1 gene and 10 different mutations in the cellulose synthase-like (AsCslF6 β-glucan biosynthesis gene were identified. Conclusion The oat TILLING population produced in this work carries, on average, hundreds of mutations in every individual
Involvement of adrenergic and serotonergic nervous mechanisms in allethrin-induced tremors in mice.
Nishimura, M; Obana, N; Yagasaki, O; Yanagiya, I
1984-05-01
Oral or intravenous administration of allethrin, a synthetic derivative of the pirethrin-based insecticides, produces neurotoxic symptoms consisting of mild salivation, hyperexcitability, tremors and convulsions which result in death. Intracerebroventricular injection of allethrin to mouse at about one-nineth the dose of intravenous administration, produced qualitatively identical but less prominent symptoms, indicating that at least some of the symptoms may be originated in the central nervous system. To investigate the mechanism of action of the compound, we studied the ability of agents which alter neurotransmission to prevent or potentiate the effect of convulsive doses of technical grade (15.5% cis, 84.5% trans) allethrin. Intraperitoneal pretreatment with drugs which block noradrenergic receptors or norepinephrine synthesis, such as pentobarbital, chlorpromazine, phentolamine, phenoxybenzamine and reserpine, depressed the tremor induced by allethrin. The inhibitory effect of reserpine was reversed by phenylephrine. Both the serotonergic blocker, methysergide, and the serotonin depletor, rho-chlorphenylalanine, potentiated the effect of allethrin. The potentiating effect of methysergide was antagonized by 5-hydroxytryptamine. However, intracerebroventricular administration of methysergide was ineffective in potentiating the effect of allethrin. alpha 2- and beta-adrenoceptor blockers, muscarinic antagonists, GABA mimenergics and morphine had no effect. These results suggest that allethrin produces its neurotoxic responses in mice by acting on the brain and spinal levels. Furthermore, adrenergic excitatory and serotonergic inhibitory mechanisms may be involved in the neural pathway through which the allethrin-induced tremor is evoked.
DEFF Research Database (Denmark)
Nielsen, Kirstine Lykke; Hedemann, Mette Skou; Lærke, Helle Nygaard
2014-01-01
A liquid chromatography–MS (LC-MS) metabolomics analysis of plasma from portal–arterial catheterised pigs fed breads prepared with whole-grain rye or wheat flour with added concentrated arabinoxylan (AX) or β-glucan (BG) was conducted. Comparison of the effects of concentrated fibres with whole...... of available carbohydrate was similar for the five breads but varied in the content of protein. Plasma was collected continuously for 4 h after feeding. Glucose levels in the portal vein were reduced postprandially in response to the AX, GR and RK breads that had high contents of AX compared with WF bread (P...... contents in the breads and leucine uptake significantly affected insulin secretion in the mesenteric artery...
de Sousa Lacerda, Camila Maria; Ferreira, Iêda Mendes; Dos Santos, Sara Roberta; de Barros, André Luís Branco; Fernandes, Simone Odília; Cardoso, Valbert Nascimento; de Andrade, Antero Silva Ribeiro
2017-03-01
Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n=6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17±0.22 for seq6 and 2.66±0.10 for seq30. These ratios were statistically higher than the value (1.54±0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53±0.03, 1.64±0.12 and 1.08±0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Sousa Lacerda, Camila Maria de; Ferreira, Iêda Mendes; Santos, Sara Roberta dos; Barros, André Luís Branco de; Fernandes, Simone Odília
2017-01-01
Introduction: Acid nucleic aptamers are RNA or DNA oligonucleotides capable of binding to a target molecule with high affinity and selectivity. These molecules are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1 → 3)-β-D-glucans are the main structural cell wall components of fungi and some bacteria. In the present study two radiolabeled (1 → 3)-β-D-glucan aptamers (seq6 and seq30) were evaluated to identity infectious foci caused by fungal or bacterial cells. Methods: Aptamer labeling with 99m Tc was performed by the direct method and biodistribution studies were accomplished in Swiss mice (n = 6) infected in the right thigh muscle with Staphylococcus aureus or Candida albicans. A 99m Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Results: There was a higher uptake of 99m Tc radiolabeled aptamers in the infected thigh than in the left thigh muscle (non-infected) in the S. aureus infected animals. The target/non-target ratios were 3.17 ± 0.22 for seq6 and 2.66 ± 0.10 for seq30. These ratios were statistically higher than the value (1.54 ± 0.05) found for the radiolabeled library (control). With regard to biodistribution, no statistical difference was verified between aptamers and control uptakes in the infection foci in the C. albicans infected animals. The target/non-target ratios were 1.53 ± 0.03, 1.64 ± 0.12 and 1.08 ± 0.02 for radiolabeled library, seq6 and seq30, respectively. Scintigraphic imaging of infected foci using radiolabeled aptamers was possible only for S. aureus infected mice. Conclusions: Seq6 and seq30 aptamers proved to be inefficient for diagnosis of C. albicans infection. Nevertheless, their applicability for diagnosis of S. aureus and other bacterial infections by scintigraphy should be further explored.
A Mechanism for Land-Atmosphere Feedback Involving Planetary Wave Structures
Koster, Randal D.; Chang, Yehui; Schubert, Siegfried D.
2014-01-01
While the ability of land surface conditions to influence the atmosphere has been demonstrated in various modeling and observational studies, the precise mechanisms by which land-atmosphere feedback occurs are still largely unknown particularly the mechanisms that allow land moisture state in one region to affect atmospheric conditions in another. Such remote impacts are examined here in the context of atmospheric general circulation model (AGCM) simulations, leading to the identification of one potential mechanism: the phase-locking and amplification of a planetary wave through the imposition of a spatial pattern of soil moisture at the land surface. This mechanism, shown here to be relevant in the AGCM, apparently also operates in nature, as suggested by supporting evidence found in reanalysis data.
Towards a Better Understanding of the Molecular Mechanisms Involved in Sunlight-Induced Melanoma
Directory of Open Access Journals (Sweden)
Williams Mandy
2005-01-01
Full Text Available Although much less prevalent than its nonmelanoma skin cancer counterparts, cutaneous malignant melanoma (CMM is the most lethal human skin cancer. Epidemiological and biological studies have established a strong link between lifetime exposure to ultraviolet (UV light, particularly sunburn in childhood, and the development of melanoma. However, the specific molecular targets of this environmental carcinogen are not known. Data obtained from genetic and molecular studies over the last few years have identified the INK4a/ARF locus as the “gatekeeper” melanoma suppressor, encoding two tumour suppressor proteins in human, p16 INK4a and p14 ARF . Recent developments in molecular biotechnology and research using laboratory animals have made a significant gene breakthrough identifying the components of the p16 INK4a /Rb pathway as the principal and rate-limiting targets of UV radiation actions in melanoma formation. This review summarizes the current knowledge of the molecular mechanisms involved in melanoma development and its relationship to sunlight UV radiation.
Effects of extrusion variables on the properties of waxy hulless barley extrudates.
Köksel, Hamit; Ryu, Gy-Hyung; Başman, Arzu; Demiralp, Hande; Ng, Perry K W
2004-02-01
The objective of this research was to investigate the extrudability of waxy hulless barley flour under various extrusion conditions. Waxy hulless barley flour was processed in a laboratory-scale corotating twin-screw extruder with different levels of feed moisture content (22.3, 26.8, and 30.7%) and die temperature (130, 150, and 170 degrees C) to develop a snack food with high beta-glucan content. The effects of extrusion condition variables (screw configuration, moisture, and temperature) on the system variables (pressure and specific mechanical energy), the extrudate physical properties (sectional expansion index, bulk density), starch gelatinization, pasting properties (cold peak viscosity, trough viscosity, and final viscosity), and beta-glucan contents were determined. Results were evaluated by using response surface methodology. Increased extrusion temperature and feed moisture content resulted in decreases in exit die pressure and specific mechanical energy values. For extrudates extruded under low shear screw configuration (LS), increased barrel temperature decreased sectional expansion index (SEI) values at both low and high moisture contents. The feed moisture seems to have an inverse relationship with SEI over the range studied. Bulk density was higher at higher moisture contents, for both low and high barrel temperatures, for samples extruded under high shear screw configuration (HS) and LS. Cold peak viscosities (CV) were observed in all samples. The CV increased with the increase in extrusion temperature and feed moisture content. Although beta-glucan contents of the LS extrudates were comparable to that of barley flour sample, HS samples had generally lower beta-glucan contents. The extrusion cooking technique seems to be promising for the production of snack foods with high beta-glucan content, especially using LS conditions.
Bontemps-Gallo, Sébastien; Madec, Edwige; Lacroix, Jean-Marie
2014-04-01
Dickeya dadantii is a phytopathogenic enterobacterium that causes soft rot disease in a wide range of plant species. Maceration, an apparent symptom of the disease, is the result of the synthesis and secretion of a set of plant cell wall-degrading enzymes (PCWDEs), but many additional factors are required for full virulence. Among these, osmoregulated periplasmic glucans (OPGs) and the PecS transcriptional regulator are essential virulence factors. Several cellular functions are controlled by both OPGs and PecS. Strains devoid of OPGs display a pleiotropic phenotype including total loss of virulence, loss of motility and severe reduction in the synthesis of PCWDEs. PecS is one of the major regulators of virulence in D. dadantii, acting mainly as a repressor of various cellular functions including virulence, motility and synthesis of PCWDEs. The present study shows that inactivation of the pecS gene restored virulence in a D. dadantii strain devoid of OPGs, indicating that PecS cannot be de-repressed in strains devoid of OPGs.
Pfaller, Michael A; Messer, Shawn A; Rhomberg, Paul R; Borroto-Esoda, Katyna; Castanheira, Mariana
2017-08-01
SCY-078 (formerly MK-3118) is a novel orally active inhibitor of fungal β-(1,3)-glucan synthase (GS). SCY-078 is a derivative of enfumafungin and is structurally distinct from the echinocandin class of antifungal agents. We evaluated the in vitro activity of this compound against wild-type (WT) and echinocandin-resistant isolates containing mutations in the FKS genes of Candida spp. Against 36 Candida spp. FKS mutants tested, 30 (83.3%) were non-WT to 1 or more echinocandins, and only 9 (25.0%) were non-WT (MIC, >WT-upper limit) to SCY-078. Among C. glabrata isolates carrying FKS alterations, 84.0% were non-WT to the echinocandins versus only 24.0% for SCY-078. In contrast to the echinocandin comparators, the activity of SCY-078 was minimally affected by the presence of FKS mutations, suggesting that this agent is useful in the treatment of Candida infections due to echinocandin-resistant strains. Copyright © 2017 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Tae-Dong Jung
2017-06-01
Full Text Available Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans. Among the fermented rice brans, the Haedam rice bran contained the highest level of total phenol content (156.08 mg gallic acid equivalents/g, DPPH (2,2-diphenyl-1-picrylhydrazyl radical scavenging activity (71.30% and ORAC (Oxygen radical absorbance capacity value (1101.31 μM trolox equivalents/g. Furthermore, the fermented Migwang rice bran showed the highest level of γ-oryzanol content (294.77 ± 6.74 mg/100 g.
Mechanisms Involved in Nematode Control by Endophytic Fungi
Schouten, Sander
2016-01-01
Colonization of plants by particular endophytic fungi can provide plants with improved defenses toward nematodes. Evidently, such endophytes can be important in developing more sustainable agricultural practices. The mechanisms playing a role in this quantitative antagonism are poorly understood
Sasaki, Masato; Ito, Fumie; Aoyama, Toshio; Sato-Okamoto, Michiyo; Takahashi-Nakaguchi, Azusa; Chibana, Hiroji; Shibata, Nobuyuki
2016-01-01
The maintenance of cell wall integrity in fungi is required for normal cell growth, division, hyphae formation, and antifungal tolerance. We observed that endoplasmic reticulum stress regulated cell wall integrity in Candida glabrata, which possesses uniquely evolved mechanisms for unfolded protein response mechanisms. Tetracycline-mediated suppression of KRE5, which encodes a predicted UDP-glucose:glycoprotein glucosyltransferase localized in the endoplasmic reticulum, significantly increased cell wall chitin content and decreased cell wall β-1,6-glucan content. KRE5 repression induced endoplasmic reticulum stress-related gene expression and MAP kinase pathway activation, including Slt2p and Hog1p phosphorylation, through the cell wall integrity signaling pathway. Moreover, the calcineurin pathway negatively regulated cell wall integrity, but not the reduction of β-1,6-glucan content. These results indicate that KRE5 is required for maintaining both endoplasmic reticulum homeostasis and cell wall integrity, and that the calcineurin pathway acts as a regulator of chitin-glucan balance in the cell wall and as an alternative mediator of endoplasmic reticulum stress in C. glabrata. PMID:27548283
Energy Technology Data Exchange (ETDEWEB)
Schreck, E., E-mail: eva.schreck@ensat.fr [Universite de Toulouse (France); INP, UPS (France); EcoLab (Laboratoire Ecologie Fonctionnelle et Environnement) (France); ENSAT, Avenue de l' Agrobiopole, 31326 Castanet Tolosan (France); CNRS (France); EcoLab, 31326 Castanet Tolosan (France); Foucault, Y. [Universite de Toulouse (France); INP, UPS (France); EcoLab (Laboratoire Ecologie Fonctionnelle et Environnement) (France); ENSAT, Avenue de l' Agrobiopole, 31326 Castanet Tolosan (France); CNRS (France); EcoLab, 31326 Castanet Tolosan (France); STCM, Societe de Traitements Chimiques des Metaux, 30 Avenue de Fondeyre 31200 Toulouse (France); Sarret, G. [ISTerre (UMR 5275), Universite J. Fourier and CNRS, BP 53, 38041 Grenoble cedex 9 (France); Sobanska, S. [LASIR (UMR CNRS 8516), Universite de Lille 1, Bat. C5, 59655 Villeneuve d' Ascq cedex (France); Cecillon, L. [ISTerre (UMR 5275), Universite J. Fourier and CNRS, BP 53, 38041 Grenoble cedex 9 (France); Castrec-Rouelle, M. [Universite Pierre and Marie Curie (UPMC-Paris 6), Bioemco (Biogeochimie et Ecologie des Milieux Continentaux), Site Jussieu, Tour 56, 4 Place Jussieu, 75252 Paris cedex 05 (France); Uzu, G. [Laboratoire d' Aerologie (UMR 5560), OMP, UPS 14, Avenue Edouard Belin, 31400 Toulouse (France); GET (UMR 5563), IRD, 14, Avenue Edouard Belin, 31400 Toulouse (France); Dumat, C. [Universite de Toulouse (France); INP, UPS (France); EcoLab (Laboratoire Ecologie Fonctionnelle et Environnement) (France); ENSAT, Avenue de l' Agrobiopole, 31326 Castanet Tolosan (France); CNRS (France); EcoLab, 31326 Castanet Tolosan (France)
2012-06-15
Fine and ultrafine metallic particulate matters (PMs) are emitted from metallurgic activities in peri-urban zones into the atmosphere and can be deposited in terrestrial ecosystems. The foliar transfer of metals and metalloids and their fate in plant leaves remain unclear, although this way of penetration may be a major contributor to the transfer of metals into plants. This study focused on the foliar uptake of various metals and metalloids from enriched PM (Cu, Zn, Cd, Sn, Sb, As, and especially lead (Pb)) resulting from the emissions of a battery-recycling factory. Metal and metalloid foliar uptake by various vegetable species, exhibiting different morphologies, use (food or fodder) and life-cycle (lettuce, parsley and rye-grass) were studied. The mechanisms involved in foliar metal transfer from atmospheric particulate matter fallout, using lead (Pb) as a model element was also investigated. Several complementary techniques (micro-X-ray fluorescence, scanning electron microscopy coupled with energy dispersive X-ray microanalysis and time-of-flight secondary ion mass spectrometry) were used to investigate the localization and the speciation of lead in their edible parts, i.e. leaves. The results showed lead-enriched PM on the surface of plant leaves. Biogeochemical transformations occurred on the leaf surfaces with the formation of lead secondary species (PbCO{sub 3} and organic Pb). Some compounds were internalized in their primary form (PbSO{sub 4}) underneath an organic layer. Internalization through the cuticle or penetration through stomata openings are proposed as two major mechanisms involved in foliar uptake of particulate matter. - Graphical abstract: Overall picture of performed observations and mechanisms potentially involved in lead foliar uptake. Highlights: Black-Right-Pointing-Pointer Foliar uptake of metallic particulate matter (PM) is of environmental and health concerns. Black-Right-Pointing-Pointer The leaf morphology influences the adsorption
Directory of Open Access Journals (Sweden)
Katagiri Ayano
2012-03-01
Full Text Available Abstract Background It has been reported that the P2Y12 receptor (P2Y12R is involved in satellite glial cells (SGCs activation, indicating that P2Y12R expressed in SGCs may play functional roles in orofacial neuropathic pain mechanisms. However, the involvement of P2Y12R in orofacial neuropathic pain mechanisms is still unknown. We therefore studied the reflex to noxious mechanical or heat stimulation of the tongue, P2Y12R and glial fibrillary acidic protein (GFAP immunohistochemistries in the trigeminal ganglion (TG in a rat model of unilateral lingual nerve crush (LNC to evaluate role of P2Y12R in SGC in lingual neuropathic pain. Results The head-withdrawal reflex thresholds to mechanical and heat stimulation of the lateral tongue were significantly decreased in LNC-rats compared to sham-rats. These nocifensive effects were apparent on day 1 after LNC and lasted for 17 days. On days 3, 9, 15 and 21 after LNC, the mean relative number of TG neurons encircled with GFAP-immunoreactive (IR cells significantly increased in the ophthalmic, maxillary and mandibular branch regions of TG. On day 3 after LNC, P2Y12R expression occurred in GFAP-IR cells but not neuronal nuclei (NeuN-IR cells (i.e. neurons in TG. After 3 days of successive administration of the P2Y12R antagonist MRS2395 into TG in LNC-rats, the mean relative number of TG neurons encircled with GFAP-IR cells was significantly decreased coincident with a significant reversal of the lowered head-withdrawal reflex thresholds to mechanical and heat stimulation of the tongue compared to vehicle-injected rats. Furthermore, after 3 days of successive administration of the P2YR agonist 2-MeSADP into the TG in naïve rats, the mean relative number of TG neurons encircled with GFAP-IR cells was significantly increased and head-withdrawal reflex thresholds to mechanical and heat stimulation of the tongue were significantly decreased in a dose-dependent manner compared to vehicle-injected rats
Farrero, Eva; Prats, Enric; Povedano, Mónica; Martinez-Matos, J Antonio; Manresa, Frederic; Escarrabill, Joan
2005-06-01
To analyze (1) the impact of a protocol of early respiratory evaluation of the indications for home mechanical ventilation (HMV) in patients with amyotrophic lateral sclerosis (ALS), and (2) the effects of the protocol and of bulbar involvement on the survival of patients receiving noninvasive ventilation (NIV). Retrospective study in a tertiary care referral center. HMV was indicated in 86 patients with ALS, with 22 patients (25%) presenting with intolerance to treatment associated with bulbar involvement. Treatment with HMV had been initiated in 15 of 64 patients prior to initiating the protocol (group A) and in the remaining 49 patients after protocol initiation (group B). In group A, the majority of patients began treatment with HMV during an acute episode requiring ICU admission (p = 0.001) and tracheal ventilation (p = 0.025), with a lower percentage of patients beginning HMV treatment without respiratory insufficiency (p = 0.013). No significant differences in survival rates were found between groups A and B among patients treated with NIV. Greater survival was observed in group B (p = 0.03) when patients with bulbar involvement were excluded (96%). Patients without bulbar involvement at the start of therapy with NIV presented a significantly better survival rate (p = 0.03). Multivariate analysis showed bulbar involvement to be an independent prognostic factor for survival (relative risk, 1.6; 95% confidence interval, 1.01 to 2.54; p = 0.04). No significant differences in survival were observed between patients with bulbar involvement following treatment with NIV and those with intolerance, except for the subgroup of patients who began NIV treatment with hypercapnia (p = 0.0002). Early systematic respiratory evaluation in patients with ALS is necessary to improve the results of HMV. Further studies are required to confirm the benefits of NIV treatment in patients with bulbar involvement, especially in the early stages.
Study of the Genes and Mechanism Involved in the Radioadaptive Response
Dasgupta, Pushan R.
2009-01-01
The radioadaptive response is a phenomenon where exposure to a prior low dose of radiation reduces the level of damage induced by a subsequent high radiation dose. The molecular mechanism behind this is still not well understood. Learning more about the radioadaptive response is critical for long duration spaceflight since astronauts are exposed to low levels of cosmic radiation. The micronucleus assay was used to measure the level of damage caused by radiation. Although cells which were not washed with phosphate buffered saline (PBS) after a low priming dose of 5cGy did not show adaptation to the challenge dose, washing the cells with PBS and giving the cells fresh media after the low dose did allow radioadaptation to occur. This is consistent with the results of a previous publication by another research group. In the present study, genes involved in DNA damage signaling and the oxidative stress response were studied using RT PCR techniques in order to look at changes in expression level after the low dose with or without washing. Our preliminary results indicate that upregulation of oxidative stress response genes ANGPTL7, NCF2, TTN, and SRXN1 may be involved in the radioadaptive response. The low dose of radiation alone was found to activate the oxidative stress response genes GPR156 and MTL5, whereas, washing the cells alone caused relatively robust upregulation of the oxidative stress response genes DUSP1 and PTGS2. Washing after the priming dose showed some changes in the expression level of several DNA damage signaling genes. In addition, we studied whether washing the cells after the priming dose has an effect on the level of nitric oxide in both the media and cells, since nitric oxide levels are known to increase in the media of the cells after a high dose of radiation only if the cells were already exposed to a low priming dose. Based on this preliminary study, we propose that washing the cells after priming exposure actually eliminates some factor
Mechanism of oxidative stress involved in the toxicity of ZnO nanoparticles against eukaryotic cells
Directory of Open Access Journals (Sweden)
M. Saliani
2016-01-01
Full Text Available ZnO NPs (zinc oxide nanoparticles has generated significant scientific interest as a novel antibacterial and anticancer agent. Since oxidative stress is a critical determinant of ZnO NPs-induced damage, it is necessary to characterize their underlying mode of action. Different structural and physicochemical properties of ZnO NPs such as particle surface, size, shape, crystal structure, chemical position, and presence of metals can lead to changes in biological activities including ROS (reactive oxygen species production. However, there are some inconsistencies in the literature on the relation between the physicochemical features of ZnO NPs and their plausible oxidative stress mechanism. Herein, the possible oxidative stress mechanism of ZnO NPs was reviewed. This is worthy of further detailed evaluations in order to improve our understanding of vital NPs characteristics governing their toxicity. Therefore, this study focuses on the different reported oxidative stress paradigms induced by ZnO NPs including ROS generated by NPs, oxidative stress due to the NPs-cell interaction, and role of the particle dissolution in the oxidative damage. Also, this study tries to characterize and understand the multiple pathways involved in oxidative stress induced by ZnO NPs. Knowledge about different cellular signaling cascades stimulated by ZnO NPs lead to the better interpretation of the toxic influences induced by the cellular and acellular parameters. Regarding the potential benefits of toxic effects of ZnO NPs, in-depth evaluation of their toxicity mechanism and various effects of these nanoparticles would facilitate their implementation for biomedical applications.
Functioning and nonfunctioning thyroid adenomas involve different molecular pathogenetic mechanisms.
Tonacchera, M; Vitti, P; Agretti, P; Ceccarini, G; Perri, A; Cavaliere, R; Mazzi, B; Naccarato, A G; Viacava, P; Miccoli, P; Pinchera, A; Chiovato, L
1999-11-01
The molecular biology of follicular cell growth in thyroid nodules is still poorly understood. Because gain-of-function (activating) mutations of the thyroid-stimulating hormone receptor (TShR) and/or Gs alpha genes may confer TSh-independent growth advantage to neoplastic thyroid cells, we searched for somatic mutations of these genes in a series of hyperfunctioning and nonfunctioning follicular thyroid adenomas specifically selected for their homogeneous gross anatomy (single nodule in an otherwise normal thyroid gland). TShR gene mutations were identified by direct sequencing of exons 9 and 10 of the TShR gene in genomic DNA obtained from surgical specimens. Codons 201 and 227 of the Gs alpha gene were also analyzed. At histology, all hyperfunctioning nodules and 13 of 15 nonfunctioning nodules were diagnosed as follicular adenomas. Two nonfunctioning thyroid nodules, although showing a prevalent microfollicular pattern of growth, had histological features indicating malignant transformation (a minimally invasive follicular carcinoma and a focal papillary carcinoma). Activating mutations of the TShR gene were found in 12 of 15 hyperfunctioning follicular thyroid adenomas. In one hyperfunctioning adenoma, which was negative for TShR mutations, a mutation in codon 227 of the Gs alpha gene was identified. At variance with hyperfunctioning thyroid adenomas, no mutation of the TShR or Gs alpha genes was detected in nonfunctioning thyroid nodules. In conclusion, our findings clearly define a different molecular pathogenetic mechanism in hyperfunctioning and nonfunctioning follicular thyroid adenomas. Activation of the cAMP cascade, which leads to proliferation but maintains differentiation of follicular thyroid cells, typically occurs in hyperfunctioning thyroid adenomas. Oncogenes other than the TShR and Gs alpha genes are probably involved in nonfunctioning follicular adenomas.
International Nuclear Information System (INIS)
Cattani, Daiane; Oliveira Cavalli, Liz Vera Lúcia de; Heinz Rieg, Carla Elise; Domingues, Juliana Tonietto; Dal-Cim, Tharine; Tasca, Carla Inês; Mena Barreto Silva, Fátima Regina; Zamoner, Ariane
2014-01-01
Graphical abstract: - Highlights: • Roundup ® induces Ca 2+ influx through L-VDCC and NMDA receptor activation. • The mechanisms underlying Roundup ® neurotoxicity involve glutamatergic excitotoxicity. • Kinase pathways participate in Roundup ® -induced neural toxicity. • Roundup ® alters glutamate uptake, release and metabolism in hippocampal cells. - Abstract: Previous studies demonstrate that glyphosate exposure is associated with oxidative damage and neurotoxicity. Therefore, the mechanism of glyphosate-induced neurotoxic effects needs to be determined. The aim of this study was to investigate whether Roundup ® (a glyphosate-based herbicide) leads to neurotoxicity in hippocampus of immature rats following acute (30 min) and chronic (pregnancy and lactation) pesticide exposure. Maternal exposure to pesticide was undertaken by treating dams orally with 1% Roundup ® (0.38% glyphosate) during pregnancy and lactation (till 15-day-old). Hippocampal slices from 15 day old rats were acutely exposed to Roundup ® (0.00005–0.1%) during 30 min and experiments were carried out to determine whether glyphosate affects 45 Ca 2+ influx and cell viability. Moreover, we investigated the pesticide effects on oxidative stress parameters, 14 C-α-methyl-amino-isobutyric acid ( 14 C-MeAIB) accumulation, as well as glutamate uptake, release and metabolism. Results showed that acute exposure to Roundup ® (30 min) increases 45 Ca 2+ influx by activating NMDA receptors and voltage-dependent Ca 2+ channels, leading to oxidative stress and neural cell death. The mechanisms underlying Roundup ® -induced neurotoxicity also involve the activation of CaMKII and ERK. Moreover, acute exposure to Roundup ® increased 3 H-glutamate released into the synaptic cleft, decreased GSH content and increased the lipoperoxidation, characterizing excitotoxicity and oxidative damage. We also observed that both acute and chronic exposure to Roundup ® decreased 3 H-glutamate uptake and
Directory of Open Access Journals (Sweden)
Joana Gangoiti
Full Text Available Previously we have reported that the Gram-negative bacterium Azotobacter chroococcum NCIMB 8003 uses the 4,6-α-glucanotransferase GtfD to convert maltodextrins and starch into a reuteran-like polymer consisting of (α1→4 glucan chains connected by alternating (α1→4/(α1→6 linkages and (α1→4,6 branching points. This enzyme constituted the single evidence for this reaction and product specificity in the GH70 family, mostly containing glucansucrases encoded by lactic acid bacteria (http://www.CAZy.org. In this work, 4 additional GtfD-like proteins were identified in taxonomically diverse plant-associated bacteria forming a new GH70 subfamily with intermediate characteristics between the evolutionary related GH13 and GH70 families. The GtfD enzyme encoded by Paenibacillus beijingensis DSM 24997 was characterized providing the first example of a reuteran-like polymer synthesizing 4,6-α-glucanotransferase in a Gram-positive bacterium. Whereas the A. chroococcum GtfD activity on amylose resulted in the synthesis of a high molecular polymer, in addition to maltose and other small oligosaccharides, two reuteran-like polymer distributions are produced by P. beijingensis GtfD: a high-molecular mass polymer and a low-molecular mass polymer with an average Mw of 27 MDa and 19 kDa, respectively. Compared to the A. chroooccum GtfD product, both P. beijingensis GtfD polymers contain longer linear (α1→4 sequences in their structure reflecting a preference for transfer of even longer glucan chains by this enzyme. Overall, this study provides new insights into the evolutionary history of GH70 enzymes, and enlarges the diversity of natural enzymes that can be applied for modification of the starch present in food into less and/or more slowly digestible carbohydrate structures.
Marcos-Zambrano, Laura Judith; Gómez-Perosanz, Marta; Escribano, Pilar; Bouza, Emilio; Guinea, Jesús
2017-07-01
We studied the antifungal activity of SCY-078 (an orally bioavailable 1,3-β -d- glucan synthesis inhibitor), micafungin and fluconazole against the planktonic and sessile forms of 178 Candida and non- Candida isolates causing fungaemia in patients recently admitted to a large European hospital. The in vitro activity of SCY-078, micafungin and fluconazole against the planktonic form of the isolates was assessed using EUCAST EDef 7.3 and CLSI M27-A3. Antibiofilm activity was assessed using the XTT reduction assay. SCY-078 and micafungin showed potent in vitro activity against Candida and non- Candida isolates. The in vitro activity of both drugs was similar, but SYC-078 displayed significantly lower MIC values than micafungin against Candida parapsilosis and non- Candida isolates, whereas micafungin displayed significantly lower MIC values for the remaining species ( P Candida glabrata , in which the micafungin sessile MIC values were significantly lower ( P Candida isolates in both sessile and planktonic forms is comparable to that of micafungin. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Gómez-Rodríguez, Víctor Manuel; Rodríguez-Garay, Benjamín; Barba-Gonzalez, Rodrigo
2012-01-01
A cytological analysis of the microsporogenesis was carried out in the Agave tequilana and A. angustifolia species. Several abnormalities such as chromosomal bridges, lagging chromosomes, micronuclei, monads, dyads and triads were found. The morphological analysis of the pollen, together with the above-mentioned 2n microspores, allowed us to confirm the presence of 2n pollen as well as its frequency. In both A. tequilana and A. angustifolia two different mechanisms were observed: the first mechanism, a failure in the cytokinesis in meiosis II caused the formation of dyads with two 2n cells and triads containing two n cells and one 2n cell; the second mechanism, involves an abnormal spindle, which caused the formation of triads with two n cells and one 2n cell. Likewise, the presence of monads was detected in both species, these, might be caused by a failure of the cytokinesis in both meiotic divisions. This is the first report about the presence of a Second Division Restitution mechanism (SDR) which causes the formation of 2n pollen in the genus Agave. The genetic implications of the presence of 2n pollen in the genus Agave are discussed.
International Nuclear Information System (INIS)
Massi, Paola; Valenti, Marta; Solinas, Marta; Parolaro, Daniela
2010-01-01
Cannabinoids, the active components of Cannabis sativa, have been shown to exert antiproliferative and proapoptotic effects on a wide spectrum of tumor cells and tissues. Of interest, cannabinoids have displayed great potency in reducing the growth of glioma tumors, one of the most aggressive CNS tumors, either in vitro or in animal experimental models curbing the growth of xenografts generated by subcutaneous or intrathecal injection of glioma cells in immune-deficient mice. Cannabinoids appear to be selective antitumoral agents as they kill glioma cells without affecting the viability of non-transformed cells. This review will summarize the anti-cancer properties that cannabinoids exert on gliomas and discuss their potential action mechanisms that appear complex, involving modulation of multiple key cell signaling pathways and induction of oxidative stress in glioma cells
Energy Technology Data Exchange (ETDEWEB)
Massi, Paola [Department of Pharmacology, Chemotherapy and Toxicology, University of Milan, Via Vanvitelli 32, 20129 Milan (Italy); Valenti, Marta; Solinas, Marta; Parolaro, Daniela [Department of Structural and Functional Biology, Section of Pharmacology, Center of Neuroscience, University of Insubria, Via A. da Giussano 10, 20152 Busto Arsizio, Varese (Italy)
2010-05-26
Cannabinoids, the active components of Cannabis sativa, have been shown to exert antiproliferative and proapoptotic effects on a wide spectrum of tumor cells and tissues. Of interest, cannabinoids have displayed great potency in reducing the growth of glioma tumors, one of the most aggressive CNS tumors, either in vitro or in animal experimental models curbing the growth of xenografts generated by subcutaneous or intrathecal injection of glioma cells in immune-deficient mice. Cannabinoids appear to be selective antitumoral agents as they kill glioma cells without affecting the viability of non-transformed cells. This review will summarize the anti-cancer properties that cannabinoids exert on gliomas and discuss their potential action mechanisms that appear complex, involving modulation of multiple key cell signaling pathways and induction of oxidative stress in glioma cells.
Directory of Open Access Journals (Sweden)
Paola Massi
2010-05-01
Full Text Available Cannabinoids, the active components of Cannabis sativa, have been shown to exert antiproliferative and proapoptotic effects on a wide spectrum of tumor cells and tissues. Of interest, cannabinoids have displayed great potency in reducing the growth of glioma tumors, one of the most aggressive CNS tumors, either in vitro or in animal experimental models curbing the growth of xenografts generated by subcutaneous or intrathecal injection of glioma cells in immune-deficient mice. Cannabinoids appear to be selective antitumoral agents as they kill glioma cells without affecting the viability of non-transformed cells. This review will summarize the anti-cancer properties that cannabinoids exert on gliomas and discuss their potential action mechanisms that appear complex, involving modulation of multiple key cell signaling pathways and induction of oxidative stress in glioma cells.
DEFF Research Database (Denmark)
Restrepo-Giraldo, John Dairo
2006-01-01
Most products and machines involve some kind of controlled movement. From window casements to DVD players, from harbor cranes to the shears to prune your garden, all these machines require mechanisms to move. This course intends to provide the analytical and conceptual tools to design such mechan......Most products and machines involve some kind of controlled movement. From window casements to DVD players, from harbor cranes to the shears to prune your garden, all these machines require mechanisms to move. This course intends to provide the analytical and conceptual tools to design...... using criteria such as size, performance parameters, operation environment, etc. Content: Understanding Mechanisms Design (2 weeks) Definitions, mechanisms representations, kinematic diagrams, the four bar linkage, mobility, applications of mechanisms, types of mechanisms, special mechanisms, the design......: equations for various mechanisms. At the end of this module you will be able to analyze existing mechanisms and to describe their movement. Designing mechanisms (7 weeks) Type synthesis and dimensional synthesis, function generation, path generation, three precision points in multi-loop mechanisms...
Directory of Open Access Journals (Sweden)
Chi Zhang
2017-02-01
Full Text Available In this paper, interfacial stress analysis for a brittle coating/ductile substrate system, which is involved in a sliding contact with a rigid ball, is presented. By combining interface mechanics theory and the image point method, stress and displacement responses within a coated material for normal load, tangential load, and thermal load are obtained; further, the Green’s functions are established. The effects of coating thickness, friction coefficient, and a coating’s thermoelastic properties on the interfacial shear stress, τxz, and transverse stress, σxx, distributions are discussed in detail. A phenomenon, where interfacial shear stress tends to be relieved by frictional heating, is found in the case of a coating material’s thermal expansion coefficient being less than a substrate material’s thermal expansion coefficient. Additionally, numerical results show that distribution of interfacial stress can be altered and, therefore, interfacial damage can be modified by adjusting a coating’s structural parameters and thermoelastic properties.
Boisvert, Luc; Denney, Melanie C; Hanson, Susan Kloek; Goldberg, Karen I
2009-11-04
The reaction of (bipy)PdMe(2) (1) (bipy = 2,2'-bipyridine) with molecular oxygen results in the formation of the palladium(II) methylperoxide complex (bipy)PdMe(OOMe) (2). The identity of the product 2 has been confirmed by independent synthesis. Results of kinetic studies of this unprecedented oxygen insertion reaction into a palladium alkyl bond support the involvement of a radical chain mechanism. Reproducible rates, attained in the presence of the radical initiator 2,2'-azobis(2-methylpropionitrile) (AIBN), reveal that the reaction is overall first-order (one-half-order in both [1] and [AIBN], and zero-order in [O(2)]). The unusual rate law (half-order in [1]) implies that the reaction proceeds by a mechanism that differs significantly from those for organic autoxidations and for the recently reported examples of insertion of O(2) into Pd(II) hydride bonds. The mechanism for the autoxidation of 1 is more closely related to that found for the autoxidation of main group and early transition metal alkyl complexes. Notably, the chain propagation is proposed to proceed via a stepwise associative homolytic substitution at the Pd center of 1 with formation of a pentacoordinate Pd(III) intermediate.
International Nuclear Information System (INIS)
Davis, H.M.
1985-01-01
The structure of a water-insoluble polysaccharide produced by the glucosyltransferase of Streptococcus mutans 6715 has been elucidated through the use of periodate oxidation, Smith degradation, dextranase digestion, concanavalin A binding studies, methylation followed by methanolysis, reductive cleavage and gas chromatographic-mass spectroscopic analysis, carbon-13 nuclear magnetic resonance and fast atom bombardment mass spectroscopy. These studies show that the water-insoluble glucan is comprised of 67% α-(1-3) linkages in a contiguous backbone with the remaining 33% existing as α-(1-6) linkages possibly as linear residues extending from α-(1-6) branch points. 14% of the residues exist as branch points and the ratio of linear extending α-(1-3) residues in the backbone to linear extending α-(1-6) residues in the side chain was found to be 5:2. Dextranase digestion and Smith degradation both gave rise to a high molecular weight fraction which is only α-(1-3) linked. In addition, the average length of the side chains was shown to not exceed 3 residues
Energy Technology Data Exchange (ETDEWEB)
Lacerda, Camila Maria de Sousa
2016-07-01
Acid nucleic aptamers are RNA or DNA oligonucleotides able of binding to a target molecule with high affinity and selectivity that are promising tools in nuclear medicine. Many aptamers have been used as targeting molecule of radiopharmaceuticals in preclinical studies. (1→3)-β-D-Glucans are the main structural cell wall components of fungi and some bacteria. In the present study was evaluated the capacity of two radiolabeled (1→3)-β-D-glucan aptamers (seq6 and seq30) to identity infectious foci caused by fungal or bacterial cells. Firstly, in vitro studies were carried out by labeling the aptamers with {sup 32}P to evaluate its binding capacity for (1→3)-β-D-glucan and peptidoglycan (main bacterial cell wall element) polysaccharides and for Staphylococcus aureus and Candida albicans cells. For the biodistribution and imaging studies aptamers were labeled with {sup 99m}Tc by the direct method and the complex stability in saline, plasma, and cysteine excess was evaluated. The biodistribution studies were accomplished in Swiss mice groups infected in the right thigh with Staphylococcus aureus, Candida albicans or with experimental inflammation induced by zymosan. A {sup 99m}Tc radiolabeled library consisting of oligonucleotides with random sequences was used as control. Seq6 and seq30 aptamers showed high binding capacity to (1→ 3)-β-D-glucan and S. aureus cells. For peptidoglycan and C. albicans cells a statistically significant binding capacity was not verified. The radiolabel yield after aptamers labeling with {sup 99m}Tc was higher than 90% and the complex stability in saline, plasma and cysteine excess was satisfactory. In the group of animals infected with S. aureus was verified a higher uptake of the {sup 99m}Tc radiolabeled aptamers in the infected thigh relative to the radiation measured in the left thigh muscle. The target/non-target ratio was 3.17 ± 0.22 for seg6 and 2.66 ± 0.10 for seg30. These ratios were statistically higher than the
Multiple mechanisms involved in diabetes protection by lipopolysaccharide in non-obese diabetic mice
Energy Technology Data Exchange (ETDEWEB)
Wang, Jun [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Department of Pharmacology, College of Medicine, Wuhan University of Science and Technology, Wuhan (China); Cao, Hui [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Wang, Hongjie [Section of Neurobiology, Torrey Pines Institute for Molecular Studies, Port Saint Lucie, FL (United States); Yin, Guoxiao; Du, Jiao; Xia, Fei; Lu, Jingli [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Xiang, Ming, E-mail: xiangming@mails.tjmu.edu.cn [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China)
2015-06-15
Toll-like receptor 4 (TLR4) activation has been proposed to be important for islet cell inflammation and eventually β cell loss in the course of type 1 diabetes (T1D) development. However, according to the “hygiene hypothesis”, bacterial endotoxin lipopolysaccharide (LPS), an agonist on TLR4, inhibits T1D progression. Here we investigated possible mechanisms for the protective effect of LPS on T1D development in non-obese diabetic (NOD) mice. We found that LPS administration to NOD mice during the prediabetic state neither prevented nor reversed insulitis, but delayed the onset and decreased the incidence of diabetes, and that a multiple-injection protocol is more effective than a single LPS intervention. Further, LPS administration suppressed spleen T lymphocyte proliferation, increased the generation of CD4{sup +}CD25{sup +}Foxp3{sup +} regulatory T cells (Tregs), reduced the synthesis of strong Th1 proinflammatory cytokines, and downregulated TLR4 and its downstream MyD88-dependent signaling pathway. Most importantly, multiple injections of LPS induced a potential tolerogenic dendritic cell (DC) subset with low TLR4 expression without influencing the DC phenotype. Explanting DCs from repeated LPS-treated NOD mice into NOD/SCID diabetic mice conferred sustained protective effects against the progression of diabetes in the recipients. Overall, these results suggest that multiple mechanisms are involved in the protective effects of LPS against the development of diabetes in NOD diabetic mice. These include Treg induction, down-regulation of TLR4 and its downstream MyD88-dependent signaling pathway, and the emergence of a potential tolerogenic DC subset. - Highlights: • Administration of lipopolysaccharide (LPS) prevented type 1 diabetes in NOD mice. • Downregulating TLR4 level and MyD88-dependent pathway contributed to protection of LPS. • LPS administration also hampered DC maturation and promoted Treg differentiation.
Multiple mechanisms involved in diabetes protection by lipopolysaccharide in non-obese diabetic mice
International Nuclear Information System (INIS)
Wang, Jun; Cao, Hui; Wang, Hongjie; Yin, Guoxiao; Du, Jiao; Xia, Fei; Lu, Jingli; Xiang, Ming
2015-01-01
Toll-like receptor 4 (TLR4) activation has been proposed to be important for islet cell inflammation and eventually β cell loss in the course of type 1 diabetes (T1D) development. However, according to the “hygiene hypothesis”, bacterial endotoxin lipopolysaccharide (LPS), an agonist on TLR4, inhibits T1D progression. Here we investigated possible mechanisms for the protective effect of LPS on T1D development in non-obese diabetic (NOD) mice. We found that LPS administration to NOD mice during the prediabetic state neither prevented nor reversed insulitis, but delayed the onset and decreased the incidence of diabetes, and that a multiple-injection protocol is more effective than a single LPS intervention. Further, LPS administration suppressed spleen T lymphocyte proliferation, increased the generation of CD4 + CD25 + Foxp3 + regulatory T cells (Tregs), reduced the synthesis of strong Th1 proinflammatory cytokines, and downregulated TLR4 and its downstream MyD88-dependent signaling pathway. Most importantly, multiple injections of LPS induced a potential tolerogenic dendritic cell (DC) subset with low TLR4 expression without influencing the DC phenotype. Explanting DCs from repeated LPS-treated NOD mice into NOD/SCID diabetic mice conferred sustained protective effects against the progression of diabetes in the recipients. Overall, these results suggest that multiple mechanisms are involved in the protective effects of LPS against the development of diabetes in NOD diabetic mice. These include Treg induction, down-regulation of TLR4 and its downstream MyD88-dependent signaling pathway, and the emergence of a potential tolerogenic DC subset. - Highlights: • Administration of lipopolysaccharide (LPS) prevented type 1 diabetes in NOD mice. • Downregulating TLR4 level and MyD88-dependent pathway contributed to protection of LPS. • LPS administration also hampered DC maturation and promoted Treg differentiation
Amaranth-oat composites were developed using gluten free amaranth flour containing essential amino acids and minerals with oat products containing ß-glucan, known for lowering blood cholesterol. Amaranth flour and oat bran concentrate (OBC) composites (1:4) were processed using different technologie...
Microarray Analysis of the Molecular Mechanism Involved in Parkinson’s Disease
Directory of Open Access Journals (Sweden)
Cheng Tan
2018-01-01
Full Text Available Purpose. This study aimed to investigate the underlying molecular mechanisms of Parkinson’s disease (PD by bioinformatics. Methods. Using the microarray dataset GSE72267 from the Gene Expression Omnibus database, which included 40 blood samples from PD patients and 19 matched controls, differentially expressed genes (DEGs were identified after data preprocessing, followed by Gene Ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway enrichment analyses. Protein-protein interaction (PPI network, microRNA- (miRNA- target regulatory network, and transcription factor- (TF- target regulatory networks were constructed. Results. Of 819 DEGs obtained, 359 were upregulated and 460 were downregulated. Two GO terms, “rRNA processing” and “cytoplasm,” and two KEGG pathways, “metabolic pathways” and “TNF signaling pathway,” played roles in PD development. Intercellular adhesion molecule 1 (ICAM1 was the hub node in the PPI network; hsa-miR-7-5p, hsa-miR-433-3p, and hsa-miR-133b participated in PD pathogenesis. Six TFs, including zinc finger and BTB domain-containing 7A, ovo-like transcriptional repressor 1, GATA-binding protein 3, transcription factor dp-1, SMAD family member 1, and quiescin sulfhydryl oxidase 1, were related to PD. Conclusions. “rRNA processing,” “cytoplasm,” “metabolic pathways,” and “TNF signaling pathway” were key pathways involved in PD. ICAM1, hsa-miR-7-5p, hsa-miR-433-3p, hsa-miR-133b, and the abovementioned six TFs might play important roles in PD development.
Directory of Open Access Journals (Sweden)
Elise Heuvelin
Full Text Available OBJECTIVES: Soluble factors released by Bifidobacterium breve C50 (Bb alleviate the secretion of pro-inflammatory cytokines by immune cells, but their effect on intestinal epithelium remains elusive. To decipher the mechanisms accounting for the cross-talk between bacteria/soluble factors and intestinal epithelium, we measured the capacity of the bacteria, its conditioned medium (Bb-CM and other Gram(+ commensal bacteria to dampen inflammatory chemokine secretion. METHODS: TNFalpha-induced chemokine (CXCL8 secretion and alteration of NF-kappaB and AP-1 signalling pathways by Bb were studied by EMSA, confocal microscopy and western blotting. Anti-inflammatory capacity was also tested in vivo in a model of TNBS-induced colitis in mice. RESULTS: Bb and Bb-CM, but not other commensal bacteria, induced a time and dose-dependent inhibition of CXCL8 secretion by epithelial cells driven by both AP-1 and NF-kappaB transcription pathways and implying decreased phosphorylation of p38-MAPK and IkappaB-alpha molecules. In TNBS-induced colitis in mice, Bb-CM decreased the colitis score and inflammatory cytokine expression, an effect reproduced by dendritic cell conditioning with Bb-CM. CONCLUSIONS: Bb and secreted soluble factors contribute positively to intestinal homeostasis by attenuating chemokine production. The results indicate that Bb down regulate inflammation at the epithelial level by inhibiting phosphorylations involved in inflammatory processes and by protective conditioning of dendritic cells.
Involvement of thiol-based mechanisms in plant development.
Rouhier, Nicolas; Cerveau, Delphine; Couturier, Jérémy; Reichheld, Jean-Philippe; Rey, Pascal
2015-08-01
Increasing knowledge has been recently gained regarding the redox regulation of plant developmental stages. The current state of knowledge concerning the involvement of glutathione, glutaredoxins and thioredoxins in plant development is reviewed. The control of the thiol redox status is mainly ensured by glutathione (GSH), a cysteine-containing tripeptide and by reductases sharing redox-active cysteines, glutaredoxins (GRXs) and thioredoxins (TRXs). Indeed, thiol groups present in many regulatory proteins and metabolic enzymes are prone to oxidation, ultimately leading to post-translational modifications such as disulfide bond formation or glutathionylation. This review focuses on the involvement of GSH, GRXs and TRXs in plant development. Recent studies showed that the proper functioning of root and shoot apical meristems depends on glutathione content and redox status, which regulate, among others, cell cycle and hormone-related processes. A critical role of GRXs in the formation of floral organs has been uncovered, likely through the redox regulation of TGA transcription factor activity. TRXs fulfill many functions in plant development via the regulation of embryo formation, the control of cell-to-cell communication, the mobilization of seed reserves, the biogenesis of chloroplastic structures, the metabolism of carbon and the maintenance of cell redox homeostasis. This review also highlights the tight relationships between thiols, hormones and carbon metabolism, allowing a proper development of plants in relation with the varying environment and the energy availability. GSH, GRXs and TRXs play key roles during the whole plant developmental cycle via their antioxidant functions and the redox-regulation of signaling pathways. This article is part of a Special Issue entitled Redox regulation of differentiation and de-differentiation. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Md Kausar Alam
Full Text Available Deletion or repression of Aspergillus nidulans ugmA (AnugmA, involved in galactofuranose biosynthesis, impairs growth and increases sensitivity to Caspofungin, a β-1,3-glucan synthesis antagonist. The A. fumigatus UgmA (AfUgmA crystal structure has been determined. From that study, AfUgmA mutants with altered enzyme activity were transformed into AnugmA▵ to assess their effect on growth and wall composition in A. nidulans. The complemented (AnugmA::wild type AfugmA strain had wild type phenotype, indicating these genes had functional homology. Consistent with in vitro studies, AfUgmA residues R182 and R327 were important for its function in vivo, with even conservative amino (RK substitutions producing AnugmA? phenotype strains. Similarly, the conserved AfUgmA loop III histidine (H63 was important for Galf generation: the H63N strain had a partially rescued phenotype compared to AnugmA▵. Collectively, A. nidulans strains that hosted mutated AfUgmA constructs with low enzyme activity showed increased hyphal surface adhesion as assessed by binding fluorescent latex beads. Consistent with previous qPCR results, immunofluorescence and ELISA indicated that AnugmA▵ and AfugmA-mutated A. nidulans strains had increased α-glucan and decreased β-glucan in their cell walls compared to wild type and AfugmA-complemented strains. Like the AnugmA▵ strain, A. nidulans strains containing mutated AfugmA showed increased sensitivity to antifungal drugs, particularly Caspofungin. Reduced β-glucan content was correlated with increased Caspofungin sensitivity. Aspergillus nidulans wall Galf, α-glucan, and β-glucan content was correlated in A. nidulans hyphal walls, suggesting dynamic coordination between cell wall synthesis and cell wall integrity.
Alongkronrusmee, Doungkamol; Chiang, Terrance; van Rijn, Richard M
2016-10-01
As a legal drug, alcohol is commonly abused and it is estimated that 17 million adults in the United States suffer from alcohol use disorder. Heavy alcoholics can experience withdrawal symptoms including anxiety and mechanical allodynia that can facilitate relapse. The molecular mechanisms underlying this phenomenon are not well understood, which stifles development of new therapeutics. Here we investigate whether delta opioid receptors (DORs) play an active role in alcohol withdrawal-induced mechanical allodynia (AWiMA) and if DOR agonists may provide analgesic relief from AWiMA. To study AWiMA, adult male wild-type and DOR knockout C57BL/6 mice were exposed to alcohol by a voluntary drinking model or oral gavage exposure model, which we developed and validated here. We also used the DOR-selective agonist TAN-67 and antagonist naltrindole to examine the involvement of DORs in AWiMA, which was measured using a von Frey model of mechanical allodynia. We created a robust model of alcohol withdrawal-induced anxiety and mechanical allodynia by orally gavaging mice with 3g/kg alcohol for three weeks. AWiMA was exacerbated and prolonged in DOR knockout mice as well as by pharmacological blockade of DORs compared to control mice. However, analgesia induced by TAN-67 was attenuated during withdrawal in alcohol-gavaged mice. DORs appear to play a protective role in the establishment of AWiMA. Our current results indicate that DORs could be targeted to prevent or reduce the development of AWiMA during alcohol use; however, DORs may be a less suitable target to treat AWiMA during active withdrawal. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.